WO2010141851A1 - Improving unnatural amino acid incorporation in eukaryotic cells - Google Patents
Improving unnatural amino acid incorporation in eukaryotic cells Download PDFInfo
- Publication number
- WO2010141851A1 WO2010141851A1 PCT/US2010/037449 US2010037449W WO2010141851A1 WO 2010141851 A1 WO2010141851 A1 WO 2010141851A1 US 2010037449 W US2010037449 W US 2010037449W WO 2010141851 A1 WO2010141851 A1 WO 2010141851A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- trna
- synthetase
- cell
- cells
- orthogonal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
Definitions
- compositions and methods for genetically incorporating unnatural amino acids (UAAs) in eukaryotic cells using an improved synthetase For example, an Asp265Arg mutation in synthetases derived from the E. coli tyrosyl-tRNA synthetase (TyrRS) in combination with tRNA ⁇ A can be used to incorporate UAAs into proteins in mammalian and yeast cells.
- UAAs unnatural amino acids
- Unnatural amino acids have been genetically encoded in E. coli, yeast, and mammalian cells using orthogonal tRNA- synthetase pairs and unique codons (Wang et al, Science, 2001, 292:498-500; Wang et ah, Annu. Rev. Biophys. Biomol. Struct., 2006, 35:225-49).
- This technology enables novel chemical and physical properties to be selectively introduced into proteins directly in live cells, and thus have potential for addressing molecular and cell biological questions in the native cell settings. While the incorporation efficiency of unnatural amino acids is high in E. coli and yeast (Wang and Wang, /. Am. Chem.
- UAAs unnatural amino acids
- yeast eukaryotic ⁇ e.g., mammalian or yeast
- the method uses a mutated orthogonal synthetase that increases the affinity of the corresponding orthogonal tRNA toward the synthetase.
- Methods are provided for incorporating a UAA into a protein in a eukaryotic cell.
- the method includes expressing a recombinant mutant orthogonal synthetase (MO-RS) in the cell (such as a non-archaeal MO-RS), wherein the MO-RS includes an Asp265Arg or equivalent mutation (wherein the amino acid numbering corresponds to wild-type E. coli TyrRS, SEQ ID NO: 36 shows the wt sequence).
- MO-RS is specific for the UAA.
- the method can also include expressing an orthogonal tRNA (O-tRNA) that corresponds to the MO-RS, thereby permitting formation of an orthogonal tRNA-mutant synthetase pair in the cell.
- the tRNA is expressed from a pol III promoter.
- a eukaryotic cell can be transduced with a nucleic acid molecule that encodes a pol III promoter operably linked to a nucleic acid molecule that encodes the orthogonal tRNA, thereby expressing the orthogonal tRNA in the cell.
- the cell is incubated or grown in growth or culture medium that includes the UAA to be incorporated under conditions that permit the MO-RS to charge the O-tRNA with the UAA, thereby generating acylated tRNA which can incorporate the UAA into proteins in the cell.
- the cell is substantially deficient in Nonsense-Mediated mRNA Decay (NMD).
- mutant sythetase proteins are also provided.
- nucleic acid molecules encoding such proteins are also provided.
- vectors containing such nucleic acid molecules are also be NMD-deficient.
- FIG. 1 includes several panels demonstrating efficient expression of prokaryotic tRNA in mammalian cells using an Hl promoter.
- FIG. IA is a schematic diagram of the expression plasmid and the reporter plasmid used in a fluorescence-based assay for the expression of functional tRNA in mammalian cells. The candidate amber suppressor tRNA and its cognate synthetase were expressed using the tRNA/aaRS expression plasmid. A reporter plasmid was used to express green fluorescent protein (GFP) with an amber stop codon at a permissive site.
- GFP green fluorescent protein
- FIG. 1C is a graph showing the total fluorescence intensity of the fluorescent GFP-TAG in HeLa cells after transfection with the constructs shown in FIG. IB. The intensities were normalized to those of cells transfected with tRNA4. The values ( ⁇ SD) were: GFP- TAG HeLa 0.3 ⁇ 0.1, tRNAl 21 ⁇ 11, tRNA2 10 ⁇ 4.7, tRNA3 1.3 ⁇ 0.7, tRNA4 100
- ID is a digital image of a Northern blot analysis showing the amount of transcribed EctRNA ⁇ A in HeLa cells.
- Transcript of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used to normalize the total amount of RNA in different samples.
- FIG. 2 includes several panels demonstrating that unnatural-amino-acid specific synthetases evolved in yeast are functional in mammalian cells.
- FIG 2A shows the chemical structures of the three unnatural amino acids used.
- FIG. 2B is a pair of graphs showing incorporation of OmeTyr and Bpa into GFP in the GFP-TAG
- FIG 2C is a pair of graphs showing incorporation of Dan- Ala into GFP in the GFP-TAG HeLa cells using the EctRNA ⁇ A and a Dan-Ala specific synthetase evolved from E. coli LeuRS. The data in this figure were normalized to those obtained from GFP-TAG HeLa cells transfected with the EctRNA ⁇ A and wt E. coli LeuRS.
- FIG. 3 includes several panels demonstrating that unnatural amino acids can be genetically encoded in neurons.
- FIG. 3 A is a schematic illustration of the reporter plasmid expressing the GFP mutant gene with a TAG stop codon at site 182 and the expression plasmid encoding the EctRNA ⁇ A , the synthetase, and an internal transfection marker mCherry.
- FIG. 3B includes four digital fluorescence images of neurons transfected with the reporter plasmid, the EctRNA ⁇ ⁇ A , and wt E. coli TyrRS. The tRNA expression was driven by the Hl promoter in the left panels, and by the 5' flanking sequence of the human tRNA Tyr in the right panels.
- FIG. 3 A is a schematic illustration of the reporter plasmid expressing the GFP mutant gene with a TAG stop codon at site 182 and the expression plasmid encoding the EctRNA ⁇ A , the synthetase, and an internal transfection marker m
- FIG. 3C includes four digital fluorescence images of neurons transfected with the reporter plasmid, the EctRNA ⁇ A , and the OmeTyrRS in the presence (left panels) and absence (right panels) of OmeTyr.
- FIG. 3D includes four digital fluorescence images of neurons transfected with the reporter plasmid, the EctRNA ⁇ ⁇ A , and the BpaRS in the presence (left panels) and absence (right panels) of Bpa.
- FIG. 4 includes several panels demonstrating a method for enhancing the efficiency of expression of E. coli tRNAs in yeast.
- FIG. 4A is a schematic diagram showing the gene elements for tRNA transcription in E. coli and in yeast.
- FIG. 4B is a schematic diagram showing an enhanced method for expressing E. coli tRNAs in yeast using a Pol III promoter that contains the conserved A- and B-box and that is cleaved from the primary transcript. Gene organization of yeast SNR52 or RPRl RNA is shown at the bottom.
- FIG. 4C is a schematic diagram showing the plasmids encoding the orthogonal EctRNA ⁇ ⁇ A /TyrRS pair and the GFP-TAG reporter, respectively.
- FIG. 4E is a digital image of a gel showing a Northern analysis of EctRNA ⁇ A expressed in yeast by the indicated promoters.
- FIG. 5 includes three panels showing that NMD inactivation increases the incorporation efficiency of UAAs in yeast.
- FIG. 5B is a digital image of a gel showing a Western analysis of the DanAla-containing GFP expressed in the upfl ⁇ strain. The same amounts of cell lysate from each sample were separated by SDS-PAGE and probed with an anti-His5 antibody.
- FIG. 5C shows the UAA structures of Dan/ Ala and OmeTyr.
- FIG. 6 includes two panels showing incorporation of UAAs into GFP using the Hl promoter in stem cells.
- FIG. 6A shows that the Hl promoter can express the orthogonal E. coli tRNA Tyr in HCN cells. Together with the orthogonal E. coli
- FIG. 6B shows that the Hl promoter drives E. coli tRNA Tyr , and the OmeRS, a synthetase specific for the UAA o-methyl-tyrosine, incorporates this UAA into GFP.
- FIG. 7 includes two panels showing incorporation of two UAAs, p- benzoylphenylalanine and dansylalanine, using the Hl promoter in stem cells.
- FIG. 7 A shows that the Hl promoter driven E. coli tRNA Tyr and the BpaRS, a synthetase specific for the UAA p-benzoylphenylalanine, incorporate this UAA into GFP.
- FIG. 7B shows that the Hl promoter can express the orthogonal E. coli tRNA 16 " in HCN cells. Together with the orthogonal Dansyl-RS, the tRNA Tyr incorporates the UAA dansylalanine into the GFP.
- FIG. 8 (A) Superposition of E. coli TyrRS (PDB ID 1X8X, cyan) on T. thermophilus tRNATyr* TyrRS complex (PDB ID 1H3E, yellow and orange). Only one subunit of the dimeric TyrRS and one tRNA are shown. Base G34 on the tRNA and the interacting Asp on TyrRS are represented as ball-and-stick. (B) Recognition of G34 by Asp259 in the T. thermophilus tRNATyr-TyrRS complex. C34 was modeled to show the gap after G34C change.
- FIG. 9 shows several panels demonstrating that enhanced mutant synthetases increased the incorporation efficiency of various unnatural amino acids in mammalian cells.
- A An in vivo fluorescence assay for measuring the amber suppression efficiency of the expressed orthogonal tRNA/synthetase. Uaa: unnatural amino acid.
- B Structures of the unnatural amino acids.
- Mutants used were: EBzoRS (Y37G, D182G, L186A, and D265R), EAziRS (Y37L, D182S, F183A, L186A, and D265R), EOmeRS (Y37T, D182T, L183M, and D265R), and EPyoRS (Y37G, D182S, F183M, and D265R). All mutations are based on the wt E. coli TyrRS.
- FIG. 10 is a series of images showing photocrosslinking in mammalian cells using Azi.
- A Crystal structure of E. coli GST (PDB ID IAOF) with three sites for Azi incorporation labeled.
- B Western blot analysis of GST mutants using an anti- His6 antibody before and after photocrosslinking.
- C Western blot analysis of GST mutants using an anti-FLAG antibody before and after photocrosslinking.
- nucleic acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and the amino acid sequences using the one letter codes, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. All Genbank Accession Numbers are incorporated by reference for the sequence available on June 5, 2009.
- SEQ ID NOs: 1 and 2 show forward and reverse primer sequences, respectively, used to amplify the E. coli TyrRS gene.
- SEQ ID NOs: 3 and 4 show forward and reverse primer sequences, respectively, used to amplify the gene for EctRNA ⁇ ⁇ A in construct tRNA2.
- SEQ ID NOs: 5 and 6 show forward and reverse primer sequences, respectively, used to amplify the gene for the E. coli LeuRS gene.
- SEQ ID NOs: 7 and 8 show forward and reverse primer sequences, respectively, used to amplify the gene for 32 P-labeled DNA probes specific for EctRNA ⁇ A .
- SEQ ID NOs: 9 and 10 show forward and reverse primer sequences FW19 and FW20, respectively, used to amplify a spacer sequence from pCDNA3.
- SEQ ID NOs: 11 and 12 show forward and reverse primer sequences FW21 and FW22, respectively, used to amplify the E. coli TyrRS gene from E. coli genomic DNA.
- SEQ ID NOs: 13 and 14 show forward and reverse primer sequences FW16 and FW17, respectively, used to amplify the SNR52 promoter from yeast genomic DNA.
- SEQ ID NOs: 15 and 16 show forward and reverse primer sequences FW14 and FW15, respectively, used to amplify the EctRNA ⁇ gene followed by the 3'- flanking sequence of the SUP4 suppressor tRNA from pEYCUA-YRS.
- SEQ ID NOs: 17 and 18 show forward and reverse primer sequences FW 12 and FW 13, respectively, used to amplify the RPRl promoter from yeast genomic DNA.
- SEQ ID NO: 19 shows a forward primer sequence used to amplify a gene cassette containing the 5' flanking sequence of the SUP4 suppressor tRNA, the EctRNA ⁇ , and the 3' flanking sequence of the SUP4 suppressor tRNA from plasmid pEYCUA-YRS-tRNA-5.
- SEQ ID NOs: 20 and 21 show forward and reverse primer sequences FW27 and FW28, respectively, used to amplify a gene cassette containing the 5' flanking sequence of the SUP4 suppressor tRNA, the EctRNA ⁇ ° A , and the 3' flanking sequence of the SUP4 suppressor tRNA from plasmid pLeuRSB8T252A.
- SEQ ID NOs: 22 and 23 show forward and reverse primer sequences FW29 and FW30, respectively, used to amplify the E. coli LeuRS gene from E. coli genomic DNA.
- SEQ ID NO: 24 shows a reverse primer sequence FW31 used to amplify the SNR52 promoter from pSNR-TyrRS.
- SEQ ID NO: 25 shows a forward primer sequence FW32 used to amplify the EctRNA ⁇ ° A -3' flanking sequence fragment from pLeuRSB8T252A.
- SEQ ID NOs: 26 and 27 show forward and reverse primer sequences JT171 and JT172, respectively, used to amplify a mutant GFP-TAG gene.
- SEQ ID NO: 28 shows the sequence of a biotinylated probe FW39 which is specific for the E. coli tRNA Tyr and the EctRNA ⁇ .
- SEQ ID NOs: 29 and 30 show forward and reverse primer sequences FW5 and FW6, respectively, used to amplify a gene cassette containing -200 bp upstream of UPFl, the Kan-MX6, and -200 bp downstream of UPFl.
- SEQ ID NOs: 31 and 32 show forward and reverse primer sequences, respectively, used to amplify genomic DNA -300 bp away from the UPFl gene.
- SEQ ID NO: 33 is the nucleic acid sequence encoding O- EctRNA ⁇ .
- SEQ ID NO: 34 is the nucleic acid sequence encoding O- EctRNA ⁇ ° A .
- SEQ ID NO: 35 is an exemplary nucleic acid sequence encoding wild-type E. coli TyrRS (GenBank # EU900554).
- SEQ ID NO: 36 is an exemplary protein sequence of wild-type E. coli TyrRS (GenBank # ACI83105.1). Other exemplary sequences are provided in GenBank Accession NOs. BAB35769; AAG56626.1; AAC00303.1; AAX65373.1; ACQ67409.1 and ACI83101.1.
- SEQ ID NO: 37 is an exemplary nucleic acid sequence encoding wild-type E. coli leucyl-tRNA synthetase (GenBank # EU904294.1).
- SEQ ID NO: 38 is an exemplary protein sequence of wild-type E. coli leucyl-tRNA synthetase (GenBank # ACI86840.1). Other exmpalry sequences are provided in GenBank Accession NOs. ACI86838.1; ACD46331.1 and ABS43058.1.
- SEQ ID NO: 39 is an exemplary nucleic acid sequence encoding wild-type E. coli glutamyl-tRNA synthetase (GenBank # EU904159.1).
- SEQ ID NO: 40 is an exemplary protein sequence of wild-type E. coli glutamyl-tRNA synthetase (GenBank # AAG55002). Other exmpalry sequences are provided in GenBank Accession NOs. AAP16122.1; AAX64613.1and CAH15509.1.
- SEQ ID NO: 41 is a nucleic acid sequence encoding a mutant E. coli TyrRS EBzoRS (containing Y37G, D182G, L186A, and D265R substitutions).
- SEQ ID NO: 42 is a nucleic acid sequence encoding a mutant E. coli TyrRS EAziRS (containing Y37L, D182S, F183A, L186A, and D265R substitutions).
- SEQ ID NO: 43 is a nucleic acid sequence encoding a mutant E. coli TyrRS EOmeRS (containing Y37T, D182T, L183M, and D265R substitutions).
- SEQ ID NO: 44 is a nucleic acid sequence encoding a mutant E. coli TyrRS EPyoRS (containing Y37G, D182S, F183M, and D265R substitutions).
- SEQ ID NO: 45 is a nucleic acid sequence encoding a mutant E. coli TyrRS
- EKetRS (containing Y37I, D182G, F183M, L186A, and D265R substitutions).
- TyrRS EKetRS can be used to incorporate p-acetyl-phenylalanine.
- SEQ ID NO: 46 is a nucleic acid sequence encoding an E. coli TyrRS used as a foundation to generate SEQ ID NOS: 41-45.
- the present disclosure provides methods of incorporating unnatural amino acids (UAA) into a protein in a eukaryotic cell, by using orthogonal mutant aminoacyl-tRNA synthetases (MO-RS).
- UAA unnatural amino acids
- MO-RS orthogonal mutant aminoacyl-tRNA synthetases
- the tRNA synthetase selected is specific for the UAA to be incorporated.
- the MO-RS proteins include one or more amino acid substitutions that increase the interaction of the MO-RS with the anticodon of the corresponding orthogonal tRNA (O-tRNA).
- the recombinant MO-RS (such as a non-archaeal MO-RS) is expressed in the cell, for example from a nucleic acid molecule encoding the MO-RS operably linked to a promoter.
- the MO-RS includes a mutation that increases the interaction of the MO-RS with the anticodon of the corresponding O- tRNA (such as tRNA residue 34, for example C34), such as an Asp265Arg or equivalent mutation, wherein the amino acid numbering corresponds to wild-type E. coli tyrosyl-tRNA synthetase (TyrRS) (SEQ ID NO: 36).
- the recombinant MO-RS can be from any organism.
- the MO-RS is a non-archaeal MO-RS.
- a prokaryotic MO-RS for example an E. coli MO-RS
- a eukaryotic MO-RS for example as a yeast MO-RS
- the MO-RS is not from M. jannaschii.
- the MO-RS can be any synthetase, such as a pyrrolysyl, tyrosyl, glutamyl, or leucyl, MO-RS (such as those from E. coli).
- an O-tRNA (such as a prokaryotic tRNA) corresponding to the MO-RS is also expressed in the cell, thereby permitting formation of an orthogonal tRNA-orthogonal mutant synthetase pair in the cell.
- the eukaryotic cell can be transduced with a nucleic acid molecule that encodes an O- tRNA synthetase (such as one specific for a UAA) operably linked to a promoter, such as an external RNA polymerase III promoter (pol III) operably linked to the O- tRNA.
- a promoter such as an external RNA polymerase III promoter (pol III) operably linked to the O- tRNA.
- Exemplary pol III promoters that can be used include type-3 pol III promoters and internal leader pol III promoters.
- the pol III promoter in some embodiments, is a type-3 pol III promoter, and in certain examples, the type-3 pol III promoter is a promoter that is itself not transcribed but instead has a defined starting transcription site for direct tRNA transcription.
- the pol III promoter is an internal leader promoter that is transcribed together with the tRNA, and is then cleaved post-transcriptionally to yield the mature tRNA, such as the SNR52 promoter or the RPRl promoter.
- the O-tRNA is a prokaryotic tRNA, such as an E. coli tRNA.
- the O-tRNA is a suppressor tRNA, for instance an amber, ochre, opal, missense, or frameshift tRNA.
- the suppressor tRNA is E. coli tyrosyl amber tRNA.
- the O-tRNA decodes a stop codon or an extended codon.
- the nucleic acid encoding the pol III operably linked to the nucleic acid encoding the O- tRNA can also include either a 3'-CCA trinucleotide at a 3'-end of the nucleic acid encoding the O-tRNA or a 3' flanking nucleic acid sequence at the 3' end of the nucleic acid encoding the O-tRNA.
- the O-tRNA and the MO-RS are selected such that an orthogonal tRNA-orthogonal mutant synthetase pair can form; that is, the O-tRNA and the MO-RS are selected or paried based on the particular UAA desired to be incorporated.
- the O-tRNA can be tRNA ⁇ A while if the recombinant MO-RS is a mutant leucyl tRNA synthetase, the tRNA can be tRNA Leu CUA •
- the cell is incubated in growth medium that includes the UAA to be incorporated under conditions that permit the MO-RS to charge the O-tRNA with the UAA, thereby generating acylated tRNA which can incorporate the UAA into proteins in the cell.
- Eukaryotic host cells that can be used include mammalian cells (e.g., human cells, stem cells, neurons) or yeast cells, such as those cell lines available from the American Type Culture Collection (Manassas, VA).
- mammalian cells e.g., human cells, stem cells, neurons
- yeast cells such as those cell lines available from the American Type Culture Collection (Manassas, VA).
- the eukaryotic cell is substantially Nonsense-Mediated mRNA Decay (NMD)-deficient.
- the protein includes or consists of the amino acid sequence shown in SEQ ID NO: 36, but having an Asp265Arg substitution and one to ten additional amino acid substitutions that generate an orthogonal synthetase for a particular UAA.
- Y37G, D182G, L186A For example, for the UAA p- benzoylphenylalanine, the following additional mutations are included: Y37G, D182G, L186A; for p-azidophenylalanine the following additional mutations are included: Y37L, D182S, F183A, L186A; for p-methoxyphenylalanine the following additional mutations are included: Y37T, D182T, L183M; for p- propargyloxyphenylalanine the following additional mutations are included: Y37G, D182S, F183M; and for p-acetyl-phenylalanine the following additional mutations are included: Y37I, D182G, F183M, L186A.
- mutations can be made at positions 37, 182, 183, and/or 186 in TyrRS to generate the desired UAA.
- isolated nucleic acid molecules that encode such mutant O-RS proteins (for example see SEQ ID NOS: 41-44), as well as vectors and cells that include such nucleic acid molecules.
- stable eukaryotic cell lines that express such nucleic acid molecules and contain recombinant MO-RS proteins are provided.
- the cell lines can be any eukaryotic cell, such as a mammalian or yeast cell line (such as a neuronal or stem cell line). Such cell lines may also be substantially NMD-deficient.
- the cell lines can further include an orthogonal tRNA that forms an orthogonal pair with the recombinant MO-RS (such as one that is specific for a UAA).
- the UAA can include, in some embodiments, a detectable label such as a fluorescent group, a photoaffinity label, or a photo-caged group, a crosslinking agent, a polymer, a cytotoxic molecule, a saccharide, a heavy metal-binding element, a spin label, a heavy atom, a redox group, an infrared probe, a keto group, an azide group, or an alkyne group.
- a detectable label such as a fluorescent group, a photoaffinity label, or a photo-caged group
- a crosslinking agent such as a fluorescent group, a photoaffinity label, or a photo-caged group
- a crosslinking agent such as a fluorescent group, a photoaffinity label, or a photo-caged group
- a crosslinking agent such as a fluorescent group, a photoaffinity label, or a photo-caged group
- a crosslinking agent such as a fluorescent group, a photo
- the UAA is a hydrophobic amino acid, a ⁇ -amino acid, a homo-amino acid, a cyclic amino acid, an aromatic amino acid, a proline derivative, a pyruvate derivative, a lysine derivative, a tyrosine derivative, a 3-substituted alanine derivative, a glycine derivative, a ring-substituted phenylalanine derivative, a linear core amino acid, or a diamino acid.
- Bacteria Unicellular microorganisms belonging to the Kingdom Procarya. Unlike eukaryotic cells, bacterial cells do not contain a nucleus and rarely harbour membrane-bound organelles. As used herein, both Archaea and Eubacteria are encompassed by the terms "prokaryote” and "bacteria”, except where it is noted that Archaea are specifically excluded. Examples of Eubacteria include, but are not limited to Escherichia coli, Thermus thermophilus and Bacillus stearothermophilus .
