WO2010144324A2 - Use of stamp related molecules in the diagnosis and inhibition of ovarian cancer cells - Google Patents

Use of stamp related molecules in the diagnosis and inhibition of ovarian cancer cells Download PDF

Info

Publication number
WO2010144324A2
WO2010144324A2 PCT/US2010/037452 US2010037452W WO2010144324A2 WO 2010144324 A2 WO2010144324 A2 WO 2010144324A2 US 2010037452 W US2010037452 W US 2010037452W WO 2010144324 A2 WO2010144324 A2 WO 2010144324A2
Authority
WO
WIPO (PCT)
Prior art keywords
stamp
ovarian cancer
cells
expression
sirna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2010/037452
Other languages
French (fr)
Other versions
WO2010144324A3 (en
Inventor
S. Stoney Simons, Jr.
Yuanzheng He
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Health and Human Services
Original Assignee
US Department of Health and Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by US Department of Health and Human Services filed Critical US Department of Health and Human Services
Publication of WO2010144324A2 publication Critical patent/WO2010144324A2/en
Publication of WO2010144324A3 publication Critical patent/WO2010144324A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57545Immunoassay; Biospecific binding assay; Materials therefor for cancer of the ovaries
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the subject invention included research supported by the Intramural Research Program of the National Institutes of Health (NIH), National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK), and the Center for Cancer Research, National Cancer Institute (NCI), NIH.
  • NIH National Institutes of Health
  • NIDDK National Institute of Diabetes and Digestive and Kidney Diseases
  • NCI National Cancer Institute
  • the subject invention relates to compositions, methods and kits for the research, diagnosis and treatment of ovarian cancer.
  • Glucocorticoids are clinically invaluable in treating lymphoid cancers and attenuating immune responses (Cole (2006)) while mineralocorticoid agonists are now thought to have significant effects on the heart and vasculature (Funder (2005); Schiffrin (2006)).
  • a major component in the expression of steroid receptor-regulated gene expression is coactivators and corepressors, which typically elevate or inhibit the action of receptor-agonist complexes (McKenna & O'Malley (2002); Nagy & Schwabe (2004)).
  • STAMP is a novel coregulator that enhances the ability of pi 60 coactivator family members TIF2 and SRC-I to augment gene induction by AR, glucocorticoid receptor (GR), and PR.
  • STAMP also modulates the potency (or EC50) of agonists and the partial agonist activity of antisteroids (He & Simons (2007); Szapary et al. (2008)). These modulatory activities of STAMP are not limited to gene induction but are also observed for GR-mediated gene repression (Sun et al. (2008)). These actions appear to proceed via the binding of internal and C-terminal regions of STAMP to coactivators and receptors respectively in a manner that includes steroid- mediated recruitment of STAMP to the enhancer region of regulated genes. Interestingly, STAMP does not interact with ER or members of the nuclear receptor sub-family such as thyroid receptor, PPAR, RAR, or RXR (He & Simons (2007)).
  • STAMP tyrosine tubulin ligase-like
  • TTL tyrosine tubulin ligase
  • Ovarian cancer is the fifth most common cancer in the United States and is responsible for 4% of new cancer cases, and 5% of the cancer deaths, occurring in women each year (Greenlee et al. (2001); Jemal et al. (2007)). The major cause of death is from epithelial ovarian tumors, which constitute the large majority of ovarian cancers (Leung et al. (2001)). Ovarian cancer in general has a 5 -year survival rate of over 90% if diagnosed and treated early, when the cancer is confined to the ovaries. Unfortunately, due to ovarian cancer's non-specific symptoms and the lack of reliable early detection methods, only about 20% of all cases are found at this beginning stage.
  • the subject invention comprises methods of diagnosing ovarian cancer in a patient, kits for diagnosing ovarian cancer, compositions comprising STAMP siRNA or variants thereof, methods of reducing ovarian cancer cell growth in ovarian cancer cells in vitro, and methods of reducing cancer cell growth in a patient diagnosed with ovarian cancer.
  • the invention encompasses a method of diagnosing ovarian cancer in a patient comprising assaying ovarian tissue in said patient for expression of the STAMP gene; and determining whether the expression level of STAMP gene in the ovarian tissue corresponds to ovarian cancer.
  • determining whether the determined STAMP expression level corresponds to ovarian cancer the skilled artisan can compare the determined expression level to a normal range standard for STAMP expression.
  • the diagnosis method expression assay can be an assay for STAMP mRNA.
  • the expression level of STAMP mRNA can be correlated to a specific stage of ovarian cancer.
  • the diagnosis method expression assay is an assay for STAMP polypeptide or protein.
  • the subject invention also comprises a kit for diagnosing ovarian cancer.
  • the kit comprises one or more capture reagents for capturing STAMP expression product, and means for detecting the binding of capture reagent to STAMP expression product.
  • the STAMP expression product is STAMP mRNA
  • the capture reagent is a nucleic acid such as a probe.
  • the means for detection is an appropriate label on the probe such as a radiolabel, fluorescent label or the like.
  • the capture reagents are primers (DNA or RNA) for qRT-PCR detection of the STAMP amplicon.
  • the STAMP expression product is a STAMP polypeptide
  • the capture reagent is an antibody.
  • the means for detection is a suitable label on the antibody such as a fluorescent tag or the like.
  • the invention also comprises a composition comprising a STAMP specific siRNA molecule or a variant thereof.
  • the siRNA is selected from the group consisting of SEQ ID NOS: 1-8 provided below, or variants thereof.
  • the top strand is the sense strand
  • the bottom is the antisense strand. (Note that "P" indicates a 5' phosphate on the adj acent nucleotide . )
  • Duplex 3 5' CGACGGAGUAGCAGAUUGAUU (SEQ ID NO.: 5) UUGCUGCCUCAUCGUCUAACUP 5' (SEQ ID NO.: 6)
  • Duplex 4 5' GGAUCGUGCUAUCUAAACAUU (SEQ ID NO.: 7) UUCCUAGCACGAUAGAUUUGUP 5' (SEQ ID NO.: 8).
  • the invention comprises a method of reducing ovarian cancer cell growth in vitro in ovarian cancer cells responsive thereto, comprising contacting said ovarian cancer cells with an agent that reduces STAMP gene expression.
  • the agent can be STAMP siRNA or a variant thereof, STAMP antisense molecules (DNA or RNA) or a variant thereof, or a STAMP antibody.
  • the invention further comprises a method of reducing cancer cell growth in a patient diagnosed with ovarian cancer comprising administering to the patient a therapeutically effective amount of a therapeutic agent that reduces STAMP gene expression, whereby ovarian cancer cell growth is substantially inhibited.
  • the therapeutic agent can comprise STAMP siRNA, STAMP antisense molecules, and/or STAMP antibodies.
  • Fig. 1 illustrates the effect of stably transfected STAMP on the growth rate of HEK 293 cells.
  • Fig. l(A) demonstrates that increased STAMP decreases cell growth; transfected cells S 13 have a lower cell titre than empty vector VA cells.
  • Figs. l(B) and (C) provide the FACS analysis of VA and S 13 cells with no steroid and G418 removed upon seeding, as described in the Examples.
  • Fig. l(D) sets forth the growth of VA and S 13 cells after removal of G418 for more than one month as described in the Examples.
  • Fig. l(E) illustrates increased STAMP results in decreased cell growth with or without steroid, as described in the Examples.
  • Fig. 2 illustrates the levels of STAMP mRNA in different human tumor samples.
  • Fig. 2(A) provides levels of STAMP mRNA in eight human tumor types.
  • Fig. 2(B) provides STAMP mRNA in human ovarian cancers as described in the Examples.
  • Fig. 3 illustrates the effect of STAMP siRNA on growth of human ovarian cancer tissue culture cells.
  • Fig. 3(A) provides the growth of ovarian tissue culture cells treated with STAMP siRNA relative to Lamin siRNA as described in the Examples.
  • Fig. 3(B) provides the growth rate vs. STAMP mRNA levels of each of the cell lines in Fig. 3(A).
  • Fig. 4 illustrates the effect of elevated STAMP on the properties of GR induction of GREtkLUC reporter gene IN 293 CELLS
  • Fig. 4(A) provides the dose-response curves for GR induction of GREtkLUC reporter with varying amounts of transiently transfected GR plasmid, as described in the Examples.
  • Fig. 4(B) illustrates modulation of A max , partial agonist activity of the antiglucocorticoid Dex-Mes (% DM), and EC 50 by elevated STAMP as described in the Examples.
  • Fig. 4(C) provides GR mRNA levels in VA and S 13 cells with or without 30 ng of transiently transfected GR plasmid, as described in the Examples.
  • Fig. 4(D) provides Western blot with TIF2 antibody of cell Iy sates from cells transfected with no or 30 ng of GR plasmid as described in the Examples. DETAILED DESCRIP
  • STAMP affects the physiologically relevant activity of cell growth apparently independent of several steroid hormones.
  • STAMP was initially characterized as a new factor that bound to, and augmented the ability of, the coactivator TIF2 to modulate the transcriptional properties GR, AR, and PR (He et al. (2007); Szapary et al. (2008); Sun et al. (2008)).
  • the steroid-independent effects of STAMP on the growth of a variety of cells represent a new activity that differs with the cell line, even within the same cell type.
  • STAMP was increased in expression in malignant epithelial ovarian cancer compared to normal ovary of unknown epithelial component and the epithelial tumor of low malignant potential.
  • the varied responses to silencing of STAMP in the ovarian cancer cell lines suggest that there may be a select subset of ovarian cancers in which STAMP may regulate behavior.
  • Epithelial ovarian cancer, while initiating in a steroid hormone sensitive organ and known to have functional ER and PR, has not been shown to be steroid hormone driven as in prostate and breast cancer.
  • the lack of response to steroid hormones found in the subject Examples may be an early signal as to a new role for STAMP that may ultimately explain the altered growth with modulation of STAMP in ovarian cancers.
  • the only other characterized domain of STAMP is the tyrosine tubulin ligase-like domain in the amino -terminal third of the molecule, which overlaps the region encoding polyglutamylation activity in some TTL domain proteins including STAMP (Janke et al. (2005)).
  • STAMP is able to polyglutamylate tubulin and a few other unidentified proteins (He and Simons, data not shown). While the TTL domain, and polyglutamylation activity, of STAMP are not required for its modulation of GR induction properties (He et al. (2007)), they could be relevant for effects on cell growth.
  • compositions of the subject invention that can be useful in research and/or diagnosis or in any other embodiment of the invention include siRNA, antisense molecules, antibodies and probes.
  • RNA interference is a naturally occurring cellular defense in eukaryotic cells. It is an evolutionarily conserved post-transcriptional gene silencing mechanism. It is also a reverse genetic tool that can be more effective than antisense technology. Only a few molecules have been found necessary to reduce the target RNA population (Fire (2004)). Small interfering RNAs, siRNAs, have been used to exploit the natural gene silencing pathway. siRNAs are double stranded and 19-25 bps long. In the cell, siRNA form a complex with RISC protein and the siRNA then dissociates. One strand of the siRNA ("guide" strand) hybridizes to the target mRNA.
  • siRNA can be rationally designed from the sequence of the target mRNA using commercially available software (e.g., siGENOMETM). Generally, it is important for siRNA to be designed to maintain an A form (RNA-like) duplex; that the 5 position on the antisense strand be able to be phosphorylated; and that it have low thermodynamic stability in the 5 ' antisense region (Juliano et al. (2008)).
  • siRNA In designing the siRNA, specificity should also be taken into consideration in order to avoid "off-target” effects. Specificity can be enhanced with the use of commercially available products (e.g., ON-TARGETTM and siSTABLETM products).
  • siRNA can be chemically modified. . Chemical modification of the siRNA to enhance in vivo half- life must take into consideration maintenance of silencing capability and specificity to STAMP mRNA, and toxicity to the cell.
  • siRNA can be labeled (if desired) for detection purposes with radiolabels, biotin, enzymes, chemiluminscent, fluorescent labels and the like using methods known in the art. Antisense molecules can also be used in diagnostic and treatment embodiments of the subject invention.
  • Antisense molecules are designed to be complementary to STAMP mRNA. The antisense hybridizes to the mRNA and thus blocks translation of mRNA into protein. As used herein, “antisense molecules” includes and is used interchangeable with “antisense,” “antisense nucleic acids,” “antisense oligonucleotides” and “antisense polynucleotides.”
  • Antisense nucleic acids of the invention can be designed using the nucleotide sequences of the STAMP gene and constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
  • an antisense nucleic acid e.g., an antisense oligonucleotide
  • an antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.
  • modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, A- acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentenyladenine, 1-methylguanine, 1-methylinosine; 2,2-dimethylguanine; 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'- me
  • the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).
  • Antisense can be labeled (if desired) for detection purposes with radio labels, biotin, enzymes, chemiluminscent, fluorescent labels and the like using methods known in the art.
  • Probes are single-stranded DNA or RNA that hybridizes to the complementary sequence in blotting or in situ techniques. They can be as short as 14 bases long and as long as several 100 bases. They are labeled for detection purposes with radiolabels, biotin, enzymes, chemiluminescent, fluorescent, antibody labels or the like using methods known in the art. Probes can be used in Southern blots (DNA), Northern blots (RNA), dot blots, and in situ hybridization (detection of nucleic acid in clinical specimen).
  • siRNA, probes and antisense molecules of the subject invention can include variants.
  • nucleotide sequence variants of the invention will have at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the STAMP siRNA sequence(s) disclosed herein or the STAMP gene known in the art (He & Simons (2007)).
  • Variants can also include sequences that hybridize under stringent conditions.
  • hybridizes under stringent conditions describes conditions for hybridization and washing. Stringent conditions are known to those skilled in the art and can be found in
  • Aqueous and nonaqueous methods are described in that reference and either can be used.
  • a preferred, example of stringent hybridization conditions is hybridization in 6 ⁇ sodium chloride/sodium citrate (SSC, Sambrook & Russell (2001)) at about 45 0 C, followed by one or more washes in 0.2xSSC; 0.1% SDS at 50° C.
  • Another example of stringent hybridization conditions is hybridization in 6 ⁇ sodium chloride/sodium citrate (SSC) at about 45 0 C, followed by one or more washes in 0.2> ⁇ SSC, 0.1% SDS at 55° C.
  • a further example of stringent hybridization conditions is hybridization in 6 ⁇ sodium chloride/sodium citrate (SSC) at about 45 0 C, followed by one or more washes in 0.2> ⁇ SSC, 0.1% SDS at 60° C.
  • stringent hybridization conditions are hybridization in 6 ⁇ sodium chloride/sodium citrate (SSC) at about 45 0 C, followed by one or more washes in 0.2> ⁇ SSC, 0.1% SDS at 65° C.
  • Particularly preferred stringency conditions are 0.5M Sodium Phosphate, 7% SDS at 65° C, followed by one or more washes at 0.2xSSC, 1% SDS at 65° C.
  • an “isolated” STAMP nucleic acid is one that is separated from other nucleic acids present in the natural source of STAMP nucleic acid.
  • an “isolated” nucleic acid is free of sequences which naturally flank STAMP nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. This is particularly true for siRNA.
  • probes and antisense molecules there can be some flanking 5'and 3' sequences, up to about 1-5 kB.
  • the isolated material can be purified to various extents. It can be part of a composition, for example, a crude extract, containing other substances, or other mixture.
  • an isolated nucleic acid comprises at least about 50, 70, 80 or 90% (on a molar basis) of all macromolecular species present.
  • the invention also provides antibodies that selectively bind to the STAMP protein and/or its variants and fragments.
  • An antibody is considered to selectively bind, even if it also binds to other proteins that are not substantially homologous with the STAMP. These other proteins share homology with a fragment or domain of STAMP. This conservation in specific regions gives rise to antibodies that bind to both proteins by virtue of the homologous sequence. In this case, it would be understood that antibody binding to STAMP is still selective.
  • an isolated STAMP polypeptide is used as an immunogen to generate antibodies using standard techniques for polyclonal and monoclonal antibody preparation. Either the full-length protein or antigenic peptide fragment can be used.
  • An appropriate immunogenic preparation can be derived from native, recombinantly expressed, or chemically synthesized peptides.
  • the antigenic peptide can comprise a contiguous sequence of at least 12, 14, 15, or 30 amino acid residues.
  • fragments correspond to regions that are located on the surface of the protein, e.g., hydrophilic regions.
  • Antibodies can be polyclonal or monoclonal. An intact antibody, or a fragment thereof (e.g. Fab or F(ab')2) can be used.
  • Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance.
  • detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, ⁇ -galactosidase, or acetylcholinesterase;
  • suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin;
  • suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin;
  • an example of a luminescent material includes luminol;
  • bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125 I,
  • Oligonucleotides including siRNA and antisense molecules, do not diffuse across intact cell membranes to any significant degree due to the hydrophobic nature of the membrane lipid bilayer and the negatively charged siRNA and antisense molecules.
  • Antisense molecules and siRNA can be delivered into cultured cells by transfection (e.g., lipid-mediated), viral infection, electroporation or microinjection. They can also be delivered via cell target ligands (CTLs) that target specific receptors or cell penetrating peptides (CPPs).
