WO2010151664A2 - Compositions and methods for treating cancer and modulating stress granule formation - Google Patents
Compositions and methods for treating cancer and modulating stress granule formation Download PDFInfo
- Publication number
- WO2010151664A2 WO2010151664A2 PCT/US2010/039814 US2010039814W WO2010151664A2 WO 2010151664 A2 WO2010151664 A2 WO 2010151664A2 US 2010039814 W US2010039814 W US 2010039814W WO 2010151664 A2 WO2010151664 A2 WO 2010151664A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- parp
- seq
- parpl
- nucleic acid
- parg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/45—Transferases (2)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/47—Hydrolases (3) acting on glycosyl compounds (3.2), e.g. cellulases, lactases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/02—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/12—Applications; Uses in screening processes in functional genomics, i.e. for the determination of gene function
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/91—Transferases (2.)
- G01N2333/91091—Glycosyltransferases (2.4)
- G01N2333/91142—Pentosyltransferases (2.4.2)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/02—Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
Definitions
- the present invention relates to the field of molecular biology and molecular medicine.
- PAR polymerases PARPs
- PAR is polymerized by PARPs onto acceptor proteins using nicotinamide adenine dinucleotide (NAD + ) as substrate ( Figure 1).
- PAR polymers are localized to distinct cellular structures in different phases of the cell cycle and localize to the mitotic spindle during mitosis ( Figure 2).
- Drosophila melanogaster are embryonic lethal (Tulin et al., Genes Dev. 16:2108-2119, 2002).
- the concentration, length, and extent of PAR branching are regulated by a balance of activities of the PARPs and PAR glycohydrolase (PARG), a highly specific, processive endo- and exo-glycosidase (Hatakeyama et al., J. Biol. Chem. 261 : 14902- 1491 1, 1986).
- PARG PAR glycohydrolase
- Poly-ADP-ribose polymers have generally been implicated for a role in several different human diseases including cancer, ischemic injury, inflammatory diseases, cardiovascular diseases, and neurodegenerative disorders.
- the invention provides methods of treating or decreasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the likelihood of developing a stress granule-related disorder in a subject requiring administering to a subject a therapeutically effective amount of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s), one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) poly- ADP ribose glycosylase (PARG) activators, and/or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARPl 1 activators.
- PARP inhibitor(s) e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARG poly- ADP ribose glycosylase
- the invention also provides methods for decreasing the number of stress granules present in a cell or in a population of cells requiring contacting the cell or population of cells with an effective amount of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s), one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARG activators, and/or one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARPl 1 activators.
- one or more e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARP inhibitor(s) e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARG activators e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARPl 1 activators e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10
- compositions and kits containing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s), one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARG activator(s), and/or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARPl 1 activators.
- the one or more PARP inhibitor(s) may selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or even 100%) the expression (e.g., mRNA or protein) and/or activity of one or more (e.g., 1 , 2, 3, 4, or 5) of PARP5a, PARPl 2, PARP13 isoform 1 (PARP13.1), PARP isoform 2 (PARP13.2), and PARP15.
- the decrease in expression of one or more of PARP5a, PARP12, PARP13.1, PARP13.2, or PARP15 is a decrease in the level of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) containing a nucleic acid sequence having at least 80% (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) sequence identity to PARP5a (SEQ ID NO: 8 or 9), PARP12 (SEQ ID NO: 18), PARPl 3.1 (SEQ ID NO: 19), PARPl 3.2 (SEQ ID NO: 20), or PARPI 5 (SEQ ID NO: 22 or 23), or a decrease in the level of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids.
- nucleic acid(s) containing a nucleic acid sequence having at least 80% (e.
- the activity of the one or more of PARP5a, PARP12, PARPl 3.1, PARPl 3.2, or PARPl 5 is poly-ADP-ribosylation of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) target protein(s) (e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, and/or a PARP protein) or formation and/or nucleation of a stress granule.
- target protein(s) e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, and/or a PARP protein
- the one or more PARG activators may selectively increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100%) the expression (e.g., mRNA and/or protein) and/or one or more activities of PARG protein or poly-ADP-ribose glycohydrolase ARH3.
- the increase in expression of PARG or ARH3 is an increase in the level of one or more (e.g., 1, 2, 3, 4, 5, or 6) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or an increase in the level of one or more (e.g., 1, 2, 3, 4, 5, or 6) polypeptides encoded by these nucleic acids.
- nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%
- PARG SEQ ID NO: 42
- ARH3 SEQ ID NO: 41
- the one or more (e.g., 1, 2, 3, 4, or 5) activities of PARG or ARH3 is hydrolysis of poly-ADP-ribose (e.g., poly-ADP-ribose attached to one or more (e.g., 1 , 2, 3, 4, or 5) substrate protein(s), e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, and/or a PARP protein), the prevention of the assembly of a stress granule, or disassembly of a stress granule.
- substrate protein(s) e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, and/or a PARP protein
- the one or more PARPl 1 activator (s) may selectively increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or even 100%) the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1 , 2, 3, 4, or 5) activities of PARPl 1.
- the increase in expression of PARPl 1 is an increase in the level of one or more (e.g., 1 , 2, 3, 4, or 5) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), or an increase in the level of one or more (e.g., 1 , 2, 3, 4, or 5) polypeptides encoded by these nucleic acids.
- the one or more (e.g., 1 , 2, 3, 4, or 5) activities of P ⁇ RP1 1 is poly-ADP-ribosylation of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) target protein(s) (e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, and/or a PARP protein), the prevention of the assembly of a stress granule, or the disassembly of a stress granule.
- target protein(s) e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, and/or a PARP protein
- the one or more PARP inhibitors may be an antibody or antibody fragment that selectively binds one or more (e.g., 1, 2, 3, 4, or 5) of PARP5a, PARP 12, PARP 13.1, PARPl 3.2, and PARP 15; an RNA aptamer (e.g., one or more RNA aptamers containing the sequence of one of SEQ ID NOS: 40, 49, 99-113, and 122-129); or a small molecule.
- one or more RNA aptamer e.g., one or more RNA aptamers containing the sequence of one of SEQ ID NOS: 40, 49, 99-113, and 122-129
- a small molecule e.g., 1, 2, 3, 4, or 5
- the one or more PARG activators may be one or more (e.g., 1, 2, 3, 4, or 5) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41).
- the one or more PARPl 1 activators may be one or more (e.g., 1, 2, 3, 4, or 5) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17).
- the one or more PARP inhibitor(s), one or more PARG activator(s), and/or one or more PARPl 1 activators may be administered once a day or one or more times a week (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, or 14 times a week), and/or administered parenterally (e.g., intravenous, intraarterial, subcutaneous, or intramuscular administration) or orally, and/or administered with one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional therapeutic agents (e.g., one or more (e.g., 1, 2, 3, 4, or 5) non-steroidal anti-inflammatory drug(s), one or more (e.g., 1 , 2, 3, 4, or 5) immunosuppressive agent(s), one or more (e.g., 1, 2, 3, 4, or 5) calcineurin inhibitors, and/or one or more (e.g., 1, 2, 3, 4, or 5) analgesic
- parenterally e
- the contacting may result in a reduction in the number of stress granules in a cell (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction in the number of stress granules in a cell or cell population compared to a control cell or cell population, e.g., a cell or cell population from a person having or diagnosed with a stress granule-related disorder).
- a control cell or cell population e.g., a cell or cell population from a person having or diagnosed with a stress granule-related disorder.
- the invention further provides methods of treating or decreasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the likelihood of developing cancer in a subject requiring administering to a subject a therapeutically effective amount of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s).
- the invention also provides methods for decreasing (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or even 100%) proliferation of a cell or a population of cells requiring contacting the cell or population of cells with an effective amount of one or more (e.g.,1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s).
- the invention also provides compositions and kits containing one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s).
- the one or more PARP inhibitor(s) may selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or even 100% decrease) the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5 ⁇ , P ⁇ RP5B, PARP7, PARP8, PARP14, and PARP16.
- the expression e.g., mRNA and/or protein
- one or more activities of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5 ⁇ , P ⁇ RP5B, PARP7, PARP8, PARP14, and PARP16 e.g., 1, 2, 3, 4, 5, 6, 7, or 8
- the decrease in expression of the one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARPl 6 is a decrease in the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARPl 4 (SEQ ID NO: 21), or PARP 16 (SEQ ID NO: 24), or a decrease in the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids
- the one or more activities of the one or more of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, or PARPl 6 is poly-ADP-ribosylation of one or more (e.g., 1 , 2, 3, 4, or 5) target protein(s) (e.g., a protein localized in the nucleus or mitotic spindle during cytokinesis, and/or a PARP protein) or is required for progression through mitosis.
- target protein(s) e.g., a protein localized in the nucleus or mitotic spindle during cytokinesis, and/or a PARP protein
- the one or more PARP inhibitors may be an antibody or antibody fragment that selectively binds one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARPl 4, and PARP 16; an RNA aptamer (e.g., an RNA aptamer containing the sequence of one or more of SEQ ID NOS: 43-46, 49, 50, 59-74, 1 14-121 , and 130-136); or a small molecule.
- an RNA aptamer e.g., an RNA aptamer containing the sequence of one or more of SEQ ID NOS: 43-46, 49, 50, 59-74, 1 14-121 , and 130-136
- a small molecule e.g., 1, 2, 3, 4, 5, 6, 7, or 8
- the one or more PARP inhibitor(s) may be administered once a day or one or more times a week (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, or 14 times a week), and/or administered parenterally (e.g., intravenous, intraarterial, subcutaneous, or intramuscular administration) or orally, and/or administered with one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional therapeutic agents (e.g., one or more (e.g., 1 , 2, 3.
- parenterally e.g., intravenous, intraarterial, subcutaneous, or intramuscular administration
- additional therapeutic agents e.g., one or more (e.g., 1 , 2, 3.
- chemotherapeutic agents one or more (e.g., 1 , 2, 3, 4, or 5) non-steroidal anti- inflammatory drug(s), one or more (e.g., 1 , 2, 3, 4, or 5) immunosuppressive agent(s), one or more (e.g., 1 , 2, 3, 4, or 5) calcineurin inhibitors, and/or one or more (e.g., 1 , 2, 3, 4, or 5) analgesic(s)).
- the contacting may result in a reduction in the rate of proliferation of a cell or cell population (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction in the rate of proliferation of a cell or cell population compared to a control cell or cell population, e.g., a cancer cell or a cancer cell line).
- a control cell or cell population e.g., a cancer cell or a cancer cell line
- the invention further provides methods for increasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the number of stress granules in a cell or cell population by contacting the cell or cell population with an effective amount of one or more (e.g., 1, 2, 3, 4, 5, 6, 1, 8, 9, or 10) PARP activators, one or more (e.g., 1, 2, 3, 4, or 5) PARG inhibitors, and/or one or more (e.g., 1 , 2, 3, 4, or 5) PARPl 1 inhibitors.
- one or more e.g., 1, 2, 3, 4, 5, 6, 1, 8, 9, or 10
- PARP activators e.g., 1, 2, 3, 4, or 5
- PARG inhibitors e.g., 1, 2, 3, 4, or 5
- PARPl 1 inhibitors e.g., 1 , 2, 3, 4, or 5 inhibitors.
- the one or more PARP activators selectively increase the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1 , 2, 3, 4, or 5) activities of one or more (e.g., 1, 2, 3, 4, or 5) of PARP5A, PARP12, PARP 13.1, PARPl 3.2, and PARPl 5.
- the increase in expression is an increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%,
- nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5b (SEQ ID NO: 10), PARP13.1 (SEQ ID NO: 19), PARP 13.2 (SEQ ID NO: 20), or PARPl 5 (SEQ ID NO: 22 or 23), or an increase in the level of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids.
- nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5b (SEQ ID NO: 10), PARP13.1 (S
- the one or more activities of PARP5A, PARP12, PARP13.1 , PARP13.2, and PARP15 is the poly-ADP-ribosylation of one or more (e.g., 1 , 2, 3, 4, or 5) target protein(s) (e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP protein) or the formation or nucleation of a stress granule.
- target protein(s) e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP protein
- the one or more PARG inhibitors may selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1 , 2, 3, 4, or 5) activities of PARG or ARH3.
- the expression e.g., mRNA and/or protein
- one or more activities of PARG or ARH3 e.g., 1 , 2, 3, 4, or 5
- the decrease in expression of PARG or ARH3 is a decrease in the level of one or more (e.g., 1 , 2, 3, 4, 5, or 6) nucleic acid(s) containing a nucleic sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or a decrease in the levels of one or more (e.g., 1 , 2, 3, 4, 5, or 6) polypeptides encoded by these nucleic acids.
- the one or more activities of PARG or ARH3 is the hydrolysis of poly-ADP-ribose (e.g., poly-ADP-ribose that is covalently attached to one or more (e.g., 1, 2, 3, 4, or 5) substrate protein(s), e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP protein), the prevention of assembly of a stress granule protein, or disassembly of a stress granule.
- substrate protein(s) e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP protein
- the one or more PARPl 1 inhibitors may selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the expression (e.g., mRNA and/or protein) and/or one or more activities of PARPl 1.
- the decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) in expression of PARPl 1 is a decrease in the level of one or more (e.g., 1, 2, 3, 4, or 5) nucleic acid(s) containing a nucleic acid having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), or a decrease in the level of one or more (e.g., 1, 2, 3, 4, or 5) polypeptides encoded by these nucleic acids.
- nucleic acid(s) containing a nucleic acid having at least 80% sequence identity e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%
- the one or more activities of PARPl 1 is poly-ADP-ribosylation of one or more (e.g., 1 , 2, 3, 4. or 5) target protein(s) (e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP protein), the prevention of the assembly of a stress granule, or disassembly of a stress granule.
- target protein(s) e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP protein
- the one or more PARP activators is one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) comprising a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARPl 3.1 (SEQ ID NO: 19), PARPl 3.2 (SEQ ID NO: 20), or PARPl 5 (SEQ ID NO: 22 or 23).
- nucleic acid(s) comprising a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARPl 3.1 (SEQ ID NO: 19), PARP
- the one or more PARG inhibitors is an antibody or antibody fragment that selectively binds to PARG or ARH3; an RNA aptamer (e.g., a nucleic acid sequence that contains one or more of SEQ ID NOS: 34-37); or a small molecule.
- the one or more PARPl 1 inhibitors may be an antibody or an antibody fragment that selectively binds to PARPl 1 ; an RNA aptamer (e.g., a nucleic acid sequence that contains one or more of SEQ ID NOS: 91 -98); or a small molecule.
- the contacting results in at least a 10% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) reduction in the number of stress granules present in the cell or the population of cells compared to a control cell or population of cells (e.g., a cell or population of cells untreated with a PARP activator, a PARG inhibitor, or a PARPl 1 inhibitor, e.g., a cell from a subject having or diagnosed with a stress-granule disorder).
- the cell or population of cells is a mammalian cell(s) or a plant cell(s).
- the invention also provides methods of increasing (e.g., by at least 10%, 20%,
- the one or more PARP activators selectively increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the expression (e.g., mRNA and/or protein) and/or one or more activities (e.g., 1, 2, 3, 4, or 5) of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP 14, and PARPl 6.
- the increase in expression of one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, or PARPl ⁇ is an increase in the level of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) comprising a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24), or an increase in the level of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids.
- nucleic acid(s)
- the one or more activities of said one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, or PARP16 is poly-ADP-ribosylation of one or more (e.g., 1, 2, 3, 4, or 5) target protein(s) (e.g., a protein localized in the nucleus or mitotic spindle during cytokinesis, and/or a PARP protein) or is required for progression through mitosis.
- target protein(s) e.g., a protein localized in the nucleus or mitotic spindle during cytokinesis, and/or a PARP protein
- the one or more PARP activators is one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24).
- PARPl SEQ ID NO: 1 or 2
- PARP2 SEQ ID NO: 3
- PARP5A SEQ ID NO: 8 or 9
- PARP5B SEQ ID NO: 10
- PARP14 SEQ ID NO: 21
- PARP16 SEQ ID NO: 24
- the cell or cell population is a plant cell(s) or mammalian cell(s).
- the contacting results in at least a 10% increase (e.g., at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% increase) in the rate of proliferation of the cell or population of cells compared to a control cell or cell population (e.g., a cell or cell population not treated with a PARP activator).
- the invention further provides methods for identifying a candidate agent for treating or decreasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the likelihood of developing a stress granule-related disorder requiring the steps of: providing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, or 20) PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins encoded by a nucleic acid containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP 12 (SEQ ID NO: 18), PARPl 3.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP15 (SEQ ID NO: 22 or 23), PAR
- the invention further provides methods for identifying a candidate agent for treating or decreasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the likelihood of developing cancer requiring the steps of providing one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) PARP protein(s) and/or PARP fusion protein(s) encoded by a nucleic acid containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%,
- PARPl SEQ ID NO: 1 or 2
- PARP2 SEQ ID NO: 3
- PARP5A SEQ ID NO: 8 or 9
- PARP5B SEQ ID NO: 10
- PARP7 SEQ ID NO: 1 T
- PARP8 SEQ ID NO: 13
- PARPl 4 SEQ ID NO: 21
- PARPl 6 SEQ ID NO: 24
- the labeled NAD + substrate is labeled with a radioisotope (e.g., 32 P) or fluorophore, or is biotinylated.
- a radioisotope e.g. 32 P
- fluorophore e.g. 32 P
- the one or more PARP, PARG, and/or ARH3 protein(s) and/or PARP, PARG, and/or ARH3 fusion protein(s) is purified.
- the one or more PARP, PARG, and/or ARH3 protein(s) and/or PARP, PARG, and/or ARH3 fusion protein(s) is present in a cell lysate.
- the agent is a small molecule (e.g., a small molecule from a chemical library), a polypeptide or peptide fragment (e.g., a polypeptide or peptide fragment present in a cellular lysate), or a nucleic acid.
- the one or more PARP, PARG, and/or ARH3 protein(s) and/or PARP, PARG, and/or ARH3 fusion protein(s) is attached to a substrate (e.g., a magnetic bead) or a solid surface.
- the method is performed in a multi-well plate.
- the invention further provides methods for determining the propensity of a subject to develop a stress granule-related disorder by determining the expression and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARP5A, PARPI l, PARP12, PARPl 3.1, PARPl 3.2, PARPl 5, PARG, and ARH3 in a subject, wherein an increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) in the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1 , 2, 3, 4, or 5) activities of one or more (e.g., 1 , 2, 3, 4, or 5) of PARP5A, PARP12, PARPl 3.1 , PARPl 3.2, and PARP15, and/or a decrease (e.g., at least 10%, 20%,
- the expression is the level of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARPI l (SEQ lD NO: 17), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARPl 5 (SEQ ID NO: 20 or 23), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41), or the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids.
- nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g.,
- the invention also provides a method for determining the propensity of a subject to develop cancer comprising determining the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16 in a subject, wherein an increase in the expression and/or one or more activities of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARPl 6 indicates an increased propensity to develop cancer.
- the expression is the level of one or more (e.g.,
- PARPl SEQ ID NO: 1 or 2
- PARP2 SEQ ID NO: 3
- PARP5A SEQ ID NO: 8 or 9
- PARP5B SEQ ID NO: 10
- PARP7 SEQ ID NO: 12
- PARP8 SEQ
- the expression of the one or more e.g., 1 ,
- nucleic acid(s) is determined using reverse transcriptase polymerase chain reaction (RT-PCR).
- RT-PCR reverse transcriptase polymerase chain reaction
- the expression of the one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptide(s) is determined using an antibody-based technique (e.g., imunoblotting or an enzyme-linked immunosorbent assay (ELISA)).
- ELISA enzyme-linked immunosorbent assay
- a stress granule-related disorder may be a cardiovascular disorder (e.g., an aneurysm, angina, atherosclerosis, stroke, cerebrovascular disease, congestive heart failure, coronary artery disease, myocardial disease, peripheral vascular disease, granulomatous myocarditis, chronic myocarditis, myocardial infarction, and primary hypertrophic cardiomyopathy), an inflammatory disorder (e.g., an autoimmune disease, asthma, an allergic intraocular inflammatory disease, arthritis, atopic dermatitis, atopic eczema, cirrhosis, Crohn's disease, ulcerative colitis, diabetes, hemolytic anemia, inflammatory dermatosis, an inflammatory bowel disorder, systemic lupus erythamatosus, psoriasis, rheumatoid arthritis, Wegener's granulomatosis, Hashimoto's thyroiditis, chronic pancreatitis, and
- a cardiovascular disorder
- the treating may result in a reduction (e.g., at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction) in one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) symptoms of a stress granule-related disorder or a reduction (e.g., at least a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction) in the likelihood of developing a stress granule-related disorder.
- a reduction e.g., at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction
- the cancer may be colon adenocarcinoma, esophagas adenocarcinoma, liver hepatocellular carcinoma, squamous cell carcinoma, pancreas adenocarcinoma, islet cell tumor, rectum adenocarcinoma, gastrointestinal stromal tumor, stomach adenocarcinoma, adrenal cortical carcinoma, follicular carcinoma, papillary carcinoma, breast cancer, ductal carcinoma, lobular carcinoma, intraductal carcinoma, mucinous carcinoma, phyllodes tumor, Ewing's sarcoma, ovarian adenocarcinoma, endometrium adenocarcinoma, granulose cell tumor, mucinous cystadenocarcinoma, cervix adenocarcinoma, vulva squamous cell carcinoma, basal cell carcinoma, prostate adenocarcinoma, giant cell tumor of bone, bone osteosarcoma, lary
- said treating may result in a reduction (e.g., at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction) in one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) symptoms of a cancer or a reduction (e.g., at least a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction) in the likelihood of developing a cancer.
- a reduction e.g., at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction
- the cell or population of cells is an epithelial cell, a fibroblast, a kidney cell, a muscle cell, a neuron, a hepatocyte, an oocyte, a sperm, a lymphocyte, or a macrophage.
- compositions may be formulated for parenteral or oral administration.
- ARH3 or "poly-ADP-ribose glycohydrolase ARH3” is meant a nucleic acid having containing a sequence at least 80% identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identical) to the sequence of SEQ ID NO: 41 , or one or more polypeptides encoded by these nucleic acids.
- ARH3 fusion protein or "poly-ADP-ribose glycohydrolase ARH3 fusion protein” is meant a polypeptide containing a polypeptide tag and a sequence having at least 80% identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to a protein encoded by ARH3 (SEQ ID NO: 41).
- the polypeptide tag of an ARH3 fusion protein may be located at the N- and/or C- terminus of the protein.
- the polypeptide tag may contain one or more of a fluorescent protein (e.g., a green fluorescence protein), a peptide epitope recognized by specific antibodies, a protein that is bound by a partner binding protein with high affinity (e.g., biotin and streptavidin), a His6-tag, or one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) protease recognition sequence(s) (e.g., one or more of a TEV protease or Factor Xa protease recognition sequence).
- a fluorescent protein e.g., a green fluorescence protein
- a peptide epitope recognized by specific antibodies e.g., a protein that is bound by a partner binding protein with high affinity (e.g., biotin and streptavidin), a His6-tag, or one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) protease recognition sequence(s) (e.g., one or more of a
- antibodies specific for the polypeptide tag or proteins that bind specifically to the protein sequence in the polypeptide tag may bound to a bead (e.g., a magnetic bead) or polymer surface in order to allow for the purification of the ARH3 fusion protein.
- An ARH3 fusion protein may also be purified and subsequently treated with one or more (e.g., 1 , 2, or 3) protease(s) to remove the polypeptide tag from the ARH3 fusion protein.
- An ARH3 fusion protein preferably has the same cellular localization and biological activity as the wild-type ARH3 protein. Methods for the generation and purification of ARH3 fusion proteins are described herein.
- biotinylated is meant the covalent attachment of a biotin molecule to a small molecule, surface, or protein.
- a biotin molecule may be attached to a small molecule, surface, or protein using methods known in the art including, but not limited to, attachment to primary amines (e.g., epsilon-amines and N-terminal ⁇ -amines of a protein), as well as attachment at a sulfhydryl group, and a carboxyl group.
- Small molecules e.g., NAD +
- proteins e.g., one or more of the PARP fusion proteins described herein
- Biotinylated NAD + is available from a number of commercial sources including R & D Systems, Gcntaur, and Trevigen (e.g., 6-biotin-17- NAD).
- Biotinylated small molecules and substrates may be specifically bound and/or purified using streptavidin, a protein that has a high affinity for biotin (Ka ⁇ 10 13 M " '), or surfaces covalently attached to streptavidin (e.g., streptavidin-coated beads).
- cancer is meant a disease of uncontrolled or misregulated cell proliferation or cell division.
- Non-limiting examples of cancer include colon adenocarcinoma, esophagas adenocarcinoma, liver hepatocellular carcinoma, squamous cell carcinoma, pancreas adenocarcinoma, islet cell tumor, rectum adenocarcinoma, gastrointestinal stromal tumor, stomach adenocarcinoma, adrenal cortical carcinoma, follicular carcinoma, papillary carcinoma, breast cancer, ductal carcinoma, lobular carcinoma, intraductal carcinoma, mucinous carcinoma, phyllodes tumor, Ewing's sarcoma, ovarian adenocarcinoma, endometrium adenocarcinoma, granulose cell tumor, mucinous cystadenocarcinoma, cervix adenocarcinoma, vulva squamous cell carcinoma, basal cell carcinoma, prostate aden
- cell lysate is meant the contents of the cell once the plasma membrane has been disrupted or permeabilized.
- Cell lysate also includes the contents of the intracellular organelles (e.g., endoplasmic reticulum, nucleus, mitochondria, chloroplasts, Golgi apparatus, and lysosome) upon disruption of their respective membranes.
- Cell lysate contains an unpurified mixture of proteins, small molecule metabolites, and nucleic acids (e.g., DNA and RNA).
- Cell lysate may be prepared from any type of cell, e.g., a mammalian cell (e.g. human, mouse, rat, and monkey cell), a bacterial cell, fungal cell, and a yeast cell.
- Cell lysate may be obtained by any methods known in the art including physical disruption (e.g., sonication, homogenization, or freeze/thaw procedures) or chemical disruption (e.g., treatment with a detergent (e.g., Triton-X-100 and NP-40)).
- Cell lysate may be prepared from a cell expressing one or more of the nucleic acid(s) that encode one or more PARP, PARG, and/or ARH3 proteins and/or one or more PARP, PARG, and/or ARH3 fusion protein(s).
- Cell lysate may also be prepared from a cell arrested in a specific stage of the cell cycle (e.g., mitosis or S- phase) or may be prepared from asynchronous cells.
- constitutive promoter a promoter that is placed 5' relative to a nucleic acid sequence encoding a protein, wherein the promoter regulates the consistent expression of a nucleic acid encoding a protein.
- the sequence of the constitutive promoter may be directly (no extraneous nucleotides) 5' to the first nucleotide of the sequence encoding the protein (e.g., a PARP, PARG, and/or ARH3 protein and/or a PARP, PARG, and/or ARH3 fusion protein as described herein) or may be between 1 -20 nucleotides, 1-100 nucleotides, 10-260 nucleotides, 100-700 nucleotides, or 100 to 2,000 nucleotides from the first nucleotide of the sequence encoding the protein.
- constitute promoters include, but are not limited to, bacterial promoters (e.g., E. coli ⁇ 70 , ⁇ s , ⁇ 32 , or ⁇ 54 promoters; B. subtilis ⁇ A or ⁇ B promoters; T7 RNA polymerase-based promoters; and bacteriophage SP6 promoter), yeast promoters (e.g., pCyc, pAdh, pSte5, ADHl, eye 100, cyc70, cyc43, cyc28, eye 16, pPGKl , pCYC, GPD (TDH3), and CLBl promoters), and mammalian promoters (e.g., cytomegalovirus immediate early gene-based promoters, SV40 early promoter, and Rous sarcoma virus promoter).
- bacterial promoters e.g., E. coli ⁇ 70 , ⁇ s , ⁇ 32 , or ⁇
- a constitutive promoter may be used to mediate the expression of a nucleic acid (e.g., one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or a PARP, PARG, and/or ARH3 fusion protein as described herein) in a transgenic mammalian, bacterial, or yeast cell.
- a nucleic acid e.g., one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or a PARP, PARG, and/or ARH3 fusion protein as described herein
- disassembly of a stress granule is meant the process of deconstructing or dissolution of one or more stress granules in a cell or cell population.
- the disassembly of a stress granule may take place by the catalytic activity of one or more proteins (e.g., one or more of a PARG, ARH3, and/or PARPl 1, and/or a PARG, ARH3, and/or PARPl 1 fusion protein).
- the disassembly of a stress granule in a cell or cell population may occur following the removal of a stress condition (e.g., washout of sodium arsenite or pateamine A from the culture medium).
- an agent e.g., one or more PARP inhibitor(s), one or more PARG activator(s), and/or one or more PARPl 1 activator(s)
- the amount of an agent e.g., one or more PARP inhibitor(s), one or more PARG activator(s), and/or one or more PARPl 1 activator(s)
- the amount of an agent that decreases the number (e.g., prevents 1, 2, 3, 4, or 5 symptoms from occurring) or severity (e.g., decrease of at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% in the severity) of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) symptoms of a stress granule-related disorder or the amount of an agent (e.g., one or more PARP inhibitors)) that decreases the number or severity of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) symptoms of cancer
- a stress granule By “formation” of a stress granule is meant a series of events that lead to the appearance of distinct protein- and RNA-containing stress granules in the cytoplasm.
- the formation of a stress granule in a cell may be accelerated by exposure to stress conditions, including, but not limited to, chemical stress (e.g., sodium arsenite and pateamine A).
- nucleation By “nucleation” of a stress granule is meant one of the initial steps or initial rate-limiting steps in the formation of a stress granule in a cell.
- proteins involved in the formation or nucleation of stress granules include, without limitation, PARP 5A, PARP12, PARP13.1 , PARP13.2, and PARP 15.
- labeled nicotinamide adenine dinucleotide or “labeled NAD +" is meant a molecule of nicotinamide adenine dinucleotide (NAD + ) that is covalently labeled with a fluorescent molecule, a colorimetric molecule, or a molecule that is recognized by a specific partner protein (e.g., biotinylation), or labeled with a radioisotope.
- a labeled NAD + is biotinylated NAD + (e.g., 6-biotin-14-NAD).
- radiolabeled NAD + include, but are not limited to, 14 C-adenine-NAD + , 32 P-NAD + , and 3 H- NAD + . Additional examples of labeled NAD + are known in the art.
- short RNA or DNA aptamer is meant a short sequence of DNA or RNA nucleotides that binds to a specific target molecule (e.g., a protein or a target RNA or DNA molecule).
- a DNA or RNA aptamer that specifically binds to its target molecule e.g., one or more (e.g., 1, 2, 3, 4, or 5) of the nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or a PARP, PARG, and/or ARH3 fusion protein (as described herein) may decrease (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) or increase (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) one or more (e.g., 1, 2, 3, 4, or 5) activities or expression (e.g., mRNA or protein level) of the target molecule
- a specific DNA or RNA aptamer may bind to one or more of the above-described PARP proteins or PARP fusion proteins and increase or decrease the poly-ADP ribosylation activity of the protein, the amount of poly-ADP ribose attached to the protein, or the levels of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP proteins or PARP fusion proteins.
- the specific DNA or RNA aptamer may also bind to one or more nucleic acids (e.g., DNA or RNA) that encode a specific PARP, PARG, and/or ARH3 protein (e.g., a nucleic acid that encodes a protein having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 1 1), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARP10 (SEQ
- RNAi inhibitory RNA
- Methods for the design of RNAi molecules are known in the art. Examples of specific RNAi molecules that may be used to decrease the expression of a PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and/or ARH3 fusion protein are described herein.
- fluorescent protein is meant a protein that absorbs light of a specific wavelength (e.g., absorption wavelength) and emits light with a longer wavelength (e.g., emission wavelength).
- fluorescent protein encompasses natural fluorescent proteins (i.e., the natural form of the fluorescent protein without any genetic manipulations) and genetically mutated fluorescent proteins (e.g., fluorescent proteins engineered to change the identity of one or more amino acid residues).
- fluorescent proteins include, but limited to, green fluorescent proteins (e.g., GFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen, T-Sapphire, and T-Sapphire), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mTagBFP), cyan fluorescent proteins (e.g., ECFP, mECFP, Cerulean, CyPet, AmCyanl, Midori-Ishi Cyan, TagCFP, mTFPl (Teal)), yellow fluorescent proteins (e.g., EYFP, Topaz, Venus, mCitrine, YPet, Tan YFP, Phi YFP, ZsYellowl, and mBanana), orange fluorescent proteins (e.g., Kusabira Orange, Kurabira Orange2, mOrange, m ⁇ range2,
- Fluorescent proteins may be attached to the N- and/or C-terminus of a target protein (e.g., one or more of the PARP, PARG, and/or ARH3 fusion proteins described herein). Fusion proteins tagged with a fluorescent protein (e.g., one or more of the PARP, PARG, and/or ARH3 fusion proteins described herein) may be analyzed using fluorescence-based techniques known in the art (e.g., fluorescence microscopy, fluorescence plate readers, fluorescence-assisted cell sorting, and use of a second antibody specific for the fluorescent protein).
- fluorescence-based techniques e.g., fluorescence microscopy, fluorescence plate readers, fluorescence-assisted cell sorting, and use of a second antibody specific for the fluorescent protein.
- inducible promoter is meant a promoter that is placed 5' relative to a nucleic acid sequence encoding a protein, wherein the promoter induces (or represses) the expression of a nucleic acid upon addition (or removal) of a specific molecule or protein.
- the sequence of the inducible promoter may be directly (no extraneous nucleotides) 5' to the first nucleotide of the sequence encoding the protein (e.g., a PARP fusion protein as described herein) or may be between 1 -20 nucleotides, 1 -100 nucleotides, 10-260 nucleotides, 100-700 nucleotides, or 100 to 2,000 nucleotides from the first nucleotide of the sequence encoding the protein.
- inducible promoters include, but are not limited to alcohol dehydrogenase I gene promoters, tetracycline-responsive promoter systems, glucocorticoid receptor promoters, estrogen receptor promoter, ecdysone receptor promoters, metal lothionein-based promoters, and T7-polymerase based promoters.
- An inducible promoter may be used to regulate the expression of a nucleic acid (e.g., one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein and/or PARP, PARG, and/or ARH3 fusion protein as described herein) in a transgenic mammalian, bacterial, or yeast cell.
- nuclear lysate is meant the contents of a nucleus upon disruption of the nuclear membrane.
- Nuclear lysate contains an unpurif ⁇ ed mixture of proteins, small molecule metabolites, and nucleic acids (e.g., DNA and RNA).
- Nuclear lysate may be prepared from any type of nucleated cell, e.g., a mammalian cell (e.g. human, mouse, rat, and monkey cell), a fungal cell, a yeast cell, or a plant cell.
- Nuclear lysate may be obtained by any methods known in the art including stepped lysis using two different concentrations of detergents (e.g., NP-40) or a combination of physical treatment to rupture the plasma membrane and chemical treatment to rupture the nuclear membrane.
- Nuclear lysate may be prepared from a cell expressing one or more of the nucleic acid(s) of the invention that encode a one or more PARP, PARG, or ARH3 proteins or PARP, PARG, or ARH3 fusion protein(s).
- PAR poly- ADP ribose
- a chain of two or more ADP-ribose molecules The two or more molecules of ADP-ribose making up PAR may occur in a single linear chain or as a branched chain with one or more branches (e.g., at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 branches).
- PoIy-ADP ribose may be attached to a specific substrate (e.g., protein, lipid, DNA, RNA, or small molecule) by the activity of one or more PARP proteins or PARP fusion proteins (e.g., one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22) of PARPl, PARP2, PARP3, PARP3.2, PARP3.3, PARP4, PARP5A, PARP5B, PARP6, PARP7, PARP8, PARP9, PARPlO, PARPl 1, PARP12, PARP13.1, PARP13.2, PARP14, PARP15.1, PARP15.2, and PARPl 6, or one or more of their respective fusion proteins) or removed by the activity of one or more PARG protein, PARG fusion protein, ARH3 protein, or ⁇ RH3 fusion protein (e.g., PARG protein or ARH3).
- PARP proteins or PARP fusion proteins
- Attachment of poly-ADP-ribose to a substrate protein may affect the biological activity of the substrate protein, localization of the protein, or the identity and number of proteins that bind to the target substrate (e.g., protein).
- PARP proteins may also be modified by the covalent attachment of poly-ADP-ribose.
- the addition of poly-ADP ribose to a PARP protein may occur by "auto-modification” or "auto-modulation” (i.e., a specific PARP catalyzes the attachment of poly-ADP ribose to itself) or may occur by the activity of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) other PARP proteins.
- poly-ADP-ribose glycolase or "PARG” is meant any enzyme that has the ability to remove an ADP-ribose attached to a substrate (e.g., a protein, RNA molecule, DNA molecule, or lipid) or to remove one or more ADP-ribose molecules from a pre-existing poly-ADP-ribose molecule covalently attached to a substrate (e.g., a protein, RNA molecule, DNA molecule, or lipid).
- a substrate e.g., a protein, RNA molecule, DNA molecule, or lipid
- a PARG may be one or more nucleic acids containing a sequence having at least 80% identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or one or more polypeptides encoded by these nucleic acids.
- a PARG may have additional biological activities, such as decreasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or even 100%) the formation or rate of formation of a stress granule in a cell or increasing the rate of disassembly of a stress granule.
- the term PARG also includes the isoforms of PARG proteins described in Meyer-Ficca et al., Exp. Cell. Res. 297(2):521-532, 2004.
- PARG protein or "poly-ADP-ribose glycolase protein” is meant is meant a polypeptide encoded by a nucleic acid containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identical) to the sequence of SEQ ID NO: 42.
- PARG fusion protein or "poly-ADP-ribose glycolase fusion protein” is meant a polypeptide containing a polypeptide tag and a sequence encoded by a nucleic acid containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARG (SEQ ID NO: 42).
- the polypeptide tag of a PARG fusion protein may be located at the N- and/or C- terminus of the protein.
- the polypeptide tag may contain one or more of a fluorescent protein (e.g., a green fluorescence protein), a peptide epitope recognized by specific antibodies, a protein that is bound by a partner binding protein with high affinity (e.g., biotin and streptavidin), a His ⁇ -tag, or one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) protease recognition sequence(s) (e.g., one or more of a TEV protease or Factor Xa protease recognition sequence).
- PARG fusion proteins may be purified using antibodies specific for the polypeptide tag.
- antibodies specific for the polypeptide tag or proteins that bind specifically to the protein sequence in the polypeptide tag may bound to a bead (e.g., a magnetic bead) or polymer surface in order to allow for the purification of the PARG fusion protein.
- a PARG fusion protein may also be purified and subsequently treated with one or more (e.g., 1 , 2, or 3) protease(s) to remove the polypeptide tag from the PARG fusion protein.
- a PARG fusion protein preferably has the same cellular localization and biological activity as the wild-type PARG protein. Methods for the generation and purification of PARG fusion proteins are described herein.
- poly-ADP-ribose glycolase activator or "PARG activator” is meant an agent that increases (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the expression (e.g., protein and/or mRNA level) or one or more (e.g., 1, 2, 3, 4, or 5) biological activities of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARG proteins.
- a PARG activator may increase the levels of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acids containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or increase the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids.
- one or more e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- a PARG activator may increase one or more of the biological activities of a PARG including the ability to remove a ADP-ribose attached to a substrate (e.g., a protein, RNA molecule, DNA molecule, lipid, or small molecule), the ability to remove one or more ⁇ DP-ribose molecules from a pre-existing poly- ADP-ribose molecule covalently attached to one or more substrate(s) (e.g., a protein, RNA molecule, DNA molecule, lipid, or small molecule), the ability to decrease or prevent the formation or the rate of formation of a stress granule in a cell, or the ability to increase the rate of disassembly of a stress granule.
- a substrate e.g., a protein, RNA molecule, DNA molecule, lipid, or small molecule
- substrate(s) e.g., a protein, RNA molecule, DNA molecule, lipid, or small molecule
- Non-limiting examples of PARG activators include one or more nucleic acids containing a nucleic acid having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41).
- poly-ADP-ribose glycolase inhibitor or "PARG inhibitor” is meant an agent that decreases (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the expression (e.g., protein and/or mRNA level) or one or more (e.g., 1, 2, 3, 4, or 5) biological activities of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARGs.
- a PARG inhibitor may decrease the levels of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or ] 0) nucleic acids containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even
- a PARG activator may decrease one or more (e.g., 1 , 2, 3, 4, or 5) of the biological activities of a PARG including, but not limited to, the ability to remove a ADP- ribose attached to one or more substrate(s) (e.g., a protein, RNA molecule, DNA molecule, lipid, or small molecule), the ability to remove one or more ADP-ribose molecules from a pre-existing poly-ADP-ribose molecule covalently attached to a substrate (e.g., a protein, RNA molecule, DNA molecule, lipid, or small molecule), the ability to decrease or prevent the formation or the rate of formation of a stress granule in a cell, or the ability to increase the rate of disassembly of a stress granule.
- substrate(s) e.g., a protein, RNA molecule, DNA molecule, lipid, or small molecule
- a substrate e.g., a protein
- Non-limiting examples of PARG inhibitors include antibodies or antibody fragments that specifically bind to PARG protein, ARH3 protein, PARG fusion protein, or ARH3 fusion protein; RNAi molecules (e.g., a nucleic acid sequence that contains the sequence of one of SEQ ID NOS: 34-37), or small molecules.
- RNAi molecules e.g., a nucleic acid sequence that contains the sequence of one of SEQ ID NOS: 34-37
- small molecules e.g., a nucleic acid sequence that contains the sequence of one of SEQ ID NOS: 34-37
- peptide fragment is meant a protein having at least 2 amino acids
- Non-limiting examples of peptide fragments have between 2 to 250 amino acids, 5 to 200 amino acids, between 5 to 150 amino acids, or between 5 to 100 amino acids.
- a peptide fragment may also represent a protein that has been processed to remove one or more (e.g., 1, 2, or 3) post-translational targeting sequences (e.g., nuclear localization sequence, ER signal peptide, mitochondrial targeting signal, nuclear export sequence, or N-terminal secretion sequence).
- poly-ADP ribose polymerase nucleic acid or "PARP nucleic acid” is meant any nucleic acid containing a sequence that has at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% sequence identity) to one or more of PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 1 1), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARPlO (SEQ ID NO: 15), PARPl 0.2 (SEQ ID NO: 16), PARPI
- a PARP nucleic acid encodes a protein that has a catalytic activity of attaching an ADP-ribose to a substrate (e.g., protein, DNA, RNA, lipid, or small molecule) or attaching one or more ADP-ribose molecules to an ADP-ribose molecule already attached to the substrate (e.g., protein, DNA, RNA, lipid, or small molecule) to create poly-ADP ribose.
- a PARP nucleic acid may encode a protein having additional activities to those described above (e.g., mediates increased stress granule formation, role in progression through mitosis or cytokinesis, and modulation (e.g., increase or decrease) of RNAi function).
- poly-ADP ribose polymerase protein or "PARP protein” is meant polypeptide containing a sequence having at least 80% identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to a protein encoded by a nucleic acid sequence containing the sequence of PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 11), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ lD NO: 14), PARPlO (SEQ ID NO: 15), PARP10.2 (SEQ ID NO: 16),
- a PARP protein may contain one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) post-translational modifications, e.g., phosphorylation and ADP-ribosylation (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 ADP- ribose molecules) on one or more amino acid residues.
- Post-translation modification of a PARP protein may occur within a cell (e.g., a transgenic cell described above) or in vitro using purified enzymes.
- PARP protein activity assays may be performed as described herein.
- poly-ADP ribose polymerase fusion protein or "PARP fusion protein” is meant a polypeptide containing a polypeptide tag and a sequence having at least 80% identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to a protein encoded by one or more of PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 1 1), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARPlO (SEQ ID NO: 15), PARPl 0.2 (SEQ ID NO:
- the polypeptide tag of a PARP fusion protein may be located at the N- and/or C- terminus of the protein.
- the polypeptide tag may contain one or more of a fluorescent protein (e.g., a green fluorescence protein), a peptide epitope recognized by specific antibodies, a protein that is bound by a partner binding protein with high affinity (e.g., biotin and streptavidin), a His 6 -tag, or one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) protease recognition sequence(s) (e.g., one or more of a TEV protease or Factor Xa protease recognition sequence).
- a fluorescent protein e.g., a green fluorescence protein
- a peptide epitope recognized by specific antibodies e.g., a protein that is bound by a partner binding protein with high affinity (e.g., biotin and streptavidin), a His 6 -tag, or one or more (
- the PARP fusion proteins of the invention may be purified using antibodies specific for the polypeptide tag.
- antibodies specific for the polypeptide tag or proteins that bind specifically to the protein sequence in the polypeptide tag may be bound to a bead (e.g., a magnetic bead) or polymer surface in order to allow for the purification of the PARP fusion protein.
- a PARP fusion protein may also be purified and subsequently treated with one or more (e.g., 1, 2, or 3) protease(s) to remove the polypeptide tag from the PARP fusion protein.
- a PARP fusion protein preferably has the same cellular localization and biological activity as the wild-type PARP protein. Methods for the generation and purification of PARP fusion proteins are described herein.
- PARP activator or “poly-ADP-ribose polymerase activator” is meant an agent that increases the expression (e.g., mRNA or protein level) and/or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) biological activities of one or more PARPs.
- a PARP activator may increase the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, or 20) PARP nucleic acids or PARP proteins (described above).
- a PARP activator may increase one or more biological activities of a PARP protein including, but not limited to, the ability to attach a poly-ADP-ribosc molecule to one or more substrate(s) (e.g., a protein, DNA molecule, RNA molecule, lipid, or small molecule), the ability to promote formation of a stress granule, the ability to nucleate the formation of a stress granule, the ability to disassemble a stress granule, the ability to decrease stress granule assembly, the ability to localize to a stress granule, the ability of a PARP protein to bind to one or more of its substrates, the ability of a PARP protein to localize to the nucleus or the mitotic spindle, the ability to promote cell proliferation, and the ability to promote progression through cytokinesis.
- substrate(s) e.g., a protein, DNA molecule, RNA molecule, lipid, or small molecule
- Specific PARP activators include nucleic acids encoding one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20) PARPs or the catalytic domains of one or more PARPs.
- a PARP activator may be a nucleic acid containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), P ⁇ RP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 1 1), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARPlO (SEQ ID NO: 15), PARP 10.2 (SEQ ID NO: 16), PARPI l (SEQ ID NO: 17), PARPl 2 (SEQ ID NO: 18), PAR
- Specific PARP activators may increase the expression and/or one or more (e.g., 1 , 2, 3, 4, or 5) biological activities of a specific PARP or a specific subset of PARPs (e.g., one or more of PARP5A, PARPl 2, PARPl 3.1 , PARPl 3.2, and PARPl 5; PARPl 1 ; and one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARPl 6).
- a specific PARP or a specific subset of PARPs e.g., one or more of PARP5A, PARPl 2, PARPl 3.1 , PARPl 3.2, and PARPl 5; PARPl 1 ; and one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARPl 6).
- PARP inhibitor or “poly-ADP-ribose polymerase inhibitor” is meant an agent that decreases the expression (e.g., mRNA or protein level) and/or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) biological activities of one or more PARPs.
- a PARP inhibitor may decrease the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 2O) PARP nucleic acids or PARP proteins (described above).
- a PARP inhibitor may decrease one or more (e.g., 1, 2, 3, 4, or 5) biological activities of a PARP protein including, but not limited to, the ability to attach a poly-ADP-ribose molecule to a substrate (e.g., a protein, DNA molecule, RNA molecule, lipid, or small molecule), the ability to promote formation of a stress granule, the ability to nucleate the formation of a stress granule, the ability to disassemble a stress granule, the ability to decrease stress granule assembly, the ability to localize to a stress granule, the ability of a PARP protein to bind to one or more of its substrates, the ability of a PARP protein to localize to the nucleus or the mitotic spindle, the ability to promote cell proliferation, and the ability to promote progression through cytokinesis.
- a substrate e.g., a protein, DNA molecule, RNA molecule, lipid, or small molecule
- Specific PARP inhibitors include antibody or antibody fragments that specifically bind one or more PARP proteins (described herein), one or more RNA aptamers (e.g., RNAi molecules; e.g., SEQ ID NOS: 40 and 43-136), and one or more small molecules.
- Specific PARP inhibitors may decrease the expression and/or one or more biological activities (e.g., 1.
- a specific PARP or a specific subset of PARPs e.g., one or more (e.g., 1 , 2, 3, 4, or 5) of PARP5A, PARPl 2, PARPl 3.1 , PARPl 3.2, and PARPl 5; PARPI l; and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARPl 6).
- Poly-ADP-ribose polymerase 1 1 activator is meant an agent that increases the expression (e.g., mRNA or protein level) and/or one or more (e.g., 1 , 2, 3, 4, or 5) biological activities of PARPl 1.
- a PARPl 1 activator may increase the level of one or more (e.g., 1 , 2, 3, 4, or 5) nucleic acids containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), and/or increase the level of one or more (e.g., 1 , 2, 3, 4, or 5) polypeptides encoded by these nucleic acids.
- one or more e.g., 1 , 2, 3, 4, or 5
- a PARPl 1 activator may increase one or more (e.g., 1 , 2, 3, 4, or 5) biological activities of a PARPl 1 protein including, but not limited to, the ability to attach a poly-ADP-ribose molecule to a substrate (e.g., a protein, DNA molecule, RNA molecule, lipid, or small molecule), the ability to prevent or reduce the rate of formation of a stress granule, the ability to prevent the nucleation of a stress granule, the ability to disassemble a stress granule, the ability to decrease stress granule assembly, the ability to localize to a stress granule, or the ability of PARPl 1 protein to bind to one or more of its substrates.
- a substrate e.g., a protein, DNA molecule, RNA molecule, lipid, or small molecule
- Specific PARPl 1 activators include nucleic acids encoding PARPl 1 or the catalytic domain of PARPl 1.
- a PARP activator may be a nucleic acid containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17).
- Specific PARPl 1 activators may increase the expression and/or one or more biological activities of a PARPl 1 , while having little or no effect on the expression and/or one or more biological activities of other PARP proteins.
- PARPl 1 inhibitor an agent that decreases the expression (e.g., mRNA or protein level) and/or one or more (e.g., 1 , 2, 3, 4, or 5) biological activities of PARPI l.
- a PARPI l inhibitor may decrease the level of one or more (e.g., 1, 2, 3, 4, or 5) nucleic acids containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), or decrease the level of one or more (e.g., 1, 2, 3, 4, or 5) polypeptides encoded by these nucleic acids.
- one or more e.g., 1, 2, 3, 4, or 5
- nucleic acids containing a sequence having at least 80% sequence identity e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%
- a PARPl 1 inhibitor may decrease one or more (e.g., 1 , 2, 3, 4, or 5) biological activities of a PARPl 1 protein including, but not limited to, the ability to attach a poly-ADP-ribose molecule to a substrate (e.g., a protein, DNA molecule, RNA molecule, lipid, or small molecule), the ability to prevent or reduce the rate of formation of a stress granule, the ability to prevent the nucleation of a stress granule, the ability to disassemble a stress granule, the ability to decrease stress granule assembly, the ability to localize to a stress granule, or the ability of PARPl 1 protein to bind to one or more of its substrates.
- a substrate e.g., a protein, DNA molecule, RNA molecule, lipid, or small molecule
- Specific PARPl 1 inhibitors include antibody or antibody fragments that specifically bind to PARPl 1 protein, one or more RNA aptamers (e.g., RNAi molecules; e.g., SEQ ID NOS: 91 -98), and one or more small molecules.
- RNA aptamers e.g., RNAi molecules; e.g., SEQ ID NOS: 91 -98
- Specific PARPl 1 inhibitors decrease the expression and/or one or more (e.g., 1, 2, 3, 4, or 5) biological activities of PARPl 1 , while having little or no effect on the expression and/or activity of other PARP proteins.
- PARP biological activity is meant one or more (e.g., 1, 2, 3, 4, or 5) of the ability of a PARP protein or PARP fusion protein to catalyze the attachment of a single ADP-ribose to a target substrate (e.g., a protein, DNA, RNA, lipid, or small molecule), the ability to attach one or more ADP-ribose molecules to a ADP-ribose molecule already attached to a substrate, the ability to add a branched ADP-ribose molecule to a preexisting poly-ADP-ribose, the ability to localize to the cell nucleus, the ability to localize to stress granules, the ability to catalyze the formation or nucleate stress granules, the ability to catalyze the disassembly of stress granules, the ability to promote cell division or progression through mitosis, or the ability to activate or inhibit RNAi activity in the cell.
- a target substrate
- PARP proteins have a different subset of biological activities.
- PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16 have the ability to localize to the nucleus and play a role in mitosis and cell division.
- PARP 5A, PARP12, PARP13.1, PARP13.2, and PARP-15 have the ability to localize to stress granules and play a role in the formation or nucleation of stress granules.
- PARPI 1 has the ability to localize to stress granules and plays a role in inhibiting stress granule formation or increasing the disassembly of stress granules.
- PARPl 3 inhibits the activity of RNAi in the cell.
- An additional PARP activity is "auto-modification” or “auto- modulation,” that is, attachment of one or more ADP-ribose molecules to itself.
- auto-modulation of a PARP protein may result in an increase or decrease in any of the above-listed PARP activities.
- Assays for the measurement of the activity of each specific PARP are described herein.
- polypeptide tag is meant a protein sequence that is located at the 5' and/or 3' end of a polypeptide sequence of an expressed protein (e.g., one or more PARP proteins as described herein).
- a polypeptide tag may include one or more of a protease recognition sequence (e.g., 1 , 2, 3, 4, 5, or 6 of the same or different protease recognition sequences), a epitope tag (e.g., 1 , 2, 3, 4, or 5 epitope tags), a peptide that has a high affinity binding partner (e.g., biotin and streptavidin), or one or more (e.g., 1, 2, 3, or 4) tag(s) which aids in protein purification (e.g., a His 6 tag).
- a protease recognition sequence e.g., 1 , 2, 3, 4, 5, or 6 of the same or different protease recognition sequences
- a epitope tag e.g., 1 , 2, 3, 4, or 5 epitope
- the polypeptide tag may later be cleaved from the purified fusion protein by incubation with one or more (e.g., 1, 2, 3, or 4) protease(s) which cleaves the fusion protein at one or more protease recognition sequence(s) (e.g., 1 , 2, 3, 4, 5, 6, or 7) within the sequence of the polypeptide tag.
- protease recognition sequence(s) e.g., 1 , 2, 3, 4, 5, 6, or 7
- positioned 3' is meant a second nucleic acid sequence that is located after the 3' terminus of a first nucleic acid sequence (the second nucleotide sequence starts at the nucleotide following the 3' terminus of the first sequence) or the second nucleic acid sequence begins at a nucleotide that follows the 3' terminus of the first nucleic acid (e.g., the second nucleotide sequence starts at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, or 400 nucleotides following the 3' terminus of the first nucleic acid).
- positioned 5' is meant a second nucleic acid sequence that is located before the 5' terminus of a first nucleic acid sequence (the second nucleotide sequence ends at the nucleotide preceding the 5' terminus of the first sequence) or the second nucleic acid sequence ends at a nucleotide that precedes the 5' lerminus of the first nucleic acid (e.g., the second nucleotide sequence ends at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, or 400 nucleotides before the 5' terminus of the first nucleic acid).
- propensity to develop disease is meant the calculated probability of a subject (e.g., a human) to develop a disease (e.g., a stress granule-related disorder or cancer).
- the probability of developing a disease may be calculated based on a number of factors including a variety of health indicators (e.g., blood pressure, cholesterol, and levels of pro-inflammatory cytokines), biological factors (e.g., weight, age, and sex), and genetic susceptibility to disease (e.g., expression of a heritable mutation in a gene, expression of a polymorphic sequence associated with a disease, and expression of an allele associated with a disease).
- the propensity to develop disease in a specific patient population may be compared to a different patient population (e.g., a patient population not receiving a therapy).
- protease recognition sequence is meant a short peptide sequence that is recognized as a substrate and cleaved by one or more (e.g., 1, 2, 3, 4, or 5) proteases.
- Protease target sequences are often 3-20 amino acids in length and often require certain amino acids to be located at specific positions within the target sequence, while any amino acid may be placed at other positions within the target sequence.
- the protease recognition sequence for TEV protease is Glu-X-X-Tyr-X-Gln-Ser (SEQ ID NO: 26), where X represents a position that may be filled by any amino acid.
- protease recognition sequences include, without limitation, factor Xa (Ile-Glu/Asp-Gly-Arg), Ala-64 subtilisin (Gly-Ala-His-Arg), clostripain (Arg and Lys-Arg), collagenase (Pro-Val-Gly-Pro), enterokinase (Asp-Asp- Asp- ⁇ sp-Lys), renin (Pro-Phe-His-Leu-Leu), and ⁇ -thrombin (Leu-Val-Pro-Arg-Gly- Ser).
- factor Xa Ile-Glu/Asp-Gly-Arg
- Ala-64 subtilisin Ga-His-Arg
- clostripain Arg and Lys-Arg
- collagenase Pro-Val-Gly-Pro
- enterokinase Asp-Asp- Asp- ⁇ sp-Lys
- renin Pro-Phe-His-Leu-Leu
- protease recognition sequence(s) may be included in the polypeptide tag of any of the PARP, PARG, or ARH3 fusion proteins described herein.