- Example of Archaea include Methanococcusjannaschii, Methanosarcina mazei, Methanobacterium thermoautotrophicum, Methanococcus maripaludis, Methanopyrus kandleri, Halobacterium such as Haloferax volcanii and
- Halobacterium species NRC-i Archaeoglobusfulgidus, Pyrococcus fit riosus, Pyrococcus horikoshii, Pyrobaculum aerophilum, Pyrococcus abyssi, Sulfolobus solfataricus, Sulfolobus tokodaii, Aeuropyrum pernix, Thermoplasma acidophilum, and Thermoplasma volcanium.
- Conservative variant refers to a peptide or amino acid sequence that deviates from another amino acid sequence only in the substitution of one or several amino acids for amino acids having similar biochemical properties (so-called conservative substitutions).
- Conservative amino acid substitutions are likely to have minimal impact on the activity of the resultant protein. Further information about conservative substitutions can be found, for instance, in Ben Bassat et al. (J. Bacteriol, 169:751-757, 1987), O'Regan et al. ⁇ Gene, 77:237-251, 1989), Sahin-Toth et al. (Protein ScL, 3:240-247, 1994), Hochuli et al. (Bio/Technology, 6:1321-1325, 1988) and in widely used textbooks of genetics and molecular biology. In some examples, the disclosed MO-RS variants have no more than 3, 5, 10, 15, 20, 25, 30, 40, or 50 conservative amino acid changes. Conservative variants are discussed in greater detail in section IV K of the Detailed Description.
- a conservative variant orthogonal tRNA (O-tRNA) or a conservative variant mutated orthogonal aminoacyl-tRNA synthetase is one that functionally performs substantially like a similar base component, for instance, an O-tRNA or MO-RS having variations in the sequence as compared to a reference O-tRNA or MO-RS.
- an MO-RS, or a conservative variant of that MO-RS that includes the Asp265Arg or equivalent substitution will aminoacylate a cognate O-tRNA with an unnatural amino acid, for instance, an amino acid including an N-acetylgalactosamine moiety, while retaining (or even increasing) its increased UAA incorporation efficiency relative to the wt O-RS.
- the MO-RS and the conservative variant MO-RS do not have the same amino acid sequence (except the Asp265Arg or equivalent substitution is retained).
- the conservative variant can have, for instance, one variation, two variations, three variations, four variations, or five or more variations in sequence, as long as the conservative variant is still complementary to the corresponding O-tRNA or MO-RS.
- a conservative variant MO-RS includes one or more conservative amino acid substitutions compared to the MO-RS from which it was derived (and retains the Asp265Arg or equivalent substitution), and yet retains MORS biological activity.
- a conservative variant MO-RS can retain at least 10% of the biological activity (e.g., increased UAA incorporation efficiency in mammalian cells) of the parent MO-RS molecule from which it was derived, or alternatively, at least 20%, at least 30%, or at least 40%.
- a conservative variant MO-RS retains at least 50% of the biological activity of the parent MO-RS molecule from which it was derived.
- the conservative amino acid substitutions of a conservative variant MO-RS can occur in any domain of the MORS, including the amino acid binding pocket (except that the Asp265Arg or equivalent substitution is retained in the variant MO-RS protein).
- Encode refers to any process whereby the information in a polymeric macromolecule or sequence is used to direct the production of a second molecule or sequence that is different from the first molecule or sequence. As used herein, the term is construed broadly, and can have a variety of applications.
- the term "encode” describes the process of semi- conservative DNA replication, where one strand of a double- stranded DNA molecule is used as a template to encode a newly synthesized complementary sister strand by a DNA-dependent DNA polymerase.
- a DNA molecule can encode an RNA molecule (for instance, by the process of transcription incorporating a DNA-dependent RNA polymerase enzyme).
- an RNA molecule can encode a peptide, as in the process of translation.
- the term “encode” also extends to the triplet codon that encodes an amino acid.
- an RNA molecule can encode a DNA molecule, for instance, by the process of reverse transcription incorporating an RNA-dependent DNA polymerase.
- a DNA molecule can encode a peptide, where it is understood that "encode” as used in that case incorporates both the processes of transcription and translation.
- Eukaryote Organisms belonging to the Kingdom Eucarya. Eukaryotes are generally distinguishable from prokaryotes by their typically multicellular organization (but not exclusively multicellular, for example, yeast), the presence of a membrane-bound nucleus and other membrane-bound organelles, linear genetic material (for instance, linear chromosomes), the absence of operons, the presence of introns, message capping and poly-A mRNA, and other biochemical characteristics known in the art, such as a distinguishing ribosomal structure.
- Eukaryotic organisms include, for example, animals (for instance, mammals, insects, reptiles, birds, etc.), ciliates, plants (for instance, monocots, dicots, algae, etc.), fungi, yeasts, flagellates, microsporidia, and protists.
- a eukaryotic cell is one from a eukaryotic organism, for instance a human cell or a yeast cell.
- Gene expression The process by which the coded information of a nucleic acid transcriptional unit (including, for example, genomic DNA or cDNA) is converted into an operational, non-operational, or structural part of a cell, often including the synthesis of a protein.
- Gene expression can be influenced by external signals; for instance, exposure of a cell, tissue or subject to an agent that increases or decreases gene expression.
- Expression of a gene also can be regulated anywhere in the pathway from DNA to RNA to protein. Regulation of gene expression occurs, for instance, through controls acting on transcription, translation, RNA transport and processing, degradation of intermediary molecules such as mRNA, or through activation, inactivation, compartmentalization or degradation of specific protein molecules after they have been made, or by combinations thereof.
- Gene expression can be measured at the RNA level or the protein level and by any method known in the art, including, without limitation, Northern blot, RT-PCR, Western blot, or in vitro, in situ, or in vivo protein activity assay(s).
- Isolated An "isolated" biological component (such as a nucleic acid molecule, peptide, or cell) has been purified away from other biological components in a mixed sample (such as a cell extract).
- a mixed sample such as a cell extract
- an "isolated" peptide or nucleic acid molecule is a peptide or nucleic acid molecule that has been separated from the other components of a cell in which the peptide or nucleic acid molecule was present (such as an expression host cell for a recombinant peptide or nucleic acid molecule).
- Mammalian cell A cell from a mammal, the class of vertebrate animals characterized by the production of milk in females for the nourishment of young, from mammary glands present on most species; the presence of hair or fur; specialized teeth; three small bones within the ear; the presence of a neocortex region in the brain; and endothermic or "warm-blooded" bodies, and, in most cases, the existence of a placenta in the ontogeny.
- the brain regulates endothermic and circulatory systems, including a four-chambered heart. Mammals encompass approximately 5,800 species (including humans), distributed in about 1,200 genera, 152 families and up to forty-six orders, though this varies with the classification scheme.
- Neurons Electrically excitable cells in the nervous system that process and transmit information.
- neurons are the core components of the brain, spinal cord and peripheral nerves.
- Neurons typically are composed of a soma, dendrites, and an axon. The majority of vertebrate neurons receive input on the cell body and dendritic tree, and transmit output via the axon.
- recombinant MO-RS proteins are expressed in neurons, for example in combination with a corresponding O-tRNA.
- vertebrate neurons include hippocampal neurons, cortical neurons, spinal neurons, motorneurons, sensory neurons, pyramidal neurons, cerebellar neurons, retinal neurons, and Purkinje cells.
- Nonsense-Mediated mRNA Decay A cellular mechanism of mRNA surveillance used by the cell to detect nonsense mutations and prevent the expression of truncated or erroneous proteins.
- NMD Nonsense-Mediated mRNA Decay
- yeast NMD is triggered by the presence of a premature stop codon in the first two thirds of the gene.
- NMD is triggered by exon-junction complexes that form during pre-RNA processing, being downstream of the nonsense codon. Normally, these exon-junction complexes are removed during the first round of translation of the mRNA, but in the case of a premature stop codon, they are still present on the mRNA.
- a substantially Nonsense-Mediated mRNA Decay- (NMD)-deficient cell or cell line has little or no NMD activity, for instance less than 20%, 15%, 10%, 5%, 2%, 1%, or even less NMD activity as compared to a wild-type cell or cell line.
- NMD Nonsense-Mediated mRNA Decay-
- an NMD-deficient cell or cell line degrades few or none of the mRNA premature stop codons that may be present in the cell, for instance a eukaryotic cell such as yeast cell or a mammalian cell.
- Nucleic acid molecule A polymeric form of nucleotides, which can include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above.
- a nucleotide refers to a ribonucleotide, deoxynucleotide or a modified form of either type of nucleotide.
- a "nucleic acid molecule” as used herein is synonymous with "nucleic acid” and “polynucleotide.”
- a nucleic acid molecule is usually at least 10 bases in length, unless otherwise specified. The term includes single- and double- stranded forms of DNA.
- a nucleic acid molecule can include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages.
- Nucleic acid molecules can be modified chemically or biochemically or can contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications, such as uncharged linkages (for example, methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (for example, phosphorothioates, phosphorodithioates, etc.), pendent moieties (for example, peptides), intercalators (for example, acridine, psoralen, etc.), chelators, alkylators, and modified linkages (for example, alpha anomeric nucleic acids, etc.).
- the term "nucleic acid molecule” also includes any topological conformation, including single- stranded, double-stranded, partially duplexed
- a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence.
- a promoter is operably linked to a coding sequence (e.g., an O-tRNA or MO-RS sequence) if the promoter affects the transcription or expression of the coding sequence.
- operably linked nucleic acid sequences are generally contiguous and, where necessary to join two protein-coding regions, in the same reading frame. However, nucleic acids need not be contiguous to be operably linked.
- Orthogonal A molecule (for instance, an orthogonal tRNA (O-tRNA) and/or a mutated orthogonal aminoacyl-tRNA synthetase (MO-RS)) that functions with endogenous components of a cell with reduced efficiency as compared to a corresponding molecule that is endogenous to the cell, or that fails to function with endogenous components of the cell.
- O-tRNA orthogonal tRNA
- MO-RS mutated orthogonal aminoacyl-tRNA synthetase
- orthogonal refers to an inability or reduced efficiency, for instance, less than 20% efficiency, less than 10% efficiency, less than 5% efficiency, or less than 1% efficiency, of an O-tRNA to function with an endogenous aminoacyl-tRNA synthetase compared to an endogenous tRNA to function with the endogenous aminoacyl-tRNA synthetase, or of an MO-RS to function with an endogenous tRNA compared to an endogenous aminoacyl-tRNA synthetase to function with the endogenous tRNA, such as 0-20% efficiency.
- an orthogonal molecule lacks a functionally normal endogenous complementary molecule in the cell.
- an orthogonal tRNA in a cell is aminoacylated by any endogenous aminoacyl-tRNA synthetase (RS) of the cell with reduced or even zero efficiency, when compared to aminoacylation of an endogenous tRNA by the endogenous RS.
- an orthogonal RS aminoacylates any endogenous tRNA a cell of interest with reduced or even zero efficiency, as compared to aminoacylation of the endogenous tRNA by an endogenous RS.
- a second orthogonal molecule can be introduced into the cell that functions with the first orthogonal molecule.
- Orthogonal tRNA A tRNA that is orthogonal to a cell of interest, where the tRNA is: (1) identical or substantially similar to a naturally occurring tRNA (e.g., a leucyl- or tyrosyl-tRNA), (2) derived from a naturally occurring tRNA by natural or artificial mutagenesis, (3) derived by any process that takes a sequence of a wild-type or mutant tRNA sequence of (1) or (2) into account, or (4) homologous to a wild-type or mutant tRNA.
- a naturally occurring tRNA e.g., a leucyl- or tyrosyl-tRNA
- derived from a naturally occurring tRNA by natural or artificial mutagenesis (3) derived by any process that takes a sequence of a wild-type or mutant tRNA sequence of (1) or (2) into account, or (4) homologous to a wild-type or mutant tRNA.
- the tRNA (e.g., a leucyl-, tyrosyl-, or pyrrolysyl-tRNA) can exist charged with an amino acid, or in an uncharged state. It is also to be understood that an "O-tRNA" optionally is charged (aminoacylated) by a cognate synthetase with an amino acid other than tyrosine or leucine, respectively, for instance, with a UAA. Indeed, it will be appreciated that an O-tRNA of the disclosure can be used to insert essentially any amino acid, whether natural or artificial, into a growing peptide, during translation, in response to a selector codon. In one example, the O-tRNA is an archaebacterial tRNA.
- Orthogonal aminoacyl-tRNA synthetase An enzyme that preferentially aminoacylates the O-tRNA with an amino acid (e.g., a UAA) in a cell of interest.
- the amino acid that the O-RS loads onto the O-tRNA can be any amino acid, whether natural, unnatural or artificial, and is not limited herein.
- the O-RS is a mutated O-RS (MO-RS), wherein the mutation increases the interaction or affinity of the O-RS with the anticodon of the O-tRNA, such as an Asp265Arg mutation of the E.
- a mutated orthogonal tyrosyl-tRNA synthetase is an enzyme that preferentially aminoacylates the O-tRNA Tyr with an amino acid (e.g., a UAA) in a cell of interest.
- an orthogonal leucyl-tRNA synthetase is an enzyme that preferentially aminoacylates the leucyl-O-tRNA Leu with an amino acid (e.g., a UAA) in a cell of interest.
- O-RS aminoacyl-tRNA synthetases
- Such enzymes can preferentially aminoacylate the corresponding O-tRNA.
- the sequences of synthetases from numerous organisms are known in the art. These synthetases can be mutated, such that the mutation increases the interaction or affinity of the O-RS with the anticodon of the O-tRNA, such as a mutation that corresponds to the Asp265Arg mutation of the E. coli tyrosyl-tRNA synthetase, and used in the methods provided herein.
- Plasmid A DNA molecule separate from chromosomal DNA and capable of autonomous replication. It is typically circular and double- stranded, and can naturally occur in bacteria, and sometimes in eukaryotic organisms (for instance, the 2-micrometre-ring in Saccharomyces cerevisiae). The size of plasmids can vary from about 1 to over 400 kilobase pairs. Plasmids often contain genes or gene cassettes that confer a selective advantage to the bacterium (or other cell) harboring them, such as the ability to make the bacterium (or other cell) antibiotic resistant.
- Plasmids contain at least one DNA sequence that serves as an origin of replication, which enables the plasmid DNA to be duplicated independently from the chromosomal DNA.
- the chromosomes of most bacteria are circular, but linear plasmids are also known.
- Plasmids used in genetic engineering are referred to as vectors. They can be used to transfer genes (such as an MO-RS or O-tRNA sequence) into a cell, and typically contain a genetic marker conferring a phenotype that can be selected for or against. Most also contain a polylinker or multiple cloning site, which is a short region containing several commonly used restriction sites allowing the easy insertion of DNA fragments at this location.
- plasmids include pCLHF, pCLNCX (Imgenex), pCLHF-GFP-TAG, pSUPER (OligoEngine), pEYCUA-YRS, pBluescript II KS (Stratagene), pCDNA3 (Invitrogen).
- Preferentially aminoacylates As used herein in reference to orthogonal translation systems, a MO-RS "preferentially aminoacylates" a cognate O-tRNA when the MO-RS charges the O-tRNA with an amino acid more efficiently than it charges any endogenous tRNA in a cell.
- the relative ratio of O-tRNA charged by the MO-RS to endogenous tRNA charged by the MO-RS is high, resulting in the MO-RS charging the O-tRNA exclusively, or nearly exclusively, when the O-tRNA and endogenous tRNA are present in equal molar concentrations in the translation system.
- the MO-RS "preferentially aminoacylates an O-tRNA with an unnatural amino acid" when (a) the MO-RS preferentially aminoacylates the O-tRNA compared to an endogenous tRNA, and (b) where that aminoacylation is specific for the unnatural amino acid, as compared to aminoacylation of the O-tRNA by the MORS with any natural amino acid.
- MO-RS charges the O-tRNA exclusively, or nearly exclusively, with the unnatural amino acid.
- Procarya Prokaryotic organisms are generally distinguishable from eukaryotes by their unicellular organization, asexual reproduction by budding or fission, the lack of a membrane-bound nucleus or other membrane-bound organelles, a circular chromosome, the presence of operons, the absence of introns, message capping and poly-A mRNA, and other biochemical characteristics, such as a distinguishing ribosomal structure.
- the Prokarya include subkingdoms Eubacteria and Archaea (sometimes termed "Archaebacteria"). In a particular example, Archaea are excluded when noted herein. Cyanobacteria (the blue green algae) and mycoplasma are sometimes given separate classifications under the Kingdom Monera.
- Promoter A region of DNA that generally is located upstream (towards the 5' region of a gene) that is needed for transcription. Promoters permit the proper activation or repression of the gene (such as an MO-RS or O-tRNA) which they control.
- a promoter contains specific sequences that are recognized by transcription factors. These factors bind to the promoter DNA sequences and result in the recruitment of RNA polymerase, the enzyme that synthesizes the RNA from the coding region of the gene. In prokaryotes, the promoter is recognized by RNA polymerase and an associated sigma factor, which in turn are brought to the promoter DNA by an activator protein binding to its own DNA sequence nearby. In eukaryotes, the process is more complicated.
- Promoters represent elements that can work in concert with other regulatory regions (enhancers, silencers, boundary elements/insulators) to direct the level of transcription of a given gene.
- RNA polymerase III also called Pol III
- Pol III RNA polymerase III
- tRNA ribosomal 5S rRNA
- RNA polymerase III also called Pol III
- Pol III is unusual (compared to Pol II) in that it requires no control sequences upstream of the gene. Instead, it can rely on internal control sequences.
- the RNA polymerase III promoters are more varied in structure than the uniform RNA polymerase I promoters, and yet not as diverse as the RNA polymerase II promoters.
- Types 1-3 They have been divided into three main types (types 1-3), two of which are gene-internal and generally TATA-less, and one of which is gene-external and contains a TATA box.
- Some embodiments of the described methods employ a type-3 promoter.
- Type-3 promoters were identified originally in mammalian U6 snRNA genes, which encode the U6 snRNA component of the spliceosome, and in the human 7SK gene, whose RNA product has been implicated in the regulation of the CDK9/cyclin T complex. They are also found in, for example, the Hl RNA gene, which encodes the RNA component of human RNase P, and the gene encoding the RNA component of human RNase MRP, as well as in genes encoding RNAs of unknown function.
- type-3 promoters came as a surprise because, unlike the then-characterized type 1 and 2 promoters, the type-3 core promoters turned out to be gene-external. They are located in the 5 '-flanking region of the gene, and include a proximal sequence element (PSE), which also constitutes, on its own, the core of RNA polymerase II snRNA promoters, and a TATA box located at a fixed distance downstream of the PSE. Strikingly, in the vertebrate snRNA promoters, RNA polymerase specificity can be switched from RNA polymerase III to RNA polymerase II and vice versa by abrogation or generation of the TATA box.
- PSE proximal sequence element
- DSE distal sequence element Upstream of the PSE is an element referred to as the distal sequence element (DSE), which activates transcription from the core promoter.
- DSE distal sequence element
- TATA box is the hallmark of type 3, gene-external promoters, it is also found in the 5 '-flanking regions of some genes with gene-internal promoter elements.
- internal leader promoter includes certain Pol III type 3 promoters from yeast that drive the transcription of a primary transcript consisting of the leader sequence and the mature RNA. The internal leader promoter is subsequently cleaved posttranscriptionally from the primary transcript to yield the mature RNA product. Specific, non-limiting examples of internal leader promoters include the SNR52 promoter and the RPRl promoter.
- SNR52 and RPRl share a promoter organization that includes a leader sequence in which the A- and B-boxes are internal to the primary transcript, but are external to the mature RNA product. As shown herein, internal leader promoters can be exploited to express E. coli tRNAs in yeast. Reporter: An agent that can be used to identify and/or select target components of a system of interest.
- a reporter can include a protein, for instance, an enzyme, that confers antibiotic resistance or sensitivity (for instance, 3-lactamase, chloramphenicol acetyltransferase (CAT), and the like), a fluorescent screening marker (for instance, green fluorescent protein (GFP), YFP, EGFP, RFP, etc.), a luminescent marker (for instance, a firefly luciferase protein), an affinity based screening marker, or positive or negative selectable marker genes such as lacZ, 3-gal/lacZ (13-galactosidase), ADH (alcohol dehydrogenase), his3, ura3, Ieu2, Iys2, or the like.
- CAT chloramphenicol acetyltransferase
- a reporter gene is a nucleic acid sequence that encodes a product (for instance firefly luciferase, CAT, and ⁇ -galactosidase), whose presence can be assayed.
- a reporter gene can be operably linked to a regulatory control sequence and introduced into cells. If the regulatory control sequence is transcriptionally active in a particular cell type, the reporter gene product normally will be expressed in such cells and its activity can be measured using techniques known in the art. The activity of a reporter gene product can be used, for example, to assess the transcriptional activity of an operably linked regulatory control sequence.
- Sequence identity The similarity between two nucleic acid sequences or between two amino acid sequences is expressed in terms of the level of sequence identity shared between the sequences. Sequence identity is typically expressed in terms of percentage identity; the higher the percentage, the more similar the two sequences. Methods for aligning sequences for comparison are described in detail below, in section IV J of the Detailed Description.
- Selector codon Codons recognized by the O-tRNA in the translation process and not recognized by an endogenous tRNA.
- the O-tRNA anticodon loop recognizes the selector codon on the mRNA and incorporates its amino acid, for instance, an unnatural amino acid, at this site in the peptide.
- Selector codons can include, for instance, nonsense codons, such as stop codons, for instance, amber, ochre, and opal codons; missense or frameshift codons; four-base codons; rare codons; codons derived from natural or unnatural base pairs and/or the like.
- Stem cell A cell that has the ability to self replicate indefinitely and that, under the right conditions, or given the right signals, can differentiate into some or all of the different cell types that make up an organism. Stem cells have the potential to develop into mature, differentiated cells, such as heart cells, skin cells, or nerve cells. In particular examples, recombinant MO-RS proteins are expressed in stem cells, for example in combination with a corresponding O-tRNA.
- the fertilized egg is a stem cell because it has the potential to generate all the cells and tissues that make up an embryo and that support its development in utero.
- Adult mammals include more than 200 kinds of cells, for instance, neurons, myocytes, epithelial cells, erythrocytes, monocytes, lymphocytes, osteocytes, and chondrocytes.
- Other cells that are essential for embryonic development but are not incorporated into the body of the embryo include the extraembryonic tissues, placenta, and umbilical cord. All of these cells are generated from a single fertilized egg.
- Pluripotent cells can give rise to cells derived from all three embryonic germ layers — mesoderm, endoderm, and ectoderm. Thus, pluripotent cells have the potential to give rise to any type of cell.
- Unipotent stem cells are capable of differentiating along only one lineage.
- Embryonic stem cells are pluripotent cells derived from the blastocyst.
- Adult stem cells are undifferentiated cells found in a differentiated tissue that can replicate and become specialized to yield all of the specialized cell types of the tissue from which it originated. Adult stem cells are capable of self-renewal for the lifetime of the organism. Sources of adult stem cells have been found in the bone marrow, blood stream, cornea, retina, dental pulp, liver, skin, gastrointestinal tract, and pancreas.