  • CPPs are typically polyanionic polypeptides rich in arginine and lysine that are linked to their "cargo” and then bind to cell surface glycosaminoglycans; endocytotic uptake is followed by the release of cargo into the cytoplasm.
  • CTLs include a wide variety of ligands to receptors, such as antibodies, polypeptides derived from phage display libraries and small organic molecules.
  • Antisense molecules and siRNA can also be delivered by nanocarriers including liposomes, cationic polymer complexes and various polymeric nanoparticles (Juliano et al. (2008)). Antibodies can be delivered into cultured cells by transfection (lipid or viral-mediated), electroporation or microinjection.
  • Silencing of gene expression can be detected by assays for mRNA, including Northern blot analysis, branched DNA and quantitative real time PCR (qRT-PCR). It can also be detected by protein assays such as immunob lotting (i.e., Western blotting), enzyme-linked immunosorbent assay (ELISA), immunocytochemistry, immunohistochemistry, immunofluroescence and immunoprecipitation.
  • assays for mRNA including Northern blot analysis, branched DNA and quantitative real time PCR (qRT-PCR). It can also be detected by protein assays such as immunob lotting (i.e., Western blotting), enzyme-linked immunosorbent assay (ELISA), immunocytochemistry, immunohistochemistry, immunofluroescence and immunoprecipitation.
  • immunob lotting i.e., Western blotting
  • ELISA enzyme-linked immunosorbent assay
  • immunocytochemistry immunohistochemistry
  • immunofluroescence immunoprecipitation
  • the subject invention also comprises methods for detection and diagnosis of ovarian cancer in a patient comprising assaying ovarian tissue in the patient for expression of the STAMP gene and determining whether the expression level of STAMP gene corresponds to ovarian cancer.
  • the assay comprises a quantitative real time PCR (qRT-PCR) using DNA STAMP primers complementary to STAMP mRNA.
  • the assay can use RNA primers.
  • STAMP mRNA can also be quantitated using labeled probes or other methods known to those of skill in the art.
  • the assay comprises an assay for a STAMP antigenic polypeptide or protein using an antibody (polyclonal or monoclonal).
  • the antibody can be labeled for detection as described herein.
  • the observed STAMP expression level as determined by the foregoing methods can optionally be compared to STAMP normal range levels as determined by studies of STAMP levels found in cancerous and healthy or noncancerous tissue.
  • the expression level of STAMP mRNA can be correlated to a specific stage of ovarian cancer.
  • the kits of the subject invention comprise a capture reagent that captures the expression product and a detecting means that permits the detection of the complex of capture reagent and expression product.
  • the capture reagent is an antibody, if the expression product is a protein, or primers, a nucleic acid or probe, if the expression product is mRNA.
  • the detecting means can be a detectable label on the capture reagent that permits the detection of the complex using methods known in the art.
  • the capture reagents are primers for use in qRT-PCR
  • the detecting means can be amplicon dye or label (e.g., Sybr® Green or ethidium bromide). The detected amount of expression product can optionally be compared to a standard in making a diagnosis of ovarian cancer.
  • the invention encompasses kits for using antibodies to detect the presence of a STAMP protein in an in vitro or biological sample.
  • the kit can comprise antibodies such as a labeled or labelable antibody for detecting STAMP in a biological sample; means for determining the amount of Ab-STAMP complex in the sample; and optionally means for comparing the amount of STAMP in the sample with a standard.
  • the compound or agent can be packaged in a suitable container.
  • the kit can further comprise instructions for using the kit to detect STAMP.
  • the invention encompasses kits for detecting the presence of a STAMP nucleic acid in vitro or in a biological sample.
  • the kit can comprise reagents such as a labeled or labelable nucleic acid capable of detecting STAMP nucleic acid in a biological sample; means for determining the amount of labeled STAMP nucleic acid complex in the sample; and optionally means for comparing the amount of STAMP nucleic acid in the sample with a standard.
  • the STAMP nucleic acid is typically a probe which can be designed to be complementary to STAMP mRNA.
  • the probe can be packaged in a suitable container.
  • the detected or quantified STAMP mRNA can then optionally be compared to a standard to determine the diagnosis.
  • the kit can further comprise instructions for using the kit to detect STAMP mRNA.
  • kits for determining the quantity of STAMP mRNA can include any method using qRT-PCR to detect STAMP mRNA level in ovarian tissue or cells.
  • the kit can contain specific probes or primers (DNA or RNA) against specific STAMP mRNA sequences.
  • Methods for determining the quantity of labeled capture reagent vary with the nature of the label. For example, a radiolabel probe comprising 3 H can be measured by liquid scintillation counting. Fluorescently labeled proteins can be measured using UV radiation.
  • the comparison of the amount of captured expression product with a standard requires a pre-determination of a normal range for expression product.
  • the means for comparison can be visual, computer-assisted or any method known in the art.
  • kits are useful for the detection of STAMP protein, polypeptide, mRNA or other nucleic acid in tissues and cells and their extracts. While in a preferred embodiment, the kits are used for detection and diagnosis of ovarian cancer in ovarian tissue and cells, the kits can also be used for detection of STAMP expression product in other tissues and cells.
  • Treatment is defined as the application or administration of a therapeutic agent to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient, who has a disease, a symptom of disease or a predisposition toward a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease, the symptoms of disease or the predisposition toward disease.
  • Subject can refer to a mammal, e.g. a human, or to an experimental or animal or disease model. The subject can also be a non-human animal, e.g. a horse, cow, goat, or other domestic animal.
  • a therapeutic agent includes, but is not limited to, siRNA, antibodies and antisense molecules. siRNA and antisense molecules do not diffuse across intact cell membranes to any significant degree due to the hydrophobic nature of the membrane lipid bilayer and the negatively charged siRNA and antisense.
  • Antisense molecules and siRNA can be delivered in vivo using CPPs, CTLs and nanocarriers as discussed herein. Many examples of successful in vivo delivery of siRNA and antisense molecules using a variety of agents are reviewed in Juliano et al. (2008).
  • compositions suitable for administration to a subject e.g., a human.
  • Such compositions typically comprise the nucleic acid molecule and a pharmaceutically acceptable carrier.
  • compositions of the present invention are used in its broadest sense and includes any method of introducing the compositions of the present invention into a subject. This includes altering the expression of endogenous polypeptides or polynucleotides in vivo by the introduction of the compositions.
  • the language "pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the therapeutic agent, such media can be used in the compositions of the invention. Supplementary active compounds can also be incorporated into the compositions.
  • a pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration.
  • routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampules
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the therapeutic agent (e.g., a siRNA, antisense molecule or antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • the therapeutic agent e.g., a siRNA, antisense molecule or antibody
  • dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier.
  • the agent can be contained in enteric forms to survive the stomach or further coated or mixed to be released in a particular region of the GI tract by known methods.
  • the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules.
  • Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed.
  • Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
  • the compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
  • the therapeutic agents are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
  • Predesigned STAMP SMARTpool® siRNA was purchased from Dharmacon (#M-015406), Lamin A/C siRNA from Qiagen (#1027320), STAMP TaqMan® gene expression assay probe (#Hs00367300_ml) and human GAPDH control probe (#4310884E) from ABI, and siLentFectTM siRNA transfection reagent from Bio-Rad #170-3361.
  • GR plasmid pSVLGR
  • Mouse monoclonal anti- TIF2 antibody is from Bethyl Labs (#A300-345A).
  • Rabbit polyclonal anti- ⁇ -tubulin antibody (used at 15 ng/ml) was from Abeam (#ab4074).
  • the following primers were used for qRT-PCR of both human and rat GR (numbers in parentheses are positions in human GR cDNA): GTCTTCAGGCTGGAATGAACC (1443-1462), SEQ ID NO:9, and CTTTGCCCATTTCACTGCTGC (1737-1717), SEQ ID NO: 10.
  • HEK293 cells were always grown in high glucose DMEM (Invitrogen) with 10% fetal bovine serum, sodium pyruvate (Cellgro), and MEM nonessential amino acids (Cellgro) to 70% confluency in 100 mm dishes. Cells were transfected with 10 ⁇ g of FLAG-
  • Cells grown with 0.1 mg/ml G418) were washed 3 times with PBS without calcium or magnesium (Invitrogen), counted with a Beckman Coulter Vi-CellTM XR2.02, and seeded at 50,000 viable cells/well in 6 well dishes in 3 ml of medium without G418. After 24 hours, the cells were washed once with PBS, trypsinized, resuspended in 500 ⁇ l of medium, and placed on ice.
  • Tissue Scan panels (8 common cancers (#CSRT101), kidney cancer (#HKRT101), ovarian cancer (#HORT101 and HORT 102), and breast cancer (#BCRT101)) and the accompanying pathology and tumor staging reports are available from OriGene (Rockville, MD). Each panel contains pre -normalized cDNA arrays prepared from pathologist-verified tumor tissues. Each well of the panel has same amount total cDNA. Thus, any target gene (e.g. STAMP) variation in different wells reflects real changes between tumor samples. Quantitative real-time PCR (qRT-PCR) was run once for each panel (plate) using validated STAMP primers according to manufacturer's instructions.
  • qRT-PCR Quantitative real-time PCR
  • siRNA was mixed with 0.05 ⁇ l siLentFect in a total of 20 ⁇ l of Opti-mem medium for 20 min before being added to each well. One day later, fresh medium was added to each well in both protocols.
  • RNA isolation, reverse transcription, real-time PCR, and luciferase assays of transiently transfected GREtkLUC were performed as previously described (He & Simons (2007)).
  • VA (1 x 10 4 ) or S 13 (2 x 10 4 ) cells in 300 ⁇ l of media were transfected for 24 hr using 0.8 ⁇ l/well of Fugene 6 and either 0, 10 or 30 ng pSVLGR plus 100 ng GREtkLuc and 10 ng Renilla TS.
  • Total transfected DNA was maintained at 300 ng/well with PBSK+.
  • the cells were then induced with steroids in fresh media for 24 hr, separated from the media, and lysed for 20 min with 300 ⁇ l of passive lysis buffer (Promega) at room temperature on a rotating shaker. Lysate (50 ⁇ l) was then loaded into 96 well luminometer plates and read in a Berthold luminometer.
  • passive lysis buffer Promega
  • Fig. 1 illustrates the effect of stably transfected STAMP on the growth rate of 293 cells.
  • Fig. 1(A) illustrates how increased STAMP decreases cell growth.
  • the number of cells in replicate plates of clone S13 (S) and VA (V) cells (no steroid, cells removed from G418 1 day prior) after increasing days was assessed by the CellTiter Aqueous One Solution assay. The average value ( ⁇ S. E. M.) of four independent experiments is shown. **P ⁇ 0.005, ***P ⁇ 0.0005.
  • STAMP mRNA in clone S13 was 32-fold higher than in VA cells but decreased by a factor of two to 14-fold after withdrawal from G418 for at least 3 months. As expected, these reduced levels of excess STAMP were reflected in a smaller reduction of cell growth, with or without glucocorticoid (Fig. ID).
  • Table 1 provides STAMP mRNA levels in a panel of 8 common human cancers. The characterization of each sample in a commercially available panel of 8 common human cancers (Origene) is listed. Also given are the Ct values from the qRT-PCR assays and the calculation of the abundance of STAMP mRNA in each sample, relative to the first sample (Al), which was arbitrarily chosen.
  • Fig. 2 illustrates levels of STAMP mRNA in different human tumor samples.
  • Fig. 2(A) provides a survey of eight human tumor types. Levels of STAMP mRNA in individual samples of OriGene TissueScan® panel (each bar corresponds to a single tissue sample) were determined as described in Materials and Methods and plotted (relative to the STAMP mRNA level of the first sample in the Breast panel) vs. tumor stage. As shown in Fig. 2(A), this preliminary screen suggested that STAMP levels in kidney cancers gradually decrease as the tumor stage progresses while STAMP levels might be elevated in Stage I of ovarian cancers and several stages of breast cancer. These pilot study observations were pursued by analyzing larger panels containing 48 samples from various stages of these three cancers.
  • FIG. 2(B) provides STAMP mRNA in human ovarian cancers.
  • Levels of STAMP mRNA in two different large scale OriGene TissueScan panels of only ovarian cancers was determined as in Fig. 2(A) (see also Table 2).
  • Table 2 also provides the Ct values from the qRT-PCR assays, the average Ct value (and S.D.) of all samples in each Stage, and the p value of the average STAMP Ct value of each Stage vs. the Stage 0 value.
  • Table 3 sets forth STAMP mRNA levels in the indicated cells as determined by qRT- PCR as described in Materials and Methods and then normalized to that seen in HeyA8 cells (which was arbitrarily selected as reference). Values are the averages ⁇ S. E. M. of 3 experiments (one experiment for 293 cells).
  • Example 4 Role of STAMP in Proliferation of Ovarian Cancer Cells Because elevated STAMP decreases the growth rate of 293 cells (Fig. 1), we asked if lowering the levels of endogenous STAMP with transfected STAMP siRNA would increase the growth rate of the ovarian cancer cells.
  • Table 4 provides relative STAMP mRNA levels in ovarian cancer tissue cells following siRNA treatment.
  • STAMP mRNA levels in the indicated cells with transfected siRNA were determined by qRT-PCR as described in Materials and Methods and then normalized to that seen in HeyA8 cells (which was arbitrarily selected as reference) after transient transfection with Lamin siRNA.
  • the data show both the percent remaining STAMP mRNA after siRNA treatment (i.e., 100 x STAMP siRNA/Lamin siRNA) and the "absolute" levels relative to STAMP in HeyA8 cells treated with Lamin siRNA.
  • Fig. 3 illustrates the effect of STAMP siRNA on growth of ovarian cancer tissue culture cells.
  • Fig. 3(A) provides the growth of ovarian tissue culture cells treated with STAMP siRNA relative to Lamin siRNA.
  • Fig. 1 The growth of cells 4 days after being transfected with STAMP siRNA or Lamin siRNA was determined as in Fig. 1.
  • Fig. 3(B) provides the growth rate vs. STAMP mRNA levels.
  • the levels of proteins and kinases known to be associated with cancer proliferation and/or apoptosis were examined in the background of STAMP or Lamin silencing to determine if they paralleled the growth rates of the ovarian cancer cells with reduced amounts of STAMP mRNA. No relationship was observed between the expression level of these proteins/kinases on Western blots and the growth rates of A1847, A2780, HeyA8, IGROVl, OVCARlO, PEO-I, and 2008 cells (data not shown). We conclude that changing the intracellular concentration or activation status of any of these proteins does not mediate the effects of STAMP levels on the growth rates of the ovarian tissue culture cells.
  • Example 5 Overexpressed STAMP In Stably Transfected 293 Cells Alters Properties of GR-Mediated Transactivation of a Cell-Specific Manner
  • Fig. 4 illustrates the effect of elevated STAMP on the properties of GR induction of GREtkLUC reporter gene in 293 cells.
  • Fig. 4(A) provides the dose-response curves for GR induction of GREtkLUC reporter with varying amounts of transiently transfected GR plasmid.
  • S 13 containing stably transfected STAMP
  • VA vector control
  • FIG. 4(B) illustrates modulation of A max , partial agonist activity of the antiglucocorticoid Dex-Mes (%DM), and EC50 by elevated STAMP.
  • %DM partial agonist activity of the antiglucocorticoid Dex-Mes
  • EC50 partial agonist activity of 1 ⁇ M Dex-Mes
  • FIG. 4(C) provides GR mRNA levels in VA and S 13 cells.
  • the qRT-PCR was used as described in Materials and Methods to determine the level of GR mRNA in VA and S13 cells with or without 30 ng of transiently transfected GR plasmid ( ⁇ S.E.M. of triplicates).
  • Fig. 4(D) provides Western blot with TIF2 antibody of cell lysates from cells transfected with no, or 30 ng of GR plasmid.
  • the lower panel shows the equal levels of the loading control, ⁇ -tubulin, in each sample.
  • a variety of factors could be responsible for the effects of STAMP in Figs. (4)A & (B) being opposite from expected (Simons (2008)).
  • Histone acetyltransferase activity of p300 is required for transcriptional repression by the promyelocytic leukemia zinc finger protein. MoI Cell Biol 2005, 25:5552- 5566.
  • Hewitt SC et al.: Lessons in estrogen biology from knockout and transgenic animals. Annu Rev Physiol 2005, 67:285-308. Ismail PM, et al.: Progesterone involvement in breast development and tumorigenesis— as revealed by progesterone receptor "knockout” and “knockin” mouse models. Steroids 2003, 68:779-787.
  • Tao Y-G, et al. Mutations of glucocorticoid receptor differentially affect AF2 domain activity in a steroid-selective manner to alter the potency and efficacy of gene induction and repression. Biochemistry 2008, 47:7648-7662.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Food Science & Technology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The subject invention comprises methods for diagnosing ovarian cancer using a STAMP expression product biomarker, kits for diagnosing ovarian cancer using assays for the STAMP expression producing biomarker, compositions comprising STAMP siRNA, methods for inhibiting growth of ovarian cells expressing STAMP expression product, and methods for treating patients diagnosed with ovarian cancer. The invention is premised on the unexpected discovery that STAMP affects the physiologically relevant activity of ovarian cancer cell growth apparently independent of several steroid hormones.