- a protease recognition sequence may be placed 5' or 3' to an amino acid sequence to be removed from the protein.
- the polypeptide sequence of the protease recognition sequence may directly abut the sequence encoding a PARP or may be separated from the remaining coding sequence by one or more amino acids (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, or 50 amino acids).
- An amino acid sequence that may be removed from the protein may include one or more antigenic sequence(s), a His 6 -tag, a fluorescent protein, a peptide sequence that has high affinity to a second protein that was used to purify the protein (e.g., His 6 tag or hemagglutinin tag), or a peptide sequence that was used to stabilize the protein during purification (e.g., albumin).
- antigenic sequence(s) e.g., a His 6 -tag, a fluorescent protein, a peptide sequence that has high affinity to a second protein that was used to purify the protein (e.g., His 6 tag or hemagglutinin tag), or a peptide sequence that was used to stabilize the protein during purification (e.g., albumin).
- purified is meant purified from other common components normally present within the cell.
- a purified protein is purified away from the other cellular proteins, nucleic acids, and small metabolites present within the cell.
- a purified protein is at least 85% pure by weight (e.g., at least 90%, 95%, 96%, 97%, 98%, 99%, or even 100% pure) from other proteins, nucleic acids, or small metabolites present in the cell.
- ⁇ purified nucleic acid is at least 85% free of other contaminating nucleic acid molecules or adjoining sequences found in the cell.
- rate of proliferation is meant the rate of a cell or a cell population to undergo successive cell divisions.
- the rate of cell proliferation of a cell or cell population may be measured by methods known in the art including cell counting (e.g., by microscopic techniques) and the incorporation of labeled nucleotides into newly synthesized DNA (e.g., incorporation of 3 H-thymidine).
- the rate of proliferation of a cell or cell population treated with one or more agent(s) may be compared to a control cell or cell population not treated with the agent.
- reduce the likelihood of developing is meant a reduction (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) for an individual or a patient population in the chance or rate of developing a specific disease by administering one or more therapeutic agent(s) compared to an individual or patient population not receiving the therapeutic agent.
- the methods of the invention may also reduce the likelihood of developing one or more (e.g., 1 , 2, 3, 4, or 5) symptoms of a stress granule-related disorder or reduce the likelihood of developing one or more (e.g., 1 , 2, 3, 4, or 5) symptoms of cancer in a patient population or an individual receiving one or more therapeutic agent(s).
- RNAi is meant a short double-stranded RNA molecule that mediates the down-regulation of a target mRNA in a cell.
- An RNAi molecule is typically 15 to 32 nucleotides in length.
- RNAi molecules are also known as siRNAs, small RNAs, or microRNAs. The design and therapeutic effectiveness of RNAi molecules is described in McCaffrey et al. (Nature 418:38-39, 2002).
- the RNAi molecules are at least 15 nucleotides, preferably, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, or 35 nucleotides in length and even up to 50 or 100 nucleotides in length (inclusive of all integers in between).
- Non-limiting examples of RNAi molecules are at least 80% identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identical) to or complementary to the translational start sequence or the nucleic acid sequence encoding the first 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acids of a PARP, PARG, or ARH3 selected from a nucleic acid sequence containing a sequence at least 80% identical to one of PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 11), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (
- RNAi molecule may target any part of the sequence encoding the target protein (e.g., any part of an mRNA encoding one of the above listed PARP, PARG, or ARH3 proteins).
- target protein e.g., any part of an mRNA encoding one of the above listed PARP, PARG, or ARH3 proteins.
- the specific requirements and modifications of small RNA are known in the art and are described, for example in PCT Publication No. WO01/75164, and U.S.
- siRNAs can also be synthesized or generated by processing longer double-stranded RNAs, for example, in the presence of the enzyme dicer under conditions in which the dsRNA is processed to RNA molecules of about 17 to about 26 nucleotides.
- siRNAs can also be generated by expression of the corresponding DNA fragment (e.g., a hairpin DNA construct).
- the siRNA has a characteristic 2- to 3- nucleotide 3' overhanging ends, preferably these are (2'-deoxy) thymidine or uracil.
- the siRNAs typically comprise a 3' hydroxyl group. Single-stranded siRNAs or blunt-ended dsRNA may also be used.
- the 3' overhangs may be stabilized against degradation.
- the RNA may be stabilized by including purine nucleotides, such as adenosine or guanosine.
- substitution of pyrimidine nucleotides by modified analogs, e.g., substitution of uridine 2-nucleotide overhangs by (2'-deoxy)thymidine is tolerated and does not affect the efficiency of RNAi.
- the absence of a 2' hydroxyl group significantly enhances the nuclease resistance of the overhang in tissue culture medium.
- siRNA molecules can also be obtained through a variety of protocols including chemical synthesis or recombinant production using a Drosophila in vitro system. They can be commercially obtained from companies such as Dharmacon Research Inc. or Xeragon Inc., or they can be synthesized using commercially available kits such as the SilencerTM siRNA Construction Kit from Ambion (catalog number 1620) or HiScribeTM RNAi Transcription Kit from New England BioLabs (catalog number E2000S).
- siRNA can be prepared using standard procedures for in vitro transcription of RNA and dsRNA annealing procedures such as those described in Elbashir et al. (Genes & Dev., 15:188-200, 2001), Girard et al. (Nature 442:199-202, 2006), Aravin et al. (Nature 442:203-207, 2006), Grivna et al. (Genes Dev. 20:1709- 1714, 2006), and Lau et al. (Science 313:305-306, 2006).
- siRNAs may also be obtained by incubation of dsRNA that corresponds to a sequence of the target gene in a cell-free Drosophila lysate from syncytial blastoderm Drosophila embryos under conditions in which the dsRNA is processed to generate siRNAs of about 21 to about 23 nucleotides, which are then isolated using techniques known to those of skill in the art. For example, gel electrophoresis can be used to separate the 21 -23 nt RNAs and the RNAs can then be eluted from the gel slices. In addition, chromatography (e.g., size exclusion chromatography), glycerol gradient centrifugation, and affinity purification with antibody can be used to isolate the small RNAs.
- gel electrophoresis can be used to separate the 21 -23 nt RNAs and the RNAs can then be eluted from the gel slices.
- chromatography e.g., size exclusion chromatography
- shRNAs Short hairpin RNAs
- shRNAs Short hairpin RNAs
- Yu et al. Proc. Natl. Acad. Sci. U.S.A. 99:6047-6052, 2002
- Paddison et al. Genes & Dev. 16:948-958, 2002
- shRNAs are designed such that both the sense and antisense strands are included within a single RNA molecule and connected by a loop of nucleotides (3 or more).
- shRNAs can be synthesized and purified using standard in vitro T7 transcription synthesis as described above and in Yu et al. (supra).
- shRNAs can also be subcloned into an expression vector that has the mouse U6 promoter sequences which can then be transfected into cells and used for in vivo expression of the shRNA.
- a variety of methods and reagents are available for transfection, or introduction, of dsRNA into mammalian cells including but not limited to: TransIT-TKOTM (Minis, Cat. # MlR 2150), Trans messengergerTM (Qiagen, Cat. # 301525), OligofectamineTM and LipofectamineTM (Invitrogen, Cat. # MlR 12252-01 1 and Cat. #13778-075), siPORTTM (Ambion, Cat. #1631), and DharmaFECTTM (Fisher Scientific, Cat. # T-2001-01).
- RNA molecules are also commercially available for electroporation-based methods for transfection of siRNA, such as siPORTerTM (Ambion Inc. Cat. # 1629). Microinjection techniques can also be used.
- the small RNA can also be transcribed from an expression construct introduced into the cells, where the expression construct includes a coding sequence for transcribing the small RNA operably-linked to one or more transcriptional regulatory sequences.
- plasmids, vectors, or viral vectors can also be used for the delivery of dsRNA or siRNA and such vectors are known in the art. Protocols for each transfection reagent are available from the manufacturer. Additional methods are known in the art and are described, for example in U.S. Patent Application Publication No. 20060058255.
- specifically binds is meant a protein, nucleic acid (e.g., DNA or
- RNA or molecule that binds one or more target molecules (e.g., polypeptides, DNA molecules, or RNA molecules) present in a cell, while not binding the majority of other proteins, DNA molecules, RNA molecules, or small molecules present within a cell, cell lysate, extracellular medium, or biological sample.
- target molecules e.g., polypeptides, DNA molecules, or RNA molecules
- an antibody provided by the invention may bind to a single PARP, PARG, or ARH protein, a PARP, PARG, or
- ARH3 fusion protein may bind more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, or 20 or more) PARP, PARG, or ARH3 proteins and/or PARP, PARG, or ARH3 fusion proteins in a cell, cell lysate, extracellular medium, or biological sample.
- substrate or “solid surface” is meant a surface on which a moiety or protein is covalently attached which allows for the binding and/or purification of a PARP, PARG, and/or ARH3 fusion protein.
- the PARP, PARG, and/or ARH3 fusion protein will bind to the substrate or solid surface through its polypeptide tag.
- Moieties or peptides covalently attached to the substrate or solid surface include, but are not limited to, monoclonal or polyclonal antibodies specific for an antigenic peptide in the polypeptide tag (e.g., anti- GFP antibody binding to GFP in the polypeptide tag), specific metal complexes bound by a peptide located in the polypeptide tag (e.g., Ni + binding to a His ⁇ polypeptide tag), or a specific binding protein for a peptide located in the polypeptide tag (e.g., IgG binding to a ZZ-domain in the polypeptide tag).
- monoclonal or polyclonal antibodies specific for an antigenic peptide in the polypeptide tag e.g., anti- GFP antibody binding to GFP in the polypeptide tag
- specific metal complexes bound by a peptide located in the polypeptide tag e.g., Ni + binding to a His ⁇ polypeptide tag
- a substrate or solid surface examples include, but are not limited to, a bead (e.g., a magnetic bead), a surface in a multi-well plate, and beads in column (e.g., column chromatography).
- a substrate or solid surface examples include, but are not limited to, a bead (e.g., a magnetic bead), a surface in a multi-well plate, and beads in column (e.g., column chromatography).
- One or more PARP, PARG, and/or ARH3 protein(s) and/or PARP, PARG, and/or ARH3 fusion protein(s) may be bound to a substrate or solid surface and eluted from the substrate or solid surface by contacting the substrate or solid surface with an elution buffer (e.g., a high salt elution buffer), a ligand that competes for binding to the substrate or solid surface, or competes for binding to the polypeptide tag (e.g., a non-bound antibody
- stress granule-related disorder any disorder that is characterized or in part caused by the activity or formation of stress granules in a specific type of cell or cell population.
- cardiovascular disorders e.g., an aneurysm, angina, atherosclerosis, stroke, cerebrovascular disease, congestive heart failure, coronary artery disease, myocardial disease, peripheral vascular disease, granulomatous myocarditis, chronic myocarditis, myocardial infarction, and primary hypertrophic cardiomyopathy
- inflammatory disorders e.g., autoimmune diseases, asthma, allergic intraocular inflammatory diseases, arthritis, atopic dermatitis, atopic eczema, cirrhosis, Crohn's disease, ulcerative colitis, diabetes, hemolytic anemia, inflammatory dermatosis, an inflammatory bowel disorder, systemic lupus eryth matosus, psoriasis,
- a stress granule-related disorder is typically characterized by a disease etiology that involves oxidative stress or the production of oxygen-based radicals in a tissue over the progression of the disease. Methods for the diagnosis of several stress granule-related disorders are known in the art. By the term “symptoms of a stress-granule related disorder” is meant one or more
- Non-limiting examples of symptoms of a stress-granule related disorder include pain, swelling, inflammation, loss of cognition, loss of vision, loss of coordination, difficulty breathing, airway constriction, artery occlusion, diarrhea, elevated blood glucose, increased levels of pro-inflammatory cytokines, increased protein aggregates or deposits, and increased cell death (e.g., apoptosis or necrosis).
- symptoms of cancer is meant one or more (e.g., 1 , 2, 3, 4, or 5) of the physical manifestations of cancer.
- symptoms of cancer include blood in urine, pain or burning upon urination, cloudy urine, pain in bone, fractures in bones, fatigue, weight loss, repeated infections, nausea, vomiting, constipation, numbness in the legs, bruising, dizziness, drowsiness, abnormal eye movements, changes in vision, changes in speech, headaches, thickening of a tissue, rectal bleeding, abdominal cramps, loss of appetite, fever, enlarged lymphnodes, persistent cough, blood in sputum, lung congestion, itchy skin, lumps in skin, abdominal swelling, vaginal bleeding, jaundice, heartburn, indigestion, cell proliferation, and loss of regulation of controlled cell death.
- target protein or "substrate protein” is meant a protein that is bound by one or more (e.g., 1, 2, 3, 4, or 5) PARP protein(s), PARG protein(s), ARH3 protein(s), PARP fusion protein(s), PARG fusion protein(s), and/or ARH3 fusion protein(s); covalently modified by attachment of a ADP-ribose molecule by the activity of one or more (e.g., 1, 2, 3, 4, or 5) PARP protein(s) or PARP fusion protein(s); or contains a poly-ADP-ribosyl group that is hydrolyzed by the activity of one or more (e.g., 1, 2, 3, 4, or 5) PARG proteins, PARG fusion proteins, ARH3 proteins, or ARH3 fusion proteins.
- a target or substrate protein may be co-localized in the nucleus or in a stress granule, and/or may localize to the mitotic spindle during cytokinesis.
- a target protein or substrate protein may localize to different structures or organelles within a cell during different stages of the cell cycle (e.g., interphase, S-phase, prophase, metaphase, telephase, and anaphase) and may have an activity in the formation, nucleation, or disassembly of stress granules, an activity in cell proliferation or progression through cytokinesis, or an activity in the regulation of miRJSfA or RNAi activity.
- a target or substrate protein may be a PARP, PARG, or ARH3 protein (described herein).
- transgenic cell is a meant a cell expressing one or more nucleic acids introduced by recombinant DNA technology.
- a transgenic cell may express a nucleic acid encoding one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, or 18) of the presently described PARP, PARG, and/or ARH3 proteins and/or one or more of the PARP, PARG, and/or ARH3 fusion proteins.
- a transgenic cell may be a mammalian cell (e.g., a mouse, rat, monkey, or human cell), a bacterial cell, a fungal cell, a yeast cell, or a plant cell.
- the transgenic cell may express the introduced nucleic acids from an inducible promoter or a constitutive promoter.
- the transgenic cell may also be located within a transgenic animal or may be cultured in tissue culture.
- the introduced one or more nucleic acid(s) may be integrated in the chromosome of a cell or may be expressed from a plasmid.
- ZZ-domain is meant a polypeptide sequence encoded by a nucleic acid having at least 80% identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to the Staphylcoccus aureus protein A domain encoded by SCQ ID NO: 27.
- the ZZ domain has the ability to bind to Fc ⁇ (the constant region of IgG involved in effector functions) and Fab (the Ig fragment responsible for antigen recognition).
- Fc ⁇ the constant region of IgG involved in effector functions
- Fab the Ig fragment responsible for antigen recognition
- Figure 1 is a picture of the chemical structure of nicotinamide adenine dinucleotide (NAD + ) and poly-ADP ribose.
- Figure 2 is a set of micrographs showing the mitotic localization of poly-ADP ribose in HeLa cells during G2-M, prophase, prometaphase (P-M), metaphasc, anaphase, and cytokinesis stages of the cell cycle using fluorescence microscopy following staining with rabbit anti-PAR antibodies labeled with Alexa 488 and X-rhodamine NHS esters.
- FIG. 3 is a set of schematic diagrams showing the domain organization of PARPl, PARP2, PARP3, PARP4, tankyrase 1 (PARP5A), tankyrase 2 (PARP5B),
- PARP7 TiPARP (PARP7), PARP12, PARPI 3, PARP9, PARP14, PARP15, PARPlO, PARPl 1, PARP6, PARP8, and PARPl 6.
- Figure 4 is a diagram of the pEGFP-Cl vector (SEQ ID NO: 28) (Invitrogen) showing the CMV promoter, the EGFP sequence, the multiple cloning site (MCS), and the SV40 poly A sequence. Also shown is the polylinker sequence (SEQ ID NO: 29).
- Figure 5 is an immunoblot showing the expression and relative size of the PARP- GFP fusion proteins of PARPl, PARP2, PARP3, PARP4, PARP5A, PARP5B, PARP6, PARP7, PARP8, PARP9, PARPlO, PARPI l, PARP12, PARP13, PARP14, PARP15, and PARP 16 expressed in HeLa Kyoto cells transfected with pEGFP-Cl plasmids containing a nucleic acid encoding each respective PARP-GFP fusion protein.
- the immunoblot was developed using a rabbit anti-GFP polyclonal antibody.
- Figure 6 is a set of micrographs showing the localization of different PARP-GFP fusion proteins in asynchronous HeLa Kyoto cells transfected with a pEGFP-Cl plasmid containing a nucleic acid encoding a PARP-GFP protein.
- the transfected cells were immunostained with rabbit anti-GFP polyclonal antibody and fluorescently-labeled secondary Alexa Fluor 594 or 488 antibody (Invitrogen), and visualized using fluorescence microscopy.
- PARPl -GFP The localization of PARPl -GFP, PARP2-GFP, PARP3-GFP, PARP7-GFP, PARP12-GFP, PARPl 3-GFP, PARP9-GFP, PARP14-GFP, PARP15-GFP, PARP6-GFP, PARP8-GFP, PARPl 6-GFP, PARP4-GFP, PARPl O-GFP, PARPl 1 -GFP, PARP5A-GFP, and PARP5B-GFP fusion proteins is shown.
- Figure 7 is two sets of micrographs showing the localization of different PARP- GFP fusion proteins in asynchronous hTERT-RPE and HeLa Kyoto cells transfected with a pEGFP-Cl plasmid containing a nucleic acid encoding a PARP-GFP protein.
- the transfected cells were immunostained with rabbit anti-GFP polyclonal antibody and fluorescently-labeled Alexa Fluor 594 or 488 antibodies (Invitrogen), and visualized using fluorescence microscopy.
- PARPl-GFP The localization of PARPl-GFP, PARP2-GFP, PARP3- GFP, PARP4-GFP, PARP5A-GFP, PARP5B-GFP, PARP6-GFP, PARP7-GFP, PARP8- GFP, PARP9-GFP, PARPlO-GFP, PARPl 1 -GFP, PARP12-GFP, PARP13-GFP, PARP14-GFP, PARP15-GFP, and PARP16-GFP fusion proteins is shown for each cell type.
- Figure 8 is a set of micrographs from asynchronous HcLa Kyoto cells transfected with a pEGFP-Cl plasmid containing a nucleic acid encoding a PARP-GFP protein following immunostaining with primary rabbit antibodies raised against each specific PARP and fluorescently-labeled Alexa Fluor 594 or 488 antibodies (Invitrogen).
- the localization of PARPl , PARP2, PARP3, PARP4, PARP5A, PARP5B, PARP6, PARP7, PARP8, PARP9, PARPl O, PARPl 1 , PARP 12, PARPl 3.1, PARPl 3.2, PARPl 4, PARPl 5, and PARP16 is shown.
- Figure 9 is a set of micrographs showing the localization of each PARP-GFP fusion protein during S-phase and mitosis in transfected HeLa Kyoto cells.
- HeLa Kyoto cells were transfected using Lipofectamine 2000 with a specific PARP-GFP expression vector (pEGFP-Cl) and were arrested in mitosis or S-phase by treatment with 100 nM nocodazole or 5 ⁇ g/mL aphidicolin for 12 hours.
- the resulting treated cells were immunostained with rabbit anti-GFP polyclonal antibodies and fluorescently-labeled Alexa Fluor 594 or 488 antibodies (Invitrogen), and visualized using fluorescence microscopy.
- S-phase-arrested cells were also stained with EdU and DAPI, and mitosis-arrested cells were further stained with tubulin and DAPI.
- Figure 10 is a set of micrographs showing the localization of overexpressed PARP16-GFP in the endoplasmic reticulum of HeLa Kyoto cells transfected with a pEGFP-Cl plasmid encoding a PARPl 6-GFP fusion protein (middle panel) and the phenotype of HeLa Kyoto cells transfected with an RNAi targeting endogenous PARPl 6 (right panel).
- the left panel shows untransfected HeLa Kyoto cells stained with anti- calnexin antibodies, secondary fluorescently-labeled antibodies (Alexa Fluor 594 or 488 antibodies (Invitrogen)), and DAPI.
- the middle panel the localization of PARPl 6-GFP and calnexin in HeLa Kyoto cells transfected with a pEGFP-Cl plasmid expressing a PARPl 6-GFP fusion protein following staining with anti-calnexin, anti-GFP, Alexa Fluor 594 or 488 antibodies (Invitrogen), and DAPI.
- the right panel shows the phenotype of HeLa Kyoto cells following transfection with an RNAi molecule targeting endogenous PARP16 (SEQ ID NO: 43) following staining with an anti-tubulin antibody, Alexa Fluor 594 or 488 antibody (Invitrogen), and DAPI.
- Figure 11 is a set of micrographs showing the co-localization of PARP7-GFP and coilin, and the co-localization of PARPl 6-GFP and calnexin.
- HeLa Kyoto cells transfected with pE ⁇ FP-Cl vectors expressing PARP7-GFP or PARPl 6-GFP were stained with anti-GFP and anti-coilin or anti-calnexin antibodies, and fluorescently labeled secondary antibodies (Alexa Fluor 594 or 488 antibodies).
- the figure also lists a number of protein markers of specific cellular organelles and structures.
- Figure 12 is a diagram of the pcDNA3.1 vector (Invitrogen) showing the CMV promoter and the restriction sites that may be used for cloning.
- Figure 13 is a diagram of an example of an activity assay using one or more of the PARP-GFP fusion proteins of the invention.
- Figure 14 is a diagram of an example of an assay for identifying an activator of one or more PARP-GFP fusion proteins of the invention.
- FIG. 15 is a picture of the Bio-Gel P-6 structure and a picture of a Coomassie Blue-stained SDS-PAGE gel showing the use of Bio-Gel P-6 for the purification of proteins from a crude HeLa Kyoto cell extract.
- the SDS-PAGE gel shows the proteins present in cell extract (Extract), in cell extract following lectin clarification (Lectin Clarification), in the lysate prior to passing over the Bio-Gel P-6 resin (Input), in the pellet following centrifugation of the resin (Pellet), and in the eluate following treatment with poly-ADP-ribose glycohydrolase ARH3 (ARH3 Release).
- Figure 16 is a set of micrographs showing the co-localization of poly-ADP ribose polymers (pADPR) and eIF3, a part of the translation initiation complex and a marker of stress granules, in HeLa Kyoto cells following treatment with 0 or 250 ⁇ M sodium arsenite for 30 minutes and immunostaining with primary antibodies specific for poly- ADP-ribose polymers and eIF3, and Alexa Fluor 594 or 488 secondary antibodies (Invitrogen).
- Figure 17 is a set of micrographs showing the co-localization of PARP-GFP fusion proteins with e!F3 in transfected HeLa Kyoto cells following treatment with 0 or 250 ⁇ M sodium arsenite for 30 minutes.
- HeLa Kyoto cells were transfected with a pEGFP-Cl plasmid expressing PARP5 A-GFP, PARPl 2-GFP, PARPI 3.1 -GFP, PARPl 3.2-GFP, or PARPl 5-GFP fusion protein and treated with 0 or 250 ⁇ M sodium arsenite.
- the cells were fixed and stained with anti-GFP and anti-elF3, and secondary fluorescently-labeled antibodies (Alexa Fluor 594 or 488 antibodies (Invitrogen)) prior to imaging.
- Figure 18 is a set of micrographs showing the co-localization of endogenous PARP5A, PARP12, PARP13/13.1, P ⁇ RP15, or poly-ADP-ribose glycohydrolase (PARG), and eIF3 (a stress granule marker) in HeLa Kyoto cells following treatment with 250 ⁇ M sodium arsenite for 30 minutes.
- PARG poly-ADP-ribose glycohydrolase
- eIF3 a stress granule marker
- Figure 20 is a set of micrographs showing the effect of PARP 13.1 -GFP, PARPl 3.2-GFP, or PARPl 5-GFP overexpression on stress granule formation.
- HeLa Kyoto cells were transfected with a plasmid expressing PARP13.1 - GFP, PARPl 3.2-GFP, or PARP 15-GFP.
- the cells were fixed and stained using rabbit anti-GFP and anti-eIF3 antibodies, and fluorescently-labeled secondary antibodies (Alexa Fluor 594 or 488 antibodies (Invitrogen)). The cells were also co-stained with DAPI.
- Figure 21 is a set of micrographs showing the co-localization of PARPl 1-GFP and eIF3 (a stress granule marker) in HeLa Kyoto cells transfected with a pEGFP-Cl vector expressing PARPl 1-GFP following treatment with 250 ⁇ M sodium arsenite for 30 minutes. Following arsenite treatment, the cells were immediately fixed and stained using rabbit anti-GFP and anti-eIF3 antibodies, and fluorescently-labeled secondary antibodies (Alexa Fluor 594 or 488 antibodies (Invitrogen)). The cells were also stained with DAPI.
- Figure 22 is a set of micrographs showing the effect of PARG99-GFP,
- PARG102-GFP or PARGl 10-GFP overexpression on stress granule formation in HeLa Kyoto cells transfected with a pEGFP-Cl plasmid containing a nucleic acid sequence encoding each PARG-GFP fusion protein, following treatment with 100 ⁇ M sodium arsenite for 30 minutes. Following arsenite treatment, the cells were fixed and stained with rabbit anti-GFP and anti-eIF3 antibodies, and fluorescently-labeled secondary antibodies (Alexa Fluor 594 or 488 antibodies (Invitrogen)). The images shown in the right panels show the same data using a threshold filter.
- Figure 23 is a set of micrographs showing the effect of PARG or ARH3 knockdown on stress granule formation in HeLa Kyoto cells transfected with 30 nM PARG siRNA (CCAGUUGGAUGGACACUAAUU (SEQ ID NO: 34) and UUACGAAGGUACC AUAGAAUU (SEQ ID NO: 35)), ARH3 siRNA (GGACAGAAGCCUUGUACUAUU (SEQ ID NO: 36) and
- CCAUUGCUGGUGCCUACUAUU SEQ ID NO: 37
- a control siRNA All Stars Negative Control siRNA; Qiagen Catalog No. 1027280
- the cells were fixed and stained with an anti-eIF3 antibody and secondary fluorescently-labeled antibodies (Alexa Fluor 594 or 488 antibodies) to visualize stress granule formation.
- the panel on the left shows an immunoblot of cell lysate from HeLa Kyoto cells treated with 30 nM PARG siRNA, ARH3 siRNA, or control siRNA for 48 hours. The immunoblot was developed using an anti-PARG antibody.
- Figure 24 is a graph showing the percentage of HeLa Kyoto cells transfected with 30 nM PARG siRNA (SEQ ID NOS: 34 and 35), ARH3 siRNA (SEQ ID NOS: 36 and 37), or a control siRNA (All Stars Negative Control siRNA; Qiagen Catalog No. 1027280) containing stress granules following treatment with 100 ⁇ M sodium arsenite for 30 minutes, or 30 minutes or 1 hour following sodium arsenite washout. The cells were fixed and stained with a fluorescently-labeled anti-eIF3 antibody to visualize stress granule formation.
- PARG siRNA SEQ ID NOS: 34 and 35
- ARH3 siRNA SEQ ID NOS: 36 and 37
- control siRNA All Stars Negative Control siRNA; Qiagen Catalog No. 1027280
- Figure 25A is a Silver-stained 4-12% SDS-PAGE gel showing the proteins immunoprecipitated with an anti-GFP antibody from lysate from HeLa S3 cells transfected with a pEGFP-Cl plasmid expressing GFP alone, PARP5A-GFP, PARP 12- GFP, PARPl 3-GFP, PARP 13.1 -GFP, or PARP15-GFP following treatment with 0 or 250 ⁇ M sodium arsenite for 30 minutes.
- Figure 25B is picture of an immunoblot of a 4-12% SDS-PAGE gel containing proteins immunoprecipitated with an anti-GFP antibody from lysate from HeLa S3 cells transfected with a pEGFP-Cl plasmid expressing GFP, PARP5A-GFP, PARP12-GFP, PARP13-GFP, PARP13.1 -GFP, or PARP15-GFP following treatment with 0 or 250 ⁇ M sodium arsenite for 30 minutes.
- the immunoblot was developed using a polyclonal anti-poly-ADP-ribose antibody.
- Figure 25C is a picture of several immunoblots of a 4-12% SDS-PAGE gel containing proteins immunoprecipitated with an anti-GFP antibody from lysate from HeLa S3 cells transfected with a pEGFP-Cl plasmid expressing GFP, PARP5 A-GFP, PARP12-GFP, PARP13-GFP, PARP13.1-GFP, or PARP15-GFP following treatment with 0 or 20 nM pateamine A for 30 minutes.
- the immunoblots were developed using one of the following antibodies: anti-Ago2, anti-DDX6, anti-LSMl, anti-PABP, anti- FMRP, anti-eIFl A, anti-eIF2 ⁇ , anti-eIF3 ⁇ , anti-eIF4Al , and anti-eIF4E.
- Figure 26A is picture of an immunoblot of a 4-12% SDS-PAGE gel containing proteins immunoprecipitated with an anti-GFP antibody from lysate from HeLa S3 cells transfected with a pEGFP-Cl plasmid expressing TIAl-GFP, PABP-GFP, G3BP-GFP, or Ago2-GFP following treatment with 0 or 20 nM pateamine A for 30 minutes.
- the immunoblot was developed using a polyclonal anti-poly- ADP-ribose antibody.
- Figure 26B is a picture of an immunoblot of an SDS-PAGE gel containing proteins immunoprecipitated from lysate from untransfected HeLa S3 cells using anti- G3BP and anti-Ago2 antibodies following treatment with 0 or 250 ⁇ M sodium arsenite for 60 minutes.
- the immunoblot was developed using a polyclonal anti-poly-ADP-ribose antibody.
- Figure 26C is a picture of an immunoblot of an SDS-PAGE gel containing proteins immunoprecipitated from lysate from HeLa S3 cells transfected with a pEGFP- Cl plasmid expressing G3BP1-GFP (full-length), G3BP1-A-GFP (domain A), G3BP1- ABC-GFP (domains A 5 B, and C), G3BP1 -BC-GFP (domains B and C), G3BP1 -BCD- GFP (domains B, C, and D), and G3BP1 -D-GFP (domain D) following treatment with 0 or 250 ⁇ M sodium arsenite for 60 minutes.
- the immunoblot was developed using a polyclonal anti-poly-ADP-ribose antibody.
- Figure 26D is a picture of an immunoblot of an SDS-PAGE gel containing proteins immunoprecipitated from lysate from HeLa S3 cells transfected with a pEGFP- Cl plasmid expressing TIAl -GFP (full-length) or TIA1 ⁇ RRM (mutant lacking RRM domain) following treatment with 0 or 250 ⁇ M sodium arsenite for 60 minutes.
- the immunoblot was developed using a polyclonal anti-poly-ADP-ribose antibody.
- Figure 27 (left panel) is a set of micrographs showing the localization of poly- ADP-ribose, and endogenous Ago2 and eIF3 in HeLa cells following treatment with 250 ⁇ M sodium arsenite for 30 minutes. The cells were imaged using fluorescently labeled anti-poly-ADP-ribose, anti-Ago2, and anti-eIF3 antibodies.
- Figure 26 (right panel) is an immunoblot of a 4-12% SDS-PAGE gel containing proteins immunoprecipitated using an anti-Ago2 antibody from untransfected HeLa cells following treatment with 0 or 250 ⁇ M sodium arsenite for 60 minutes. The immunoblot was developed using anti-poly-ADP- ribose antibodies.
- Figure 28 is a picture of an immunoblot of a 4-12% SDS-PAGE gel containing proteins immunoprecipitated with an anti-Ago2 antibody from lysate from untransfected HeLa cells following treatment with 0 or 250 ⁇ M sodium arsenite for 30 minutes.
- the immunoblot was developed using a polyclonal anti-PARP13/13.1 antibody.
- Figure 29 is a picture of a Coomassie Blue-stained 4-12% SDS-PAGE gel containing proteins immunoprecipitated using an anti-GFP antibody from lysate from HeLa S3 cells transfected with a pEGFP-Cl plasmid expressing PARPl 3-GFP following treatment with 0 or 250 ⁇ M sodium arsenite for 30 minutes.
- Figure 30 is a graph showing the relative expression of luciferase in lysates from 293T cells transfected with a modified pGL4.72[hRlucCP]TM vector (Promega); 10 nM of vector-target RNAi (SEQ ID NOS: 38 and 39); and a pEGFP-Cl vector encoding EGFP, G3BP, PAPR5A, PARP 12, PARPl 3, PARPl 3.1, or PARPl 5. Luciferase expression was measured in cell lysates at 48 hours post-transfection. The level of luciferase in treated cells is compared to the level of luciferase produced in cells transfected with the modified pGL4.72[hRlucCP]TM vector alone.
- FIG. 31 is a graph showing the relative expression of luciferase in 293T cells transfected with a modified pGL4.72[hRlucCP]TM vector and 20 nM of negative RNAi control for PARPl 3 siRNA (siNeg; All Stars Negative Control siRNA; Qiagen Catalog No. 1027280) or P ⁇ RP13 siRNA (siPARPB;
- the invention therefore provides methods, compositions, and kits for the treatment of stress granule-related disorders and cancer, and methods for determining the propensity of a subject to develop a stress granule- related disorder or cancer based on these unique activities of specific PARP proteins and PARGs.
- the invention also provides methods for increasing the proliferation rate of a cell or cell population and increasing stress granule formation in a cell or cell population by modulating PARP function, PARG function, or poly-ADP-ribose pathways or homeostasis in a cell or cell population.
- the invention provides screening methods for the identification of candidate agents that may be useful for treating or reducing the likelihood of developing a stress granule-related disorder and/or cancer.
- the present invention provides methods for treating or reducing the likelihood of developing one or more stress-granule related disorders in a subject.
- Stress granule- related disorders share a common etiology and pathology linked to oxidative stress and inflammation.
- Stress granule-related disorders include, without limitation, cardiovascular disorders, inflammatory disorders, neurological disorders, or ischemic-reperfusion injury.
- a subject is administered a therapeutically effective dose of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s), one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARG activator(s), and/or one or more (e.g., 1 , 2, 3, 4, or 5) PARPl 1 activator(s).
- a patient receiving the treatment may be previously diagnosed as having a stress granule-related disorder, or may be diagnosed as having a high probability (i.e., at significant risk) of developing a stress granule-related disorder.
- a person receiving the treatment may be asymptomatic or may be experiencing one or more (e.g., 1, 2, 3, 4, or 5) of the symptoms of a stress granule- related disorder.
- stress granule related disorders include an aneurysm, angina, atherosclerosis, stroke, cerebrovascular disease, congestive heart failure, coronary artery disease, myocardial disease, peripheral vascular disease, granulomatous myocarditis, chronic myocarditis, myocardial infarction, primary hypertrophic cardiomyopathy, autoimmune diseases, asthma, allergic intraocular inflammatory diseases, arthritis, atopic dermatitis, atopic eczema, cirrhosis, Crohn's disease, ulcerative colitis, diabetes, hemolytic anemia, inflammatory dermatosis, an inflammatory bowel disorder, systemic lupus erythematosus, psoriasis, rheumatoid arthritis, Wegener's granulomatosis, Ha
- the methods of the invention may reduce (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) one or more (e.g., 1, 2, 3, 4, or 5) of the symptoms of a stress granule related-disorder or prevent the onset of one or more (e.g., 1, 2, 3, 4, or 5) of the symptoms of a stress-related disorder.
- Symptoms of a stress granule-related disorder include, but are not limited to, pain, swelling, inflammation, loss of cognition, loss of vision, loss of coordination, difficulty breathing, airway constriction, artery occlusion, diarrhea, elevated blood glucose, increased levels of pro-inflammatory cytokines, increase protein aggregates or deposits, and increased cell death (e.g., apoptosis or necrosis).
- the methods of treatment provided herein may be used with one or more (e.g., 1, 2, 3, 4, or 5) other therapies or therapeutic agents used to treat a stress granule-related disorder.
- the effectiveness of treatment may be measured by a physician using methods known in the art.
- a subject may be administered one or more (e.g., 1 , 2, 3, 4, or 5) PAHP inhibitors.
- the one or more PARP inhibitors preferably decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% decrease) the expression (e.g., protein and/or mRNA levels) and/or one or more activities of PAR5A, PARP 12, PARPl 3.1, PARPl 3.2, and PARl 5.
- the decrease in expression of PARP5A, PARP 12, PARP 13.1 , PARPl 3.2, and PARP 15 preferably is a decrease in the expression of one or more nucleic acids containing a sequence having at least 80% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP13.1 (SEQ ID NO: 19), PARPl 3.2 (SEQ ID NO: 20), or PARPl 5 (SEQ ID NO: 22 or 23), or one or more polypeptides encoded by these nucleic acids.
- the PARP inhibitors also preferably inhibit one or more of the activities of a PARP protein (e.g., PARP5A, PARP12, PARP13.1 , PARPl 3.2, or PARPI 5) including poly-ADP-ribosylation of a target protein (e.g., a protein in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, or a PARP protein) or the formation or nucleation of a stress granule.
- a target protein e.g., a protein in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, or a PARP protein
- Methods for measuring the activity of one or more PARP proteins are described herein.
- a subject may also be administered one or more (e.g., 1 , 2, 3, 4, or 5) PARG activators.
- Preferred PARG activators selectively increase the expression and/or biological activity of PARG protein or ARH3.
- PARG activators desirably increase the level of one or more nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or increase the level of one or more polypeptides encoded by these nucleic acids.
- a PARG activator increases the one or more activities of a PARG protein or ARH3, including, but not limited to, hydrolysis of poly-ADP-ribose (e.g., poly-ADP-ribose attached to a substrate protein, e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, or a PARP protein), the prevention of the assembly of a stress granule, or disassembly of a stress granule.
- poly-ADP-ribose e.g., poly-ADP-ribose attached to a substrate protein, e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, or a PARP protein
- a subject may also be administered one or more (e.g., 1, 2, 3, 4, or 5) PARPl 1 activators.
- the one or more PARPl 1 activators selectively increase the level of one or more nucleic acids containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARPl 1 (SEQ ID NO: 17), or increase the level of one or more polypeptides encoded by these nucleic acids.
- Additional desirable PARPl 1 activators increase one or more activities of PARPl 1, including, but not limited to, poly-ADP-ribosylation of a target protein (e.g., a protein localized in a stress granule or a polypeptide involved in the formation, a polypeptide involved in the disassembly of a stress granule, and/or a PARP protein), the prevention of the assembly of a stress granule, or the disassembly of a stress granule.
- a target protein e.g., a protein localized in a stress granule or a polypeptide involved in the formation, a polypeptide involved in the disassembly of a stress granule, and/or a PARP protein
- PARP inhibitors examples include an antibody or antibody fragment that selectively binds one or more of PARP5A, PARP 12, PARP13.1 , PARP13.2, and PARP15; an RNA aptamer (e.g., SEQ ID NOS: 40, 49, 99- 1 13, and 122-129); or a small molecule.
- PARG activators examples include one or more nucleic acids containing a sequence having at least 80% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41).
- PARPl 1 activators examples include one or more nucleic acids containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARPl 1 (SEQ ID NO: 17).
- the one or more PARP inhibitors, one or more PARG activators, and one or more PARPl 1 activators may be administered co-extensively (overlapping bioactive periods) or non-extensively (non-overlapping bioactive periods).
- the one or more PARP inhibitors, one or more PARG activators, and one or more PARPl 1 activators may be administered together in a single dose or may be administered separately in one or more separate doses (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 doses).
- the amount of one or more PARP inhibitors, one or more PARG activators, and one or more PARPl 1 activators that may be administered to a subject per dose may be between 0.1 mg and 1 g, 0.1 mg and 750 mg, 0.1 mg and 600 mg, 0.1 mg and 500 mg, 10 mg and 450 mg, 10 rag and 400 mg, 10 mg and 350 mg, 10 mg and 350 mg, and 10 mg and 250 mg.
- Various combinations of the one or more PARP inhibitors, one or more PARG activators, and one or more PARPl 1 activators are contemplated herein, for example, administration of one or more PARP inhibitors alone, administration of one or more PARG activators alone, administration of one or more PARPl 1 activators alone, administration of one or more PARP inhibitors and one or more PARG activators together, and administration of one or more PARP inhibitors and one or more PARPl 1 activators together.
- the one or more PARP inhibitors, one or more PARG activators, and the one or more PARPl 1 activators may be administered to the subjects once a day, twice a day, three times a day, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, seven times a week, bi-weekly, tri-weekly, or monthly.
- the one or more PARP inhibitors, one or more PARG activators, and the one or more PARPl 1 activators may be administered via the same route of administration or via different routes of administration.
- the one or more PARP inhibitors may be administered orally and the PARG activators may be administered parenterally (e.g., subcutaneously).
- the one or more PARP inhibitors, one or more PARG activators, and/or the one or more PARPl 1 activators may be fo ⁇ nulated for any known route of administration, including oral, intravenous, intraarterial, intraocular, intranasal, intramuscular, and subcutaneous administration.
- the one or more PARP inhibitors, one or more PARG activators, and/or the one or more PARPl 1 activators may also be fo ⁇ nulated for administration in a sustained-release form.
- the therapeutically effective dose of the one or more PARP inhibitors, one or more PARG activators, and/or one or more PARP 11 activators may be determined by a skilled physician using methods known in the art, in addition to the in vitro assays described herein.
- the invention similarly provides methods of decreasing the number of stress granules in a cell or a cell population by contacting the cell or cell population with an effective amount of one or more PARP inhibitors, one or more PARG activators, and one or more PARPl 1 activators (as described for the treatment of subjects above).
- the one or more PARP inhibitors, one or more PARG activators, and the one or more PARPl 1 activators are added to the tissue culture medium to decrease the formation of stress granules in a cell or a cell population.
- the cells are cultured for regenerative cell technology or the cells are primary or germ cells. This method desirably confers on the cells protection against oxidative stress and promotes the longevity and morphology of the cultured cells.
- Preferred cells that may be used in these methods include, without limitation, an epithelial cell, a fibroblast, a kidney cell, a muscle cell, a neuron, a hepatocyte, a sperm, a lymphocyte, or a macrophage.
- concentration of the one or more PARP inhibitors, the one or more PARG activators, and the one or more PARPl 1 activators to be added to the culture medium may be determined by using the methods described herein (e.g., methods for the measurement of stress granule formation).
- the present invention provides methods for treating or reducing the likelihood of developing cancer in a subject. All forms of cancer share a common etiology and pathology of uncontrolled, unregulated, or misregulated cell proliferation or cell division.
- Cancers that may be treated by the methods, compositions, and kits of the invention include, without limitation, colon adenocarcinoma, esophagas adenocarcinoma, liver hepatocellular carcinoma, squamous cell carcinoma, pancreas adenocarcinoma, islet cell tumor, rectum adenocarcinoma, gastrointestinal stromal tumor, stomach adenocarcinoma, adrenal cortical carcinoma, follicular carcinoma, papillary carcinoma, breast cancer, ductal carcinoma, lobular carcinoma, intraductal carcinoma, mucinous carcinoma, phyllodes tumor, Ewing's sarcoma, ovarian adenocarcinoma, endometrium adenocarcinoma, granulose cell tumor, mucinous cystadenocarcinoma, cervix adenocarcinoma, vulva squamous cell carcinoma, basal cell carcinoma, prostate adenocarcinoma, giant
- the methods of the invention may reduce (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) one or more (e.g., 1 , 2, 3, 4, or 5) of the symptoms of a cancer or prevent the onset of one or more (e.g., 1, 2, 3, 4, or 5) of the symptoms of a cancer.
- Symptoms of a cancer include, but are not limited to, blood in urine, pain or burning upon urination, cloudy urine, pain in bone, fractures in bones, fatigue, weight loss, repeated infections, nausea, vomiting, constipation, numbness in the legs, bruising, dizziness, drowsiness, abnormal eye movements, changes in vision, changes in speech, headaches, thickening of a tissue, rectal bleeding, abdominal cramps, loss of appetite, fever, enlarged lymphnodes, persistent cough, blood in sputum, lung congestion, itchy skin, lumps in skin, abdominal swelling, vaginal bleeding, jaundice, heartburn, indigestion, cell proliferation, and loss of regulation of controlled cell death.
- the methods of treatment provided herein may be used with one or more (e.g., 1, 2, 3, 4, or 5) other therapies or therapeutic agents used to treat a cancer (e.g., chemotherapy, radiation, and/or surgery).
- the effectiveness of treatment may be measured by a physician using methods known in the art. Methods for the diagnosis and monitoring of several cancers are known in the art.
- a subject is administered a therapeutically effective dose of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of a PARP inhibitor(s).
- a patient receiving the treatment may be previously diagnosed as having a cancer, or may be diagnosed as having a high probability (i.e., at significant risk) of developing a cancer.
- a person receiving the treatment may be asymptomatic or may be experiencing one or more of the symptoms of a cancer.
- a subject may be administered one or more PARP inhibitors.
- the one or more PARP inhibitors preferably decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% decrease) the expression and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of one or more of PARPl, PARP2, PARP5A, PARP 5B, PARP7, PARP8, PARP14, or PARPl 6.
- the decrease in expression is a decrease in the level of one or more nucleic acids containing a sequence having at least 80% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24), or one or more polypeptides encoded by these nucleic acids.
- PARPl SEQ ID NO: 1 or 2
- PARP2 SEQ ID NO: 3
- PARP5A SEQ ID NO: 8 or 9
- PARP5B SEQ ID NO: 10
- PARP7 SEQ ID NO: 12
- PARP8 SEQ ID NO: 13
- PARP14 SEQ
- the PARP inhibitors also preferably inhibit one or more of the activities of a PARP protein (e.g., PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARPl 4, or PARPl 6) including poly-ADP- ribosylation of a target protein (e.g., a protein localized in the nucleus or mitotic spindle during cytokinesis, a protein required for progression through mitosis, and/or a PARP protein) or is required for progression through mitosis.
- a target protein e.g., a protein localized in the nucleus or mitotic spindle during cytokinesis, a protein required for progression through mitosis, and/or a PARP protein
- PARP inhibitors examples include an antibody or antibody fragment that selectively binds one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16; an RNA aptamer (e.g., SEQ ID NOS: 43-46, 49, 50, 59-74, 1 14-121 , and 130-136; shown in table below); or a small molecule.
- the one or more PARP inhibitors may be administered co-extensively (overlapping bioactive periods) or non-extensively (non-overlapping bioactive periods).
- the one or more PARP inhibitors may be administered together in a single dose or may be administered separately in one or more separate doses (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 doses).
- the amount of one or more PARP inhibitors may be between 0.1 mg and 1 g, 0.1 mg and 750 mg, 0.1 mg and 600 mg, 0.1 mg and 500 mg, 10 mg and 450 mg, 10 mg and 400 mg, 10 mg and 350 mg, 10 mg and 350 mg, and 10 mg and 250 mg.
- Various combinations of the one or more PARP inhibitors are contemplated herein, for example, administration of one or more PARP inhibitors alone or co-administration of one or more PARP inhibitors with another therapeutic for the treatment of cancer or a therapeutic used to alleviate one or more symptoms of a cancer.
- the one or more PARP inhibitors may be administered to the subjects once a day, twice a day, three times a day, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, seven times a week, bi-weekly, tri-weekly, or monthly.
- the one or more PARP inhibitors may be administered via the same route of administration or via different routes of administration.
- the one or more PARP inhibitors may be administered orally and one or more other PARP inhibitors may be administered parenterally (e.g., subcutaneously).
- the one or more PARP inhibitors may be formulated for any known route of administration, including oral, intravenous, intraarterial, intraocular, intranasal, intramuscular, and subcutaneous administration.
- the one or more PARP inhibitors may also be formulated for administration in a sustained- release form.
- the invention similarly provides methods of decreasing the proliferation rate in a cell or a cell population by contacting the cell or cell population with an effective amount of one or more PARP inhibitors (as described for the treatment of subjects above).
- the one or more PARP inhibitors are added to the tissue culture medium to decrease the proliferation rate of a cell or a cell population.
- the cells are cultured for regenerative cell technology, the cells are primary or germ cells, or the cells are being stored for later therapeutic or experimental use. This method desirably confers on the cells protection from oxidative stress, promotes the longevity and morphology of the cultured cells, and/or delays the onset of senescence of the cells.
- Preferred cells that may be used in these methods include, without limitation, an epithelial cell, a fibroblast, a kidney cell, a muscle cell, a neuron, a hepatocyte, a sperm, a lymphocyte, or a macrophage.
- concentration of the one or more PARP inhibitors may be determined using methods known in the art and those methods described herein (e.g., methods for the measurement of cell growth and division).
- compositions for treating or reducing the likelihood of developing one or more stress granule disorders and cancer may include one or more of the PARP inhibitors (e.g., PARP5A, PARP12, PARP13.1, PARP13.2, and PARP15 inhibitors), one or more of the PARG activators (e.g., PARG protein and ARH3 activators), and/or one or more of the PARPl 1 activators as described above.
- the PARP inhibitors e.g., PARP5A, PARP12, PARP13.1, PARP13.2, and PARP15 inhibitors
- the PARG activators e.g., PARG protein and ARH3 activators
- PARPl 1 activators e.g., PARPl 1 activators as described above.
- Compositions for treating or decreasing the likelihood of developing a cancer may include one or more of the PARP inhibitors (e.g., PARP 1, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16 inhibitors) as described above.
- the one or more agents that may be used as pharmaceutical compositions for treating or reducing the likelihood of developing a stress granule-related disorder or cancer may also be identified using the screening assays provided herein.
- compositions for treating or reducing the likelihood of developing a stress granule related disorder include one or more of an antibody or antibody fragment that specifically binds to PARP5A, PARP12, PARP13.1 , PARP13.2, and PARPl 5; an RNAi molecule that decreases the expression of one or more of PARP5A, PARP12, PARP13.1, PARP13.2, and PARP15 (e.g., SEQ ID NOS: 40, 49, 99- 1 13, and 122-129); one or more nucleic acids containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41), and one or more small molecules or metabolites identified in the screening assays provided herein.
- an antibody or antibody fragment that specifically binds to PARP5A, PARP12
- compositions for treating or reducing the likelihood of developing a cancer include one or more of an antibody or antibody fragment that specifically binds to PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARPl 6; an RNAi molecule that decreases the expression of one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARPl 4, and PARPl 6 (e.g., SEQ ID
- compositions provided by the invention may further include one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) secondary agents.
- secondary agents that may be included in the compositions of the invention are one or more chemotherapeutic agent(s), one or more non-steroidal anti-inflammatory drug(s), one or more immunosuppressive agent(s), one or more calcineurin inhibitor(s), or one or more analgesic(s). Examples of these classes of therapeutic agents are known in the art.
- the dose of one or more PARP inhibitors, PARPl 1 activators, and/or PARG activators may be between 0.1 mg and 1 g, 0.1 mg and 750 mg, 0.1 mg and 600 mg, 0.1 mg and 500 mg, 10 mg and 450 mg, 10 mg and 400 mg, 10 mg and 350 mg, 10 mg and 350 mg, and 10 mg and 250 mg.
- the dose of one or more secondary agents that may be included in the compositions of the invention may be between 0.1 mg and 2 g, 0.1 mg and 1.5 mg, 0.1 mg and 1 g, 0.1 mg and 750 mg, 1 mg and 650 mg, 1 mg and 550 mg, 1 mg and 500 mg, 10 mg and 450 mg, 10 mg and 400 mg, 10 mg and 350 mg, 10 mg and 350 mg, and 10 mg and 250 mg.
- compositions may be formulated using any known method including formulation as a pill, an injectible fluid (e.g., in PBS), or in a sustained-release form.
- the compositions may be formulated for any specific route of administration including oral, intramuscular, intraocular, intranasal, subcutaneous, intraarterial, and intravenous administration.
- Kits The invention further provides kits containing one or more (e.g., 1 , 2, 3, 4, 5, 6, 7,
- kits may further contain materials to aid in the administration of the pharmaceutical agents (e.g., a syringe).
- the kits may contain one or more doses of a pharmaceutical agent provided by the invention.
- the kits may further contain instructions for administering the pharmaceutical compositions to a subject having a stress granule-related disorder or cancer, or a subject that has a high probability of developing (a high propensity) for developing a stress granule-related disorder or cancer.
- the invention further provides methods of determining the propensity of a subject to develop a stress granule-related disorder by determining the expression (e.g., protein or mRNA levels) and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, or 8) of PARP5A, PARPl 1 , PARPl 2, PARP13.1, PARP13.2, PARP15, PARG, and ARH3 in a subject, wherein an increase (e.g., at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) in the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1 , 2, 3, 4, or 5) activities of one or more (e.g., 1 , 2, 3, 4, or 5) of PARP5A, PARPl 2, PARPl 3.1 , PARP 13.2, and PARP
- the expression measured may be the level of one or more nucleic acids containing a nucleic acid sequence having at least 80% (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARPl 1 (SEQ ID NO: 17), PARP 13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP15 (SEQ ID NO: 22 or 23), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41), or one or more polypeptides encoded by these nucleic acids.
- PARP5A SEQ ID NO: 8 or 9
- PARP5B SEQ ID NO: 10
- PARPl 1 SEQ ID NO: 17
- PARP 13.1 SEQ ID NO: 19
- PARP13.2 SEQ ID NO: 20
- PARP15 SEQ ID NO: 22 or 23
- the invention further provides methods of determining the propensity of a subject to develop a cancer by determining the expression (e.g., protein and/or mRNA level) and/or one or more activities (e.g., 1, 2, 3, 4, or 5) of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16 in a subject, wherein an increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) in the expression and/or one or more activities of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP 14, and PARP 16 indicates an increased propensity to develop cancer.
- an increase e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%
- the expression measured may be the level of one or more nucleic acids containing a nucleic acid sequence having at least 80% (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) identity to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP 7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ ID NO: 21), and PARP16 (SEQ ID NO: 16), or the level of one or more polypeptides encoded by these nucleic acids.
- PARPl SEQ ID NO: 1 or 2
- PARP2 SEQ ID NO: 3
- PARP5A SEQ ID NO: 8 or 9
- PARP5B SEQ ID NO: 10
- PARP 7 SEQ ID NO: 12
- PARP8 SEQ ID NO: 13
- the level of expression of a nucleic acid may be determined using RT-PCR and the level of a polypeptide encoded by a nucleic acid may be determined by a variety of different antibody-based techniques including, but not limited to, immunoblotting, fluorescence-assisted cell sorting (FACS), and enzyme-linked immunosorbent assay (ELISA).
- FACS fluorescence-assisted cell sorting
- ELISA enzyme-linked immunosorbent assay
- the level of expression in a subject may be compared to a subject known to have a stress granule-related disorder or cancer, or a control subject that does not have a stress granule-related disorder or cancer, or a very low propensity for developing a stress granule-related disorder or cancer.
- the invention provides fusion proteins for each PARP, PARG, and ARH3.
- the fusion proteins may be used to identify unique biological activities for each PARP, PARG, and ARH3 protein and to identify specific inhibitors and activators for each PARP, PARG, or ARH3, or specific subsets of these proteins.
- the invention provides nucleic acid sequences encoding these PARP, PARG, and ARH3 fusion proteins.
- the nucleic acids contain a sequence that is at least 80% identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identical) to the full-length sequence of PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 11), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARPlO (SEQ ID NO: 15), PARP 10.2 (SEQ ID NO: 16), PARPI l (SEQ ID NO: 17), PARP12 (SEQ ID NO: 18), PARP13.1 (SEQ ID NO: 19), PAR
- the nucleic acids of the invention further contain nucleic acid sequences encoding one or two polypeptide tags.
- the nucleic acids encoding a polypeptide tag may be placed at a position 5' or a position 3' to the sequence encoding a PARP, PARG, or ARH3 protein.
- the 3' end of a nucleic acid sequence encoding a polypeptide tag may directly abut (i.e., no intervening nucleotides) the 5' end of a nucleic acid sequence encoding a PARP, PARG, or ARH3 protein.
- nucleic acid sequence encoding a polypeptide tag may directly abut (i.e., no intervening nucleotides) the 3' end of nucleic acid sequence encoding a PARP, PARG, or ARH3 protein.
- one or more nucleotides separate the 5' end of the sequence encoding the polypeptide tag from the 3' end of the sequence encoding a PARP protein, or separate the 3' end of the sequence encoding the polypeptide tag from the 5' end of the sequence encoding the PARP protein.
- Sequences encoding the polypeptide tags are described in further detail below.
- Polypeptide tags may be attached to a native protein sequence in order to aid in the purification of the protein, to label the protein for visualization in the cell, and/or to increase the thermodynamic stability and/or half-life of a protein.