- a suppressor tRNA is a tRNA that alters the reading of a messenger RNA (mRNA) in a given translation system, for instance, by providing a mechanism for incorporating an amino acid into a peptide chain in response to a selector codon.
- a suppressor tRNA can read through, for instance, a stop codon (for instance, an amber, ocher or opal codon), a four-base codon, a missense codon, a frameshift codon, or a rare codon. Stop codons include, for example, the ochre codon (UAA), amber codon (UAG), and opal codon (UGA).
- Transduction The process by which genetic material, for instance, DNA or other nucleic acid molecule, is inserted into a cell.
- Common transduction techniques include the use of viral vectors (including bacteriophages), electroporation, and chemical reagents that increase cell permeability. Transfection and transformation are other terms for transduction, although these sometimes imply expression of the genetic material as well.
- Transfer RNA A small RNA chain (generally 73-93 nucleotides) that transfers a specific amino acid to a growing peptide chain at the ribosomal site of protein synthesis during translation. It has a 3' terminal site for amino acid attachment. This covalent linkage is catalyzed by an aminoacyl tRNA synthetase. It also contains a three-base region called the anticodon that can base-pair to the corresponding three base codon region on mRNA. Each type of tRNA molecule can be attached to only one type of amino acid, but because the genetic code contains multiple codons that specify the same amino acid, tRNA molecules bearing different anticodons can also carry the same amino acid.
- tRNAs that can be used with the methods provided herein include but are not limited to tRNA Tyr , tRNA Leu , tRNA Gb , tRNA Asp , tRNA Trp and tRNA 1 ' 5 ' 1 .
- Transfer RNA has a primary structure, a secondary structure (usually visualized as the cloverleaf structure), and a tertiary structure (an L-shaped three- dimensional structure that allows the tRNA to fit into the P and A sites of the ribosome).
- the acceptor stem is a 7-bp stem made by the base pairing of the 5'- terminal nucleotide with the 3'-terminal nucleotide (which contains the CCA 3'- terminal group used to attach the amino acid).
- the acceptor stem can contain non- Watson-Crick base pairs.
- the CCA tail is a CCA sequence at the 3' end of the tRNA molecule that is used for the recognition of tRNA by enzymes involved in translation. In prokaryotes, the CCA sequence is transcribed, whereas in eukaryotes, the CCA sequence is added during processing and therefore does not appear in the tRNA gene.
- An anticodon is a unit made up of three nucleotides that correspond to the three bases of the mRNA codon. Each tRNA contains a specific anticodon triplet sequence that can base-pair to one or more codons for an amino acid. For example, one codon for lysine is AAA; the anticodon of a lysine tRNA might be UUU. Some anticodons can pair with more than one codon due to a phenomenon known as wobble base pairing. Frequently, the first nucleotide of the anticodon is one of two not found on mRNA: inosine and pseudouridine, which can hydrogen bond to more than one base in the corresponding codon position.
- the amino acid glycine is coded for by the codon sequences GGU, GGC, GGA, and GGG.
- the codon sequences GGU, GGC, GGA, and GGG are codon sequences that specify amino acids.
- Aminoacylation is the process of adding an aminoacyl group to a compound. It produces tRNA molecules with their CCA 3' ends covalently linked to an amino acid. Each tRNA is aminoacylated (or charged) with a specific amino acid by an aminoacyl tRNA synthetase. There is normally a single aminoacyl tRNA synthetase for each amino acid, despite the fact that there can be more than one tRNA, and more than one anticodon, for an amino acid. Recognition of the appropriate tRNA by the synthetases is not mediated solely by the anticodon, and the acceptor stem often plays a prominent role.
- Unnatural amino acid Any amino acid, modified amino acid, and/or amino acid analogue, which is not one of the 20 common naturally occurring amino acids or seleno cysteine or pyrrolysine. Unnatural amino acids are described at greater length in section IV F of the Detailed Description below.
- Vector A nucleic acid molecule capable of transporting a non- vector nucleic acid sequence (such as a MO-RS or O-tRNA sequence) which has been introduced into the vector.
- a non- vector nucleic acid sequence such as a MO-RS or O-tRNA sequence
- plasmid refers to a circular double-stranded DNA into which non-plasmid DNA segments can be ligated.
- Other vectors include cosmids, bacterial artificial chromosomes (BAC) and yeast artificial chromosomes (YAC).
- BAC bacterial artificial chromosome
- YAC yeast artificial chromosome
- Another type of vector is a viral vector, wherein additional DNA segments can be ligated into all or part of the viral genome.
- Certain vectors are capable of autonomous replication in a host cell into which they are introduced (for example, vectors having a bacterial origin of replication replicate in bacteria hosts).
- vectors can be integrated into the genome of a host cell upon introduction into the host cell and are replicated along with the host genome.
- Some vectors contain expression control sequences (such as promoters) and are capable of directing the transcription of an expressible nucleic acid sequence that has been introduced into the vector. Such vectors are referred to as "expression vectors.”
- a vector can also include one or more selectable marker genes and/or genetic elements known in the art.
- Yeast A eukaryotic microorganism classified in the Kingdom Fungi, with about 1,500 species described. Most reproduce asexually by budding, although a few reproduce by binary fission.
- Yeasts generally are unicellular, although some species may become multicellular through the formation of a string of connected budding cells known as pseudohyphae, or false hyphae.
- Exemplary yeasts that can be used in the disclosed methods and compositions include but are not limited to Saccharomyces cerevisiae, Candida albicans, Schizosaccharomyces pombe, and Saccharomycetales.
- orthogonal tRNA orthogonal tRNA
- O-RS orthogonal aminoacyl-tRNA synthetase
- the mutation (Asp265Arg in E. coli tyrosyl-tRNA synthetase) can generally transplanted to other synthetases specific for different unnatural amino acids to improve their incorporation efficiencies in mammalian or other eukaryotic cells.
- Azi enhanced synthetase specific for /?-azidophenylalanine
- the efficiency of an orthogonal synthetase in charging the orthogonal tRNA with an unnatural amino acid depends on the affinity of the synthetase toward both the unnatural amino acid and the tRNA.
- the anticodon of the orthogonal tRNA is changed to CUA. This change would decrease the affinity of the tRNA toward its cognate orthogonal synthetase, because the anticodon is a major recognition element of most synthetases in distinguishing tRNAs.
- coli tRNAjj A /tyrosyl-tRNA synthetase (TyrRS) pair has been the candidate for evolving orthogonal tRNA/synthetase pairs for incorporating various unnatural amino acids in yeast and mammalian cells.
- the inventors mutated the E. coli TyrRS to increase the recognition of the E. coli TyrRS toward the tRNAjj A .
- Described herein is a general strategy for increasing the efficiency and incorporation rate of UAAs in eukaryotic cells (such as mammalian cells) using mutated orthogonal aminoacyl-tRNA sythetases.
- eukaryotic cells such as mammalian cells
- mutated orthogonal aminoacyl-tRNA sythetases By mutating the anticodon binding domain of a prokaryotic O-RS, the incorporation efficiency of UAAs into proteins in vivo (as evidenced by the produced amount of protein containing the UAA) increased by 1.6 to 5.2 fold depending on the particular UAA. Therefore, the methods can be used to increase UAA incorporation by at least 1.5-fold, at least 2- fold, at least 3-fold, at least 4-fold, or even at least 5-fold, relative to the corresponding wt O-RS. For example, in an E.
- the MO-RS is selected for the particular UAA to be incorporated.
- the MO-RS can be expressed in a eukaryotic cell using standard molecular biology methods.
- a nucleic acid encoding the MO-RS can be introduced into the eukaryotic cell, such as under the control of a promoter.
- the cell also includes an orthogonal tRNA (O-tRNA) corresponding to the MO-RS, thereby permitting formation of an orthogonal tRNA-orthogonal mutant synthetase pair in the cell.
- the MO-RS/O-tRNA can be selected for the particular unnatural amino acid to be incorporated into proteins.
- the cell is then incubated in growth medium that includes the UAA under conditions that permit the MO-RS to charge the O-tRNA with the UAA, thereby generating acylated tRNA which can incorporate the UAA into proteins in the cell.
- the O-tRNA (such as a prokaryotic or archaebacterial tRNA), regardless of the internal promoter elements, can be expressed in eukaryotic cells by using a pol III promoter.
- exemplary pol III promoters include those that are not transcribed and do not require downstream transcriptional elements, but have a defined starting transcription site for direct RNA transcription, and those that are transcribed together with the tRNA, and are then cleaved post-transcriptionally to yield the tRNA.
- a pol III promoter can be operably linked to a prokaryotic O- tRNA, and the resulting construct introduced into a eukaryotic cell, thereby permitting expression of the O-tRNA in the cell.
- the type 3 pol III promoters do not require downstream transcriptional elements, and have a well-defined transcription initiation site for generating the correct 5 '-end of tRNA.
- the Hl promoter can drive the expression of different tRNAs (for instance, EctRNA ⁇ A and
- EctRNA p u A in various cell types (e.g., HeLa, HEK293, mouse and rat primary neurons) for the incorporation of diverse natural or unnatural amino acids.
- Other members of the type-3 class of pol III promoters such as the promoter for U6 snRNA, 7SK, and MRP/7-2, also work in a similar manner.
- an internal leader promoter can be operably linked to the
- O-tRNA and the resulting construct introduced into a eukaryotic cell, thereby permitting expression of the prokaryotic tRNA in the cell.
- Internal leader promoters are transcribed together with the O-tRNA, and are then cleaved post- transcriptionally to yield the O-tRNA.
- internal leader promoters such as the SNR52 promoter and the RPRl promoter can drive the efficient expression of different prokaryotic tRNAs (for instance, EctRNA
- Co-expression of the O-tRNA and mutated O-tRNA synthetase in the same eukaryotic cell can be used to drive the incorporation of unnatural amino acids (UAAs) into proteins in the cell.
- the eukaryotic cell can genetically encode an UAA when: (1) the O-tRNA/MO-RS pair is specific for the UAA, (2) the O-tRNA decodes a blank codon unused by a common amino acid (such as stop codons or extended codons), (3) the O-tRNA/synthetase pair works with the protein biosynthesis machinery of the host cell, and (4) there is little or no crosstalk between the O-tRNA/synthetase and endogenous tRNA/synthetase pairs (i.e., the tRNA/synthetase pair is orthogonal).
- the NMD pathway is a cellular mechanism of mRNA surveillance used by the cell to detect nonsense mutations and prevent the expression of truncated or erroneous proteins. Disruption of this pathway results in a higher efficiency of incorporation of UAAs in cells such as yeast cells and mammalian cells.
- the NMD pathway mediates the rapid degradation of mRNAs that contain premature stop codons in yeast, whereas no such pathway exists in E. coli. When stop codons are used to encode UAAs, in some examples, NMD results in a shorter lifetime for the target mRNA, and thus a lower protein yield in yeast.
- An NMD-deficient yeast strain is used in some embodiments to overcome this problem, and to enable high- yield production of UAAs in yeast.
- fluorescent unnatural amino acids can be used to sense local environmental changes and serve as reporters for enzyme activity, membrane potential or neurotransmitter release; unnatural amino acids bearing photocrosslinking agents can be applied to identify protein-protein and protein-nucleic acid interactions in cells; and photocaged and photoisomerizable amino acids can be designed to switch on and off signal initiation and transduction noninvasively.
- unnatural amino acids previously have been encoded in E. coli and in yeast, albeit with low efficiency (Wang et al., (2006) Annu. Rev. Biophys. Biomol. Struct. 35, 225-249).
- compositions and methods described herein enable the genetic encoding of such novel amino acids in mammalian cells and neurons, thus making possible more precise molecular studies of cell biology and neurobiology. Furthermore, improvements in the efficiency of unnatural amino acid expression in yeast enable large-scale preparation of modified polypeptides.
- orthogonal pairs including an aminoacyl-tRNA synthetase (such as an MO-RS) and a suitable tRNA are needed that can function efficiently in the host translational machinery, but that are "orthogonal" to the translation system at issue, meaning that it functions independently of the synthetases and tRNAs endogenous to the translation system.
- an aminoacyl-tRNA synthetase such as an MO-RS
- a suitable tRNA are needed that can function efficiently in the host translational machinery, but that are "orthogonal" to the translation system at issue, meaning that it functions independently of the synthetases and tRNAs endogenous to the translation system.
- characteristics of the orthologous pair include tRNAs that decode or recognize only a specific codon, for instance, a selector codon, that is not decoded by any endogenous tRNA, and mutated aminoacyl-tRNA synthetases that preferentially aminoacylate (or "charge") its cognate tRNA with only one specific unnatural amino acid.
- the O-tRNA also typically is not aminoacylated by endogenous synthetases.
- an orthogonal pair in a eukaryotic cell, will, in certain examples, include an aminoacyl- tRNA synthetase that does not cross-react with endogenous tRNA, and an orthogonal tRNA that is not aminoacylated by endogenous synthetases.
- the exogenous tRNA and MO-RS are prokaryotic. When expressed in a eukaryotic cell, the exogenous MO-RS aminoacylates the exogenous suppressor tRNA with its respective UAA and not with any of the common twenty amino acids.
- UAAs in eukaryotic cells and incorporate an UAA into a protein expressed in a eukaryotic cell can facilitate the study of proteins, as well as enable the engineering of proteins with novel properties.
- expression of proteins containing one or more UAAs can facilitate the study of proteins by specific labeling, alter catalytic function of enzymes, improve biological activity or reduce cross-reactivity to a substrate, crosslink a protein with other proteins, small molecules or biomolecules, reduce or eliminate protein degradation, improve half- life of proteins in vivo (for instance, by pegylation or other modifications of introduced reactive sites), etc.
- the orthogonal pair when an orthogonal pair recognizes a selector codon and loads an amino acid in response to the selector codon, the orthogonal pair is said to "suppress" the selector codon. That is, a selector codon that is not recognized by the translation system's (for instance, the eukaryotic cell's) endogenous machinery is not ordinarily translated, which can result in blocking production of a peptide that would otherwise be translated from the nucleic acid.
- An O-tRNA of the disclosure recognizes a selector codon and includes at least about, for instance, a 45%, a 50%, a 60%, a 75%, a 80%, or a 90% or more suppression efficiency in the presence of a cognate synthetase in response to a selector codon as compared to the suppression efficiency of an O-tRNA comprising or encoded by a nucleic acid molecule sequence, for instance as set forth in SEQ ID NOs 33 and 34.
- the MO-RS aminoacylates the O-tRNA with an UAA of interest
- the cell uses the O-tRNA/MO-RS pair to incorporate the UAA into a growing peptide chain, for instance, via a nucleic acid molecule that includes a nucleic acid molecule that encodes a peptide of interest, where the nucleic acid molecule includes a selector codon that is recognized by the O-tRNA.
- the cell can include an additional O-tRNA/MO-RS pair, where the additional O-tRNA is loaded by the additional MO-RS with a different UAA.
- one of the O- tRNAs can recognize a four-base codon and the other can recognize a stop codon.
- the suppression efficiency of the O-RS and the MO-tRNA together is at least 5-fold, 10- fold, 15-fold, 20-fold, or 25-fold (or more) greater than the suppression efficiency of the O-tRNA lacking the MO-RS.
- Suppression efficiency can be determined by any of a number of assays known in the art, for example, a ⁇ -galactosidase reporter assay.
- a cognate synthetase can also be introduced (either as a peptide or a nucleic acid molecule that encodes the cognate synthetase when expressed).
- the cells are grown in media to a desired density, and ⁇ -galactosidase assays are performed.
- Percent suppression can be calculated as the percentage of activity for a sample relative to a suitable control, for instance, the value observed from the derivatized lacZ construct, where the construct has a corresponding sense codon at desired position rather than a selector codon.
- the O-tRNA and/or the MO-RS can be naturally occurring or can be derived by mutation of a naturally occurring tRNA and/or RS, for instance, by generating libraries of tRNAs and/or libraries of RSs, from any of a variety of organisms and/or by using any of a variety of available mutation methods.
- one method for producing an orthogonal tRNA/aminoacyl-tRNA synthetase pair involves importing a heterologous (to the host cell) tRNA/synthetase pair from a source other than the host cell, or multiple sources, into the host cell.
- the properties of the heterologous synthetase candidate include that it does not charge any host cell tRNA, and the properties of the heterologous tRNA candidate include that it is not aminoacylated by any host cell synthetase.
- the heterologous tRNA is orthogonal to all host cell synthetases.
- a second strategy for generating an orthogonal pair involves generating mutant libraries from which to screen and/or select an O-tRNA or MO-RS. These strategies also can be combined.
- tyrosyl tRNA/TyrRS derived from E. coli
- leucyl tRNA/TyrRS derived from E. coli
- glutaminyl tRNA/GlnRS derived from E. coli
- tryptophanyl tRNA/TrpRS derived from B. subtilis
- E. coli tyrosyl tRNA/TyrRS for use in yeast
- the pyrrolysyl tRNA/PylRS pair from Methanosarcina barken or
- Methanosarcina mazei for use in E. coli and mammalian cells (Blight et al., (2004) Nature 431: 333-5).
- the tRNA/aminoacyl-tRNA synthetase pair is not from M. jannaschii.
- the orthogonal translational components (O-tRNA and MO-RS) of the disclosure can be derived from any organism (or a combination of organisms) for use in a host translation system from any other species, with the caveat that the O- tRNA/MO-RS components and the host system work in an orthogonal manner.
- one or more of the orthogonal translational components are non- Archaeal. It is not a requirement that the O-tRNA and the MO-RS from an orthogonal pair be derived from the same organism.
- the orthogonal components are derived from prokaryotic genes (for instance, E. coli) for use in a eukaryotic host system.
- the O-tRNA and the MO-RS can be derived from a eubacterium, such as Escherichia coli, Thermus thermophilics, Bacillus stearotherinphilus, or the like.
- the individual components of an O-tRNA/MO-RS pair can be derived from the same organism or different organisms.
- the eukaryotic host cell in which the recombinant MO-RS and O-tRNA are expressed can be from any eukaryotic species, for example, animals (for instance, mammals, insects, reptiles, birds, etc.), plants (for instance, monocots, dicots, algae, etc.), fungi, yeasts, flagellates, microsporidia, and protists, etc.
- the eukaryotic host cell is a mammalian cell, for example a human, cat, dog, mouse, rat, sheep, cow, or horse cell.
- the host cell is a neuron.
- the host cell is a stem cell.
- the host cell is a yeast cell, for instance an S.
- the cell is a eukaryotic cell that is substantially Nonsense-Mediated mRNA Decay- (NMD)-deficient, such as a yeast or mammalian cell that is NMD-deficient.
- NMD Nonsense-Mediated mRNA Decay-
- ATCC Manassas, VA
- primary cell lines can be used, as well as primary cell lines.
- the NMD pathway is an evolutionarily conserved mRNA surveillance pathway that recognizes and eliminates aberrant mRNAs harboring premature termination codons, thereby preventing the accumulation of nonfunctional or potentially deleterious truncated proteins in the cells.
- NMD degrades a variety of naturally occurring transcripts to suppress genomic noise.
- One step in NMD is the translation-dependent recognition of transcripts with aberrant termination events and then targeting those mRNAs for destruction.
- Upfl As is well known in the art, the three Upf proteins, Upfl, Upf2 and UpO, constitute the core NMD machinery as they are conserved and required for NMD in Saccharomyces cerevisiae, Drosophila melanogaster, and in mammalian cells.
- Upfl appears to recognize aberrant translation termination events and, then in a subsequent step, interacts with Upf2 and UpO to trigger degradation of mRNA.
- Specific, non-limiting examples of Upfl sequences include GenBank Accession Nos: AAF48115 (D. melanogaster), EAW84742 (human), AAH52149 (mouse), and CAA91194 (S. pombe).
- Upf2 sequences include GenBank Accession Nos: AAF46314 (D. melanogaster), AAG60689 (human), CAM23670 (mouse), and CABl 1644 (S. pombe).
- UpO sequences include GenBank Accession Nos: AAM68275 (D. melanogaster), AAG60690 (human), AAI19036 (mouse), and CAA97074 (S. cerevisiae).
- NMD pathway mediates the rapid degradation of mRNAs that contain premature stop codons in yeast, whereas no such pathway exists in E. coli.
- stop codons are used to encode UAAs
- NMD results in a shorter lifetime for the target mRNA, and thus a lower protein yield in yeast.
- an NMD-deficient yeast strain is used in some embodiments to overcome this problem, and to enable high-yield production of UAAs in yeast.
- This strategy also can be used effectively in mammalian cells.
- the efficacy of disrupting the NMD pathway depends on the presence of exon-intron junctions in the DNA sequence. Thus, if there are introns in the gene of interest, disrupting the NMD pathway increases the efficiency of UAA incorporation.
- Complete NMD deficiency in the cell is not required, and in some examples is avoided (for example if complete NMD deficiency is toxic to the cell).
- partial NMD deficiency can be sufficient to achieve the desired result, such as enhancing prokaryotic tRNA expression in a eukaryotic cell, enhancing the efficiency of incorporation of a UAA a eukaryotic cell, or both.
- Methods of decreasing expression or activity of a gene in a eukaryotic cell are well known in the molecular biology arts.
- such methods are enabled by the public availability of genes in the NMD-pathway (for example on GenBank or EMBL).
- such methods are enabled by the public availability of genes in the NMD-pathway (for example on GenBank or EMBL).
- NMD-deficient cells such as yeast or mammalian cells
- UPFl gene which in some examples is essential for the function of the NMD pathway.
- Other methods for deactivating the NMD pathway include the complete knock out, partial deletion, partial mutation, or silencing (e.g., through RNA interference) of any genes involved in the NMD pathway, such as upfl, upf2, upf3, hrpl, nmd2, etc., and using small molecules to inhibit the function of proteins involved in the NMD pathway, such as the function of Upf Ip, Upf2p, UpOp, Hrplp, Nmd2p, etc.
- Methods of reducing the expression of a protein using molecular biological techniques are conventional, and are well known in the art.
- Some embodiments include cell lines that are substantially NMD-deficient, such as NMD-deficient mammalian cell lines and NMD-deficient yeast cell lines.
- a labeled UAA such as a fluorescent UAA, can be incorporated in the NMD-deficient strain, and the intensity of the label can be used as a measure of UAA incorporation efficiency.
- a promoter is a region of DNA that generally is located upstream (towards the 5' region of a gene) and is needed for transcription. Promoters permit the proper activation or repression of the gene which they control. A promoter contains specific sequences that are recognized by transcription factors. These factors bind to the promoter DNA sequences and result in the recruitment of RNA polymerase, the enzyme that synthesizes the RNA from the coding region of the gene. Promoters can be used to express MO-RS and O-tRNA molecules.
- Promoters useful in carrying out the methods described herein include RNA polymerase III (also called pol III) promoters, which transcribe DNA to synthesize ribosomal 5S rRNA, tRNA, and other small RNAs, generally structural or catalytic RNAs that are, generally, shorter than 400 base pairs.
- Pol III is unusual in that it requires no control sequences upstream of the gene. Instead it normally relies on internal control sequences.
- Type-1 genes include 5s RNA genes whose promoters are distinguished by three intragenic sequence elements; a 5' A block, an intermediate element and a 3' C block. These elements span a region of approximately 50 bp beginning at about position +45.