Description

USE OF STAMP RELATED MOLECULES IN THE DIAGNOSIS AND INHIBITION OF OVARIAN CANCER CELLS
FEDERALLY FUNDED RESEARCH The subject invention included research supported by the Intramural Research Program of the National Institutes of Health (NIH), National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK), and the Center for Cancer Research, National Cancer Institute (NCI), NIH.
FIELD OF THE INVENTION
The subject invention relates to compositions, methods and kits for the research, diagnosis and treatment of ovarian cancer.
BACKGROUND OF THE INVENTION Cell proliferation is a complicated and poorly understood process with contributions from many factors. Consequently identifying the causes for abnormal cell propagation, such as in cancers, has been an even more daunting task. Recent evidence suggests that mutant pathways (produced by a variety of mutant or dysregulated proteins) as opposed to a single mutant or dysregulated protein are responsible for at least some cancers (Jones, S. et al. (2008)). One pathway that is well known for its role with normal cell growth and differentiation involves the classical steroid receptors. Androgen (ARs), estrogen (ERs), and progesterone receptors (PRs) are best recognized for their contribution in the morphogenesis of reproductive tissues (Wang et al. (2009); Hewitt et al. (2005); Ismail et al. (2003). Conversely, preventing the actions of ARs and ERs has been the major treatment of choice for many years in combating hormone-sensitive prostate and breast cancers respectively (Gradishar & Jordan (1997); Akaza (2008)).
Glucocorticoids are clinically invaluable in treating lymphoid cancers and attenuating immune responses (Cole (2006)) while mineralocorticoid agonists are now thought to have significant effects on the heart and vasculature (Funder (2005); Schiffrin (2006)). A major component in the expression of steroid receptor-regulated gene expression is coactivators and corepressors, which typically elevate or inhibit the action of receptor-agonist complexes (McKenna & O'Malley (2002); Nagy & Schwabe (2004)). STAMP is a novel coregulator that enhances the ability of pi 60 coactivator family members TIF2 and SRC-I to augment gene induction by AR, glucocorticoid receptor (GR), and PR. STAMP also modulates the potency (or EC50) of agonists and the partial agonist activity of antisteroids (He & Simons (2007); Szapary et al. (2008)). These modulatory activities of STAMP are not limited to gene induction but are also observed for GR-mediated gene repression (Sun et al. (2008)). These actions appear to proceed via the binding of internal and C-terminal regions of STAMP to coactivators and receptors respectively in a manner that includes steroid- mediated recruitment of STAMP to the enhancer region of regulated genes. Interestingly, STAMP does not interact with ER or members of the nuclear receptor sub-family such as thyroid receptor, PPAR, RAR, or RXR (He & Simons (2007)).
The physiological role of STAMP, however, remains unclear. The absence of STAMP paralogs in the human genome suggests an important function. STAMP has been included as a member of the tyrosine tubulin ligase-like (TTLL) family (Janke et al. (2005)) on the basis of containing a tyrosine tubulin ligase (TTL) domain. However, this grouping is not applicable to several of the biological function assays of STAMP in that the coregulatory activity of STAMP with GRs does not require the TTL domain (He & Simons (2007)). Differential detection in Northern blots (He & Simons (2007)) and qPCR analysis of mouse tissues (G-S Lee and SS Simons, unpublished) is consistent with a role for STAMP in brain, ovaries, and testes. In addition, the importance of steroid receptors in normal and aberrant cell growth combined with STAMP binding to, and modulating the activity of, AR, GR, and PR suggests a possible role for STAMP in regulating the growth of some cells and cancers.
Ovarian cancer is the fifth most common cancer in the United States and is responsible for 4% of new cancer cases, and 5% of the cancer deaths, occurring in women each year (Greenlee et al. (2001); Jemal et al. (2007)). The major cause of death is from epithelial ovarian tumors, which constitute the large majority of ovarian cancers (Leung et al. (2001)). Ovarian cancer in general has a 5 -year survival rate of over 90% if diagnosed and treated early, when the cancer is confined to the ovaries. Unfortunately, due to ovarian cancer's non-specific symptoms and the lack of reliable early detection methods, only about 20% of all cases are found at this beginning stage. If caught in an advanced stage, the 5-year survival rate can be as low as 29% (Jemal et al. (2002); Cvetkovic (2003)). The inability to identify and treat this cancer early underscores the necessity for better understanding its biology and unique gene and protein expression panels. Unfortunately, the heterogeneity of epithelial ovarian cancers complicates this task. It has recently been suggested that ovarian cancer, like breast cancer, may be subdivided by differences in gene expression panels (Kobel et al. (2008); Malek et al, in press)). Therefore, it is likely that the mechanism(s) of ovarian cancer growth and metastasis will involve multiple biochemical pathways, as has been concluded for pancreatic and breast cancers (Jones et al. (2008); Easton et al. (2007)).
There is a long-felt need for a reliable diagnostic test for ovarian cancer. Further, advances in treatment are urgently needed in order to improve the 5 -year survival rate, particularly for those patients who are not diagnosed until an advanced stage. The subject invention addresses these needs.
SUMMARY OF THE INVENTION
The subject invention comprises methods of diagnosing ovarian cancer in a patient, kits for diagnosing ovarian cancer, compositions comprising STAMP siRNA or variants thereof, methods of reducing ovarian cancer cell growth in ovarian cancer cells in vitro, and methods of reducing cancer cell growth in a patient diagnosed with ovarian cancer.
In one embodiment, the invention encompasses a method of diagnosing ovarian cancer in a patient comprising assaying ovarian tissue in said patient for expression of the STAMP gene; and determining whether the expression level of STAMP gene in the ovarian tissue corresponds to ovarian cancer. When determining whether the determined STAMP expression level corresponds to ovarian cancer, the skilled artisan can compare the determined expression level to a normal range standard for STAMP expression.
The diagnosis method expression assay can be an assay for STAMP mRNA. In one embodiment, the expression level of STAMP mRNA can be correlated to a specific stage of ovarian cancer. In the alternative, the diagnosis method expression assay is an assay for STAMP polypeptide or protein.
The subject invention also comprises a kit for diagnosing ovarian cancer. The kit comprises one or more capture reagents for capturing STAMP expression product, and means for detecting the binding of capture reagent to STAMP expression product. In one embodiment, the STAMP expression product is STAMP mRNA, and the capture reagent is a nucleic acid such as a probe. In this case, the means for detection is an appropriate label on the probe such as a radiolabel, fluorescent label or the like. In another embodiment, the capture reagents are primers (DNA or RNA) for qRT-PCR detection of the STAMP amplicon. In yet another embodiment, the STAMP expression product is a STAMP polypeptide, and the capture reagent is an antibody. Here, the means for detection is a suitable label on the antibody such as a fluorescent tag or the like.
The invention also comprises a composition comprising a STAMP specific siRNA molecule or a variant thereof. The siRNA is selected from the group consisting of SEQ ID NOS: 1-8 provided below, or variants thereof. In the following sequences, the top strand is the sense strand, and the bottom is the antisense strand. (Note that "P" indicates a 5' phosphate on the adj acent nucleotide . )
Duplex 1
5' GGUCCUACCUCGAGCAUAAUU (SEQ ID NO.:1) UUCCAGGAUGGAGCUCGUAUUP 5' (SEQ ID NO . : 2 )
Duplex 2 5 ' GUUCGUGAAUGGAAUAAUAUU (SEQ ID NO.: 3) UUCAAGCACUUACCUUAUUAUP 5' (SEQ ID NO.: 4)
Duplex 3 5' CGACGGAGUAGCAGAUUGAUU (SEQ ID NO.: 5) UUGCUGCCUCAUCGUCUAACUP 5' (SEQ ID NO.: 6)
Duplex 4 5' GGAUCGUGCUAUCUAAACAUU (SEQ ID NO.: 7) UUCCUAGCACGAUAGAUUUGUP 5' (SEQ ID NO.: 8).
In another embodiment, the invention comprises a method of reducing ovarian cancer cell growth in vitro in ovarian cancer cells responsive thereto, comprising contacting said ovarian cancer cells with an agent that reduces STAMP gene expression. The agent can be STAMP siRNA or a variant thereof, STAMP antisense molecules (DNA or RNA) or a variant thereof, or a STAMP antibody. The invention further comprises a method of reducing cancer cell growth in a patient diagnosed with ovarian cancer comprising administering to the patient a therapeutically effective amount of a therapeutic agent that reduces STAMP gene expression, whereby ovarian cancer cell growth is substantially inhibited. The therapeutic agent can comprise STAMP siRNA, STAMP antisense molecules, and/or STAMP antibodies.
All references cited herein are incorporated in their entirety by reference.
BRIEF DESCRIPTION OF THE FIGURES
Fig. 1 illustrates the effect of stably transfected STAMP on the growth rate of HEK 293 cells. Fig. l(A) demonstrates that increased STAMP decreases cell growth; transfected cells S 13 have a lower cell titre than empty vector VA cells. Figs. l(B) and (C) provide the FACS analysis of VA and S 13 cells with no steroid and G418 removed upon seeding, as described in the Examples. Fig. l(D) sets forth the growth of VA and S 13 cells after removal of G418 for more than one month as described in the Examples. Fig. l(E) illustrates increased STAMP results in decreased cell growth with or without steroid, as described in the Examples.
Fig. 2 illustrates the levels of STAMP mRNA in different human tumor samples. Fig. 2(A) provides levels of STAMP mRNA in eight human tumor types. Fig. 2(B) provides STAMP mRNA in human ovarian cancers as described in the Examples.
Fig. 3 illustrates the effect of STAMP siRNA on growth of human ovarian cancer tissue culture cells. Fig. 3(A) provides the growth of ovarian tissue culture cells treated with STAMP siRNA relative to Lamin siRNA as described in the Examples. Fig. 3(B) provides the growth rate vs. STAMP mRNA levels of each of the cell lines in Fig. 3(A).
Fig. 4 illustrates the effect of elevated STAMP on the properties of GR induction of GREtkLUC reporter gene IN 293 CELLS Fig. 4(A) provides the dose-response curves for GR induction of GREtkLUC reporter with varying amounts of transiently transfected GR plasmid, as described in the Examples. Fig. 4(B) illustrates modulation of Amax, partial agonist activity of the antiglucocorticoid Dex-Mes (% DM), and EC50 by elevated STAMP as described in the Examples. Fig. 4(C) provides GR mRNA levels in VA and S 13 cells with or without 30 ng of transiently transfected GR plasmid, as described in the Examples. Fig. 4(D) provides Western blot with TIF2 antibody of cell Iy sates from cells transfected with no or 30 ng of GR plasmid as described in the Examples. DETAILED DESCRIPTION
I. Discussion of the Results Set Forth in the Examples In the subject invention, it has surprisingly been found that STAMP affects the physiologically relevant activity of cell growth apparently independent of several steroid hormones. STAMP was initially characterized as a new factor that bound to, and augmented the ability of, the coactivator TIF2 to modulate the transcriptional properties GR, AR, and PR (He et al. (2007); Szapary et al. (2008); Sun et al. (2008)). The steroid-independent effects of STAMP on the growth of a variety of cells represent a new activity that differs with the cell line, even within the same cell type. As is exemplified herein, increased levels of stably transfected STAMP inhibit the growth rate of human embryonic kidney 293 cells while all possible growth responses with changing STAMP are seen in an assortment of ovarian cancer cell lines. It has also been found that a significant correlation exists between the level of STAMP mRNA and the presence of ovarian cancer. Stage I-III tumor samples possess significantly higher levels of STAMP mRNA.
STAMP was increased in expression in malignant epithelial ovarian cancer compared to normal ovary of unknown epithelial component and the epithelial tumor of low malignant potential. In view of the known heterogeneity of ovarian cancers (Kobel (2008); Malek, in press)), the varied responses to silencing of STAMP in the ovarian cancer cell lines suggest that there may be a select subset of ovarian cancers in which STAMP may regulate behavior. Epithelial ovarian cancer, while initiating in a steroid hormone sensitive organ and known to have functional ER and PR, has not been shown to be steroid hormone driven as in prostate and breast cancer. The lack of response to steroid hormones found in the subject Examples may be an early signal as to a new role for STAMP that may ultimately explain the altered growth with modulation of STAMP in ovarian cancers.