- Nucleic acids encoding a polypeptide tag(s) may include one or more of the following sequences: a sequence encoding an epitope which may be recognized by a specific antibody recognizing the epitope (e.g., 1 , 2, 3, 4 or 5 antigenic peptide sequences); a sequence encoding a protein that is bound with high affinity by a specific binding partner; one or more (e.g., 1 , 2, 3, 4, or 5) sequence(s) encoding a peptide sequence that aids in purification (e.g., a His 6 tag); one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) sequence(s) encoding a protease recognition sequence; and one or more (e.g., 1, 2, 3, or 4) sequences
- the size of the nucleic acid sequence encoding the polypeptide tag may be between 1-50 nucleotides, 1-100 nucleotides, 1-200 nucleotides, 1-300 nucleotides, 1 -400 nucleotides, 1-500 nucleotides, 200-500 nucleotides, 1-1,000 nucleotides, 1-5,000 nucleotides, 1- 8,000 nucleotides, 1-10,000 nucleotides, or 1-20,000 nucleotides.
- polypeptide tags and sequences encoding polypeptide tags are known in the art. Non-limiting examples of sequences that may be incorporated in polypeptide tags are described below.
- the nucleic acids encoding a polypeptide tag may contain sequences for one or more (e.g., 1, 2, 3, 4, or 5) epitopes or antigenic peptide sequences.
- Epitopes incorporated into polypeptide tags may be used to aid in the purification of a fusion protein, for e.g., by use of an antibody that specifically binds to the epitope.
- epitope sequences include, but are not limited to, a FLAG peptide (DYKDDDDK; SEQ ID NO: 30); a glutathione-S- transferase (GST) peptide; a KT3 peptide (KPPTPPPEPET; SEQ ID NO: 31); a hemagglutinin peptide (YPYDVPDYA; SEQ ID NO: 32), a calmodulin-binding peptide ⁇ Methods in Molecular Biology: E. coli Gene Expression Protocols, volume 205, Humana Press, 2003, pp. 79-97), a R-tag peptide (Jones et al., Protein Expr. Purif.
- V5 peptide a V5 peptide, a c-myc peptide, and peptides derived from chitin-binding protein (CBP), CYD, Strep II, HPC, and maltose binding protein (MBP), as described in Lichty et al. ⁇ Protein Expr. Purif. 41 :98-105, 2005).
- CBP chitin-binding protein
- MBP maltose binding protein
- Nucleic acids encoding a polypeptide tag may contain sequences for one or more (e.g., 1 , 2, 3, 4, or 5) proteins with specific binding partners.
- the specific binding partner has a high affinity (e.g., K D ⁇ 150 nM or K D ⁇ 250 nM) to the peptide sequence in the polypeptide tag.
- sequences that encode a protein with a high-affinity binding partner is biotin and the ZZ-domain of S. aureus protein A (e.g., a nucleic acid sequence with at least 80% identity to SEQ ID NO: 27).
- the polypeptide tag may contain one or more peptide sequences that aid in the purification of the protein.
- Non-limiting examples of peptide sequences that aid in the purification of a protein include a His 6 tag, chitin-binding protein (CBP), maltose-binding protein (MBP), and glutathione-S-transferase (GST).
- CBP chitin-binding protein
- MBP maltose-binding protein
- GST glutathione-S-transferase
- a protein containing a polypeptide tag containing a His 6 tag may be purified by passing a crude cellular lysate over a metal matrix (e.g., a Ni + -Sepharose resin).
- a polypeptide tag may also contain a sequence encoding a protein that increases the thermodynamic stability, half-life, and/or solubility of a protein.
- Non-limiting examples of peptides that increase the solubility of a protein include thioredoxin and poly(NANP). Additional non-limiting examples of proteins that increase the thermodynamic stability or half-life of a protein include the Fc domain of an antibody and albumin.
- a polypeptide tag may also contain one or more (e.g., 1, 2, 3, or 4) sequences encoding a protein that allows for the visualization of the fusion protein in the cell (e.g., a polypeptide tag containing a sequence encoding a fluorescent protein, such as green fluorescence protein).
- a polypeptide tag may also contain one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) protease recognition sequences.
- a fusion protein may be treated with one or more (e.g., 1 , 2, 3, or 4) specific proteases that cleave the fusion protein at the one or more specific protease recognition sequences at any step in the purification process (e.g., after being bound to a resin or solid surface) to remove the polypeptide tag(s) from the remainder of the fusion protein.
- one or more e.g., 1 , 2, 3, or 4
- specific proteases that cleave the fusion protein at the one or more specific protease recognition sequences at any step in the purification process (e.g., after being bound to a resin or solid surface) to remove the polypeptide tag(s) from the remainder of the fusion protein.
- Non-limiting examples of protease recognition sequences include TEV protease (Glu-X-X-Tyr-X-Gln-Ser; SEQ ID NO: 26), factor Xa (Ile-Glu/Asp-Gly- Arg), Ala-64 subtilisin (Gly-Ala-His-Arg), clostripain (Arg and Lys-Arg), collagenase (Pro-Val-Gly-Pro), enterokinase (Asp-Asp-Asp-Asp-Lys), renin (Pro-Phe-His-Leu-Leu), and ⁇ -thrombin (Leu-Val-Pro-Arg-Gly-Ser).
- TEV protease Glu-X-X-Tyr-X-Gln-Ser
- factor Xa Ile-Glu/Asp-Gly- Arg
- Ala-64 subtilisin Gly-Ala-His-Arg
- a protease recognition sequence is preferably located at a position 3' to a peptide sequence encoding an epitope, a sequence encoding a protein that is bound with high affinity by a specific binding partner, or a sequence encoding a peptide sequence that aids in purification.
- a protease recognition sequence is preferably located at a position 5' to a peptide sequence encoding an epitope, a sequence encoding a protein that is bound with high affinity by a specific binding partner, and/or a sequence encoding a peptide sequence that aids in purification.
- a polypeptide tag may contain one or more (e.g., 1 , 2, 3, 4, 5, 6, or 7) of the same or different protease recognition sequences in tandem (i.e., without intervening amino acids) or with one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) intervening amino acids between each protease recognition sequence.
- Methods for the treatment of a fusion protein containing a protease recognition sequence in the polypeptide tag with one or more protease(s) are known in the art.
- a number of expression vectors for the expression of a nucleic acid encoding one or more nucleic acids encoding a PARP, PARG, and/or ARH3 fusion protein of the invention are known in the art. Different examples of expression vectors are available for expression of the PARP, PARG, and/or ARH3 fusion proteins in mammalian cells, insect cells, yeast cells, and bacterial cells.
- the pEGFP-Cl mammalian vector contains a CMV promoter sequence, a nucleic acid sequence encoding green fluorescence protein, a multiple cloning site for insertion of nucleic acid sequence encoding a PARP, PARG, or ARH3 nucleic acid (e.g., a sequence with 80% to one of SEQ ID NOS: 1-24, 41 , and 42).
- mammalian expression vectors include constitutive expression vectors Gateway” pDESTTM26, pDESTTM27, pDESTTM40, and pDESTTM47 (Invitrogen); adenoviral expression vectors (e.g., pAd/CM/V5-Dest Gateway” Vector Kit (Invitrogen); episomal expression vectors pCEP4 and pEBNA DEST (Invitrogen); lentiviral expression vectors (e.g., ViraPowerTM Bsd; Invitrogen); and regulated expression vectors Gateway ® pT- RexTM-DEST 30 and pT-RexTM-DEST 31 (Invitrogen).
- adenoviral expression vectors e.g., pAd/CM/V5-Dest Gateway” Vector Kit
- episomal expression vectors pCEP4 and pEBNA DEST Invitrogen
- lentiviral expression vectors e.g., ViraPowerTM Bsd;
- Non-limiting examples of bacterial expression vectors include Gateway ® pDESTTM14; Gateway ® pDESTTM15; Gateway ® pDESTTM17; Gateway ® pDESTTM24; Gateway ® pET-DEST42; pEM7/Bsd; pEM7/Zeo; pRSET A, B, & C; pRSET-BFP; pRSET-CFP; pRSET-EmGFP; pTrcHIs A, B, & C; and pTrcHIs2 A, B, & C vectors (Invitrogen).
- yeast expression vectors include pAO815; pGAPZ A, B, & C; pPIC3.5K; pPIC9K; pTEFl/Bsd; pTEFl/Zeo; pYC2/CT; pYES2; pYES2/CT; and pYES3/CT (Invitrogen).
- Non-limiting examples of insect and baculovirus expression vectors include Gateway" pDESTTM10; Gateway ® pDEST I M 20; Gateway ® pDESTTM8; Gateway ® pMT-DESTTM48; pAC5.1/V5- His A, B, & C; pFastBac Dual; and pIB/V5-His-DEST (Invitrogen).
- the expression vectors used to express a fusion protein may include one or more (e.g., 1 , 2, 3, 4, or 5) constitutive promoter sequences and/or one or more (e.g., 1 , 2, 3, 4, or 5) inducible promoter sequences.
- constitutive promoter sequences include bacterial promoters (e.g., E. coli a 70 , ⁇ s , ⁇ 32 , or ⁇ 54 promoters; B.
- subtilis ⁇ ⁇ or ⁇ B promoters subtilis ⁇ ⁇ or ⁇ B promoters; T7 RNA polymerase-based promoters; and a bacteriophage SP6 promoter
- yeast promoters e.g., pCyc, pAdh, pSte5, ADHl , cycl 00, cyc70, cyc43, cyc28, eye 16, pPGKl, pCYC, GPD (TDH3), and CLB l promoters
- mammalian promoters e.g., cytomegalovirus immediate early gene-based promoters, SV40 early promoter, and Rous sarcoma virus promoter.
- Non-limiting examples of inducible promoter sequences include alcohol dehydrogenase I gene promoters, tctracycline- responsive promoter systems, glucocorticoid receptor promoters, estrogen receptor promoter, ecdysone receptor promoters, metallothionein-based promoters, and T7- polymerase based promoters.
- a nucleic acid sequence e.g., a P ⁇ RP fusion protein
- pTet-On-Advanced Clontech
- pERV3 Stratagene
- pNEBR-Rl New England BioLabs
- pCMV5-CymR Qbiogene
- the above-described methods for the generation of PARP, PARG, or ARH3 fusion proteins may be modified to generate PARP, PARG, or ARH3 proteins.
- the expression vectors that contain a nucleic acid sequence encoding a PARP, PARG, or ARH3 fusion protein may be modified to remove the nucleic acid sequences encoding the polypeptide tag.
- the modified vector may then be introduced into a cell to generate a transgenic cell for the expression of the full-length or wild-type PARP, PARG, or ARH3 protein.
- the produced PARP, PARG, or ARH3 protein may contain one or more post-translational modifications, including phosphorylation and poly-ADP- riboyslation.
- the post-translational modifications may be introduced using recombinant enzymes in vitro or may be the result of processing within the transgenic cell.
- PARG, and/or ARH3 fusion protein may be introduced into a transgenic cell using methods known in the art, including, but not limited to electroporation, microinjection, lipid-mediated transfection (e.g., liposomal delivery systems), calcium phosphate-mediated transfection, DEAE dextran-mediated transfection, DNA transfection by biolistics, DNA transfection mediated by polybrene, and virus-mediated transduction.
- the one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and/or ARH3 fusion protein may be introduced into any type of cell, including, but not limited to, a mammalian cell (e.g., a human, mouse, rat, monkey, or rabbit cell), a yeast cell, a bacterial cell, or an insect cell.
- a mammalian cell e.g., a human, mouse, rat, monkey, or rabbit cell
- yeast cell e.g., a yeast cell, a bacterial cell, or an insect cell.
- a mammalian cell that expresses one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and/or ARH3 fusion protein may include a fibroblast, an epithelial cell, an endothelial cell, a smooth muscle cell, a hepatocyte, a kidney cell, and a lymphocyte.
- suitable mammalian cell lines include COS-7 monkey kidney cells, CV-I, L cells, C 127 cells, 3T3 cells, Chinese hamster ovary (CHO) cells, human embryonic kidney (HEK) cells, HeLa cells (e.g., HeLa S3 or HeLa Kyoto cells), 293 cells, 293T cells, and BHK cell lines.
- One or more nucleic acids may also be expressed in a cell (e.g., a mammalian cell, a bacterial cell, or a yeast cell) that has been engineered to express one or more (e.g., 1, 2, 3, or 4) chaperone proteins, one or more (e.g., 1, 2, 3, or 4) enzymes that promote the post-translational modification of proteins, and/or contain one or more (e.g., 1, 2, 3, or 4) mutations in the nucleic acids encoding one or more (e.g., 1 , 2, 3, or 4) proteins that have a negative effect on the expression of a transgenic protein (e.g., a PARP fusion protein), such as a specific RNAse or protease.
- a transgenic protein e.g., a PARP fusion protein
- BL21 StarTM An example of a bacterial cell that has been engineered to contain a mutation in a RNAse is BL21 StarTM (Invitrogen).
- a variety of cells are commercially available for the expression of one or more recombinant proteins (e.g., one or more PARP, PARG, and/or ARH3 fusion proteins), including, but not limited to, bacterial competent cells (e.g., BL21-AITM One Shot ® , One Shot ® -BL21(DE3), and One Shot ® -BL21(DE3) pLysE, One Shot" BL21(DE3) pLysS (Invitrogen); and mammalian competent cells (e.g., Espresso Competent HeIa S3 Cells, Espresso Competent CHO-Kl cells, and Espresso Competent HEK 293 cells (Neuromics), MaxPAK Competent HeLa S3 cells, MaxPAK Competent CHO-Kl cells, and MaxPAK Competent HEK 293
- a transgenic mammal may also be produced from a transgenic cell containing one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or a PARP, PARG, and/or ARH3 fusion protein.
- a transgenic animal may be a mouse, a rat, a bovine, an ovine, a caprine, a porcine, a horse, a rabbit, or a monkey.
- the nucleic acid encoding one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may contain a tissue-specific promoter that allows the expression of one or more transgenic proteins into a biological fluid of the mammal (e.g., into the milk or serum of the transgenic mammal).
- a protein may be engineered for expression in the milk of a mammal by placing the sequence encoding the protein downstream of the casein promoter (U.S. Patent No. 4,873,316).
- a PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and/or ARH3 fusion protein produced in a biological fluid of a transgenic mammal may be purified as described below.
- Methods for the production of a transgenic mammal from a transgenic cell include, without limitation, methods that require the transfer of a nucleus from a transgenic cell to an enucleated oocyte and/or the microinjection of one or more nucleic acids (e.g., a plasmid or an artificial chromosome) encoding one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins into an oocyte.
- nucleic acids e.g., a plasmid or an artificial chromosome
- Such genetically manipulated oocytes may then be transferred into a recipient female host to produce a transgenic mammal.
- Cell lysates may be prepared from the transgenic cells containing a nucleic acid encoding one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins of the invention.
- Cell lysates may be prepared by any methods known in the art, including both physical disruption methods and chemical disruption methods. Physical disruption methods include, but are not limited to sonication, homogenization, and rapid freeze/thaw lysis. Chemical disruption methods include, but are not limited to, the use of lysis buffers (e.g., buffers containing a detergent such as Triton-X-100 and NP-40).
- lysis buffers e.g., buffers containing a detergent such as Triton-X-100 and NP-40.
- the lysate may optionally be centrifuged to remove cellular debris and/or partially purified by one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) of the following steps: salt gradient precipitation (e.g., ammonium sulfate precipitation), size exclusion chromatography or dialysis, and column chromatography (e.g., affinity chromatography, size exclusion chromatography, anion exchange chromatography, and cation exchange chromatography).
- the cell lysate may also be treated with one or more (e.g., 1, 2, or 3) of a DNAse, RNAse, or lipase prior to further use.
- One or more (e.g., 1 , 2, 3, 4, or 5) protease inhibitors may also be added to the cell lysate prior to use.
- One or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may be fully or partially purified (e.g., at least 60%, 70%, 80%, 85%, 90%, 95%, and 99% pure from other proteins in the cell) from cell lysates, a biological medium (e.g., cell culture medium from a transgenic cell), or a biological fluid (e.g., blood, serum, or milk) from transgenic mammal expressing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or a PARP, PARG, and/or ARH3 fusion protein of the invention.
- a biological medium e.g., cell culture medium from a transgenic cell
- a biological fluid e.g., blood, serum, or milk
- one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may be fully or partially purified from the extracellular medium of a transgenic cell expressing one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or a PARP, PARG, and/or ARH3 fusion protein of the invention.
- a cell lysate, biological fluid (e.g., milk or serum), or extracellular medium containing one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins is collected.
- an antibody specific for the epitope e.g., anti-GFP antibodies, anti-FLAG antibodies, anti-GST antibodies, anti-hemagglutinin antibodies, anti-c-myc antibodies, and anti-V5 antibodies
- an antibody specific for the epitope may be used to purify one or more PARP, PARG, and/or ARH3 fusion protein(s).
- a PARP, PARG, and/or ARH3 fusion protein may contain a polypeptide tag containing a sequence that aids in affinity purification of the protein (e.g., a His ⁇ tag, a calmodulin-binding protein tag, a glutathione S-transferase protein tag, a strep II tag, a HPC tag, a maltose-binding protein tag).
- a solid surface, resin, or bead e.g., magnetic bead
- contacting the one or more PARP, PARG, and/or ARH3 fusion protein(s) with the solid surface, resin, or bead will cause the selective binding of the one or more PARP, PARG, and/or ARH3 fusion protcin(s) with the solid surface, resin, or bead.
- the remaining non- bound proteins will not bind and may be washed away using an appropriate buffer. Specific methods for the affinity purification of proteins are known in the art.
- One or more PARP, PARG, and/or ARH3 fusion proteins may also be purified from a cell lysate, biological sample, or a extracellular medium by a purification protocol including, but limited to: salt precipitation (e.g., ammonium sulfate precipitation), pH precipitation, precipitation using organic solvents, high performance liquid chromatography (HPLC), column chromatography, ion exchange chromatography (e.g., cation exchange chromatography and anion exchange chromatography), immobilized metal affinity chromatography, gel filtration, or size exclusion chromatography or dialysis.
- salt precipitation e.g., ammonium sulfate precipitation
- HPLC high performance liquid chromatography
- ion exchange chromatography e.g., cation exchange chromatography and anion exchange chromatography
- immobilized metal affinity chromatography gel filtration, or size exclusion chromatography or dialysis.
- PARG, and/or ARH3 fusion proteins may be dialyzed to exchange the buffer or concentrated prior to use in one or more of the assays described herein (e.g., PARP, PARG, and/or ARH3 activity assays or assays for the identification of a specific PARP activator or inhibitor).
- the one or more purified PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may be stored at -70 0 C in the presence or absence of one or more (e.g., 1, 2, 3, 4, or 5) stabilizing proteins including, but not limited to, albumin.
- the biological activity of the one or more PARP proteins and PARP fusion proteins of the invention include, but are not limited to, one or more (e.g., 1 , 2, 3, 4, or 5) of the ability to covalently attach an ADP-ribose molecule to one or more (e.g., 1 , 2, 3, 4, or 5) substrate(s) (e.g., a protein, a RNA molecule, a DNA molecule, or a lipid), the ability to covalently attach an ADP-ribose molecule to a ADP-ribose residue covalently attached to a substrate, the ability to add a branched ADP-ribose molecule to a preexisting poly-ADP-ribose, the ability to localize to the cell nucleus, the ability to localize to stress granules, the ability to catalyze the formation or nucleation of stress granules, the ability to catalyze the disas
- substrate(s) e.g
- PARP7, PARP8, PARPl 4, and PARPl 6 have the ability to localize to the nucleus and/or the ability to promote cell division and mitosis;
- PARP5A, PARP12, PARP13.1 , PARP13.2, and PARP15 have the ability to localize Io stress granules and the ability to promote or nucleate stress granule formation;
- PARPl 1 has the ability to localize to stress granules and the ability to promote disassembly of stress granules or prevent the formation of stress granules;
- PARPl 3.1 has the ability to decrease the activity of RNAi and the ability to add one or more ADP-ribose molecules to Argonaut.
- Assays to measure the ability of one or more PARP proteins and PARP fusion protein(s) to covalently attach an ADP-ribose to one or more (e.g., 1 , 2, 3, 4, or 5) substrate(s) involve the incubation of one or more PARP fusion protein(s) with the one or more substrate(s) in the presence of a labeled NAD + molecule (e.g., radiolabeled, fluorescently-labeled, and colorimetrically- labeled NAD + ).
- a labeled NAD + molecule e.g., radiolabeled, fluorescently-labeled, and colorimetrically- labeled NAD +
- a radiolabeled NAD + substrate may contain one or more radioisotopes including, but not limited to, 14 C (e.g., 14 C-adenine), 32 P, and 3 H.
- Additional NAD + substrates include fluorescently-labeled NAD + (Putt et al., Anal. Biochem. 78:326, 2004), colorimetrically-labeled NAD + (Nottbohn et al., Agnew. Chem. Int. Ed. 46:2066-2069, 2007), and biotinylated NAD + (6-biotin-17-NAD; R & D Systems).
- the specific labeling of the substrate(s) with one or more labeled ADP-ribose molecules is determined by measuring the amount of the label associated with the NAD + that is covalently bound to the one or more substrate molecules.
- An increase (e.g., at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) in the amount of the label associated with the NAD + that is covalently bound to the one or more substrate(s) indicates PARP protein or PARP fusion protein activity.
- the auto-modification of one or more is measured by incubating the one or more PARP proteins and/or PARP fusion proteins of the invention with a labeled NAD + substrate and subsequently, measuring the amount of the label associated with the NAD + covalently bound to the one or more PARP fusion proteins.
- An increase in the amount of the label associated with the NAD + covalently bound to the one or more PARP fusion proteins indicates PARP fusion protein auto-modification.
- one or more e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
- PARP proteins and/or PARP fusion proteins may be incubated with one or more (e.g., 1 , 2, 3, 4, or 5) substrates and a non-labeled NAD + .
- the poly-ADP-ribosylation of the one or more substrates may be measured by contacting the one or more substrates with a poly-ADP-ribose antibody.
- a sample of substrate proteins may be electrophoresed and immmunoblotted with an anti-poly-ADP- ribose antibody.
- An increased number of proteins or an increased level of detection using an anti-poly-ADP ribose antibody indicates an increase in the activity of the one or more PARP fusion proteins.
- antibodies specific for one or more PARP proteins and/or fusion proteins, and antibodies specific for one or more proteins or molecules specific to a cellular structure or organelle may be used to perform immunofluorescent microscopy.
- Localization of one or more PARP proteins and/or PARP fusion proteins may be measured in high- throughput experiments by co-localization of one or more PARP proteins and/or fusion proteins with one or more proteins specific for a cellular structure or organelle (e.g., proteins listed in Figure 10). Localization of one or more PARP proteins and/or PARP fusion proteins in the nucleus may also be demonstrated by co-localization of a dye that stains DNA and an antibody that specifically binds the one or more PARP proteins and/or PARP fusion proteins (e.g., co-localization of an antibody specific for one or more PARP proteins and/or PARP fusion proteins, and 4',6-diamindino-2-phenylindole (DAPI)).
- DAPI 4',6-diamindino-2-phenylindole
- Localization of one or more PARP proteins and/or PARP fusion proteins to a specific cell structure or organelle may occur only during one or more (e.g., 1, 2, 3, 4, 5, or 6) specific stages of the cell cycle, including, but not limited to, G2-M, prophase, prometaphase (P-M), metaphase, anaphase, cytokinesis, G 0 , and Gi stages.
- a PARP protein and/or PARP fusion protein is deemed to have the ability to localize to a specific cellular structure or organelle if it localizes to the specific cellular structure or organelle in at least one stage (e.g., mitosis or cytokinesis) of the cell cycle.
- a PARP protein and/or fusion protein to promote stress granule assembly or to inhibit stress granule assembly may be measured using fluorescence microscopy.
- cells are treated with one or more PARP inhibitors, one or more PARP activators, or a nucleic acid encoding one or more PARP proteins and/or PARP fusion proteins, and are subsequently fixed and immunostained with antibodies specific for one or more stress granule protein (e.g., one or more of eIF3, eIFl A, eIF2 ⁇ , eIF3 ⁇ , eIF4Al , elF4e, and G3BP).
- stress granule protein e.g., one or more of eIF3, eIFl A, eIF2 ⁇ , eIF3 ⁇ , eIF4Al , elF4e, and G3BP.
- An increase in the number of foci containing one or more stress granule proteins indicates an increase in the formation of stress granules.
- a decrease in the number of foci containing one or more stress granule proteins indicates a decrease in the formation of stress granules.
- stress granule formation may be induced by exposure to stress conditions, for example, by treatment with sodium arsenite and pateamine A.
- the ability of one of more PARP proteins and/or PARP fusion proteins to promote cell division and mitosis may be measured using any method known in the art.
- cell proliferation assays including, but not limited to, standard cell counting assays, BrdU labeling, and quantitative assays for DNA synthesis such as 3 H-thymidine incorporation may be used to measure the ability of one or more PARP proteins and/or PARP fusion proteins to promote cell division and mitosis.
- cell proliferation assays including, but not limited to, standard cell counting assays, BrdU labeling, and quantitative assays for DNA synthesis such as 3 H-thymidine incorporation may be used to measure the ability of one or more PARP proteins and/or PARP fusion proteins to promote cell division and mitosis.
- inhibition of one or more PARP proteins and/or P ⁇ RP fusion proteins with the ability to promote cell division and mitosis may result in cell death.
- RNAiCHECKTM-l Assays for measuring RNAi activity in a cell are available in the art.
- psiCHECKTM-l, psiCHECKTM-2, and pGL4.72[hRlucCP]TM vector assay systems provide methods for the measurement of RNAi activity in a cell.
- luciferase is used a primary reporter gene and a target sequence (i.e., the target of one or more RNAi molecules) is cloned a multiple cloning region located downstream of the luciferase translational stop codon.
- RNAi Initiation of the RNAi process towards the target gene results in the cleavage and subsequent degradation of the fusion mRNA encoded by the vectors (i.e., upon treatment of the transfected cell with a vector-target RNAi molecule). Measurement of decreased luciferase activity in the transfected cells following treatment with the vector-target RNAi indicates the activity of RNAi in the cell.
- a cell transfected with the psiCHECK vector is treated with the vector-target RNAi and with an activator or inhibitor of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP proteins and/or PARP fusion proteins (e.g., 1, 2, 3, 4, or 5 RNAi molecules targeting a specific PARP).
- Transfected cells treated with the vector-target RNAi and with a PARP inhibitor or activator that demonstrate increased luciferase activity relative to a transfected cell treated with the vector-target RNAi alone indicate that the specific targeted PARP activates or inhibits RNAi activity in the cell, respectively.
- Cells treated with a PARP inhibitor or activator that demonstrate decreased luciferase activity relative to a cell treated with vector-target RNAi alone indicate that the specific targeted PARP inhibits or activates RNAi activity in the cell, respectively.
- any of the above-referenced PARP protein and/or PARP fusion protein activity assays may be performed to determine the activity of PARP protein or PARP fusion protein sequence encoded by a nucleic acid having at least 80% sequence identity to one of SEQ ID NOS: 1-24.
- the domain structure of several PARP proteins are shown in Figure 3. Preferred mutations in the wild-type sequences of PARP proteins (e.g., SEQ ID NOS: 1-24) do not introduce amino acid changes in the catalytic domain in Figure 3.
- 80% sequence identity to one of SEQ ID NOS: 1-24 may be assessed using any of the above-described cellular or in vitro assays.
- PARG and ARH3 Protein and Fusion Protein Assays The activity of one or more PARG protein, ARH3 protein, PARG fusion protein, and/or ARH3 fusion protein may be determined using assays known in the art. PARG and ARH3 proteins herein have been demonstrated to decrease or prevent the formation of stress granules. Assays for the measurement of stress granule formation and disassembly are described herein. Additional assays for PARG and ARH3 proteins (and fusion proteins) include the hydrolysis of poly-ADP-ribose.
- Labeled poly-ADP-ribose e.g., 32 P, 14 C, or biotinylated ADP
- ADP-ribose may be used as a substrate for the measurement of the hydrolysis and release of ADP-ribose from a labeled and/or attached poly-ADP-ribose polymer.
- cells may be transfected with a nucleic acid that overexpresses a PARG protein, ARH3 protein, PARG fusion protein, and/or ARH3 fusion protein and cells untreated or treated with a stress condition (e.g., sodium arsenite).
- a stress condition e.g., sodium arsenite
- Cells that contain an active form of a PARG protein, ARH3 protein, PARG fusion protein, and/or ARH3 fusion protein show decreased staining for poly-ADP-ribose than cells transfected with a control form or inactive form of these proteins (e.g., a form lacking its catalytic domain or a form containing an inactivating mutation).
- activity assays will also aid in the identification of which amino acids may be mutated to generate nucleic acids having at least 80% (e.g., at least 85%, 90%, 95%, 99%, or 100% identity) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41).
- Preferred sites of mutation lie outside the catalytic domains of PARG and/or ARH3.
- Antibodies specific to the one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP proteins and/or PARP fusion proteins of the invention can be generated using standard methods, such as those described herein.
- Antibodies specific for one or more PARP fusion proteins, PARP proteins, or fragments of PARP proteins and/or PARP fusion proteins may be used in quantitative assays to measure to amount of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP proteins and/or PARP fusion proteins present in a cell, cell lysate, biological sample, or extracellular medium.
- Antibodies specific to the one or more may also be used to identify specific binding partners or potential inhibitors or activators of the one or more PARP proteins and/or PARP fusion proteins.
- one or more PARP protein(s), PARP fusion protein(s), fragments of PARP protein(s), or fragments of PARP fusion protein(s) can be purified from natural sources (e.g., cultures of cells expressing one or more PARP proteins) or synthesized in, e.g., mammalian, insect, or bacterial cells by expression of corresponding DNA sequences contained in a suitable cloning vehicle (e.g., the nucleic acids encoding PARP proteins and PARP fusion proteins described herein). Fusion proteins are commonly used as a source of antigen for producing antibodies.
- the antigenic proteins can be optionally purified, and then coupled to a carrier protein, mixed with Freund's adjuvant to enhance stimulation of the antigenic response in an inoculated animal, and injected into rabbits, mice, or other laboratory animals.
- Primary immunizations are carried out with Freund's complete adjuvant and subsequent immunizations performed with Freund's incomplete adjuvant.
- the inoculated animals are then bled and the sera isolated.
- the sera is used directly or is purified prior to use by various methods, including affinity chromatography employing reagents such as Protein A-Sepharose, antigen-Sepharose, and anti-horse-Ig-Sepharose.
- Antibody titers can be monitored by Western blot and immunoprecipitation analyses using one or more PARP proteins, PARP fusion proteins, and/or fragments of PARP fusion proteins or PARP proteins.
- Immune sera can be affinity purified using one or more PARP proteins, PARP fusion proteins, and/or fragments of PARP fusion proteins or PARP proteins coupled to beads.
- Antiserum specificity can be determined using a panel of proteins, such as one or more PARP proteins, PARP fusion proteins, and/or fragments of PARP fusion proteins or PARP proteins.
- monoclonal antibodies are produced by removing the spleen from the inoculated animal, homogenizing the spleen tissue, and suspending the spleen cells suspended in phosphate buffered saline (PBS).
- PBS phosphate buffered saline
- the spleen cells serve as a source of lymphocytes, some of which produce antibody of the appropriate specificity.
- These cells are then fused with permanently growing myeloma partner cells, and the products of the fusion plated into a number of tissue culture wells in the presence of selective agents, such as hypoxanthine, aminopterine, and thymidine (Mocikat, J. Immunol. Methods 225:185-189, 1999; Jonak et al., Hum.
- the wells can then be screened by ELlSA to identify those containing cells making antibody capable of binding to one or more PARP proteins, PARP fusion proteins, fragments of PARP proteins, and/or fragments of PARP fusion proteins, or mutants thereof. These cells can then be re-plated and, after a period of growth, the wells containing these cells can be screened again to identify antibody- producing cells. Several cloning procedures can be carried out until over 90% of the wells contain single clones that are positive for specific antibody production. From this procedure, a stable cell line of clones that produce the antibody are established.
- the monoclonal antibody can then be purified by affinity chromatography using Protein A Sepharose and ion-exchange chromatography, as well as variations and combinations of these techniques. Once produced, monoclonal antibodies are also tested for specific PARP protein and/or PARP fusion protein recognition by ELISA, Western blot, and/or immunoprecipitation analysis (see, e.g., Kohler et al., Nature 256:495, 1975; Kohler et al., Eur. J. Immunol. 6:511 , 1976; Kohler et al., Eur. J. Immunol. 6:292, 1976;
- peptides corresponding to relatively unique regions of a PARP protein or PARP fusion protein can be generated and coupled to keyhole limpet hemocyanin (KLH) through an introduced C-terminal lysine.
- KLH keyhole limpet hemocyanin
- Antiserum to each of these peptides can be similarly affinity-purified on peptides conjugated to BSA, and specificity tested by ELISA and Western blotting using peptide conjugates, and by Western blotting and immunoprecipitation using a PARP protein, PARP fusion protein, and/or fragment of a PARP protein or PARP fusion protein.
- Antibodies of the invention are desirably produced using PARP protein and/or PARP fusion protein amino acid sequences that do not reside within highly conserved regions, and that appear likely to be antigenic, as evaluated by criteria such as those provided by the Peptide Structure Program (Genetics Computer Group Sequence Analysis Package, Program Manual for the GCG Package, Version 7, 1991) using the algorithm of Jameson et al., CABIOS 4:181, 1988.
- Peptide Structure Program Genetics Computer Group Sequence Analysis Package, Program Manual for the GCG Package, Version 7, 1991
- These fragments can be generated by standard techniques, e.g., by PCR, and cloned into any appropriate expression vector.
- GST fusion proteins can be expressed in E. coli and purified using a glutathione-agarose affinity matrix.
- two or three PARP fusion proteins may be generated for each fragment injected into a separate animal.
- Antisera are raised by injections in series, preferably including at least three booster injections.
- various genetically engineered antibodies and antibody fragments e.g., F(ab')2, Fab', Fab, Fv, and sFv fragments
- F(ab')2, Fab', Fab, Fv, and sFv fragments can be produced using standard methods.
- Truncated versions of monoclonal antibodies can be produced by recombinant methods in which plasmids are generated that express the desired monoclonal antibody fragment(s) in a suitable host.
- Ladner U.S. Patent Nos. 4,946,778 and 4,704,692 describes methods for preparing single polypeptide chain antibodies. Ward et al., Nature 341 :544-546, 1989. describes the preparation of heavy chain variable domain which have high antigen-binding affinities. McCafferty et al.
- Boss et al. (U.S. Patent No. 4,816,397) describes various methods for producing immunoglobulins, and immunologically functional fragments thereof, that include at least the variable domains of the heavy and light chains in a single host cell.
- Cabilly et al. (U.S. Patent No. 4,816,567) describes methods for preparing chimeric antibodies.
- the antibodies can be coupled to compounds, such as toxins or radiolabels.
- the PARP proteins and/or PARP fusion proteins of the invention may be used to identify one or more (e.g., 1 , 2, 3. 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) specific PARP activators or inhibitors.
- one or more e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more
- PARP proteins and/or PARP fusion proteins are contacted with an agent (e.g., a test agent), a labeled NAD + (e.g., a colorimetrically-labeled, fluorescently-labeled, biotinylated-, or radioisotope-labeled NAD + ), and one or more substrates, and measuring the amount of labeled ADP-ribose covalently attached to the one or more substrates.
- an agent e.g., a test agent
- a labeled NAD + e.g., a colorimetrically-labeled, fluorescently-labeled, biotinylated-, or radioisotope-labeled NAD +
- one or more PARP protein and/or PARP fusion proteins of the invention are incubated with a labeled NAD + substrate and the amount of label associated with the NAD + that is covalently attached to the one or more PARP proteins and/or PARP fusion proteins is measured (e.g., auto-modulation activity assay).
- an agent that is a specific PARP inhibitor mediates a decrease (e.g., at least a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or even 100% decrease) in the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) PARP proteins and/or fusion proteins, wherein the label on the PARP-fusion proteins is the same as the label of the NAD + .
- the agent mediates an increase (e.g., at least a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or even 100% increase) in the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) PARP proteins and/or PARP fusion proteins.
- an increase e.g., at least a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or even 100% increase
- one or more e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
- PARP proteins and/or PARP fusion proteins e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or
- the one or more PARP proteins and/or PARP fusion proteins utilized in each assay may be purified, partially purified (e.g., at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, or 95% pure) or may be present in a cell lysate (e.g., a bacterial cell lysate, a yeast cell lysate, or a mammalian cell lysate), in a biological fluid from a transgenic animal (e.g., milk or serum), or an extracellular medium.
- a cell lysate e.g., a bacterial cell lysate, a yeast cell lysate, or a mammalian cell lysate
- a biological fluid from a transgenic animal e.g., milk or serum
- a transgenic animal e.g., milk or serum
- the one or more PARP proteins and/or PARP fusion proteins utilized in the assay may be bound to substrate, such as, but not limited to, a solid surface (e.g., a multi-well plate), a resin, or a bead (e.g., a magnetic bead).
- substrate such as, but not limited to, a solid surface (e.g., a multi-well plate), a resin, or a bead (e.g., a magnetic bead).
- substrate such as, but not limited to, a solid surface (e.g., a multi-well plate), a resin, or a bead (e.g., a magnetic bead).
- a solid surface e.g., a multi-well plate
- resin e.g., a resin
- bead e.g., a magnetic bead
- PARP fusion proteins may be bound to a solid surface, resin, or bead (e.g., a magnetic bead) and subsequently treated with one or more protease(s) (e.g., a TEV protease) prior to contacting the one or more PARP proteins and/or PARP fusion proteins with the labeled NAD + .
- protease(s) e.g., a TEV protease
- an activator or inhibitor increases or decreases the amount of labeled ADP-ribose covalently attached to a specific PARP protein, PARP fusion protein, and/or subset of PARP proteins or fusion proteins while having no or little (e.g., less than 50%, 40%, 30%, 25%, 20%, 15%, 10%, or 5% change (e.g., increase or decrease)) affect on the amount of labeled ADP-ribose covalently attached to other PARP proteins and/or PARP fusion proteins, is identified as a PARP activator or inhibitor, respectively.
- the assay desirably identifies an agent that specifically inhibits the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP5A proteins or fusion proteins, PARP12 proteins and/or fusion proteins, PARP13.1 proteins and/or fusion proteins, PARP 13.2 proteins and/or fusion proteins, and PARP 15 proteins and/or fusion proteins.
- one or more e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARP5A proteins or fusion proteins e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARP12 proteins and/or fusion proteins e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARP13.1 proteins and/or fusion proteins e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARP 132 proteins and/or fusion proteins e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- Another assay desirably identifies an agent that specifically increases the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP5A proteins and/or fusion proteins, PARP 12 proteins and/or fusion proteins, PARP 13.1 proteins and/or fusion proteins, PARP 13.2 proteins and/or fusion proteins, and PARPl 5 proteins and/or fusion proteins.
- Another example of the assay desirable identifies an activator or inhibitor that specifically increases or decreases, respectfully, the amount of labeled ADP-ribose covalently bound to one or more (e.g., 1, 2, 3, 4, 5, or 6) PARPl 1 proteins and/or fusion proteins.
- Another example of the assay desirably identifies an agent that specifically decreases the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARPl proteins and/or fusion proteins, PARP2 proteins and/or fusion proteins, PARP5A proteins and/or fusion proteins, PARP5B proteins and/or fusion proteins, PARP7 proteins and/or fusion proteins, PARP8 proteins and/or fusion proteins, PARPl 4 proteins and/or fusion proteins, and PARPl 6 proteins and/or fusion proteins.
- one or more e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARPl proteins and/or fusion proteins e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARP2 proteins and/or fusion proteins e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARP5A proteins and/or fusion proteins e.g., 1, 2, 3, 4,
- Another example of the assay desirably identifies an agent that specifically increases the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARPl proteins and/or fusion proteins, PARP2 proteins and/or fusion proteins, PARP5A proteins and/or fusion proteins, PARP5B proteins and/or fusion proteins, PARP7 proteins and/or fusion proteins, PARP8 proteins and/or fusion proteins, PARPl 4 proteins and/or fusion proteins, and PARPl 6 proteins and/or fusion proteins.
- one or more e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARPl proteins and/or fusion proteins e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARP2 proteins and/or fusion proteins e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
- PARP5A proteins and/or fusion proteins e.g., 1, 2, 3, 4, 5,
- the assay identifies an agent that specifically increases or decreases the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, or 6) different PARP 13.1 proteins and/or fusion proteins.
- a tested agent may be a derived from or present in a crude lysate (e.g., a lysate from a mammalian cell or plant extract) or be derived from a commercially available chemical libraries. Large libraries of natural product or synthetic (or semi-synthetic) extracts or chemical libraries are commercially available and known in the art.
- the screening methods of the present invention are appropriate and useful for testing agents from a variety of sources for activity as a specific PARP activator or inhibitor. The initial screens may be performed using a diverse library of agents, but the method is suitable for a variety of other compounds and compound libraries. Such compound libraries can also be combinatorial libraries.
- An agent may be a protein, a peptide, a DNA or RNA aptamer (e.g., a RNAi molecule), a lipid, or a small molecule (e.g., a lipid, carbohydrate, a bioinorganic molecule, or an organic molecule).
- a DNA or RNA aptamer e.g., a RNAi molecule
- a lipid e.g., a lipid, carbohydrate, a bioinorganic molecule, or an organic molecule.
- Agents that may be tested as a specific PARP activator include nucleic acids that contain a sequence encoding one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) domains of a PARP protein (e.g., a domain encoded by part of the nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOS: 1-24).
- nucleic acids that contain a sequence encoding one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) domains of a PARP protein (e.g., a domain encoded by part of the nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOS: 1-24).
- the invention also provides methods for identifying an agent that specifically binds to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP proteins and/or PARP fusion proteins. These methods require the contacting of one or more of the PARP proteins and/or PARP fusion proteins of the invention with a test agent and determining whether the test agent specifically binds to the one or more PARP proteins and/or PARP fusion proteins.
- An agent that specifically binds one or more of the described PARP proteins and/or PARP fusion proteins may act as an activator or inhibitor of the expression or activity of the one or more PARP proteins and/or PARP fusion proteins in a cell.
- an agent that specifically binds to one or more PARP proteins and/or PARP fusion proteins may selectively increase the activity or expression of one or more PARP proteins and/or fusion proteins, while at the same time decreasing the activity or expression of one or more other PARP proteins and/or PARP fusion proteins in the same cell or sample.
- the one or more PARP proteins and/or PARP fusion proteins used in this method may be attached to a solid surface or substrate (e.g., a bead) and/or may be present in purified form or present in a crude cell lysate, biological fluid, or extracellular medium.
- the methods may optionally include one or more (e.g., 1, 2, 3, 4, or 5) washing steps following contacting the one or more PARP proteins and/or PARP fusion proteins with the test agent.
- the test agent may be a small molecule, a lipid, an RNA molecule, a DNA molecule, a protein, or a peptide fragment.
- the test agent may be purified in form (e.g., at least 70%, 80%, 85%, 90%, 95%, or 99% pure by weight) or may be present in a crude cell lysate.
- the test agent may also, optionally be labeled (e.g., a colorimetric label, a radionuclide label, labeled with a biotin molecule, or labeled with a fluorophore).
- the binding of the test agent to one of more PARP proteins and/or PARP fusion proteins may detected by any known method including, BIAcore, competitive binding assays (e.g., a competitive binding assay using one or more of the antibodies provided by the invention), and detection of the agent following its release from the one or more PARP proteins and/or PARP fusion proteins (e.g., elution of the bound test agent following exposure to high salt or a high or low pH buffer).
- the one or more PARP proteins and/or PARP fusion proteins may be any of the example PARP proteins and PARP fusion proteins described herein.
- a bead attached to one or more PARP proteins and/or PARP fusion proteins of the invention may be incubated with a crude cell lysate, and the proteins or peptide fragments bound to the one or more PARP proteins and/or PARP fusion proteins may be eluted from the beads by exposure to a high salt buffer, a high detergent buffer, or a high or low pH buffer.
- the resulting eluted proteins may be electrophoresed onto an SDS-polyacrylamide gel and the specific protein bands cut out from the gel and analyzed using mass spectrometry to identify the specific agent that binds to the one or more PARP proteins and/or PARP fusion proteins.
- a bead attached to one or more PARP proteins and/or PARP fusion proteins of the invention is incubated with a purified protein or peptide fragment.
- a protein or peptide fragment bound to the one or more PARP proteins and/or PARP fusion proteins may be eluted using a high salt buffer, a high detergent buffer, or a high or low pH buffer.
- the amount of protein in the eluate may be detected by any method known in the art including UV/vis spectroscopy, mass spectrometry, or any colorimetric protein dye (e.g., a Bradford assay).
- one or more PARP proteins and/or PARP fusion proteins may be placed in individual wells of a multi-well plate (e.g., one or more PARP proteins and/or PARP fusion proteins covalently linked to the plate surface) and incubated with the test agent. Following a washing step, the amount of test agent remaining in each well may be determined and the ability of the test agent to bind one or more PARP proteins and/or PARP fusion proteins determined.
- the methods desirably identify a test agent that specifically binds one or more of a PARPl protein and/or fusion protein, a PARP2 protein and/or fusion protein, a PARP5A protein and/or fusion protein, a PARP5B protein and/or fusion protein, a PARP7 protein and/or fusion protein, a PARP8 protein and/or fusion protein, a PARP 14 protein and/or fusion protein, and a PARP16 protein and/or fusion protein of the invention.
- the methods also desirably identify a test agent that specifically binds to one or more of a PARP5 A protein and/or fusion protein, a PARP 12 protein and/or fusion protein, a PARP 13.1 protein and/or fusion protein, a PARP 13.2 protein and/or fusion protein, and a PARP15 protein and/or fusion protein of the invention.
- the methods also desirably identify a test agent that specifically binds to a PARP13.1 protein and/or fusion protein or a PARPl 1 protein and/or fusion protein of the invention.
- the present invention further provides methods for quantitating the level of one or more PARP proteins or PARP fusion proteins present in a sample (e.g., a cell, a cell lysate, a biological fluid, or an extracellular medium).
- a cell, cell lysate, biological fluid, or extracellular medium is contacted with one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) antibodies of the invention (e.g., antibodies that specifically bind to one or more PARP proteins or PARP fusion proteins described herein) and the level of one or more PARP proteins and/or PARP fusion proteins is determined by measuring the amount of the one or more PARP proteins and/or PARP fusion proteins bound to the one or more antibodies.
- the one or more antibodies may be polyclonal antibodies.
- the antibodies used in these methods may also be covalently bound to a bead (e.g., a magnetic bead or a bead in a column) or may be covalently bound to the surface of a multi-well plate (e.g., for use in an enzyme-linked immunosorbent assay (ELISA)).
- ELISA enzyme-linked immunosorbent assay
- PARP fusion proteins may be determined by any method known in the art, including, but not limited to, BIAcore, immunofluorescence microscopy, immunofluorescence-assisted cell sorting, ELISA, immunoblotting, and competitive binding assays (e.g., assays using purified labeled PARP proteins and/or PARP fusion proteins). In these assays, the level of one or more PARP proteins and/or PARP fusion proteins may be compared to a standard curve control generated using one or more purified PARP proteins and/or PARP fusion proteins as described herein.
- the level of one or more PARP proteins present in a cell, cell lysate, or biological sample may be used as an indicator of the status or severity of one or more stress granule-related condition (e.g., a neurodegenerative disease, a cardiovascular disease, an inflammatory disease, and ischemia-reperfusion injury).
- a stress granule-related condition e.g., a neurodegenerative disease, a cardiovascular disease, an inflammatory disease, and ischemia-reperfusion injury.
- an increase in the level of one or more of PARP5A, PARP 12, PARP 13.1, PARP 13.2, and PARP 15 indicates an increased severity or an increase in the likelihood of developing a stress granule-related disorder.
- the invention further provides methods for identifying a candidate agent for treating or decreasing a stress granule-related disorder requiring the steps of: providing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins encoded by a nucleic acid containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP 12 (SEQ ID NO: 18), PAPR13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP15 (SEQ ID NO: 22 or 23), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41); contacting the one or more PARP, PARG, and/or ARH3 proteins, and/or PARP,
- the invention further provides methods for identifying a candidate agent for treating or decreasing the likelihood of developing cancer requiring the steps of: providing one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP proteins and/or PARP fusion proteins encoded by a nucleic acid containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to a PARP selected from PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24); contacting the one or more PARP proteins and/or PARP fusion proteins with the agent and a labeled NAD + substrate; and measuring
- the one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may be generated using any methods known in the art or the methods described herein.
- the PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may be purified or present in a crude cell lysate.
- the PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may be attached to a substrate (e.g., a magnetic bead) or a solid surface (multi-well plate).
- the methods of the assay include the measurement of the activity of the one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins using any assay known in the art or those assays described herein.
- the assays may include the incubation of the one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins with a labeled NAD + substrate and/or the incubation with other substrates that are not labeled (e.g., non-labeled NAD + ).
- Each PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and ARH3 fusion protein may have one or more activities (described herein). Any known activity of a PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and/or ARH3 fusion protein (or activity described herein) may be measured in the above screening assays (e.g., catalytic addition of an ADP-ribose molecule or polymerization of a poly-ADP-ribose molecule, catalytic degradation of poly- ADP ribose or removal of a ADP-ribose moiety from a substrate, localization to a particular cell structure (e.g., nucleus or stress granule), formation of a stress granule, disassembly of a stress granule, nucleation of a stress granule, promotion of cell proliferation or cell division, or required for cell cycle progression (e.g., progression through
- the ability of an agent to bind to one or more PARP or PARP fusion proteins may be measured using any method known in the art, as well as those methods described herein.
- the ability of an agent to specifically bind to a PARP protein or PARP fusion protein may be measured by chromatography (e.g., using beads wherein a PARP protein, a PARP fusion protein, or a domain of a PARP protein or PARP fusion protein is covalently attached), BIAcore analysis, UV/vis spectroscopy, or calorimetry.
- a candidate agent may be a derived from or present in a crude lysate (e.g., a lysate from a mammalian cell or plant extract) or be derived from a commercially available chemical libraries. Large libraries of natural product or synthetic (or semi-synthetic) extracts or chemical libraries are commercially available and known in the art.
- the screening methods of the present invention are appropriate and useful for testing agents from a variety of sources for activity as a candidate agent. The initial screens may be performed using a diverse library of agents, but the method is suitable for a variety of other compounds and compound libraries. Such compound libraries can also be combinatorial libraries.
- compounds from commercial sources can be tested, as well as commercially available analogs of identified inhibitors.
- An agent may be a protein, a peptide fragment, a DNA or RNA aptamer (e.g., a
- RNAi molecule a lipid, or a small molecule (e.g., a lipid, carbohydrate, a bioinorganic molecule, or an organic molecule).
- Candidate agents that may be tested include nucleic acids that contain a sequence encoding one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) domains of a PARP protein (e.g., a domain encoded by part of the nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOS: 1-24), nucleic acids that contain a sequence encoding one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) domains of a PARG protein or ARH3 (e.g., a domain encoded by part of the nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 41 and 42), or any polypeptide encoded by these nucleic acids.
- a PARP protein e.g., a domain encoded by part of the nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOS: 1-24
- the NAD + may be labeled with a radioisotope (e.g., 32 P) or fluorophore (e.g., fluorescein), or be biotinylated.
- a radioisotope e.g., 32 P
- fluorophore e.g., fluorescein
- the invention further provides methods of increasing the proliferation of a cell or population of cells requiring contacting the cell or population of cells with an effective amount of one or more PARP activators.
- the one or more (e.g., 1, 2, 3, 4, or 5) PARP activators preferably increase the expression (e.g., mRNA and/or protein) and/or one or more activities of a PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16.
- the expression may be an increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) in the level of one or more nucleic acid sequence(s) containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or even 100%) to PARPl (SEQ ID NOS: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NOS: 8 or 9), PARP5B (SEQ ID NO: 10), PARP14 (SEQ ID NO: 21 ), or PARP16 (SEQ ID NO: 24), or one or more polypeptides encoded by one of these nucleic acids.
- PARPl SEQ ID NOS: 1 or 2
- PARP2 SEQ ID NO: 3
- PARP5A SEQ ID NOS: 8 or 9
- PARP5B SEQ ID NO: 10
- PARP14 SEQ ID NO: 21
- the activity of one or more PARPs may be any activity described herein, including, but not limited to, poly- ADP-ribosylation of a target protein (e.g., a protein localized to the nucleus or mitotic spindle during cytokinesis, or a PARP protein) or is required for progression through mitosis or cytokinesis.
- a target protein e.g., a protein localized to the nucleus or mitotic spindle during cytokinesis, or a PARP protein
- a PARP activator encompassed by these methods may include one or more nucleic acid sequences containing a sequence having at least 80% sequence identity (e.g., 85%, 90%, 95%, 99%, or even 100%) to one of SEQ ID NOS: 1-3, 8-10, 21, or 24.
- the rate of proliferation may be increased in a mammalian cell or a plant cell using these methods.
- the rate of proliferation of a primary cell e.g., a cell used for cell replacement therapies
- the rate of proliferation of a plant cell may be increased using these methods.
- These methods include the introduction of xenogenous nucleic acids encoding a PARP activator to create a transgenic mammalian or plant cell or transgenic mammal or plant.
- the invention further provides methods of increasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) the number of stress granules in a cell or cell population requiring contacting the cell or population of cells with one or more (e.g., 1 , 2, 3, 4, or 5) PARP activators, one or more (e.g., 1 , 2, 3, 4, or 5) PARG inhibitors, or one or more (e.g., 1, 2, 3, 4, or 5) PARPl 1 inhibitors.
- the increased number of stress granules may be the result of an increase in the rate of stress granule nucleation or formation and/or a decrease in the rate of stress granule breakdown or turnover.
- the one or more PARP activators preferably increase (e.g., at least 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) the expression (e.g., mRNA and/or protein) and/or activity of a protein encoded by a nucleic acid sequence containing a sequence that is at least 80% identical (e.g., at least 85%, 90%, 95%, 99%, or even 100% identical) to PARP5A (SEQ ID NO: 8 or 9), PARP 12 (SEQ ID NO: 18), PARPl 3.1 (SEQ ID NO: 19), PARPl 3.2 (SEQ ID NO: 20), or PARPl 5 (SEQ ID NO: 22 or 23).
- the expression e.g., mRNA and/or protein
- the activity of the one or more PARPs may be an increase in the poly- ADP-ribosylation of one or more (e.g., 1 , 2, 3, 4, or 5) target protein(s) (e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP protein) or the nucleation and/or formation of a stress granule. Additional activities of a PARP protein are described herein.
- target protein(s) e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP protein
- Additional activities of a PARP protein are described herein.
- PARP activators examples include, nucleic acid sequence containing a sequence having at least 80% identity (e.g., at least 85%, 90%, 95%, 99%, or even 100% identical) to any one of SEQ ID NOS: 8, 9, 18-20, 22, or 23.
- the one or more P ⁇ RG inhibitors may selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% decrease) in the expression (e.g., mRNA and/or protein) or activity of PARG or glycohydrolase ARH3.
- one or more PARG inhibitors may decrease the level of one or more nucleic acid sequence(s) containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 99%, or even 100% identity) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or a polypeptide encoded by these nucleic acids.
- PARG protein or ARH3 glycohydrolase are described herein and include, without limitation, the hydrolysis of poly-ADP-ribose (e.g., poly-ADP-ribose attached to a protein, e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP), the prevention of the assembly of a stress granule, or disassembly of a stress granule.
- poly-ADP-ribose e.g., poly-ADP-ribose attached to a protein, e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP
- the prevention of the assembly of a stress granule, or disassembly of a stress granule are described herein and
- PARG inhibitors examples include an antibody that specifically binds to a polypeptide or peptide fragment encoded by a nucleic acid sequence containing a sequence having at least 80% sequence identity (e.g., 85%, 90%, 95%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41 ), or an RNA aptamer that binds to one or more of these nucleic acid sequences.
- RNAi molecules that may target PARG and ARH3 are SEQ ID NOS: 34 and 35, and SEQ ID NOS: 36 and 37, respectively.
- the one or more PARPl 1 inhibitors may selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the expression (mRNA and/or protein) and/or activity of PARPl 1.
- the PARPl 1 inhibitors may decrease the expression of one or more nucleic acid(s) containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), or decrease the expression of one or more polypeptides encoded by these nucleic acids.
- the activity of PARPl 1 may include poly-ADP-ribosylation of a target protein (e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, and/or a PARP), prevention of the assembly of a stress granule, or disassembly of a stress granule.
- a target protein e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, and/or a PARP
- PARPl 1 inhibitors examples include an antibody that specifically binds to a polypeptide or peptide fragment encoded by a nucleic acid sequence containing a sequence having at least 80% sequence identity (e.g., 85%, 90%, 95%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), or an RNA aptamer that binds to one or more of these nucleic acid sequences.
- RNAi molecules that may target PARPl 1 are SEQ ID NOS: 91-98.
- These methods may allow for the specific up-regulation of stress granule formation in cells in which increased resistance to toxic stress is desired (e.g., a plant cell (e.g., a transgenic plant cell) or a cultured mammalian cell (e.g., for cell replacement therapies).
- a plant cell e.g., a transgenic plant cell
- a cultured mammalian cell e.g., for cell replacement therapies.
- Each resulting plasmid contained a nucleic acid sequence encoding a PARP-GFP fusion protein, wherein the nucleic acid sequence encoding GFP was located 5' to the nucleic acid sequence encoding the PARP protein.