- Type-2 genes are identified by well conserved A and B block elements.
- the A block is invariantly intragenic and, in contrast to 5s genes, is positioned closer to the transcription start site (usually at about 10-20 bp).
- Type-3 genes are characterized by promoter sequences that reside upstream of the coding sequence.
- the prototypes of this group include metazoan U6 small-nuclear RNA genes and the human 7SK gene.
- the promoters of these genes contain a TATA sequence near position -30 that determines the polymerase specificity of the transcription unit, and a proximal sequence element at around position -60. Together, these two elements constitute a basal promoter which is subject to activation by a variety of factors that bind to distal sequence elements.
- Hl The human gene for this RNA, designated Hl, contains multiple cis-acting elements upstream of the start site and does not require internal sequences for transcription in vitro.
- the Hl RNA gene is a typical type-3 gene.
- RPRl homologous gene from S. cerevisiae
- the promoter is a type-3 pol III Hl promoter.
- the Hl promoter can drive the expression of different tRNAs in various cell types (for instance, HeLa, HEK293, mammalian primary neurons) for the incorporation of diverse natural or UAAs.
- Other members of the type-3 class of pol III promoter are also useful in the practice of the disclosed methods, and include, for instance, the promoters for U6 snRNA, 7SK, and MRP/7-2, as well as internal leader promoters of yeast.
- Certain yeast pol III type 3 promoters are transcribed together with the tRNA, and are then cleaved post-transcriptionally to yield the mature RNA.
- Such promoters for instance, the SNR52 promoter and the RPRl promoter, can be used for efficient incorporation of UAAs in yeast cells.
- Internal leader promoters such as SNR52 and RPRl, share a promoter organization that includes a leader sequence in which the A- and B-boxes are internal to the primary transcript, but are external to the mature RNA product.
- Selector codons of the disclosure expand the genetic codon framework of protein biosynthetic machinery.
- Exemplary selector codons include a unique three base codon, a nonsense codon, such as a stop codon, for instance, an ochre codon (UAA), an amber codon (UAG), or an opal codon (UGA), a missense or frameshift codon, an unnatural codon, a four-base codon, a rare codon, or the like.
- a number of selector codons can be introduced into a desired gene, and by using different selector codons, multiple orthogonal tRNA/synthetase pairs can be used that allow the simultaneous site- specific incorporation of multiple UAAs.
- the methods include the use of a selector codon that is a stop codon for the incorporation of a UAA in vivo in a cell.
- a selector codon that is a stop codon for the incorporation of a UAA in vivo in a cell.
- an O- tRNA is produced that recognizes the stop codon and is aminoacylated by an O-RS with a UAA. This O-tRNA is not recognized by the naturally occurring host's aminoacyl- tRNA synthetases.
- the O-RS, O-tRNA and the nucleic acid molecule that encodes a peptide of interest are combined, for instance, in vivo, the UAA is incorporated in response to the stop codon to give a peptide containing the UAA at the specified position.
- the stop codon used as a selector codon is an amber codon, UAG, and/or an opal codon, UGA.
- UAAs Unnatural Amino Acids
- an unnatural amino acid refers to any amino acid, modified amino acid, or amino acid analogue other than selenocysteine and/or pyrrolysine and the following twenty genetically encoded alpha- amino acids: alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine.
- the generic structure of an alpha- amino acid is illustrated by Formula I: H 2 NCH(R)COOH.
- Such UAAs can be included the growth medium of the cells expressing the MO-RS and O-tRNA, thereby permitting incorporation of the UAA into proteins.
- a UAA typically is any structure having Formula I wherein the R group is any substituent other than one used in the twenty natural amino acids. See for instance, Biochemistry by L. Stryer, 31(1 ed. 1988), Freeman and Company, New York, for structures of the twenty natural amino acids. UAAs also can be naturally occurring compounds other than the twenty alpha-amino acids above.
- UAAs include p- ethylthiocarbonyl- L- phenylalanine, p-(3-oxobutanoyl)-L- phenylalanine, 1, 5-dansyl-alanine, 7-amino- coumarin amino acid, 7- hydroxy-coumarin amino acid, nitrobenzyl-serine, 0-(2- nitrobenzyl)-L- tyrosine, p-carboxymethyl- L-phenylalanine, p-cyano-L- phenylalanine, m- cyano-L-phenylalanine, biphenylalanine, 3-amino-L-tyrosine, bipyridyl alanine, p-(2- amino-i - hydroxyethyl)-L-phenylalanine, p- isopropylthiocarbonyl-L-phenylalanine, 3- nitro- L-tyrosine
- R in Formula I optionally includes an alkyl-, aryl-, acyl-, hydrazine, cyano-, halo-, hydrazide, alkenyl, ether, borate, boronate, phospho, phosphono, phosphine, enone, imine, ester, hydroxylamine, or amine group or the like, or any combination thereof.
- UAAs of interest include, but are not limited to, amino acids comprising a crosslinking amino acid, photoactivatable crosslinking amino acids, spin-labeled amino acids, fluorescent amino acids, metal binding amino acids, metal-containing amino acids, radioactive amino acids, amino acids with novel functional groups, amino acids that covalently or noncovalently interact with other molecules, photocaged and/or photoisomerizable amino acids, photoaffinity labeled amino acids, biotin or biotin-analogue containing amino acids, polymer- containing amino acids, cytotoxic molecule-containing amino acids, saccharide- containing amino acids, heavy metal-binding element-containing amino acids, amino acids containing a heavy atom, amino acids containing a redox group, amino acids containing an infrared probe, amino acids containing an azide group, amino acids containing an alkyne group, keto containing amino acids, glycosylated amino acids, a saccharide moiety attached to the amino acid side chain, amino acids comprising polyethylene glycol or poly
- UAAs that contain novel side chains
- UAAs also can optionally include modified backbone structures, for instance, as illustrated by the structures of Formulas II and III:
- H 2 NC(R 1 )(R 2 )CO 2 H wherein Z typically includes OH, NH 2 , SH, NH-R 2 , or S-R 2 ; X and Y, which can be the same or different, typically include S or O, and R 1 and R 2 , which are optionally the same or different, are typically selected from the same list of constituents for the R group described above for the UAAs having Formula I as well as hydrogen.
- unnatural amino optionally include substitutions in the amino or carboxyl group as illustrated by Formulas II and III.
- UAAs of this type include, but are not limited to, ⁇ -hydroxy acids, ⁇ -thioacids ⁇ -aminothiocarboxylates, for instance, with side chains corresponding to the common twenty natural amino acids or unnatural side chains.
- substitutions at the ⁇ -carbon optionally include L, D, or ⁇ - disubstituted amino acids such as D-glutamate, D-alanine, D-methyl-O-tyrosine, aminobutyric acid, and the like.
- UAAs are used in the L-configuration.
- the disclosure is not limited to the use of L-configuration UAAs, and D-enantiomers of these UAAs also can be used.
- Tyrosine analogs include para-substituted tyrosines, ortho- substituted tyrosines, and meta substituted tyrosines, wherein the substituted tyrosine includes an alkynyl group, acetyl group, a benzoyl group, an amino group, a hydrazine, an hydroxyamine, a thiol group, a carboxy group, an isopropyl group, a methyl group, a C6 - C20 straight chain or branched hydrocarbon, a saturated or unsaturated hydrocarbon, an O-methyl group, a polyether group, a nitro group, or the like.
- multiply substituted aryl rings are also contemplated.
- Glutamine analogs include, but are not limited to, ⁇ -hydroxy derivatives, ⁇ -substituted derivatives, cyclic derivatives, and amide substituted glutamine derivatives.
- Example phenylalanine analogs include, but are not limited to, para-substituted phenylalanines, ortho- substituted phenyalanines, and meta- substituted phenylalanines, wherein the substituent includes an alkynyl group, a hydroxy group, a methoxy group, a methyl group, an allyl group, an aldehyde, a nitro, a thiol group, or keto group, or the like.
- UAAs include, but are not limited to, p-ethylthiocarbonyl-L- phenylalanine, p-(3-oxobutanoyl)-L-phenylalanine, 1,5- dansyl-alanine, 7- amino-coumarin amino acid, 7-hydroxy-coumarin amino acid, nitrobenzyl- serine, O-(2-nitrobenzyl)-L-tyrosine, p-carboxymethyl-L- phenylalanine, p- cyano-L-phenylalanine, m-cyano-L-phenylalanine, biphenylalanine, 3-amino- L-tyrosine, bipyridyl alanine, p-(2-amino- 1 - hydroxyethyl)-L- phenylalanine, p-isopropylthiocarbonyl-L- phenylalanine, 3-nitro- L- tyrosine and p
- UAA uptake by a cell can be considered when designing and selecting UAAs, for instance, for incorporation into a protein.
- the high charge density of ⁇ -amino acids indicates that these compounds are unlikely to be cell permeable.
- Natural amino acids are taken up into the cell via a collection of protein- based transport systems often displaying varying degrees of amino acid specificity. A rapid screen can be done to identify which UAAs, if any, are taken up by cells.
- biosynthetic pathways already exist in cells for the production of amino acids and other compounds. While a biosynthetic method for a particular UAA may not exist in nature, for instance, in a cell, such methods are contemplated. In some examples, the UAA is not added to the growth medium of cells expressing MO-RS and O-tRNA; instead the cell also makes the UAA.
- biosynthetic pathways for UAAs can be optionally generated in host cell by adding new enzymes or modifying existing host cell pathways. Additional new enzymes are optionally naturally occurring enzymes or artificially evolved enzymes.
- the biosynthesis of p-aminophenylalanine relies on the addition of a combination of known enzymes from other organisms.
- the genes for these enzymes can be introduced into a cell by transforming the cell with a plasmid that includes the genes.
- the genes, when expressed in the cell, provide an enzymatic pathway to synthesize the desired compound.
- Artificially evolved enzymes are also optionally added into a cell in the same manner. In this manner, the cellular machinery and resources of a cell are manipulated to produce UAAs.
- nucleic acid molecules that encode for MO- RS proteins and O-tRNAs.
- a peptide of interest is encoded by its corresponding nucleic acid sequence (for instance, an mRNA or genomic DNA).
- nucleic acid sequences encoding O-tRNAs and MO-RSs are contemplated herein, at least, to make and use the O-tRNAs and MO-RS peptides of the disclosed compositions and methods.
- in vitro nucleic acid amplification such as polymerase chain reaction (PCR) can be utilized as a method for producing nucleic acid sequences encoding O-tRNAs and MO-RSs.
- PCR is a standard technique, which is described, for instance, in PCR Protocols: A Guide to Methods and Applications (Innis et al., San Diego, CA:Academic Press, 1990), or PCR Protocols, Second Edition (Methods in Molecular Biology, Vol. 22, ed. by Bartlett and Stirling, Humana Press, 2003).
- a representative technique for producing a nucleic acid sequence encoding an O-tRNA or MO-RS by PCR involves preparing a sample containing a target nucleic acid molecule that includes the O-tRNA or MO-RS sequence.
- DNA or RNA can serve as a suitable target nucleic acid molecule for PCR reactions.
- the target nucleic acid molecule can be extracted from cells by any one of a variety of methods well known to those of ordinary skill in the art (for instance, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989; Ausubel et al., Current Protocols in Molecular Biology, Greene Publ.
- O-tRNAs and MO-RSs are expressed in a variety of cell types; for example, prokaryotic and eukaryotic cells.
- RNA is the initial target
- the RNA is reverse transcribed (using one of a myriad of reverse transcriptases commonly known in the art) to produce a double-stranded template molecule for subsequent amplification.
- This particular method is known as reverse transcriptase (RT)-PCR.
- RT-PCR Representative methods and conditions for RT-PCR are described, for example, in Kawasaki et al. (In PCR Protocols, A Guide to Methods and Applications, Innis et al. (eds.), 21-27, Academic Press, Inc., San Diego, California, 1990).
- primers typically, at least 10 consecutive nucleotides of an O-tRNA or MO-RS nucleic acid sequence
- Variations in amplification conditions may be required to accommodate primers and amplicons of differing lengths and composition; such considerations are well known in the art and are discussed for instance in Innis et al. (PCR Protocols, A Guide to Methods and Applications, San Diego, CA:Academic Press, 1990). From a provided O-tRNA or MO-RS nucleic acid sequence, one skilled in the art can easily design many different primers that can successfully amplify all or part of an O-tRNA or MO-RS -encoding sequence.
- nucleic acid sequences encoding O-tRNAs and MO-RSs See, for instance, SEQ ID NOs: 33 and 34.
- nucleic acid sequences are disclosed herein, one of skill in the art will appreciate that also provided are many related sequences with the functions described herein, for instance, nucleic acid molecules encoding conservative variants of an O-tRNA or an MO-RS disclosed herein.
- sequence identity a measure of similarity between two nucleic acid sequences or between two amino acid sequences expressed in terms of the level of sequence identity shared between the sequences. Sequence identity is typically expressed in terms of percentage identity; the higher the percentage, the more similar the two sequences.
- NCBI National Center for Biotechnology Information
- BLASTTM Basic Local Alignment Search Tool
- NCBI National Center for Biotechnology Information
- NCBI Bethesda, MD
- sequence-analysis programs blastp, blastn, blastx, tblastn and tblastx A description of how to determine sequence identity using this program is available on the internet under the help section for BLASTTM.
- Nucleic acid sequences with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the O-tRNA or MO-RS of interest.
- O-tRNA or MO-RS nucleic acid variants hybridize to a disclosed (or otherwise known) O-tRNA or MO-RS nucleic acid sequence, for example, under low stringency, high stringency, or very high stringency conditions.
- Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences.
- the temperature of hybridization and the ionic strength (especially the Na + concentration) of the hybridization buffer will determine the stringency of hybridization, although wash times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and 11. The following are representative hybridization conditions and are not meant to be limiting.
- Hybridization 6x SSC at RT to 55°C for 16-20 hours Wash at least twice: 2x-3x SSC at RT to 55°C for 20-30 minutes each.
- MO-RS variants include the substitution of one or several amino acids for amino acids having similar biochemical properties (so-called conservative substitutions). However the mutation engineered to increase the interaction between the MO-RS and the O-tRNA is retained (e.g., the
- MO-RS variants can have no more than 3, 5, 10, 15, 20, 25, 30, 40, or 50 conservative amino acid changes.
- Table shows exemplary conservative amino acid substitutions that can be made to an MO- RS peptide:
- the MO-RS protein has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to SEQ ID NO: 36 and includes an Asp265Arg substitution.
- the MO-RS protein can include an Asp265Arg substitution as well as other substitutions that generate an MO-RS specific for a particular UAA.
- Exemplary other substitutions that can be made to SEQ ID NO: 36, along with the Asp265Arg substitution include but are not limited to: Y37G, D182G, L186A; Y37L, D182S, F183A, L186A; Y37T, D182T, L183M; or Y37G, D182S, F183M. Nucleic acids that encode such proteins are also encompassed by this disclosure. L. Vectors
- Eukaryotic host cells are provided that are genetically engineered (for instance, transformed, transduced or transfected) with one or more nucleic acid molecules encoding O-tRNA, and/or an MO-RS (for instance, an O-RS that is specific for a UAA), or constructs which include a nucleic acid molecule encoding an O-tRNA and/or a MO-RS (for instance, a vector) which can be, for example, an expression vector.
- the coding regions for the orthogonal tRNA, the mutated orthogonal tRNA synthetase, and the protein to be derivatized are operably linked to gene expression control elements that are co-transduced into the desired host cell, for instance a eukaryotic pol III promoter such as a type-3 pol III promoter or an internal leader promoter.
- a eukaryotic pol III promoter such as a type-3 pol III promoter or an internal leader promoter.
- a nucleic acid molecule encoding all or part of a protein of interest is obtained using methods such as those described herein.
- the protein-encoding nucleic acid sequence is cloned into an expression vector that is suitable for the particular host cell of interest using standard recombinant DNA procedures.
- Expression vectors include (among other elements) regulatory sequences (for instance, eukaryotic promoters, such as a pol II promoter or internal leader promoter) that can be operably linked to the desired protein-encoding nucleic acid molecule to cause the expression of such nucleic acid molecule in the host cell.
- Expression vectors can also include an origin of replication, marker genes that provide phenotypic selection in transformed cells, one or more other promoters, and a polylinker region containing several restriction sites for insertion of heterologous nucleic acid sequences.
- heterologous protein(s) such as those that include a UAA
- the host cell is transfected with (or infected with a virus containing) the expression vector using any method suitable for the particular host cell. Such transfection methods are also well known in the art and non-limiting exemplar methods are described herein.
- the transfected (also called, transformed) host cell is capable of expressing the protein encoded by the corresponding nucleic acid sequence in the expression cassette. Transient or stable transfection of the host cell with one or more expression vectors is contemplated by the present disclosure.
- heterologous proteins such as yeasts and vertebrate cells (such as mammalian cells), including (as appropriate) primary cells and immortal cell lines.
- yeasts and vertebrate cells such as mammalian cells
- primary cells and immortal cell lines Numerous representatives of each cell type are commonly used and are available from a wide variety of commercial sources, including, for example, ATCC, Pharmacia, and Invitrogen.
- Pichia pastoris expression systems obtained from Invitrogen (Carlsbad, California), can be used to express a MO-RS peptide.
- Such systems include suitable Pichia pastoris strains, vectors, reagents, transformants, sequencing primers, and media.
- Available strains include KM71H (a prototrophic strain), SMDl 168H (a prototrophic strain), and SMDl 168 (a pep4 mutant strain) (Invitrogen).
- Schizosaccharomyces pombe and Saccharomyces cerevisiae are other yeasts that are commonly used.
- the plasmid YRp7 (Stinchcomb et al., Nature, 282:39,1979; Kingsman et al., Gene, 7:141, 1979; Tschemper et al., Gene, 10:157, 1980) is commonly used as an expression vector in Saccharomyces.
- This plasmid contains the trpl gene that provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, such as strains ATCC No. 44,076 and PEP4-1 (Jones, Genetics, 85:12, 1977).
- the presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
- Yeast host cells can be transformed using the polyethylene glycol method, as described by Hinnen (Proc. Natl. Acad. ScL USA, 75:1929, 1978). Additional yeast transformation protocols are set forth in Gietz et al. (Nucl. Acids Res., 20(17): 1425, 1992) and Reeves et al. (FEMS, 99(2-3): 193- 197, 1992).
- the termination sequences associated with these genes are also ligated into the expression vector 3' of the sequence desired to be expressed to provide polyadenylation of the mRNA and termination.
- Any plasmid vector containing a yeast-compatible promoter (such as a pol II promoter) capable of efficiently transcribing a nucleic acid sequence encoding a MO-RS, an origin of replication, and a termination sequence is suitable.
- Mammalian host cells can also be used for heterologous expression of an MO-RS peptide.
- suitable mammalian cell lines include, without limitation, monkey kidney CVI line transformed by SV40 (COS -7, ATCC CRL 1651); human embryonic kidney line 293S (Graham et al., J. Gen. Virol., 36:59, 1977); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells (Urlab and Chasin, Proc. Natl. Acad. Sci USA, 77:4216, 1980); mouse Sertoli cells (TM4, Mather, Biol.
- monkey kidney cells CVI-76, ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor cells (MMT 060562, ATCC CCL 5 1); rat hepatoma cells (HTC, MI.54, Baumann et al, J. Cell Biol, 85:1, 1980); and TRI cells (Mather et al, Annals N.Y.
- Expression vectors for these cells ordinarily include (if necessary) DNA sequences for an origin of replication, a promoter capable of transcribing a nucleic acid sequence encoding a prokaryotic tRNA, wherein the promoter sequence usually is located 5' of the nucleic acid sequence to be expressed, a ribosome binding site, an RNA splice site, a polyadenylation site, and/or a transcription terminator site.
- Kits are also a feature of this disclosure.
- a kit for producing a protein that includes at least one UAA in a eukaryotic cell includes a plasmid that includes a nucleic acid molecule that encodes an MO-RS, for example, a mutated orthogonal aminoacyl-tRNA synthetase specific for the UAA to be incorporated.
- the kit further includes a nucleic acid molecule that encodes an O-tRNA. The tRNA and the MO-RS form an orthogonal pair.
- a kit can also include, in certain embodiments, eukaryotic cells (for example, but not limited to yeast or mammalian cell lines) with orthogonal tRNA and unnatural-amino-acid-specific MO-RS genes integrated into the chromosome.
- the kit includes eukaryotic cells (for examples mammalian cells or yeast cells) with an inactivated NMD pathway. Kits such as these enable a user to transfect a gene of interest to make proteins containing UAAs.
- the elements of a kit are provided in separate containers. The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described. EXAMPLES Example 1: Materials and Methods
- OmeTyr and Bpa were purchased from Chem-Impex. DanAla was synthesized using a procedure previously described (see, for instance, Summerer et al. (2006) Proc. Natl. Acad. ScL U. S. A. 103, 9785-9789). AU other chemicals were purchased from Sigma- Aldrich.
- Plasmid pCLHF is a derivative of pCLNCX (Imgenex), and contains the hygromycin resistance gene instead of the neomycin resistance gene.
- the amber stop codon TAG was introduced into the enhanced GFP (EGFP) gene at position 182 through site-directed mutagenesis.
- the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE; Zufferey et al., (1999) J. Virol. 73, 2886-2892) was added to the 3' end of the GFP-TAG mutant gene.
- the GFP-TAG- WPRE gene fragment was ligated into the Hind III and CIa I sites of pCLHF to generate plasmid pCLHF-GFP-TAG.
- the E. coli TyrRS gene was amplified from E. coli genomic DNA using the primer sequences CCACCATGGAACTCGAGATTTTGATGGCAAGCAGTAACTTGATTAAAC (SEQ ID NO: 1) and
- GGAAGGATTCGAACCTTCGAAGTCGATGACGGCAGATTTAG SEQ ID NO: 4 through Klenow extension.
- Other tRNA constructs were made by PCR using tRNA2 as the template.
- Genes for EctRNA ⁇ A and the mutant synthetase specific for DanAla were amplified from plasmid pLeuRSB8T252A 20 using PCR.
- E. coli LeuRS gene was amplified from E. coli genomic DNA using the primers GCCTCGAGAAGAGCAATACCGCCCGG (SEQ ID NO: 5) and CGCTAGCTTAGCCAACGACCAGATTGAGGAG (SEQ ID NO: 6).
- the Hl promoter was amplified from plasmid pSUPER (OligoEngine).
- pBluescript II KS (Stratagene) was used as the backbone for construction.
- the PGK promoter and the SV40 polyA signal were inserted between EcoR I and Not I sites.
- the E. coli TyrRS gene was inserted between the PGK and SV40 polyA sequences using the introduced Xho I and Nde I sites.
- the Hl promoter containing the BgI II and Hind III sites at the 3' end was cloned into the EcoR I and CIa I sites.
- the EctRNA ⁇ ⁇ A was then inserted between the BgI II and Hind III sites.
- a gene cassette containing the SV40 promoter followed by the neomycin resistance gene and the SV40 poly A signal was amplified from pCDNA3 (Invitrogen) and inserted into the CIa I and Kpn I sites.