As exemplified herein, eleven tissue culture cell lines of human ovarian cancer revealed a cell line-dependent effect of reduced STAMP mRNA, with increased or decreased growth rates seen in many lines and no changes in others. Identical cell-specific responses are seen in Fig. 4 regarding another activity of STAMP: its ability to modulate various parameters of GR- regulated gene induction. Thus, the effects of STAMP appear to be sensitive to unknown cell- specific factors. These varying consequences of STAMP are reminiscent of CBP and p300, which can display gene repressive activity (Szapary et al. (1999); Fonte et al. (2005); Guidez et al. (2005); Santoso et al. (2006)) in addition to its more common coactivator properties (McKenna & O'Malley (2002); Rosenfeld et al. (2006)). For STAMP, the different responses are unrelated to the absolute gene expression level of STAMP after knockdown with STAMP siRNA (Fig. 3B). There is also no direct correlation between the growth rate of the cells and the amounts of seven common growth factors and kinases. GEO file searches uncovered several proteins, the expression of which shows some correlation with STAMP on various platforms, but no consistent connection of any protein was evident across the different platforms (data not shown). Thus we have not yet identified the molecular cause for STAMP'S effects on cell growth. Nevertheless, given the heterogeneity of ovarian cancers, the statistically significant effect of decreased STAMP mRNA on the growth rates of 5 of 11 ovarian cancer tissue culture cell lines represents a medically important and useful advance in inhibition and treatment of ovarian cancer cells. The steroid-independent effect of STAMP on the growth of stably transfected 293 cells appears to reflect a new activity in addition to its ability to alter the properties of gene induction by GR, PR, and AR (He et al. (2007); Szapary et al. (2008)). The only other characterized domain of STAMP is the tyrosine tubulin ligase-like domain in the amino -terminal third of the molecule, which overlaps the region encoding polyglutamylation activity in some TTL domain proteins including STAMP (Janke et al. (2005)). We have confirmed that STAMP is able to polyglutamylate tubulin and a few other unidentified proteins (He and Simons, data not shown). While the TTL domain, and polyglutamylation activity, of STAMP are not required for its modulation of GR induction properties (He et al. (2007)), they could be relevant for effects on cell growth. It is also possible that steroids will be found to influence the growth properties of the ovarian cancer tissue culture cell lines as their response to different levels of STAMP is often different from that of the 293 cells, where growth is unaffected by steroids. Thus, understanding the role of STAMP in ovarian cancer can lead to new insight to the deadly disease. II. Methods, Compositions and Kits for Research and Diagnosis of Ovarian Cancer.
Compositions for Research and Diagnosis
Compositions of the subject invention that can be useful in research and/or diagnosis or in any other embodiment of the invention include siRNA, antisense molecules, antibodies and probes.
RNA interference, RNAi, is a naturally occurring cellular defense in eukaryotic cells. It is an evolutionarily conserved post-transcriptional gene silencing mechanism. It is also a reverse genetic tool that can be more effective than antisense technology. Only a few molecules have been found necessary to reduce the target RNA population (Fire (2004)). Small interfering RNAs, siRNAs, have been used to exploit the natural gene silencing pathway. siRNAs are double stranded and 19-25 bps long. In the cell, siRNA form a complex with RISC protein and the siRNA then dissociates. One strand of the siRNA ("guide" strand) hybridizes to the target mRNA. Then the RISC complex cleaves the mRNA (Juliano et al (2008)). The complex is capable of repeating this process multiple times, enhancing the potency of the siRNA The silencing effect can be relatively stable and persist through several cell divisions (Tuschl et al. (2004)). siRNA can be rationally designed from the sequence of the target mRNA using commercially available software (e.g., siGENOME™). Generally, it is important for siRNA to be designed to maintain an A form (RNA-like) duplex; that the 5 position on the antisense strand be able to be phosphorylated; and that it have low thermodynamic stability in the 5 ' antisense region (Juliano et al. (2008)). In designing the siRNA, specificity should also be taken into consideration in order to avoid "off-target" effects. Specificity can be enhanced with the use of commercially available products (e.g., ON-TARGET™ and siSTABLE™ products). To enhance siRNA stability and half-life in vitro or in vivo, siRNA can be chemically modified. . Chemical modification of the siRNA to enhance in vivo half- life must take into consideration maintenance of silencing capability and specificity to STAMP mRNA, and toxicity to the cell. siRNA can be labeled (if desired) for detection purposes with radiolabels, biotin, enzymes, chemiluminscent, fluorescent labels and the like using methods known in the art. Antisense molecules can also be used in diagnostic and treatment embodiments of the subject invention. Antisense molecules are designed to be complementary to STAMP mRNA. The antisense hybridizes to the mRNA and thus blocks translation of mRNA into protein. As used herein, "antisense molecules" includes and is used interchangeable with "antisense," "antisense nucleic acids," "antisense oligonucleotides" and "antisense polynucleotides."
Antisense nucleic acids of the invention can be designed using the nucleotide sequences of the STAMP gene and constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, A- acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentenyladenine, 1-methylguanine, 1-methylinosine; 2,2-dimethylguanine; 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'- methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine, uracil-5- oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6- diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).
Antisense can be labeled (if desired) for detection purposes with radio labels, biotin, enzymes, chemiluminscent, fluorescent labels and the like using methods known in the art.
Probes are single-stranded DNA or RNA that hybridizes to the complementary sequence in blotting or in situ techniques. They can be as short as 14 bases long and as long as several 100 bases. They are labeled for detection purposes with radiolabels, biotin, enzymes, chemiluminescent, fluorescent, antibody labels or the like using methods known in the art. Probes can be used in Southern blots (DNA), Northern blots (RNA), dot blots, and in situ hybridization (detection of nucleic acid in clinical specimen).
The siRNA, probes and antisense molecules of the subject invention can include variants. Generally, nucleotide sequence variants of the invention will have at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the STAMP siRNA sequence(s) disclosed herein or the STAMP gene known in the art (He & Simons (2007)).
Variants can also include sequences that hybridize under stringent conditions. As used herein, the term "hybridizes under stringent conditions" describes conditions for hybridization and washing. Stringent conditions are known to those skilled in the art and can be found in
Current Protocols in Molecular Biology John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. Aqueous and nonaqueous methods are described in that reference and either can be used. A preferred, example of stringent hybridization conditions is hybridization in 6χ sodium chloride/sodium citrate (SSC, Sambrook & Russell (2001)) at about 450C, followed by one or more washes in 0.2xSSC; 0.1% SDS at 50° C. Another example of stringent hybridization conditions is hybridization in 6χ sodium chloride/sodium citrate (SSC) at about 450C, followed by one or more washes in 0.2><SSC, 0.1% SDS at 55° C. A further example of stringent hybridization conditions is hybridization in 6χ sodium chloride/sodium citrate (SSC) at about 450C, followed by one or more washes in 0.2><SSC, 0.1% SDS at 60° C. Preferably, stringent hybridization conditions are hybridization in 6χ sodium chloride/sodium citrate (SSC) at about 450C, followed by one or more washes in 0.2><SSC, 0.1% SDS at 65° C. Particularly preferred stringency conditions (and the conditions that should be used if the practitioner is uncertain about what conditions should be applied to determine if a molecule is within a hybridization limitation of the invention) are 0.5M Sodium Phosphate, 7% SDS at 65° C, followed by one or more washes at 0.2xSSC, 1% SDS at 65° C.
An "isolated" STAMP nucleic acid is one that is separated from other nucleic acids present in the natural source of STAMP nucleic acid. Preferably, an "isolated" nucleic acid is free of sequences which naturally flank STAMP nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. This is particularly true for siRNA. For probes and antisense molecules, there can be some flanking 5'and 3' sequences, up to about 1-5 kB. The isolated material can be purified to various extents. It can be part of a composition, for example, a crude extract, containing other substances, or other mixture. Or, the isolated material may be purified to essential homogeneity, for example as determined by PAGE or column chromatography such as HPLC. Preferably, an isolated nucleic acid comprises at least about 50, 70, 80 or 90% (on a molar basis) of all macromolecular species present.
The invention also provides antibodies that selectively bind to the STAMP protein and/or its variants and fragments. An antibody is considered to selectively bind, even if it also binds to other proteins that are not substantially homologous with the STAMP. These other proteins share homology with a fragment or domain of STAMP. This conservation in specific regions gives rise to antibodies that bind to both proteins by virtue of the homologous sequence. In this case, it would be understood that antibody binding to STAMP is still selective. To generate antibodies, an isolated STAMP polypeptide is used as an immunogen to generate antibodies using standard techniques for polyclonal and monoclonal antibody preparation. Either the full-length protein or antigenic peptide fragment can be used. An appropriate immunogenic preparation can be derived from native, recombinantly expressed, or chemically synthesized peptides.
The antigenic peptide can comprise a contiguous sequence of at least 12, 14, 15, or 30 amino acid residues. In one embodiment, fragments correspond to regions that are located on the surface of the protein, e.g., hydrophilic regions. Antibodies can be polyclonal or monoclonal. An intact antibody, or a fragment thereof (e.g. Fab or F(ab')2) can be used.
Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125I, 1311, 35S or 3H. Completely human antibodies are particularly desirable for therapeutic treatment of human patients. For an overview of this technology for producing human antibodies, see Lonberg & Huszar (1995). For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, e.g., Lonberg & Kay, U.S. Pat. Nos. 5,625,126; 5,633,425; 5,569,825; 5,661,016; and 5,545,806.
Methods for In Vitro Delivery into Cells and Inhibition of Expression
Oligonucleotides, including siRNA and antisense molecules, do not diffuse across intact cell membranes to any significant degree due to the hydrophobic nature of the membrane lipid bilayer and the negatively charged siRNA and antisense molecules.
Antisense molecules and siRNA can be delivered into cultured cells by transfection (e.g., lipid-mediated), viral infection, electroporation or microinjection. They can also be delivered via cell target ligands (CTLs) that target specific receptors or cell penetrating peptides (CPPs). CPPs are typically polyanionic polypeptides rich in arginine and lysine that are linked to their "cargo" and then bind to cell surface glycosaminoglycans; endocytotic uptake is followed by the release of cargo into the cytoplasm. CTLs include a wide variety of ligands to receptors, such as antibodies, polypeptides derived from phage display libraries and small organic molecules. Antisense molecules and siRNA can also be delivered by nanocarriers including liposomes, cationic polymer complexes and various polymeric nanoparticles (Juliano et al. (2008)). Antibodies can be delivered into cultured cells by transfection (lipid or viral-mediated), electroporation or microinjection.
Silencing of gene expression can be detected by assays for mRNA, including Northern blot analysis, branched DNA and quantitative real time PCR (qRT-PCR). It can also be detected by protein assays such as immunob lotting (i.e., Western blotting), enzyme-linked immunosorbent assay (ELISA), immunocytochemistry, immunohistochemistry, immunofluroescence and immunoprecipitation.
Methods and Kits for Detection of Overexpression of STAMP in Ovarian Cells
The subject invention also comprises methods for detection and diagnosis of ovarian cancer in a patient comprising assaying ovarian tissue in the patient for expression of the STAMP gene and determining whether the expression level of STAMP gene corresponds to ovarian cancer.
In one embodiment, the assay comprises a quantitative real time PCR (qRT-PCR) using DNA STAMP primers complementary to STAMP mRNA. In other embodiments, the assay can use RNA primers. STAMP mRNA can also be quantitated using labeled probes or other methods known to those of skill in the art.