- Table 2 Restriction Sites Used for Cloning PARP Sequences into pEGFP-Cl
- Each generated pEGFP-Cl vector was transfected into HeLa Kyoto cells using Lipofectamine 2000, according to the manufacturer's instructions.
- Cell lysate was prepared from the HeLa cells at 48 hours following transfection. Electrophoresis was performed on the cell lysate using 4-12% SDS-PAGE, and immunoblotting was performed using a rabbit anti-GFP polyclonal antibody ( Figure 5).
- each PARP-GFP fusion protein in the transfected HeLa Kyoto cells was determined using immunofluorescence microscopy using rabbit anti-GFP polyclonal antibody and a fluorescently-labeled secondary antibody (Figure 6).
- the data from this experiment indicate that several PARP-GFP proteins are primarily localized in the nucleus of asynchronous cells, including PARPl-GFP, PARP2-GFP, PARP7-GFP, and PARP8-GFP.
- the data further indicate that several PARP-GFP fusion proteins are localized in primarily in the cytoplasm of asynchronous cells, including PARP12-GFP, PARP13-GFP, PARPl 4-GFP, PARPl 5-GFP, PARP16-GFP, PARPl O-GFP, PARPl 1- GFP, PARP5 A-GFP, and PARP5B-GFP.
- the data indicate that several PARP-GFP fusion proteins are localized in both the cytoplasm and the nucleus of asynchronous cells, including PARP3-GFP, PARP9-GFP, PARP6-GFP, and PARP4- GFP.
- the antibodies for each PARP and a secondary-fluorescently labeled anti-rabbit polyclonal antibody were used to visualize the location of each PARP in asynchronous HeLa Kyoto cells transfected with a pEGFP-Cl plasmid encoding a PARP-GFP fusion protein (Figure 8).
- the data from this experiment confirm that PARPl, PARP2, PARP7, PARP8, and PARP 14 are primarily localized in the nucleus of asynchronous cells.
- the data from this experiment also confirm that PARP3, PARP4, P ⁇ RP6, PARP9, and PARP 15 are localized in the both the nucleus and the cytoplasm of asynchronous cells.
- each PARP-GFP fusion protein was also determined in HeLa Kyoto cells transfected with a pEGFP-C 1 plasmid encoding a PARP- GFP fusion protein following 12-hour treatment with 100 nM nocodazole or 5 ⁇ g/mL aphidicolin. Cells treated with nocodazole are arrested in S phase, while cells treated with aphidicolin are arrested in mitotosis.
- Figure 9 shows the cellular localization for each PARP-GFP fusion protein following cell arrest in S-phase or mitosis.
- the data show that the PARPl-GFP, PARP2-GFP, and PARP8-GFP fusion proteins localize to the nucleus during S-phase, and that PARP5A-GFP and PARP5B-GFP localize to the mitotic spindle during mitosis.
- the localization of these PARP-GFP fusion proteins e.g., PARPl-GFP, PARP2-GFP, PARP5 A-GFP, PARP5B-GFP, and PARP8-GFP
- PARP9-GFP fusion proteins e.g., PARPl-GFP, PARP2-GFP, PARP5 A-GFP, PARP5B-GFP, and PARP8-GFP
- each PARP-GFP fusion protein may be further analyzed by immunofluorescence microscopy using a combination of labeled antibodies specific for the GFP-tag of each PARP-GFP fusion protein and one or more markers of cellular structures or organelles.
- immunofluorescence staining of asynchronous HeLa Kyoto cells transfected with a pEGFP-Cl vector expressing the PARP7-GFP fusion protein shows co-localization of an anti-GFP antibody and an anti- coilin antibody (a marker of Cajal bodies in the nucleus) ( Figure 11).
- asynchronous HeLa Kyoto cells transfected with a pEGFP-Cl vector expressing the PARP16-GFP fusion protein shows co-localization of an anti-GFP antibody and an anti- calnexin antibody (a marker of the endoplasmic reticulum) (Figure 10).
- Figure 10 A non-limiting list of marker proteins that may be used to determine the cellular localization of a PARP- GFP fusion protein is also provided in Figure 1 1.
- the cells were blocked in PBS containing 4% bovine serum albumin (BSA) and 0.1% Triton-X 100. All antibodies used for imaging were diluted in blocking buffer. The coverslips were incubated with primary antibodies for 45 minutes and with secondary antibodies for 30 minutes. Images were collected on a Nikon TE2000 confocal microscope equipped with a Yokogawa CSU-Xl spinning disk head, Hamamatsu ORCA ER digital camera, and NIS-Elements imaging software.
- BSA bovine serum albumin
- Fusion proteins containing the sequence of each PARP, a ZZ-domain of SEQ ID NO: 27, and four TEV protease recognition sequences (SEQ ID NO: 26) were cloned using the pcDNA3.1 vector (SEQ ID NO: 33) (Invitrogen) ( Figure 12) to yield a ZZ-4x- TEV-PARP fusion protein for each PARP.
- Each resulting plasmid contained a nucleic acid sequence encoding a ZZ-TEV-
- PARP fusion protein wherein the nucleic acid sequence encoding ZZ domain was located 5' to the nucleic acid sequence encoding the four TEV protease recognition sequences, which in turn, was located 5' to the nucleic acid sequence encoding each PARP.
- Nucleic acids encoding each ZZ-TEV-PARP fusion protein may be transfected into target cells (e.g., HeLa Kyoto or HeLa S3 cells) and the resulting ZZ-TEV-PARP fusion proteins purified by binding to magnetic beads coated with a protein containing an Fc domain (e.g., IgG).
- target cells e.g., HeLa Kyoto or HeLa S3 cells
- the resulting ZZ-TEV-PARP fusion proteins purified by binding to magnetic beads coated with a protein containing an Fc domain (e.g., IgG).
- the resulting ZZ-TEV-PARP fusion proteins may be used in the assays described below for the PARP-GFP fusion proteins and the other assays described herein.
- Assays utilizing the ZZ-TEV-PARP fusion proteins have the additional advantage of containing an engineered TEV protease recognition sequence, whereby the polypeptide tag on each PARP fusion protein (e.g., the ZZ-domain and the four TEV protease recognition sequences) may optionally be removed from the ZZ-TEV-PARP fusion proteins by treatment with TEV protease.
- the polypeptide tag on each PARP fusion protein e.g., the ZZ-domain and the four TEV protease recognition sequences
- one or more ZZ-TEV-PARP fusion proteins may be removed from a magnetic bead, resin, or solid surface by treatment with a TEV protease.
- PARP Activity Assays and Screening Methods The above-described PARP fusion proteins may be used in PARP activity assays and in assays to identify an activator or inhibitor for a specific PARP or a specific subset of PARPs.
- An example of such an activity assay in shown in Figure 13.
- cell lysate is first prepared from a HeLa S3 cell culture expressing one or more PARP- GFP fusion proteins. The cell lysate is then incubated with an anti-GFP polyclonal antibody bound to Dynabead ® Protein A beads, and the beads magnetically removed from the cell lysate.
- the isolated beads bound to one or more PARP-GFP fusion proteins are placed into a multi-well plate and incubated with a labeled NAD + substrate (e.g., 32 P- NAD + ). Following incubation with the labeled NAD + substrate, the magnetic beads bound with the one or more PARP-GFP proteins are magnetically isolated or washed, and the level of the label (i.e., the label present in the labeled NAD + substrate) that is covalently attached to the one or more PARP-GFP fusion proteins bound to the magnetic beads is determined (e.g., the amount Of 32 P covalently bound to the one or more PARP- GFP proteins attached to the beads).
- a labeled NAD + substrate e.g. 32 P- NAD +
- the magnetic beads bound with the one or more PARP-GFP proteins are magnetically isolated or washed, and the level of the label (i.e., the label present in the labeled NAD + substrate) that is covalently attached to the
- This assay provides a means of measuring the auto- modulation activity of one or more PARP-GFP fusion proteins (e.g., the ability of a PARP to modify its own structure by catalyzing the covalent attachment of one or more ADP-ribose molecules).
- the assay may also be designed such that lysate or PARP-GFP fusion proteins isolated from several different transfected HeLa S3 cells, each expressing a different PARP-GFP fusion proteins or subset of PARP-GFP fusion proteins, may be placed in different wells of the multi-well plate.
- the assay may also be designed such that the lysate from several different transfected HeLa S3 cells is combined, wherein the lysate from each transfected HeLa S3 cell culture contains one or more PARP-GFP fusion proteins.
- the PARP-GFP fusion proteins may contain a protease recognition site.
- the one or more PARP-GFP fusion proteins bound to the magnetic beads may be treated with a specific protease (i.e., a protease that recognizes a protease recognition sequence in the PARP-GFP fusion protein) to mediate release of the PARP-GFP fusion protein from the magnetic bead.
- Figure 14 provides an example of the use of the PARP-GFP fusion proteins of the invention for the identification of an agent that specifically inhibits the activity of one or more PARPs.
- This assay is similar to the assay described above, except that the one or more PARP-GFP fusion proteins is incubated with both a test agent and a labeled NAD + substrate.
- a specific PARP inhibitor will decrease the amount of the label (i.e., the label present in the labeled NAD + substrate) covalently attached to the one or more PARP-GFP fusion proteins bound to the magnetic beads relative to the amount of the label attached to the one or more PARP-GFP fusion proteins in the absence of the test agent.
- lysate or PARP-GFP fusion proteins isolated from two or more different transfected HeLa S3 cells, each expressing a different PARP- GFP fusion protein or subset of PARP-GFP fusion proteins may be placed in different wells of the multi-well plate.
- the assay may also be designed such that the lysate from several different transfected HeLa S3 cells is combined, wherein the lysate from each transfected HeLa S3 cells contains one or more PARP-GFP fusion proteins.
- the assay may also be specifically designed to identify inhibitors of a specific PARP-GFP protein or subset of PARP-GFP proteins including the subsets of: one or more of PARPl-GFP, PARP2-GFP, PARP5 A-GFP, PARP5B-GFP, PARP7-GFP, PARP8-GFP, PARP14-GFP, and PARP16-GFP; one or more of PARP5 A-GFP, PARP12-GFP, PARPl 3.1 -GFP, PARP13.2-GFP, PARP15-GFP; PARPI l-GFP; or PARP 13.1 -GFP.
- the PARP-GFP fusion proteins of the invention may be used to identify activators of one or more specific PARPs.
- the assay may be used to identify agents that increase the amount of the label (i.e., the label present in the labeled NAD + substrate) covalently attached to the one or more PARP-GFP fusion proteins bound to the magnetic beads relative to the amount of the label covalently attached to the one or more PARP-GFP fusion proteins in the absence of the test agent.
- this assay may be designed to identify activators of a specific PARP-GFP fusion protein or subset of PARP-GFP fusion proteins including the subsets of: one or more of PARPl-GFP, PARP2-GFP, PARP5 A-GFP, PARP5B-GFP, PARP7-GFP, PARP8-GFP, PARPl 4-GFP, and PARPl 6-GFP; one or more of PARP5A- GFP, PARP 12-GFP, PARP 13.1 -GFP, PARP 13.2-GFP, and PARP 15-GFP; PARP 1 1 - GFP; or PARP 13.1 -GFP.
- PARP proteins are involved in the cell cycle and are required for progression through mitosis (e.g., PARP 16).
- the identity of the various substrate proteins of the different PARP proteins remains largely unknown.
- the Bio-Gel P-6 resin shown in Figure 15 was used to purify proteins that bind poly-ADP-ribose polymer and/or act as an acceptor of a ADP-ribose molecule or a poly-ADP-ribose polymer.
- Figure 15 also shows a Coomassie Blue-stained SDS-PAGE gel showing the proteins present in the HeLa Kyoto cell extract (Extract), in cell extract following lectin clarification (Lectin Clarification), in the lysate prior to passing over the Bio-Gel P-6 resin (Input), in the pellet following centrifugation of the resin (Pellet), and in the eluate following treatment with poly-ADP-ribose glycohydrolase ARH3 (ARH3 Release).
- the data in Figure 15 demonstrates the selective purification of proteins bound to the Bio-Gel P-6 resin.
- Figure 16 shows the co- localization of poly-ADP-ribose polymers and eIF3, a marker of stress granules, in HeLa Kyoto cells following treatment with 0 or 250 ⁇ M sodium arsenite for 30 minutes and immunostaining with fluorescently-labeled antibodies specific for poly-ADP-ribose polymers and eIF3.
- the data indicate that stress granules contain proteins modified with poly-ADP-ribose polymers.
- Endogenous PARP5A, PARP12, PARP13/13.1, PARPl 5, and poly-ADP-ribose glycohydrolase (PARG) also localize to stress granules in HeLa Kyoto cells following treatment with 250 ⁇ M sodium arsenite for 30 minutes (Figure 18).
- PARPl 3.2-GFP or PARPl 5-GFP fusion protein
- overexpression of PARPI l-GFP in HeLa Kyoto cells mediates a decrease in stress granule formation following treatment with 250 ⁇ M sodium arsenite for 30 minutes (Figure 21).
- HeLa Kyoto cells transfected with a pEGFP-Cl vector expressing a PARPl 1 -GFP fusion protein were treated with sodium arsenite, and stained with anti-GFP antibodies, anti-eIF3 antibodies, and fluorescently-labeled secondary antibodies.
- HeLa Kyoto cells were cultured as described above. Lipofectamine 2000 (Invitrogen) was used to transfect the HeLa Kyoto cells with a pEGFP-Cl plasmid encoding a PARP-GFP fusion protein (described above) according to the manufacturer ' s instructions. For stress granule induction, cells were treated with 250 ⁇ M sodium arsenite for 30 minutes. For long-term, real-time imaging of PARP-GFP transfected HeLa cells, the cells were split into 24-well glass bottom plates and imaged every 20 minutes for 48 hours.
- HeLa Kyoto cells were cultured in medium as described above.
- Lipofectamine 2000 (Invitrogen) was used to transfect HeLa Kyoto cells with pEGFP-Cl plasmids containing the nucleic acid sequences for each PARG isoform, i.e., PARG99, PARG102, and PARGl 10 (sequences described in Meyer-Ficca et al., Exp. Cell. Res. 297(2):521-532, 2004) according to the manufacturer's instructions.
- the resulting cell lysate was immunoprecipitated using anti-GFP antibodies and the resulting immunoprecipitated proteins were electrophoresed using SDS-PAGE.
- the resulting gel indicates that each PARP-GFP fusion protein binds to several proteins and that treatment with sodium arsenite results in an alteration in the amount and identity of the proteins binding to each PARP-GFP fusion protein ( Figure 25A).
- the immunoprecipitated proteins are transferred to a membrane and immunostained with an anti-poly-ADP-ribose antibody.
- the data in this experiment show that PARP5A-GFP, PARP12-GFP, PARP13-GFP, and PARP13.1 -GFP fusion proteins bind to poly-ADP-ribosylated proteins (Figure 25B).
- the resulting proteins were transferred to a membrane and immunoblotted using commercially-available antibodies specific for different stress granule-associated proteins: Ago2, DDX6, LSMl, PABP, FMRP, elFIA, eIF2 ⁇ , eIF3 ⁇ , eIF4Al, and eIF4E.
- the data indicate that the PARP13-GFP, PARP12- GFP, and PARP5 A-GFP fusion proteins have the ability to interact with one or more of these stress granule-associated proteins under both normal (0 nM pateamine A) and stress conditions (30 nM pateamine A) ( Figure 25 C).
- HeLa S3 cells were transfected with a pEGFP-Cl plasmid encoding a GFP fusion protein of TIAl, PABP, G3BP, or Ago2, and treated with 0 or 20 nM pateamine A for 30 minutes. Lysates from these cells were immunoprecipitated using anti-GFP antibodies and immunoblotted using an anti-po Iy-ADP ribose antibody.
- G3BP1 a stress granule-associated protein, was shown to be poly-ADP- ribosylated ( Figure 26C).
- Figure 26C In order to map the specific domain in G3BP1 that is modified by a poly-ADP-ribose polymer, GFP-fusion proteins of different truncation 250 ⁇ M sodium arsenite for 60 minutes.
- the specific nucleic acid sequences encoding each G3BP1 truncation mutant are described in Tourriere et al. (J. Cell Biol. 160:823-831 , 2003).
- the cell lysate from each cell sample was immunoprecipitated using anti-GFP antibodies and immunoblotted using an anti-poly-ADP-ribose antibody.
- the data demonstrate that poly-ADP-ribosylation of G3BP1 occurs within the RNA-recognition motif (RRM) domain ("D" in Figure 26C).
- the RRM domain of G3BP1 is a domain that binds to RNA molecules.
- the poly-ADP-ribosylation of G3BP1 in the RRM domain is thought to regulate the RNA-binding activity of G3BP1.
- TIAl a stress granule-associated protein, was also shown to be poly-ADP- ribosylated ( Figure 26D).
- Figure 26D GFP-fusion proteins of full-length TlAl and a truncation mutant of TIAl lacking its RRM domain (TIA1 ⁇ RRM) were expressed in HeLa S3 cells treated with 0 or 250 ⁇ M sodium arsenite for 60 minutes.
- the specific nucleic acid sequences encoding the full-length TIAl and the TIA1 ⁇ RRM truncation mutant are described in Kedersha et al. (J. Cell Biol.
- the cell lysate from each cell sample was immunoprecipitated using anti-GFP antibodies and immunoblotting was performed using an anti-poly-ADP-ribose antibody.
- the data demonstrate that poly- ADP-ribosylation of TIAl also occurs within its RNA-recognition motif (RRM) domain ( Figure 26D).
- RRM RNA-recognition motif
- Immunoprccipitation experiments to identify proteins binding to PARP5A-GFP, PARP12-GFP, PARP13-GFP, PARP13.1-GFP, and PARP15-GFP were performed using HeLa S3 cells transfected with a pEGFP-Cl plasmid containing a nucleic acid sequence encoding each respective PARP-GFP fusion protein following treatment with 0 or 20 nM pateamine A for 30 minutes.
- the cell lysate is incubated with an anti- GFP antibody to immunoprecipitate proteins bound to each of the PARP-GFP fusion proteins using standard methods.
- the resulting immunoprepitated proteins were electrophoresed on 4-12% SDS-PAGE gels, and either stained directly with Coomassie Blue or transferred onto a membrane and immunostained with one or more of the following antibodies: anti-poly-ADP-ribose, anti-Ago2, anti-DDX6, anti-LSMl , anti- PABP, anti-FMRP, anti-elFIA, anti-eIF2 ⁇ , anti-eIF3 ⁇ , anti-eIF4Al, and anti-e!F4e antibodies.
- RNAi and niiRNA molecules regulate the activity of RNAi and niiRNA molecules in cells. Regulation of RNAi and miRNA activity in cells remains largely uncharacterized.
- Argonaut 2 a single-stranded RNAse. Using immunofluorescence microscopy we have observed that Argonaut 2 localizes to stress granules in HeLa cells treated with 250 ⁇ M sodium arsenite for 30 minutes ( Figure 27, left panel). In these experiments, cells were treated with sodium arsenite and stained using both antibodies against Argonaut 2 and eIF3 (a stress granule marker), and secondary fluorescently-labeled antibodies.
- the identification of the specific proteins co- immunoprecipitated with the PARPl 3-GFP fusion protein will help to further elucidate the role of PARPl 3 in cellular mechanisms, including its regulation of Argonaut 2 and its role in the regulation of miRNA and RNAi activity. Additional experiments were performed to determine the effect of PARP 13 knockdown on miRNA activity. For these experiments, the pGL4.72[hRlucCP]TM-vector assay (Promega) was used to measure RNAi activity in 293T cells.
- the pGL4.72[hRlucCP]TM vector contains a constitutively expressed firefly luciferase gene which is located upstream of several nucleic acid sequences targeted by an RNAi molecule.
- RNAi molecule targeting the downstream 3' sequences of the vector results in a decrease in the amount of luciferase produced from the vector.
- the pGL4.72[hRlucCP]TM vector was first engineered to contain 6 repeats of a sequence recognized by an RNAi molecule targeting the vector ("vector-target RNAi;" SEQ ID NOS: 38 and 39;
- RNAi activity may occur through the poly-ADP- ribosylation of Argonaut 2 by PARP 13 or by the ability of PARP 13 to modify or bind other proteins located within stress granules or proteins required for the assembly or disassembly of stress granules.
- Immunopreciptation experiments were performed using non-transfected HeLa cells following treatment with 0 or 250 ⁇ M sodium arsenite for 60 minutes using an anti- Argonaut 2 antibody.
- the resulting precipitated proteins were electrophoresed using 4- 12% SDS-PAGE and immunoblotted using an anti-poly- ADP ribose antibody.
- Non- transfected HeLa cells treated with 250 ⁇ M sodium arsenite for 30 minutes were also stained for immunofluorescence microscopy using antibodies specific for Argonaut 2 and eIF3 (a marker of stress granules), and a secondary fluorescently-labeled antibody (Alexa Fluor 594 and 488 antibodies).
- HeLa cell lysate was prepared from cells treated with 0 or 250 ⁇ M sodium arsenite for 30 minutes, and the lysate subsequently immunoprecipitated with an anti-Argonaut 2 antibody. The resulting precipitated proteins were immunoblotted using an anti-PARP13/13.1 antibody.
- RNAi activity was performed using a modified pGL4.72[hRlucCP]TM- vector assay (Promega).
- the pGL4.72[hRlucCP]TM- vector was modified by placing six copies of a target sequence at a position 3' to the luciferase gene.
- RNAi molecules targeting the vector were designed to bind the six copies of the target sequence (SEQ ID NOS: 34 and 35).
- the modified pGL4.72[hRlucCP]TM- vector was introduced into 293T cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
- the cells were further transfected (Lipofectamine 2000) with 10 or 20 nM of the vector-target RNAi alone or in combination with either 20 nM of a control RNAi molecule for the siRNA targeting PARPl 3 (siNeg) or an RNAi molecule targeting PARPl 3 (siPARG13), and the cells treated with 0 or 30 nM pateamine A for 60 minutes.
- the level of luciferase protein production was measured using a luciferase assay kit (Promega). The data are shown as the relative level of luciferase protein produced in cells transfected with the modified vector alone in the absence of any RNAi treatment.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biophysics (AREA)
- Epidemiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Mycology (AREA)
- Virology (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Endocrinology (AREA)
- General Physics & Mathematics (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
Abstract
Methods for treating or decreasing the likelihood of developing a stress-granule related disorder and/or cancer by administering one or more poly-ADP-ribose polymerase (PARP) inhibitors, one or more PARP activators, one or more poly-ADP-ribose glycosylase (PARG) activators, and/or one or more poly-ADP- ribose glycohydrolase ARH3 activators are disclosed.
Description
COMPOSITIONS AND METHODS FOR TREATING CANCER AND MODULATING STRESS GRANULE FORMATION
Field of the Invention
The present invention relates to the field of molecular biology and molecular medicine.
Background of the Invention Poly-adenosine diphosphate (ADP)-ribose (PAR) polymers are the product of post-translational modifications carried out by PAR polymerases (PARPs). PAR is polymerized by PARPs onto acceptor proteins using nicotinamide adenine dinucleotide (NAD+) as substrate (Figure 1). PAR polymers are localized to distinct cellular structures in different phases of the cell cycle and localize to the mitotic spindle during mitosis (Figure 2). There are at least 18 PARPs in the human genome: the domain structure for several PARPs is depicted in Figure 3. However, the specific biological function and protein substrates of these PARPs are not fully characterized (Ame et al., Bioessays 26:882-893, 2004). The identification of the function and the substrates of each member of this family of proteins has been difficult to date. PAR polymers are required for normal cell division and PARP knockouts in
Drosophila melanogaster are embryonic lethal (Tulin et al., Genes Dev. 16:2108-2119, 2002). The concentration, length, and extent of PAR branching are regulated by a balance of activities of the PARPs and PAR glycohydrolase (PARG), a highly specific, processive endo- and exo-glycosidase (Hatakeyama et al., J. Biol. Chem. 261 : 14902- 1491 1, 1986). Poly-ADP-ribose polymers have generally been implicated for a role in several different human diseases including cancer, ischemic injury, inflammatory diseases, cardiovascular diseases, and neurodegenerative disorders.
We have discovered that several PARP proteins are localized to the nucleus and/or are required for cell cycle progression through mitosis. We have also discovered a role for several PARP proteins in the formation, nucleation, and disassembly of stress granules. Stress granules are distinct cellular structures that form in the cytosol upon exposure of a cell to stress conditions. Stress granules are composed of both proteins and RNA molecules. The RNA molecules present in stress granules are mRNA molecules stalled in translation pre-initiation complexes. Stress granules are typically 100 to 200 nM in size and are commonly associated with the endoplasmic reticulum. Stress granules
have been implicated in several different disease states including cardiovascular disorders, inflammatory disorders, neurological disorders, and ischemic-reperfusion injury.
Methods and compositions for the treatment of stress granule-related disorders and cancer are presently desired.
Summary of the Invention
The invention provides methods of treating or decreasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the likelihood of developing a stress granule-related disorder in a subject requiring administering to a subject a therapeutically effective amount of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s), one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) poly- ADP ribose glycosylase (PARG) activators, and/or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARPl 1 activators. The invention also provides methods for decreasing the number of stress granules present in a cell or in a population of cells requiring contacting the cell or population of cells with an effective amount of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s), one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARG activators, and/or one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARPl 1 activators. The invention also provides compositions and kits containing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s), one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARG activator(s), and/or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARPl 1 activators.
In each of the above of the above methods, compositions, and kits, the one or more PARP inhibitor(s) may selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or even 100%) the expression (e.g., mRNA or protein) and/or activity of one or more (e.g., 1 , 2, 3, 4, or 5) of PARP5a, PARPl 2, PARP13 isoform 1 (PARP13.1), PARP isoform 2 (PARP13.2), and PARP15. In different embodiments of the above aspects of the invention, the decrease in expression of one or more of PARP5a, PARP12, PARP13.1, PARP13.2, or PARP15 is a decrease in the level of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) containing a nucleic acid sequence having at least 80% (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) sequence identity to PARP5a (SEQ ID NO: 8 or 9), PARP12 (SEQ ID NO: 18), PARPl 3.1 (SEQ ID NO: 19), PARPl 3.2 (SEQ ID NO: 20), or PARPI 5 (SEQ ID NO: 22 or 23), or a decrease in the level of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids. In different embodiments of the above
aspects, the activity of the one or more of PARP5a, PARP12, PARPl 3.1, PARPl 3.2, or PARPl 5 is poly-ADP-ribosylation of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) target protein(s) (e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, and/or a PARP protein) or formation and/or nucleation of a stress granule.
In each of the above aspects, the one or more PARG activators may selectively increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100%) the expression (e.g., mRNA and/or protein) and/or one or more activities of PARG protein or poly-ADP-ribose glycohydrolase ARH3. In different embodiments of the above aspects of the invention, the increase in expression of PARG or ARH3 is an increase in the level of one or more (e.g., 1, 2, 3, 4, 5, or 6) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or an increase in the level of one or more (e.g., 1, 2, 3, 4, 5, or 6) polypeptides encoded by these nucleic acids. In different embodiments of the above aspects, the one or more (e.g., 1, 2, 3, 4, or 5) activities of PARG or ARH3 is hydrolysis of poly-ADP-ribose (e.g., poly-ADP-ribose attached to one or more (e.g., 1 , 2, 3, 4, or 5) substrate protein(s), e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, and/or a PARP protein), the prevention of the assembly of a stress granule, or disassembly of a stress granule.
In each of the above of the above methods, compositions, and kits, the one or more PARPl 1 activator (s) may selectively increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or even 100%) the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1 , 2, 3, 4, or 5) activities of PARPl 1. In different embodiments of the above aspects of the invention, the increase in expression of PARPl 1 is an increase in the level of one or more (e.g., 1 , 2, 3, 4, or 5) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), or an increase in the level of one or more (e.g., 1 , 2, 3, 4, or 5) polypeptides encoded by these nucleic acids. In different embodiments of the above aspects, the one or more (e.g., 1 , 2, 3, 4, or 5) activities of PΛRP1 1 is poly-ADP-ribosylation of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) target protein(s) (e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, and/or a PARP protein), the prevention of the assembly of a stress granule, or the disassembly of a stress granule.
In each of the above aspects, the one or more PARP inhibitors may be an antibody or antibody fragment that selectively binds one or more (e.g., 1, 2, 3, 4, or 5) of PARP5a, PARP 12, PARP 13.1, PARPl 3.2, and PARP 15; an RNA aptamer (e.g., one or more RNA aptamers containing the sequence of one of SEQ ID NOS: 40, 49, 99-113, and 122-129); or a small molecule. In each of the above aspects, the one or more PARG activators may be one or more (e.g., 1, 2, 3, 4, or 5) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41). In each of the above aspects, the one or more PARPl 1 activators may be one or more (e.g., 1, 2, 3, 4, or 5) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17).
In each of the above methods of treatment, the one or more PARP inhibitor(s), one or more PARG activator(s), and/or one or more PARPl 1 activators may be administered once a day or one or more times a week (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, or 14 times a week), and/or administered parenterally (e.g., intravenous, intraarterial, subcutaneous, or intramuscular administration) or orally, and/or administered with one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional therapeutic agents (e.g., one or more (e.g., 1, 2, 3, 4, or 5) non-steroidal anti-inflammatory drug(s), one or more (e.g., 1 , 2, 3, 4, or 5) immunosuppressive agent(s), one or more (e.g., 1, 2, 3, 4, or 5) calcineurin inhibitors, and/or one or more (e.g., 1, 2, 3, 4, or 5) analgesic(s)). In each of the above methods of treating a cell or cell population, the contacting may result in a reduction in the number of stress granules in a cell (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction in the number of stress granules in a cell or cell population compared to a control cell or cell population, e.g., a cell or cell population from a person having or diagnosed with a stress granule-related disorder).
The invention further provides methods of treating or decreasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the likelihood of developing cancer in a subject requiring administering to a subject a therapeutically effective amount of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s). The invention also provides methods for decreasing (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or even 100%) proliferation of a cell or a population of cells requiring contacting the cell or population of cells with an effective amount of one or more
(e.g.,1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s). The invention also provides compositions and kits containing one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s).
In each of these methods, compositions, and kits, the one or more PARP inhibitor(s) may selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or even 100% decrease) the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5Λ, PΛRP5B, PARP7, PARP8, PARP14, and PARP16. In different embodiments of these aspects of the invention, the decrease in expression of the one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARPl 6 is a decrease in the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARPl 4 (SEQ ID NO: 21), or PARP 16 (SEQ ID NO: 24), or a decrease in the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids. In different embodiments of these aspects of the invention, the one or more activities of the one or more of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, or PARPl 6 is poly-ADP-ribosylation of one or more (e.g., 1 , 2, 3, 4, or 5) target protein(s) (e.g., a protein localized in the nucleus or mitotic spindle during cytokinesis, and/or a PARP protein) or is required for progression through mitosis.
In each of the these aspects, the one or more PARP inhibitors may be an antibody or antibody fragment that selectively binds one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARPl 4, and PARP 16; an RNA aptamer (e.g., an RNA aptamer containing the sequence of one or more of SEQ ID NOS: 43-46, 49, 50, 59-74, 1 14-121 , and 130-136); or a small molecule. In each of these methods of treatment, the one or more PARP inhibitor(s) may be administered once a day or one or more times a week (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, or 14 times a week), and/or administered parenterally (e.g., intravenous, intraarterial, subcutaneous, or intramuscular administration) or orally, and/or administered with one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional therapeutic agents (e.g., one or more (e.g., 1 , 2, 3. 4, or 5) chemotherapeutic agents, one or more (e.g., 1 , 2, 3, 4, or 5) non-steroidal anti- inflammatory drug(s), one or more (e.g., 1 , 2, 3, 4, or 5) immunosuppressive agent(s), one or more (e.g., 1 , 2, 3, 4, or 5) calcineurin inhibitors, and/or one or more (e.g., 1 , 2, 3, 4, or
5) analgesic(s)). In each of the these methods of treating a cell or cell population, the contacting may result in a reduction in the rate of proliferation of a cell or cell population (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction in the rate of proliferation of a cell or cell population compared to a control cell or cell population, e.g., a cancer cell or a cancer cell line).
The invention further provides methods for increasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the number of stress granules in a cell or cell population by contacting the cell or cell population with an effective amount of one or more (e.g., 1, 2, 3, 4, 5, 6, 1, 8, 9, or 10) PARP activators, one or more (e.g., 1, 2, 3, 4, or 5) PARG inhibitors, and/or one or more (e.g., 1 , 2, 3, 4, or 5) PARPl 1 inhibitors. In one embodiment of these methods, the one or more PARP activators selectively increase the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1 , 2, 3, 4, or 5) activities of one or more (e.g., 1, 2, 3, 4, or 5) of PARP5A, PARP12, PARP 13.1, PARPl 3.2, and PARPl 5. In different embodiments of these methods, the increase in expression is an increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, or even 100% increase) in the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5b (SEQ ID NO: 10), PARP13.1 (SEQ ID NO: 19), PARP 13.2 (SEQ ID NO: 20), or PARPl 5 (SEQ ID NO: 22 or 23), or an increase in the level of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids. In different embodiments of this method, the one or more activities of PARP5A, PARP12, PARP13.1 , PARP13.2, and PARP15 is the poly-ADP-ribosylation of one or more (e.g., 1 , 2, 3, 4, or 5) target protein(s) (e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP protein) or the formation or nucleation of a stress granule.
In different embodiments of this method, the one or more PARG inhibitors may selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1 , 2, 3, 4, or 5) activities of PARG or ARH3. In additional embodiments of this method, the decrease in expression of PARG or ARH3 is a decrease in the level of one or more (e.g., 1 , 2, 3, 4, 5, or 6) nucleic acid(s) containing a nucleic sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or a decrease in the levels of one or more (e.g., 1 , 2, 3, 4, 5, or 6) polypeptides encoded by these nucleic acids. In additional
embodiments of this method, the one or more activities of PARG or ARH3 is the hydrolysis of poly-ADP-ribose (e.g., poly-ADP-ribose that is covalently attached to one or more (e.g., 1, 2, 3, 4, or 5) substrate protein(s), e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP protein), the prevention of assembly of a stress granule protein, or disassembly of a stress granule.
In an additional embodiment of this method, the one or more PARPl 1 inhibitors may selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the expression (e.g., mRNA and/or protein) and/or one or more activities of PARPl 1. In different embodiments of this method, the decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) in expression of PARPl 1 is a decrease in the level of one or more (e.g., 1, 2, 3, 4, or 5) nucleic acid(s) containing a nucleic acid having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), or a decrease in the level of one or more (e.g., 1, 2, 3, 4, or 5) polypeptides encoded by these nucleic acids. In different embodiments of this method, the one or more activities of PARPl 1 is poly-ADP-ribosylation of one or more (e.g., 1 , 2, 3, 4. or 5) target protein(s) (e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP protein), the prevention of the assembly of a stress granule, or disassembly of a stress granule.
In additional embodiments of this method, the one or more PARP activators is one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) comprising a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARPl 3.1 (SEQ ID NO: 19), PARPl 3.2 (SEQ ID NO: 20), or PARPl 5 (SEQ ID NO: 22 or 23). In additional embodiments of this method, the one or more PARG inhibitors is an antibody or antibody fragment that selectively binds to PARG or ARH3; an RNA aptamer (e.g., a nucleic acid sequence that contains one or more of SEQ ID NOS: 34-37); or a small molecule. In additional embodiments of this method, the one or more PARPl 1 inhibitors may be an antibody or an antibody fragment that selectively binds to PARPl 1 ; an RNA aptamer (e.g., a nucleic acid sequence that contains one or more of SEQ ID NOS: 91 -98); or a small molecule.
In additional embodiments of this method, the contacting results in at least a 10% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) reduction in the number of stress granules present in the cell or the population of cells compared to a
control cell or population of cells (e.g., a cell or population of cells untreated with a PARP activator, a PARG inhibitor, or a PARPl 1 inhibitor, e.g., a cell from a subject having or diagnosed with a stress-granule disorder). In additional embodiments of this method, the cell or population of cells is a mammalian cell(s) or a plant cell(s). The invention also provides methods of increasing (e.g., by at least 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the proliferation of a cell or a population of cells requiring contacting the cell or population of cells with an effective amount of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP activators. In different embodiments of this method, the one or more PARP activators selectively increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the expression (e.g., mRNA and/or protein) and/or one or more activities (e.g., 1, 2, 3, 4, or 5) of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP 14, and PARPl 6. In additional embodiments of this method, the increase in expression of one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, or PARPlό is an increase in the level of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) comprising a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24), or an increase in the level of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids. In additional embodiments of this method, the one or more activities of said one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, or PARP16 is poly-ADP-ribosylation of one or more (e.g., 1, 2, 3, 4, or 5) target protein(s) (e.g., a protein localized in the nucleus or mitotic spindle during cytokinesis, and/or a PARP protein) or is required for progression through mitosis.
In additional embodiments of this method, the one or more PARP activators is one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24). In different embodiments of this method, the cell or cell population is a plant cell(s) or mammalian cell(s). In different embodiments of this method, the contacting results in at least a 10% increase (e.g., at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% increase) in the rate of proliferation of the cell
or population of cells compared to a control cell or cell population (e.g., a cell or cell population not treated with a PARP activator).
The invention further provides methods for identifying a candidate agent for treating or decreasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the likelihood of developing a stress granule-related disorder requiring the steps of: providing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, or 20) PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins encoded by a nucleic acid containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP 12 (SEQ ID NO: 18), PARPl 3.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP15 (SEQ ID NO: 22 or 23), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41); contacting the one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins with the agent and a labeled nicotinamide adenine dinucleotide (NAD+) substrate; and measuring one or more (e.g., 1, 2, 3, 4, or 5) activities of the one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins, or the specific binding of the agent to said one or more PARP proteins and/or PARP fusion proteins; wherein an agent that decreases (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the one or more activities and/or specifically binds to the one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) PARP proteins and/or PARP fusion proteins, and/or increases the activity of the one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) PARG and/or ARH3 proteins, and/or PARG and/or ARH3 fusion proteins is identified as a candidate agent for treating or decreasing the likelihood of developing a stress granule- related disorder. The invention further provides methods for identifying a candidate agent for treating or decreasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the likelihood of developing cancer requiring the steps of providing one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) PARP protein(s) and/or PARP fusion protein(s) encoded by a nucleic acid containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%,
99%, or even 100%) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ ID NO: 1 T), PARP8 (SEQ ID NO: 13), PARPl 4 (SEQ ID NO: 21 ), or PARPl 6 (SEQ ID NO: 24); contacting the one or more PARP protein(s) and/or PARP fusion protein(s) with the agent and a labeled NAD+ substrate; and measuring the one or more (e.g., 1 , 2, 3, 4, or 5) activities of
the one or more PARP protein(s) and/or PARP fusion protein(s), and/or the specific binding of the agent to the one or more PARP protein(s) and/or PARP fusion protein(s); wherein an agent that decreases (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the one or more activities and/or specifically binds to the one or more PARP protein(s) and/or fusion protein(s) is identified as a candidate for treating or reducing the likelihood of developing cancer.
In different embodiments of the screening methods, the labeled NAD+ substrate is labeled with a radioisotope (e.g., 32P) or fluorophore, or is biotinylated. In different embodiments of the screening methods, the one or more PARP, PARG, and/or ARH3 protein(s) and/or PARP, PARG, and/or ARH3 fusion protein(s) is purified. In another embodiment of the screening methods, the one or more PARP, PARG, and/or ARH3 protein(s) and/or PARP, PARG, and/or ARH3 fusion protein(s) is present in a cell lysate. In different embodiments of the screening methods, the agent is a small molecule (e.g., a small molecule from a chemical library), a polypeptide or peptide fragment (e.g., a polypeptide or peptide fragment present in a cellular lysate), or a nucleic acid. In additional embodiments of the above screening methods, the one or more PARP, PARG, and/or ARH3 protein(s) and/or PARP, PARG, and/or ARH3 fusion protein(s) is attached to a substrate (e.g., a magnetic bead) or a solid surface. In additional embodiments of the above screening methods, the method is performed in a multi-well plate. The invention further provides methods for determining the propensity of a subject to develop a stress granule-related disorder by determining the expression and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARP5A, PARPI l, PARP12, PARPl 3.1, PARPl 3.2, PARPl 5, PARG, and ARH3 in a subject, wherein an increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) in the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1 , 2, 3, 4, or 5) activities of one or more (e.g., 1 , 2, 3, 4, or 5) of PARP5A, PARP12, PARPl 3.1 , PARPl 3.2, and PARP15, and/or a decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) in the expression (e.g., mRNA and/or protein) or one or more (e.g., 1, 2, 3, 4, or 5) activities of one or more (e.g., 1, 2, or 3) of PARPl 1 , PARG, or ARH3 indicates an increased propensity to develop a stress granule- related disorder. In an additional embodiment of this method, the expression is the level of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARPI l (SEQ lD NO: 17), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID
NO: 20), PARPl 5 (SEQ ID NO: 20 or 23), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41), or the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids.
The invention also provides a method for determining the propensity of a subject to develop cancer comprising determining the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16 in a subject, wherein an increase in the expression and/or one or more activities of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARPl 6 indicates an increased propensity to develop cancer. In an additional embodiment of this method, the expression is the level of one or more (e.g.,
1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24), or the level of one or more polypeptides (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) encoded by these nucleic acids.
In any of the above screening methods, the expression of the one or more (e.g., 1 ,
2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) is determined using reverse transcriptase polymerase chain reaction (RT-PCR). In additional embodiments of the above screening methods, the expression of the one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptide(s) is determined using an antibody-based technique (e.g., imunoblotting or an enzyme-linked immunosorbent assay (ELISA)).
In all of the above aspects, a stress granule-related disorder may be a cardiovascular disorder (e.g., an aneurysm, angina, atherosclerosis, stroke, cerebrovascular disease, congestive heart failure, coronary artery disease, myocardial disease, peripheral vascular disease, granulomatous myocarditis, chronic myocarditis, myocardial infarction, and primary hypertrophic cardiomyopathy), an inflammatory disorder (e.g., an autoimmune disease, asthma, an allergic intraocular inflammatory disease, arthritis, atopic dermatitis, atopic eczema, cirrhosis, Crohn's disease, ulcerative colitis, diabetes, hemolytic anemia, inflammatory dermatosis, an inflammatory bowel disorder, systemic lupus erythamatosus, psoriasis, rheumatoid arthritis, Wegener's granulomatosis, Hashimoto's thyroiditis, chronic pancreatitis, and reactive lymphoid hyperplasia), a neurological disorder (e.g., multiple sclerosis, Alzheimer's disease, Parkinson's disease, Huntingon's disease, amyotrophic lateral sclerosis, retinosa
pigmentosum, macular degeneration, traumatic brain injury, stroke, and peripheral neuropathy), or ischemic-reperfusion injury. In different embodiments of all the above aspects, the treating may result in a reduction (e.g., at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction) in one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) symptoms of a stress granule-related disorder or a reduction (e.g., at least a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction) in the likelihood of developing a stress granule-related disorder.
In all the above aspects, the cancer may be colon adenocarcinoma, esophagas adenocarcinoma, liver hepatocellular carcinoma, squamous cell carcinoma, pancreas adenocarcinoma, islet cell tumor, rectum adenocarcinoma, gastrointestinal stromal tumor, stomach adenocarcinoma, adrenal cortical carcinoma, follicular carcinoma, papillary carcinoma, breast cancer, ductal carcinoma, lobular carcinoma, intraductal carcinoma, mucinous carcinoma, phyllodes tumor, Ewing's sarcoma, ovarian adenocarcinoma, endometrium adenocarcinoma, granulose cell tumor, mucinous cystadenocarcinoma, cervix adenocarcinoma, vulva squamous cell carcinoma, basal cell carcinoma, prostate adenocarcinoma, giant cell tumor of bone, bone osteosarcoma, larynx carcinoma, lung adenocarcinoma, kidney carcinoma, urinary bladder carcinoma, Wilm's tumor, lymphoma, and non-Hodgkin's lymphoma. In different embodiments of all the above aspects, said treating may result in a reduction (e.g., at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction) in one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) symptoms of a cancer or a reduction (e.g., at least a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction) in the likelihood of developing a cancer.
In all the above aspects of the invention, the cell or population of cells is an epithelial cell, a fibroblast, a kidney cell, a muscle cell, a neuron, a hepatocyte, an oocyte, a sperm, a lymphocyte, or a macrophage.
In all the above aspects of the invention, the compositions may be formulated for parenteral or oral administration.
By the term "ARH3" or "poly-ADP-ribose glycohydrolase ARH3" is meant a nucleic acid having containing a sequence at least 80% identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identical) to the sequence of SEQ ID NO: 41 , or one or more polypeptides encoded by these nucleic acids.
By the term "ARH3 fusion protein" or "poly-ADP-ribose glycohydrolase ARH3 fusion protein" is meant a polypeptide containing a polypeptide tag and a sequence having at least 80% identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even
100% identity) to a protein encoded by ARH3 (SEQ ID NO: 41). The polypeptide tag of an ARH3 fusion protein may be located at the N- and/or C- terminus of the protein. The polypeptide tag may contain one or more of a fluorescent protein (e.g., a green fluorescence protein), a peptide epitope recognized by specific antibodies, a protein that is bound by a partner binding protein with high affinity (e.g., biotin and streptavidin), a His6-tag, or one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) protease recognition sequence(s) (e.g., one or more of a TEV protease or Factor Xa protease recognition sequence). ARH3 fusion proteins may be purified using antibodies specific for the polypeptide tag. For example, antibodies specific for the polypeptide tag or proteins that bind specifically to the protein sequence in the polypeptide tag may bound to a bead (e.g., a magnetic bead) or polymer surface in order to allow for the purification of the ARH3 fusion protein. An ARH3 fusion protein may also be purified and subsequently treated with one or more (e.g., 1 , 2, or 3) protease(s) to remove the polypeptide tag from the ARH3 fusion protein. An ARH3 fusion protein preferably has the same cellular localization and biological activity as the wild-type ARH3 protein. Methods for the generation and purification of ARH3 fusion proteins are described herein.
By the term "biotinylated" is meant the covalent attachment of a biotin molecule to a small molecule, surface, or protein. A biotin molecule may be attached to a small molecule, surface, or protein using methods known in the art including, but not limited to, attachment to primary amines (e.g., epsilon-amines and N-terminal α-amines of a protein), as well as attachment at a sulfhydryl group, and a carboxyl group. Small molecules (e.g., NAD+) and proteins (e.g., one or more of the PARP fusion proteins described herein) may be biotinylated. Biotinylated NAD+ is available from a number of commercial sources including R & D Systems, Gcntaur, and Trevigen (e.g., 6-biotin-17- NAD). Biotinylated small molecules and substrates may be specifically bound and/or purified using streptavidin, a protein that has a high affinity for biotin (Ka ~ 1013 M"'), or surfaces covalently attached to streptavidin (e.g., streptavidin-coated beads).
By the term "cancer" is meant a disease of uncontrolled or misregulated cell proliferation or cell division. Non-limiting examples of cancer include colon adenocarcinoma, esophagas adenocarcinoma, liver hepatocellular carcinoma, squamous cell carcinoma, pancreas adenocarcinoma, islet cell tumor, rectum adenocarcinoma, gastrointestinal stromal tumor, stomach adenocarcinoma, adrenal cortical carcinoma, follicular carcinoma, papillary carcinoma, breast cancer, ductal carcinoma, lobular carcinoma, intraductal carcinoma, mucinous carcinoma, phyllodes tumor, Ewing's sarcoma, ovarian adenocarcinoma, endometrium adenocarcinoma, granulose cell tumor,
mucinous cystadenocarcinoma, cervix adenocarcinoma, vulva squamous cell carcinoma, basal cell carcinoma, prostate adenocarcinoma, giant cell tumor of bone, bone osteosarcoma, larynx carcinoma, lung adenocarcinoma, kidney carcinoma, urinary bladder carcinoma, Wilm's tumor, lymphoma, and non-Hodgkin's lymphoma. By the term "cell lysate" is meant the contents of the cell once the plasma membrane has been disrupted or permeabilized. Cell lysate also includes the contents of the intracellular organelles (e.g., endoplasmic reticulum, nucleus, mitochondria, chloroplasts, Golgi apparatus, and lysosome) upon disruption of their respective membranes. Cell lysate contains an unpurified mixture of proteins, small molecule metabolites, and nucleic acids (e.g., DNA and RNA). Cell lysate may be prepared from any type of cell, e.g., a mammalian cell (e.g. human, mouse, rat, and monkey cell), a bacterial cell, fungal cell, and a yeast cell. Cell lysate may be obtained by any methods known in the art including physical disruption (e.g., sonication, homogenization, or freeze/thaw procedures) or chemical disruption (e.g., treatment with a detergent (e.g., Triton-X-100 and NP-40)). Cell lysate may be prepared from a cell expressing one or more of the nucleic acid(s) that encode one or more PARP, PARG, and/or ARH3 proteins and/or one or more PARP, PARG, and/or ARH3 fusion protein(s). Cell lysate may also be prepared from a cell arrested in a specific stage of the cell cycle (e.g., mitosis or S- phase) or may be prepared from asynchronous cells. By the term "constitutive promoter" is meant a promoter that is placed 5' relative to a nucleic acid sequence encoding a protein, wherein the promoter regulates the consistent expression of a nucleic acid encoding a protein. The sequence of the constitutive promoter may be directly (no extraneous nucleotides) 5' to the first nucleotide of the sequence encoding the protein (e.g., a PARP, PARG, and/or ARH3 protein and/or a PARP, PARG, and/or ARH3 fusion protein as described herein) or may be between 1 -20 nucleotides, 1-100 nucleotides, 10-260 nucleotides, 100-700 nucleotides, or 100 to 2,000 nucleotides from the first nucleotide of the sequence encoding the protein. Examples of constitute promoters include, but are not limited to, bacterial promoters (e.g., E. coli σ70, σs, σ32, or σ54 promoters; B. subtilis σA or σB promoters; T7 RNA polymerase-based promoters; and bacteriophage SP6 promoter), yeast promoters (e.g., pCyc, pAdh, pSte5, ADHl, eye 100, cyc70, cyc43, cyc28, eye 16, pPGKl , pCYC, GPD (TDH3), and CLBl promoters), and mammalian promoters (e.g., cytomegalovirus immediate early gene-based promoters, SV40 early promoter, and Rous sarcoma virus promoter). A constitutive promoter may be used to mediate the expression of a nucleic acid (e.g., one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein,
and/or a PARP, PARG, and/or ARH3 fusion protein as described herein) in a transgenic mammalian, bacterial, or yeast cell.
By the term "disassembly" of a stress granule is meant the process of deconstructing or dissolution of one or more stress granules in a cell or cell population. The disassembly of a stress granule may take place by the catalytic activity of one or more proteins (e.g., one or more of a PARG, ARH3, and/or PARPl 1, and/or a PARG, ARH3, and/or PARPl 1 fusion protein). The disassembly of a stress granule in a cell or cell population may occur following the removal of a stress condition (e.g., washout of sodium arsenite or pateamine A from the culture medium). By the term "effective amount" or "therapeutically effective amount" is meant the amount of the agent administered to a subject, to a cell, or to a cell population that elicits a specific desirable effect. For example, the amount of an agent (e.g., one or more PARP inhibitor(s), one or more PARG activator(s), and/or one or more PARPl 1 activator(s)) that decreases the number (e.g., prevents 1, 2, 3, 4, or 5 symptoms from occurring) or severity (e.g., decrease of at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% in the severity) of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) symptoms of a stress granule-related disorder or the amount of an agent (e.g., one or more PARP inhibitors)) that decreases the number or severity of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) symptoms of cancer. The effective amount or therapeutically effective amount of an agent may determined by a skilled artisan using methods known in the art and the methods described herein.
By "formation" of a stress granule is meant a series of events that lead to the appearance of distinct protein- and RNA-containing stress granules in the cytoplasm. The formation of a stress granule in a cell may be accelerated by exposure to stress conditions, including, but not limited to, chemical stress (e.g., sodium arsenite and pateamine A). By "nucleation" of a stress granule is meant one of the initial steps or initial rate-limiting steps in the formation of a stress granule in a cell. Examples of proteins involved in the formation or nucleation of stress granules include, without limitation, PARP 5A, PARP12, PARP13.1 , PARP13.2, and PARP 15. By "labeled nicotinamide adenine dinucleotide" or "labeled NAD+" is meant a molecule of nicotinamide adenine dinucleotide (NAD+) that is covalently labeled with a fluorescent molecule, a colorimetric molecule, or a molecule that is recognized by a specific partner protein (e.g., biotinylation), or labeled with a radioisotope. One example of a labeled NAD+ is biotinylated NAD+ (e.g., 6-biotin-14-NAD). Examples of
radiolabeled NAD+ include, but are not limited to, 14C-adenine-NAD+, 32P-NAD+, and 3H- NAD+. Additional examples of labeled NAD+ are known in the art.
By the term "short RNA or DNA aptamer" is meant a short sequence of DNA or RNA nucleotides that binds to a specific target molecule (e.g., a protein or a target RNA or DNA molecule). A DNA or RNA aptamer that specifically binds to its target molecule (e.g., one or more (e.g., 1, 2, 3, 4, or 5) of the nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or a PARP, PARG, and/or ARH3 fusion protein (as described herein) may decrease (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) or increase (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) one or more (e.g., 1, 2, 3, 4, or 5) activities or expression (e.g., mRNA or protein level) of the respective target molecule. For example, a specific DNA or RNA aptamer may bind to one or more of the above-described PARP proteins or PARP fusion proteins and increase or decrease the poly-ADP ribosylation activity of the protein, the amount of poly-ADP ribose attached to the protein, or the levels of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP proteins or PARP fusion proteins. The specific DNA or RNA aptamer may also bind to one or more nucleic acids (e.g., DNA or RNA) that encode a specific PARP, PARG, and/or ARH3 protein (e.g., a nucleic acid that encodes a protein having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 1 1), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARP10 (SEQ ID NO: 15), PARPl 0.2 (SEQ ID NO: 16), PARPI l (SEQ ID NO: 17), PARP12 (SEQ ID NO: 18), PARP13.1 (SEQ ID NO: 19), PARP 13.2 (SEQ ID NO: 20), PARP14 (SEQ ID NO: 21), PARP15.1 (SEQ ID NO: 22), PARPl 5.2 (SEQ ID NO: 23), PARPl 6 (SEQ ID NO: 24), PARG (SEQ ID NO: 42), and ARH3 (SEQ ID NO: 41)), and mediate an increase or decrease in the expression (e.g., protein and/or mRNA level) of the PARP, PARG, or ARH3. A specific example of an RNA aptamer is an inhibitory RNA (RNAi) molecule. Methods for the design of RNAi molecules are known in the art. Examples of specific RNAi molecules that may be used to decrease the expression of a PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and/or ARH3 fusion protein are described herein.
By the term "fluorescent protein" is meant a protein that absorbs light of a specific wavelength (e.g., absorption wavelength) and emits light with a longer wavelength (e.g., emission wavelength). The term fluorescent protein encompasses
natural fluorescent proteins (i.e., the natural form of the fluorescent protein without any genetic manipulations) and genetically mutated fluorescent proteins (e.g., fluorescent proteins engineered to change the identity of one or more amino acid residues). Several different examples of fluorescent proteins are known in the art, including, but limited to, green fluorescent proteins (e.g., GFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen, T-Sapphire, and T-Sapphire), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mTagBFP), cyan fluorescent proteins (e.g., ECFP, mECFP, Cerulean, CyPet, AmCyanl, Midori-Ishi Cyan, TagCFP, mTFPl (Teal)), yellow fluorescent proteins (e.g., EYFP, Topaz, Venus, mCitrine, YPet, Tan YFP, Phi YFP, ZsYellowl, and mBanana), orange fluorescent proteins (e.g., Kusabira Orange, Kurabira Orange2, mOrange, mθrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP- T, DsRed, DsRed2, DsRed-Express (Tl), DsRed-Monomer, and mTangerine), and red fluorescent proteins (e.g., mRuby, mApple, mStrawberry, AsRed2, mRFPl, JRed, mCherry, HcRedl , mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum, and AQ143). Fluorescent proteins may be attached to the N- and/or C-terminus of a target protein (e.g., one or more of the PARP, PARG, and/or ARH3 fusion proteins described herein). Fusion proteins tagged with a fluorescent protein (e.g., one or more of the PARP, PARG, and/or ARH3 fusion proteins described herein) may be analyzed using fluorescence-based techniques known in the art (e.g., fluorescence microscopy, fluorescence plate readers, fluorescence-assisted cell sorting, and use of a second antibody specific for the fluorescent protein).
By the term "inducible promoter" is meant a promoter that is placed 5' relative to a nucleic acid sequence encoding a protein, wherein the promoter induces (or represses) the expression of a nucleic acid upon addition (or removal) of a specific molecule or protein. The sequence of the inducible promoter may be directly (no extraneous nucleotides) 5' to the first nucleotide of the sequence encoding the protein (e.g., a PARP fusion protein as described herein) or may be between 1 -20 nucleotides, 1 -100 nucleotides, 10-260 nucleotides, 100-700 nucleotides, or 100 to 2,000 nucleotides from the first nucleotide of the sequence encoding the protein. Examples of inducible promoters include, but are not limited to alcohol dehydrogenase I gene promoters, tetracycline-responsive promoter systems, glucocorticoid receptor promoters, estrogen receptor promoter, ecdysone receptor promoters, metal lothionein-based promoters, and T7-polymerase based promoters. An inducible promoter may be used to regulate the expression of a nucleic acid (e.g., one or more nucleic acids encoding a PARP, PARG,
and/or ARH3 protein and/or PARP, PARG, and/or ARH3 fusion protein as described herein) in a transgenic mammalian, bacterial, or yeast cell.