- Other tRNA/synthetase plasmids were modified from plasmid pEYCUA-YRS by swapping the synthetase gene and/or the tRNA gene, or by inserting various 3 '-flanking sequences after the tRNA.
- DMEM Dulbecco's modified Eagle's medium
- 293T cells were co-transfected with the retroviral vector pCLHF-GFP-TAG and the packaging vector pCL-Ampho (Imgenex) using FuGENE 6 transfection reagent (Roche). Viruses were harvested after 48 hours and used to infect HeLa cells grown in 50% conditioned medium in the presence of 8 ng/ml hexadimethrine bromide (Sigma). From the next day on, cells were split to a very low confluence. Stably infected cells were selected with 200 ng/ml hygromycin (Invitrogen). Hygromycin (50 ng/ml) was always present in subsequent cell culture to ascertain plasmid DNA maintenance.
- Cells were plated and grown in Neurobasal-A (Invitrogen) containing 2% B-27 (Life Technologies), 1.8% HEPES, and 2 mM glutamine (Life Technologies). Half of the medium was replaced next day. For imaging, the cells cultured for 3 days were transfected with Lipofecamine 2000, changed into fresh medium with 1 mM OmeTyr or Bpa after 5 hours, and cultured for another 24 hours prior to testing.
- RNA was prepared from the GFP-TAG HeLa cells transfected with different tRNA/aaRS constructs using PureLink miRNA Kit (Invitrogen). The RNA was denatured, electrophoresed on 15% PAGE gel, blotted onto Hybond-N (Amersham) membrane, and crosslinked by ultraviolet fixation. 32 P-labeled DNA probes specific for the EctRNA ⁇ ⁇ A were made using Klenow extension with the primer sequences:
- AACCTTCGAAGTCGATGACGGCAGATTTACAGTCTGC (SEQ ID NO: 7) and primer CCGTCTAAATGTCAGACGAGGGAAACCGGCGAG (SEQ ID NO: 8).
- membranes were hybridized with 32 P-labeled cDNA probes (0.5-2 x 10 7 c.p.m./mL) in the same buffer plus 50 ⁇ g/mL salmon sperm DNA at 58 0 C overnight.
- Hybridized membrane was sequentially washed with high stringency buffer (40 niM Na 2 HPO 4 , 1 niM EDTA, 1% SDS, 58 0 C) twice and exposed to an X-ray film (Kodak) for 48 hours.
- high stringency buffer 40 niM Na 2 HPO 4 , 1 niM EDTA, 1% SDS, 58 0 C
- GPDH glyceraldehyde-3-phosphate dehydrogenase
- GFP-TAG HeLa cells were transfected with plasmid DNA by lipofection 2000 according to the protocol of the vendor (Invitrogen).
- UAAs (1 mM) were added into the medium immediately after transfection.
- Cells were collected after 48 hours, washed twice, and resuspended in 1 mL of PBS containing 0.05 ⁇ g/mL propidium iodide. Samples were analyzed with a FACScan (Becton & Dickinson).
- Fluorescence images were acquired on an Olympus X81 inverted microscope using a 2Ox objective.
- filters were 480/30 nm for excitation and 535/40 nm for emission.
- filters were 580/20 nm for excitation and 675/130 nm for emission.
- Example 2 Expression of Orthogonal tRNAs in Mammalian Cells This Example demonstrates efficient expression of prokaryotic orthogonal tRNAs in mammalian cells. Although particular methods of expressing prokaryotic orthogonal tRNAs in mammalian cells are described, one of skill in the art will appreciate that similar methods can be used to express prokaryotic tRNAs in other eukaryotic cells using other pol III promoters. One way to generate an orthogonal tRNA/synthetase pair is to import a tRNA/synthetase pair from species in a different kingdom because the cross aminoacylation between different species is often low. However, expression of functional E. coli tRNAs in mammalian cells is challenging.
- E. coli and mammalian cells differ significantly in tRNA transcription and processing.
- E. coli tRNAs are transcribed by the sole RNA polymerase through promoters upstream of the tRNA structural gene.
- the transcription of mammalian tRNA genes depends principally on promoter elements within the tRNA known as the A and B box sequences, which are recognized by RNA polymerase III (pol III) and its associated factors (Galli et al, (1981) Nature 294, 626-631). While all E. coli tRNA genes encode full tRNA sequences, mammalian tRNAs have the 3'-CCA sequence added enzymatically by the tRNA nucleotidyltransferase after transcription.
- E. coli tRNAs especially those diverge from the preserved eukaryotic A and B box sequences, are not efficiently biosynthesized or correctly processed in mammalian cells.
- a pol III promoter lacking any requirement for intragenic elements can efficiently transcribe prokaryotic tRNAs without the preserved internal A and B boxes that are present in mammalian cells.
- the Hl promoter, type-3 pol III promoter (which does not have any downstream transcriptional elements; Myslinski et al., (2001) Nucleic Acids Res.
- the Hl promoter drives the expression of the human HlRNA gene, and thus is of mammalian origin.
- the transcription initiation site of Hl promoter is well-defined, and it can be used to generate the 5' end of the tRNA without further posttranscriptional processing.
- a fluorescence-based functional assay in mammalian cells was developed to identify the expression elements that can efficiently drive the transcription of E. coli tRNAs to generate functional tRNAs in mammalian cells (FIG. IA).
- the gene for the candidate E. coli amber suppressor tRNA EctRNA ⁇ A , whose anticodon was changed to CUA to decode the amber stop codon TAG was co-expressed with its cognate synthetase (aaRS).
- aaRS cognate synthetase
- a TAG stop codon was introduced at a permissive site of the green fluorescent protein (GFP) gene, and this mutant GFP gene was co- expressed with the EctRNA ⁇ A /aaRS pair in mammalian cells.
- GFP green fluorescent protein
- EctRNA ⁇ a UA is expressed and correctly processed to a functional tRNA, the synthetase aminoacylates this tRNA with the cognate amino acid.
- the acylated EctRNA ⁇ a UA then suppresses the TAG codon in the GFP gene, producing full-length GFP and rendering the cells fluorescent.
- this method also serves as a sensitive in vivo assay for the orthogonality of the EctRNA ⁇ A to endogenous synthetases of host cells when the cognate E.
- EctRNA ⁇ A The E. coli tyrosyl amber suppressor tRNA ( EctRNA ⁇ A ) was chosen as the candidate orthogonal tRNA because it is orthogonal to yeast synthetases and suppresses the amber stop codon efficiently in yeast when coexpressed with E. coli TyrRS (Edwards & Schimmel, (1990) MoI. Cell. Biol. 10, 1633-1641). In vitro aminoacylation assays indicate that E.
- coli TyrRS does not charge eukaryotic tRNAs (Doctor & Mudd, (1963) J. Biol. Chem. 238, 3677-3681).
- the 3' flanking sequence of the human tRNATM 61 was used.
- the 5' and 3' flanking sequences of the human tRNAfMet were found to drive the functional expression of E. coli EctRNA ⁇ A (which has the A box and B box) in mammalian cells (Drabkin et al, (1996) MoI. Cell. Biol. 16, 907-913).
- the tRNA/aaRS expression plasmid was transfected into the stable GFP-TAG HeLa cell line, and cells were analyzed with flow cytometry after 48 hours.
- the total fluorescence intensity of the green fluorescent cells indicated the amount of GFP produced, and is shown in FIG. 1C.
- the intensity of cells transfected with tRNA-2 was 10% of that of cells transfected with tRNA-4, indicating that the 3 '-flanking sequence of the human tRNATM 61 also is needed for the efficient expression of the EctRNA
- Functional tRNA was produced in mammalian cells transfected with tRNA-1 (21% of tRNA-4), in which the CCA trinucleotide but no 3 '-flanking sequence is included, which was unexpected, since mammalian cells do not encode the CCA in the tRNA gene. However, when both the CCA trinucleotide and the 3 '-flanking sequence were included in tRNA-3, the fluorescence intensity dropped dramatically to 1.3%.
- ⁇ A Very low levels of EctRNA
- the Northern blot data confirmed that the EctRNA ⁇ A was transcribed in HeLa cells, and the increase of tRNA transcription was consistent with the increase of fluorescence intensity measured by cytometry in different samples.
- the E. coli TyrRS was removed in tRNA-4 so that only EctRNAgj A was expressed.
- Transfection of the resultant plasmid in the GFP-TAG HeLa cell line did not change the fluorescence intensity of the cells, demonstrating that EctRNA ⁇ A was not aminoacylated by any synthetases in HeLa cells.
- ⁇ A in tRNA-4 construct was replaced with the E.
- This Example describes the use of an UAA specific synthetase in mammalian cells. Although particular methods of using orthogonal synthetases in mammalian cells are described, one of skill in the art will appreciate that similar methods can be used to express and use orthogonal synthetases in other eukaryotic cells.
- TAG HeLa cell line (FIG. 2C). DanAla was incorporated in 13% efficiency, and
- This Example describes the genetic encoding of UAAs in neurons. Although particular methods of genetic encoding of UAAs in mouse hippocampal and cortical neurons are described, one of skill in the art will appreciate that similar methods can be used to genetically encode UAAsin other types of neurons, and in neurons from other mammalian species, such as humans.
- Hl promoter and the 3 '-flanking sequence identified in HeLa cells also could generate functional amber suppressor tRNAs in neurons.
- Mouse hippocampal neurons were transfected with two plasmids simultaneously (FIG. 3A): the reporter plasmid pCLHF-GFP-TAG encoding a mutant GFP (182TAG) gene, and the expression plasmid encoding the E. coli TyrRS, the EctRNA ⁇ A driven by either the Hl promoter or the 5' flanking sequence of human tRNA Tyr , and a red fluorescent protein, mCherry, as an internal marker for transfection.
- EctRNA ⁇ A was driven by the 5' flanking sequence of the human tRNA Tyr .
- OmeTyr and Bpa were also genetically encoded in hippocampal and cortical neurons isolated from rats.
- This Example describes materials and methods that were used in performing
- DHlOB E. coli cells (In vitro gen, Carlsbad, CA) were used for cloning and
- PCR polymerase chain reaction
- plasmids were assembled by standard cloning methods and confirmed by DNA sequencing.
- a plasmid containing the 2 ⁇ ori, TRPl, Kan r , the CoIEl ori, and multiple cloning sites (MCS) was used as the backbone to construct plasmids expressing tRNA and synthetase.
- a spacer sequence was amplified from pCDNA3 (Invitrogen, Carlsbad, CA) using primer FW19 (SEQ ID NO: 9) 5'-ATA CTA GTG CGG GCG CTA GGG CGC TG-3' and primer FW20 (SEQ ID NO: 10) 5'-ATG GTA CCC CTG GAA GGT GCC ACT CC-3'.
- This spacer was digested with Kpn I and Spe I, and inserted at the Kpn I and Xba I site of the backbone plasmid to make plasmid p-Xd.
- the E. coli TyrRS gene was amplified from E. coli genomic DNA using primer FW21 (SEQ ID NO: 11) 5'-CAA CTA GTA TGG AGA TTT TGA
- the PCR product was digested with Sp e I and Xho I and ligated into the precut vector p415 (American Type Culture Collection, Manassas, VA) to make p415-EY.
- the gene cassette containing the GPD promoter, the E. coli TyrRS gene, and the CYCl terminator was cut from p415-EY with Sac I and Kpn I, and inserted into plasmid p-Xd to make plasmid p-TyrRS.
- the SNR52 promoter was amplified from yeast genomic DNA using primer FW16 (SEQ ID NO: 13) 5'-CAC TGC AGT CTT TGA AAA GAT AAT GTA TGA TTA TG-3' and primer FW17 (SEQ ID NO: 14) 5'-GGC CGC TCG GGA ACC CCA CCG ATC ATT TAT CTT TCA CTG CGG AG-3'.
- the EctRNA ⁇ gene followed by the 3'-flanking sequence of the SUP4 suppressor tRNA was amplified from pEYCUA-YRS (Wang et al., (2007) Nat. Neurosci.
- the RPRl promoter was amplified from yeast genomic DNA using primer FW12 (SEQ ID NO: 17) 5'-CAC TGC AGT CTG CCA ATT GAA CAT AAC ATG G-3' and primer FW13 (SEQ ID NO: 18) 5'-GGC CGC TCG GGA ACC CCA CCT GCC AAT CGC AGC TCC CAG AGT TTC-3'. It was pieced with the above EctRNA ⁇ -3' flanking sequence through overlapping PCR to make the RPRl-
- EctRNA ⁇ -3' flanking sequence cassette The cassette was digested with Pst I and Sal I, and ligated into the precut p-TyrRS to make pRPR-TyrRS.
- the gene cassette containing the 5' flanking sequence of the SUP4 suppressor tRNA, the EctRNA ⁇ , and the 3' flanking sequence of the SUP4 suppressor tRNA was amplified from plasmid pEYCUA-YRS-tRNA-5 (Wang et al.,
- the OmeRS gene was made from E. coli TyrRS gene through site-directed mutagenesis to introduce the following mutations: Y37T, D182T, and F183M.
- the OmeRS gene was digested with Spe I and Xho I, and ligated into the precut pSNR- TyrRS to make pSNR-OmeRS.
- the gene cassette containing the 5' flanking sequence of the SUP4 suppressor tRNA, the EctRNA ⁇ A , and the 3' flanking sequence of the SUP4 suppressor tRNA was amplified from plasmid pLeuRSB8T252A (Summerer et ah, (2006) Proc. Natl. Acad. ScL U.S.A. 103, 9785-9789) using primer FW27 (SEQ ID NO: 20) 5'-CAA AGC TTC TCT TTT TCA ATT GTA TAT GTG-3' and primer FW28 (SEQ ID NO: 21) 5'-GAG TCG ACA GAC ATA AAA AAC AAA AAA ATA C-3'.
- the PCR product was digested with Hind III and Sal I, and ligated into the precut pSNR-TyrRS to make ptRNA ⁇ -TyrRS.
- the E. coli LeuRS gene was amplified from E. coli genomic DNA using primer FW29 (SEQ ID NO: 22) 5'-AGC TCG AGT TAG CCA ACG ACC AGA TTG AG-3' and FW30 (SEQ ID NO: 23) 5'-AGA CTA GTA TGC AAG AGC AAT ACC GCC CG-3' .
- the PCR product was digested with Spe I and Xho I, and ligated into the precut ptRNA Leu -TyrRS to make pFS -LeuRS.
- the SNR52 promoter was amplified from pSNR-TyrRS using primer FW 16 and primer FW31 (SEQ ID NO: 24) 5'-CTA CCG ATT CCA CCA TCC GGG CGA TCA TTT ATC TTT CAC TGC GG-3'.
- the EctRNA ⁇ ° A -3' flanking sequence fragment was amplified from pLeuRSB8T252A using primer FW32 (SEQ ID NO: 25) 5'-GCC CGG ATG GTG GAA TCG GTA G-3' and primer FW28. These two PCR fragments were pieced together through overlapping PCR to make the gene cassette SNR52- EctRNA ⁇ ° A -3' flanking sequence.
- the gene cassette was digested with Pst I and Sal I, and ligated into the precut pSNR-TyrRS to make pSNRtRNA Leu -TyrRS.
- the TyrRS gene was then replaced with the E. coli LeuRS gene using Spe I and Xho I sites to make pSNR-LeuRS.
- the DanRS gene was amplified from plasmid pLeuRSB8T252A using primer FW29 and primer FW30.
- the PCR product was digested with Spe I and Xho
- a plasmid containing the 2 ⁇ ori, LEU2, Amp r , the CoIEl ori, and MCS was used as the backbone to construct the GFP-TAG reporter plasmids. Site-directed mutagenesis was used to introduce Tyr39TAG and Tyrl82TAG mutations into the EGFP gene.
- the mutant GFP-TAG gene was amplified with primer JT171 (SEQ ID NO: 26) 5'-TAG TCG GAT CCT CAG TGA TGG TGA TGG TGA TGC TTG TAC AGC TCG TCC ATG CC-3' and primer JT172 (SEQ ID NO: 27) 5'-TAG TCG TCG ACA TGG ATT ACA AAG ATG ATG ATG ATA AAG TGA GCA AGG GCG AGG AG-3' to add a His6 tag at the C-terminus and a HA tag at the N- terminus.
- the PCR product was then flanked by the ADHl promoter and ADHl terminator, and the whole gene cassette was cloned into the backbone plasmid using the Hind III and EcoR I sites to make pGFP-39TAG or pGFP-182TAG.
- RNA was prepared from yeast cells transformed with different tRNA expressing constructs using PureLink miRNA Isolation Kit (Invitrogen, Carlsbad, CA). The RNA was denatured and electrophoresed on 8% PAGE gel with 8 M urea. A large DNA sequencing gel (15 inches in length) was used to obtain high resolution. After electrophoresis, the samples were blotted onto Hybond-N+ (Amersham Biosciences, Uppsala, Sweden) membrane, and crosslinked by ultraviolet fixation.
- the membrane was hybridized overnight at 55 0 C with a biotinylated probe FW39 (SEQ ID NO: 28) 5'-TCT GCT CCC TTT GGC CGC TCG GGA ACC CC-biotin-3', which is specific for the E. coli tRNA Tyr and the EctRNA p u A .
- the hybridized probe was detected using the North2South ® chemiluminescent hybridization and detection kit (Pierce Biotechnology, Inc., Rockford, IL) according to the manufacturer's protocol. The amount of cell pellet was used to control the total RNA loaded in each lane.
- a single yeast clone was selected and cultured in 5 mL liquid medium at 30 0 C for 48 hours. These cells were used to inoculate 10 mL of fresh medium with a starting OD OOO of 0.2. Cells were grown at 30 0 C in an orbital shaker (250 rpm) for 6 hours. Cells were then pelleted, washed once with PBS, and resuspended in PBS. Samples were analyzed with a FACScanTM (Becton & Dickinson, Franklin Lakes,
- PCR product was transformed into yeast strain YVL2968 (MATa ura3-52 lys2-801 trp ⁇ l his3 ⁇ 200 leu2 ⁇ l) using the lithium acetate method. Transformed cells were plated on G418 YPAD plates for selection.
- the genomic DNA of surviving clones were amplified with primers -300 bp away from the UPFl gene (FORWARD (SEQ ID NO: 31) 5'- GAT TTG GGA GGG ACA CCT TTA TAC GC-3', REVERSE (SEQ ID NO: 32) 5'-TTC ATT AGA AGT ACA ATG GTA GCC C-3'), and the PCR products were sequenced to confirm that the UPFl gene was replaced with the Kan-MX6 through homologous recombination.
- the resultant upfl ⁇ strain was designated as LWUPF1 ⁇ .
- YVL2968 is a wild type, protease-proficient haploid strain that is derived from S288C, and it was used as the wild type strain in all of Example 6.
- Yeast culture (5 mL) was started from a single clone and grown for 48 hours. These cells were used to inoculate 200 mL fresh medium with or without 1 mM DanAla. After incubating at 30 0 C for 48 hours, cells were pelleted and lysed with Y-PER (Pierce Biotechnology, Inc., Rockford, IL) in the presence of EDTA-free protease inhibitor (Roche, Basel, Switzerland). After agitating at room temperature for 20 minutes, the mixture was sonicated for 1 minute using a Sonic Dismembrator (Fisher Scientific, Pittsburgh, PA). After centrifugation, a second Y-PER extraction and sonication was applied to the pellet.
- Wild type EGFP with a His6 tag at the C-terminus and a HA tag at the N- terminus was purified and used as the positive control.
- the same amounts of yeast cells from each sample were lysed with Y-PER in the presence of EDTA-free protease inhibitor. After centrifugation at 14,000 g for 10 minutes, 5 ⁇ l of the supernatants were loaded and separated by SDS-PAGE.
- a monoclonal penta His antibody (Invitrogen, Carlsbad, CA) was used to detect the His6-containing proteins.
- Example 6 Expression of Orthogonal tRNA in yeast and De-activation of the NMD Pathway Increases UAA Incorporation Efficiency
- This Example describes methods of improving the efficiency of methods of incorporation of unnatural amino acids.
- the results described below are demonstrate increased UAA incorporation efficiency when used with orthogonal tRNA/synthetase pairs and a pol III promoter, the efficiency of any strategy for the incorporation of UAAs (for instance, using a 5' flanking sequence methodology) is improved by de-activation of the NMD pathway in a eukaryotic cell in which the UAA is expressed, as described herein
- UAAs unnatural amino acids
- the UAA incorporation efficiency is further improved or optimized. For instance, although tens of milligrams of UAA-containing proteins were produced from 1 liter of E. coli culture, in some embodiments, the yield in yeast is only tens of micrograms.
- NMD results in a shorter lifetime for the target mRNA, and thus a lower protein yield in yeast.
- An NMD-deficient yeast strain was generated, and, as disclosed herein, this strain indeed increased the UAA incorporation efficiency in comparison to the wild-type (wt) yeast.
- This strategy also can be used effectively in mammalian cells.
- the efficacy of disrupting the NMD pathway depends on the presence of exon-intron junctions in the DNA sequence. Thus, if there are introns in the gene encoding the UAA of interest, disrupting the NMD pathway increases the efficiency of UAA incorporation.
- E. coli tRNAs are transcribed by the sole RNA polymerase (Pol) through promoters upstream of the tRNA gene.
- Pol RNA polymerase
- the transcription of yeast tRNAs by Pol III depends principally on promoter elements within the tRNA known as the A- and B-box (FIG. 4A).
- the A- and B-box identity elements are conserved among eukaryotic tRNAs, but are lacking in many E. coli tRNAs. Creating the consensus A- and B-box sequences in E. coli tRNAs through mutation could cripple the tRNA, as these nucleotides make up the conserved tertiary base pairs bridging the tRNA D- and T-loop.
- yeast tRNAs encode full tRNA sequences, whereas yeast tRNAs have the 3'-CCA trinucleotide enzymatically added after transcription. Therefore, transplanting E. coli tRNA into the tRNA gene cassette in yeast does not generate functional tRNA.
- E. coli tRNAs are expressed efficiently in yeast using the following strategy: a promoter containing the consensus A- and B- box sequences is placed upstream of the E. coli tRNA to drive transcription, and is cleaved post-transcriptionally to yield the mature tRNA (FIG. 4B).
- Two internal leader promoters, SNR52 and RPRl share a promoter organization consisting of a leader sequence in which the A- and B-boxes are internal to the primary transcript but are external to the mature RNA product. It is shown herein that the SNR52 and RPRl promoter can be exploited to express E. coli tRNAs in yeast.
- EctRNA ⁇ E. coli tyrosyl amber suppressor tRNA lacking the 3'-CCA trinucleotide was placed after the candidate promoter and followed by the 3'-flanking sequence of the yeast tRNA SUP4 (FIG. 4C).
- This tRNA gene cassette was coexpressed with the cognate E. coli tyrosyl-tRNA synthetase (TyrRS) in S. cerevisiae.
- An in vivo fluorescence assay was developed to test whether the expressed EctRNA ⁇ is functional for protein translation in yeast.
- a TAG stop codon was introduced at a permissive site (Tyr39) of the green fluorescent protein (GFP) gene, and this mutant gene is coexpressed with the EctRNA ⁇ A /TyrRS.