In another embodiment, the assay comprises an assay for a STAMP antigenic polypeptide or protein using an antibody (polyclonal or monoclonal). The antibody can be labeled for detection as described herein. To make a diagnosis of ovarian cancer, the observed STAMP expression level as determined by the foregoing methods can optionally be compared to STAMP normal range levels as determined by studies of STAMP levels found in cancerous and healthy or noncancerous tissue. In some cases, the expression level of STAMP mRNA can be correlated to a specific stage of ovarian cancer. The kits of the subject invention comprise a capture reagent that captures the expression product and a detecting means that permits the detection of the complex of capture reagent and expression product.
Typically, the capture reagent is an antibody, if the expression product is a protein, or primers, a nucleic acid or probe, if the expression product is mRNA. Where the capture reagent is an antibody or a probe, the detecting means can be a detectable label on the capture reagent that permits the detection of the complex using methods known in the art. Where the capture reagents are primers for use in qRT-PCR, the detecting means can be amplicon dye or label (e.g., Sybr® Green or ethidium bromide). The detected amount of expression product can optionally be compared to a standard in making a diagnosis of ovarian cancer. In one embodiment, the invention encompasses kits for using antibodies to detect the presence of a STAMP protein in an in vitro or biological sample. The kit can comprise antibodies such as a labeled or labelable antibody for detecting STAMP in a biological sample; means for determining the amount of Ab-STAMP complex in the sample; and optionally means for comparing the amount of STAMP in the sample with a standard. The compound or agent can be packaged in a suitable container. The kit can further comprise instructions for using the kit to detect STAMP. In another embodiment, the invention encompasses kits for detecting the presence of a STAMP nucleic acid in vitro or in a biological sample. For example, the kit can comprise reagents such as a labeled or labelable nucleic acid capable of detecting STAMP nucleic acid in a biological sample; means for determining the amount of labeled STAMP nucleic acid complex in the sample; and optionally means for comparing the amount of STAMP nucleic acid in the sample with a standard. The STAMP nucleic acid is typically a probe which can be designed to be complementary to STAMP mRNA. The probe can be packaged in a suitable container. The detected or quantified STAMP mRNA can then optionally be compared to a standard to determine the diagnosis. The kit can further comprise instructions for using the kit to detect STAMP mRNA.
In addition, real time PCR (qRT-PCR) now is a standard method to detect mRNA level. Therefore, kits for determining the quantity of STAMP mRNA can include any method using qRT-PCR to detect STAMP mRNA level in ovarian tissue or cells. The kit can contain specific probes or primers (DNA or RNA) against specific STAMP mRNA sequences. Methods for determining the quantity of labeled capture reagent vary with the nature of the label. For example, a radiolabel probe comprising 3H can be measured by liquid scintillation counting. Fluorescently labeled proteins can be measured using UV radiation.
The comparison of the amount of captured expression product with a standard requires a pre-determination of a normal range for expression product. The means for comparison can be visual, computer-assisted or any method known in the art.
The kits are useful for the detection of STAMP protein, polypeptide, mRNA or other nucleic acid in tissues and cells and their extracts. While in a preferred embodiment, the kits are used for detection and diagnosis of ovarian cancer in ovarian tissue and cells, the kits can also be used for detection of STAMP expression product in other tissues and cells.
III. Methods for Reducing Ovarian Cancer Cell Growth in a Patient
Treatment is defined as the application or administration of a therapeutic agent to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient, who has a disease, a symptom of disease or a predisposition toward a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease, the symptoms of disease or the predisposition toward disease. "Subject," as used herein, can refer to a mammal, e.g. a human, or to an experimental or animal or disease model. The subject can also be a non-human animal, e.g. a horse, cow, goat, or other domestic animal. A therapeutic agent includes, but is not limited to, siRNA, antibodies and antisense molecules. siRNA and antisense molecules do not diffuse across intact cell membranes to any significant degree due to the hydrophobic nature of the membrane lipid bilayer and the negatively charged siRNA and antisense.
Antisense molecules and siRNA can be delivered in vivo using CPPs, CTLs and nanocarriers as discussed herein. Many examples of successful in vivo delivery of siRNA and antisense molecules using a variety of agents are reviewed in Juliano et al. (2008).
Pharmaceutical Compositions
The therapeutic agents of the subject invention, i.e., siRNA and antisense molecules, can be formulated into pharmaceutical compositions suitable for administration to a subject, e.g., a human. Such compositions typically comprise the nucleic acid molecule and a pharmaceutically acceptable carrier.
The term "administer" is used in its broadest sense and includes any method of introducing the compositions of the present invention into a subject. This includes altering the expression of endogenous polypeptides or polynucleotides in vivo by the introduction of the compositions.
As used herein, the language "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the therapeutic agent, such media can be used in the compositions of the invention. Supplementary active compounds can also be incorporated into the compositions. A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampules, disposable syringes or multiple dose vials made of glass or plastic.
Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating the therapeutic agent (e.g., a siRNA, antisense molecule or antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For oral administration, the agent can be contained in enteric forms to survive the stomach or further coated or mixed to be released in a particular region of the GI tract by known methods. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser, which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. The compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
In one embodiment, the therapeutic agents are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. "Dosage unit form" as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
EXAMPLES The following examples are provided for illustrative purposes only and are not intended to limit the scope of the application as defined by the appended claims. All examples described herein were carried out using standard techniques which are well known and routine to those of skill in the art. Routine molecular biology techniques described in the following examples can be carried out as described in references cited therein or in standard laboratory manuals, such as Sambrook & Russell (2001). Example 1 - Methods and Materials
The following summarizes methods and materials used in subsequent Examples (see also He et al. (2010)).
Cell lines and reagents
Various epithelial ovarian cancer cell lines were obtained as gifts: SHIN3 and OVCAR5 from Mark Levine (NIDDK), and A1847, A2780, IGROVl, OVCARlO, PEO-I, and 2008 from Charles Drescher and Beatrice Knudsen (Fred Hutchinson Cancer Research Center, Seattle WA). Renilla TS was a gift from Nasreldin M. Ibrahim, Otto Frόhlich, and S. Russ Price (Emory University School of Medicine). Predesigned STAMP SMARTpool® siRNA was purchased from Dharmacon (#M-015406), Lamin A/C siRNA from Qiagen (#1027320), STAMP TaqMan® gene expression assay probe (#Hs00367300_ml) and human GAPDH control probe (#4310884E) from ABI, and siLentFect™ siRNA transfection reagent from Bio-Rad #170-3361. GR plasmid (pSVLGR) was a gift from Keith Yamamoto (Univ. of CaL, SF). The CellTiter 96® AQueous One Solution™ cell growth assay was supplied by Promega. Mouse monoclonal anti- TIF2 antibody is from Bethyl Labs (#A300-345A). Rabbit polyclonal anti-α-tubulin antibody (used at 15 ng/ml) was from Abeam (#ab4074). The following primers were used for qRT-PCR of both human and rat GR (numbers in parentheses are positions in human GR cDNA): GTCTTCAGGCTGGAATGAACC (1443-1462), SEQ ID NO:9, and CTTTGCCCATTTCACTGCTGC (1737-1717), SEQ ID NO: 10.
Stably transfected 293 cells
HEK293 cells were always grown in high glucose DMEM (Invitrogen) with 10% fetal bovine serum, sodium pyruvate (Cellgro), and MEM nonessential amino acids (Cellgro) to 70% confluency in 100 mm dishes. Cells were transfected with 10 μg of FLAG-
STAMP/pCDNA3.1neo or pCDNA3.1neo using 23 μl Fugene® 6 (Roche Diagnostics, Branford, CT) for 24 hr. The media was changed and the cells grown for another 24 hr before being washed (PBS without Ca++/Mg++; Invitrogen), trypsinized, diluted 1 :50-1000 in media containing 1 mg/ml G418 (Invitrogen), plated in 100 mm dishes and grown for 14 days. Colonies were selected and expanded first in 24 well plates for 10 days and then in 6 well plates until there were enough cells, all with 0.5 mg/ml G418. Positive clones were tested for Flag- STAMP expression by Western blotting with anti-STAMP antibody prepared by Covance (3rd bleed, HL5761). All HEK293 stable cells used for experiments were grown in media free of G418 for at least 2 weeks unless otherwise noted.
Cell growth assay
Cells were washed (PBS without Ca++/Mg++), trypsinized, and then seeded at 10,000 cells/well in 96 well culture plates. Cell growth at the indicated points (day of seeding = Day 0) was determined by adding 20 μl of CellTiter Aqueous One Solution/well and measuring the OD492 three hours later in a Beckman Count DTX880® as recommended by the supplier (Promega). Medium without cells was used as the blank control.
FACS and cell counting
Cells (grown with 0.1 mg/ml G418) were washed 3 times with PBS without calcium or magnesium (Invitrogen), counted with a Beckman Coulter Vi-Cell™ XR2.02, and seeded at 50,000 viable cells/well in 6 well dishes in 3 ml of medium without G418. After 24 hours, the cells were washed once with PBS, trypsinized, resuspended in 500 μl of medium, and placed on ice. Cells were incubated at 00C with 1 μl of 5 mg/ml of propidium iodide (Invitrogen) immediately prior to analysis on a Becton Dickinson FacsCalibur™ flow cytometry system and counting with a Beckman Coulter Vi-CeIl XR2.02.
Tissue scan panels for endogenous STAMP determination
Tissue Scan panels (8 common cancers (#CSRT101), kidney cancer (#HKRT101), ovarian cancer (#HORT101 and HORT 102), and breast cancer (#BCRT101)) and the accompanying pathology and tumor staging reports are available from OriGene (Rockville, MD). Each panel contains pre -normalized cDNA arrays prepared from pathologist-verified tumor tissues. Each well of the panel has same amount total cDNA. Thus, any target gene (e.g. STAMP) variation in different wells reflects real changes between tumor samples. Quantitative real-time PCR (qRT-PCR) was run once for each panel (plate) using validated STAMP primers according to manufacturer's instructions. To determine the absolute level of STAMP, 10 μl 2x Taqman PCR master, 1 μl STAMP Taqman probe, and 9 μl water (total 20 μl) was added to each well of the 96 well plate, as recommended by OriGene. Then real-time qRT-PCR was run on an ABI HT 7900 according to the manufacturer's instructions.
Transient transfections of stably transfected cells with siRNAs or plasmids For 6 well plates, cells were seeded at 5000 per well one day before transfection. One hour before transfection, 1.25 ml of fresh medium was added. siRNA (75 pM) was incubated for 20 min at r.t. with 1 μl siLentFect® reagent in Opti-mem® medium (total of 250 μl) before being added to Opti-mem medium in each well (final concentration of siRNA = 50 nM). For 96 well plates, cells were seeded at 500-2000 per well and 50 μl of fresh medium was added one hour before transfection. Then 3.5 pM of siRNA was mixed with 0.05 μl siLentFect in a total of 20 μl of Opti-mem medium for 20 min before being added to each well. One day later, fresh medium was added to each well in both protocols.
Total RNA isolation, reverse transcription, real-time PCR, and luciferase assays of transiently transfected GREtkLUC were performed as previously described (He & Simons (2007)). For transient transfection experiments with GREtkLUC, VA (1 x 104) or S 13 (2 x 104) cells in 300 μl of media were transfected for 24 hr using 0.8 μl/well of Fugene 6 and either 0, 10 or 30 ng pSVLGR plus 100 ng GREtkLuc and 10 ng Renilla TS. Total transfected DNA was maintained at 300 ng/well with PBSK+. The cells were then induced with steroids in fresh media for 24 hr, separated from the media, and lysed for 20 min with 300 μl of passive lysis buffer (Promega) at room temperature on a rotating shaker. Lysate (50 μl) was then loaded into 96 well luminometer plates and read in a Berthold luminometer.
Statistical analysis