By the term "nuclear lysate" is meant the contents of a nucleus upon disruption of the nuclear membrane. Nuclear lysate contains an unpurifϊed mixture of proteins, small molecule metabolites, and nucleic acids (e.g., DNA and RNA). Nuclear lysate may be prepared from any type of nucleated cell, e.g., a mammalian cell (e.g. human, mouse, rat, and monkey cell), a fungal cell, a yeast cell, or a plant cell. Nuclear lysate may be obtained by any methods known in the art including stepped lysis using two different concentrations of detergents (e.g., NP-40) or a combination of physical treatment to rupture the plasma membrane and chemical treatment to rupture the nuclear membrane. Nuclear lysate may be prepared from a cell expressing one or more of the nucleic acid(s) of the invention that encode a one or more PARP, PARG, or ARH3 proteins or PARP, PARG, or ARH3 fusion protein(s).
By "PAR" or "poly- ADP ribose" is meant a chain of two or more ADP-ribose molecules. The two or more molecules of ADP-ribose making up PAR may occur in a single linear chain or as a branched chain with one or more branches (e.g., at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 branches). PoIy-ADP ribose may be attached to a specific substrate (e.g., protein, lipid, DNA, RNA, or small molecule) by the activity of one or more PARP proteins or PARP fusion proteins (e.g., one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22) of PARPl, PARP2, PARP3, PARP3.2, PARP3.3, PARP4, PARP5A, PARP5B, PARP6, PARP7, PARP8, PARP9, PARPlO, PARPl 1, PARP12, PARP13.1, PARP13.2, PARP14, PARP15.1, PARP15.2, and PARPl 6, or one or more of their respective fusion proteins) or removed by the activity of one or more PARG protein, PARG fusion protein, ARH3 protein, or ΛRH3 fusion protein (e.g., PARG protein or ARH3). Attachment of poly-ADP-ribose to a substrate protein may affect the biological activity of the substrate protein, localization of the protein, or the identity and number of proteins that bind to the target substrate (e.g., protein). PARP proteins may also be modified by the covalent attachment of poly-ADP-ribose. The addition of poly-ADP ribose to a PARP protein may occur by "auto-modification" or "auto-modulation" (i.e., a specific PARP catalyzes the attachment of poly-ADP ribose to itself) or may occur by the activity of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) other PARP proteins.
By the term "poly-ADP-ribose glycolase" or "PARG" is meant any enzyme that has the ability to remove an ADP-ribose attached to a substrate (e.g., a protein, RNA molecule, DNA molecule, or lipid) or to remove one or more ADP-ribose molecules from
a pre-existing poly-ADP-ribose molecule covalently attached to a substrate (e.g., a protein, RNA molecule, DNA molecule, or lipid). For example, a PARG may be one or more nucleic acids containing a sequence having at least 80% identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or one or more polypeptides encoded by these nucleic acids. A PARG may have additional biological activities, such as decreasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or even 100%) the formation or rate of formation of a stress granule in a cell or increasing the rate of disassembly of a stress granule. The term PARG also includes the isoforms of PARG proteins described in Meyer-Ficca et al., Exp. Cell. Res. 297(2):521-532, 2004.
By the term "PARG protein" or "poly-ADP-ribose glycolase protein" is meant is meant a polypeptide encoded by a nucleic acid containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identical) to the sequence of SEQ ID NO: 42. By the term "PARG fusion protein" or "poly-ADP-ribose glycolase fusion protein" is meant a polypeptide containing a polypeptide tag and a sequence encoded by a nucleic acid containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARG (SEQ ID NO: 42). The polypeptide tag of a PARG fusion protein may be located at the N- and/or C- terminus of the protein. The polypeptide tag may contain one or more of a fluorescent protein (e.g., a green fluorescence protein), a peptide epitope recognized by specific antibodies, a protein that is bound by a partner binding protein with high affinity (e.g., biotin and streptavidin), a Hisβ-tag, or one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) protease recognition sequence(s) (e.g., one or more of a TEV protease or Factor Xa protease recognition sequence). PARG fusion proteins may be purified using antibodies specific for the polypeptide tag. For example, antibodies specific for the polypeptide tag or proteins that bind specifically to the protein sequence in the polypeptide tag may bound to a bead (e.g., a magnetic bead) or polymer surface in order to allow for the purification of the PARG fusion protein. A PARG fusion protein may also be purified and subsequently treated with one or more (e.g., 1 , 2, or 3) protease(s) to remove the polypeptide tag from the PARG fusion protein. A PARG fusion protein preferably has the same cellular localization and biological activity as the wild-type PARG protein. Methods for the generation and purification of PARG fusion proteins are described herein.
By the term "poly-ADP-ribose glycolase activator" or "PARG activator" is meant an agent that increases (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%,
or even 100%) the expression (e.g., protein and/or mRNA level) or one or more (e.g., 1, 2, 3, 4, or 5) biological activities of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARG proteins. For example, a PARG activator may increase the levels of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acids containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or increase the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids. A PARG activator may increase one or more of the biological activities of a PARG including the ability to remove a ADP-ribose attached to a substrate (e.g., a protein, RNA molecule, DNA molecule, lipid, or small molecule), the ability to remove one or more ΛDP-ribose molecules from a pre-existing poly- ADP-ribose molecule covalently attached to one or more substrate(s) (e.g., a protein, RNA molecule, DNA molecule, lipid, or small molecule), the ability to decrease or prevent the formation or the rate of formation of a stress granule in a cell, or the ability to increase the rate of disassembly of a stress granule. Non-limiting examples of PARG activators include one or more nucleic acids containing a nucleic acid having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41).
By the term "poly-ADP-ribose glycolase inhibitor" or "PARG inhibitor" is meant an agent that decreases (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the expression (e.g., protein and/or mRNA level) or one or more (e.g., 1, 2, 3, 4, or 5) biological activities of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARGs. For example, a PARG inhibitor may decrease the levels of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or ] 0) nucleic acids containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even
] 00%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41 ), or decrease the level of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids. A PARG activator may decrease one or more (e.g., 1 , 2, 3, 4, or 5) of the biological activities of a PARG including, but not limited to, the ability to remove a ADP- ribose attached to one or more substrate(s) (e.g., a protein, RNA molecule, DNA molecule, lipid, or small molecule), the ability to remove one or more ADP-ribose molecules from a pre-existing poly-ADP-ribose molecule covalently attached to a substrate (e.g., a protein, RNA molecule, DNA molecule, lipid, or small molecule), the ability to decrease or prevent the formation or the rate of formation of a stress granule in a cell, or the ability to increase the rate of disassembly of a stress granule. Non-limiting
examples of PARG inhibitors include antibodies or antibody fragments that specifically bind to PARG protein, ARH3 protein, PARG fusion protein, or ARH3 fusion protein; RNAi molecules (e.g., a nucleic acid sequence that contains the sequence of one of SEQ ID NOS: 34-37), or small molecules. By the term "peptide fragment" is meant a protein having at least 2 amino acids
(e.g., at least 5, 10,. 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acids), but having fewer amino acids than the wild-type protein. Non-limiting examples of peptide fragments have between 2 to 250 amino acids, 5 to 200 amino acids, between 5 to 150 amino acids, or between 5 to 100 amino acids. A peptide fragment may also represent a protein that has been processed to remove one or more (e.g., 1, 2, or 3) post-translational targeting sequences (e.g., nuclear localization sequence, ER signal peptide, mitochondrial targeting signal, nuclear export sequence, or N-terminal secretion sequence).
By "poly-ADP ribose polymerase nucleic acid" or "PARP nucleic acid" is meant any nucleic acid containing a sequence that has at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% sequence identity) to one or more of PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 1 1), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARPlO (SEQ ID NO: 15), PARPl 0.2 (SEQ ID NO: 16), PARPI l (SEQ ID NO: 17), PARP12 (SEQ ID NO: 18), PARPl 3.1 (SEQ ID NO: 19), PARPl 3.2 (SEQ ID NO: 20), PARP14 (SEQ ID NO: 21), PARP 15.1 (SEQ ID NO: 22), PARPl 5.2 (SEQ ID NO: 23), and PARPl 6 (SEQ ID NO: 24). A PARP nucleic acid encodes a protein that has a catalytic activity of attaching an ADP-ribose to a substrate (e.g., protein, DNA, RNA, lipid, or small molecule) or attaching one or more ADP-ribose molecules to an ADP-ribose molecule already attached to the substrate (e.g., protein, DNA, RNA, lipid, or small molecule) to create poly-ADP ribose. A PARP nucleic acid may encode a protein having additional activities to those described above (e.g., mediates increased stress granule formation, role in progression through mitosis or cytokinesis, and modulation (e.g., increase or decrease) of RNAi function).
By "poly-ADP ribose polymerase protein" or "PARP protein" is meant polypeptide containing a sequence having at least 80% identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to a protein encoded by a nucleic acid sequence containing the sequence of PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID
NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 11), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ lD NO: 14), PARPlO (SEQ ID NO: 15), PARP10.2 (SEQ ID NO: 16), PARPI l (SEQ ID NO: 17), PARPl 2 (SEQ ID NO: 18), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARPl 4 (SEQ ID NO: 21), PARPl 5.1 (SEQ ID NO: 22), PARPl 5.2 (SEQ ID NO: 23), and PARP16 (SEQ ID NO: 24). A PARP protein may contain one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) post-translational modifications, e.g., phosphorylation and ADP-ribosylation (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 ADP- ribose molecules) on one or more amino acid residues. Post-translation modification of a PARP protein may occur within a cell (e.g., a transgenic cell described above) or in vitro using purified enzymes. PARP protein activity assays may be performed as described herein.
By "poly-ADP ribose polymerase fusion protein" or "PARP fusion protein" is meant a polypeptide containing a polypeptide tag and a sequence having at least 80% identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to a protein encoded by one or more of PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 1 1), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARPlO (SEQ ID NO: 15), PARPl 0.2 (SEQ ID NO: 16), PARPI l (SEQ ID NO: 17), PARPl 2 (SEQ ID NO: 18), PARP13.1 (SEQ lD NO: 19), PARP13.2 (SEQ ID NO: 20), PARPl 4 (SEQ ID NO: 21), PARPl 5.1 (SEQ ID NO: 22), PARPl 5.2 (SEQ ID NO: 23), and PARP16 (SEQ ID NO: 24). The polypeptide tag of a PARP fusion protein may be located at the N- and/or C- terminus of the protein. The polypeptide tag may contain one or more of a fluorescent protein (e.g., a green fluorescence protein), a peptide epitope recognized by specific antibodies, a protein that is bound by a partner binding protein with high affinity (e.g., biotin and streptavidin), a His6-tag, or one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) protease recognition sequence(s) (e.g., one or more of a TEV protease or Factor Xa protease recognition sequence). The PARP fusion proteins of the invention may be purified using antibodies specific for the polypeptide tag. For example, antibodies specific for the polypeptide tag or proteins that bind specifically to the protein sequence in the polypeptide tag may be bound to a bead (e.g., a magnetic bead) or polymer surface in order to allow for the purification of the PARP fusion protein. A PARP fusion protein may also be purified and subsequently
treated with one or more (e.g., 1, 2, or 3) protease(s) to remove the polypeptide tag from the PARP fusion protein. A PARP fusion protein preferably has the same cellular localization and biological activity as the wild-type PARP protein. Methods for the generation and purification of PARP fusion proteins are described herein. By "PARP activator" or "poly-ADP-ribose polymerase activator" is meant an agent that increases the expression (e.g., mRNA or protein level) and/or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) biological activities of one or more PARPs. For example, a PARP activator may increase the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, or 20) PARP nucleic acids or PARP proteins (described above). A PARP activator may increase one or more biological activities of a PARP protein including, but not limited to, the ability to attach a poly-ADP-ribosc molecule to one or more substrate(s) (e.g., a protein, DNA molecule, RNA molecule, lipid, or small molecule), the ability to promote formation of a stress granule, the ability to nucleate the formation of a stress granule, the ability to disassemble a stress granule, the ability to decrease stress granule assembly, the ability to localize to a stress granule, the ability of a PARP protein to bind to one or more of its substrates, the ability of a PARP protein to localize to the nucleus or the mitotic spindle, the ability to promote cell proliferation, and the ability to promote progression through cytokinesis. Specific PARP activators include nucleic acids encoding one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20) PARPs or the catalytic domains of one or more PARPs. For example, a PARP activator may be a nucleic acid containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PΛRP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 1 1), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARPlO (SEQ ID NO: 15), PARP 10.2 (SEQ ID NO: 16), PARPI l (SEQ ID NO: 17), PARPl 2 (SEQ ID NO: 18), PARPl 3.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP14 (SEQ ID NO: 21), PARPl 5.1 (SEQ ID NO: 22), PARP15.2 (SEQ ID NO: 23), and PARPl 6 (SEQ ID NO: 24). Specific PARP activators may increase the expression and/or one or more (e.g., 1 , 2, 3, 4, or 5) biological activities of a specific PARP or a specific subset of PARPs (e.g., one or more of PARP5A, PARPl 2, PARPl 3.1 , PARPl 3.2, and PARPl 5; PARPl 1 ; and one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARPl 6).
By "PARP inhibitor" or "poly-ADP-ribose polymerase inhibitor" is meant an agent that decreases the expression (e.g., mRNA or protein level) and/or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) biological activities of one or more PARPs. For example, a PARP inhibitor may decrease the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 2O) PARP nucleic acids or PARP proteins (described above). A PARP inhibitor may decrease one or more (e.g., 1, 2, 3, 4, or 5) biological activities of a PARP protein including, but not limited to, the ability to attach a poly-ADP-ribose molecule to a substrate (e.g., a protein, DNA molecule, RNA molecule, lipid, or small molecule), the ability to promote formation of a stress granule, the ability to nucleate the formation of a stress granule, the ability to disassemble a stress granule, the ability to decrease stress granule assembly, the ability to localize to a stress granule, the ability of a PARP protein to bind to one or more of its substrates, the ability of a PARP protein to localize to the nucleus or the mitotic spindle, the ability to promote cell proliferation, and the ability to promote progression through cytokinesis. Specific PARP inhibitors include antibody or antibody fragments that specifically bind one or more PARP proteins (described herein), one or more RNA aptamers (e.g., RNAi molecules; e.g., SEQ ID NOS: 40 and 43-136), and one or more small molecules. Specific PARP inhibitors may decrease the expression and/or one or more biological activities (e.g., 1. 2, 3, 4, or 5) of a specific PARP or a specific subset of PARPs (e.g., one or more (e.g., 1 , 2, 3, 4, or 5) of PARP5A, PARPl 2, PARPl 3.1 , PARPl 3.2, and PARPl 5; PARPI l; and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARPl 6).
By "Poly-ADP-ribose polymerase 1 1 activator" is meant an agent that increases the expression (e.g., mRNA or protein level) and/or one or more (e.g., 1 , 2, 3, 4, or 5) biological activities of PARPl 1. For example, a PARPl 1 activator may increase the level of one or more (e.g., 1 , 2, 3, 4, or 5) nucleic acids containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), and/or increase the level of one or more (e.g., 1 , 2, 3, 4, or 5) polypeptides encoded by these nucleic acids. A PARPl 1 activator may increase one or more (e.g., 1 , 2, 3, 4, or 5) biological activities of a PARPl 1 protein including, but not limited to, the ability to attach a poly-ADP-ribose molecule to a substrate (e.g., a protein, DNA molecule, RNA molecule, lipid, or small molecule), the ability to prevent or reduce the rate of formation of a stress granule, the ability to prevent the nucleation of a stress granule, the ability to disassemble a stress granule, the ability to decrease stress granule assembly, the ability to localize to a stress granule, or the ability
of PARPl 1 protein to bind to one or more of its substrates. Specific PARPl 1 activators include nucleic acids encoding PARPl 1 or the catalytic domain of PARPl 1. For example, a PARP activator may be a nucleic acid containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17). Specific PARPl 1 activators may increase the expression and/or one or more biological activities of a PARPl 1 , while having little or no effect on the expression and/or one or more biological activities of other PARP proteins.
By "poly-ADP-ribose polymerase- 1 1 inhibitor'Or "PARPl 1 inhibitor" is meant an agent that decreases the expression (e.g., mRNA or protein level) and/or one or more (e.g., 1 , 2, 3, 4, or 5) biological activities of PARPI l. For example, a PARPI l inhibitor may decrease the level of one or more (e.g., 1, 2, 3, 4, or 5) nucleic acids containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), or decrease the level of one or more (e.g., 1, 2, 3, 4, or 5) polypeptides encoded by these nucleic acids. A PARPl 1 inhibitor may decrease one or more (e.g., 1 , 2, 3, 4, or 5) biological activities of a PARPl 1 protein including, but not limited to, the ability to attach a poly-ADP-ribose molecule to a substrate (e.g., a protein, DNA molecule, RNA molecule, lipid, or small molecule), the ability to prevent or reduce the rate of formation of a stress granule, the ability to prevent the nucleation of a stress granule, the ability to disassemble a stress granule, the ability to decrease stress granule assembly, the ability to localize to a stress granule, or the ability of PARPl 1 protein to bind to one or more of its substrates. Specific PARPl 1 inhibitors include antibody or antibody fragments that specifically bind to PARPl 1 protein, one or more RNA aptamers (e.g., RNAi molecules; e.g., SEQ ID NOS: 91 -98), and one or more small molecules. Specific PARPl 1 inhibitors decrease the expression and/or one or more (e.g., 1, 2, 3, 4, or 5) biological activities of PARPl 1 , while having little or no effect on the expression and/or activity of other PARP proteins. By "PARP biological activity" is meant one or more (e.g., 1, 2, 3, 4, or 5) of the ability of a PARP protein or PARP fusion protein to catalyze the attachment of a single ADP-ribose to a target substrate (e.g., a protein, DNA, RNA, lipid, or small molecule), the ability to attach one or more ADP-ribose molecules to a ADP-ribose molecule already attached to a substrate, the ability to add a branched ADP-ribose molecule to a preexisting poly-ADP-ribose, the ability to localize to the cell nucleus, the ability to localize to stress granules, the ability to catalyze the formation or nucleate stress granules, the ability to catalyze the disassembly of stress granules, the ability to promote cell division
or progression through mitosis, or the ability to activate or inhibit RNAi activity in the cell. Specific PARP proteins have a different subset of biological activities. For example, PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16 have the ability to localize to the nucleus and play a role in mitosis and cell division. PARP 5A, PARP12, PARP13.1, PARP13.2, and PARP-15 have the ability to localize to stress granules and play a role in the formation or nucleation of stress granules. PARPI 1 has the ability to localize to stress granules and plays a role in inhibiting stress granule formation or increasing the disassembly of stress granules. PARPl 3 inhibits the activity of RNAi in the cell. An additional PARP activity is "auto-modification" or "auto- modulation," that is, attachment of one or more ADP-ribose molecules to itself. Such auto-modulation of a PARP protein may result in an increase or decrease in any of the above-listed PARP activities. Assays for the measurement of the activity of each specific PARP are described herein.
By "polypeptide tag" is meant a protein sequence that is located at the 5' and/or 3' end of a polypeptide sequence of an expressed protein (e.g., one or more PARP proteins as described herein). A polypeptide tag may include one or more of a protease recognition sequence (e.g., 1 , 2, 3, 4, 5, or 6 of the same or different protease recognition sequences), a epitope tag (e.g., 1 , 2, 3, 4, or 5 epitope tags), a peptide that has a high affinity binding partner (e.g., biotin and streptavidin), or one or more (e.g., 1, 2, 3, or 4) tag(s) which aids in protein purification (e.g., a His6 tag). The polypeptide tag may later be cleaved from the purified fusion protein by incubation with one or more (e.g., 1, 2, 3, or 4) protease(s) which cleaves the fusion protein at one or more protease recognition sequence(s) (e.g., 1 , 2, 3, 4, 5, 6, or 7) within the sequence of the polypeptide tag. Examples of polypeptide tags are described herein. By "positioned 3'" is meant a second nucleic acid sequence that is located after the 3' terminus of a first nucleic acid sequence (the second nucleotide sequence starts at the nucleotide following the 3' terminus of the first sequence) or the second nucleic acid sequence begins at a nucleotide that follows the 3' terminus of the first nucleic acid (e.g., the second nucleotide sequence starts at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, or 400 nucleotides following the 3' terminus of the first nucleic acid).
By "positioned 5'" is meant a second nucleic acid sequence that is located before the 5' terminus of a first nucleic acid sequence (the second nucleotide sequence ends at the nucleotide preceding the 5' terminus of the first sequence) or the second nucleic acid sequence ends at a nucleotide that precedes the 5' lerminus of the first nucleic acid (e.g.,
the second nucleotide sequence ends at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, or 400 nucleotides before the 5' terminus of the first nucleic acid).
By the term "propensity to develop disease" is meant the calculated probability of a subject (e.g., a human) to develop a disease (e.g., a stress granule-related disorder or cancer). The probability of developing a disease may be calculated based on a number of factors including a variety of health indicators (e.g., blood pressure, cholesterol, and levels of pro-inflammatory cytokines), biological factors (e.g., weight, age, and sex), and genetic susceptibility to disease (e.g., expression of a heritable mutation in a gene, expression of a polymorphic sequence associated with a disease, and expression of an allele associated with a disease). The propensity to develop disease in a specific patient population may be compared to a different patient population (e.g., a patient population not receiving a therapy).
By the term "protease recognition sequence" is meant a short peptide sequence that is recognized as a substrate and cleaved by one or more (e.g., 1, 2, 3, 4, or 5) proteases. Protease target sequences are often 3-20 amino acids in length and often require certain amino acids to be located at specific positions within the target sequence, while any amino acid may be placed at other positions within the target sequence. For example, the protease recognition sequence for TEV protease is Glu-X-X-Tyr-X-Gln-Ser (SEQ ID NO: 26), where X represents a position that may be filled by any amino acid. Additional examples of protease recognition sequences are known in the art and include, without limitation, factor Xa (Ile-Glu/Asp-Gly-Arg), Ala-64 subtilisin (Gly-Ala-His-Arg), clostripain (Arg and Lys-Arg), collagenase (Pro-Val-Gly-Pro), enterokinase (Asp-Asp- Asp-Λsp-Lys), renin (Pro-Phe-His-Leu-Leu), and α-thrombin (Leu-Val-Pro-Arg-Gly- Ser). One or more of the same or different protease recognition sequence(s) may be included in the polypeptide tag of any of the PARP, PARG, or ARH3 fusion proteins described herein. A protease recognition sequence may be placed 5' or 3' to an amino acid sequence to be removed from the protein. The polypeptide sequence of the protease recognition sequence may directly abut the sequence encoding a PARP or may be separated from the remaining coding sequence by one or more amino acids (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, or 50 amino acids). An amino acid sequence that may be removed from the protein may include one or more antigenic sequence(s), a His6-tag, a fluorescent protein, a peptide sequence that has high affinity to a second protein that was used to purify the protein (e.g., His6 tag or
hemagglutinin tag), or a peptide sequence that was used to stabilize the protein during purification (e.g., albumin).
By the term "purified" is meant purified from other common components normally present within the cell. For example, a purified protein is purified away from the other cellular proteins, nucleic acids, and small metabolites present within the cell. A purified protein is at least 85% pure by weight (e.g., at least 90%, 95%, 96%, 97%, 98%, 99%, or even 100% pure) from other proteins, nucleic acids, or small metabolites present in the cell. Λ purified nucleic acid is at least 85% free of other contaminating nucleic acid molecules or adjoining sequences found in the cell. By the term "rate of proliferation" is meant the rate of a cell or a cell population to undergo successive cell divisions. The rate of cell proliferation of a cell or cell population may be measured by methods known in the art including cell counting (e.g., by microscopic techniques) and the incorporation of labeled nucleotides into newly synthesized DNA (e.g., incorporation of 3H-thymidine). The rate of proliferation of a cell or cell population treated with one or more agent(s) (e.g., one or more PARP activators or PARP inhibitors) may be compared to a control cell or cell population not treated with the agent.
By the term "reduce the likelihood of developing" is meant a reduction (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) for an individual or a patient population in the chance or rate of developing a specific disease by administering one or more therapeutic agent(s) compared to an individual or patient population not receiving the therapeutic agent. The methods of the invention may also reduce the likelihood of developing one or more (e.g., 1 , 2, 3, 4, or 5) symptoms of a stress granule-related disorder or reduce the likelihood of developing one or more (e.g., 1 , 2, 3, 4, or 5) symptoms of cancer in a patient population or an individual receiving one or more therapeutic agent(s).
By the term "RNAi" is meant a short double-stranded RNA molecule that mediates the down-regulation of a target mRNA in a cell. An RNAi molecule is typically 15 to 32 nucleotides in length. RNAi molecules are also known as siRNAs, small RNAs, or microRNAs. The design and therapeutic effectiveness of RNAi molecules is described in McCaffrey et al. (Nature 418:38-39, 2002). The RNAi molecules are at least 15 nucleotides, preferably, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, or 35 nucleotides in length and even up to 50 or 100 nucleotides in length (inclusive of all integers in between). Non-limiting examples of RNAi molecules are at least 80% identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identical) to
or complementary to the translational start sequence or the nucleic acid sequence encoding the first 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acids of a PARP, PARG, or ARH3 selected from a nucleic acid sequence containing a sequence at least 80% identical to one of PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 11), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARP10 (SEQ ID NO: 15), PARPl 0.2 (SEQ ID NO: 16), PARPI l (SEQ ID NO: 17), PARP12 (SEQ ID NO: 18), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP14 (SEQ ID NO: 21), PARP15.1 (SEQ ID NO: 22), PARP15.2 (SEQ ID NO: 23), PARP16 (SEQ ID NO: 24), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41). An RNAi molecule may target any part of the sequence encoding the target protein (e.g., any part of an mRNA encoding one of the above listed PARP, PARG, or ARH3 proteins). The specific requirements and modifications of small RNA are known in the art and are described, for example in PCT Publication No. WO01/75164, and U.S.
Application Publication Nos. 20060134787, 200501539] 8, 20050058982, 20050037988, and 20040203145, the relevant portions of which are herein incorporated by reference. siRNAs can also be synthesized or generated by processing longer double-stranded RNAs, for example, in the presence of the enzyme dicer under conditions in which the dsRNA is processed to RNA molecules of about 17 to about 26 nucleotides. siRNAs can also be generated by expression of the corresponding DNA fragment (e.g., a hairpin DNA construct). Generally, the siRNA has a characteristic 2- to 3- nucleotide 3' overhanging ends, preferably these are (2'-deoxy) thymidine or uracil. The siRNAs typically comprise a 3' hydroxyl group. Single-stranded siRNAs or blunt-ended dsRNA may also be used. In order to further enhance the stability of the RNA, the 3' overhangs may be stabilized against degradation. For example, the RNA may be stabilized by including purine nucleotides, such as adenosine or guanosine. Alternatively, substitution of pyrimidine nucleotides by modified analogs, e.g., substitution of uridine 2-nucleotide overhangs by (2'-deoxy)thymidine is tolerated and does not affect the efficiency of RNAi. The absence of a 2' hydroxyl group significantly enhances the nuclease resistance of the overhang in tissue culture medium. siRNA molecules can also be obtained through a variety of protocols including chemical synthesis or recombinant production using a Drosophila in vitro system. They can be commercially obtained from companies such as Dharmacon Research Inc. or Xeragon Inc., or they can be synthesized using commercially available kits such as the
Silencer™ siRNA Construction Kit from Ambion (catalog number 1620) or HiScribe™ RNAi Transcription Kit from New England BioLabs (catalog number E2000S).
Alternatively siRNA can be prepared using standard procedures for in vitro transcription of RNA and dsRNA annealing procedures such as those described in Elbashir et al. (Genes & Dev., 15:188-200, 2001), Girard et al. (Nature 442:199-202, 2006), Aravin et al. (Nature 442:203-207, 2006), Grivna et al. (Genes Dev. 20:1709- 1714, 2006), and Lau et al. (Science 313:305-306, 2006). siRNAs may also be obtained by incubation of dsRNA that corresponds to a sequence of the target gene in a cell-free Drosophila lysate from syncytial blastoderm Drosophila embryos under conditions in which the dsRNA is processed to generate siRNAs of about 21 to about 23 nucleotides, which are then isolated using techniques known to those of skill in the art. For example, gel electrophoresis can be used to separate the 21 -23 nt RNAs and the RNAs can then be eluted from the gel slices. In addition, chromatography (e.g., size exclusion chromatography), glycerol gradient centrifugation, and affinity purification with antibody can be used to isolate the small RNAs.
Short hairpin RNAs (shRNAs), as described in Yu et al. (Proc. Natl. Acad. Sci. U.S.A. 99:6047-6052, 2002) or Paddison et al. (Genes & Dev. 16:948-958, 2002), incorporated herein by reference, may also be used. shRNAs are designed such that both the sense and antisense strands are included within a single RNA molecule and connected by a loop of nucleotides (3 or more). shRNAs can be synthesized and purified using standard in vitro T7 transcription synthesis as described above and in Yu et al. (supra). shRNAs can also be subcloned into an expression vector that has the mouse U6 promoter sequences which can then be transfected into cells and used for in vivo expression of the shRNA. A variety of methods and reagents are available for transfection, or introduction, of dsRNA into mammalian cells including but not limited to: TransIT-TKO™ (Minis, Cat. # MlR 2150), Transmessenger™ (Qiagen, Cat. # 301525), Oligofectamine™ and Lipofectamine™ (Invitrogen, Cat. # MlR 12252-01 1 and Cat. #13778-075), siPORT™ (Ambion, Cat. #1631), and DharmaFECT™ (Fisher Scientific, Cat. # T-2001-01). Agents are also commercially available for electroporation-based methods for transfection of siRNA, such as siPORTer™ (Ambion Inc. Cat. # 1629). Microinjection techniques can also be used. The small RNA can also be transcribed from an expression construct introduced into the cells, where the expression construct includes a coding sequence for transcribing the small RNA operably-linked to one or more transcriptional regulatory sequences. Where desired, plasmids, vectors, or viral vectors can also be used
for the delivery of dsRNA or siRNA and such vectors are known in the art. Protocols for each transfection reagent are available from the manufacturer. Additional methods are known in the art and are described, for example in U.S. Patent Application Publication No. 20060058255. By the term "specifically binds" is meant a protein, nucleic acid (e.g., DNA or
RNA), or molecule that binds one or more target molecules (e.g., polypeptides, DNA molecules, or RNA molecules) present in a cell, while not binding the majority of other proteins, DNA molecules, RNA molecules, or small molecules present within a cell, cell lysate, extracellular medium, or biological sample. For example, an antibody provided by the invention may bind to a single PARP, PARG, or ARH protein, a PARP, PARG, or
ARH3 fusion protein, or may bind more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, or 20 or more) PARP, PARG, or ARH3 proteins and/or PARP, PARG, or ARH3 fusion proteins in a cell, cell lysate, extracellular medium, or biological sample. By "substrate" or "solid surface" is meant a surface on which a moiety or protein is covalently attached which allows for the binding and/or purification of a PARP, PARG, and/or ARH3 fusion protein. The PARP, PARG, and/or ARH3 fusion protein will bind to the substrate or solid surface through its polypeptide tag. Moieties or peptides covalently attached to the substrate or solid surface include, but are not limited to, monoclonal or polyclonal antibodies specific for an antigenic peptide in the polypeptide tag (e.g., anti- GFP antibody binding to GFP in the polypeptide tag), specific metal complexes bound by a peptide located in the polypeptide tag (e.g., Ni+ binding to a Hisβ polypeptide tag), or a specific binding protein for a peptide located in the polypeptide tag (e.g., IgG binding to a ZZ-domain in the polypeptide tag). Examples of a substrate or solid surface include, but are not limited to, a bead (e.g., a magnetic bead), a surface in a multi-well plate, and beads in column (e.g., column chromatography). One or more PARP, PARG, and/or ARH3 protein(s) and/or PARP, PARG, and/or ARH3 fusion protein(s) may be bound to a substrate or solid surface and eluted from the substrate or solid surface by contacting the substrate or solid surface with an elution buffer (e.g., a high salt elution buffer), a ligand that competes for binding to the substrate or solid surface, or competes for binding to the polypeptide tag (e.g., a non-bound antibody that specifically binds to the protein in the polypeptide tag), or by treating the bound fusion protein with a protease that recognizes the one or more (e.g., 1 , 2, 3, 4, 5, 6, or 7) specific cleavage recognition sequence(s) found in the polypeptide tag.
By the term "stress granule-related disorder" is meant any disorder that is characterized or in part caused by the activity or formation of stress granules in a specific type of cell or cell population. Non-limiting examples of stress granule-related disorders include cardiovascular disorders (e.g., an aneurysm, angina, atherosclerosis, stroke, cerebrovascular disease, congestive heart failure, coronary artery disease, myocardial disease, peripheral vascular disease, granulomatous myocarditis, chronic myocarditis, myocardial infarction, and primary hypertrophic cardiomyopathy), inflammatory disorders (e.g., autoimmune diseases, asthma, allergic intraocular inflammatory diseases, arthritis, atopic dermatitis, atopic eczema, cirrhosis, Crohn's disease, ulcerative colitis, diabetes, hemolytic anemia, inflammatory dermatosis, an inflammatory bowel disorder, systemic lupus eryth matosus, psoriasis, and rheumatoid arthritis, Wegener's granulomatosis, Hashimoto's thyroiditis, chronic pancreatitis, and reactive lymphoid hyperplasia), neurological disorders (e.g., multiple sclerosis, Alzheimer's disease, Parkinson's disease, Huntingon's disease, amyotrophic lateral sclerosis, retinosa pigmentosum, macular degeneration, traumatic brain injury, stroke, and peripheral neuropathy), and ischemia-reperfusion injury (e.g., stroke). A stress granule-related disorder is typically characterized by a disease etiology that involves oxidative stress or the production of oxygen-based radicals in a tissue over the progression of the disease. Methods for the diagnosis of several stress granule-related disorders are known in the art. By the term "symptoms of a stress-granule related disorder" is meant one or more
(e.g., 1 , 2, 3, 4, or 5) of the physical manifestations of a stress-granule related disorder. Non-limiting examples of symptoms of a stress-granule related disorder include pain, swelling, inflammation, loss of cognition, loss of vision, loss of coordination, difficulty breathing, airway constriction, artery occlusion, diarrhea, elevated blood glucose, increased levels of pro-inflammatory cytokines, increased protein aggregates or deposits, and increased cell death (e.g., apoptosis or necrosis).
By the term "symptoms of cancer" is meant one or more (e.g., 1 , 2, 3, 4, or 5) of the physical manifestations of cancer. Non-limiting examples of symptoms of cancer include blood in urine, pain or burning upon urination, cloudy urine, pain in bone, fractures in bones, fatigue, weight loss, repeated infections, nausea, vomiting, constipation, numbness in the legs, bruising, dizziness, drowsiness, abnormal eye movements, changes in vision, changes in speech, headaches, thickening of a tissue, rectal bleeding, abdominal cramps, loss of appetite, fever, enlarged lymphnodes, persistent cough, blood in sputum, lung congestion, itchy skin, lumps in skin, abdominal
swelling, vaginal bleeding, jaundice, heartburn, indigestion, cell proliferation, and loss of regulation of controlled cell death.
By the term "target protein" or "substrate protein" is meant a protein that is bound by one or more (e.g., 1, 2, 3, 4, or 5) PARP protein(s), PARG protein(s), ARH3 protein(s), PARP fusion protein(s), PARG fusion protein(s), and/or ARH3 fusion protein(s); covalently modified by attachment of a ADP-ribose molecule by the activity of one or more (e.g., 1, 2, 3, 4, or 5) PARP protein(s) or PARP fusion protein(s); or contains a poly-ADP-ribosyl group that is hydrolyzed by the activity of one or more (e.g., 1, 2, 3, 4, or 5) PARG proteins, PARG fusion proteins, ARH3 proteins, or ARH3 fusion proteins. A target or substrate protein may be co-localized in the nucleus or in a stress granule, and/or may localize to the mitotic spindle during cytokinesis. A target protein or substrate protein may localize to different structures or organelles within a cell during different stages of the cell cycle (e.g., interphase, S-phase, prophase, metaphase, telephase, and anaphase) and may have an activity in the formation, nucleation, or disassembly of stress granules, an activity in cell proliferation or progression through cytokinesis, or an activity in the regulation of miRJSfA or RNAi activity. A target or substrate protein may be a PARP, PARG, or ARH3 protein (described herein).
By the term "transgenic cell" is a meant a cell expressing one or more nucleic acids introduced by recombinant DNA technology. For example, a transgenic cell may express a nucleic acid encoding one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, or 18) of the presently described PARP, PARG, and/or ARH3 proteins and/or one or more of the PARP, PARG, and/or ARH3 fusion proteins. A transgenic cell may be a mammalian cell (e.g., a mouse, rat, monkey, or human cell), a bacterial cell, a fungal cell, a yeast cell, or a plant cell. The transgenic cell may express the introduced nucleic acids from an inducible promoter or a constitutive promoter. The transgenic cell may also be located within a transgenic animal or may be cultured in tissue culture. The introduced one or more nucleic acid(s) may be integrated in the chromosome of a cell or may be expressed from a plasmid.
By "ZZ-domain" is meant a polypeptide sequence encoded by a nucleic acid having at least 80% identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to the Staphylcoccus aureus protein A domain encoded by SCQ ID NO: 27. The ZZ domain has the ability to bind to Fcγ (the constant region of IgG involved in effector functions) and Fab (the Ig fragment responsible for antigen recognition). The specific structure and binding properties of the ZZ-domain are described in Graille et al. (Proc. Natl. Acad ScL U.S.A. 97:5399-5404, 2000) and Roben et al. (J. Immunol.
154:6437-6445, 1995). Expression of the ZZ-domain in the polypeptide tag allows for the purification of a fusion protein (e.g., one or more PARP fusion proteins as described herein) by the use of an Fc-containing protein (e.g.. IgG).
Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof.
Brief Description of the Drawings
Figure 1 is a picture of the chemical structure of nicotinamide adenine dinucleotide (NAD+) and poly-ADP ribose. Figure 2 is a set of micrographs showing the mitotic localization of poly-ADP ribose in HeLa cells during G2-M, prophase, prometaphase (P-M), metaphasc, anaphase, and cytokinesis stages of the cell cycle using fluorescence microscopy following staining with rabbit anti-PAR antibodies labeled with Alexa 488 and X-rhodamine NHS esters.
Figure 3 is a set of schematic diagrams showing the domain organization of PARPl, PARP2, PARP3, PARP4, tankyrase 1 (PARP5A), tankyrase 2 (PARP5B),
TiPARP (PARP7), PARP12, PARPI 3, PARP9, PARP14, PARP15, PARPlO, PARPl 1, PARP6, PARP8, and PARPl 6.
Figure 4 is a diagram of the pEGFP-Cl vector (SEQ ID NO: 28) (Invitrogen) showing the CMV promoter, the EGFP sequence, the multiple cloning site (MCS), and the SV40 poly A sequence. Also shown is the polylinker sequence (SEQ ID NO: 29).
Figure 5 is an immunoblot showing the expression and relative size of the PARP- GFP fusion proteins of PARPl, PARP2, PARP3, PARP4, PARP5A, PARP5B, PARP6, PARP7, PARP8, PARP9, PARPlO, PARPI l, PARP12, PARP13, PARP14, PARP15, and PARP 16 expressed in HeLa Kyoto cells transfected with pEGFP-Cl plasmids containing a nucleic acid encoding each respective PARP-GFP fusion protein. The immunoblot was developed using a rabbit anti-GFP polyclonal antibody.
Figure 6 is a set of micrographs showing the localization of different PARP-GFP fusion proteins in asynchronous HeLa Kyoto cells transfected with a pEGFP-Cl plasmid containing a nucleic acid encoding a PARP-GFP protein. The transfected cells were immunostained with rabbit anti-GFP polyclonal antibody and fluorescently-labeled secondary Alexa Fluor 594 or 488 antibody (Invitrogen), and visualized using fluorescence microscopy. The localization of PARPl -GFP, PARP2-GFP, PARP3-GFP, PARP7-GFP, PARP12-GFP, PARPl 3-GFP, PARP9-GFP, PARP14-GFP, PARP15-GFP, PARP6-GFP, PARP8-GFP, PARPl 6-GFP, PARP4-GFP, PARPl O-GFP, PARPl 1 -GFP, PARP5A-GFP, and PARP5B-GFP fusion proteins is shown.
Figure 7 is two sets of micrographs showing the localization of different PARP- GFP fusion proteins in asynchronous hTERT-RPE and HeLa Kyoto cells transfected with a pEGFP-Cl plasmid containing a nucleic acid encoding a PARP-GFP protein. The transfected cells were immunostained with rabbit anti-GFP polyclonal antibody and fluorescently-labeled Alexa Fluor 594 or 488 antibodies (Invitrogen), and visualized using fluorescence microscopy. The localization of PARPl-GFP, PARP2-GFP, PARP3- GFP, PARP4-GFP, PARP5A-GFP, PARP5B-GFP, PARP6-GFP, PARP7-GFP, PARP8- GFP, PARP9-GFP, PARPlO-GFP, PARPl 1 -GFP, PARP12-GFP, PARP13-GFP, PARP14-GFP, PARP15-GFP, and PARP16-GFP fusion proteins is shown for each cell type.
Figure 8 is a set of micrographs from asynchronous HcLa Kyoto cells transfected with a pEGFP-Cl plasmid containing a nucleic acid encoding a PARP-GFP protein following immunostaining with primary rabbit antibodies raised against each specific PARP and fluorescently-labeled Alexa Fluor 594 or 488 antibodies (Invitrogen). The localization of PARPl , PARP2, PARP3, PARP4, PARP5A, PARP5B, PARP6, PARP7, PARP8, PARP9, PARPl O, PARPl 1 , PARP 12, PARPl 3.1, PARPl 3.2, PARPl 4, PARPl 5, and PARP16 is shown.
Figure 9 is a set of micrographs showing the localization of each PARP-GFP fusion protein during S-phase and mitosis in transfected HeLa Kyoto cells. In each experiment, HeLa Kyoto cells were transfected using Lipofectamine 2000 with a specific PARP-GFP expression vector (pEGFP-Cl) and were arrested in mitosis or S-phase by treatment with 100 nM nocodazole or 5 μg/mL aphidicolin for 12 hours. The resulting treated cells were immunostained with rabbit anti-GFP polyclonal antibodies and fluorescently-labeled Alexa Fluor 594 or 488 antibodies (Invitrogen), and visualized using fluorescence microscopy. S-phase-arrested cells were also stained with EdU and DAPI, and mitosis-arrested cells were further stained with tubulin and DAPI.
Figure 10 is a set of micrographs showing the localization of overexpressed PARP16-GFP in the endoplasmic reticulum of HeLa Kyoto cells transfected with a pEGFP-Cl plasmid encoding a PARPl 6-GFP fusion protein (middle panel) and the phenotype of HeLa Kyoto cells transfected with an RNAi targeting endogenous PARPl 6 (right panel). The left panel shows untransfected HeLa Kyoto cells stained with anti- calnexin antibodies, secondary fluorescently-labeled antibodies (Alexa Fluor 594 or 488 antibodies (Invitrogen)), and DAPI. The middle panel the localization of PARPl 6-GFP and calnexin in HeLa Kyoto cells transfected with a pEGFP-Cl plasmid expressing a PARPl 6-GFP fusion protein following staining with anti-calnexin, anti-GFP, Alexa Fluor
594 or 488 antibodies (Invitrogen), and DAPI. The right panel shows the phenotype of HeLa Kyoto cells following transfection with an RNAi molecule targeting endogenous PARP16 (SEQ ID NO: 43) following staining with an anti-tubulin antibody, Alexa Fluor 594 or 488 antibody (Invitrogen), and DAPI. Figure 11 is a set of micrographs showing the co-localization of PARP7-GFP and coilin, and the co-localization of PARPl 6-GFP and calnexin. In each experiment, HeLa Kyoto cells transfected with pEϋFP-Cl vectors expressing PARP7-GFP or PARPl 6-GFP were stained with anti-GFP and anti-coilin or anti-calnexin antibodies, and fluorescently labeled secondary antibodies (Alexa Fluor 594 or 488 antibodies). The figure also lists a number of protein markers of specific cellular organelles and structures.
Figure 12 is a diagram of the pcDNA3.1 vector (Invitrogen) showing the CMV promoter and the restriction sites that may be used for cloning.
Figure 13 is a diagram of an example of an activity assay using one or more of the PARP-GFP fusion proteins of the invention. Figure 14 is a diagram of an example of an assay for identifying an activator of one or more PARP-GFP fusion proteins of the invention.
Figure 15 is a picture of the Bio-Gel P-6 structure and a picture of a Coomassie Blue-stained SDS-PAGE gel showing the use of Bio-Gel P-6 for the purification of proteins from a crude HeLa Kyoto cell extract. The SDS-PAGE gel shows the proteins present in cell extract (Extract), in cell extract following lectin clarification (Lectin Clarification), in the lysate prior to passing over the Bio-Gel P-6 resin (Input), in the pellet following centrifugation of the resin (Pellet), and in the eluate following treatment with poly-ADP-ribose glycohydrolase ARH3 (ARH3 Release).
Figure 16 is a set of micrographs showing the co-localization of poly-ADP ribose polymers (pADPR) and eIF3, a part of the translation initiation complex and a marker of stress granules, in HeLa Kyoto cells following treatment with 0 or 250 μM sodium arsenite for 30 minutes and immunostaining with primary antibodies specific for poly- ADP-ribose polymers and eIF3, and Alexa Fluor 594 or 488 secondary antibodies (Invitrogen). Figure 17 is a set of micrographs showing the co-localization of PARP-GFP fusion proteins with e!F3 in transfected HeLa Kyoto cells following treatment with 0 or 250 μM sodium arsenite for 30 minutes. In these experiments, HeLa Kyoto cells were transfected with a pEGFP-Cl plasmid expressing PARP5 A-GFP, PARPl 2-GFP, PARPI 3.1 -GFP, PARPl 3.2-GFP, or PARPl 5-GFP fusion protein and treated with 0 or 250 μM sodium arsenite. The cells were fixed and stained with anti-GFP and anti-elF3,
and secondary fluorescently-labeled antibodies (Alexa Fluor 594 or 488 antibodies (Invitrogen)) prior to imaging.
Figure 18 is a set of micrographs showing the co-localization of endogenous PARP5A, PARP12, PARP13/13.1, PΛRP15, or poly-ADP-ribose glycohydrolase (PARG), and eIF3 (a stress granule marker) in HeLa Kyoto cells following treatment with 250 μM sodium arsenite for 30 minutes. In these experiments, cells were stained with rabbit antibodies specific for one of PARP5A, PARP12, PARP13/13.1, PARP15, or PARG, and an anti-eIF3 antibody, and fluorescently-labeled secondary antibodies (Alexa Fluor 594 or 488 antibodies (Invitrogen)). Figure 19 is a set of micrographs showing the localization of poly-ADP-ribose
(PAR), endogenous PARP5A, PARP12, PARP13, and PARPl 5, and eIF3 (a stress granule marker) in hTERT RPE cells following treatment with 250 μM sodium arsenite for 30 minutes. In these experiments, cells were stained with antibodies specific for one of PAR, PARP5A, PARP12, PARP13, or PARP15, or an anti-eIF3 antibody, and a secondary fluorescently-labeled antibodies (Alexa Fluor 594 or 488 antibodies (Invitrogen)).
Figure 20 is a set of micrographs showing the effect of PARP 13.1 -GFP, PARPl 3.2-GFP, or PARPl 5-GFP overexpression on stress granule formation. In these experiments, HeLa Kyoto cells were transfected with a plasmid expressing PARP13.1 - GFP, PARPl 3.2-GFP, or PARP 15-GFP. The cells were fixed and stained using rabbit anti-GFP and anti-eIF3 antibodies, and fluorescently-labeled secondary antibodies (Alexa Fluor 594 or 488 antibodies (Invitrogen)). The cells were also co-stained with DAPI.
Figure 21 is a set of micrographs showing the co-localization of PARPl 1-GFP and eIF3 (a stress granule marker) in HeLa Kyoto cells transfected with a pEGFP-Cl vector expressing PARPl 1-GFP following treatment with 250 μM sodium arsenite for 30 minutes. Following arsenite treatment, the cells were immediately fixed and stained using rabbit anti-GFP and anti-eIF3 antibodies, and fluorescently-labeled secondary antibodies (Alexa Fluor 594 or 488 antibodies (Invitrogen)). The cells were also stained with DAPI. Figure 22 is a set of micrographs showing the effect of PARG99-GFP,
PARG102-GFP, or PARGl 10-GFP overexpression on stress granule formation in HeLa Kyoto cells transfected with a pEGFP-Cl plasmid containing a nucleic acid sequence encoding each PARG-GFP fusion protein, following treatment with 100 μM sodium arsenite for 30 minutes. Following arsenite treatment, the cells were fixed and stained with rabbit anti-GFP and anti-eIF3 antibodies, and fluorescently-labeled secondary
antibodies (Alexa Fluor 594 or 488 antibodies (Invitrogen)). The images shown in the right panels show the same data using a threshold filter.
Figure 23 is a set of micrographs showing the effect of PARG or ARH3 knockdown on stress granule formation in HeLa Kyoto cells transfected with 30 nM PARG siRNA (CCAGUUGGAUGGACACUAAUU (SEQ ID NO: 34) and UUACGAAGGUACC AUAGAAUU (SEQ ID NO: 35)), ARH3 siRNA (GGACAGAAGCCUUGUACUAUU (SEQ ID NO: 36) and
CCAUUGCUGGUGCCUACUAUU (SEQ ID NO: 37)), or a control siRNA (All Stars Negative Control siRNA; Qiagen Catalog No. 1027280) following treatment with 100 μM sodium arsenite for 30 minutes, or 30 minutes or 1 hour following sodium arsenite washout. The cells were fixed and stained with an anti-eIF3 antibody and secondary fluorescently-labeled antibodies (Alexa Fluor 594 or 488 antibodies) to visualize stress granule formation. The panel on the left shows an immunoblot of cell lysate from HeLa Kyoto cells treated with 30 nM PARG siRNA, ARH3 siRNA, or control siRNA for 48 hours. The immunoblot was developed using an anti-PARG antibody.
Figure 24 is a graph showing the percentage of HeLa Kyoto cells transfected with 30 nM PARG siRNA (SEQ ID NOS: 34 and 35), ARH3 siRNA (SEQ ID NOS: 36 and 37), or a control siRNA (All Stars Negative Control siRNA; Qiagen Catalog No. 1027280) containing stress granules following treatment with 100 μM sodium arsenite for 30 minutes, or 30 minutes or 1 hour following sodium arsenite washout. The cells were fixed and stained with a fluorescently-labeled anti-eIF3 antibody to visualize stress granule formation.
Figure 25A is a Silver-stained 4-12% SDS-PAGE gel showing the proteins immunoprecipitated with an anti-GFP antibody from lysate from HeLa S3 cells transfected with a pEGFP-Cl plasmid expressing GFP alone, PARP5A-GFP, PARP 12- GFP, PARPl 3-GFP, PARP 13.1 -GFP, or PARP15-GFP following treatment with 0 or 250 μM sodium arsenite for 30 minutes.
Figure 25B is picture of an immunoblot of a 4-12% SDS-PAGE gel containing proteins immunoprecipitated with an anti-GFP antibody from lysate from HeLa S3 cells transfected with a pEGFP-Cl plasmid expressing GFP, PARP5A-GFP, PARP12-GFP, PARP13-GFP, PARP13.1 -GFP, or PARP15-GFP following treatment with 0 or 250 μM sodium arsenite for 30 minutes. The immunoblot was developed using a polyclonal anti-poly-ADP-ribose antibody.
Figure 25C is a picture of several immunoblots of a 4-12% SDS-PAGE gel containing proteins immunoprecipitated with an anti-GFP antibody from lysate from
HeLa S3 cells transfected with a pEGFP-Cl plasmid expressing GFP, PARP5 A-GFP, PARP12-GFP, PARP13-GFP, PARP13.1-GFP, or PARP15-GFP following treatment with 0 or 20 nM pateamine A for 30 minutes. The immunoblots were developed using one of the following antibodies: anti-Ago2, anti-DDX6, anti-LSMl, anti-PABP, anti- FMRP, anti-eIFl A, anti-eIF2α, anti-eIF3η, anti-eIF4Al , and anti-eIF4E.
Figure 26A is picture of an immunoblot of a 4-12% SDS-PAGE gel containing proteins immunoprecipitated with an anti-GFP antibody from lysate from HeLa S3 cells transfected with a pEGFP-Cl plasmid expressing TIAl-GFP, PABP-GFP, G3BP-GFP, or Ago2-GFP following treatment with 0 or 20 nM pateamine A for 30 minutes. The immunoblot was developed using a polyclonal anti-poly- ADP-ribose antibody.
Figure 26B is a picture of an immunoblot of an SDS-PAGE gel containing proteins immunoprecipitated from lysate from untransfected HeLa S3 cells using anti- G3BP and anti-Ago2 antibodies following treatment with 0 or 250 μM sodium arsenite for 60 minutes. The immunoblot was developed using a polyclonal anti-poly-ADP-ribose antibody.
Figure 26C is a picture of an immunoblot of an SDS-PAGE gel containing proteins immunoprecipitated from lysate from HeLa S3 cells transfected with a pEGFP- Cl plasmid expressing G3BP1-GFP (full-length), G3BP1-A-GFP (domain A), G3BP1- ABC-GFP (domains A5 B, and C), G3BP1 -BC-GFP (domains B and C), G3BP1 -BCD- GFP (domains B, C, and D), and G3BP1 -D-GFP (domain D) following treatment with 0 or 250 μM sodium arsenite for 60 minutes. The immunoblot was developed using a polyclonal anti-poly-ADP-ribose antibody.
Figure 26D is a picture of an immunoblot of an SDS-PAGE gel containing proteins immunoprecipitated from lysate from HeLa S3 cells transfected with a pEGFP- Cl plasmid expressing TIAl -GFP (full-length) or TIA1ΔRRM (mutant lacking RRM domain) following treatment with 0 or 250 μM sodium arsenite for 60 minutes. The immunoblot was developed using a polyclonal anti-poly-ADP-ribose antibody.
Figure 27 (left panel) is a set of micrographs showing the localization of poly- ADP-ribose, and endogenous Ago2 and eIF3 in HeLa cells following treatment with 250 μM sodium arsenite for 30 minutes. The cells were imaged using fluorescently labeled anti-poly-ADP-ribose, anti-Ago2, and anti-eIF3 antibodies. Figure 26 (right panel) is an immunoblot of a 4-12% SDS-PAGE gel containing proteins immunoprecipitated using an anti-Ago2 antibody from untransfected HeLa cells following treatment with 0 or 250 μM
sodium arsenite for 60 minutes. The immunoblot was developed using anti-poly-ADP- ribose antibodies.
Figure 28 is a picture of an immunoblot of a 4-12% SDS-PAGE gel containing proteins immunoprecipitated with an anti-Ago2 antibody from lysate from untransfected HeLa cells following treatment with 0 or 250 μM sodium arsenite for 30 minutes. The immunoblot was developed using a polyclonal anti-PARP13/13.1 antibody.
Figure 29 is a picture of a Coomassie Blue-stained 4-12% SDS-PAGE gel containing proteins immunoprecipitated using an anti-GFP antibody from lysate from HeLa S3 cells transfected with a pEGFP-Cl plasmid expressing PARPl 3-GFP following treatment with 0 or 250 μM sodium arsenite for 30 minutes.
Figure 30 is a graph showing the relative expression of luciferase in lysates from 293T cells transfected with a modified pGL4.72[hRlucCP]™ vector (Promega); 10 nM of vector-target RNAi (SEQ ID NOS: 38 and 39); and a pEGFP-Cl vector encoding EGFP, G3BP, PAPR5A, PARP 12, PARPl 3, PARPl 3.1, or PARPl 5. Luciferase expression was measured in cell lysates at 48 hours post-transfection. The level of luciferase in treated cells is compared to the level of luciferase produced in cells transfected with the modified pGL4.72[hRlucCP]™ vector alone. As another positive control, the level of luciferase produced from cells transfected with the modified pGL4.72[hRlucCP]™ vector and the vector-target RNAi is shown (CXCR4 sponge). Figure 31 is a graph showing the relative expression of luciferase in 293T cells transfected with a modified pGL4.72[hRlucCP]™ vector and 20 nM of negative RNAi control for PARPl 3 siRNA (siNeg; All Stars Negative Control siRNA; Qiagen Catalog No. 1027280) or PΛRP13 siRNA (siPARPB;
GCUCACGGAACUAUGAGCUGAGUUU; SEQ ID NO: 40) following treatment with 0 or 30 nM pateamine A for 30 minutes. Luciferase expression was measured in cell lysates at 48 hours post-transfection.