- EctRNA ⁇ is transcribed and correctly processed into a functional tRNA, the TyrRS will aminoacylate it with tyrosine, and the acylated EctRNA ⁇ will then suppress the TAG codon, producing full-length GFP and rendering cells fluorescent.
- the fluorescence intensities of cells indicate how efficiently a promoter can drive the functional expression of the EctRNA ⁇ in yeast.
- the EctRNA ⁇ was expressed using the conventional method, the 5 '-flanking sequence of an endogenous yeast tRNA SUP4, weak fluorescence could be detected, confirming that the 5 '-flanking sequence expressed functional EctRNA ⁇ A with low efficiency only (FIG. 4D).
- the EctRNA ⁇ was driven by the SNR52 or
- the EctRNA ⁇ were replaced with the E. coli leucyl amber suppress tRNA ( EctRNA ⁇ A ) and the TyrRS with the E. coli leucyl-tRNA synthetase (LeuRS).
- the 5'-flanking sequence of SUP4 could also drive the EctRNA ⁇ ° A expression in yeast, but the fluorescence intensity increased 4-fold when the SNR52 promoter was used (FIG. 4D).
- the EctRNA ⁇ does not have a fully matched A-box, while the EctRNA ⁇ ° A has matched A- and B-box. Regardless of the identity elements, the SNR52 promoter significantly increased the functional expression of both types of E. coli tRNAs in yeast.
- the amber stop codon TAG is the most frequently used to encode UAAs, but mRNAs containing premature stop codons are rapidly degraded in yeast by the NMD pathway, a surveillance mechanism to prevent the synthesis of truncated proteins.
- Inactivation of NMD preserved the stability of the UAG- containing target mRNA and thus enhanced the incorporation efficiency of UAAs.
- the yeast UPFl gene has been shown to be essential for NMD, deletion of which restores wild-type decay rates to nonsense-containing mRNA transcripts. Therefore, a upfl ⁇ strain of S. cerevisiae was generated, and the UAA incorporation efficiency was compared in this strain to the wild-type strain.
- the EctRNA ⁇ ° A driven by the SNR52 promoter and the DanRS 11 were used to incorporate the fluorescent UAA DanAla (FIG. 5C) into the GFP at site 39.
- DanAla was added to the growth media, the fluorescence intensity of the upfl ⁇ strain was doubled compared to that of the wt strain (FIG. 5A).
- the intensities dropped to low background levels, suggesting high specificity of the EctRNA ⁇ ° A /DanRS pair for DanAla.
- the GFP(39TAG) gene was expressed in the upfl ⁇ strain using the DanRS and the EctRNA ⁇ ° A was driven by the SNR52 promoter (FIG. 5B).
- the full-length GFP was produced in an overall purified yield of 15 ⁇ 2 mg/1, about 300-fold higher than the previous system and comparable to the yield in E. coli.
- Example 7 Using Orthogonal tRNA/MO-RS Pairs to Express Unnatural Amino Acids in Eukaryotic Cells
- This example demonstrates expression in eukaryotic cells of a prokaryotic orthogonal tRNA, together with an unnatural-amino-acid specific MO-RS, in order to incorporate unnatural amino acids in the eukaryotic cells.
- MO-RS unnatural-amino-acid specific MO-RS
- a tRNA/mutated synthetase pair is selected that will be orthogonal to the eukaryotic cell in which incorporation of the unnatural amino acid is desirable.
- One way to identify a tRNA/ mutated synthetase pair that will be orthogonal to the eukaryotic cell is to select a tRNA/mutated synthetase pair from species in a different kingdom, for example a prokaryotic tRNA/mutated synthetase pair, since the cross aminoacylation between different species often is low.
- An orthogonal tRNA/mutated synthetase pair will exhibit little or no crosstalk with endogenous eukaryotic tRNA/synthetase pairs.
- a promoter also is chosen that will drive expression of the O-tRNA. Expression of functional prokaryotic tRNAs in eukaryotic cells can be difficult because of the different tRNA transcription and processing involved in prokaryotes and eukaryotes. However, a pol III that lacks any requirement for intragenic elements can efficiently transcribe prokaryotic tRNAs in eukaryotic cells. Different pol III polymerases are chosen depending on the type of eukaryotic cell and the prokaryotic tRNA to be expressed. In some embodiments, the pol III promoter is a type-3 promoter.
- promoters of use include the Hl promoter, as well as the promoters for U6 snRNA, 7SK, and MRP/7-2.
- a promoter also is selected that will drive expression of the MO-RS. Numerous promoters will accomplish this goal.
- One specific, non-limiting example is a PGK promoter.
- an internal leader promoter is selected.
- Certain type 3 Pol III promoters from yeast e.g., internal leader Pol III promoters
- yeast are transcribed together with the RNA, and are then cleaved post-transcriptionally to yield the mature RNA.
- Specific, non- limiting examples of internal leader pol III promoters of yeast include the SNR52 promoter and the RPRl promoter.
- the O-tRNA chosen is one that recognizes a suppressor codon, such as a stop codon or an extended codon, for example amber, ochre, or opal.
- the MO-RS chosen is specific for an unnatural amino acid.
- One or more vectors (such as an expression plasmid or viral vector) are selected for transforming the eukaryotic cell with the O-tRNA and the MO-RS.
- the pol III promoter is inserted upstream of the O-tRNA gene using standard molecular biology techniques, the promoter that will drive expression of the MO-RS is inserted upstream of the MO-RS gene in the same or a different vector.
- the eukaryotic cell is then transformed with the vector(s) using conventional techniques.
- a source of the unnatural amino acid is provided to the transformed cell, for example in the cell culture medium.
- the MO-RS charges the O-tRNA with the unnatural amino acid
- the O-tRNA recognizes the stop or extended codon
- the unnatural amino acid is inserted into peptide.
- This Example describes the use of an UAA specific synthetase in stem cells. Although particular methods of using orthogonal synthetases in stem cells are described, one of skill in the art will appreciate that similar methods can be used for other stem cells and other UAAs (as well as with other synthetases, such as the MORS s described herein). These results also demonstrate that the Hl promoter strategy for expressing orthogonal tRNA works in stem cells. It was confirmed that the Hl promoter and the 3 '-flanking sequence identified in HeLa cells also can generate functional amber suppressor tRNAs in neural stem cells. HCN- A94 cells were transfected with two plasmids simultaneously (FIG.
- ⁇ A was driven by the Hl promoter showed intense green fluorescence, whereas no green fluorescence could be detected in neurons in which the EctRNA
- UAAs could be genetically encoded in stem cells using the EctRNA
- This example describes methods used to mutate the E. coli synthetase (TyrRS; SEQ ID NO: 36) to improve improve the recognition of the E. coli TyrRS toward tRNA
- Optimizing the anticodon recognition between orthogonal tRNA and synthetase significantly increased the incorporation efficiencies of various unnatural amino acids in mammalian cells, and this enhanced incorporation enabled in vivo photocros slinking of interacting proteins in mammalian cells with high efficiency.
- genes for the E. coli tRNAjJ A and the synthetase mutant to be tested were transfected into a stable clonal HeLa cell line, in which the green fluorescent protein (GFP) gene containing a premature UAG stop codon at a permissive site (Tyr39) was integrated into the genome (FIG. 9A). Suppression of UAG39 by the tRNAjj A /synthetase pair results in full-length fluorescent GFP.
- the total fluorescence intensity of cells measured by fluorescence-activated cell sorting (FACS) reports the incorporation efficiency and thus the affinity of the mutant synthetase for the tRNAjj A .
- the Asp265Gln and Asp265Tyr mutants decreased the fluorescence intensity to below 10%, while the Asp265Arg mutant increased the fluorescence intensity to 186%, indicating that the Asp265Arg mutant TyrRS (EwtYRS) has higher activity toward the IRNA ⁇ A than wt TyrRS (FIG. 9C).
- Asp265Arg mutation can generally be transplanted to other TyrRS -derived synthetases (for example, synthetases specific for p-iodo-phenylalanine, p-acetyl-phenylalanine, p-nitro- phenylalanine, p-amino-phenylalanine, p-carboxylmethyl-phenylalanine, L-(7- hydroxycoumarin-4-yl) ethylglycine, and so on.)
- the mutation can be made at Asp265Arg for all synthetases.
- Prokaryotic TyrRS differ distinctly from archaeal and eukaryotic TyrRS in anticodon recognition (Tsunoda et al., Nucleic Acids Res., 2007, 35:4289- 4300).
- base ⁇ 35 is flipped oppositely to G34 and A36 and recognized by the extra C-terminal domain characteristic of prokaryotic TyrRS, and base G34 is stacked directly on base A36.
- all three anticodon bases are in the same side, and G34 is stacked with hydrophobic residues of the TyrRS (for example compare FIGS. 5B and D of Kobayashi et al., Nat. Struct.
- G34 is recognized by the carboxyl group of Asp in both prokaryotic and archaeal/eukaryotic TyrRS, the helices in which this Asp residue locates do not correspond (for example compare FIGS. 5 A and C of Kobayashi et al., Nat. Struct. Biol, 2003, 10:425-32).
- Kobayashi et al, (Id.) showed that the initial aminoacylation rate of the cognate tRNAjJ A by the archaeal Methanococcus jannaschii TyrRS can be increased.
- Kobayashi et al. did not show whether this mutation can increase unnatural amino acid incorproation.
- an increase in aminoacylation rate does not necessarily mean an increase in unnatural amino acid incorporation, because unnatural amino acid incorporation involves multiple steps and aminoacylation is merely one of those steps.
- the prokaryotic TyrRS could be optimized for its cognate tRNAjJ A that lead to higher incorporation efficiency for Tyr and various unnatural amino acids into proteins.
- the Asp265Arg mutation can be generally transplanted into multiple synthetases that are specific for different unnatural amino acids.
- EAziRS was used to incorporate Azi into glutathione ⁇ -transferase (GST) and photocros slinking in HEK293T cells.
- GST glutathione ⁇ -transferase
- E. coli GST is homodimer (Nishida et al, J. MoI. Biol, 1998, 281: 135-147). Three sites at the dimer interface, Asn87 in a loop and Tyr92 and Vall25 in ⁇ -helices were chosen for incorporating Azi (FIG. 10A).
- crosslinked GST migrated at different positions in the gel depending on where Azi was incorporated.
- One possible explanation is that the crosslinking of GST dimer with 2 Azis generates an interlocked polypeptide with a core and 4 arms. Different Azi incorporation sites will change the core size and arm length in the crosslinked product, thus leading to different mobility in gel. This effect may be analogous to how disulfide bonds influence protein mobility in nonreducing electrophoresis conditions.
- Another possibility to be excluded by mass spectrometry is that GST was crosslinked to other proteins.
- the closest residue on the opposite monomer is 6.50 A, 6.36 A, and 9.70 A (distance between the ⁇ carbons) away, respectively. That site 125 has the highest crosslinking efficiency suggests that space for proper accommodating the photocrosslinker is important.
- the bulky side chain of Bzo is more likely to disrupt the protein interaction under study.
- GST crosslinked at different sites showed different migration positions in the gel, indicating that one should not look for the crosslinked product at positions corresponding to the sum of molecular weight of interacting proteins only.
- cells were exposed to UV light for 10 minutes and detection was performed on cell lysate directly in the Azi crosslinking experiment.
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
This disclosure concerns compositions and methods for improving the incorporation of unnatural amino acids (UAAs) into proteins in eukaryotic cells. It is shown herein that mutation of a prokaryotic tRNA synthetase to increase the interaction with the corresponding tRNA anticodon region results in increased UAA incorporation efficiency in mammalian cells.
Description
IMPROVING UNNATURAL AMINO ACID INCORPORATION IN
EUKARYOTIC CELLS
CROSS REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No.
61/184,417, filed June 5, 2009, herein incorporated by reference.
FIELD OF THE DISCLOSURE
This disclosure concerns compositions and methods for genetically incorporating unnatural amino acids (UAAs) in eukaryotic cells using an improved synthetase. For example, an Asp265Arg mutation in synthetases derived from the E. coli tyrosyl-tRNA synthetase (TyrRS) in combination with tRNA^A can be used to incorporate UAAs into proteins in mammalian and yeast cells.
BACKGROUND
Unnatural amino acids (UAAs) have been genetically encoded in E. coli, yeast, and mammalian cells using orthogonal tRNA- synthetase pairs and unique codons (Wang et al, Science, 2001, 292:498-500; Wang et ah, Annu. Rev. Biophys. Biomol. Struct., 2006, 35:225-49). This technology enables novel chemical and physical properties to be selectively introduced into proteins directly in live cells, and thus have potential for addressing molecular and cell biological questions in the native cell settings. While the incorporation efficiency of unnatural amino acids is high in E. coli and yeast (Wang and Wang, /. Am. Chem. Soc, 2008, 130:6066-7; Chen et al., J. MoI. Biol. , 2007, 371 : 112-22), current methods only permit low incorporation efficiency in mammalian cells. Inefficient incorporation results in reduced yield of proteins containing the UAA, which may not be sufficient to perform the desired function and to be detected. In addition, as stop codons are the most frequently used to encode unnatural amino acids, low incorporation efficiency often leads to increase of truncated proteins products, which may negatively interfere with the function of the full-length target protein.
Therefore, efficient incorporation of unnatural amino acid is critical for their effective application in mammalian cells. Previous efforts to improve the efficiency focused on optimizing the expression of the orthogonal tRNA and synthetase (Wang and Wang, J. Am. Chem. Soc, 2008, 130:6066-7; Chen et ah, J. MoI. Biol, 2007, 371 : 112-22; Liu et al., Nat. Methods, 2007, 4:239-44; Wang et al., Nat. Neurosci. , 2007, 10:1063-72). The present disclosure is directed to a different approach: namely increasing the affinity of the orthogonal tRNA toward the orthogonal synthetase.
SUMMARY OF THE DISCLOSURE
Disclosed herein are methods of increasing the incorporation of unnatural amino acids (UAAs) in eukaryotic {e.g., mammalian or yeast) cells. In particular methods, the method uses a mutated orthogonal synthetase that increases the affinity of the corresponding orthogonal tRNA toward the synthetase. Methods are provided for incorporating a UAA into a protein in a eukaryotic cell. In particular examples the method includes expressing a recombinant mutant orthogonal synthetase (MO-RS) in the cell (such as a non-archaeal MO-RS), wherein the MO-RS includes an Asp265Arg or equivalent mutation (wherein the amino acid numbering corresponds to wild-type E. coli TyrRS, SEQ ID NO: 36 shows the wt sequence). The MO-RS is specific for the UAA. The method can also include expressing an orthogonal tRNA (O-tRNA) that corresponds to the MO-RS, thereby permitting formation of an orthogonal tRNA-mutant synthetase pair in the cell. In particular examples, the tRNA is expressed from a pol III promoter. For example, a eukaryotic cell can be transduced with a nucleic acid molecule that encodes a pol III promoter operably linked to a nucleic acid molecule that encodes the orthogonal tRNA, thereby expressing the orthogonal tRNA in the cell. The cell is incubated or grown in growth or culture medium that includes the UAA to be incorporated under conditions that permit the MO-RS to charge the O-tRNA with the UAA, thereby generating acylated tRNA which can incorporate the UAA into proteins in the cell. In a specific example, for example if the cell is a yeast cell, the cell is substantially deficient in Nonsense-Mediated mRNA Decay (NMD).
Also provided are isolated mutant sythetase proteins, nucleic acid molecules encoding such proteins, vectors containing such nucleic acid molecules, and cells containing such molecules. In some examples the cells are stable eukaryotic cell lines, which may also be NMD-deficient. The foregoing and other features will become more apparent from the following detailed description of several embodiments, which proceeds with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE FIGURES FIG. 1 includes several panels demonstrating efficient expression of prokaryotic tRNA in mammalian cells using an Hl promoter. FIG. IA is a schematic diagram of the expression plasmid and the reporter plasmid used in a fluorescence-based assay for the expression of functional tRNA in mammalian cells. The candidate amber suppressor tRNA and its cognate synthetase were expressed using the tRNA/aaRS expression plasmid. A reporter plasmid was used to express green fluorescent protein (GFP) with an amber stop codon at a permissive site. FIG. IB is a schematic illustration of several tRNA/aaRS expression plasmids that use different elements to drive tRNA transcription and processing. FIG. 1C is a graph showing the total fluorescence intensity of the fluorescent GFP-TAG in HeLa cells after transfection with the constructs shown in FIG. IB. The intensities were normalized to those of cells transfected with tRNA4. The values (±SD) were: GFP- TAG HeLa 0.3 ± 0.1, tRNAl 21 ± 11, tRNA2 10 ± 4.7, tRNA3 1.3 ± 0.7, tRNA4 100 ± 12, tRNA5 1.4 ± 0.5. For all samples, n = 5. FIG. ID is a digital image of a Northern blot analysis showing the amount of transcribed EctRNA^A in HeLa cells. Transcript of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used to normalize the total amount of RNA in different samples.
FIG. 2 includes several panels demonstrating that unnatural-amino-acid specific synthetases evolved in yeast are functional in mammalian cells. FIG 2A shows the chemical structures of the three unnatural amino acids used. FIG. 2B is a pair of graphs showing incorporation of OmeTyr and Bpa into GFP in the GFP-TAG
HeLa cells using the EctRNA^A and corresponding synthetases evolved from E.
coli TyrRS in yeast. All data were normalized to those obtained from GFP-TAG HeLa cells transfected with the EctRNA^A and wt E. coli TyrRS. The percentages of fluorescent cells were: 71 ± 19 (+ OmeTyr, n=3), 4.8 ± 3.4 (- OmeTyr, n=3), 47 ± 14 (+ Bpa, n=3), and 4.2 ± 1.5 (- Bpa, n=3). The total fluorescence intensities were: 41 ± 9.5 (+ OmeTyr, n=3), 0.17 ± 0.02 (- OmeTyr, n=3), 13 ± 1.4 (+ Bpa, n=3), and 0.11 ± 0.06 (- Bpa, n=3). FIG 2C is a pair of graphs showing incorporation of Dan- Ala into GFP in the GFP-TAG HeLa cells using the EctRNA^A and a Dan-Ala specific synthetase evolved from E. coli LeuRS. The data in this figure were normalized to those obtained from GFP-TAG HeLa cells transfected with the EctRNA^A and wt E. coli LeuRS. The percentages of fluorescent cells were: 42 ± 1.3 (+ DanAla, n=3) and 5.9 ± 2.6 (- DanAla, n=3). The total fluorescence intensities were: 13 ± 2.1 (+ DanAla, n=3) and 1.4 ± 1.0 (- DanAla, n=3).
FIG. 3 includes several panels demonstrating that unnatural amino acids can be genetically encoded in neurons. FIG. 3 A is a schematic illustration of the reporter plasmid expressing the GFP mutant gene with a TAG stop codon at site 182 and the expression plasmid encoding the EctRNA^A , the synthetase, and an internal transfection marker mCherry. FIG. 3B includes four digital fluorescence images of neurons transfected with the reporter plasmid, the EctRNA<^A , and wt E. coli TyrRS. The tRNA expression was driven by the Hl promoter in the left panels, and by the 5' flanking sequence of the human tRNATyr in the right panels. FIG. 3C includes four digital fluorescence images of neurons transfected with the reporter plasmid, the EctRNA^A , and the OmeTyrRS in the presence (left panels) and absence (right panels) of OmeTyr. FIG. 3D includes four digital fluorescence images of neurons transfected with the reporter plasmid, the EctRNA<^A , and the BpaRS in the presence (left panels) and absence (right panels) of Bpa.
FIG. 4 includes several panels demonstrating a method for enhancing the efficiency of expression of E. coli tRNAs in yeast. FIG. 4A is a schematic diagram showing the gene elements for tRNA transcription in E. coli and in yeast. FIG. 4B is a schematic diagram showing an enhanced method for expressing E. coli tRNAs
in yeast using a Pol III promoter that contains the conserved A- and B-box and that is cleaved from the primary transcript. Gene organization of yeast SNR52 or RPRl RNA is shown at the bottom. FIG. 4C is a schematic diagram showing the plasmids encoding the orthogonal EctRNA<^A /TyrRS pair and the GFP-TAG reporter, respectively. FIG 4D is a chart showing the fluorescence assay results for the functional expression of EctRNA<^A and EctRNA^A driven by different promoters in yeast. Error bars represent s.e.m. n = 3. FIG. 4E is a digital image of a gel showing a Northern analysis of EctRNA^A expressed in yeast by the indicated promoters. FIG. 5 includes three panels showing that NMD inactivation increases the incorporation efficiency of UAAs in yeast. FIG. 5A is a graph showing the fluorescence assay results for UAA incorporation in wt and the upflΔ strain. Error bars represent s.e.m. n = 3. FIG. 5B is a digital image of a gel showing a Western analysis of the DanAla-containing GFP expressed in the upflΔ strain. The same amounts of cell lysate from each sample were separated by SDS-PAGE and probed with an anti-His5 antibody. FIG. 5C shows the UAA structures of Dan/ Ala and OmeTyr.
FIG. 6 includes two panels showing incorporation of UAAs into GFP using the Hl promoter in stem cells. FIG. 6A shows that the Hl promoter can express the orthogonal E. coli tRNATyr in HCN cells. Together with the orthogonal E. coli
TyrRS, the tRNATyr incorporates Tyr into the GFP and makes the cells fluorescent. FIG. 6B shows that the Hl promoter drives E. coli tRNATyr, and the OmeRS, a synthetase specific for the UAA o-methyl-tyrosine, incorporates this UAA into GFP. FIG. 7 includes two panels showing incorporation of two UAAs, p- benzoylphenylalanine and dansylalanine, using the Hl promoter in stem cells. FIG. 7 A shows that the Hl promoter driven E. coli tRNATyr and the BpaRS, a synthetase specific for the UAA p-benzoylphenylalanine, incorporate this UAA into GFP. FIG. 7B shows that the Hl promoter can express the orthogonal E. coli tRNA16" in HCN cells. Together with the orthogonal Dansyl-RS, the tRNATyr incorporates the UAA dansylalanine into the GFP.
FIG. 8 (A) Superposition of E. coli TyrRS (PDB ID 1X8X, cyan) on T. thermophilus tRNATyr* TyrRS complex (PDB ID 1H3E, yellow and orange). Only one subunit of the dimeric TyrRS and one tRNA are shown. Base G34 on the tRNA and the interacting Asp on TyrRS are represented as ball-and-stick. (B) Recognition of G34 by Asp259 in the T. thermophilus tRNATyr-TyrRS complex. C34 was modeled to show the gap after G34C change.
FIG. 9 shows several panels demonstrating that enhanced mutant synthetases increased the incorporation efficiency of various unnatural amino acids in mammalian cells. (A) An in vivo fluorescence assay for measuring the amber suppression efficiency of the expressed orthogonal tRNA/synthetase. Uaa: unnatural amino acid. (B) Structures of the unnatural amino acids. (C) Fluorescence assay results for the incorporation efficiency of different synthetases. Error bars represent sem n = 3. Mutants used were: EBzoRS (Y37G, D182G, L186A, and D265R), EAziRS (Y37L, D182S, F183A, L186A, and D265R), EOmeRS (Y37T, D182T, L183M, and D265R), and EPyoRS (Y37G, D182S, F183M, and D265R). All mutations are based on the wt E. coli TyrRS.