Unless otherwise noted, the values of n independent experiments, performed in triplicate for Luciferase assays, were analyzed for statistical significance by the two-tailed Student's t test using InStat® 2.03 (GraphPad® Software, San Diego, CA). In every case, each average of triplicates was treated as one value of the n experiments. When the difference between the SDs of two populations was significantly different, the Mann- Whitney or Alternate Welch t test was used. A nonparametric test was used if the distribution of values was non-Gaussian. Best- fit curves (R2 almost always > 0.95) following Michaelis-Menten kinetics were obtained for the dose-response experiments with KaleidaGraph® (Synergy Software, Reading, PA). Example 2 - STAMP Overexpression Decreases Growth of Human Embryonic Kidney 293 Cells
Two colonies of 293 cells containing stably transfected STAMP were selected for study. Both colonies gave less than 50% of the increase of control cells with stably transfected empty vector (clone VA) after 3-4 days, as determined by counting of isolated cells (43 ± 19% [S.D., n = 9] and 33 ± 7% [S.D., n = 2] for clones 13 and 10 respectively vs. VA cells). One colony (clone S 13) was selected for further study. When removed from G418 selection and immediately examined by "Cell Titre" assay, clone S 13 cells show a 65% reduction in cell replication (Fig. IA). Automated cell counting gave similar results (data not shown). FACS analysis showed no increase in the proportion of dead cells in S 13 vs. VA cells (Figs. 1B&C). Thus, the lower density of S 13 cells over time is due to slower growth as opposed to increased cell death.
Fig. 1 illustrates the effect of stably transfected STAMP on the growth rate of 293 cells. Fig. 1(A) illustrates how increased STAMP decreases cell growth. The number of cells in replicate plates of clone S13 (S) and VA (V) cells (no steroid, cells removed from G418 1 day prior) after increasing days was assessed by the CellTiter Aqueous One Solution assay. The average value (± S. E. M.) of four independent experiments is shown. **P < 0.005, ***P < 0.0005. (Figs. l(B) & (C)) FACS analysis of VA and S13 cells (no steroid, cells removed from G418 upon seeding; S = single cells, D = double cells). The number of dead cells after increasing days in one of three representative experiments is plotted in Fig. l(C) (± SD, n = 3, *P < 0.05, **P < 0.005). Fig. l(D) illustrates growth of VA and S13 cells after removal from G418 for more than 1 month. The experiment was conducted and plotted (± S.E.M., n = 4, *P < 0.05) as in Fig. l(A) except that 1 μM Dex was added to cells as indicated. Fig. l(E) Increased STAMP decreases cell growth ± steroid. The experiment was conducted as in Fig. l(D) except that four different steroids (100 nM aldosterone, 1 μM Dex, 20 nM R5020, and 10 nM R1881) were added. Similar results were obtained in two additional independent experiments. In some cases (e.g., S13 cells in Fig. IA), the error bar length is smaller than the symbol.
Given the undetectable level of STAMP in VA cells by Western blotting (data not shown), qPvT-PCPv was used to determine the relative amounts of STAMP. STAMP mRNA in clone S13 was 32-fold higher than in VA cells but decreased by a factor of two to 14-fold after withdrawal from G418 for at least 3 months. As expected, these reduced levels of excess STAMP were reflected in a smaller reduction of cell growth, with or without glucocorticoid (Fig. ID). The growth rate of clone S 13 as a percent of clone VA cells was the same with EtOH (77 ± 0.02%; S.E.M, n = 10, P < 0.0001) and Dex (76 ± 0.03%; S.E.M., n = 9, P < 0.0002).
In view of the ability of STAMP to also alter the induction properties of PR and AR (He & Simons (2007)), we asked if the addition of any other steroids could influence the growth of clone S 13 vs. control (clone VA) cells. As shown in Fig. l(E), saturating levels for receptor binding of progestin (R5020), androgen (Rl 881), or mineralocorticoid (aldosterone) also did not change the growth rate of cells with or without overexpressed STAMP.
Example 3 - STAMP Levels in Human Tumor Samples
In view of the effect of STAMP on 293 cell growth, we asked if the abnormal growth of any cancers might be influenced by the levels of endogenous STAMP. Standardized amounts of cDNAs from each stage of 8 common human cancers were obtained from OriGene. Quantitative real time PCR analysis with STAMP TaqMan probes was performed to determine the amount of STAMP mRNA in each tumor sample.
Table 1 provides STAMP mRNA levels in a panel of 8 common human cancers. The characterization of each sample in a commercially available panel of 8 common human cancers (Origene) is listed. Also given are the Ct values from the qRT-PCR assays and the calculation of the abundance of STAMP mRNA in each sample, relative to the first sample (Al), which was arbitrarily chosen.
Fig. 2 illustrates levels of STAMP mRNA in different human tumor samples. Fig. 2(A) provides a survey of eight human tumor types. Levels of STAMP mRNA in individual samples of OriGene TissueScan® panel (each bar corresponds to a single tissue sample) were determined as described in Materials and Methods and plotted (relative to the STAMP mRNA level of the first sample in the Breast panel) vs. tumor stage. As shown in Fig. 2(A), this preliminary screen suggested that STAMP levels in kidney cancers gradually decrease as the tumor stage progresses while STAMP levels might be elevated in Stage I of ovarian cancers and several stages of breast cancer. These pilot study observations were pursued by analyzing larger panels containing 48 samples from various stages of these three cancers. This more extensive study displayed no significant differences in STAMP levels among various kidney and breast cancer samples (data not shown). Fig. 2(B) provides STAMP mRNA in human ovarian cancers. Levels of STAMP mRNA in two different large scale OriGene TissueScan panels of only ovarian cancers was determined as in Fig. 2(A) (see also Table 2). The data from both panels were combined and plotted (box plot) as percent of the average STAMP level in normal (Stage 0) samples (n = 13) for the different stages (n for Stage IGB [low malignant potential] = 3, Stage I = 12, Stage II = 12, Stage III = 34, Stage IV = 9). P values were determined for ΔCt values from the qRT-PCR assay before conversion to percent of STAMP in normal samples, which was plotted. Table 2 also provides the Ct values from the qRT-PCR assays, the average Ct value (and S.D.) of all samples in each Stage, and the p value of the average STAMP Ct value of each Stage vs. the Stage 0 value.
It was appreciated by the inventors that these results with ovarian tumors could be misleading as the "normal" is most likely enriched for normal ovarian stroma, which is nearly devoid of epithelial cells that are found primarily on the capsular surface of the ovary. The difference between overt Stage I-III cancers and the three low malignant potential, borderline tumors (IGB) is significant (P = 0.033 by one-tailed Student t-test) because low malignant potential ovarian neoplasm is a nonmalignant but epithelial process. These two findings led to further investigation of the role of STAMP in ovarian cancer.
Nine cultured human ovarian cancer cell lines were examined: Hey A8, SKOV3, OVCAR8, A1847, PEO-I, OVCARlO, A2780, 2008, and IGROVl. The STAMP levels in three randomly selected, untreated cell lines (Hey A8, SKO V3, OVCAR8) were determined and normalized to the amount in Hey A8 cells, which was arbitrarily selected as a reference value. STAMP mRNA levels in these ovarian cancer cell lines do not appear abnormal. They are slightly higher than that in two other transformed cell lines (U2OS.rGR osteosarcoma cells with stably transfected GR and the control 293 VA cells) and much less than in the clone S 13 293 cells with stably transfected STAMP (Table 3).
Table 3 sets forth STAMP mRNA levels in the indicated cells as determined by qRT- PCR as described in Materials and Methods and then normalized to that seen in HeyA8 cells (which was arbitrarily selected as reference). Values are the averages ± S. E. M. of 3 experiments (one experiment for 293 cells). Example 4 - Role of STAMP in Proliferation of Ovarian Cancer Cells Because elevated STAMP decreases the growth rate of 293 cells (Fig. 1), we asked if lowering the levels of endogenous STAMP with transfected STAMP siRNA would increase the growth rate of the ovarian cancer cells. After transfecting the cells with either Lamin siRNA, as a control, or a SMARTpool (Dharmacon) of STAMP siRNAs, we again determined the STAMP levels. On average, STAMP siRNA reduced the level of endogenous STAMP mRNA in each cell line to 28 ± 8% (S.D., n = 7 cell lines, each being the average of three independent experiments) of that seen in the same cells treated with the Lamin siRNA control (Table 2; "percent remaining"). The "absolute" values of STAMP mRNA in each cell line following STAMP siRNA treatment, after adjusting for the different initial levels in each cell line, are also given Table 4 (values are expressed relative to Hey A8 reference cells, with STAMP levels in Hey A8 cells treated with Lamin siRNA = 100). Unexpectedly, a reduced amount of STAMP mRNA now inhibits the growth of Hey A8, Al 847 and IGROVl cells, in each case compared to the growth of the same cells treated with Lamin siRNA (Fig. 3A). However, lower STAMP mRNA levels have the opposite (and initially predicted) effect on the proliferation of PEO-I and 2008 cells, which are significantly increased. Finally, reduced STAMP mRNA levels cause no change in the propagation of SKOV3, OVCAR8, OVCARlO, A2780 and two other ovarian cancer cell lines (SHIN3 and OVCAR5) (Fig. 3A).
Table 4 provides relative STAMP mRNA levels in ovarian cancer tissue cells following siRNA treatment. STAMP mRNA levels in the indicated cells with transfected siRNA were determined by qRT-PCR as described in Materials and Methods and then normalized to that seen in HeyA8 cells (which was arbitrarily selected as reference) after transient transfection with Lamin siRNA. The data show both the percent remaining STAMP mRNA after siRNA treatment (i.e., 100 x STAMP siRNA/Lamin siRNA) and the "absolute" levels relative to STAMP in HeyA8 cells treated with Lamin siRNA. For this normalization to STAMP in Lamin siRNA-treated HeyA8 cells, the ratio (xlOO) of (STAMP mRNA in each STAMP siRNA-treated cell)/(STAMP mRNA in STAMP siRNA-treated HeyA8 cells) is multiplied by the ratio of (STAMP mRNA in STAMP siRNA-treated HeyA8 cells)/(STAMP in Lamin siRNA treated HeyA8 cells) in the same experiment (values ranged from 0.22 to 0.38). Values are the averages ± S.E.M. of 3 experiments. Fig. 3 illustrates the effect of STAMP siRNA on growth of ovarian cancer tissue culture cells. Fig. 3(A) provides the growth of ovarian tissue culture cells treated with STAMP siRNA relative to Lamin siRNA. The growth of cells 4 days after being transfected with STAMP siRNA or Lamin siRNA was determined as in Fig. 1. The average data ± S. E. M. for 2-6 determinations (n = 12 for HeyA8 cells) are plotted as growth of cells treated with STAMP siRNA as percent of growth of cells treated with Lamin siRNA. * P < 0.05, ** P < 0.005, *** P < 0.0005. Fig. 3(B) provides the growth rate vs. STAMP mRNA levels. The relative growth rate (STAMP siRNA vs. Lamin siRNA) of each of the cell lines in Fig. 3(A) (± S.E.M.) was plotted against the level of STAMP mRNA in the same cells after siRNA treatment relative to HeyA8 cells (± S.E.M.; length of bar may be less than symbol) given in Table 2. Straight line is the best fit by Kaleidagraph (R2 = 0.016).
In view of the different growth responses to lowered STAMP levels in the ovarian cancer cell lines, it seemed possible that the absolute level of STAMP, as opposed to the relative amount, might be a critical determinant for growth rates. In this case, cells with high levels of STAMP mRNA after siRNA treatment, relative to HeyA8 (see "absolute" values in Table 4), might have different growth rates than those with much lower levels. However, PEO-I and IGROVl cells have similar levels of STAMP mRNA after STAMP siRNA treatment ("absolute" in Table 4) but very different growth rates (Fig. 3(A)). The growth response of the cells treated with STAMP siRNA (Table 4) are plotted in Fig. 3(B). This clearly shows that there is no correlation between the amount of STAMP mRNA in STAMP siRNA-treated cells and the growth rate of STAMP siRNA-treated cells as a percent of Lamin siRNA-treated cells. These data suggest that neither absolute nor relative levels of STAMP uniquely control the growth rates of these ovarian cancer cells. In this case, the effects of decreased intracellular STAMP on cell growth would depend on additional factors in a cell-dependent manner. The levels of proteins and kinases known to be associated with cancer proliferation and/or apoptosis (p21, p53, ERK, phospho-ERK, AKT, phospho-AKT and cleaved PARP) were examined in the background of STAMP or Lamin silencing to determine if they paralleled the growth rates of the ovarian cancer cells with reduced amounts of STAMP mRNA. No relationship was observed between the expression level of these proteins/kinases on Western blots and the growth rates of A1847, A2780, HeyA8, IGROVl, OVCARlO, PEO-I, and 2008 cells (data not shown). We conclude that changing the intracellular concentration or activation status of any of these proteins does not mediate the effects of STAMP levels on the growth rates of the ovarian tissue culture cells.