Detailed Description
We have discovered that specific PARP proteins and subsets of PARP proteins have an effect on stress granule formation, nucleation, or disassembly, and/or are localized in the nucleus and are required for cell cycle progression through mitosis. We have also discovered that PARGs have an effect on stress granule formation, nucleation, and disassembly (i.e., stress granule kinetics). The invention therefore provides methods, compositions, and kits for the treatment of stress granule-related disorders and cancer, and methods for determining the propensity of a subject to develop a stress granule-
related disorder or cancer based on these unique activities of specific PARP proteins and PARGs. Conversely, the invention also provides methods for increasing the proliferation rate of a cell or cell population and increasing stress granule formation in a cell or cell population by modulating PARP function, PARG function, or poly-ADP-ribose pathways or homeostasis in a cell or cell population. Lastly, the invention provides screening methods for the identification of candidate agents that may be useful for treating or reducing the likelihood of developing a stress granule-related disorder and/or cancer.
Methods for Treating a Stress-Granule Related Disorder and Decreasing Stress Granule Formation
The present invention provides methods for treating or reducing the likelihood of developing one or more stress-granule related disorders in a subject. Stress granule- related disorders share a common etiology and pathology linked to oxidative stress and inflammation. Stress granule-related disorders include, without limitation, cardiovascular disorders, inflammatory disorders, neurological disorders, or ischemic-reperfusion injury.
In the treatment methods provided by the invention, a subject is administered a therapeutically effective dose of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s), one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARG activator(s), and/or one or more (e.g., 1 , 2, 3, 4, or 5) PARPl 1 activator(s). A patient receiving the treatment may be previously diagnosed as having a stress granule-related disorder, or may be diagnosed as having a high probability (i.e., at significant risk) of developing a stress granule-related disorder. A person receiving the treatment may be asymptomatic or may be experiencing one or more (e.g., 1, 2, 3, 4, or 5) of the symptoms of a stress granule- related disorder. Non-limiting examples of stress granule related disorders include an aneurysm, angina, atherosclerosis, stroke, cerebrovascular disease, congestive heart failure, coronary artery disease, myocardial disease, peripheral vascular disease, granulomatous myocarditis, chronic myocarditis, myocardial infarction, primary hypertrophic cardiomyopathy, autoimmune diseases, asthma, allergic intraocular inflammatory diseases, arthritis, atopic dermatitis, atopic eczema, cirrhosis, Crohn's disease, ulcerative colitis, diabetes, hemolytic anemia, inflammatory dermatosis, an inflammatory bowel disorder, systemic lupus erythematosus, psoriasis, rheumatoid arthritis, Wegener's granulomatosis, Hashimoto's thyroiditis, chronic pancreatitis, reactive lymphoid hyperplasia, multiple sclerosis, Alzheimer's disease, Parkinson's disease, Huntingon's disease, amyotrophic lateral sclerosis, retinosa pigmentosum, macular degeneration,
traumatic brain injury, stroke, and peripheral neuropathy. Methods for the diagnosis and monitoring of several stress granule related disorders and known in the art. The methods of the invention may reduce (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) one or more (e.g., 1, 2, 3, 4, or 5) of the symptoms of a stress granule related-disorder or prevent the onset of one or more (e.g., 1, 2, 3, 4, or 5) of the symptoms of a stress-related disorder. Symptoms of a stress granule-related disorder include, but are not limited to, pain, swelling, inflammation, loss of cognition, loss of vision, loss of coordination, difficulty breathing, airway constriction, artery occlusion, diarrhea, elevated blood glucose, increased levels of pro-inflammatory cytokines, increase protein aggregates or deposits, and increased cell death (e.g., apoptosis or necrosis). The methods of treatment provided herein may be used with one or more (e.g., 1, 2, 3, 4, or 5) other therapies or therapeutic agents used to treat a stress granule-related disorder. The effectiveness of treatment may be measured by a physician using methods known in the art. In the treatment methods provided herein, a subject may be administered one or more (e.g., 1 , 2, 3, 4, or 5) PAHP inhibitors. The one or more PARP inhibitors preferably decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% decrease) the expression (e.g., protein and/or mRNA levels) and/or one or more activities of PAR5A, PARP 12, PARPl 3.1, PARPl 3.2, and PARl 5. The decrease in expression of PARP5A, PARP 12, PARP 13.1 , PARPl 3.2, and PARP 15 preferably is a decrease in the expression of one or more nucleic acids containing a sequence having at least 80% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP13.1 (SEQ ID NO: 19), PARPl 3.2 (SEQ ID NO: 20), or PARPl 5 (SEQ ID NO: 22 or 23), or one or more polypeptides encoded by these nucleic acids. The PARP inhibitors also preferably inhibit one or more of the activities of a PARP protein (e.g., PARP5A, PARP12, PARP13.1 , PARPl 3.2, or PARPI 5) including poly-ADP-ribosylation of a target protein (e.g., a protein in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, or a PARP protein) or the formation or nucleation of a stress granule. Methods for measuring the activity of one or more PARP proteins are described herein.
A subject may also be administered one or more (e.g., 1 , 2, 3, 4, or 5) PARG activators. Preferred PARG activators selectively increase the expression and/or biological activity of PARG protein or ARH3. For example, PARG activators desirably increase the level of one or more nucleic acid(s) containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%,
99%, or even 100% identity) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or increase the level of one or more polypeptides encoded by these nucleic acids. Desirably, a PARG activator increases the one or more activities of a PARG protein or ARH3, including, but not limited to, hydrolysis of poly-ADP-ribose (e.g., poly-ADP-ribose attached to a substrate protein, e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, or a PARP protein), the prevention of the assembly of a stress granule, or disassembly of a stress granule.
A subject may also be administered one or more (e.g., 1, 2, 3, 4, or 5) PARPl 1 activators. Desirably, the one or more PARPl 1 activators selectively increase the level of one or more nucleic acids containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARPl 1 (SEQ ID NO: 17), or increase the level of one or more polypeptides encoded by these nucleic acids. Additional desirable PARPl 1 activators increase one or more activities of PARPl 1, including, but not limited to, poly-ADP-ribosylation of a target protein (e.g., a protein localized in a stress granule or a polypeptide involved in the formation, a polypeptide involved in the disassembly of a stress granule, and/or a PARP protein), the prevention of the assembly of a stress granule, or the disassembly of a stress granule.
Examples of PARP inhibitors that may be used in these methods include an antibody or antibody fragment that selectively binds one or more of PARP5A, PARP 12, PARP13.1 , PARP13.2, and PARP15; an RNA aptamer (e.g., SEQ ID NOS: 40, 49, 99- 1 13, and 122-129); or a small molecule. Examples of PARG activators that may be used in these methods include one or more nucleic acids containing a sequence having at least 80% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41). Examples of PARPl 1 activators that may be used in these methods include one or more nucleic acids containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARPl 1 (SEQ ID NO: 17).
In these methods, the one or more PARP inhibitors, one or more PARG activators, and one or more PARPl 1 activators may be administered co-extensively (overlapping bioactive periods) or non-extensively (non-overlapping bioactive periods). In one example, the one or more PARP inhibitors, one or more PARG activators, and one or more PARPl 1 activators may be administered together in a single dose or may be administered separately in one or more separate doses (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 doses). The amount of one or more PARP inhibitors, one or more PARG activators, and one or more PARPl 1 activators that may be administered to a subject per dose may be
between 0.1 mg and 1 g, 0.1 mg and 750 mg, 0.1 mg and 600 mg, 0.1 mg and 500 mg, 10 mg and 450 mg, 10 rag and 400 mg, 10 mg and 350 mg, 10 mg and 350 mg, and 10 mg and 250 mg. Various combinations of the one or more PARP inhibitors, one or more PARG activators, and one or more PARPl 1 activators are contemplated herein, for example, administration of one or more PARP inhibitors alone, administration of one or more PARG activators alone, administration of one or more PARPl 1 activators alone, administration of one or more PARP inhibitors and one or more PARG activators together, and administration of one or more PARP inhibitors and one or more PARPl 1 activators together. The one or more PARP inhibitors, one or more PARG activators, and the one or more PARPl 1 activators may be administered to the subjects once a day, twice a day, three times a day, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, seven times a week, bi-weekly, tri-weekly, or monthly. The one or more PARP inhibitors, one or more PARG activators, and the one or more PARPl 1 activators may be administered via the same route of administration or via different routes of administration. For example, the one or more PARP inhibitors may be administered orally and the PARG activators may be administered parenterally (e.g., subcutaneously). The one or more PARP inhibitors, one or more PARG activators, and/or the one or more PARPl 1 activators may be foπnulated for any known route of administration, including oral, intravenous, intraarterial, intraocular, intranasal, intramuscular, and subcutaneous administration. The one or more PARP inhibitors, one or more PARG activators, and/or the one or more PARPl 1 activators may also be foπnulated for administration in a sustained-release form. The therapeutically effective dose of the one or more PARP inhibitors, one or more PARG activators, and/or one or more PARP 11 activators may be determined by a skilled physician using methods known in the art, in addition to the in vitro assays described herein.
The invention similarly provides methods of decreasing the number of stress granules in a cell or a cell population by contacting the cell or cell population with an effective amount of one or more PARP inhibitors, one or more PARG activators, and one or more PARPl 1 activators (as described for the treatment of subjects above). In these methods, the one or more PARP inhibitors, one or more PARG activators, and the one or more PARPl 1 activators are added to the tissue culture medium to decrease the formation of stress granules in a cell or a cell population. Desirably, the cells are cultured for regenerative cell technology or the cells are primary or germ cells. This method desirably confers on the cells protection against oxidative stress and promotes the longevity and
morphology of the cultured cells. Preferred cells that may be used in these methods include, without limitation, an epithelial cell, a fibroblast, a kidney cell, a muscle cell, a neuron, a hepatocyte, a sperm, a lymphocyte, or a macrophage. The concentration of the one or more PARP inhibitors, the one or more PARG activators, and the one or more PARPl 1 activators to be added to the culture medium may be determined by using the methods described herein (e.g., methods for the measurement of stress granule formation).
Methods for Treating a Cancer and Decreasing Cell Proliferation The present invention provides methods for treating or reducing the likelihood of developing cancer in a subject. All forms of cancer share a common etiology and pathology of uncontrolled, unregulated, or misregulated cell proliferation or cell division. Cancers that may be treated by the methods, compositions, and kits of the invention include, without limitation, colon adenocarcinoma, esophagas adenocarcinoma, liver hepatocellular carcinoma, squamous cell carcinoma, pancreas adenocarcinoma, islet cell tumor, rectum adenocarcinoma, gastrointestinal stromal tumor, stomach adenocarcinoma, adrenal cortical carcinoma, follicular carcinoma, papillary carcinoma, breast cancer, ductal carcinoma, lobular carcinoma, intraductal carcinoma, mucinous carcinoma, phyllodes tumor, Ewing's sarcoma, ovarian adenocarcinoma, endometrium adenocarcinoma, granulose cell tumor, mucinous cystadenocarcinoma, cervix adenocarcinoma, vulva squamous cell carcinoma, basal cell carcinoma, prostate adenocarcinoma, giant cell tumor of bone, bone osteosarcoma, larynx carcinoma, lung adenocarcinoma, kidney carcinoma, urinary bladder carcinoma, Wilm's tumor, lymphoma, and non-Hodgkin's lymphoma. The methods of the invention may reduce (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) one or more (e.g., 1 , 2, 3, 4, or 5) of the symptoms of a cancer or prevent the onset of one or more (e.g., 1, 2, 3, 4, or 5) of the symptoms of a cancer. Symptoms of a cancer include, but are not limited to, blood in urine, pain or burning upon urination, cloudy urine, pain in bone, fractures in bones, fatigue, weight loss, repeated infections, nausea, vomiting, constipation, numbness in the legs, bruising, dizziness, drowsiness, abnormal eye movements, changes in vision, changes in speech, headaches, thickening of a tissue, rectal bleeding, abdominal cramps, loss of appetite, fever, enlarged lymphnodes, persistent cough, blood in sputum, lung congestion, itchy skin, lumps in skin, abdominal swelling, vaginal bleeding, jaundice, heartburn, indigestion, cell proliferation, and loss of regulation of controlled cell death. The methods of treatment provided herein may be
used with one or more (e.g., 1, 2, 3, 4, or 5) other therapies or therapeutic agents used to treat a cancer (e.g., chemotherapy, radiation, and/or surgery). The effectiveness of treatment may be measured by a physician using methods known in the art. Methods for the diagnosis and monitoring of several cancers are known in the art. In the treatment methods provided by the invention, a subject is administered a therapeutically effective dose of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of a PARP inhibitor(s). A patient receiving the treatment may be previously diagnosed as having a cancer, or may be diagnosed as having a high probability (i.e., at significant risk) of developing a cancer. A person receiving the treatment may be asymptomatic or may be experiencing one or more of the symptoms of a cancer.
In the treatment methods provided herein, a subject may be administered one or more PARP inhibitors. The one or more PARP inhibitors preferably decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% decrease) the expression and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of one or more of PARPl, PARP2, PARP5A, PARP 5B, PARP7, PARP8, PARP14, or PARPl 6. Preferably, the decrease in expression is a decrease in the level of one or more nucleic acids containing a sequence having at least 80% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24), or one or more polypeptides encoded by these nucleic acids. The PARP inhibitors also preferably inhibit one or more of the activities of a PARP protein (e.g., PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARPl 4, or PARPl 6) including poly-ADP- ribosylation of a target protein (e.g., a protein localized in the nucleus or mitotic spindle during cytokinesis, a protein required for progression through mitosis, and/or a PARP protein) or is required for progression through mitosis. Methods for measuring the activity of one or more PARP proteins are described herein.
Examples of PARP inhibitors that may be used in these methods include an antibody or antibody fragment that selectively binds one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16; an RNA aptamer (e.g., SEQ ID NOS: 43-46, 49, 50, 59-74, 1 14-121 , and 130-136; shown in table below); or a small molecule. In these methods, the one or more PARP inhibitors may be administered co-extensively (overlapping bioactive periods) or non-extensively (non-overlapping bioactive periods). In one example, the one or more PARP inhibitors may be administered together in a single dose or may be administered separately in one or more
separate doses (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 doses). The amount of one or more PARP inhibitors may be between 0.1 mg and 1 g, 0.1 mg and 750 mg, 0.1 mg and 600 mg, 0.1 mg and 500 mg, 10 mg and 450 mg, 10 mg and 400 mg, 10 mg and 350 mg, 10 mg and 350 mg, and 10 mg and 250 mg. Various combinations of the one or more PARP inhibitors are contemplated herein, for example, administration of one or more PARP inhibitors alone or co-administration of one or more PARP inhibitors with another therapeutic for the treatment of cancer or a therapeutic used to alleviate one or more symptoms of a cancer.
Table 1: Specific PARP RNAi molecules
PARP1 AAGCCUCCGCUCCUGAACAAU SEQ ID NO 44
PARP2A AAUCAGUGUAAUGAACUACUA SEQ ID NO 45
PARP2B AAUGAUUCAGCUAUUAGAAGA SEQ ID NO 46
PARP3 GGACCCAGGUGUAUGAGGACUACAA SEQ ID NO 47
PARP4 AAACAAGGAUUUCUACUAAGA SEQ ID NO 48
PARP5A AACAAUUCACCGUCGUCCUCU SEQ ID NO 49
PARP5B AAGCUUCAGAAUGGUGCAAAU SEQ ID NO 50
PARP6 CCCAACAAUGGAAACAUCUGAGCAA SEQ ID NO 51
PARP6 UUGCUCAGAUGUUUCCAUUGUUGGG SEQ ID NO 52
PARP6 GGUUCAAGGCAAGUGGUACCAUCAA SEQ ID NO 53
PARP6 UUGAUGGUACCACUUGCCUUGAACC SEQ ID NO 54
PARP6 CAAAGUGGAAGUGUUUGGCUACCCU SEQ ID NO 55
PARP6 AGGGUAGCCAAACACUUCCACUUUG SEQ ID NO 56
PARP6 CAGAACAGAGGAUUCCAACAUUGAA SEQ ID NO 57
PARP6 UUCAAUGUUGGAAUCCUCUGUUCUG SEQ ID NO 58
PARP7 UGAGGUCUUUGAGGCCAAUAUUAAA SEQ ID NO 59
PARP7 UUUAAUAUUGGCCUCAAAGACCUCA SEQ ID NO 60
PARP7 GACUUUCUGCAAGGCACUUGUAUUU SEQ ID NO 61
PARP7 AAAUACAAGUGCCUUGCAGAAAGUC SEQ ID NO 62
PARP7 UCCUCCACCUCUUGAAGCAACUUCA SEQ ID NO 63
PARP7 UGAAGUUGCUUCAAGAGGUGGAGGA SEQ ID NO 64
PARP7 AAUGAUGACCAGAGUUACCCUUAUU SEQ ID NO 65
PARP7 AAUAAGGGUAACUCUGGUCAUCAUU SEQ ID NO 66
PARP8 GGAAGAUUCUGAAGGUGACAAUGAU SEQ ID NO 67
PARP8 AUCAUUGUCACCUUCAGAAUCUUCC SEQ ID NO 68
PARP8 CCCACAACUGGAAGCUGAUUUGUCA SEQ ID NO 69
PARP8 UGACAAAUCAGCUUCCAGUUGUGGG SEQ ID NO 70
PARP8 GAAGUGGAAUCUAUCUUAGUCCAAU SEQ ID NO 71
PARP8 AUUGGACUAAGAUAGAUUCCACUUC SEQ ID NO 72
PARP8 GCCUUAUGUGAAGUGAUCACCUCAU SEQ ID NO 73
PARP8 AUGAGGUGAUCACUUCACAUAAGGC SEQ ID NO 74
PARP9 GCCGGAGCAGCAGCUUACAAUGAAA SEQ ID NO 75
PARP9 UUUCAUUGUAAGCUGCUGCUCCGGC SEQ ID NO 76
PARP9 CCCUCUGAAUUUGUGUACAAAGACU SEQ ID NO 77
PARP9 AGUCUUUGUACACAAAUUCAGAGGG SEQ ID NO 78
PARP9 GGACCCUACUGUUGCUGCCUUUAAA SEQ ID NO 79
PARP9 UUUAAAGGCAGCAACAGUAGGGUCC SEQ ID NO 80
PARP9 UGGCAGACGGCAGAUGUAAUUGUUA SEQ ID NO 81
PARP9 UAACAAUUACAUCUGCCGUCUGCCA SEQ ID NO 82
PARP10 CAUGGUGCAGGGUAGAGGGAUUAUG SEQIDNO 83
PARP10 CAUAAUCCCUCUACCCUGCACCAUG SEQ ID NO 84
PARP10 GCCUGGUGGAGAUGGUGCUAUUGAU SEQ ID NO 85
PARP10 AUCAAUAGCACCAUCUCCACCAGGC SEQ ID NO 86
PARP10 AGACGUCGCUCUCUUGCCACUUGAA SEQ ID NO 87
PARP10 UUCAAGUGGCAAGAGAGCGACGUCU SEQIDNO 88
PARP10 UGGGCAGCAUUAGCUGCCAUGUGUU SEQIDNO 89
PARP10 AACACAUGGCAGCUAAUGCUGCCCA SEQ ID NO 90
PARP11 CAACAAACAAUGAAGUGGAUGACAU SEQIDNO 91
PARP11 AUGUCAUCCACUUCAUUGUUUGUUG SEQIDNO 92
PARP11 CAGCCGGAUACCAACAGUCAGUGUU SEQIDNO 93
PARP11 AACACUGACUGUUGGUAUCCGGCUG SEQIDNO 94
PARP11 CAAACCCUUGUGGCUCCAUUUCUUU SEQ ID NO 95
PARP11 AAAGAAAUGGAGCCACAAGGGUUUG SEQIDNO 96
PARP11 UGCCACCACACUGGGAGAAUGUGAA SEQIDNO 97
PARP11 UUCACAUUCUCCCAGUGUGGUGGCA SEQIDNO 98
PARP12 UCCACCUCUGCAGGUUCAUGGUCUA SEQIDNO 99
PARP12 UAGACCAUGAACCUGCAGAGGUGGA SEQIDNO 100
PARP12 UGCCAGAAAUUUGCCAACAUUACAA SEQIDNO 101
PARP12 UUGUAAUGUUGGCAAAUUUCUGGCA SEQIDNO 102
PARP12 GGUGAGCAGGCUGCCUACCAUUUAU SEQIDNO 103
PARP12 AUAAAUGGUAGGCAGCCUGCUCACC SEQIDNO 104
PARP12 AGGAUUUGGACAACAUGGAACUUAU SEQIDNO 105
PARP12 AUAAGUUCCAUGUUGUCCAAAUCCU SEQIDNO 106
PARP13 GCUGACCCAAGAGUAGCACUUGUUA SEQIDNO 107
PARP13 UAACAAGUGCUACUCUUGGGUCAGC SEQIDNO 108
PARP13 CCGGUGGCAGAUGCUUAUUGGUAAA SEQIDNO 109
PARP13 UUUACCAAUAAGCAUCUGCCACCGG SEQIDNO 110
PARP13 GCUCACGGAACUAUGAGCUGAGUUU SEQ ID NO 40
PARP13 AAACUCAGCUCAUAGUUCCGUGAGC SEQIDNO 111
PARP13 UGCCUCAGUGGUAUGUGCAGCAGAU SEQIDNO 112
PARP13 AUCUGCUGCACAUACCACUGAGGCA SEQIDNO 113
PARP14 UGGCCUGUCUAAUGAUGACUUUCAA SEQIDNO 114
PARP14 UUGAAAGUCAUCAUUAGACAGGCCA SEQIDNO 115
PARP14 CCUGGUGCUGAUGACUACAGUUUAA SEQIDNO 116
PARP14 UUAAACUGUAGUCAUCAGCACCAGG SEQIDNO 117
PARP14 GCCACUUUCUGUGUUCCCAUACUAU SEQIDNO 118
PARP14 AUAGUAUGGGAACACAGAAAGUGGC SEQIDNO 119
PARP14 GAAGAGUCACUAGAUCUUCCCUUAU SEQIDNO 120
PARP14 AUAAGGGAAGAUCUAGUGACUCUUC SEQIDNO 121
PARP15 GAUGAAUUCACUAACUGGUCAAGAA SEQIDNO 122
PARP15 UUCUUGACCAGUUAGUGAAUUCAUC SEQIDNO 123
PARP15 CCUAUCACAGUUGCUGAUAACAUAA SEQIDNO 124
PARP15 UUAUGUUAUCAGCAACUGUGAUAGG SEQ ID NO 125
PARP15 GGACUGACAUGAAUCAUCAGCUGUU SEQIDNO 126
PARP15 AACAGCUGAUGAUUCAUGUCAGUCC SEQIDNO 127
PARP15 CGAGUACUUACUGGAGUCUUCACAA SEQIDNO 128
PARP15 UUGUGAAGACUCCAGUAAGUACUCG SEQ ID NO 129
PARP16 CAGUGCAGGGAAGGCAGAGUUUGAA SEQIDNO 130
PARP16 UUCAAACUCUGCCUUCCCUGCACUG SEQIDNO 131
PARP16 GAGACCAAAGGAGAACGAGACCUAA SEQ ID NO: 132
PARP16 UUAGGUCUCGUUCUCCUUUGGUCUC SEQ ID NO: 133
PARP16 GACUUGAGCCUGGCCCUCAUAUACA SEQ ID NO: 134
PARP16 UGUAUAUGAGGGCCAGGCUCAAGUC SEQ ID NO: 135
PARP16 CCCAAGUACUUCGUGGUCACCAAUA SEQ ID NO: 43
PARP16 UAUUGGUGACCACGAAGUACUUGGG SEQ ID NO: 136
The one or more PARP inhibitors may be administered to the subjects once a day, twice a day, three times a day, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, seven times a week, bi-weekly, tri-weekly, or monthly. The one or more PARP inhibitors may be administered via the same route of administration or via different routes of administration. For example, the one or more PARP inhibitors may be administered orally and one or more other PARP inhibitors may be administered parenterally (e.g., subcutaneously). The one or more PARP inhibitors may be formulated for any known route of administration, including oral, intravenous, intraarterial, intraocular, intranasal, intramuscular, and subcutaneous administration. The one or more PARP inhibitors may also be formulated for administration in a sustained- release form.
The invention similarly provides methods of decreasing the proliferation rate in a cell or a cell population by contacting the cell or cell population with an effective amount of one or more PARP inhibitors (as described for the treatment of subjects above). In these methods, the one or more PARP inhibitors are added to the tissue culture medium to decrease the proliferation rate of a cell or a cell population. Desirably, the cells are cultured for regenerative cell technology, the cells are primary or germ cells, or the cells are being stored for later therapeutic or experimental use. This method desirably confers on the cells protection from oxidative stress, promotes the longevity and morphology of the cultured cells, and/or delays the onset of senescence of the cells. Preferred cells that may be used in these methods include, without limitation, an epithelial cell, a fibroblast, a kidney cell, a muscle cell, a neuron, a hepatocyte, a sperm, a lymphocyte, or a macrophage. The concentration of the one or more PARP inhibitors may be determined using methods known in the art and those methods described herein (e.g., methods for the measurement of cell growth and division).
Pharmaceutical Compositions
The invention further provides pharmaceutical compositions for treating or reducing the likelihood of developing one or more stress granule disorders and cancer. For example, the compositions for the treating or decreasing the likelihood of developing
a stress granule-related disorder may include one or more of the PARP inhibitors (e.g., PARP5A, PARP12, PARP13.1, PARP13.2, and PARP15 inhibitors), one or more of the PARG activators (e.g., PARG protein and ARH3 activators), and/or one or more of the PARPl 1 activators as described above. Compositions for treating or decreasing the likelihood of developing a cancer may include one or more of the PARP inhibitors (e.g., PARP 1, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16 inhibitors) as described above. The one or more agents that may be used as pharmaceutical compositions for treating or reducing the likelihood of developing a stress granule-related disorder or cancer may also be identified using the screening assays provided herein.
Examples of pharmaceutical compositions for treating or reducing the likelihood of developing a stress granule related disorder include one or more of an antibody or antibody fragment that specifically binds to PARP5A, PARP12, PARP13.1 , PARP13.2, and PARPl 5; an RNAi molecule that decreases the expression of one or more of PARP5A, PARP12, PARP13.1, PARP13.2, and PARP15 (e.g., SEQ ID NOS: 40, 49, 99- 1 13, and 122-129); one or more nucleic acids containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41), and one or more small molecules or metabolites identified in the screening assays provided herein.
Examples of pharmaceutical compositions for treating or reducing the likelihood of developing a cancer include one or more of an antibody or antibody fragment that specifically binds to PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARPl 6; an RNAi molecule that decreases the expression of one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARPl 4, and PARPl 6 (e.g., SEQ ID
NOS: 43-46, 49, 50, 59-74, 1 14-121 , and 130-136); and one or more small molecules or metabolites identified in the screening assays provided herein.
The pharmaceutical compositions provided by the invention may further include one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) secondary agents. Non-limiting examples of secondary agents that may be included in the compositions of the invention are one or more chemotherapeutic agent(s), one or more non-steroidal anti-inflammatory drug(s), one or more immunosuppressive agent(s), one or more calcineurin inhibitor(s), or one or more analgesic(s). Examples of these classes of therapeutic agents are known in the art. The dose of one or more PARP inhibitors, PARPl 1 activators, and/or PARG activators may be between 0.1 mg and 1 g, 0.1 mg and 750 mg, 0.1 mg and 600 mg, 0.1
mg and 500 mg, 10 mg and 450 mg, 10 mg and 400 mg, 10 mg and 350 mg, 10 mg and 350 mg, and 10 mg and 250 mg.
The dose of one or more secondary agents that may be included in the compositions of the invention may be between 0.1 mg and 2 g, 0.1 mg and 1.5 mg, 0.1 mg and 1 g, 0.1 mg and 750 mg, 1 mg and 650 mg, 1 mg and 550 mg, 1 mg and 500 mg, 10 mg and 450 mg, 10 mg and 400 mg, 10 mg and 350 mg, 10 mg and 350 mg, and 10 mg and 250 mg.
The compositions may be formulated using any known method including formulation as a pill, an injectible fluid (e.g., in PBS), or in a sustained-release form. The compositions may be formulated for any specific route of administration including oral, intramuscular, intraocular, intranasal, subcutaneous, intraarterial, and intravenous administration.
Kits The invention further provides kits containing one or more (e.g., 1 , 2, 3, 4, 5, 6, 7,
8, 9, or 10) of the pharmaceutical compositions described herein. The kits may further contain materials to aid in the administration of the pharmaceutical agents (e.g., a syringe). The kits may contain one or more doses of a pharmaceutical agent provided by the invention. The kits may further contain instructions for administering the pharmaceutical compositions to a subject having a stress granule-related disorder or cancer, or a subject that has a high probability of developing (a high propensity) for developing a stress granule-related disorder or cancer.
Medical Screening Assays The invention further provides methods of determining the propensity of a subject to develop a stress granule-related disorder by determining the expression (e.g., protein or mRNA levels) and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, or 8) of PARP5A, PARPl 1 , PARPl 2, PARP13.1, PARP13.2, PARP15, PARG, and ARH3 in a subject, wherein an increase (e.g., at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) in the expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1 , 2, 3, 4, or 5) activities of one or more (e.g., 1 , 2, 3, 4, or 5) of PARP5A, PARPl 2, PARPl 3.1 , PARP 13.2, and PARPl 5, and/or a decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) in one or more (e.g., 1 , 2, or 3) of PARG, ARH3, and PARPl 1 expression (e.g., protein or mRNA levels) and/or one or more activities indicates an increased propensity to develop a stress-granule
related disorder. In this method, the expression measured may be the level of one or more nucleic acids containing a nucleic acid sequence having at least 80% (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARPl 1 (SEQ ID NO: 17), PARP 13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP15 (SEQ ID NO: 22 or 23), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41), or one or more polypeptides encoded by these nucleic acids. The invention further provides methods of determining the propensity of a subject to develop a cancer by determining the expression (e.g., protein and/or mRNA level) and/or one or more activities (e.g., 1, 2, 3, 4, or 5) of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16 in a subject, wherein an increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) in the expression and/or one or more activities of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP 14, and PARP 16 indicates an increased propensity to develop cancer. In this method, the expression measured may be the level of one or more nucleic acids containing a nucleic acid sequence having at least 80% (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) identity to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP 7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ ID NO: 21), and PARP16 (SEQ ID NO: 16), or the level of one or more polypeptides encoded by these nucleic acids.
In each of these methods, the level of expression of a nucleic acid may be determined using RT-PCR and the level of a polypeptide encoded by a nucleic acid may be determined by a variety of different antibody-based techniques including, but not limited to, immunoblotting, fluorescence-assisted cell sorting (FACS), and enzyme-linked immunosorbent assay (ELISA). In each assay, the level of expression in a subject may be compared to a subject known to have a stress granule-related disorder or cancer, or a control subject that does not have a stress granule-related disorder or cancer, or a very low propensity for developing a stress granule-related disorder or cancer.
PARP, PARG, and ARH3 Fusion Proteins General Design
The invention provides fusion proteins for each PARP, PARG, and ARH3. The fusion proteins may be used to identify unique biological activities for each PARP, PARG, and ARH3 protein and to identify specific inhibitors and activators for each
PARP, PARG, or ARH3, or specific subsets of these proteins. The invention provides nucleic acid sequences encoding these PARP, PARG, and ARH3 fusion proteins. The nucleic acids contain a sequence that is at least 80% identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identical) to the full-length sequence of PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 11), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARPlO (SEQ ID NO: 15), PARP 10.2 (SEQ ID NO: 16), PARPI l (SEQ ID NO: 17), PARP12 (SEQ ID NO: 18), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP14 (SEQ ID NO: 21 ), PARP15.1 (SEQ ID NO: 22), PARP15.2 (SEQ ID NO: 23), PARP16 (SEQ ID NO: 24), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41).
The nucleic acids of the invention further contain nucleic acid sequences encoding one or two polypeptide tags. The nucleic acids encoding a polypeptide tag may be placed at a position 5' or a position 3' to the sequence encoding a PARP, PARG, or ARH3 protein. For example, the 3' end of a nucleic acid sequence encoding a polypeptide tag may directly abut (i.e., no intervening nucleotides) the 5' end of a nucleic acid sequence encoding a PARP, PARG, or ARH3 protein. In another example, the 5' end of a nucleic acid sequence encoding a polypeptide tag may directly abut (i.e., no intervening nucleotides) the 3' end of nucleic acid sequence encoding a PARP, PARG, or ARH3 protein. In another example, one or more nucleotides (e.g., at least 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, or 400 nucleotides) separate the 5' end of the sequence encoding the polypeptide tag from the 3' end of the sequence encoding a PARP protein, or separate the 3' end of the sequence encoding the polypeptide tag from the 5' end of the sequence encoding the PARP protein. Sequences encoding the polypeptide tags are described in further detail below.
Polypeptide Tags
Polypeptide tags may be attached to a native protein sequence in order to aid in the purification of the protein, to label the protein for visualization in the cell, and/or to increase the thermodynamic stability and/or half-life of a protein. Nucleic acids encoding a polypeptide tag(s) may include one or more of the following sequences: a sequence encoding an epitope which may be recognized by a specific antibody recognizing the epitope (e.g., 1 , 2, 3, 4 or 5 antigenic peptide sequences); a sequence encoding a protein that is bound with high affinity by a specific binding partner; one or more (e.g., 1 , 2, 3, 4,
or 5) sequence(s) encoding a peptide sequence that aids in purification (e.g., a His6 tag); one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) sequence(s) encoding a protease recognition sequence; and one or more (e.g., 1, 2, 3, or 4) sequences encoding a protein or a domain of a protein which increases the thermodynamic stability or half-life of the protein. The size of the nucleic acid sequence encoding the polypeptide tag may be between 1-50 nucleotides, 1-100 nucleotides, 1-200 nucleotides, 1-300 nucleotides, 1 -400 nucleotides, 1-500 nucleotides, 200-500 nucleotides, 1-1,000 nucleotides, 1-5,000 nucleotides, 1- 8,000 nucleotides, 1-10,000 nucleotides, or 1-20,000 nucleotides. Several polypeptide tags and sequences encoding polypeptide tags are known in the art. Non-limiting examples of sequences that may be incorporated in polypeptide tags are described below.
The nucleic acids encoding a polypeptide tag may contain sequences for one or more (e.g., 1, 2, 3, 4, or 5) epitopes or antigenic peptide sequences. Epitopes incorporated into polypeptide tags may be used to aid in the purification of a fusion protein, for e.g., by use of an antibody that specifically binds to the epitope. Examples of epitope sequences include, but are not limited to, a FLAG peptide (DYKDDDDK; SEQ ID NO: 30); a glutathione-S- transferase (GST) peptide; a KT3 peptide (KPPTPPPEPET; SEQ ID NO: 31); a hemagglutinin peptide (YPYDVPDYA; SEQ ID NO: 32), a calmodulin-binding peptide {Methods in Molecular Biology: E. coli Gene Expression Protocols, volume 205, Humana Press, 2003, pp. 79-97), a R-tag peptide (Jones et al., Protein Expr. Purif. 53:404-410, 2007), a V5 peptide, a c-myc peptide, and peptides derived from chitin-binding protein (CBP), CYD, Strep II, HPC, and maltose binding protein (MBP), as described in Lichty et al. {Protein Expr. Purif. 41 :98-105, 2005).
Nucleic acids encoding a polypeptide tag may contain sequences for one or more (e.g., 1 , 2, 3, 4, or 5) proteins with specific binding partners. Desirably, the specific binding partner has a high affinity (e.g., KD < 150 nM or KD < 250 nM) to the peptide sequence in the polypeptide tag. Non-limiting examples of sequences that encode a protein with a high-affinity binding partner is biotin and the ZZ-domain of S. aureus protein A (e.g., a nucleic acid sequence with at least 80% identity to SEQ ID NO: 27). Additionally, the polypeptide tag may contain one or more peptide sequences that aid in the purification of the protein. Non-limiting examples of peptide sequences that aid in the purification of a protein include a His6 tag, chitin-binding protein (CBP), maltose-binding protein (MBP), and glutathione-S-transferase (GST). For example, a protein containing a polypeptide tag containing a His6 tag may be purified by passing a crude cellular lysate over a metal matrix (e.g., a Ni+-Sepharose resin).
A polypeptide tag may also contain a sequence encoding a protein that increases the thermodynamic stability, half-life, and/or solubility of a protein. Non-limiting examples of peptides that increase the solubility of a protein include thioredoxin and poly(NANP). Additional non-limiting examples of proteins that increase the thermodynamic stability or half-life of a protein include the Fc domain of an antibody and albumin. A polypeptide tag may also contain one or more (e.g., 1, 2, 3, or 4) sequences encoding a protein that allows for the visualization of the fusion protein in the cell (e.g., a polypeptide tag containing a sequence encoding a fluorescent protein, such as green fluorescence protein). A polypeptide tag may also contain one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) protease recognition sequences. A fusion protein may be treated with one or more (e.g., 1 , 2, 3, or 4) specific proteases that cleave the fusion protein at the one or more specific protease recognition sequences at any step in the purification process (e.g., after being bound to a resin or solid surface) to remove the polypeptide tag(s) from the remainder of the fusion protein. Non-limiting examples of protease recognition sequences include TEV protease (Glu-X-X-Tyr-X-Gln-Ser; SEQ ID NO: 26), factor Xa (Ile-Glu/Asp-Gly- Arg), Ala-64 subtilisin (Gly-Ala-His-Arg), clostripain (Arg and Lys-Arg), collagenase (Pro-Val-Gly-Pro), enterokinase (Asp-Asp-Asp-Asp-Lys), renin (Pro-Phe-His-Leu-Leu), and α-thrombin (Leu-Val-Pro-Arg-Gly-Ser). When a polypeptide tag is present at the N- terminus of a fusion protein, a protease recognition sequence is preferably located at a position 3' to a peptide sequence encoding an epitope, a sequence encoding a protein that is bound with high affinity by a specific binding partner, or a sequence encoding a peptide sequence that aids in purification. When a polypeptide tag is present at the C-terminus of a fusion protein, a protease recognition sequence is preferably located at a position 5' to a peptide sequence encoding an epitope, a sequence encoding a protein that is bound with high affinity by a specific binding partner, and/or a sequence encoding a peptide sequence that aids in purification. A polypeptide tag may contain one or more (e.g., 1 , 2, 3, 4, 5, 6, or 7) of the same or different protease recognition sequences in tandem (i.e., without intervening amino acids) or with one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) intervening amino acids between each protease recognition sequence. Methods for the treatment of a fusion protein containing a protease recognition sequence in the polypeptide tag with one or more protease(s) are known in the art.
Expression Vectors
A number of expression vectors for the expression of a nucleic acid encoding one or more nucleic acids encoding a PARP, PARG, and/or ARH3 fusion protein of the invention are known in the art. Different examples of expression vectors are available for expression of the PARP, PARG, and/or ARH3 fusion proteins in mammalian cells, insect cells, yeast cells, and bacterial cells. For example, the pEGFP-Cl mammalian vector (Invitrogen) contains a CMV promoter sequence, a nucleic acid sequence encoding green fluorescence protein, a multiple cloning site for insertion of nucleic acid sequence encoding a PARP, PARG, or ARH3 nucleic acid (e.g., a sequence with 80% to one of SEQ ID NOS: 1-24, 41 , and 42). Additional non-limiting examples of publicly-available mammalian expression vectors include constitutive expression vectors Gateway" pDEST™26, pDEST™27, pDEST™40, and pDEST™47 (Invitrogen); adenoviral expression vectors (e.g., pAd/CM/V5-Dest Gateway" Vector Kit (Invitrogen); episomal expression vectors pCEP4 and pEBNA DEST (Invitrogen); lentiviral expression vectors (e.g., ViraPower™ Bsd; Invitrogen); and regulated expression vectors Gateway® pT- Rex™-DEST 30 and pT-Rex™-DEST 31 (Invitrogen). Non-limiting examples of bacterial expression vectors include Gateway® pDEST™14; Gateway® pDEST™15; Gateway® pDEST™17; Gateway® pDEST™24; Gateway® pET-DEST42; pEM7/Bsd; pEM7/Zeo; pRSET A, B, & C; pRSET-BFP; pRSET-CFP; pRSET-EmGFP; pTrcHIs A, B, & C; and pTrcHIs2 A, B, & C vectors (Invitrogen). Non-limiting examples yeast expression vectors include pAO815; pGAPZ A, B, & C; pPIC3.5K; pPIC9K; pTEFl/Bsd; pTEFl/Zeo; pYC2/CT; pYES2; pYES2/CT; and pYES3/CT (Invitrogen). Non-limiting examples of insect and baculovirus expression vectors include Gateway" pDEST™10; Gateway® pDESTI M20; Gateway® pDEST™8; Gateway® pMT-DEST™48; pAC5.1/V5- His A, B, & C; pFastBac Dual; and pIB/V5-His-DEST (Invitrogen).
The expression vectors used to express a fusion protein may include one or more (e.g., 1 , 2, 3, 4, or 5) constitutive promoter sequences and/or one or more (e.g., 1 , 2, 3, 4, or 5) inducible promoter sequences. Non-limiting examples of constitutive promoter sequences include bacterial promoters (e.g., E. coli a70, σs, σ32, or σ54 promoters; B. subtilis σΛ or σB promoters; T7 RNA polymerase-based promoters; and a bacteriophage SP6 promoter), yeast promoters (e.g., pCyc, pAdh, pSte5, ADHl , cycl 00, cyc70, cyc43, cyc28, eye 16, pPGKl, pCYC, GPD (TDH3), and CLB l promoters), and mammalian promoters (e.g., cytomegalovirus immediate early gene-based promoters, SV40 early promoter, and Rous sarcoma virus promoter). Non-limiting examples of inducible promoter sequences include alcohol dehydrogenase I gene promoters, tctracycline-
responsive promoter systems, glucocorticoid receptor promoters, estrogen receptor promoter, ecdysone receptor promoters, metallothionein-based promoters, and T7- polymerase based promoters. Several different mammalian expression vectors available that allow for the inducible expression of a nucleic acid sequence (e.g., a PΛRP fusion protein) are publicly available including pTet-On-Advanced (Clontech), pERV3 (Stratagene), pNEBR-Rl (New England BioLabs), and pCMV5-CymR (Qbiogene).
PARP, PARG, and ARH3 Proteins
The above-described methods for the generation of PARP, PARG, or ARH3 fusion proteins may be modified to generate PARP, PARG, or ARH3 proteins. In these methods, the expression vectors that contain a nucleic acid sequence encoding a PARP, PARG, or ARH3 fusion protein may be modified to remove the nucleic acid sequences encoding the polypeptide tag. The modified vector may then be introduced into a cell to generate a transgenic cell for the expression of the full-length or wild-type PARP, PARG, or ARH3 protein. The produced PARP, PARG, or ARH3 protein may contain one or more post-translational modifications, including phosphorylation and poly-ADP- riboyslation. The post-translational modifications may be introduced using recombinant enzymes in vitro or may be the result of processing within the transgenic cell.
Methods for the expression and purification of one or more PARP, PARG, and ARH3 proteins are the same as those employed for the corresponding PARP, PARG, and ARH3 fusion proteins, with the exception that affinity purification using antibodies and molecules that specifically recognize the polypeptide tag will not be employed.
Transgenic Cells and Mammals One or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or PARP. PARG, and/or ARH3 fusion protein may be introduced into a transgenic cell using methods known in the art, including, but not limited to electroporation, microinjection, lipid-mediated transfection (e.g., liposomal delivery systems), calcium phosphate-mediated transfection, DEAE dextran-mediated transfection, DNA transfection by biolistics, DNA transfection mediated by polybrene, and virus-mediated transduction.
The one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and/or ARH3 fusion protein may be introduced into any type of cell, including, but not limited to, a mammalian cell (e.g., a human, mouse, rat, monkey, or rabbit cell), a yeast cell, a bacterial cell, or an insect cell. A mammalian cell that expresses one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein,
and/or PARP, PARG, and/or ARH3 fusion protein may include a fibroblast, an epithelial cell, an endothelial cell, a smooth muscle cell, a hepatocyte, a kidney cell, and a lymphocyte. Additional examples of suitable mammalian cell lines include COS-7 monkey kidney cells, CV-I, L cells, C 127 cells, 3T3 cells, Chinese hamster ovary (CHO) cells, human embryonic kidney (HEK) cells, HeLa cells (e.g., HeLa S3 or HeLa Kyoto cells), 293 cells, 293T cells, and BHK cell lines. One or more nucleic acids may also be expressed in a cell (e.g., a mammalian cell, a bacterial cell, or a yeast cell) that has been engineered to express one or more (e.g., 1, 2, 3, or 4) chaperone proteins, one or more (e.g., 1, 2, 3, or 4) enzymes that promote the post-translational modification of proteins, and/or contain one or more (e.g., 1, 2, 3, or 4) mutations in the nucleic acids encoding one or more (e.g., 1 , 2, 3, or 4) proteins that have a negative effect on the expression of a transgenic protein (e.g., a PARP fusion protein), such as a specific RNAse or protease. An example of a bacterial cell that has been engineered to contain a mutation in a RNAse is BL21 Star™ (Invitrogen). A variety of cells are commercially available for the expression of one or more recombinant proteins (e.g., one or more PARP, PARG, and/or ARH3 fusion proteins), including, but not limited to, bacterial competent cells (e.g., BL21-AI™ One Shot®, One Shot®-BL21(DE3), and One Shot®-BL21(DE3) pLysE, One Shot" BL21(DE3) pLysS (Invitrogen); and mammalian competent cells (e.g., Espresso Competent HeIa S3 Cells, Espresso Competent CHO-Kl cells, and Espresso Competent HEK 293 cells (Neuromics), MaxPAK Competent HeLa S3 cells, MaxPAK Competent CHO-Kl cells, and MaxPAK Competent HEK 293 cells (Genlantis)).
A transgenic cell that contains one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and/or ARH3 fusion protein may a stable cell line (e.g., a cell that has integrated the one or more nucleic acids encoding a PARP fusion protein into one or more of its chromosomes). Alternatively, a transgenic cell may contain the one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and/or ARH3 fusion protein in a plasmid or on an artificial chromosome, which replicates independently of the chromosomes of the cell.
A transgenic mammal may also be produced from a transgenic cell containing one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or a PARP, PARG, and/or ARH3 fusion protein. A transgenic animal may be a mouse, a rat, a bovine, an ovine, a caprine, a porcine, a horse, a rabbit, or a monkey. The nucleic acid encoding one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may contain a tissue-specific promoter that allows the expression of one or more transgenic proteins into a biological fluid of the mammal (e.g., into the
milk or serum of the transgenic mammal). For example, a protein may be engineered for expression in the milk of a mammal by placing the sequence encoding the protein downstream of the casein promoter (U.S. Patent No. 4,873,316). A PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and/or ARH3 fusion protein produced in a biological fluid of a transgenic mammal may be purified as described below.
Methods for the production of a transgenic mammal from a transgenic cell are known in the art and include, without limitation, methods that require the transfer of a nucleus from a transgenic cell to an enucleated oocyte and/or the microinjection of one or more nucleic acids (e.g., a plasmid or an artificial chromosome) encoding one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins into an oocyte. Such genetically manipulated oocytes may then be transferred into a recipient female host to produce a transgenic mammal.
Cell Lysates Cell lysates may be prepared from the transgenic cells containing a nucleic acid encoding one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins of the invention. Cell lysates may be prepared by any methods known in the art, including both physical disruption methods and chemical disruption methods. Physical disruption methods include, but are not limited to sonication, homogenization, and rapid freeze/thaw lysis. Chemical disruption methods include, but are not limited to, the use of lysis buffers (e.g., buffers containing a detergent such as Triton-X-100 and NP-40). Following lysis of the cell membrane using chemical and/or physical disruption methods, the lysate may optionally be centrifuged to remove cellular debris and/or partially purified by one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) of the following steps: salt gradient precipitation (e.g., ammonium sulfate precipitation), size exclusion chromatography or dialysis, and column chromatography (e.g., affinity chromatography, size exclusion chromatography, anion exchange chromatography, and cation exchange chromatography). The cell lysate may also be treated with one or more (e.g., 1, 2, or 3) of a DNAse, RNAse, or lipase prior to further use. One or more (e.g., 1 , 2, 3, 4, or 5) protease inhibitors may also be added to the cell lysate prior to use.
PARP, PARG, and ARH Protein and Fusion Protein Purification
One or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may be fully or partially purified (e.g., at least 60%, 70%, 80%, 85%, 90%, 95%, and 99% pure from other proteins in the cell) from cell lysates, a
biological medium (e.g., cell culture medium from a transgenic cell), or a biological fluid (e.g., blood, serum, or milk) from transgenic mammal expressing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or a PARP, PARG, and/or ARH3 fusion protein of the invention. Alternatively, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may be fully or partially purified from the extracellular medium of a transgenic cell expressing one or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein, and/or a PARP, PARG, and/or ARH3 fusion protein of the invention. In each example, a cell lysate, biological fluid (e.g., milk or serum), or extracellular medium containing one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins is collected.
Methods for the purification of a recombinant protein from a cell lysate, biological fluid, or extracellular medium are known in the art. For example, in instances where the PARP, PARG, and/or ARH3 fusion protein contains an epitope, an antibody specific for the epitope (e.g., anti-GFP antibodies, anti-FLAG antibodies, anti-GST antibodies, anti-hemagglutinin antibodies, anti-c-myc antibodies, and anti-V5 antibodies) may be used to purify one or more PARP, PARG, and/or ARH3 fusion protein(s). In another example, a PARP, PARG, and/or ARH3 fusion protein may contain a polypeptide tag containing a sequence that aids in affinity purification of the protein (e.g., a Hisβ tag, a calmodulin-binding protein tag, a glutathione S-transferase protein tag, a strep II tag, a HPC tag, a maltose-binding protein tag). In each example, a solid surface, resin, or bead (e.g., magnetic bead) may be covalently attached to a protein or molecule specifically bound by the protein sequence located in the polypeptide tag. In such instances, contacting the one or more PARP, PARG, and/or ARH3 fusion protein(s) with the solid surface, resin, or bead will cause the selective binding of the one or more PARP, PARG, and/or ARH3 fusion protcin(s) with the solid surface, resin, or bead. The remaining non- bound proteins will not bind and may be washed away using an appropriate buffer. Specific methods for the affinity purification of proteins are known in the art.
One or more PARP, PARG, and/or ARH3 fusion proteins may also be purified from a cell lysate, biological sample, or a extracellular medium by a purification protocol including, but limited to: salt precipitation (e.g., ammonium sulfate precipitation), pH precipitation, precipitation using organic solvents, high performance liquid chromatography (HPLC), column chromatography, ion exchange chromatography (e.g.,
cation exchange chromatography and anion exchange chromatography), immobilized metal affinity chromatography, gel filtration, or size exclusion chromatography or dialysis. One or more (e.g., 1, 2, 3, 4, 5, 6, or 7) of these steps may also be used in combination with an affinity purification step as described above. The one or more purified PARP, PARG, and/or ARH3 proteins, and/or PARP,
PARG, and/or ARH3 fusion proteins may be dialyzed to exchange the buffer or concentrated prior to use in one or more of the assays described herein (e.g., PARP, PARG, and/or ARH3 activity assays or assays for the identification of a specific PARP activator or inhibitor). The one or more purified PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may be stored at -700C in the presence or absence of one or more (e.g., 1, 2, 3, 4, or 5) stabilizing proteins including, but not limited to, albumin.
PARP Protein and PARP Fusion Protein Assays The biological activity of the one or more PARP proteins and PARP fusion proteins of the invention include, but are not limited to, one or more (e.g., 1 , 2, 3, 4, or 5) of the ability to covalently attach an ADP-ribose molecule to one or more (e.g., 1 , 2, 3, 4, or 5) substrate(s) (e.g., a protein, a RNA molecule, a DNA molecule, or a lipid), the ability to covalently attach an ADP-ribose molecule to a ADP-ribose residue covalently attached to a substrate, the ability to add a branched ADP-ribose molecule to a preexisting poly-ADP-ribose, the ability to localize to the cell nucleus, the ability to localize to stress granules, the ability to catalyze the formation or nucleation of stress granules, the ability to catalyze the disassembly of stress granules, the ability to promote cell division and mitosis, or the ability to inhibit RNAi activity in the cell. Specific PARP proteins have a different subset of biological activities: PARPl , PARP2, PARP5A, PARP5B,
PARP7, PARP8, PARPl 4, and PARPl 6 have the ability to localize to the nucleus and/or the ability to promote cell division and mitosis; PARP5A, PARP12, PARP13.1 , PARP13.2, and PARP15 have the ability to localize Io stress granules and the ability to promote or nucleate stress granule formation; PARPl 1 has the ability to localize to stress granules and the ability to promote disassembly of stress granules or prevent the formation of stress granules; and PARPl 3.1 has the ability to decrease the activity of RNAi and the ability to add one or more ADP-ribose molecules to Argonaut.
Assays to measure the ability of one or more PARP proteins and PARP fusion protein(s) to covalently attach an ADP-ribose to one or more (e.g., 1 , 2, 3, 4, or 5) substrate(s) (e.g., a protein, a RNA, a DNA, or a lipid) involve the incubation of one or
more PARP fusion protein(s) with the one or more substrate(s) in the presence of a labeled NAD+ molecule (e.g., radiolabeled, fluorescently-labeled, and colorimetrically- labeled NAD+). A radiolabeled NAD+ substrate may contain one or more radioisotopes including, but not limited to, 14C (e.g., 14C-adenine), 32P, and 3H. Additional NAD+ substrates include fluorescently-labeled NAD+ (Putt et al., Anal. Biochem. 78:326, 2004), colorimetrically-labeled NAD+ (Nottbohn et al., Agnew. Chem. Int. Ed. 46:2066-2069, 2007), and biotinylated NAD+ (6-biotin-17-NAD; R & D Systems). Following incubation of the one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP proteins and/or the one or more PARP fusion proteins with the labeled NAD+ and one or more (e.g., 1 , 2, 3, 4, or 5) substrate molecules, the specific labeling of the substrate(s) with one or more labeled ADP-ribose molecules is determined by measuring the amount of the label associated with the NAD+ that is covalently bound to the one or more substrate molecules. An increase (e.g., at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) in the amount of the label associated with the NAD+ that is covalently bound to the one or more substrate(s) indicates PARP protein or PARP fusion protein activity.
In another example of a PARP assay, the auto-modification of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP proteins or PARP fusion protein(s) is measured by incubating the one or more PARP proteins and/or PARP fusion proteins of the invention with a labeled NAD+ substrate and subsequently, measuring the amount of the label associated with the NAD+ covalently bound to the one or more PARP fusion proteins. An increase in the amount of the label associated with the NAD+ covalently bound to the one or more PARP fusion proteins indicates PARP fusion protein auto-modification. In an alternative assay, one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, or 20 or more) PARP proteins and/or PARP fusion proteins may be incubated with one or more (e.g., 1 , 2, 3, 4, or 5) substrates and a non-labeled NAD+. The poly-ADP-ribosylation of the one or more substrates may be measured by contacting the one or more substrates with a poly-ADP-ribose antibody. For example, a sample of substrate proteins may be electrophoresed and immmunoblotted with an anti-poly-ADP- ribose antibody. An increased number of proteins or an increased level of detection using an anti-poly-ADP ribose antibody indicates an increase in the activity of the one or more PARP fusion proteins.
Assays to measure the ability of a PARP protein and/or PARP fusion protein to localize to a specific cellular structure or organelle using immunofluorescence
microscopy are known in the art. For example, antibodies specific for one or more PARP proteins and/or fusion proteins, and antibodies specific for one or more proteins or molecules specific to a cellular structure or organelle (e.g., cytoskeleton, mitochondria, trans-Golgi network, endoplasmic reticulum, early endosome, centrosome, GW bodies, nuclear envelope, lysosome, peroxisomes, histones, Cajal bodies, nucleus, and mitochondria) may be used to perform immunofluorescent microscopy. Localization of one or more PARP proteins and/or PARP fusion proteins may be measured in high- throughput experiments by co-localization of one or more PARP proteins and/or fusion proteins with one or more proteins specific for a cellular structure or organelle (e.g., proteins listed in Figure 10). Localization of one or more PARP proteins and/or PARP fusion proteins in the nucleus may also be demonstrated by co-localization of a dye that stains DNA and an antibody that specifically binds the one or more PARP proteins and/or PARP fusion proteins (e.g., co-localization of an antibody specific for one or more PARP proteins and/or PARP fusion proteins, and 4',6-diamindino-2-phenylindole (DAPI)). Localization of one or more PARP proteins and/or PARP fusion proteins to a specific cell structure or organelle may occur only during one or more (e.g., 1, 2, 3, 4, 5, or 6) specific stages of the cell cycle, including, but not limited to, G2-M, prophase, prometaphase (P-M), metaphase, anaphase, cytokinesis, G0, and Gi stages. For the purposes described herein, a PARP protein and/or PARP fusion protein is deemed to have the ability to localize to a specific cellular structure or organelle if it localizes to the specific cellular structure or organelle in at least one stage (e.g., mitosis or cytokinesis) of the cell cycle.