FIG. 10 is a series of images showing photocrosslinking in mammalian cells using Azi. (A) Crystal structure of E. coli GST (PDB ID IAOF) with three sites for Azi incorporation labeled. (B) Western blot analysis of GST mutants using an anti- His6 antibody before and after photocrosslinking. (C) Western blot analysis of GST mutants using an anti-FLAG antibody before and after photocrosslinking.
SEQUENCE LISTING
The nucleic acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and the amino acid sequences using the one letter codes, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. All Genbank Accession Numbers are incorporated by reference for the sequence available on June 5, 2009.
The Sequence Listing is submitted as an ASCII text file, Annex C/St.25 text file, created on June 4, 2010, 43KB, which is incorporated by reference herein.
In the accompanying sequence listing:
SEQ ID NOs: 1 and 2 show forward and reverse primer sequences, respectively, used to amplify the E. coli TyrRS gene.
SEQ ID NOs: 3 and 4 show forward and reverse primer sequences, respectively, used to amplify the gene for EctRNA<^A in construct tRNA2.
SEQ ID NOs: 5 and 6 show forward and reverse primer sequences, respectively, used to amplify the gene for the E. coli LeuRS gene.
SEQ ID NOs: 7 and 8 show forward and reverse primer sequences, respectively, used to amplify the gene for 32P-labeled DNA probes specific for EctRNA^A .
SEQ ID NOs: 9 and 10 show forward and reverse primer sequences FW19 and FW20, respectively, used to amplify a spacer sequence from pCDNA3.
SEQ ID NOs: 11 and 12 show forward and reverse primer sequences FW21 and FW22, respectively, used to amplify the E. coli TyrRS gene from E. coli genomic DNA.
SEQ ID NOs: 13 and 14 show forward and reverse primer sequences FW16 and FW17, respectively, used to amplify the SNR52 promoter from yeast genomic DNA.
SEQ ID NOs: 15 and 16 show forward and reverse primer sequences FW14 and FW15, respectively, used to amplify the EctRNA^ gene followed by the 3'- flanking sequence of the SUP4 suppressor tRNA from pEYCUA-YRS.
SEQ ID NOs: 17 and 18 show forward and reverse primer sequences FW 12 and FW 13, respectively, used to amplify the RPRl promoter from yeast genomic DNA. SEQ ID NO: 19 shows a forward primer sequence used to amplify a gene cassette containing the 5' flanking sequence of the SUP4 suppressor tRNA, the EctRNA^ , and the 3' flanking sequence of the SUP4 suppressor tRNA from plasmid pEYCUA-YRS-tRNA-5.
SEQ ID NOs: 20 and 21 show forward and reverse primer sequences FW27 and FW28, respectively, used to amplify a gene cassette containing the 5' flanking
sequence of the SUP4 suppressor tRNA, the EctRNA^°A , and the 3' flanking sequence of the SUP4 suppressor tRNA from plasmid pLeuRSB8T252A.
SEQ ID NOs: 22 and 23 show forward and reverse primer sequences FW29 and FW30, respectively, used to amplify the E. coli LeuRS gene from E. coli genomic DNA.
SEQ ID NO: 24 shows a reverse primer sequence FW31 used to amplify the SNR52 promoter from pSNR-TyrRS.
SEQ ID NO: 25 shows a forward primer sequence FW32 used to amplify the EctRNA^°A -3' flanking sequence fragment from pLeuRSB8T252A. SEQ ID NOs: 26 and 27 show forward and reverse primer sequences JT171 and JT172, respectively, used to amplify a mutant GFP-TAG gene.
SEQ ID NO: 28 shows the sequence of a biotinylated probe FW39 which is specific for the E. coli tRNATyr and the EctRNA^ .
SEQ ID NOs: 29 and 30 show forward and reverse primer sequences FW5 and FW6, respectively, used to amplify a gene cassette containing -200 bp upstream of UPFl, the Kan-MX6, and -200 bp downstream of UPFl.
SEQ ID NOs: 31 and 32 show forward and reverse primer sequences, respectively, used to amplify genomic DNA -300 bp away from the UPFl gene.
SEQ ID NO: 33 is the nucleic acid sequence encoding O- EctRNA^ . SEQ ID NO: 34 is the nucleic acid sequence encoding O- EctRNA^°A .
SEQ ID NO: 35 is an exemplary nucleic acid sequence encoding wild-type E. coli TyrRS (GenBank # EU900554).
SEQ ID NO: 36 is an exemplary protein sequence of wild-type E. coli TyrRS (GenBank # ACI83105.1). Other exemplary sequences are provided in GenBank Accession NOs. BAB35769; AAG56626.1; AAC00303.1; AAX65373.1; ACQ67409.1 and ACI83101.1.
SEQ ID NO: 37 is an exemplary nucleic acid sequence encoding wild-type E. coli leucyl-tRNA synthetase (GenBank # EU904294.1).
SEQ ID NO: 38 is an exemplary protein sequence of wild-type E. coli leucyl-tRNA synthetase (GenBank # ACI86840.1). Other exmpalry sequences are provided in GenBank Accession NOs. ACI86838.1; ACD46331.1 and ABS43058.1.
SEQ ID NO: 39 is an exemplary nucleic acid sequence encoding wild-type E. coli glutamyl-tRNA synthetase (GenBank # EU904159.1).
SEQ ID NO: 40 is an exemplary protein sequence of wild-type E. coli glutamyl-tRNA synthetase (GenBank # AAG55002). Other exmpalry sequences are provided in GenBank Accession NOs. AAP16122.1; AAX64613.1and CAH15509.1.
SEQ ID NO: 41 is a nucleic acid sequence encoding a mutant E. coli TyrRS EBzoRS (containing Y37G, D182G, L186A, and D265R substitutions).
SEQ ID NO: 42 is a nucleic acid sequence encoding a mutant E. coli TyrRS EAziRS (containing Y37L, D182S, F183A, L186A, and D265R substitutions).
SEQ ID NO: 43 is a nucleic acid sequence encoding a mutant E. coli TyrRS EOmeRS (containing Y37T, D182T, L183M, and D265R substitutions).
SEQ ID NO: 44 is a nucleic acid sequence encoding a mutant E. coli TyrRS EPyoRS (containing Y37G, D182S, F183M, and D265R substitutions). SEQ ID NO: 45 is a nucleic acid sequence encoding a mutant E. coli TyrRS
EKetRS (containing Y37I, D182G, F183M, L186A, and D265R substitutions). TyrRS EKetRS can be used to incorporate p-acetyl-phenylalanine.
SEQ ID NO: 46 is a nucleic acid sequence encoding an E. coli TyrRS used as a foundation to generate SEQ ID NOS: 41-45.
DETAILED DESCRIPTION /. Overview of several embodiments
The present disclosure provides methods of incorporating unnatural amino acids (UAA) into a protein in a eukaryotic cell, by using orthogonal mutant aminoacyl-tRNA synthetases (MO-RS). The tRNA synthetase selected is specific for the UAA to be incorporated. The MO-RS proteins include one or more amino acid substitutions that increase the interaction of the MO-RS with the anticodon of the corresponding orthogonal tRNA (O-tRNA).
In particular examples, the recombinant MO-RS (such as a non-archaeal MO-RS) is expressed in the cell, for example from a nucleic acid molecule encoding the MO-RS operably linked to a promoter. The MO-RS includes a mutation that increases the interaction of the MO-RS with the anticodon of the corresponding O-
tRNA (such as tRNA residue 34, for example C34), such as an Asp265Arg or equivalent mutation, wherein the amino acid numbering corresponds to wild-type E. coli tyrosyl-tRNA synthetase (TyrRS) (SEQ ID NO: 36). The recombinant MO-RS can be from any organism. However, in one example, the MO-RS is a non-archaeal MO-RS. For example a prokaryotic MO-RS, for example an E. coli MO-RS, can be used. Alternatively, a eukaryotic MO-RS, for example as a yeast MO-RS, can be used. In a particular example, the MO-RS is not from M. jannaschii. The MO-RS can be any synthetase, such as a pyrrolysyl, tyrosyl, glutamyl, or leucyl, MO-RS (such as those from E. coli). In some examples, an O-tRNA (such as a prokaryotic tRNA) corresponding to the MO-RS is also expressed in the cell, thereby permitting formation of an orthogonal tRNA-orthogonal mutant synthetase pair in the cell. For example, the eukaryotic cell can be transduced with a nucleic acid molecule that encodes an O- tRNA synthetase (such as one specific for a UAA) operably linked to a promoter, such as an external RNA polymerase III promoter (pol III) operably linked to the O- tRNA. Exemplary pol III promoters that can be used include type-3 pol III promoters and internal leader pol III promoters. The pol III promoter, in some embodiments, is a type-3 pol III promoter, and in certain examples, the type-3 pol III promoter is a promoter that is itself not transcribed but instead has a defined starting transcription site for direct tRNA transcription. In other examples, the pol III promoter is an internal leader promoter that is transcribed together with the tRNA, and is then cleaved post-transcriptionally to yield the mature tRNA, such as the SNR52 promoter or the RPRl promoter. In a specific example, the O-tRNA is a prokaryotic tRNA, such as an E. coli tRNA. In some examples, the O-tRNA is a suppressor tRNA, for instance an amber, ochre, opal, missense, or frameshift tRNA. In particular examples, the suppressor tRNA is E. coli tyrosyl amber tRNA. In more particular examples, the O-tRNA decodes a stop codon or an extended codon. The nucleic acid encoding the pol III operably linked to the nucleic acid encoding the O- tRNA can also include either a 3'-CCA trinucleotide at a 3'-end of the nucleic acid encoding the O-tRNA or a 3' flanking nucleic acid sequence at the 3' end of the nucleic acid encoding the O-tRNA. Thus the O-tRNA and the MO-RS are selected such that an orthogonal tRNA-orthogonal mutant synthetase pair can form; that is,
the O-tRNA and the MO-RS are selected or paried based on the particular UAA desired to be incorporated. For example, if the recombinant MO-RS is a mutant TyrRS, the O-tRNA can be tRNA^A while if the recombinant MO-RS is a mutant leucyl tRNA synthetase, the tRNA can be tRNA Leu CUA • The cell is incubated in growth medium that includes the UAA to be incorporated under conditions that permit the MO-RS to charge the O-tRNA with the UAA, thereby generating acylated tRNA which can incorporate the UAA into proteins in the cell. Eukaryotic host cells that can be used include mammalian cells (e.g., human cells, stem cells, neurons) or yeast cells, such as those cell lines available from the American Type Culture Collection (Manassas, VA). In some examples, the eukaryotic cell is substantially Nonsense-Mediated mRNA Decay (NMD)-deficient.
Also provided by the present disclosure are isolated mutated orthogonal tRNA synthetase proteins. In some examples, the protein includes or consists of the amino acid sequence shown in SEQ ID NO: 36, but having an Asp265Arg substitution and one to ten additional amino acid substitutions that generate an orthogonal synthetase for a particular UAA. For example, for the UAA p- benzoylphenylalanine, the following additional mutations are included: Y37G, D182G, L186A; for p-azidophenylalanine the following additional mutations are included: Y37L, D182S, F183A, L186A; for p-methoxyphenylalanine the following additional mutations are included: Y37T, D182T, L183M; for p- propargyloxyphenylalanine the following additional mutations are included: Y37G, D182S, F183M; and for p-acetyl-phenylalanine the following additional mutations are included: Y37I, D182G, F183M, L186A. Thus, mutations can be made at positions 37, 182, 183, and/or 186 in TyrRS to generate the desired UAA. Also provided are isolated nucleic acid molecules that encode such mutant O-RS proteins (for example see SEQ ID NOS: 41-44), as well as vectors and cells that include such nucleic acid molecules. In particular examples, stable eukaryotic cell lines that express such nucleic acid molecules and contain recombinant MO-RS proteins are provided. The cell lines can be any eukaryotic cell, such as a mammalian or yeast cell line (such as a neuronal or stem cell line). Such cell lines may also be
substantially NMD-deficient. The cell lines can further include an orthogonal tRNA that forms an orthogonal pair with the recombinant MO-RS (such as one that is specific for a UAA).
The UAA can include, in some embodiments, a detectable label such as a fluorescent group, a photoaffinity label, or a photo-caged group, a crosslinking agent, a polymer, a cytotoxic molecule, a saccharide, a heavy metal-binding element, a spin label, a heavy atom, a redox group, an infrared probe, a keto group, an azide group, or an alkyne group. In some embodiments, the UAA is a hydrophobic amino acid, a β-amino acid, a homo-amino acid, a cyclic amino acid, an aromatic amino acid, a proline derivative, a pyruvate derivative, a lysine derivative, a tyrosine derivative, a 3-substituted alanine derivative, a glycine derivative, a ring-substituted phenylalanine derivative, a linear core amino acid, or a diamino acid.
//. Abbreviations
ADH alcohol dehydrogenase
BAC bacterial artificial chromosome
BPA p-benzoylphenylalanine
CAT chloramphenicol acetyltransferase
DMEM Dulbecco's modified Eagle's medium
DNA deoxyribonucleic acid
EctRNA*a UA E. coli amber suppressor tRNA, anticodon CUA
EDTA ethylenediaminetetraacetic acid
EGFP enhanced green fluorescent protein
GAPDH glyceraldehyde-3-phosphate dehydrogenase
GFP green fluorescent protein
Leucyl-O-RS orthogonal leucyl-tRNA synthetase
LeuRS leucyl tRNA synthetase
MCS multiple cloning sites
MO-RS mutant orthogonal aminoacyl-tRNA synthetase
NMD Nonsense-Mediated mRNA Decay
O-RS orthogonal aminoacyl-tRNA synthetase
O-tRNA orthogonal tRNA
PAGE polyacrylamide gel electrophoresis
PBS phosphate buffered saline
PCR polymerase chain reaction
Pol polymerase
RNA ribonucleic acid
RS aminoacyl-tRNA synthetase
SDS sodium dodecylsulfate
Tyrosyl-O-RS orthogonal tyrosyl-tRNA synthetase
TyrRS tyrosyl-tRNA synthetase
UAA unnatural amino acid
WPRE woodchuck hepatitis virus posttranscriptional regulatory element
Wt wild-type
YAC yeast artificial chromosome
///. Terms In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:
Bacteria: Unicellular microorganisms belonging to the Kingdom Procarya. Unlike eukaryotic cells, bacterial cells do not contain a nucleus and rarely harbour membrane-bound organelles. As used herein, both Archaea and Eubacteria are encompassed by the terms "prokaryote" and "bacteria", except where it is noted that Archaea are specifically excluded. Examples of Eubacteria include, but are not limited to Escherichia coli, Thermus thermophilus and Bacillus stearothermophilus . Example of Archaea include Methanococcusjannaschii, Methanosarcina mazei, Methanobacterium thermoautotrophicum, Methanococcus maripaludis, Methanopyrus kandleri, Halobacterium such as Haloferax volcanii and
Halobacterium species NRC-i, Archaeoglobusfulgidus, Pyrococcus fit riosus, Pyrococcus horikoshii, Pyrobaculum aerophilum, Pyrococcus abyssi, Sulfolobus solfataricus, Sulfolobus tokodaii, Aeuropyrum pernix, Thermoplasma acidophilum, and Thermoplasma volcanium. Conservative variant: As used herein, the term "conservative variant," in the context of a translation component, refers to a peptide or amino acid sequence that deviates from another amino acid sequence only in the substitution of one or several amino acids for amino acids having similar biochemical properties (so-called conservative substitutions). Conservative amino acid substitutions are likely to have minimal impact on the activity of the resultant protein. Further information about conservative substitutions can be found, for instance, in Ben Bassat et al. (J. Bacteriol, 169:751-757, 1987), O'Regan et al. {Gene, 77:237-251, 1989), Sahin-Toth et al. (Protein ScL, 3:240-247, 1994), Hochuli et al. (Bio/Technology, 6:1321-1325, 1988) and in widely used textbooks of genetics and molecular biology.
In some examples, the disclosed MO-RS variants have no more than 3, 5, 10, 15, 20, 25, 30, 40, or 50 conservative amino acid changes. Conservative variants are discussed in greater detail in section IV K of the Detailed Description.
In one example, a conservative variant orthogonal tRNA (O-tRNA) or a conservative variant mutated orthogonal aminoacyl-tRNA synthetase (MO-RS) is one that functionally performs substantially like a similar base component, for instance, an O-tRNA or MO-RS having variations in the sequence as compared to a reference O-tRNA or MO-RS. For example, an MO-RS, or a conservative variant of that MO-RS that includes the Asp265Arg or equivalent substitution, will aminoacylate a cognate O-tRNA with an unnatural amino acid, for instance, an amino acid including an N-acetylgalactosamine moiety, while retaining (or even increasing) its increased UAA incorporation efficiency relative to the wt O-RS. In this example, the MO-RS and the conservative variant MO-RS do not have the same amino acid sequence (except the Asp265Arg or equivalent substitution is retained). The conservative variant can have, for instance, one variation, two variations, three variations, four variations, or five or more variations in sequence, as long as the conservative variant is still complementary to the corresponding O-tRNA or MO-RS.
In some embodiments, a conservative variant MO-RS includes one or more conservative amino acid substitutions compared to the MO-RS from which it was derived (and retains the Asp265Arg or equivalent substitution), and yet retains MORS biological activity. For example, a conservative variant MO-RS can retain at least 10% of the biological activity (e.g., increased UAA incorporation efficiency in mammalian cells) of the parent MO-RS molecule from which it was derived, or alternatively, at least 20%, at least 30%, or at least 40%. In some embodiments, a conservative variant MO-RS retains at least 50% of the biological activity of the parent MO-RS molecule from which it was derived. The conservative amino acid substitutions of a conservative variant MO-RS can occur in any domain of the MORS, including the amino acid binding pocket (except that the Asp265Arg or equivalent substitution is retained in the variant MO-RS protein). Encode: As used herein, the term "encode" refers to any process whereby the information in a polymeric macromolecule or sequence is used to direct the production of a second molecule or sequence that is different from the first molecule
or sequence. As used herein, the term is construed broadly, and can have a variety of applications. In some aspects, the term "encode" describes the process of semi- conservative DNA replication, where one strand of a double- stranded DNA molecule is used as a template to encode a newly synthesized complementary sister strand by a DNA-dependent DNA polymerase.
In another aspect, the term "encode" refers to any process whereby the information in one molecule is used to direct the production of a second molecule that has a different chemical nature from the first molecule. For example, a DNA molecule can encode an RNA molecule (for instance, by the process of transcription incorporating a DNA-dependent RNA polymerase enzyme). Also, an RNA molecule can encode a peptide, as in the process of translation. When used to describe the process of translation, the term "encode" also extends to the triplet codon that encodes an amino acid. In some aspects, an RNA molecule can encode a DNA molecule, for instance, by the process of reverse transcription incorporating an RNA-dependent DNA polymerase. In another aspect, a DNA molecule can encode a peptide, where it is understood that "encode" as used in that case incorporates both the processes of transcription and translation.
Eukaryote: Organisms belonging to the Kingdom Eucarya. Eukaryotes are generally distinguishable from prokaryotes by their typically multicellular organization (but not exclusively multicellular, for example, yeast), the presence of a membrane-bound nucleus and other membrane-bound organelles, linear genetic material (for instance, linear chromosomes), the absence of operons, the presence of introns, message capping and poly-A mRNA, and other biochemical characteristics known in the art, such as a distinguishing ribosomal structure. Eukaryotic organisms include, for example, animals (for instance, mammals, insects, reptiles, birds, etc.), ciliates, plants (for instance, monocots, dicots, algae, etc.), fungi, yeasts, flagellates, microsporidia, and protists. A eukaryotic cell is one from a eukaryotic organism, for instance a human cell or a yeast cell.
Gene expression: The process by which the coded information of a nucleic acid transcriptional unit (including, for example, genomic DNA or cDNA) is converted into an operational, non-operational, or structural part of a cell, often including the synthesis of a protein. Gene expression can be influenced by external
signals; for instance, exposure of a cell, tissue or subject to an agent that increases or decreases gene expression. Expression of a gene also can be regulated anywhere in the pathway from DNA to RNA to protein. Regulation of gene expression occurs, for instance, through controls acting on transcription, translation, RNA transport and processing, degradation of intermediary molecules such as mRNA, or through activation, inactivation, compartmentalization or degradation of specific protein molecules after they have been made, or by combinations thereof. Gene expression can be measured at the RNA level or the protein level and by any method known in the art, including, without limitation, Northern blot, RT-PCR, Western blot, or in vitro, in situ, or in vivo protein activity assay(s).
Isolated: An "isolated" biological component (such as a nucleic acid molecule, peptide, or cell) has been purified away from other biological components in a mixed sample (such as a cell extract). For example, an "isolated" peptide or nucleic acid molecule is a peptide or nucleic acid molecule that has been separated from the other components of a cell in which the peptide or nucleic acid molecule was present (such as an expression host cell for a recombinant peptide or nucleic acid molecule).
Mammalian cell: A cell from a mammal, the class of vertebrate animals characterized by the production of milk in females for the nourishment of young, from mammary glands present on most species; the presence of hair or fur; specialized teeth; three small bones within the ear; the presence of a neocortex region in the brain; and endothermic or "warm-blooded" bodies, and, in most cases, the existence of a placenta in the ontogeny. The brain regulates endothermic and circulatory systems, including a four-chambered heart. Mammals encompass approximately 5,800 species (including humans), distributed in about 1,200 genera, 152 families and up to forty-six orders, though this varies with the classification scheme.
Neurons: Electrically excitable cells in the nervous system that process and transmit information. In vertebrate animals, neurons are the core components of the brain, spinal cord and peripheral nerves. Neurons typically are composed of a soma, dendrites, and an axon. The majority of vertebrate neurons receive input on the cell body and dendritic tree, and transmit output via the axon. In particular examples,
recombinant MO-RS proteins are expressed in neurons, for example in combination with a corresponding O-tRNA.
Specific, non-limiting examples of vertebrate neurons include hippocampal neurons, cortical neurons, spinal neurons, motorneurons, sensory neurons, pyramidal neurons, cerebellar neurons, retinal neurons, and Purkinje cells.
Nonsense-Mediated mRNA Decay (NMD): A cellular mechanism of mRNA surveillance used by the cell to detect nonsense mutations and prevent the expression of truncated or erroneous proteins. In yeast, NMD is triggered by the presence of a premature stop codon in the first two thirds of the gene. In mammalian cells, NMD is triggered by exon-junction complexes that form during pre-RNA processing, being downstream of the nonsense codon. Normally, these exon-junction complexes are removed during the first round of translation of the mRNA, but in the case of a premature stop codon, they are still present on the mRNA. This is identified as a problem by NMD factors, and the RNA is degraded, for example by the exosome complex. A substantially Nonsense-Mediated mRNA Decay- (NMD)-deficient cell or cell line has little or no NMD activity, for instance less than 20%, 15%, 10%, 5%, 2%, 1%, or even less NMD activity as compared to a wild-type cell or cell line. Thus, an NMD-deficient cell or cell line degrades few or none of the mRNA premature stop codons that may be present in the cell, for instance a eukaryotic cell such as yeast cell or a mammalian cell.