Example 5 - Overexpressed STAMP In Stably Transfected 293 Cells Alters Properties of GR-Mediated Transactivation of a Cell-Specific Manner
It was theorized that the ability of higher levels of STAMP to produce opposite effects on the growth of 293 and ovarian cancer cells could be due to cell-specific factors. To test this hypothesis, we asked if similar cell-specific differences might also reverse the effects of STAMP on the parameters of GR-regulated gene expression. Previous studies revealed that transiently transfected STAMP in both CV-I and U2OS.rGR cells not only augment the maximal amount of Dex activity (Amax), and the partial agonist activity of antisteroids (expressed as percent of maximum Dex activity), but also shift the dose-response curve (and EC50) for gene induction to lower concentrations of steroid (He & Simons (2007); Szapary et al. (2008); Sun et al. (2008)). It was therefore proposed that elevated STAMP levels in 293-derived clone S 13 cells could reduce the EC50 of the dose-response curve for GR induction of exogenous GREtkLUC reporter relative to the same treatment of vector control VA cells. We used the identical exogenous reporter gene (GREtkLUC) as in our previously published studies (He & Simons (2007); Szapary et al. (2008); Sun et al. (2008)) was used in order to minimize the differences inherent upon comparing gene induction properties in different cell lines. Due to the relatively low level of GR in 293 cells, the effects of STAMP in the presence of two amounts (10 and 30 ng) of transiently transfected GR plasmid were the focus of the study. As expected, the magnitude of change in each parameter was proportional to the amount of transfected GR plasmid (Simons (2006)). With both amounts of transfected GR, however, the higher level of STAMP in clone S 13 cells unexpectedly causes a significant right-shift in the dose-response curve to higher steroid concentrations relative to that seen with vector control VA clone cells (Figs. 4(A) & (B)). Similarly, the elevated STAMP in S 13 cells decreases both the Amax and the partial agonist activity of the antiglucocorticoid Dex-mesylate (%DM) (Fig 4B). These changes are statistically significant for each parameter in the presence of both 10 and 30 ng of transfected GR.
Fig. 4 illustrates the effect of elevated STAMP on the properties of GR induction of GREtkLUC reporter gene in 293 cells. Fig. 4(A) provides the dose-response curves for GR induction of GREtkLUC reporter with varying amounts of transiently transfected GR plasmid. S 13 (containing stably transfected STAMP) and vector control (VA) cells were cotransfected with GREtkLUC reporter and the indicated amounts of GR-encoding plasmid. Dose-response curves were conducted and plotted as described by Tao et al. (T ao et al. (2008)). Fig. 4(B) illustrates modulation of Amax, partial agonist activity of the antiglucocorticoid Dex-Mes (%DM), and EC50 by elevated STAMP. Four independent experiments with clone S 13 and VA cells such as in Fig. 4(A), which included assaying the activity of 1 μM Dex-Mes, were analyzed to yield Amax and EC50 in addition to partial agonist activity of 1 μM Dex-Mes (%DM). The average values ± S.E.M. are plotted. * P < 0.05, ** P < 0.005, *** P < 0.0005 for clone S13 vs. the similarly treated clone VA sample. Fig. 4(C) provides GR mRNA levels in VA and S 13 cells. The qRT-PCR was used as described in Materials and Methods to determine the level of GR mRNA in VA and S13 cells with or without 30 ng of transiently transfected GR plasmid (± S.E.M. of triplicates). Fig. 4(D) provides Western blot with TIF2 antibody of cell lysates from cells transfected with no, or 30 ng of GR plasmid. The lower panel shows the equal levels of the loading control, α-tubulin, in each sample. A variety of factors could be responsible for the effects of STAMP in Figs. (4)A & (B) being opposite from expected (Simons (2008)). Two well-known factors that cause increases in Amax, and partial agonist activity, and decreases in EC50 are GR itself and the coactivator TIF2 (Simons (2008); Szapary et al. (1999); Chen et al. (2000)). We therefore asked whether higher levels of either GR or TIF2 in VA cells might account for the results of Figs. 4(A) & (B). Unfortunately, the amount of GR protein is too low to detect by Western blotting, even after transient transfection with 30 ng of GR plasmid (data not shown). qRT-PCR was therefore used to determine the GR mRNA levels, which were found to be very similar in the two cell lines both with and without transfected GR plasmid (Fig. 4(C)). Likewise, Western blotting revealed equal TIF2 protein levels in clone VA and S 13 cells both with and without transfected GR (Fig. 4(D)). Thus, the differences between VA and S 13 cells in Figs. 4(A) & (B) cannot be explained by VA cells possessing greater amounts of GR and/or TIF2 than S 13 cells. We concluded that unidentified cell-specific properties can further alter the effects of changing levels of STAMP on the expression of the same gene(s) in different cells. Therefore, just as was observed for the growth of ovarian cancer cells upon depletion of endogenous STAMP, the other known effects of STAMP are also cell-line dependent. TABLE 1 -DATA FOR PANEL OF 8 COMMON HUMAN TUMORS
K)
Figure imgf000030_0001
TABLE 1 -DATA FOR PANEL OF 8 COMMON HUMAN TUMORS
o
Figure imgf000031_0001
TABLE 1 -DATA FOR PANEL OF 8 COMMON HUMAN TUMORS
Figure imgf000032_0001
TABLE 1 -DATA FOR PANEL OF 8 COMMON HUMAN TUMORS
K)
Figure imgf000033_0001
TABLE 1 -DATA FOR PANEL OF 8 COMMON HUMAN TUMORS
Figure imgf000034_0001
TABLE 1 -DATA FOR PANEL OF 8 COMMON HUMAN TUMORS
TABLE 1 -DATA FOR PANEL OF 8 COMMON HUMAN TUMORS
Ol
Figure imgf000036_0001
TABLE 1 -DATA FOR PANEL OF 8 COMMON HUMAN TUMORS
Figure imgf000037_0001
TABLE 1 -DATA FOR PANEL OF 8 COMMON HUMAN TUMORS
Figure imgf000038_0001
TABLE 1 -DATA FOR PANEL OF 8 COMMON HUMAN TUMORS
OO
Figure imgf000039_0001
TABLE 1 -DATA FOR PANEL OF 8 COMMON HUMAN TUMORS
Figure imgf000040_0001
TABLE 1 -DATA FOR PANEL OF 8 COMMON HUMAN TUMORS
-t-> o
Figure imgf000041_0001
TABLE 2 COMBINED DATA OF BOTH ORIGIN OVARIAN CANCER PANELS
Figure imgf000042_0001
TABLE 2 COMBINED DATA OF BOTH ORIGIN OVARIAN CANCER PANELS
-t->
K)
Figure imgf000043_0001
TABLE 2 COMBINED DATA OF BOTH ORIGIN OVARIAN CANCER PANELS
-t->
Figure imgf000044_0001
TABLE 2 COMBINED DATA OF BOTH ORIGIN OVARIAN CANCER PANELS
-t->
Figure imgf000045_0001
TABLE 2 COMBINED DATA OF BOTH ORIGIN OVARIAN CANCER PANELS
-t->
Ol
Figure imgf000046_0001
TABLE 2 COMBINED DATA OF BOTH ORIGIN OVARIAN CANCER PANELS
-t->
ON
Figure imgf000047_0001
TABLE 2 COMBINED DATA OF BOTH ORIGIN OVARIAN CANCER PANELS
-t->
Figure imgf000048_0001
TABLE 2 COMBINED DATA OF BOTH ORIGIN OVARIAN CANCER PANELS
-t->
OO
Figure imgf000049_0001
TABLE 2 COMBINED DATA OF BOTH ORIGIN OVARIAN CANCER PANELS
-t->
Figure imgf000050_0001
TABLE 2 COMBINED DATA OF BOTH ORIGIN OVARIAN CANCER PANELS
Figure imgf000051_0001
O
Table 3
Relative STAMP mRNA levels in ovarian cancer tissue culture cells
Cells: Hey A8 SKOV 3 OVCAR 8 U20S.rGR 293 clone VA 293 clone S13
Level : 100 269 ± 67 113 ± 8 59 ± 6 149 1864
Table 4
Relative STAMP mRNA levels in ovarian cancer tissue culture cells after siRNA treatment
Cells: Hey A8 A1847 PEO-I OVCARlO A2780 2008 IGROVl
Percent remaining: 29 ± 5 13 ± 3 33 ± 6 25 ± 5 33 ± 9 23 ± 3 38 ± 4
Absolute STAMP mRNA relative to HeyA8): 29 ± 5 16 ± 2 47 ± 12 208 ± 37 110 ± 32 30 ± 6 43 ± 14
Cited References
Akaza H: Current status and prospects of androgen depletion therapy for prostate cancer. Best Pract Res Clin Endocrinol Metab 2008, 22:293-302.
Chen S, et al.: Evidence for a common step in three different processes for modulating the kinetic properties of glucocorticoid receptor-induced gene transcription. J Biol Chem 2000, 275:30106-30117.
Cole TJ: Glucocorticoid action and the development of selective glucocorticoid receptor ligands. Biotechnol Annu Rev 2006, 12:269-300.
Cvetkovic D: Early events in ovarian oncogenesis. Reprod Biol Endocrinol 2003, 1 :68. Easton DF, et al.: Genome-wide association study identifies novel breast cancer susceptibility loci. Nature 2007, 447:1087-1093.
Fire, A.: RNA-triggered gene silencing. Trends Genet. 1999, 15(9):358-63.
Fonte C, et al.: Involvement of {beta}-catenin and unusual behavior of CBP and p300 in glucocorticosteroid signaling in Schwann cells. Proc Natl Acad Sci USA 2005, 102:14260- 14265.
Funder JW: RALES, EPHESUS and redox. J Steroid Biochem MoI Biol 2005, 93:121- 125.
Gradishar WJ, Jordan VC: Clinical potential of new antiestrogens. J Clin Oncol 1997, 15:840-852. Greenlee RT, et al.: Cancer statistics, 2001. CA Cancer J Clin 2001, 51 :15-36.
Guidez F, et al.: Histone acetyltransferase activity of p300 is required for transcriptional repression by the promyelocytic leukemia zinc finger protein. MoI Cell Biol 2005, 25:5552- 5566.
He Y, Simons SS Jr: STAMP: a novel predicted factor assisting TIF2 actions in glucocorticoid receptor-mediated induction and repression. MoI Cell Biol 2007, 27: 1467-1485.
He Y et al.: STAMP alters the growth of transformed and ovarian cancer cells. BMC Cancer 2010, 10:128.
Hewitt SC, et al.: Lessons in estrogen biology from knockout and transgenic animals. Annu Rev Physiol 2005, 67:285-308. Ismail PM, et al.: Progesterone involvement in breast development and tumorigenesis— as revealed by progesterone receptor "knockout" and "knockin" mouse models. Steroids 2003, 68:779-787.
Janke C, et al.: Tubulin polyglutamylase enzymes are members of the TTL domain protein family. Science 2005, 308:1758-1762.
Jones S, et al.: Core signaling pathways in human pancreatic cancers revealed by global genomic analyses. Science 2008, 321 :1801-1806.
Juliano R et al. : Mechanisms and strategies for effective delivery of antisense and siRNA oligonucleotides. Nucleic Acids Research 2008, 36(12):4158-71. Kobel M, et al.: Ovarian carcinoma subtypes are different diseases: implications for biomarker studies. PLoS Med 2008, 5:e232.
Jemal A, et al.: Cancer statistics, 2002. CA Cancer J Clin 2002, 52:23-47.
Jemal A, et al.: Cancer statistics, 2007. CA Cancer J Clin 2007, 57:43-66.
Leung EH, et al.: Differentiation and growth potential of human ovarian surface epithelial cells expressing temperature-sensitive SV40 T antigen. In Vitro Cell Dev Biol Anim 2001, 37:515-521.
Lonberg, N & Huszar, D: Human antibodies from transgenic mice. Int. Rev. Immunol. 1995, 13:65-93
Lonberg & Kay, U.S. Pat. No. 5,625,126, entitled "Transgenic non-human animals for producing heterologous antibodies"
Lonberg & Kay, U.S. Pat. No. 5,633,425, entitled "Transgenic non-human animals capable of producing heterologous antibodies"
Lonberg & Kay, U.S. Pat. No. 5,569,825, entitled "Transgenic non-human animals capable of producing heterologous antibodies of various isotypes" Lonberg & Kay, U.S. Pat. No. 5,661,016, entitled "Transgenic non-human animals capable of producing heterologous antibodies of various isotypes"
Lonberg & Kay, U.S. Pat. No. 5,545,806, entitled "Ransgenic non-human animals for producing heterologous antibodies"
Malek A, et al.: Target genes suitable for silencing approaches and protein product interference in ovarian epithelial cancer. Cancer Treat Rev, in press. McKenna NJ & O'Malley BW: Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 2002, 108:465-474.
Nagy L, Schwabe JW: Mechanism of the nuclear receptor molecular switch. Trends Biochem Sci 2004, 29:317-324. Rosenfeld MG, et al.: Sensors and signals: a coactivator/corepressor/epigenetic code for integrating signal-dependent programs of transcriptional response. Genes Dev 2006, 20: 1405- 1428.
Sambrook, J & Russell, D: Molecular Cloning: A Laboratory Manual, Vol. 1, p. 6.5.1, and Vol. 3, App. 1, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001. Santoso B, Kadonaga JT: Reconstitution of chromatin transcription with purified components reveals a chromatin-specific repressive activity of p300. Nat Struct MoI Biol 2006, 13:131-139.
Schiffrin EL: Effects of aldosterone on the vasculature. Hypertension 2006, 47:312-318.
Simons SS Jr: How much is enough? Modulation of dose-response curve for steroid receptor-regulated gene expression by changing concentrations of transcription factor. Current Topics in Medicinal Chemistry 2006, 6:271-285.
Simons SS Jr: What goes on behind closed doors: physiological versus pharmacological steroid hormone actions. Bioessays 2008, 30:744-756.
Sun Y, et al.: Modulation of transcription parameters in glucocorticoid receptor- mediated repression. MoI Cell Endocrinol 2008, 295 :59-69.
Szapary D, et al.: Opposing effects of corepressor and coactivators in determining the dose-response curve of agonists, and residual agonist activity of antagonists, for glucocorticoid receptor regulated gene expression. MoI Endocrinol 1999, 13:2108-2121.
Szapary D, et al.: Differential modulation of glucocorticoid and progesterone receptor transactivation. MoI Cell Endocrinol 2008, 283:114-126.
Tao Y-G, et al.: Mutations of glucocorticoid receptor differentially affect AF2 domain activity in a steroid-selective manner to alter the potency and efficacy of gene induction and repression. Biochemistry 2008, 47:7648-7662.
Tuschl, T. et al.: The siRNA user guide. 2004 (www.rocke feller, edu/labheads/tuschl/sirna) Wang RS, et al.: Androgen Receptor Roles in Spermatogenesis and Fertility: Lessons from Testicular Cell-Specific Androgen Receptor Knockout Mice. Endocr Rev 2009, in press.