The ability of a PARP protein and/or fusion protein to promote stress granule assembly or to inhibit stress granule assembly may be measured using fluorescence microscopy. In such a method, cells are treated with one or more PARP inhibitors, one or more PARP activators, or a nucleic acid encoding one or more PARP proteins and/or PARP fusion proteins, and are subsequently fixed and immunostained with antibodies specific for one or more stress granule protein (e.g., one or more of eIF3, eIFl A, eIF2α, eIF3η, eIF4Al , elF4e, and G3BP). An increase in the number of foci containing one or more stress granule proteins (e.g., intense immunostaining in distinct cellular structures) indicates an increase in the formation of stress granules. A decrease in the number of foci containing one or more stress granule proteins, likewise, indicates a decrease in the formation of stress granules. In such assays, stress granule formation may be induced by exposure to stress conditions, for example, by treatment with sodium arsenite and pateamine A.
The ability of one of more PARP proteins and/or PARP fusion proteins to promote cell division and mitosis may be measured using any method known in the art. For example, cell proliferation assays including, but not limited to, standard cell counting assays, BrdU labeling, and quantitative assays for DNA synthesis such as 3H-thymidine incorporation may be used to measure the ability of one or more PARP proteins and/or PARP fusion proteins to promote cell division and mitosis. Likewise, inhibition of one or more PARP proteins and/or PΛRP fusion proteins with the ability to promote cell division and mitosis may result in cell death. Several assays to measure cell death are known in the art, including, but not limited to Hoechst 33342 staining of chromatin, propidium iodide staining, annexin V staining of phosphoserine, and 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) staining.
Assays for measuring RNAi activity in a cell are available in the art. For example, psiCHECK™-l, psiCHECK™-2, and pGL4.72[hRlucCP]™ vector assay systems provide methods for the measurement of RNAi activity in a cell. In these assays systems, luciferase is used a primary reporter gene and a target sequence (i.e., the target of one or more RNAi molecules) is cloned a multiple cloning region located downstream of the luciferase translational stop codon. Initiation of the RNAi process towards the target gene results in the cleavage and subsequent degradation of the fusion mRNA encoded by the vectors (i.e., upon treatment of the transfected cell with a vector-target RNAi molecule). Measurement of decreased luciferase activity in the transfected cells following treatment with the vector-target RNAi indicates the activity of RNAi in the cell. For example, in experiments using the psiCHECK assay system, a cell transfected with the psiCHECK vector is treated with the vector-target RNAi and with an activator or inhibitor of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP proteins and/or PARP fusion proteins (e.g., 1, 2, 3, 4, or 5 RNAi molecules targeting a specific PARP). Transfected cells treated with the vector-target RNAi and with a PARP inhibitor or activator that demonstrate increased luciferase activity relative to a transfected cell treated with the vector-target RNAi alone indicate that the specific targeted PARP activates or inhibits RNAi activity in the cell, respectively. Cells treated with a PARP inhibitor or activator that demonstrate decreased luciferase activity relative to a cell treated with vector-target RNAi alone indicate that the specific targeted PARP inhibits or activates RNAi activity in the cell, respectively.
Any of the above-referenced PARP protein and/or PARP fusion protein activity assays may be performed to determine the activity of PARP protein or PARP fusion protein sequence encoded by a nucleic acid having at least 80% sequence identity to one
of SEQ ID NOS: 1-24. The domain structure of several PARP proteins are shown in Figure 3. Preferred mutations in the wild-type sequences of PARP proteins (e.g., SEQ ID NOS: 1-24) do not introduce amino acid changes in the catalytic domain in Figure 3. In addition, the biological activity of a PARP protein and/or PARP fusion protein containing a sequence having at least
80% sequence identity to one of SEQ ID NOS: 1-24 may be assessed using any of the above-described cellular or in vitro assays.
PARG and ARH3 Protein and Fusion Protein Assays The activity of one or more PARG protein, ARH3 protein, PARG fusion protein, and/or ARH3 fusion protein may be determined using assays known in the art. PARG and ARH3 proteins herein have been demonstrated to decrease or prevent the formation of stress granules. Assays for the measurement of stress granule formation and disassembly are described herein. Additional assays for PARG and ARH3 proteins (and fusion proteins) include the hydrolysis of poly-ADP-ribose. Labeled poly-ADP-ribose (e.g., 32P, 14C, or biotinylated ADP) may be used as a substrate for the measurement of the hydrolysis and release of ADP-ribose from a labeled and/or attached poly-ADP-ribose polymer.
Additional assays for PARG and ARH3 proteins involve the use of antibodies specific for poly-ADP-ribose. For example, cells may be transfected with a nucleic acid that overexpresses a PARG protein, ARH3 protein, PARG fusion protein, and/or ARH3 fusion protein and cells untreated or treated with a stress condition (e.g., sodium arsenite). Cells that contain an active form of a PARG protein, ARH3 protein, PARG fusion protein, and/or ARH3 fusion protein show decreased staining for poly-ADP-ribose than cells transfected with a control form or inactive form of these proteins (e.g., a form lacking its catalytic domain or a form containing an inactivating mutation).
These activity assays will also aid in the identification of which amino acids may be mutated to generate nucleic acids having at least 80% (e.g., at least 85%, 90%, 95%, 99%, or 100% identity) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41). Preferred sites of mutation lie outside the catalytic domains of PARG and/or ARH3.
PARP-Specific Antibodies
Antibodies specific to the one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP proteins and/or PARP fusion proteins of the invention can be generated using standard methods, such as those described herein.
Antibodies specific for one or more PARP fusion proteins, PARP proteins, or fragments of PARP proteins and/or PARP fusion proteins may be used in quantitative assays to measure to amount of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP proteins and/or PARP fusion proteins present in a cell, cell lysate, biological sample, or extracellular medium. Antibodies specific to the one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP proteins and/or PARP fusion proteins of the invention may also be used to identify specific binding partners or potential inhibitors or activators of the one or more PARP proteins and/or PARP fusion proteins. For the preparation of polyclonal antibodies reactive with one or more PARP proteins and/or PARP fusion proteins, one or more PARP protein(s), PARP fusion protein(s), fragments of PARP protein(s), or fragments of PARP fusion protein(s) can be purified from natural sources (e.g., cultures of cells expressing one or more PARP proteins) or synthesized in, e.g., mammalian, insect, or bacterial cells by expression of corresponding DNA sequences contained in a suitable cloning vehicle (e.g., the nucleic acids encoding PARP proteins and PARP fusion proteins described herein). Fusion proteins are commonly used as a source of antigen for producing antibodies. The antigenic proteins can be optionally purified, and then coupled to a carrier protein, mixed with Freund's adjuvant to enhance stimulation of the antigenic response in an inoculated animal, and injected into rabbits, mice, or other laboratory animals. Primary immunizations are carried out with Freund's complete adjuvant and subsequent immunizations performed with Freund's incomplete adjuvant. Following booster injections at bi-weekly intervals, the inoculated animals are then bled and the sera isolated. The sera is used directly or is purified prior to use by various methods, including affinity chromatography employing reagents such as Protein A-Sepharose, antigen-Sepharose, and anti-horse-Ig-Sepharose. Antibody titers can be monitored by Western blot and immunoprecipitation analyses using one or more PARP proteins, PARP fusion proteins, and/or fragments of PARP fusion proteins or PARP proteins. Immune sera can be affinity purified using one or more PARP proteins, PARP fusion proteins, and/or fragments of PARP fusion proteins or PARP proteins coupled to beads. Antiserum specificity can be determined using a panel of proteins, such as one or more PARP proteins, PARP fusion proteins, and/or fragments of PARP fusion proteins or PARP proteins.
Alternatively, monoclonal antibodies are produced by removing the spleen from the inoculated animal, homogenizing the spleen tissue, and suspending the spleen cells
suspended in phosphate buffered saline (PBS). The spleen cells serve as a source of lymphocytes, some of which produce antibody of the appropriate specificity. These cells are then fused with permanently growing myeloma partner cells, and the products of the fusion plated into a number of tissue culture wells in the presence of selective agents, such as hypoxanthine, aminopterine, and thymidine (Mocikat, J. Immunol. Methods 225:185-189, 1999; Jonak et al., Hum. Antibodies Hybridomas 3:177-185, 1992; Srikumaran et al., Science 220:522, 1983). The wells can then be screened by ELlSA to identify those containing cells making antibody capable of binding to one or more PARP proteins, PARP fusion proteins, fragments of PARP proteins, and/or fragments of PARP fusion proteins, or mutants thereof. These cells can then be re-plated and, after a period of growth, the wells containing these cells can be screened again to identify antibody- producing cells. Several cloning procedures can be carried out until over 90% of the wells contain single clones that are positive for specific antibody production. From this procedure, a stable cell line of clones that produce the antibody are established. The monoclonal antibody can then be purified by affinity chromatography using Protein A Sepharose and ion-exchange chromatography, as well as variations and combinations of these techniques. Once produced, monoclonal antibodies are also tested for specific PARP protein and/or PARP fusion protein recognition by ELISA, Western blot, and/or immunoprecipitation analysis (see, e.g., Kohler et al., Nature 256:495, 1975; Kohler et al., Eur. J. Immunol. 6:511 , 1976; Kohler et al., Eur. J. Immunol. 6:292, 1976;
Hammerling et al., In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, New York, NY, 1981).
As an alternate or adjunct immunogen to a PARP protein and/or PARP fusion protein, peptides corresponding to relatively unique regions of a PARP protein or PARP fusion protein can be generated and coupled to keyhole limpet hemocyanin (KLH) through an introduced C-terminal lysine. Antiserum to each of these peptides can be similarly affinity-purified on peptides conjugated to BSA, and specificity tested by ELISA and Western blotting using peptide conjugates, and by Western blotting and immunoprecipitation using a PARP protein, PARP fusion protein, and/or fragment of a PARP protein or PARP fusion protein.
Antibodies of the invention are desirably produced using PARP protein and/or PARP fusion protein amino acid sequences that do not reside within highly conserved regions, and that appear likely to be antigenic, as evaluated by criteria such as those provided by the Peptide Structure Program (Genetics Computer Group Sequence Analysis Package, Program Manual for the GCG Package, Version 7, 1991) using the algorithm of
Jameson et al., CABIOS 4:181, 1988. These fragments can be generated by standard techniques, e.g., by PCR, and cloned into any appropriate expression vector. For example, GST fusion proteins can be expressed in E. coli and purified using a glutathione-agarose affinity matrix. To minimize the potential for obtaining antisera that is non-specific or exhibits low-affinity binding to one or more PARP proteins, PARP fusion proteins, and/or fragments of PARP proteins or PARP fusion proteins, two or three PARP fusion proteins may be generated for each fragment injected into a separate animal. Antisera are raised by injections in series, preferably including at least three booster injections. In addition to intact monoclonal and polyclonal anti-PARP protein or anti-PARP fusion protein antibodies, various genetically engineered antibodies and antibody fragments (e.g., F(ab')2, Fab', Fab, Fv, and sFv fragments) can be produced using standard methods. Truncated versions of monoclonal antibodies, for example, can be produced by recombinant methods in which plasmids are generated that express the desired monoclonal antibody fragment(s) in a suitable host. Ladner (U.S. Patent Nos. 4,946,778 and 4,704,692) describes methods for preparing single polypeptide chain antibodies. Ward et al., Nature 341 :544-546, 1989. describes the preparation of heavy chain variable domain which have high antigen-binding affinities. McCafferty et al. {Nature 348:552-554, 1990) show that complete antibody V domains can be displayed on the surface of fd bacteriophage, that the phage bind specifically to antigen, and that rare phage (one in a million) can be isolated after affinity chromatography. Boss et al. (U.S. Patent No. 4,816,397) describes various methods for producing immunoglobulins, and immunologically functional fragments thereof, that include at least the variable domains of the heavy and light chains in a single host cell. Cabilly et al. (U.S. Patent No. 4,816,567) describes methods for preparing chimeric antibodies. In addition, the antibodies can be coupled to compounds, such as toxins or radiolabels.
Methods for Identification of Specific PARP Inhibitors or Activators
The PARP proteins and/or PARP fusion proteins of the invention may be used to identify one or more (e.g., 1 , 2, 3. 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) specific PARP activators or inhibitors. In the provided assays, one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP proteins and/or PARP fusion proteins are contacted with an agent (e.g., a test agent), a labeled NAD+ (e.g., a colorimetrically-labeled, fluorescently-labeled, biotinylated-, or radioisotope-labeled NAD+), and one or more substrates, and measuring the amount of
labeled ADP-ribose covalently attached to the one or more substrates. In one example, one or more PARP protein and/or PARP fusion proteins of the invention are incubated with a labeled NAD+ substrate and the amount of label associated with the NAD+ that is covalently attached to the one or more PARP proteins and/or PARP fusion proteins is measured (e.g., auto-modulation activity assay). In this example, an agent that is a specific PARP inhibitor mediates a decrease (e.g., at least a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or even 100% decrease) in the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) PARP proteins and/or fusion proteins, wherein the label on the PARP-fusion proteins is the same as the label of the NAD+. In a method for identifying an agent that is a specific PARP activator, the agent mediates an increase (e.g., at least a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or even 100% increase) in the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) PARP proteins and/or PARP fusion proteins.
The one or more PARP proteins and/or PARP fusion proteins utilized in each assay may be purified, partially purified (e.g., at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, or 95% pure) or may be present in a cell lysate (e.g., a bacterial cell lysate, a yeast cell lysate, or a mammalian cell lysate), in a biological fluid from a transgenic animal (e.g., milk or serum), or an extracellular medium. The one or more PARP proteins and/or PARP fusion proteins utilized in the assay may be bound to substrate, such as, but not limited to, a solid surface (e.g., a multi-well plate), a resin, or a bead (e.g., a magnetic bead). In additional examples of the assays, the one or more PARP proteins and/or
PARP fusion proteins may be bound to a solid surface, resin, or bead (e.g., a magnetic bead) and subsequently treated with one or more protease(s) (e.g., a TEV protease) prior to contacting the one or more PARP proteins and/or PARP fusion proteins with the labeled NAD+. In preferred assays, an activator or inhibitor increases or decreases the amount of labeled ADP-ribose covalently attached to a specific PARP protein, PARP fusion protein, and/or subset of PARP proteins or fusion proteins while having no or little (e.g., less than 50%, 40%, 30%, 25%, 20%, 15%, 10%, or 5% change (e.g., increase or decrease)) affect on the amount of labeled ADP-ribose covalently attached to other PARP proteins and/or PARP fusion proteins, is identified as a PARP activator or inhibitor, respectively. For
example, the assay desirably identifies an agent that specifically inhibits the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP5A proteins or fusion proteins, PARP12 proteins and/or fusion proteins, PARP13.1 proteins and/or fusion proteins, PARP 13.2 proteins and/or fusion proteins, and PARP 15 proteins and/or fusion proteins. Another assay desirably identifies an agent that specifically increases the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP5A proteins and/or fusion proteins, PARP 12 proteins and/or fusion proteins, PARP 13.1 proteins and/or fusion proteins, PARP 13.2 proteins and/or fusion proteins, and PARPl 5 proteins and/or fusion proteins. Another example of the assay desirable identifies an activator or inhibitor that specifically increases or decreases, respectfully, the amount of labeled ADP-ribose covalently bound to one or more (e.g., 1, 2, 3, 4, 5, or 6) PARPl 1 proteins and/or fusion proteins. Another example of the assay desirably identifies an agent that specifically decreases the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARPl proteins and/or fusion proteins, PARP2 proteins and/or fusion proteins, PARP5A proteins and/or fusion proteins, PARP5B proteins and/or fusion proteins, PARP7 proteins and/or fusion proteins, PARP8 proteins and/or fusion proteins, PARPl 4 proteins and/or fusion proteins, and PARPl 6 proteins and/or fusion proteins. Another example of the assay desirably identifies an agent that specifically increases the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARPl proteins and/or fusion proteins, PARP2 proteins and/or fusion proteins, PARP5A proteins and/or fusion proteins, PARP5B proteins and/or fusion proteins, PARP7 proteins and/or fusion proteins, PARP8 proteins and/or fusion proteins, PARPl 4 proteins and/or fusion proteins, and PARPl 6 proteins and/or fusion proteins. In another desirable embodiment of the assay, the assay identifies an agent that specifically increases or decreases the amount of labeled ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5, or 6) different PARP 13.1 proteins and/or fusion proteins.
A variety of different agents may be tested in the above-described assays provided by the invention. For example, a tested agent may be a derived from or present in a crude lysate (e.g., a lysate from a mammalian cell or plant extract) or be derived from a commercially available chemical libraries. Large libraries of natural product or synthetic (or semi-synthetic) extracts or chemical libraries are commercially available and known in the art. The screening methods of the present invention are appropriate and useful for testing agents from a variety of sources for activity as a specific PARP activator or inhibitor. The initial screens may be performed using a diverse library of
agents, but the method is suitable for a variety of other compounds and compound libraries. Such compound libraries can also be combinatorial libraries. In addition, compounds from commercial sources can be tested, as well as commercially available analogs of identified inhibitors. An agent may be a protein, a peptide, a DNA or RNA aptamer (e.g., a RNAi molecule), a lipid, or a small molecule (e.g., a lipid, carbohydrate, a bioinorganic molecule, or an organic molecule).
Agents that may be tested as a specific PARP activator include nucleic acids that contain a sequence encoding one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) domains of a PARP protein (e.g., a domain encoded by part of the nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOS: 1-24).
Methods for Identification of an Agent that Specifically Binds One or More PARPs
The invention also provides methods for identifying an agent that specifically binds to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP proteins and/or PARP fusion proteins. These methods require the contacting of one or more of the PARP proteins and/or PARP fusion proteins of the invention with a test agent and determining whether the test agent specifically binds to the one or more PARP proteins and/or PARP fusion proteins. An agent that specifically binds one or more of the described PARP proteins and/or PARP fusion proteins may act as an activator or inhibitor of the expression or activity of the one or more PARP proteins and/or PARP fusion proteins in a cell. For example, an agent that specifically binds to one or more PARP proteins and/or PARP fusion proteins may selectively increase the activity or expression of one or more PARP proteins and/or fusion proteins, while at the same time decreasing the activity or expression of one or more other PARP proteins and/or PARP fusion proteins in the same cell or sample.
The one or more PARP proteins and/or PARP fusion proteins used in this method may be attached to a solid surface or substrate (e.g., a bead) and/or may be present in purified form or present in a crude cell lysate, biological fluid, or extracellular medium. The methods may optionally include one or more (e.g., 1, 2, 3, 4, or 5) washing steps following contacting the one or more PARP proteins and/or PARP fusion proteins with the test agent. The test agent may be a small molecule, a lipid, an RNA molecule, a DNA molecule, a protein, or a peptide fragment. The test agent may be purified in form (e.g., at least 70%, 80%, 85%, 90%, 95%, or 99% pure by weight) or may be present in a crude
cell lysate. The test agent may also, optionally be labeled (e.g., a colorimetric label, a radionuclide label, labeled with a biotin molecule, or labeled with a fluorophore).
The binding of the test agent to one of more PARP proteins and/or PARP fusion proteins may detected by any known method including, BIAcore, competitive binding assays (e.g., a competitive binding assay using one or more of the antibodies provided by the invention), and detection of the agent following its release from the one or more PARP proteins and/or PARP fusion proteins (e.g., elution of the bound test agent following exposure to high salt or a high or low pH buffer). The one or more PARP proteins and/or PARP fusion proteins may be any of the example PARP proteins and PARP fusion proteins described herein.
In one example of this method, a bead attached to one or more PARP proteins and/or PARP fusion proteins of the invention (e.g., a ZZ-TEV-PARP fusion protein) may be incubated with a crude cell lysate, and the proteins or peptide fragments bound to the one or more PARP proteins and/or PARP fusion proteins may be eluted from the beads by exposure to a high salt buffer, a high detergent buffer, or a high or low pH buffer. The resulting eluted proteins may be electrophoresed onto an SDS-polyacrylamide gel and the specific protein bands cut out from the gel and analyzed using mass spectrometry to identify the specific agent that binds to the one or more PARP proteins and/or PARP fusion proteins. In another example of the method, a bead attached to one or more PARP proteins and/or PARP fusion proteins of the invention is incubated with a purified protein or peptide fragment. In this instance, a protein or peptide fragment bound to the one or more PARP proteins and/or PARP fusion proteins may be eluted using a high salt buffer, a high detergent buffer, or a high or low pH buffer. The amount of protein in the eluate may be detected by any method known in the art including UV/vis spectroscopy, mass spectrometry, or any colorimetric protein dye (e.g., a Bradford assay).
In specific screening assays for agents that bind one or more PARP proteins and/or PARP fusion proteins, one or more PARP proteins and/or PARP fusion proteins may be placed in individual wells of a multi-well plate (e.g., one or more PARP proteins and/or PARP fusion proteins covalently linked to the plate surface) and incubated with the test agent. Following a washing step, the amount of test agent remaining in each well may be determined and the ability of the test agent to bind one or more PARP proteins and/or PARP fusion proteins determined.
The methods desirably identify a test agent that specifically binds one or more of a PARPl protein and/or fusion protein, a PARP2 protein and/or fusion protein, a
PARP5A protein and/or fusion protein, a PARP5B protein and/or fusion protein, a PARP7 protein and/or fusion protein, a PARP8 protein and/or fusion protein, a PARP 14 protein and/or fusion protein, and a PARP16 protein and/or fusion protein of the invention. The methods also desirably identify a test agent that specifically binds to one or more of a PARP5 A protein and/or fusion protein, a PARP 12 protein and/or fusion protein, a PARP 13.1 protein and/or fusion protein, a PARP 13.2 protein and/or fusion protein, and a PARP15 protein and/or fusion protein of the invention. The methods also desirably identify a test agent that specifically binds to a PARP13.1 protein and/or fusion protein or a PARPl 1 protein and/or fusion protein of the invention.
Methods for Quantification of the Level of One or More PARPs in a Sample
The present invention further provides methods for quantitating the level of one or more PARP proteins or PARP fusion proteins present in a sample (e.g., a cell, a cell lysate, a biological fluid, or an extracellular medium). In these methods, a cell, cell lysate, biological fluid, or extracellular medium is contacted with one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) antibodies of the invention (e.g., antibodies that specifically bind to one or more PARP proteins or PARP fusion proteins described herein) and the level of one or more PARP proteins and/or PARP fusion proteins is determined by measuring the amount of the one or more PARP proteins and/or PARP fusion proteins bound to the one or more antibodies.
In these methods, the one or more antibodies may be polyclonal antibodies. The antibodies used in these methods may also be covalently bound to a bead (e.g., a magnetic bead or a bead in a column) or may be covalently bound to the surface of a multi-well plate (e.g., for use in an enzyme-linked immunosorbent assay (ELISA)). The quantitation of the binding of the one or more antibodies to the one or more PARP proteins and/or
PARP fusion proteins may be determined by any method known in the art, including, but not limited to, BIAcore, immunofluorescence microscopy, immunofluorescence-assisted cell sorting, ELISA, immunoblotting, and competitive binding assays (e.g., assays using purified labeled PARP proteins and/or PARP fusion proteins). In these assays, the level of one or more PARP proteins and/or PARP fusion proteins may be compared to a standard curve control generated using one or more purified PARP proteins and/or PARP fusion proteins as described herein. The level of one or more PARP proteins present in a cell, cell lysate, or biological sample may be used as an indicator of the status or severity of one or more stress granule-related condition (e.g., a neurodegenerative disease, a cardiovascular disease, an inflammatory disease, and
ischemia-reperfusion injury). For example, an increase in the level of one or more of PARP5A, PARP 12, PARP 13.1, PARP 13.2, and PARP 15 indicates an increased severity or an increase in the likelihood of developing a stress granule-related disorder.
Agent Screening Assays
The invention further provides methods for identifying a candidate agent for treating or decreasing a stress granule-related disorder requiring the steps of: providing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins encoded by a nucleic acid containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP 12 (SEQ ID NO: 18), PAPR13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP15 (SEQ ID NO: 22 or 23), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41); contacting the one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARID fusion proteins with the agent and a labeled NAD+ substrate; and measuring the activity of the one or more PARP, PARG, and/or ARH3 proteins and/or PARP, PARG, and/or ARH3 fusion proteins or the specific binding of the agent to the one or more PARP fusion proteins; wherein an agent that decreases (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the activity of the one or more PARP proteins and/or one or more PARP fusion proteins, and/or specifically binds to the one or more PARP proteins or fusion proteins, and/or increases the activity of the one or more PARG and/or ARH3 proteins or fusion proteins is identified as an agent for treating or decreasing the likelihood of developing a stress granule-related disorder.
The invention further provides methods for identifying a candidate agent for treating or decreasing the likelihood of developing cancer requiring the steps of: providing one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP proteins and/or PARP fusion proteins encoded by a nucleic acid containing a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to a PARP selected from PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24); contacting the one or more PARP proteins and/or PARP fusion proteins with the agent and a labeled NAD+ substrate; and measuring the activity of one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP proteins and/or PARP fusion proteins; wherein an agent that decreases (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even
100%) the activity and/or specifically binds to the one or more PARP proteins and/or PARP fusion proteins is identified as a candidate agent for treating or decreasing the likelihood of developing cancer.
In all the above screening methods, the one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may be generated using any methods known in the art or the methods described herein. The PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may be purified or present in a crude cell lysate. The PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may be attached to a substrate (e.g., a magnetic bead) or a solid surface (multi-well plate).
The methods of the assay include the measurement of the activity of the one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins using any assay known in the art or those assays described herein. The assays may include the incubation of the one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins with a labeled NAD+ substrate and/or the incubation with other substrates that are not labeled (e.g., non-labeled NAD+). Each PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and ARH3 fusion protein may have one or more activities (described herein). Any known activity of a PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and/or ARH3 fusion protein (or activity described herein) may be measured in the above screening assays (e.g., catalytic addition of an ADP-ribose molecule or polymerization of a poly-ADP-ribose molecule, catalytic degradation of poly- ADP ribose or removal of a ADP-ribose moiety from a substrate, localization to a particular cell structure (e.g., nucleus or stress granule), formation of a stress granule, disassembly of a stress granule, nucleation of a stress granule, promotion of cell proliferation or cell division, or required for cell cycle progression (e.g., progression through cytokinesis or mitosis)).
The ability of an agent to bind to one or more PARP or PARP fusion proteins may be measured using any method known in the art, as well as those methods described herein. For example, the ability of an agent to specifically bind to a PARP protein or PARP fusion protein may be measured by chromatography (e.g., using beads wherein a PARP protein, a PARP fusion protein, or a domain of a PARP protein or PARP fusion protein is covalently attached), BIAcore analysis, UV/vis spectroscopy, or calorimetry.
A variety of different agents may be tested in the above-described screening assays provided by the invention. For example, a candidate agent may be a derived from or present in a crude lysate (e.g., a lysate from a mammalian cell or plant extract) or be
derived from a commercially available chemical libraries. Large libraries of natural product or synthetic (or semi-synthetic) extracts or chemical libraries are commercially available and known in the art. The screening methods of the present invention are appropriate and useful for testing agents from a variety of sources for activity as a candidate agent. The initial screens may be performed using a diverse library of agents, but the method is suitable for a variety of other compounds and compound libraries. Such compound libraries can also be combinatorial libraries. In addition, compounds from commercial sources can be tested, as well as commercially available analogs of identified inhibitors. An agent may be a protein, a peptide fragment, a DNA or RNA aptamer (e.g., a
RNAi molecule), a lipid, or a small molecule (e.g., a lipid, carbohydrate, a bioinorganic molecule, or an organic molecule).
Candidate agents that may be tested include nucleic acids that contain a sequence encoding one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) domains of a PARP protein (e.g., a domain encoded by part of the nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOS: 1-24), nucleic acids that contain a sequence encoding one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) domains of a PARG protein or ARH3 (e.g., a domain encoded by part of the nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 41 and 42), or any polypeptide encoded by these nucleic acids.
In any of the above screening assays, the NAD+ may be labeled with a radioisotope (e.g., 32P) or fluorophore (e.g., fluorescein), or be biotinylated.
Methods for Increasing Cell Proliferation in a Cell The invention further provides methods of increasing the proliferation of a cell or population of cells requiring contacting the cell or population of cells with an effective amount of one or more PARP activators. In these methods, the one or more (e.g., 1, 2, 3, 4, or 5) PARP activators preferably increase the expression (e.g., mRNA and/or protein) and/or one or more activities of a PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16. In these methods, the expression may be an increase (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) in the level of one or more nucleic acid sequence(s) containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or even 100%) to PARPl (SEQ ID NOS: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NOS: 8 or 9), PARP5B (SEQ ID NO: 10), PARP14 (SEQ ID NO: 21 ), or PARP16 (SEQ ID NO: 24), or
one or more polypeptides encoded by one of these nucleic acids. The activity of one or more PARPs may be any activity described herein, including, but not limited to, poly- ADP-ribosylation of a target protein (e.g., a protein localized to the nucleus or mitotic spindle during cytokinesis, or a PARP protein) or is required for progression through mitosis or cytokinesis.
A PARP activator encompassed by these methods may include one or more nucleic acid sequences containing a sequence having at least 80% sequence identity (e.g., 85%, 90%, 95%, 99%, or even 100%) to one of SEQ ID NOS: 1-3, 8-10, 21, or 24. The rate of proliferation may be increased in a mammalian cell or a plant cell using these methods. For example, the rate of proliferation of a primary cell (e.g., a cell used for cell replacement therapies) may be increased using these methods. In another example, the rate of proliferation of a plant cell may be increased using these methods. These methods include the introduction of xenogenous nucleic acids encoding a PARP activator to create a transgenic mammalian or plant cell or transgenic mammal or plant.
Methods for Increasing Stress Granule Formation in a Cell
The invention further provides methods of increasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) the number of stress granules in a cell or cell population requiring contacting the cell or population of cells with one or more (e.g., 1 , 2, 3, 4, or 5) PARP activators, one or more (e.g., 1 , 2, 3, 4, or 5) PARG inhibitors, or one or more (e.g., 1, 2, 3, 4, or 5) PARPl 1 inhibitors. In these methods, the increased number of stress granules may be the result of an increase in the rate of stress granule nucleation or formation and/or a decrease in the rate of stress granule breakdown or turnover. In these methods, the one or more PARP activators preferably increase (e.g., at least 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) the expression (e.g., mRNA and/or protein) and/or activity of a protein encoded by a nucleic acid sequence containing a sequence that is at least 80% identical (e.g., at least 85%, 90%, 95%, 99%, or even 100% identical) to PARP5A (SEQ ID NO: 8 or 9), PARP 12 (SEQ ID NO: 18), PARPl 3.1 (SEQ ID NO: 19), PARPl 3.2 (SEQ ID NO: 20), or PARPl 5 (SEQ ID NO: 22 or 23). The activity of the one or more PARPs may be an increase in the poly- ADP-ribosylation of one or more (e.g., 1 , 2, 3, 4, or 5) target protein(s) (e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP protein) or the nucleation and/or formation of a stress granule. Additional activities of a PARP protein are described herein. Examples of the PARP
activators that may be used with these methods include, nucleic acid sequence containing a sequence having at least 80% identity (e.g., at least 85%, 90%, 95%, 99%, or even 100% identical) to any one of SEQ ID NOS: 8, 9, 18-20, 22, or 23.
In these methods, the one or more PΛRG inhibitors may selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% decrease) in the expression (e.g., mRNA and/or protein) or activity of PARG or glycohydrolase ARH3. For example, one or more PARG inhibitors may decrease the level of one or more nucleic acid sequence(s) containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 99%, or even 100% identity) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or a polypeptide encoded by these nucleic acids. The activities of PARG protein or ARH3 glycohydrolase are described herein and include, without limitation, the hydrolysis of poly-ADP-ribose (e.g., poly-ADP-ribose attached to a protein, e.g., a protein localized in a stress granule, a protein involved in the formation or disassembly of a stress granule, and/or a PARP), the prevention of the assembly of a stress granule, or disassembly of a stress granule. Examples of PARG inhibitors that may be used in these methods include an antibody that specifically binds to a polypeptide or peptide fragment encoded by a nucleic acid sequence containing a sequence having at least 80% sequence identity (e.g., 85%, 90%, 95%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41 ), or an RNA aptamer that binds to one or more of these nucleic acid sequences. Specific examples of RNAi molecules that may target PARG and ARH3 are SEQ ID NOS: 34 and 35, and SEQ ID NOS: 36 and 37, respectively.
In these methods, the one or more PARPl 1 inhibitors may selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the expression (mRNA and/or protein) and/or activity of PARPl 1. In different examples of these methods, the PARPl 1 inhibitors) may decrease the expression of one or more nucleic acid(s) containing a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), or decrease the expression of one or more polypeptides encoded by these nucleic acids. The activity of PARPl 1 may include poly-ADP-ribosylation of a target protein (e.g., a protein localized in a stress granule, a polypeptide involved in the formation or disassembly of a stress granule, and/or a PARP), prevention of the assembly of a stress granule, or disassembly of a stress granule. Examples of PARPl 1 inhibitors that may be used in these methods include an antibody that specifically binds to a polypeptide or peptide fragment encoded by a nucleic acid sequence containing a sequence having at least 80% sequence identity
(e.g., 85%, 90%, 95%, 99%, or even 100%) to PARPl 1 (SEQ ID NO: 17), or an RNA aptamer that binds to one or more of these nucleic acid sequences. Specific examples of RNAi molecules that may target PARPl 1 are SEQ ID NOS: 91-98.
These methods may allow for the specific up-regulation of stress granule formation in cells in which increased resistance to toxic stress is desired (e.g., a plant cell (e.g., a transgenic plant cell) or a cultured mammalian cell (e.g., for cell replacement therapies).
Examples
The features and other details of the invention will now be more particularly described and pointed out in the following examples describing preferred techniques and experimental results. These examples are provided for the purpose of illustrating the invention and should not be construed as limiting.
Example 1. Generation of PARP-GFP Fusion Proteins and Assays
Fusion proteins containing the sequence of each PARP and green fluorescent protein (GFP) were generated using the pEGFP-Cl vector (Invitrogen) (Figure 4). For these experiments, the DNA sequences encoding each of PARPl (SEQ ID NOS: 1 and 2), PARP3 (SEQ ID NOS: 4, 5, and 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NOS: 8 and 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 1 1 ), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARPl O (SEQ ID NOS: 15 and 16), PARP1 1 (SEQ ID NO: 17), PARP 12 (SEQ ID NO: 18), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP14 (SEQ ID NO: 21), PARP15 (SEQ ID NOS: 22 and 23), and PARPl 6 (SEQ ID NO: 24) were cloned into the pEGFP-Cl vector using the restriction sites indicated in Table 2. Each resulting plasmid contained a nucleic acid sequence encoding a PARP-GFP fusion protein, wherein the nucleic acid sequence encoding GFP was located 5' to the nucleic acid sequence encoding the PARP protein.
Table 2. Restriction Sites Used for Cloning PARP Sequences into pEGFP-Cl
Each generated pEGFP-Cl vector was transfected into HeLa Kyoto cells using Lipofectamine 2000, according to the manufacturer's instructions. Cell lysate was prepared from the HeLa cells at 48 hours following transfection. Electrophoresis was performed on the cell lysate using 4-12% SDS-PAGE, and immunoblotting was performed using a rabbit anti-GFP polyclonal antibody (Figure 5).
The localization of each PARP-GFP fusion protein in the transfected HeLa Kyoto cells was determined using immunofluorescence microscopy using rabbit anti-GFP polyclonal antibody and a fluorescently-labeled secondary antibody (Figure 6). The data from this experiment indicate that several PARP-GFP proteins are primarily localized in the nucleus of asynchronous cells, including PARPl-GFP, PARP2-GFP, PARP7-GFP, and PARP8-GFP. The data further indicate that several PARP-GFP fusion proteins are localized in primarily in the cytoplasm of asynchronous cells, including PARP12-GFP, PARP13-GFP, PARPl 4-GFP, PARPl 5-GFP, PARP16-GFP, PARPl O-GFP, PARPl 1- GFP, PARP5 A-GFP, and PARP5B-GFP. In addition, the data indicate that several PARP-GFP fusion proteins are localized in both the cytoplasm and the nucleus of asynchronous cells, including PARP3-GFP, PARP9-GFP, PARP6-GFP, and PARP4- GFP. The same pattern of cell localization for each PARP-GFP fusion protein was observed in the h I ERT-RPEl cell line (Clontech), a telomerase-immortalized human retinal pigment epithelial (RPE) normal cell line (Figure 7).
Antibodies specific for each PARP were generated by immunizing rabbits with PARP-specific peptides conjugated to keyhole limpet hemocyanin (KLH) using known methods. The antibodies produced in the rabbit serum were later affinity purified using peptide columns (e.g., columns containing, as substrate, the specific peptide sequence used to inoculate the rabbit).
The antibodies for each PARP and a secondary-fluorescently labeled anti-rabbit polyclonal antibody were used to visualize the location of each PARP in asynchronous HeLa Kyoto cells transfected with a pEGFP-Cl plasmid encoding a PARP-GFP fusion protein (Figure 8). The data from this experiment confirm that PARPl, PARP2, PARP7, PARP8, and PARP 14 are primarily localized in the nucleus of asynchronous cells. The data from this experiment also confirm that PARP3, PARP4, PΛRP6, PARP9, and PARP 15 are localized in the both the nucleus and the cytoplasm of asynchronous cells. The localization of each PARP-GFP fusion protein (described above) was also determined in HeLa Kyoto cells transfected with a pEGFP-C 1 plasmid encoding a PARP- GFP fusion protein following 12-hour treatment with 100 nM nocodazole or 5 μg/mL aphidicolin. Cells treated with nocodazole are arrested in S phase, while cells treated with aphidicolin are arrested in mitotosis. Figure 9 shows the cellular localization for each PARP-GFP fusion protein following cell arrest in S-phase or mitosis. The data show that the PARPl-GFP, PARP2-GFP, and PARP8-GFP fusion proteins localize to the nucleus during S-phase, and that PARP5A-GFP and PARP5B-GFP localize to the mitotic spindle during mitosis. The localization of these PARP-GFP fusion proteins (e.g., PARPl-GFP, PARP2-GFP, PARP5 A-GFP, PARP5B-GFP, and PARP8-GFP) to the nucleus during S-phase and mitosis indicate a role for these PARP proteins in cell division and cell proliferation. In order to study the role of PARPl 6, additional experiments were performed using RNAi knockdown of endogenous PARPl 6 or overexpression of PAPRl 6-GFP fusion proteins to study the effect of PARPl 6 knockdown and overexpression, respectively on cell morphology. Asynchronous HeLa Kyoto cells overexpressing PARP16-GFP protein had normal cell morphology (Figure 10; middle panel). In these cells, the PARPl 6-GFP protein was primarily localized in the endoplasmic reticulum, as demonstrated by its co-localization with calnexin (Figure 10; middle panel). HeLa Kyoto cells transfected with an RNAi molecule specific for PARPl 6 demonstrated significant morphological changes, including cell shrinkage and dramatic membrane defects (Figure 10; right panel).
The specific cellular localization of each PARP-GFP fusion protein may be further analyzed by immunofluorescence microscopy using a combination of labeled antibodies specific for the GFP-tag of each PARP-GFP fusion protein and one or more markers of cellular structures or organelles. For example, immunofluorescence staining of asynchronous HeLa Kyoto cells transfected with a pEGFP-Cl vector expressing the PARP7-GFP fusion protein shows co-localization of an anti-GFP antibody and an anti- coilin antibody (a marker of Cajal bodies in the nucleus) (Figure 11). In another example, asynchronous HeLa Kyoto cells transfected with a pEGFP-Cl vector expressing the PARP16-GFP fusion protein shows co-localization of an anti-GFP antibody and an anti- calnexin antibody (a marker of the endoplasmic reticulum) (Figure 10). A non-limiting list of marker proteins that may be used to determine the cellular localization of a PARP- GFP fusion protein is also provided in Figure 1 1.
Experimental Methods Kyoto HcLa cells were grown in DMEM supplemented with 10% FCS and penicillin/streptomycin at 37°C in 5% CO2. Lipofectamine 2000 (Invitrogen) was used to transfect the cells with each pEGFP-Cl vector according to the manufacturer's protocol. Cells were arrested in mitosis and S-phase by treatment with 100 nM nocodazole or 5 μg/mL aphidicolin for 12 hours, respectively. For immunofluorescence imaging, cells on coverslips were fixed in ice-cold methanol for five minutes and rehydrated in phosphate buffered saline (PBS). The cells were blocked in PBS containing 4% bovine serum albumin (BSA) and 0.1% Triton-X 100. All antibodies used for imaging were diluted in blocking buffer. The coverslips were incubated with primary antibodies for 45 minutes and with secondary antibodies for 30 minutes. Images were collected on a Nikon TE2000 confocal microscope equipped with a Yokogawa CSU-Xl spinning disk head, Hamamatsu ORCA ER digital camera, and NIS-Elements imaging software.
Example 2. Generation of ZZ-TE V-PARP Fusion Proteins
Fusion proteins containing the sequence of each PARP, a ZZ-domain of SEQ ID NO: 27, and four TEV protease recognition sequences (SEQ ID NO: 26) were cloned using the pcDNA3.1 vector (SEQ ID NO: 33) (Invitrogen) (Figure 12) to yield a ZZ-4x- TEV-PARP fusion protein for each PARP. For these experiments, the DNA sequences encoding PARPl (SEQ ID NOS: 1 and 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NOS: 4, 5, and 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NOS: 8 and 9), PARP6 (SEQ ID NO: 1 1 ), PARP7 (SEQ ID NO: 12), PARP9 (SEQ ID NO: 14), PARPl 0 (SFQ
ID NOS: 15 and 16), PARPI l (SEQ ID NO: 17), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP14 (SEQ ID NO: 21), PARP15 (SEQ ID NOS: 22 and 23), and PARP 16 (SEQ ID NO: 24) were cloned into the pcDNA3.1 vector using the restriction sites indicated in Table 3. The sequence encoding the ZZ-domain and the sequence encoding the four TEV protease recognition sequences were cloned into the Nhel and HinDIII restriction sites in pcDNA3.1.
Table 3. Restriction Sites Used for Cloning PARP Sequences into pcDNA3.1
Each resulting plasmid contained a nucleic acid sequence encoding a ZZ-TEV-
PARP fusion protein, wherein the nucleic acid sequence encoding ZZ domain was located 5' to the nucleic acid sequence encoding the four TEV protease recognition sequences, which in turn, was located 5' to the nucleic acid sequence encoding each PARP.
Nucleic acids encoding each ZZ-TEV-PARP fusion protein may be transfected into target cells (e.g., HeLa Kyoto or HeLa S3 cells) and the resulting ZZ-TEV-PARP fusion proteins purified by binding to magnetic beads coated with a protein containing an Fc domain (e.g., IgG). The resulting ZZ-TEV-PARP fusion proteins may be used in the assays described below for the PARP-GFP fusion proteins and the other assays described herein. Assays utilizing the ZZ-TEV-PARP fusion proteins have the additional advantage of containing an engineered TEV protease recognition sequence, whereby the polypeptide tag on each PARP fusion protein (e.g., the ZZ-domain and the four TEV protease recognition sequences) may optionally be removed from the ZZ-TEV-PARP fusion proteins by treatment with TEV protease. In one example, one or more ZZ-TEV-PARP
fusion proteins may be removed from a magnetic bead, resin, or solid surface by treatment with a TEV protease.
Example 3. PARP Activity Assays and Screening Methods The above-described PARP fusion proteins may be used in PARP activity assays and in assays to identify an activator or inhibitor for a specific PARP or a specific subset of PARPs. An example of such an activity assay in shown in Figure 13. In this example, cell lysate is first prepared from a HeLa S3 cell culture expressing one or more PARP- GFP fusion proteins. The cell lysate is then incubated with an anti-GFP polyclonal antibody bound to Dynabead® Protein A beads, and the beads magnetically removed from the cell lysate. The isolated beads bound to one or more PARP-GFP fusion proteins are placed into a multi-well plate and incubated with a labeled NAD+ substrate (e.g., 32P- NAD+). Following incubation with the labeled NAD+ substrate, the magnetic beads bound with the one or more PARP-GFP proteins are magnetically isolated or washed, and the level of the label (i.e., the label present in the labeled NAD+ substrate) that is covalently attached to the one or more PARP-GFP fusion proteins bound to the magnetic beads is determined (e.g., the amount Of 32P covalently bound to the one or more PARP- GFP proteins attached to the beads). This assay provides a means of measuring the auto- modulation activity of one or more PARP-GFP fusion proteins (e.g., the ability of a PARP to modify its own structure by catalyzing the covalent attachment of one or more ADP-ribose molecules). The assay may also be designed such that lysate or PARP-GFP fusion proteins isolated from several different transfected HeLa S3 cells, each expressing a different PARP-GFP fusion proteins or subset of PARP-GFP fusion proteins, may be placed in different wells of the multi-well plate. The assay may also be designed such that the lysate from several different transfected HeLa S3 cells is combined, wherein the lysate from each transfected HeLa S3 cell culture contains one or more PARP-GFP fusion proteins. In a different version of the assay, the PARP-GFP fusion proteins may contain a protease recognition site. In this version of the assay, the one or more PARP-GFP fusion proteins bound to the magnetic beads may be treated with a specific protease (i.e., a protease that recognizes a protease recognition sequence in the PARP-GFP fusion protein) to mediate release of the PARP-GFP fusion protein from the magnetic bead.
Figure 14 provides an example of the use of the PARP-GFP fusion proteins of the invention for the identification of an agent that specifically inhibits the activity of one or more PARPs. This assay is similar to the assay described above, except that the one or more PARP-GFP fusion proteins is incubated with both a test agent and a labeled
NAD+ substrate. A specific PARP inhibitor will decrease the amount of the label (i.e., the label present in the labeled NAD+ substrate) covalently attached to the one or more PARP-GFP fusion proteins bound to the magnetic beads relative to the amount of the label attached to the one or more PARP-GFP fusion proteins in the absence of the test agent. In different examples of this assay, lysate or PARP-GFP fusion proteins isolated from two or more different transfected HeLa S3 cells, each expressing a different PARP- GFP fusion protein or subset of PARP-GFP fusion proteins, may be placed in different wells of the multi-well plate. The assay may also be designed such that the lysate from several different transfected HeLa S3 cells is combined, wherein the lysate from each transfected HeLa S3 cells contains one or more PARP-GFP fusion proteins. The assay may also be specifically designed to identify inhibitors of a specific PARP-GFP protein or subset of PARP-GFP proteins including the subsets of: one or more of PARPl-GFP, PARP2-GFP, PARP5 A-GFP, PARP5B-GFP, PARP7-GFP, PARP8-GFP, PARP14-GFP, and PARP16-GFP; one or more of PARP5 A-GFP, PARP12-GFP, PARPl 3.1 -GFP, PARP13.2-GFP, PARP15-GFP; PARPI l-GFP; or PARP 13.1 -GFP.
Similar to the examples, described above, the PARP-GFP fusion proteins of the invention may be used to identify activators of one or more specific PARPs. In this instance, the assay may be used to identify agents that increase the amount of the label (i.e., the label present in the labeled NAD+ substrate) covalently attached to the one or more PARP-GFP fusion proteins bound to the magnetic beads relative to the amount of the label covalently attached to the one or more PARP-GFP fusion proteins in the absence of the test agent. Preferably, this assay may be designed to identify activators of a specific PARP-GFP fusion protein or subset of PARP-GFP fusion proteins including the subsets of: one or more of PARPl-GFP, PARP2-GFP, PARP5 A-GFP, PARP5B-GFP, PARP7-GFP, PARP8-GFP, PARPl 4-GFP, and PARPl 6-GFP; one or more of PARP5A- GFP, PARP 12-GFP, PARP 13.1 -GFP, PARP 13.2-GFP, and PARP 15-GFP; PARP 1 1 - GFP; or PARP 13.1 -GFP.
Example 4. Involvement of PARPs in Stress Granule Formation and Disassembly
We have discovered through a PARP family-wide RNAi screen that several
PARP proteins are involved in the cell cycle and are required for progression through mitosis (e.g., PARP 16). The identity of the various substrate proteins of the different PARP proteins remains largely unknown. To further identify PARP substrate proteins and/or proteins that bind to poly-ADP-ribose polymers, the Bio-Gel P-6 resin shown in
Figure 15 was used to purify proteins that bind poly-ADP-ribose polymer and/or act as an acceptor of a ADP-ribose molecule or a poly-ADP-ribose polymer. Figure 15 also shows a Coomassie Blue-stained SDS-PAGE gel showing the proteins present in the HeLa Kyoto cell extract (Extract), in cell extract following lectin clarification (Lectin Clarification), in the lysate prior to passing over the Bio-Gel P-6 resin (Input), in the pellet following centrifugation of the resin (Pellet), and in the eluate following treatment with poly-ADP-ribose glycohydrolase ARH3 (ARH3 Release). The data in Figure 15 demonstrates the selective purification of proteins bound to the Bio-Gel P-6 resin.
We have discovered that poly-ADP-ribose polymers are associated with stress granules in cells during exposure to stress conditions. Figure 16 shows the co- localization of poly-ADP-ribose polymers and eIF3, a marker of stress granules, in HeLa Kyoto cells following treatment with 0 or 250 μM sodium arsenite for 30 minutes and immunostaining with fluorescently-labeled antibodies specific for poly-ADP-ribose polymers and eIF3. The data indicate that stress granules contain proteins modified with poly-ADP-ribose polymers.
In order to identify the specific PARP proteins that mediate the formation of the poly-ADP-ribose polymers present in stress granules, experiments were performed to determine whether the different PARP-GFP fusion proteins localize to stress granules. In these experiments, HeLa Kyoto cells transfected with a pEGFP-Cl plasmid expressing a PARP-GFP fusion protein were visualized using fluorescently-labeled anti-GFP and anti- eIF3 antibodies following treatment with 250 μM sodium arsenite for 30 minutes (Figure 17). The data indicate that the PARP5A-GFP, PARP12-GFP, PARP13.1-GFP, PARPl 3.2-GFP, and PARPl 5-GFP fusion proteins localize to stress granules under stress conditions. Endogenous PARP5A, PARP12, PARP13/13.1, PARPl 5, and poly-ADP-ribose glycohydrolase (PARG) also localize to stress granules in HeLa Kyoto cells following treatment with 250 μM sodium arsenite for 30 minutes (Figure 18). In these experiments, the fixed cells were visualized using antibodies specific for one of PAR5Λ, PARP12, PARPl 3/13.1 , PARPl 5, or PARG, and an anti-eIF3 antibody, and secondary fluorescently-labeled antibodies. The data indicate that PARG, as well as the endogenous- and fusion protein-forms of PARP5A, PARP12, PARPl 3/13.1 , and PARPl 5, localize to stress granules under stress conditions. In a similar set of experiments using hTERT RPE cells, endogenous PARP5A, PARPl 2, PARPl 3, and PARPl 5 showed a similar cellular localization following exposure to 250 μM sodium arsenite for 30 minutes, as was observed in HeLa Kyoto cells (Figure 19).
Experiments using time-lapse immunofluorescence microscopy in live HeLa Kyoto cells further indicate that endogenous PARP12, PARP12-GFP, endogenous PARP13, and PARP13-GFP localize to stress granules at an early point in stress granule assembly and therefore, may play a regulatory role in the formation of stress granules (data not shown).
In an additional set of experiments, the effect of PARP13.1, PARP13.2, and PARP 15 on stress granule formation was further studied by measuring the effect of ovcrcxprcssion of PARP 13.1 -GFP, PARP13.2-GFP, and PARP15-GFP on stress granule formation. In these experiments, HeLa Kyoto cells were transfected with a pEGFP-Cl plasmid encoding PARP13.1 -GFP, PARP13.2-GFP, or PARP15-GFP. The transfected cells were stained with anti-GFP antibodies, anti-eIF3 antibodies, and fluorescently- labeled secondary antibodies. These data indicate that overexpression of PARP 13.1 -GFP, PARPl 3.2-GFP, or PARPl 5-GFP fusion protein nucleates stress granule formation (Figure 20). In contrast to the effect mediated by overexpression of PARP 13.1 -GFP,
PARPl 3.2-GFP, or PARPl 5-GFP fusion protein, overexpression of PARPI l-GFP in HeLa Kyoto cells mediates a decrease in stress granule formation following treatment with 250 μM sodium arsenite for 30 minutes (Figure 21). In this experiment, HeLa Kyoto cells transfected with a pEGFP-Cl vector expressing a PARPl 1 -GFP fusion protein were treated with sodium arsenite, and stained with anti-GFP antibodies, anti-eIF3 antibodies, and fluorescently-labeled secondary antibodies. These data indicate that overexpression of PARPl 1 -GFP suppresses the formation of stress granules in cells exposed to stress conditions.
Experimental Methods
HeLa Kyoto cells were cultured as described above. Lipofectamine 2000 (Invitrogen) was used to transfect the HeLa Kyoto cells with a pEGFP-Cl plasmid encoding a PARP-GFP fusion protein (described above) according to the manufacturer's instructions. For stress granule induction, cells were treated with 250 μM sodium arsenite for 30 minutes. For long-term, real-time imaging of PARP-GFP transfected HeLa cells, the cells were split into 24-well glass bottom plates and imaged every 20 minutes for 48 hours. Images were collected on a Nikon TE2000 confocal microscope equipped with a Yokogawa CSU-Xl spinning disc head, Hamamatsu ORCA ER digital camera, and NIS- Elements imaging software.
Example 5. Involvement of PARG and ARH3 in Stress Granule Disassembly
In order to determine the importance of poly-ADP-ribose polymers on stress granule formation and disassembly, an additional set of experiments were performed to test the effect of PARG and ARH3 activity on stress granule dynamics. In a first set of experiments, HeLa Kyoto cells were transfected with a pEGFP-Cl plasmid encoding PARG99-GFP, PARG102-GFP, or a PARGl 10-GFP fusion protein. Overexpression of PARG99-GFP, PARG102-GFP, or PARGl 10-GFP reduces the formation of stress granules in HeLa Kyoto cells following exposure to 100 μM sodium arsenite for 30 minutes (Figure 22). In these experiments, formation of stress granules was determined by staining the fixed cells with anti-eIF3 antibodies and secondary fluorescently-labeled antibodies. These data indicate that PARG activity (hydrolysis of poly-ADP-ribose) inhibits the formation of stress granules in cells under stress conditions.
Another set of experiments was performed to determine the effect of knockdown of PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41) on stress granule formation in cells under stress conditions. In these experiments, HeLa Kyoto cells were treated with 30 nM siRNA specific for PARG (SEQ ID NOS: 34 and 35) or ARH3 (SEQ ID NOS: 36 and 37), or a control siRNA (All Stars Negative Control siRNA; Qiagen Catalog No. 1027280), and treated with 100 μM sodium arsenite for 30 minutes, or 30 minutes or 1 hour following sodium arsenite washout (Figure 23). Cells treated with a PARG siRNA or ARH3 siRNA show a sustained presence of stress granules following removal of sodium arsenite from the culture medium (via imaging using anti-eIF3 antibodies and fluorescently-labeled secondary antibodies). These data indicate that PARG and ARH3 activity (hydrolysis of poly-ADP-ribose) has a positive effect on stress granule disassembly, and that poly-ADP-ribose turnover kinetics regulate the formation/disassembly of stress granules. The percentage of cells with stress granules following 30-minute washout and 1-hour washout after arsenite treatment was quantitated for cells treated with control siRNA, PARG siRNA, and ARl 13 siRNA (Figure 24). These data indicate that knockdown of PARG and ARH3 reduces the rate of stress granule disassembly following removal of the stress condition (sodium arsenite).
Experimental Methods
HeLa Kyoto cells were cultured in medium as described above. In PARG overexpression experiments, Lipofectamine 2000 (Invitrogen) was used to transfect HeLa Kyoto cells with pEGFP-Cl plasmids containing the nucleic acid sequences for each PARG isoform, i.e., PARG99, PARG102, and PARGl 10 (sequences described in
Meyer-Ficca et al., Exp. Cell. Res. 297(2):521-532, 2004) according to the manufacturer's instructions. In PARG knockdown experiments, cells were treated with 30 nM of a siRNA targeting PARG (SEQ ID NOS: 34 and 35), a siRNA targeting ARH3 (SEQ ID NO: 36 and 37), or a control siRNA (AllStars Negative Control siRNA; Qiagen Catalog No. 1027280) using Lipofectamine 2000 according to the manufacturer's instructions. In these experiments, stress granule formation was induced by treatment with 100 μM sodium arsenite for 30 minutes. For stress granule disassembly experiments, the media was replaced after sodium arsenite treatment, and cells were incubated for 30 minutes and 1 hour prior to fixation and immunostaining. At least 200 cells were counted for each condition (in triplicate) to determine the percentage of cells containing stress granules.
Example 6. Stress Granule Proteins Bind to GFP-PARPs
Experiments were performed to further identify stress granule-related proteins that may bind and be the substrates of one or more of the PARPs localized in stress granules (e.g., PARP5A, PARP12, PARP13, PARP13.1 , and PARP15). In these experiments, HeLa S3 cells were transfected with pEGFP-Cl plasmids containing a nucleic acid sequence encoding PARP5A-GFP, PARP12-GFP, PARP13-GFP, PARP13.1-GFP, or PARPl 5-GFP fusion protein and treated with 0 or 250 μM sodium arsenite for 30 minutes. The resulting cell lysate was immunoprecipitated using anti-GFP antibodies and the resulting immunoprecipitated proteins were electrophoresed using SDS-PAGE. The resulting gel indicates that each PARP-GFP fusion protein binds to several proteins and that treatment with sodium arsenite results in an alteration in the amount and identity of the proteins binding to each PARP-GFP fusion protein (Figure 25A). In a similar experiment, the immunoprecipitated proteins are transferred to a membrane and immunostained with an anti-poly-ADP-ribose antibody. The data in this experiment show that PARP5A-GFP, PARP12-GFP, PARP13-GFP, and PARP13.1 -GFP fusion proteins bind to poly-ADP-ribosylated proteins (Figure 25B).
Data from a separate set of experiments indicate that several stress granule- associated proteins bind to the PARPl 3-GFP, PARP12-GFP, and PARP5A-GFP fusion proteins. In these experiments, HeLa S3 cells were transfected with a pEGFP-Cl plasmid encoding a PARPl 3-GFP, PARPl 2-GFP, or PARP5 A-GFP fusion protein and treated with 0 or 20 nM pateamine A for 30 minutes. Cell lysates from the cells were immunoprecipitated using an anti-GFP antibody and the immunoprecipitated proteins were electrophoresed using 4-12% SDS-PAGE. The resulting proteins were transferred to a membrane and immunoblotted using commercially-available antibodies specific for
different stress granule-associated proteins: Ago2, DDX6, LSMl, PABP, FMRP, elFIA, eIF2α, eIF3η, eIF4Al, and eIF4E. The data indicate that the PARP13-GFP, PARP12- GFP, and PARP5 A-GFP fusion proteins have the ability to interact with one or more of these stress granule-associated proteins under both normal (0 nM pateamine A) and stress conditions (30 nM pateamine A) (Figure 25 C).
An additional set of experiments was performed to determine whether one or more stress granule-associated proteins are poly-ADP-ribosylated. In these experiments, HeLa S3 cells were transfected with a pEGFP-Cl plasmid encoding a GFP fusion protein of TIAl, PABP, G3BP, or Ago2, and treated with 0 or 20 nM pateamine A for 30 minutes. Lysates from these cells were immunoprecipitated using anti-GFP antibodies and immunoblotted using an anti-po Iy-ADP ribose antibody. The data show that several proteins bind the TIAl-GFP, PABP-GFP, G3BP-GFP, and Ago2-GFP fusion proteins in untreated (0 nM pateamine A) and treated (20 nM pateamine A) cells (Figure 26A). In an additional experiment, the proteins that bind to endogenous G3BP and Ago2 proteins in 250 μM sodium arsenite-treated HeLa S3 cells were also shown to be poly-ADP- ribosylated (Figure 26B). In this experiment, cell lysates from untransfected HeLa S3 cells treated with 0 or 250 μM sodium arsenite for 60 minutes were immunoprecipitated with anti-G3BP or anti-Ago2 antibodies and immunoblotted using an anti-poly-ADP- ribose antibody. G3BP1 , a stress granule-associated protein, was shown to be poly-ADP- ribosylated (Figure 26C). In order to map the specific domain in G3BP1 that is modified by a poly-ADP-ribose polymer, GFP-fusion proteins of different truncation 250 μM sodium arsenite for 60 minutes. The specific nucleic acid sequences encoding each G3BP1 truncation mutant are described in Tourriere et al. (J. Cell Biol. 160:823-831 , 2003). The cell lysate from each cell sample was immunoprecipitated using anti-GFP antibodies and immunoblotted using an anti-poly-ADP-ribose antibody. The data demonstrate that poly-ADP-ribosylation of G3BP1 occurs within the RNA-recognition motif (RRM) domain ("D" in Figure 26C). The RRM domain of G3BP1 is a domain that binds to RNA molecules. The poly-ADP-ribosylation of G3BP1 in the RRM domain is thought to regulate the RNA-binding activity of G3BP1.
TIAl , a stress granule-associated protein, was also shown to be poly-ADP- ribosylated (Figure 26D). In order to determine whether TIAl is poly-ADP-ribosylated in its RRM domain, GFP-fusion proteins of full-length TlAl and a truncation mutant of TIAl lacking its RRM domain (TIA1 ΔRRM) were expressed in HeLa S3 cells treated
with 0 or 250 μM sodium arsenite for 60 minutes. The specific nucleic acid sequences encoding the full-length TIAl and the TIA1ΔRRM truncation mutant are described in Kedersha et al. (J. Cell Biol. 151:1257-1268, 2000). The cell lysate from each cell sample was immunoprecipitated using anti-GFP antibodies and immunoblotting was performed using an anti-poly-ADP-ribose antibody. The data demonstrate that poly- ADP-ribosylation of TIAl also occurs within its RNA-recognition motif (RRM) domain (Figure 26D). The poly-ADP-ribosylation of TIAl in its RRM domain is also thought to mediate an alteration in its RNA-binding activity.
Experimental Methods
Immunoprccipitation experiments to identify proteins binding to PARP5A-GFP, PARP12-GFP, PARP13-GFP, PARP13.1-GFP, and PARP15-GFP were performed using HeLa S3 cells transfected with a pEGFP-Cl plasmid containing a nucleic acid sequence encoding each respective PARP-GFP fusion protein following treatment with 0 or 20 nM pateamine A for 30 minutes. In each experiment, the cell lysate is incubated with an anti- GFP antibody to immunoprecipitate proteins bound to each of the PARP-GFP fusion proteins using standard methods. The resulting immunoprepitated proteins were electrophoresed on 4-12% SDS-PAGE gels, and either stained directly with Coomassie Blue or transferred onto a membrane and immunostained with one or more of the following antibodies: anti-poly-ADP-ribose, anti-Ago2, anti-DDX6, anti-LSMl , anti- PABP, anti-FMRP, anti-elFIA, anti-eIF2α, anti-eIF3η, anti-eIF4Al, and anti-e!F4e antibodies.
Immunoprecipitation experiments using TIΛ1-GFP, PΛBP-GFP, G3BP-GFP, and Ago2-GFP fusion proteins were performed using HeLa S3 cells transfected with pEGFP- Cl plasmids containing a sequence encoding a nucleic acid sequence encoding TIAl
(Kedersha et al., J. Cell Biol. 151 :1257-1268, 2000), PABP (NCBI Accession No. NM- _12154.2), G3BP (Tourriere et al., J Cell Biol. 160:823-831 , 2003), Ago2 (NCBI Accession No._002568.3), a truncation mutant of G3BP (i.e., A, ABC, BC, BCD, and D truncation mutants described in Tourriere et al., supra), or the ΔRRM truncation mutation of TIAl (described in Kedersha et al., supra) following treatment with 0 or 20 nM pateamine A for 30 minutes. In each experiment, the cell lysate is incubated with an anti- GFP antibody to immunoprecipitate proteins bound to each of the GFP fusion proteins using standard methods. The resulting immunoprepitated proteins were electrophoresed on 4-12% SDS-PAGE gels, and either stained directly with Coomassie Blue or transferred onto a membrane and immunostained with anti-poly-ADP-ribose antibody.
Example 7. PARP13 and PARG Regulation of RNAi Activity
We have further discovered that PARP 13 and PARG regulate the activity of RNAi and niiRNA molecules in cells. Regulation of RNAi and miRNA activity in cells remains largely uncharacterized. One of the proteins implicated for a role in the regulation of RNAi and miRNA activity is Argonaut 2, a single-stranded RNAse. Using immunofluorescence microscopy we have observed that Argonaut 2 localizes to stress granules in HeLa cells treated with 250 μM sodium arsenite for 30 minutes (Figure 27, left panel). In these experiments, cells were treated with sodium arsenite and stained using both antibodies against Argonaut 2 and eIF3 (a stress granule marker), and secondary fluorescently-labeled antibodies. The data show that Argonaut 2 is poly-ADP- ribosylated in HeLa cells following exposure to 250 μM sodium arsenite for 30 minutes (Figure 27, right panel). In these experiments, cell lysate from cells treated with 250 μM sodium arsenite was immunoprecipitated with an anti-Argonaut 2 antibody, and the resulting immunoprecipitated proteins were immunoblotted using an anti-poly- ADP- ribose antibody. The results indicate that Argonaut 2 is localized to stress granules and poly-ADP-ribosylated under cellular stress conditions.
To determine whether one or more of the PARPs identified herein mediate the poly-ADP-riboyslation of Argonaut 2, immunoprecipitation experiments were performed on cell lysate from untransfected HeLa cells treated with 0 or 250 μM sodium arsenite for 30 minutes using an anti-Argonaut 2 antibody. The resulting immunoprecipitated proteins were immunoblotted using an anti-PARP13/13.1 antibody. The data show that PARP13/13.1 binds to Argonaut 2 under both normal (0 μM sodium arsenile) and stress conditions (250 μM sodium arsenite) (Figure 28). To identify additional substrate proteins of PAPRl 3, immunoprecipitation experiments were performed on lysate from HeLa cells transfected with a pEGFP-Cl plasmid containing a sequence encoding a PARP13-GFP fusion protein following treatment with either 0 or 250 μM sodium arsenite for 30 minutes. The cell lysate was treated with an anti-GFP antibody and the resulting immunoprecipitated proteins were electrophoresed using SDS-PAGE. The data show that exposure to 250 μM sodium arsenite increases the number and identity of proteins that bind to the PARPl 3-GFP fusion protein (Figure 29). The identification of the specific proteins co- immunoprecipitated with the PARPl 3-GFP fusion protein will help to further elucidate the role of PARPl 3 in cellular mechanisms, including its regulation of Argonaut 2 and its role in the regulation of miRNA and RNAi activity.
Additional experiments were performed to determine the effect of PARP 13 knockdown on miRNA activity. For these experiments, the pGL4.72[hRlucCP]™-vector assay (Promega) was used to measure RNAi activity in 293T cells. The pGL4.72[hRlucCP]™ vector contains a constitutively expressed firefly luciferase gene which is located upstream of several nucleic acid sequences targeted by an RNAi molecule. An increase in the activity of an RNAi molecule targeting the downstream 3' sequences of the vector results in a decrease in the amount of luciferase produced from the vector. In experiments to study the effect of PARP13 on miRNA activity, the pGL4.72[hRlucCP]™ vector was first engineered to contain 6 repeats of a sequence recognized by an RNAi molecule targeting the vector ("vector-target RNAi;" SEQ ID NOS: 38 and 39;
GUUUUCACUCCAGCUAACACA and TTCAAAAGUGAGGUCGAUUGU, respectively). In a first experiment, cells were transfected with a modified pGL4.72[hRlucCP]™ vector and a pEGFP-Cl plasmid encoding EGFP (negative control), G3BP (negative control), PARP5a, PARP 12, PARPl 3, PARP 13.1, or PARPl 5; and 10 nM of the vector-target RNAi. In a positive control, the cells were transfected with the modified pGL4.72[hRlucCP]™ vector and vector-target RNAi alone (CXCR4 sponge). Cells overexpressing PARP 13 or PARP 13.1 showed a 3-fold decrease in the level of miRNA-mediated repression compared to control cells (e.g., EGFP- and G3BP- overexpressing cells) (Figure 30). In a second set of experiments, the ability of the vector-target RNAi to reduce the expression of luciferase was measured in 293T cells transfected with pGL4.72[hRlucCP]™ vector, 20 nM vector-target RNAi, and 20 nM of negative RNAi control for PARPl 3 siRNA (siNeg; AllStars Negative Control siRNA; Qiagen Catalog No. 1027280) or PARPl 3 siRNA (siPARP13; SEQ ID NO: 40) following treatment with 0 or 30 nM pateamine A for 2 hours. The data in Figure 31 show that knockdown of PARP 13 expression by siPARP13 results in an increase in the activity of the vector-target RNAi under stress conditions (i.e., 30 nM pateamine A) (Figure 31). These data indicate that PARPl 3 activity in the cell has a negative effect on RNAi activity in the cell. This effect on RNAi activity may occur through the poly-ADP- ribosylation of Argonaut 2 by PARP 13 or by the ability of PARP 13 to modify or bind other proteins located within stress granules or proteins required for the assembly or disassembly of stress granules.
Experimental Methods
Immunopreciptation experiments were performed using non-transfected HeLa cells following treatment with 0 or 250 μM sodium arsenite for 60 minutes using an anti-
Argonaut 2 antibody. The resulting precipitated proteins were electrophoresed using 4- 12% SDS-PAGE and immunoblotted using an anti-poly- ADP ribose antibody. Non- transfected HeLa cells treated with 250 μM sodium arsenite for 30 minutes were also stained for immunofluorescence microscopy using antibodies specific for Argonaut 2 and eIF3 (a marker of stress granules), and a secondary fluorescently-labeled antibody (Alexa Fluor 594 and 488 antibodies).
Additional co-immunoprecipitation experiments were performed using methods known in the art. In these experiments, HeLa cell lysate was prepared from cells treated with 0 or 250 μM sodium arsenite for 30 minutes, and the lysate subsequently immunoprecipitated with an anti-Argonaut 2 antibody. The resulting precipitated proteins were immunoblotted using an anti-PARP13/13.1 antibody.
Experiments to identify additional proteins bound to a PARPl 3-GFP fusion protein were performed by transfecting HeLa S3 cells with a pEGFP-Cl plasmid encoding a PARPl 3-GFP fusion protein. The transfected cells were treated with 0 or 250 μM sodium arsenite for 30 minutes before lysis. The resulting cell lysate was immunoprecipitated with an anti-GFP antibody and the resulting precipitated proteins were electrophoresed using 4-12% SDS-PAGE and the resulting gel stained with Coomassie Blue.
Experiments to determine the effect of knockdown of PARPl 3 on miRNA and RNAi activity were performed using a modified pGL4.72[hRlucCP]™- vector assay (Promega). For these experiments, the pGL4.72[hRlucCP]™- vector was modified by placing six copies of a target sequence at a position 3' to the luciferase gene. RNAi molecules targeting the vector were designed to bind the six copies of the target sequence (SEQ ID NOS: 34 and 35). The modified pGL4.72[hRlucCP]™- vector was introduced into 293T cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. In each experiment, the cells were further transfected (Lipofectamine 2000) with 10 or 20 nM of the vector-target RNAi alone or in combination with either 20 nM of a control RNAi molecule for the siRNA targeting PARPl 3 (siNeg) or an RNAi molecule targeting PARPl 3 (siPARG13), and the cells treated with 0 or 30 nM pateamine A for 60 minutes. Following 48-hours incubation, the level of luciferase protein production was measured using a luciferase assay kit (Promega). The data are shown as the relative level of luciferase protein produced in cells transfected with the modified vector alone in the absence of any RNAi treatment.
Experiments were also performed to determine the effect of overexpression of a PARP-GFP protein on the activity of miRNA using the modified pGL4.72[hRlucCP]™-
vector assay described above. In these experiments, 293T cells were transfected with pEGFP-Cl expression vectors encoding EGFP, G3BP, PARP5A, PARP 12, PARPl 3, PARPl 3.1, or PARPl 5; the modified pGL4.72[hRlucCP]™ vector, and 10 nM vector- targeting RNAi. As a positive control for RNAi activity, the cells were transfected with the modified pGL4.72[hRlucCP]™ and the vector-target RNAi alone (CXCR4 sponge).
From the foregoing description, one skilled in the art can easily ascertain the essential characteristics of this invention; can make various changes and modifications of the invention to adapt it to various usages and conditions.
What is claimed is:
Claims
1. A method of treating or decreasing the likelihood of developing a stress granule-related disorder in a subject comprising administering to said subject a therapeutically effective amount of one or more poly-ADP-ribose polymerase (PARP) inhibitor(s), one or more poly-ADP ribose glycolase (PARG) activators, and/or one or more PARPl 1 activators.
2. The method of claim 1, wherein said one or more PARP inhibitor(s) selectively decrease the expression and/or one or more activities of one or more PARP(s) selected from the group consisting of PARP5a, PARP12, PARP13 isoform 1 (PARP13.1), PARP13 isoform 2 (PARP13.2), and PARP15.
3. The method of claim 2, wherein said decrease in expression is a decrease in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARP5a (SEQ ID NO: 8 or 9), PARP5b (SEQ ID NO: 10), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), or PARP15 (SEQ ID NOS: 22 or 23), or a decrease in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
4. The method of claim 2, wherein said one or more activities of said one or more PARP(s) is poly-ADP-ribosylation of a target protein localized in a stress granule or a target protein involved in the formation or disassembly of a stress granule.
5. The method of claim 4, wherein said target protein is a PARP protein.
6. The method of claim 2, wherein said one or more activities of said one or more PARP(s) is the formation or nucleation of a stress granule.
7. The method of claim 1 , wherein said one or more PARG activators selectively increase the expression and/or one or more activities of PARG protein or poly-ADP- ribose glycohydrolase ARH3.
8. The method of claim 7, wherein said increase in expression is an increase in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or an increase in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
9. The method of claim 7, wherein said one or more activities of PARG or ARH3 is hydrolysis of poly-ADP-ribose.
10. The method of claim 9, wherein said poly-ADP-ribose is covalently attached to a substrate protein localized in a stress granule or involved in the formation or disassembly of a stress granule.
11. The method of claim 10, wherein said substrate protein is a PARP protein.
12. The method of claim 7, wherein said one or more activities of PARG protein or ARH3 is the prevention of the assembly of a stress granule or disassembly of a stress granule.
13. The method of claim 1 , wherein said one or more PARPl 1 activators selectively increase the expression and/or one or more activities of PARPl 1.
14. The method of claim 13, wherein said increase in expression is an increase in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARPl 1 (SEQ ID NO: 17), or an increase in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
15. The method of claim 13, wherein said one or more activities of PARPl 1 is poly-ADP-ribosylation of a target protein localized in a stress granule or a target protein involved in the formation or disassembly of a stress granule.
16. The method of claim 15, wherein said target protein is a PARP protein.
17. The method of claim 13, wherein said one or more activities of PARPl 1 is the prevention of the assembly of a stress granule or disassembly of a stress granule.
18. The method of claim 1, wherein said one or more PARP inhibitors is an antibody or an antibody fragment that selectively binds one or more of PARP5a, PARP12, PARP13.1, PARP13.2, and PARP15 polypeptide.
19. The method of claim 1, wherein said one or more PARP inhibitors is an RNA aptamer.
20. The method of claim 19, wherein said RNA aptamer is an RNAi molecule comprising a sequence selected from the group consisting of SEQ ID NOS: 40, 49, 99- 1 13, and 122-129.
21. The method of claim 1 , wherein said one or more PARG activators is one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41).
22. The method of claim 1, wherein said one or more PARPl 1 activators is one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARPl 1 (SEQ ID NO: 17).
23. The method of claim 1, wherein said stress granule-related disorder is a cardiovascular disorder, an inflammatory disorder, a neurological disorder, or ischemic reperfusion injury.
24. The method of claim 23, wherein said cardiovascular disorder is selected from the group consisting of: an aneurysm, angina, atherosclerosis, stroke, cerebrovascular disease, congestive heart failure, coronary artery disease, myocardial disease, peripheral vascular disease, granulomatous myocarditis, chronic myocarditis, myocardial infarction, and primary hypertrophic cardiomyopathy.
25. The method of claim 23, wherein said inflammatory disorder is selected from the group consisting of autoimmune diseases, asthma, allergic intraocular inflammatory diseases, arthritis, atopic dermatitis, atopic eczema, cirrhosis, Crohn's disease, ulcerative colitis, diabetes, hemolytic anemia, inflammatory dermatosis, inflammatory bowel disorder, systemic lupus erythamatosus, psoriasis, rheumatoid arthritis, Wegener's granulomatosis, Hashimoto's thyroiditis, chronic pancreatitis, and reactive lymphoid hyperplasia.
26. The method of claim 23, wherein said neurological disorder is selected from the group consisting of multiple sclerosis, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, retinosa pigmentosum, macular degeneration, traumatic brain injury, stroke, and peripheral neuropathy.
27. The method of claim 1, wherein said one or more PARP inhibitor(s), one or more PARG activators, and/or one or more PARPl 1 activators is administered parenterally or orally.
28. The method of claim 27, wherein said parenteral administration is intravenous, intraarterial, subcutaneous, or intramuscular administration.
29. The method of claim 1, said one or more PARP inhibitor(s), one or more PARG activators, and/or one or more PARPl 1 activators is administered with one or more additional therapeutic agents selected from the group consisting of a non-steroidal anti-inflammatory drug (NSAID), an immunosuppressive agent, a calcineurin inhibitor, or an analgesic.
30. A method of decreasing the number of stress granules present in a cell or a population of cells comprising contacting said cell or population of cells with an effective amount of one or more poly-ADP-ribose polymerase (PARP) inhibitor(s), one or more poly-ADP ribose glycolase (PARG) activators, and/or one or more PARPl 1 activators.
31 . The method of claim 30, wherein said one or more PARP inhibitor(s) selectively decrease the expression and/or one or more activities of one or more PARP(s) selected from the group consisting of PARP5a, PARP12, PARP13 isoform 1 (PARP13.1 ), PARP 13 isoform 2 (PARPl 3.2), and PARPl 5.
32. The method of claim 31 , wherein said decrease in expression is a decrease in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARP5a (SEQ ID NO: 8 or 9), PARP5b (SEQ ID NO: 10), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), or PARPl 5 (SEQ ID NOS: 22 or 23), or a decrease in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
33. The method of claim 31, wherein said one or more activities of said one or more PARP(s) is poly-ADP-ribosylation of a target protein localized in a stress granule or a target protein involved in the formation or disassembly of a stress granule.
34. The method of claim 33, wherein said target protein is a PARP protein.
35. The method of claim 31, wherein said one or more activities of one or more PARP(s) is the formation or nuclcation of a stress granule.
36. The method of claim 30, wherein said one or more PARG activators selectively increase the expression and/or one or more activities of PARG or poly- ADP- ribose glycohydrolase ARH3.
37. The method of claim 36, wherein said increase in expression is an increase in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or an increase in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
38. The method of claim 36, wherein said one or more activities of PARG or ARH3 is hydrolysis of poly-ADP-ribose.
39. The method of claim 38, wherein said poly-ADP-ribose is covalently attached to a substrate protein localized in a stress granule or a substrate protein involved in the formation or disassembly of a stress granule.
40. The method of claim 39, wherein said substrate protein is a PARP protein.
41. The method of claim 36, wherein said one or more activities of PARG or ARH3 is the prevention of the assembly of a stress granule or disassembly of a stress granule.
42. The method of claim 30, wherein said one or more PARPl 1 activators selectively increase the expression and/or one or more activities of PARPl 1.
43. The method of claim 42, wherein said increase in expression is an increase in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARPl 1 (SEQ ID NO: 17), or an increase in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
44. The method of claim 42, wherein said one or more activities of PARPl 1 is poly-ADP-ribosylation of a target protein localized in a stress granule or a target protein involved in the foπnation or disassembly of a stress granule.
45. The method of claim 44, wherein said target protein is a PARP protein.
46. The method of claim 42, wherein said one or more activities of PARPI 1 is the prevention of the assembly of a stress granule or disassembly of a stress granule.
47. The method of claim 30, wherein said one or more PARP inhibitors is an antibody or an antibody fragment that selectively binds one or more of PARP5a, PARP12, PARP13.1, PΛRP13.2, and PARP15 polypeptide.
48. The method of claim 30, wherein said one or more PARP inhibitors is an RNA aptamer.
49. The method of claim 48, wherein said RNA aptamer is an RNAi molecule comprising a sequence selected from the group consisting of SEQ ID NOS: 40, 49, 99- 1 13, and 122-129.
50. The method of claim 30, wherein said one or more PARG activators is one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41).
51 . The method of claim 30, wherein said one or more PARPl 1 activators is one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARPl 1 (SEQ ID NO: 17).
52. A method of treating or decreasing the likelihood of developing cancer in a subject comprising administering to said subject a therapeutically effective amount of one or more poly-ADP-ribose polymerase (PARP) inhibitor(s).
53. The method of claim 52, wherein said one or more PARP inhibitor(s) selectively decrease the expression and/or one or more activities of one or more PARP(s) selected from the group consisting of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARPl 6.
54. The method of claim 53, wherein said decrease in expression is a decrease in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP 14 (SEQ ID NO: 21), or PARPl 6 (SEQ ID NO: 24), or a decrease in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
55. The method of claim 53, wherein said activity of said one or more PARP(s) is poly-ADP-ribosylation of a target protein localized in the nucleus or a target protein localized in the mitotic spindle during cytokinesis.
56. The method of claim 55, wherein said target protein is a PARP protein.
57. The method of claim 53, wherein said one or more activities of one or more PARP(s) is required for progression through mitosis.
58. The method of claim 53, wherein said one or more PARP inhibitors is an antibody or an antibody fragment that selectively binds one or more of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and/or PARPl 6 polypeptide.
59. The method of claim 53, wherein said one or more PARP inhibitors is an RNA aptamer.
60. The method of claim 59, wherein said RNA aptamer is an RNAi molecule comprising a sequence selected from the group consisting of SEQ ID NOS: 43-46, 49, 50, 59-74, 114-121, and 130-136.
61. The method of claim 53, wherein said cancer is selected from the group consisting of colon adenocarcinoma, esophagas adenocarcinoma, liver hepatocellular carcinoma, squamous cell carcinoma, pancreas adenocarcinoma, islet cell tumor, rectum adenocarcinoma, gastrointestinal stromal tumor, stomach adenocarcinoma, adrenal cortical carcinoma, follicular carcinoma, papillary carcinoma, breast cancer, ductal carcinoma, lobular carcinoma, intraductal carcinoma, mucinous carcinoma, phyl lodes tumor, Ewing's sarcoma, ovarian adenocarcinoma, endometrium adenocarcinoma, granulose cell tumor, mucinous cystadenocarcinoma, cervix adenocarcinoma, vulva squamous cell carcinoma, basal cell carcinoma, prostate adenocarcinoma, giant cell tumor of bone, bone osteosarcoma, larynx carcinoma, lung adenocarcinoma, kidney carcinoma, urinary bladder carcinoma, Wilm's tumor, lymphoma, and non-Hodgkin's lymphoma.
62. The method of claim 53, wherein said one or more PARP inhibitor(s) is administered parenterally or orally.
63. The method of claim 62, wherein said parenteral administration is intravenous, intraarterial, subcutaneous, or intramuscular administration.
64. The method of claim 53, said one or more PARP inhibitor(s) is administered with one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a non-steroidal anti-inflammatory drug (NSAlD), an immunosuppressive agent, a calcineurin inhibitor, or an analgesic.
65. A method of decreasing proliferation of a cell or a population of cells by contacting said cell or population of cells with an effective amount of one or more poly- ADP-ribose polymerase (PARP) inhibitor(s).
66. The method of claim 65, wherein said one or more PARP inhibitor(s) selectively decrease the expression and/or one or more activities of one or more PARP(s) selected from the group consisting of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP 14, and PARPl 6.
67. The method of claim 66, wherein said decrease in expression is a decrease in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24), or a decrease in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
68. The method of claim 66, wherein said one or more activities of said one or more PARP(s) is poly-ADP-ribosylation of a target protein localized in the nucleus or a target protein localized in the mitotic spindle during cytokinesis.
69. The method of claim 68, wherein said target protein is a PARP protein.
70. The method of claim 66, wherein said activity of one or more PARP(s) is required for progression through mitosis.
71. The method of claim 65, wherein said one or more PARP inhibitors is an antibody or an antibody fragment that selectively binds one or more of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and/or PARP16 polypeptide.
72. The method of claim 65, wherein said one or more PARP inhibitors is an RNA aptamer.
73. The method of claim 72, wherein said RNA aptamer is an RNAi molecule comprising a sequence selected from the group consisting of SEQ ID NOS: 43-46, 49, 50, 59-74, 114-121 , and 130-136.
74. The method of claim 65, wherein said cell or population of cells is a mammalian cell(s).
75. A pharmaceutical composition comprising one or more PARP inhibitors, one or more PARG activators, and/or one or more PARPl 1 activators, wherein said one or more PARP inhibitor(s) selectively decrease the expression and/or one or more activities of one or more PARP(s) selected from the group consisting of PARP5a, PARP12, PARP13 isoform 1 (PARPl 3.1), PARP13 isoform 2 (PARPl 3.2), and PARP15.
76. The composition of claim 75, wherein said decrease in expression is a decrease in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARP5a (SEQ ID NO: 8 or 9), PARP5b (SEQ ID NO: 10), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), or PARP15 (SEQ ID NOS: 22 or 23), or a decrease in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
77. The composition of claim 75, wherein said activity of said one or more PARP(s) is poly-ADP-ribosylation of a target protein localized in a stress granule or a target protein involved in the formation or disassembly of a stress granule.
78. The composition of claim 77, wherein said target protein is a PARP protein.
79. The composition of claim 75, wherein said activity of one or more PARP(s) is the formation or nucleation of a stress granule.
80. The composition of claim 75, wherein said one or more PARG activators selectively increase the expression and/or one or more activities of PARG protein or poly- ADP-ribose glycohydrolase ARH3.
81. The composition of claim 80, wherein said increase in expression is an increase in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41 ), or an increase in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
82. The composition of claim 80, wherein said one or more activities of PARG protein or ARH3 is hydrolysis of poly-ADP-ribose.
83. The composition of claim 82, wherein said poly-ADP-ribose is covalently attached to a substrate protein localized in a stress granule or a substrate protein involved in the formation or disassembly of a stress granule.
84. The composition of claim 83, wherein said substrate protein is a PARP protein.
85. The composition of claim 80, wherein said activity of PARG protein or ARH3 is the prevention of the assembly of a stress granule or disassembly of a stress granule.
86. The composition of claim 75, wherein said one or more PARPl 1 activators selectively increase the expression and/or one or more activities of PARPl 1.
87. The composition of claim 86, wherein said increase in expression is an increase in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARPl 1 (SEQ ID NO: 17), or an increase in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
88. The composition of claim 86, wherein said one or more activities of PARPl 1 is poly-ADP-ribosylation of a target protein localized in a stress granule or a target protein involved in the formation or disassembly of a stress granule.
89. The composition of claim 88, wherein said target protein is a PARP protein.
90. The composition of claim 86, wherein said one or more activities of PARPl 1 is the prevention of the assembly of a stress granule or disassembly of a stress granule.
91. The composition of claim 75, wherein said one or more PARP inhibitors is an antibody or an antibody fragment that selectively binds one or more of PARP5a, PARP12, PARPl 3.1 , PARP13.2, and PARP15 polypeptide.
92. The composition of claim 75, wherein said one or more PARP inhibitors is an RNA aptamer.
93. The composition of claim 92, wherein said RNA aptamer is an RNAi molecule comprising a sequence selected from the group consisting of SEQ ID NOS: 40, 49, 99-1 13, and 122-129.
94. The composition of claim 75, wherein said one or more PARP activators is one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41).
95. The composition of claim 75, wherein said one or more PARPl 1 activators is one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARPl 1 (SEQ ID NO: 17).
96. The composition of claim 75, formulated for parenteral or oral administration.
97. A kit comprising one or more pharmaceutical compositions of claim 75 and instructions for administering the one or more compositions to a subject diagnosed with a stress granule-related disorder or diagnosed as having a propensity to develop a stress granule-related disorder.
98. A pharmaceutical composition comprising one or more poly-ADP-ribose polymerase (PARP) inhibitor(s), wherein said one or more PARP inhibitor(s) selectively decrease the expression and/or one or more activities of one or more PARP(s) selected from the group consisting of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16.
99. The composition of claim 98, wherein said decrease in expression is a decrease in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP 14 (SEQ ID NO: 21), or PARP 16 (SEQ ID NO: 24), or a decrease in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
100. The composition of claim 98, wherein said one or more activities of said one or more PARP(s) is poly-ADP-ribosylation of a target protein localized in the nucleus or a target protein localized in the mitotic spindle during cytokinesis.
101. The composition of claim 100, wherein said target protein is a PARP protein.
102. The composition of claim 98, wherein said one or more activities of one or more PARP(s) is required for progression through mitosis.
103. The composition of claim 98, wherein said one or more PARP inhibitors is an antibody or an antibody fragment that selectively binds one or more of PARPl, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and/or PARP16 polypeptide.
104. The composition of claim 98, wherein said one or more PARP inhibitors is an RNA aptamer.
105. The composition of claim 104, wherein said RNA aptamer is an RNAi molecule comprising a sequence selected from the group consisting of SEQ ID NOS: 43- 46, 49, 50, 59-74, 114-121, and 130-136.
106. The composition of claim 98, formulated for parenteral or oral administration.
107. A kit comprising one or more pharmaceutical compositions of claim 98 and instructions for administering the one or more compositions to a subject diagnosed with cancer or diagnosed as having a propensity to develop a cancer.
108. A method for increasing the number of stress granules in a cell or a population of cells comprising contacting said cell or population of cells with one or more poly-ADP-ribose polymerase (PARP) activators(s), one or more poly-ADP ribose glycolase (PARG) inhibitors, and/or one or more PARPl 1 inhibitors.
109. The method of claim 108, wherein said one or more PARP activators(s) selectively increase the expression and/or one or more activities of one or more PARP(s) selected from the group consisting of PARP5a, PARP12, PARP13 isoform 1 (PARP 13.1), PARP13 isoform 2 (PARP13.2), and PARP15.
110. The method of claim 109, wherein said increase in expression is an increase in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARP5a (SEQ ID NO: 8 or 9), PARP5b (SEQ ID NO: 10), PARPl 3.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), or PARPl 5 (SEQ ID NOS: 22 or 23), or an increase in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
11 1. The method of claim 109, wherein said one or more activities of said one or more PARP(s) is poly-ADP-ribosylation of a target protein localized in a stress granule or a target protein involved in the formation or disassembly of a stress granule.
1 12. The method of claim 1 1 1 , wherein said target protein is a PARP protein.
1 13. The method of claim 109, wherein said one or more activities of one or more PARP(s) is the formation or nucleation of a stress granule.
114. The method of claim 108, wherein said one or more PARG inhibitors selectively decrease the expression and/or one or more activities of PARG or poly- ADP- ribose glycohydrolase ARH3.
1 15. The method of claim 1 14, wherein said decrease in expression is a decrease in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or a decrease in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
1 16. The method of claim 1 14, wherein said one or more activities of PARG or ARH3 is hydrolysis of poly-ADP-ribose.
1 17. The method of claim 1 16, wherein said poly-ADP-ribose is covalently attached to a substrate protein localized in a stress granule or a substrate protein involved in the formation or disassembly of a stress granule.
1 18. The method of claim 1 17, wherein said substrate protein is a PARP protein.
119. The method of claim 114, wherein said one or more activities of PARG or ARH3 is the prevention of the assembly of a stress granule or disassembly of a stress granule.
120. The method of claim 108, wherein said one or more PARPl 1 inhibitors selectively decrease the expression and/or one or more activities of PARPl 1.
121. The method of claim 120, wherein said decrease in expression is a decrease in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARPl 1 (SEQ ID NO: 17), or a decrease in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
122. The method of claim 120, wherein said one or more activities of PARPl 1 is poly-ADP-ribosylation of a target protein localized in a stress granule or a target protein involved in the formation or disassembly of a stress granule.
123. The method of claim 122, wherein said target protein is a PARP protein.
124. The method of claim 120, wherein said one or more activities of PARPl 1 is the prevention of the assembly of a stress granule or disassembly of a stress granule.
125. The method of claim 108, wherein said one or more PARP activators is one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARP5a (SEQ ID NO: 8 or 9), PARP5b (SEQ ID NO: 10), PARP13.1 (SEQ ID NO: 19), PARPl 3.2 (SEQ ID NO: 20), or PARP 15 (SEQ ID NOS: 22 or 23).
126. The method of claim 108, wherein said one or more PARG inhibitors is an antibody or an antibody fragment that selectively binds one or more of PARG or ARH3.
127. The method of claim 108, wherein said one or more PARG inhibitors is an RNA aptamer.
128. The method of claim 127, wherein said RNA aptamer is an RNAi molecule.
129. The method of claim 108, wherein said one or more PARPl 1 inhibitors is an antibody or an antibody fragment that selectively binds PARPl 1.
130. The method of claim 108, wherein said one or more PARPl 1 inhibitors is an RNA aptamer.
131. The method of claim 130, wherein said RNA aptamer is an RNAi molecule comprising a sequence selected from the group consisting of SEQ ID NOS: 91-98.
132. The method of claim 108, wherein said cell or population of cells is a mammalian cell(s) or plant cell(s).
133. A method of increasing proliferation of a cell or a population of cells comprising contacting said cell or population of cells with an effective amount of one or more poly-ADP-ribose polymerase (PARP) activators(s).
134. The method of claim 133, wherein said one or more PARP activator(s) selectively increase the expression and/or one or more activities of one or more PARP(s) selected from the group consisting of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16.
135. The method of claim 134, wherein said increase in expression is an increase in the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARPl 4 (SEQ ID NO: 21), or PARPl 6 (SEQ ID NO: 24), or an increase in the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
136. The method of claim 134, wherein said one or more activities of said one or more PARP(s) is poly-ADP-ribosylation of a target protein localized in the nucleus or a target protein localized in the mitotic spindle during cytokinesis.
137. The method of claim 136, wherein said target protein is a PARP protein.
I l l
138. The method of claim 134, wherein said one or more activities of one or more PARP(s) is required for progression through mitosis.
139. The method of claim 133, wherein said one or more PARP activators is one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24).
140. The method of claim 133, wherein said cell or population of cells is a mammalian cell(s).
141. The method of claim 133, wherein said cell or populations of cells is a plant cell(s).
142. A method of identifying a candidate agent for treating or decreasing the likelihood of developing a stress granule-related disorder comprising the steps of: a) providing one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARC, and/or ARH3 fusion proteins encoded by a nucleic acid comprising a nucleic acid sequence having at least 95% sequence identity to PARP5A (SEQ ID NO: 8 or 9), PARP12 (SEQ ID NO: 18), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20) PARPl 5 (SEQ ID NO: 22 or 23), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41); b) contacting said one or more PARP, PΛRG, and/or ΛRH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins with said agent and a labeled nicotinamide adenine dinucleotide (NAD+) substrate; and c) measuring one or more activities of said one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins, and/or the specific binding of said agent to said one or more PARP proteins or fusion proteins; wherein an agent that decreases one or more activities and/or specifically binds to said one or more PARP proteins and/or PARP fusion proteins, and/or increases one or more activities of said one or more PARG and/or ARH3 proteins, and/or PARG and/or ARH3 fusion proteins is identified as a candidate agent for treating or decreasing the likelihood of developing a stress granule-related disorder.
143. The method of claim 142, wherein the labeled NAD+ substrate is labeled with a radioisotope or fluorophore, or is biotinylated.
144. The method of claim 143, wherein said radioisotope is 32P.
145. The method of claim 142, wherein said one or more PARP proteins or PARP fusion proteins is purified.
146. The method of claim 142, wherein said one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins is present in a cell Iy sate.
147. The method of claim 142, wherein said one or more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins is attached to a substrate or solid surface.
148. The method of claim 147, wherein said substrate is a magnetic bead.
149. The method of claim 142, wherein said method is performed in a multi-well plate.
150. A method of identifying a candidate agent for treating or decreasing the likelihood of developing cancer comprising the steps of: a) providing one or more PARP proteins and/or PARP fusion proteins encoded by a nucleic acid comprising a nucleic acid sequence having at least 95% sequence identity to a PARP selected from PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10) PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ ID NO: 21), or PARPl 6 (SEQ ID NO: 24); b) contacting said one or more PARP proteins and/or PARP fusion proteins with said agent and a labeled nicotinamide adenine dinucleotide (NAD+) substrate; and c) measuring one or more activities of said one or more PARP proteins and/or PARP fusion proteins or the specific binding of said agent to said one or more PARP proteins and/or PARP fusion proteins; wherein an agent that decreases one or more activities and/or specifically binds to said one or more PARP proteins and/or fusion proteins is identified as a candidate agent for treating or decreasing the likelihood of developing cancer.
151. The method of claim 150, wherein the labeled NAD+ substrate is labeled with a radioisotope or fluorophore, or is biotinylated.
152. The method of claim 151, wherein said radioisotope is 32P.
153. The method of claim 150, wherein said one or more PARP proteins and/or PARP fusion proteins is purified.
154. The method of claim 150, wherein said one or more PARP proteins and/or PARP fusion proteins is present in a cell lysate.
155. The method of claim 150, wherein said one or more PARP proteins and/or PARP fusion proteins is attached to a substrate or solid surface.
156. The method of claim 155, wherein said substrate is a magnetic bead.
157. The method of claim 150, wherein said method is performed in a multi-well plate.
158. A method for determining the propensity of a subject to develop a stress granule-related disorder comprising determining the expression and/or one or more activities of one or more of PARP5A, PARPl 1, PARP12, PARPl 3.1 , PARPl 3.2, PARPl 5, PARG, and ARH3 in a subject, wherein an increase in the expression and/or one or more activities of one or more of PARP5A, PARPl 2, PARP 13.1, PARPl 3.2, and PARPl 5, and/or a decrease in the expression or one or more activities of PARPl 1, PARG, or ARH3 indicates an increased propensity to develop a stress granule-related disorder.
159. The method of claim 158, wherein said expression is the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARP5a (SEQ ID NO: 8 or 9), PARP5b (SEQ ID NO: 10), PARPl 1 (SEQ ID NO: 17), PARP13.1 (SEQ lD NO: 19), PARPl 3.2 (SEQ ID NO: 20), PARPl 5 (SEQ ID NOS: 22 or 23), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41), or the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
160. The method of claim 158, wherein said stress granule-related disorder is a cardiovascular disorder, an inflammatory disorder, a neurological disorder, or ischemic reperfusion injury.
161. The method of claim 160, wherein said cardiovascular disorder is selected from the group consisting of: an aneurysm, angina, atherosclerosis, stroke, cerebrovascular disease, congestive heart failure, coronary artery disease, myocardial disease, peripheral vascular disease, granulomatous myocarditis, chronic myocarditis, myocardial infarction, and primary hypertrophic cardiomyopathy.
162. The method of claim 160, wherein said inflammatory disorder is selected from the group consisting of autoimmune diseases, asthma, allergic intraocular inflammatory diseases, arthritis, atopic dermatitis, atopic eczema, cirrhosis, Crohn's disease, ulcerative colitis, diabetes, hemolytic anemia, inflammatory dermatosis, inflammatory bowel disorder, systemic lupus erythematosus, psoriasis, rheumatoid arthritis, Wegener's granulomatosis, Hashimoto's thyroiditis, chronic pancreatitis, and reactive lymphoid hyperplasia.
163. The method of claim 160, wherein said neurological disorder is selected from the group consisting of multiple sclerosis, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, retinosa pigmentosum, macular degeneration, traumatic brain injury, stroke, and peripheral neuropathy.
164. A method for determining the propensity of a subject to develop cancer comprising determining the expression and/or one or more activities of one or more of PARPl , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP 14, and PARP 16 in a subject, wherein an increase in the expression and/or one or more activities of one or more of PARPI , PARP2, PARP5A, PARP5B, PARP7, PARP8, PARPl 4, and PARPl 6 indicates an increased propensity to develop cancer.
165. The method of claim 164, wherein said expression is the level of one or more nucleic acid(s) comprising a nucleic acid sequence having at least 95% sequence identity to PARPl (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24), or the level of one or more polypeptide(s) encoded by said one or more nucleic acid(s).
166. The method of claim 164, wherein said cancer is selected from the group consisting of colon adenocarcinoma, esophagas adenocarcinoma, liver hepatocellular carcinoma, squamous cell carcinoma, pancreas adenocarcinoma, islet cell tumor, rectum adenocarcinoma, gastrointestinal stromal tumor, stomach adenocarcinoma, adrenal cortical carcinoma, follicular carcinoma, papillary carcinoma, breast cancer, ductal carcinoma, lobular carcinoma, intraductal carcinoma, mucinous carcinoma, phyl lodes tumor, Ewing's sarcoma, ovarian adenocarcinoma, endometrium adenocarcinoma, granulose cell tumor, mucinous cystadenocarcinoma, cervix adenocarcinoma, vulva squamous cell carcinoma, basal cell carcinoma, prostate adenocarcinoma, giant cell tumor of bone, bone osteosarcoma, larynx carcinoma, lung adenocarcinoma, kidney carcinoma, urinary bladder carcinoma, Wilm's tumor, lymphoma, and non-Hodgkin's lymphoma.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US26961409P | 2009-06-26 | 2009-06-26 | |
| US61/269,614 | 2009-06-26 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2010151664A2 true WO2010151664A2 (en) | 2010-12-29 |
| WO2010151664A3 WO2010151664A3 (en) | 2011-04-07 |
Family
ID=43387125
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/039814 Ceased WO2010151664A2 (en) | 2009-06-26 | 2010-06-24 | Compositions and methods for treating cancer and modulating stress granule formation |
Country Status (2)
| Country | Link |
|---|---|
| US (3) | US20110097329A1 (en) |
| WO (1) | WO2010151664A2 (en) |
Families Citing this family (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2807552A1 (en) | 2010-08-06 | 2012-02-09 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| ES3005233T3 (en) | 2010-10-01 | 2025-03-14 | Modernatx Inc | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| JP2014511687A (en) | 2011-03-31 | 2014-05-19 | モデルナ セラピューティクス インコーポレイテッド | Engineered nucleic acid delivery and formulation |
| US9359363B2 (en) | 2011-05-20 | 2016-06-07 | Aquinnah Pharmaceuticals, Inc. | Identification of compounds that disperse TDP-43 inclusions |
| US9464124B2 (en) | 2011-09-12 | 2016-10-11 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| EP2763701B1 (en) | 2011-10-03 | 2018-12-19 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9840708B2 (en) * | 2011-10-05 | 2017-12-12 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for the modulation of DNA damage responses using BAL1 and BBAP |
| US20140348857A1 (en) * | 2011-10-27 | 2014-11-27 | Massachusetts Institute Of Technology | Methods of diagnosis and treatment of endoplasmic reticulum (er) stress-related conditions |
| JP2015501844A (en) | 2011-12-16 | 2015-01-19 | モデルナ セラピューティクス インコーポレイテッドModerna Therapeutics,Inc. | Modified nucleosides, nucleotides and nucleic acid compositions |
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| WO2013151663A1 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of membrane proteins |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9254311B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins |
| ES2921623T3 (en) | 2012-11-26 | 2022-08-30 | Modernatx Inc | terminally modified RNA |
| US8980864B2 (en) | 2013-03-15 | 2015-03-17 | Moderna Therapeutics, Inc. | Compositions and methods of altering cholesterol levels |
| WO2015048744A2 (en) | 2013-09-30 | 2015-04-02 | Moderna Therapeutics, Inc. | Polynucleotides encoding immune modulating polypeptides |
| KR20160067219A (en) | 2013-10-03 | 2016-06-13 | 모더나 세라퓨틱스, 인코포레이티드 | Polynucleotides encoding low density lipoprotein receptor |
| JP6708545B2 (en) * | 2013-11-14 | 2020-06-10 | ザ ブリガム アンド ウィメンズ ホスピタル インコーポレイテッドThe Brigham and Women’s Hospital, Inc. | PARP9 and PARP14 as key regulators of macrophage activation |
| US20160287622A1 (en) * | 2013-11-18 | 2016-10-06 | Massachusetts Institute Of Technology | Compositions and methods for treating immune and viral disorders and modulating protein-rna interaction |
| WO2020023616A1 (en) * | 2018-07-24 | 2020-01-30 | Cornell University | Methods of upregulating tiparp as anticancer strategies |
| TW202237095A (en) * | 2020-12-03 | 2022-10-01 | 德商艾斯巴赫生物有限公司 | Alc1 inhibitors and synergy with parpi |
| CN113943264B (en) * | 2021-10-18 | 2023-04-21 | 中国科学技术大学 | Compound for inhibiting formation of G3BP1 stress particles, preparation method and application thereof |
Family Cites Families (39)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB8308235D0 (en) | 1983-03-25 | 1983-05-05 | Celltech Ltd | Polypeptides |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4828991A (en) * | 1984-01-31 | 1989-05-09 | Akzo N.V. | Tumor specific monoclonal antibodies |
| US4704692A (en) | 1986-09-02 | 1987-11-03 | Ladner Robert C | Computer based system and method for determining and displaying possible chemical structures for converting double- or multiple-chain polypeptides to single-chain polypeptides |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US4873316A (en) | 1987-06-23 | 1989-10-10 | Biogen, Inc. | Isolation of exogenous recombinant proteins from the milk of transgenic mammals |
| US6395282B1 (en) * | 1998-04-16 | 2002-05-28 | University Of Rochester | Immunogenic conjugates of Gram-negative bacterial autoinducer molecules |
| US6277613B1 (en) * | 1998-06-10 | 2001-08-21 | The Rockefeller University | TRF1 binding protein, methods of use thereof |
| AU4338300A (en) | 1999-04-09 | 2000-11-14 | Geron Corporation | A second mammalian tankyrase |
| AU779689B2 (en) | 1999-06-16 | 2005-02-03 | Icos Corporation | Human poly(ADP-ribose) polymerase 2 materials and methods |
| ATE450621T2 (en) | 2000-03-30 | 2009-12-15 | Whitehead Biomedical Inst | MEDIATORS OF RNA INTERFERENCE THAT ARE RNA SEQUENCE SPECIFIC |
| AU2002255478A1 (en) | 2001-01-10 | 2002-09-12 | Pe Corporation (Ny) | Kits, such as nucleic acid arrays, comprising a majority of human exons or transcripts, for detecting expression and other uses thereof |
| US20020142334A1 (en) | 2001-01-30 | 2002-10-03 | Brown Janice A. | Methods of detecting poly(ADP-ribose) polymerase enzymatic activity |
| WO2003070884A2 (en) | 2002-02-20 | 2003-08-28 | Sirna Therapeutics, Inc. | RNA INTERFERENCE MEDIATED INHIBITION OF MDR P-GLYCOPROTEIN GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| IL162568A0 (en) | 2002-01-22 | 2005-11-20 | Evrogen Ip | fluorescent protein from aequorea coerulscens and uses thereof |
| JP2006500916A (en) | 2002-05-30 | 2006-01-12 | テロジェン インコーポレーテッド | Methods and compositions for treating neoplasia associated with hnRNPA1 and A2 nucleic acid molecules |
| EP1532248B1 (en) | 2002-07-26 | 2009-04-01 | Novartis Vaccines and Diagnostics, Inc. | Modified small interfering rna molecules and methods of use |
| WO2004014933A1 (en) | 2002-08-07 | 2004-02-19 | University Of Massachusetts | Compositions for rna interference and methods of use thereof |
| GB0301628D0 (en) | 2002-09-19 | 2003-02-26 | Aventis Pharma Inc | Method for assaying compounds that decrease the activity of poly (ADP-ribose) - polymerase (PARP) |
| ES2712695T3 (en) | 2003-06-02 | 2019-05-14 | Univ Massachusetts | Methods and compositions to control the efficiency of RNA silencing |
| GB0317466D0 (en) | 2003-07-25 | 2003-08-27 | Univ Sheffield | Use |
| AU2004262369A1 (en) | 2003-07-29 | 2005-02-10 | Bristol-Myers Squibb Company | Biomarkers of cyclin-dependent kinase modulation |
| US20070161003A1 (en) * | 2003-09-29 | 2007-07-12 | Morris David W | Novel therapeutic targets in cancer |
| TWI338000B (en) | 2003-12-01 | 2011-03-01 | Kudos Pharm Ltd | Dna damage repair inhibitors for treatment of cancer |
| US20080015144A1 (en) | 2003-12-12 | 2008-01-17 | Alvert Einstein College Of Medicine Of Yeshiva Uni | Glp- (9-36) Methods and Compositions |
| US20060134787A1 (en) | 2004-12-22 | 2006-06-22 | University Of Massachusetts | Methods and compositions for enhancing the efficacy and specificity of single and double blunt-ended siRNA |
| US20060058255A1 (en) | 2004-03-01 | 2006-03-16 | Jianzhu Chen | RNAi-based therapeutics for allergic rhinitis and asthma |
| JP4761389B2 (en) | 2004-04-09 | 2011-08-31 | 株式会社ジーンケア研究所 | Cancer cell-specific apoptosis inducer targeting genes related to chromosome stabilization |
| JP4852540B2 (en) * | 2004-06-30 | 2012-01-11 | ジヤンセン・フアーマシユーチカ・ナームローゼ・フエンノートシヤツプ | Phthalazine derivatives as PARP inhibitors |
| DE602005023345D1 (en) | 2004-12-17 | 2010-10-14 | Beth Israel Hospital | COMPOSITIONS FOR BACTERIALLY MEDIATED GENE SILENCING AND METHOD OF USE THEREOF |
| WO2006078503A2 (en) | 2005-01-07 | 2006-07-27 | Arqule, Inc. | Compositions for modulation of parp and methods for screening for same |
| WO2007033298A2 (en) * | 2005-09-13 | 2007-03-22 | The Government Of The Usa As Represented By The Secretary Of The Department Of Health And Human Services | Hydrolase and methods for its use |
| EP2005185B1 (en) | 2006-03-22 | 2010-10-20 | Viral Logic Systems Technology Corp. | Methods for identifying polypeptide targets |
| US20080262062A1 (en) * | 2006-11-20 | 2008-10-23 | Bipar Sciences, Inc. | Method of treating diseases with parp inhibitors |
| US20100120627A1 (en) | 2006-08-02 | 2010-05-13 | Abdelmajid Belouchi | Genemap of the human genes associated with psoriasis |
| GB2442118B (en) | 2006-09-19 | 2011-08-17 | Chisso Corp | Process for production of recombinant proteins as a soluble form |
| WO2009027650A1 (en) * | 2007-08-24 | 2009-03-05 | The Institute Of Cancer: Royal Cancer Hospital | Materials and methods for exploiting synthetic lethality in brca-associated cancers |
| CN101854924A (en) | 2007-11-05 | 2010-10-06 | 诺瓦提斯公司 | Methods and compositions for measuring WNT activation and treating WNT-associated cancers |
| US20110151538A1 (en) | 2008-08-07 | 2011-06-23 | Ramot At Tel-Aviv University Ltd. | Affinity purification by cohesin-dockerin interaction |
-
2010
- 2010-06-24 US US12/822,995 patent/US20110097329A1/en not_active Abandoned
- 2010-06-24 WO PCT/US2010/039814 patent/WO2010151664A2/en not_active Ceased
-
2012
- 2012-03-30 US US13/435,932 patent/US9272022B2/en not_active Expired - Fee Related
-
2016
- 2016-01-29 US US15/011,188 patent/US20160251662A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| US9272022B2 (en) | 2016-03-01 |
| US20160251662A1 (en) | 2016-09-01 |
| US20130156776A1 (en) | 2013-06-20 |
| US20110097329A1 (en) | 2011-04-28 |
| WO2010151664A3 (en) | 2011-04-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9272022B2 (en) | Compositions and methods for treating cancer and modulating stress granule formation | |
| Weingarten-Gabbay et al. | The translation initiation factor DAP5 promotes IRES-driven translation of p53 mRNA | |
| Friedmann et al. | SPPL2a and SPPL2b promote intramembrane proteolysis of TNFα in activated dendritic cells to trigger IL-12 production | |
| Tafesse et al. | GPR107, a G-protein-coupled receptor essential for intoxication by Pseudomonas aeruginosa exotoxin A, localizes to the Golgi and is cleaved by furin | |
| JP6025758B2 (en) | Regulatory factors of NFAT | |
| Pierantoni et al. | High mobility group I (Y) proteins bind HIPK2, a serine-threonine kinase protein which inhibits cell growth | |
| Scudiero et al. | Alternative splicing of CARMA2/CARD14 transcripts generates protein variants with differential effect on NF‐κB activation and endoplasmic reticulum stress‐induced cell death | |
| Rozanska et al. | The human RNA-binding protein RBFA promotes the maturation of the mitochondrial ribosome | |
| Nishimoto et al. | Heterocomplex formation by Arp4 and β-actin is involved in the integrity of the Brg1 chromatin remodeling complex | |
| TW200920406A (en) | EBI3, DLX5, NPTX1 and CDKN3 for target genes of lung cancer therapy and diagnosis | |
| SG174071A1 (en) | Genes and polypeptides relating to breast cancers | |
| JP2010531662A (en) | TRIM24 (TIF-1A) is a modulator of P53 and a cancer target | |
| Fukukawa et al. | Critical roles of LGN/GPSM2 phosphorylation by PBK/TOPK in cell division of breast cancer cells | |
| US8268550B2 (en) | Compositions and methods for identification of PARP function, inhibitors, and activators | |
| JP2010523081A (en) | Screening method targeting CDCA8-AURKB complex and method for treating NSCLC | |
| JP5150855B2 (en) | Screening targeting CDCA1-KNTC2 complex and method for treating NSCLC | |
| Akiyama et al. | Mammalian homologue of E. coli ras‐like GTPase (ERA) is a possible apoptosis regulator with RNA binding activity | |
| CN112250751B (en) | Application of LENG8 as mRNA transcription regulation protein and mitochondrial activity regulation protein | |
| Galvan et al. | Subversion of mRNA degradation pathways by EWSR1:: FLI1 represents a therapeutic vulnerability in Ewing sarcoma | |
| WO2006015084A2 (en) | Compositions, kits and assays containing reagents directed to cortactin and an arg/abl protein kinase | |
| US8435961B2 (en) | Methods and compositions for increasing the activity of inhibitory RNA | |
| JP2010501827A (en) | Screening method for agents that inhibit binding of MPHOSPH1 and PRC1 | |
| CN101528768A (en) | Genes and polypeptides relating to breast cancers | |
| WO2001038527A1 (en) | Novel protein tab2 | |
| Duan et al. | Characterization of the nuclear import pathway for BLM protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10792662 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10792662 Country of ref document: EP Kind code of ref document: A2 |