Claims

Claims
1. A method of diagnosing ovarian cancer in a patient comprising: assaying ovarian tissue in said patient for expression of the STAMP gene; and determining whether expression level of STAMP gene corresponds to ovarian cancer.
2. The method of claim 1, wherein the assay is an assay for STAMP mRNA.
3. The method of claim 2, wherein the capture reagents are DNA primers and the detection means is Sybr® Green label.
4. The method of claim 2, wherein said expression level of STAMP mRNA can be correlated to a specific stage of ovarian cancer.
5. The method of claim 1, wherein the expression assay is an assay for STAMP polypeptide or protein.
6. The method of claim 5, wherein the capture reagent is a monoclonal antibody and the detecting means is a fluorescent label.
7. The method of claim 1 , wherein said determination of whether the STAMP expression level corresponds to ovarian cancer comprises comparing the determined expression level to a STAMP expression level normal range.
8. A kit for detecting STAMP expression product in a cell or tissue comprising: one or more capture reagents for capturing STAMP expression product; and optionally means for detecting the binding of capture reagent to STAMP expression product.
9. The kit of claim 8, wherein said STAMP expression product is STAMP mRNA, and the capture reagent is a probe.
10. The kit of claim 9, wherein said detecting means is a radiolabel tag on the probe.
11. The kit of claim 8, wherein said STAMP expression product is STAMP mRNA and the capture reagents are DNA primers for performing qRT-PCR.
12. The kit of claim 11 , wherein said detecting means is Sybr Green label.
13. The kit of claim 8, wherein said STAMP expression product is a STAMP polypeptide or protein, and the capture reagent is an antibody.
14. The kit of claim 13, wherein said detecting means is a fluorescent tag on the antibody.
15. The kit of claim 8, wherein said kit is for detecting or diagnosing ovarian cancer and said tissue or cell is an ovarian tissue or cell.
16. A method of reducing ovarian cancer cell growth in ovarian cancer cells having elevated STAMP expression product, comprising: contacting said ovarian cancer cells with an agent that reduces the STAMP gene expression in said cancer cells.
17. The method of claim 16, wherein said agent is STAMP siRNA.
18. The method of claim 16, wherein said agent is a STAMP antisense molecule.
19. The method of claim 16, wherein said agent is STAMP antibody.
20. A method of reducing ovarian cancer cell growth in a patient diagnosed with ovarian cancer comprising: administering to said patient, whose ovarian cancer cells exhibit elevated STAMP expression, a therapeutically effective amount of an agent that reduces STAMP gene expression, thereby substantially inhibiting ovarian cancer cell growth.
21. The method of claim 20, wherein said agent comprises STAMP siRNA.
22. The method of claim 20, wherein said agent comprises a STAMP antisense molecule.
23. The method of claim 20, wherein said agent comprises STAMP antibodies.
24. A composition for treatment or prevention of ovarian cancer cell growth in a patient comprising an agent capable of reducing expression of STAMP gene in ovarian cells in which STAMP gene expression is elevated, wherein the composition is administered to the patient diagnosed with the ovarian cancer.
25. The composition of claim 24, wherein the agent comprises STAMP siRNA.
26. The composition of claim 24, wherein the agent comprises a STAMP antisense molecule.
27. The composition of claim 24, wherein the agent comprises STAMP antibodies.
PCT/US2010/037452 2009-06-09 2010-06-04 Use of stamp related molecules in the diagnosis and inhibition of ovarian cancer cells Ceased WO2010144324A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US18550309P 2009-06-09 2009-06-09
US61/185,503 2009-06-09

Publications (2)

Publication Number Publication Date
WO2010144324A2 true WO2010144324A2 (en) 2010-12-16
WO2010144324A3 WO2010144324A3 (en) 2011-04-21

Family

ID=43309417

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/037452 Ceased WO2010144324A2 (en) 2009-06-09 2010-06-04 Use of stamp related molecules in the diagnosis and inhibition of ovarian cancer cells

Country Status (1)

Country Link
WO (1) WO2010144324A2 (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2005217646A1 (en) * 2004-02-26 2005-09-09 Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services A novel cofactor that modulates steroid receptor activities

Also Published As

Publication number Publication date
WO2010144324A3 (en) 2011-04-21

Similar Documents

Publication Publication Date Title
Blanco et al. Impact of HuR inhibition by the small molecule MS-444 on colorectal cancer cell tumorigenesis
Ke et al. Nuclear hormone receptor NR4A2 is involved in cell transformation and apoptosis
Peng et al. Antiproliferative effects by Let-7 repression of high-mobility group A2 in uterine leiomyoma
EP2334791B1 (en) Method for controlling cancer metastasis or cancer cell migration by modulating the cellular level of lysyl trna synthetase
Zhang et al. USP39 facilitates breast cancer cell proliferation through stabilization of FOXM1
Khan et al. Attenuation of tumor suppressive function of FBXO16 ubiquitin ligase activates Wnt signaling in glioblastoma
US9062309B2 (en) Use of a growth-stimulating protein
Mishra et al. Upstream determinants of estrogen receptor-α regulation of metastatic tumor antigen 3 pathway
Dong et al. Rictor promotes cell migration and actin polymerization through regulating ABLIM1 phosphorylation in Hepatocellular Carcinoma
Liu et al. An HMGA2‐p62‐ERα axis regulates uterine leiomyomas proliferation
Weyer-Czernilofsky et al. Antitumor activity of the IGF-1/IGF-2–neutralizing antibody xentuzumab (BI 836845) in combination with enzalutamide in prostate cancer models
Li et al. Estrogen promotes Epithelial ovarian cancer cells proliferation via down-regulating expression and activating phosphorylation of PTEN
US20070248535A1 (en) Methods to treat or prevent hormone-resistant prostate cancer using siRNA specific for protocadherin-PC, or other inhibitors of protocadherin-PC expression or activity
Mansoori et al. The synergy between miR-486–5p and tamoxifen causes profound cell death of tamoxifen-resistant breast cancer cells
Choi et al. Caveolin-2 palmitoylation turnover facilitates insulin receptor substrate-1-directed lipid metabolism by insulin receptor tyrosine kinase
Hoang et al. Inhibition of Stat5a/b enhances proteasomal degradation of androgen receptor liganded by antiandrogens in prostate cancer
Velarde et al. Progesterone receptor transactivation of the secretory leukocyte protease inhibitor gene in Ishikawa endometrial epithelial cells involves recruitment of Kruppel-like factor 9/basic transcription element binding protein-1
Yu et al. miR-1271 inhibits ERα expression and confers letrozole resistance in breast cancer
Chiu et al. CDC25A functions as a novel Ar corepressor in prostate cancer cells
EP2436694A1 (en) Novel gpcr protein and use of same
Huang et al. The DLG1-AS1/miR-497/YAP1 axis regulates papillary thyroid cancer progression
CN113679735A (en) Application of SLC7A11 gene in hepatocellular carcinoma interventional embolization operation
Du et al. Uncarboxylated osteocalcin induced miR-143-3p targets SP7 and activates PI3K/Akt signaling in TNBC cells to promote invasion and migration
WO2010144324A2 (en) Use of stamp related molecules in the diagnosis and inhibition of ovarian cancer cells
KR20230131449A (en) A biomarker for diagnosing BCR-ABL-independent tyrosine kinase inhibitor resistance comprising FAM167A and a composition for preventing or treating chronic myeloid leukemia targeting FAM167A

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10786607

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10786607

Country of ref document: EP

Kind code of ref document: A2