Nucleic acid molecule: A polymeric form of nucleotides, which can include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. A nucleotide refers to a ribonucleotide, deoxynucleotide or a modified form of either type of nucleotide. A "nucleic acid molecule" as used herein is synonymous with "nucleic acid" and "polynucleotide." A nucleic acid molecule is usually at least 10 bases in length, unless otherwise specified. The term includes single- and double- stranded forms of DNA. A nucleic acid molecule can include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages.
Nucleic acid molecules can be modified chemically or biochemically or can contain non-natural or derivatized nucleotide bases, as will be readily appreciated by
those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications, such as uncharged linkages (for example, methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (for example, phosphorothioates, phosphorodithioates, etc.), pendent moieties (for example, peptides), intercalators (for example, acridine, psoralen, etc.), chelators, alkylators, and modified linkages (for example, alpha anomeric nucleic acids, etc.). The term "nucleic acid molecule" also includes any topological conformation, including single- stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular and padlocked conformations.
Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence (e.g., an O-tRNA or MO-RS sequence) if the promoter affects the transcription or expression of the coding sequence. When recombinantly produced, operably linked nucleic acid sequences are generally contiguous and, where necessary to join two protein-coding regions, in the same reading frame. However, nucleic acids need not be contiguous to be operably linked. Orthogonal: A molecule (for instance, an orthogonal tRNA (O-tRNA) and/or a mutated orthogonal aminoacyl-tRNA synthetase (MO-RS)) that functions with endogenous components of a cell with reduced efficiency as compared to a corresponding molecule that is endogenous to the cell, or that fails to function with endogenous components of the cell. In the context of tRNAs and mutant aminoacyl- tRNA synthetases, orthogonal refers to an inability or reduced efficiency, for instance, less than 20% efficiency, less than 10% efficiency, less than 5% efficiency, or less than 1% efficiency, of an O-tRNA to function with an endogenous aminoacyl-tRNA synthetase compared to an endogenous tRNA to function with the endogenous aminoacyl-tRNA synthetase, or of an MO-RS to function with an endogenous tRNA compared to an endogenous aminoacyl-tRNA synthetase to function with the endogenous tRNA, such as 0-20% efficiency.
An orthogonal molecule lacks a functionally normal endogenous complementary molecule in the cell. For example, an orthogonal tRNA in a cell is aminoacylated by any endogenous aminoacyl-tRNA synthetase (RS) of the cell with reduced or even zero efficiency, when compared to aminoacylation of an endogenous tRNA by the endogenous RS. In another example, an orthogonal RS aminoacylates any endogenous tRNA a cell of interest with reduced or even zero efficiency, as compared to aminoacylation of the endogenous tRNA by an endogenous RS. A second orthogonal molecule can be introduced into the cell that functions with the first orthogonal molecule. Orthogonal tRNA (O-tRNA): A tRNA that is orthogonal to a cell of interest, where the tRNA is: (1) identical or substantially similar to a naturally occurring tRNA (e.g., a leucyl- or tyrosyl-tRNA), (2) derived from a naturally occurring tRNA by natural or artificial mutagenesis, (3) derived by any process that takes a sequence of a wild-type or mutant tRNA sequence of (1) or (2) into account, or (4) homologous to a wild-type or mutant tRNA. The tRNA (e.g., a leucyl-, tyrosyl-, or pyrrolysyl-tRNA) can exist charged with an amino acid, or in an uncharged state. It is also to be understood that an "O-tRNA" optionally is charged (aminoacylated) by a cognate synthetase with an amino acid other than tyrosine or leucine, respectively, for instance, with a UAA. Indeed, it will be appreciated that an O-tRNA of the disclosure can be used to insert essentially any amino acid, whether natural or artificial, into a growing peptide, during translation, in response to a selector codon. In one example, the O-tRNA is an archaebacterial tRNA.
Orthogonal aminoacyl-tRNA synthetase (O-RS): An enzyme that preferentially aminoacylates the O-tRNA with an amino acid (e.g., a UAA) in a cell of interest. The amino acid that the O-RS loads onto the O-tRNA can be any amino acid, whether natural, unnatural or artificial, and is not limited herein. In a specific example, the O-RS is a mutated O-RS (MO-RS), wherein the mutation increases the interaction or affinity of the O-RS with the anticodon of the O-tRNA, such as an Asp265Arg mutation of the E. coli tyrosyl-tRNA synthetase (or the corresponding mutation in another O-RS), thereby increasing the incorporation efficiency of UAAs in vivo.
For example, a mutated orthogonal tyrosyl-tRNA synthetase is an enzyme that preferentially aminoacylates the O-tRNATyr with an amino acid (e.g., a UAA) in a cell of interest. Similarly, an orthogonal leucyl-tRNA synthetase (Leucyl-O-RS) is an enzyme that preferentially aminoacylates the leucyl-O-tRNALeu with an amino acid (e.g., a UAA) in a cell of interest.
Exemplary aminoacyl-tRNA synthetases (O-RS) are provided in the table below. Such enzymes can preferentially aminoacylate the corresponding O-tRNA. The sequences of synthetases from numerous organisms are known in the art. These synthetases can be mutated, such that the mutation increases the interaction or affinity of the O-RS with the anticodon of the O-tRNA, such as a mutation that corresponds to the Asp265Arg mutation of the E. coli tyrosyl-tRNA synthetase, and used in the methods provided herein.
Amino acid aminoacyl-tRNA synthetase Exemplary GenBank #s
GIu glutamyl-tRNA synthetase NP_415206.1; AAA65629.1
GIn glutaminyl-tRNA synthetase EFB39295.1; ACX40586.1
Arg arginyl-tRNA synthetase ZP_04685856.1; ACX39423.1
Cys cysteinyl-tRNA synthetase ADG91355.1; CAA41983.1
Met methionyl-tRNA synthetase CAA39315.1; ABN64376.1
VaI valyl-tRNA synthetase AAA24657.1; YP_003491557.1 lie isoleucyl-tRNA synthetase NP_414567.1; AAT01099.1
Leu leucyl-tRNA synthetase AAA33599.1; ACX40613.1
Tyr tyrosyl-tRNA synthetase NP_416154.1; CAA55643.1
Trp tryptophanyl-tRNA synthetase NP_417843.1; CAD55313.1
GIy glycyl-tRNA synthetase ZP_06664288.1 ; ZP_06664287.1
Ala alanyl-tRNA synthetase NP_417177.1; ZP_06586222.1
Pro prolyl-tRNA synthetase YP_003541955.1; AAA24420.1
Ser seryl-tRNA synthetase ACT29724.1; YP_003515250.1
Thr threonyl-tRNA synthetase CAA99608.1; ACX39580.1
His histidyl-tRNA synthetase NP_417009.1; CAD80177.1
Asp aspartyl-tRNA synthetase CAD90572.1; ACT28823.1
Asn asparaginyl-tRNA synthetase NP_415450.1; YP_002959094.1
Lys lysyl-tRNA synthetase YP_250982.1; ACX41463.1
Phe phenylalanyl-tRNA synthetase CAA22014.1; ZP_06653605.1
PyI pyrrolysyl-tRNA synthetase YP_003541460.1; AA Y81923.1
Plasmid: A DNA molecule separate from chromosomal DNA and capable of autonomous replication. It is typically circular and double- stranded, and can naturally occur in bacteria, and sometimes in eukaryotic organisms (for instance, the 2-micrometre-ring in Saccharomyces cerevisiae). The size of plasmids can vary from about 1 to over 400 kilobase pairs. Plasmids often contain genes or gene
cassettes that confer a selective advantage to the bacterium (or other cell) harboring them, such as the ability to make the bacterium (or other cell) antibiotic resistant.
Plasmids contain at least one DNA sequence that serves as an origin of replication, which enables the plasmid DNA to be duplicated independently from the chromosomal DNA. The chromosomes of most bacteria are circular, but linear plasmids are also known.
Plasmids used in genetic engineering are referred to as vectors. They can be used to transfer genes (such as an MO-RS or O-tRNA sequence) into a cell, and typically contain a genetic marker conferring a phenotype that can be selected for or against. Most also contain a polylinker or multiple cloning site, which is a short region containing several commonly used restriction sites allowing the easy insertion of DNA fragments at this location. Specific, non-limiting examples of plasmids include pCLHF, pCLNCX (Imgenex), pCLHF-GFP-TAG, pSUPER (OligoEngine), pEYCUA-YRS, pBluescript II KS (Stratagene), pCDNA3 (Invitrogen).
Preferentially aminoacylates: As used herein in reference to orthogonal translation systems, a MO-RS "preferentially aminoacylates" a cognate O-tRNA when the MO-RS charges the O-tRNA with an amino acid more efficiently than it charges any endogenous tRNA in a cell. In particular examples, the relative ratio of O-tRNA charged by the MO-RS to endogenous tRNA charged by the MO-RS is high, resulting in the MO-RS charging the O-tRNA exclusively, or nearly exclusively, when the O-tRNA and endogenous tRNA are present in equal molar concentrations in the translation system.
The MO-RS "preferentially aminoacylates an O-tRNA with an unnatural amino acid" when (a) the MO-RS preferentially aminoacylates the O-tRNA compared to an endogenous tRNA, and (b) where that aminoacylation is specific for the unnatural amino acid, as compared to aminoacylation of the O-tRNA by the MORS with any natural amino acid. In specific examples, MO-RS charges the O-tRNA exclusively, or nearly exclusively, with the unnatural amino acid. Prokaryote: Organisms belonging to the Kingdom Monera (also termed
Procarya). Prokaryotic organisms are generally distinguishable from eukaryotes by their unicellular organization, asexual reproduction by budding or fission, the lack of
a membrane-bound nucleus or other membrane-bound organelles, a circular chromosome, the presence of operons, the absence of introns, message capping and poly-A mRNA, and other biochemical characteristics, such as a distinguishing ribosomal structure. The Prokarya include subkingdoms Eubacteria and Archaea (sometimes termed "Archaebacteria"). In a particular example, Archaea are excluded when noted herein. Cyanobacteria (the blue green algae) and mycoplasma are sometimes given separate classifications under the Kingdom Monera.
Promoter: A region of DNA that generally is located upstream (towards the 5' region of a gene) that is needed for transcription. Promoters permit the proper activation or repression of the gene (such as an MO-RS or O-tRNA) which they control. A promoter contains specific sequences that are recognized by transcription factors. These factors bind to the promoter DNA sequences and result in the recruitment of RNA polymerase, the enzyme that synthesizes the RNA from the coding region of the gene. In prokaryotes, the promoter is recognized by RNA polymerase and an associated sigma factor, which in turn are brought to the promoter DNA by an activator protein binding to its own DNA sequence nearby. In eukaryotes, the process is more complicated. For instance, at least seven different factors are necessary for the transcription of an RNA polymerase II promoter. Promoters represent elements that can work in concert with other regulatory regions (enhancers, silencers, boundary elements/insulators) to direct the level of transcription of a given gene.
The promoters that are useful in carrying out the methods described herein include RNA polymerase III (also called Pol III) promoters, which transcribe DNA to synthesize ribosomal 5S rRNA, tRNA, and other small RNAs. Pol III is unusual (compared to Pol II) in that it requires no control sequences upstream of the gene. Instead, it can rely on internal control sequences. The RNA polymerase III promoters are more varied in structure than the uniform RNA polymerase I promoters, and yet not as diverse as the RNA polymerase II promoters. They have been divided into three main types (types 1-3), two of which are gene-internal and generally TATA-less, and one of which is gene-external and contains a TATA box.
Some embodiments of the described methods employ a type-3 promoter. Type-3 promoters were identified originally in mammalian U6 snRNA genes, which encode the U6 snRNA component of the spliceosome, and in the human 7SK gene, whose RNA product has been implicated in the regulation of the CDK9/cyclin T complex. They are also found in, for example, the Hl RNA gene, which encodes the RNA component of human RNase P, and the gene encoding the RNA component of human RNase MRP, as well as in genes encoding RNAs of unknown function.
The discovery of type-3 promoters came as a surprise because, unlike the then-characterized type 1 and 2 promoters, the type-3 core promoters turned out to be gene-external. They are located in the 5 '-flanking region of the gene, and include a proximal sequence element (PSE), which also constitutes, on its own, the core of RNA polymerase II snRNA promoters, and a TATA box located at a fixed distance downstream of the PSE. Strikingly, in the vertebrate snRNA promoters, RNA polymerase specificity can be switched from RNA polymerase III to RNA polymerase II and vice versa by abrogation or generation of the TATA box.
Upstream of the PSE is an element referred to as the distal sequence element (DSE), which activates transcription from the core promoter. Although the presence of a TATA box is the hallmark of type 3, gene-external promoters, it is also found in the 5 '-flanking regions of some genes with gene-internal promoter elements. As used herein, the term "internal leader promoter" includes certain Pol III type 3 promoters from yeast that drive the transcription of a primary transcript consisting of the leader sequence and the mature RNA. The internal leader promoter is subsequently cleaved posttranscriptionally from the primary transcript to yield the mature RNA product. Specific, non-limiting examples of internal leader promoters include the SNR52 promoter and the RPRl promoter. SNR52 and RPRl share a promoter organization that includes a leader sequence in which the A- and B-boxes are internal to the primary transcript, but are external to the mature RNA product. As shown herein, internal leader promoters can be exploited to express E. coli tRNAs in yeast. Reporter: An agent that can be used to identify and/or select target components of a system of interest. For example, a reporter can include a protein, for instance, an enzyme, that confers antibiotic resistance or sensitivity (for instance,
3-lactamase, chloramphenicol acetyltransferase (CAT), and the like), a fluorescent screening marker (for instance, green fluorescent protein (GFP), YFP, EGFP, RFP, etc.), a luminescent marker (for instance, a firefly luciferase protein), an affinity based screening marker, or positive or negative selectable marker genes such as lacZ, 3-gal/lacZ (13-galactosidase), ADH (alcohol dehydrogenase), his3, ura3, Ieu2, Iys2, or the like.
A reporter gene is a nucleic acid sequence that encodes a product (for instance firefly luciferase, CAT, and β-galactosidase), whose presence can be assayed. A reporter gene can be operably linked to a regulatory control sequence and introduced into cells. If the regulatory control sequence is transcriptionally active in a particular cell type, the reporter gene product normally will be expressed in such cells and its activity can be measured using techniques known in the art. The activity of a reporter gene product can be used, for example, to assess the transcriptional activity of an operably linked regulatory control sequence. Sequence identity: The similarity between two nucleic acid sequences or between two amino acid sequences is expressed in terms of the level of sequence identity shared between the sequences. Sequence identity is typically expressed in terms of percentage identity; the higher the percentage, the more similar the two sequences. Methods for aligning sequences for comparison are described in detail below, in section IV J of the Detailed Description.
Selector codon: Codons recognized by the O-tRNA in the translation process and not recognized by an endogenous tRNA. The O-tRNA anticodon loop recognizes the selector codon on the mRNA and incorporates its amino acid, for instance, an unnatural amino acid, at this site in the peptide. Selector codons can include, for instance, nonsense codons, such as stop codons, for instance, amber, ochre, and opal codons; missense or frameshift codons; four-base codons; rare codons; codons derived from natural or unnatural base pairs and/or the like.
Stem cell: A cell that has the ability to self replicate indefinitely and that, under the right conditions, or given the right signals, can differentiate into some or all of the different cell types that make up an organism. Stem cells have the potential to develop into mature, differentiated cells, such as heart cells, skin cells,
or nerve cells. In particular examples, recombinant MO-RS proteins are expressed in stem cells, for example in combination with a corresponding O-tRNA.
The fertilized egg is a stem cell because it has the potential to generate all the cells and tissues that make up an embryo and that support its development in utero. Adult mammals include more than 200 kinds of cells, for instance, neurons, myocytes, epithelial cells, erythrocytes, monocytes, lymphocytes, osteocytes, and chondrocytes. Other cells that are essential for embryonic development but are not incorporated into the body of the embryo include the extraembryonic tissues, placenta, and umbilical cord. All of these cells are generated from a single fertilized egg.
Pluripotent cells can give rise to cells derived from all three embryonic germ layers — mesoderm, endoderm, and ectoderm. Thus, pluripotent cells have the potential to give rise to any type of cell.
Unipotent stem cells are capable of differentiating along only one lineage. Embryonic stem cells are pluripotent cells derived from the blastocyst.
Adult stem cells are undifferentiated cells found in a differentiated tissue that can replicate and become specialized to yield all of the specialized cell types of the tissue from which it originated. Adult stem cells are capable of self-renewal for the lifetime of the organism. Sources of adult stem cells have been found in the bone marrow, blood stream, cornea, retina, dental pulp, liver, skin, gastrointestinal tract, and pancreas.
Suppressor tRNA: A suppressor tRNA is a tRNA that alters the reading of a messenger RNA (mRNA) in a given translation system, for instance, by providing a mechanism for incorporating an amino acid into a peptide chain in response to a selector codon. For example, a suppressor tRNA can read through, for instance, a stop codon (for instance, an amber, ocher or opal codon), a four-base codon, a missense codon, a frameshift codon, or a rare codon. Stop codons include, for example, the ochre codon (UAA), amber codon (UAG), and opal codon (UGA).
Transduction: The process by which genetic material, for instance, DNA or other nucleic acid molecule, is inserted into a cell. Common transduction techniques include the use of viral vectors (including bacteriophages), electroporation, and chemical reagents that increase cell permeability. Transfection and transformation
are other terms for transduction, although these sometimes imply expression of the genetic material as well.
Transfer RNA (tRNA): A small RNA chain (generally 73-93 nucleotides) that transfers a specific amino acid to a growing peptide chain at the ribosomal site of protein synthesis during translation. It has a 3' terminal site for amino acid attachment. This covalent linkage is catalyzed by an aminoacyl tRNA synthetase. It also contains a three-base region called the anticodon that can base-pair to the corresponding three base codon region on mRNA. Each type of tRNA molecule can be attached to only one type of amino acid, but because the genetic code contains multiple codons that specify the same amino acid, tRNA molecules bearing different anticodons can also carry the same amino acid. Exemplary tRNAs that can be used with the methods provided herein include but are not limited to tRNATyr, tRNALeu , tRNAGb, tRNAAsp, tRNATrp and tRNA1'5'1. One skilled in the art will appreciate the tRNAs for other amino acids can be used. Transfer RNA has a primary structure, a secondary structure (usually visualized as the cloverleaf structure), and a tertiary structure (an L-shaped three- dimensional structure that allows the tRNA to fit into the P and A sites of the ribosome). The acceptor stem is a 7-bp stem made by the base pairing of the 5'- terminal nucleotide with the 3'-terminal nucleotide (which contains the CCA 3'- terminal group used to attach the amino acid). The acceptor stem can contain non- Watson-Crick base pairs. The CCA tail is a CCA sequence at the 3' end of the tRNA molecule that is used for the recognition of tRNA by enzymes involved in translation. In prokaryotes, the CCA sequence is transcribed, whereas in eukaryotes, the CCA sequence is added during processing and therefore does not appear in the tRNA gene.
An anticodon is a unit made up of three nucleotides that correspond to the three bases of the mRNA codon. Each tRNA contains a specific anticodon triplet sequence that can base-pair to one or more codons for an amino acid. For example, one codon for lysine is AAA; the anticodon of a lysine tRNA might be UUU. Some anticodons can pair with more than one codon due to a phenomenon known as wobble base pairing. Frequently, the first nucleotide of the anticodon is one of two not found on mRNA: inosine and pseudouridine, which can hydrogen bond to more
than one base in the corresponding codon position. In the genetic code, it is common for a single amino acid to occupy all four third-position possibilities; for example, the amino acid glycine is coded for by the codon sequences GGU, GGC, GGA, and GGG. To provide a one-to-one correspondence between tRNA molecules and codons that specify amino acids, 61 tRNA molecules would be required per cell.
However, many cells contain fewer than 61 types of tRNAs because the wobble base is capable of binding to several, though not necessarily all, of the codons that specify a particular amino acid.
Aminoacylation is the process of adding an aminoacyl group to a compound. It produces tRNA molecules with their CCA 3' ends covalently linked to an amino acid. Each tRNA is aminoacylated (or charged) with a specific amino acid by an aminoacyl tRNA synthetase. There is normally a single aminoacyl tRNA synthetase for each amino acid, despite the fact that there can be more than one tRNA, and more than one anticodon, for an amino acid. Recognition of the appropriate tRNA by the synthetases is not mediated solely by the anticodon, and the acceptor stem often plays a prominent role.
Unnatural amino acid (UAA): Any amino acid, modified amino acid, and/or amino acid analogue, which is not one of the 20 common naturally occurring amino acids or seleno cysteine or pyrrolysine. Unnatural amino acids are described at greater length in section IV F of the Detailed Description below.
Vector: A nucleic acid molecule capable of transporting a non- vector nucleic acid sequence (such as a MO-RS or O-tRNA sequence) which has been introduced into the vector. One type of vector is a "plasmid," which refers to a circular double-stranded DNA into which non-plasmid DNA segments can be ligated. Other vectors include cosmids, bacterial artificial chromosomes (BAC) and yeast artificial chromosomes (YAC). Another type of vector is a viral vector, wherein additional DNA segments can be ligated into all or part of the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (for example, vectors having a bacterial origin of replication replicate in bacteria hosts). Other vectors can be integrated into the genome of a host cell upon introduction into the host cell and are replicated along with the host genome. Some vectors contain expression control sequences (such as promoters) and are
capable of directing the transcription of an expressible nucleic acid sequence that has been introduced into the vector. Such vectors are referred to as "expression vectors." A vector can also include one or more selectable marker genes and/or genetic elements known in the art. Yeast: A eukaryotic microorganism classified in the Kingdom Fungi, with about 1,500 species described. Most reproduce asexually by budding, although a few reproduce by binary fission. Yeasts generally are unicellular, although some species may become multicellular through the formation of a string of connected budding cells known as pseudohyphae, or false hyphae. Exemplary yeasts that can be used in the disclosed methods and compositions include but are not limited to Saccharomyces cerevisiae, Candida albicans, Schizosaccharomyces pombe, and Saccharomycetales.
Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Definitions of common terms in molecular biology can be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: A Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). All GenBank accession numbers are incorporated by reference for the sequence available on June 5, 2009. All references recited herein are incorporated by reference. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. "Comprising" means "including." "Comprising A or B" means "including A," "including B" or "including A and B." It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or peptides are approximate, and are provided for description.
Suitable methods and materials for the practice or testing of the disclosure are described below. However, the provided materials, methods, and examples are
illustrative only and are not intended to be limiting. Accordingly, except as otherwise noted, the methods and techniques of the present disclosure can be performed according to methods and materials similar or equivalent to those described and/or according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification (see, for instance, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et al., Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Press, 2001; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates, 1992 (and Supplements to 2000); Ausubel et al. , Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 4th ed., Wiley & Sons, 1999).
IV. Genetic incorporation of unnatural amino acids in eukaryotic cells A. Overview
It is demonstrated herein that the recognition of the orthogonal tRNA (O- tRNA) by the orthogonal aminoacyl-tRNA synthetase (O-RS) was enhanced by engineering the anticodon-binding domain of the synthetase. The mutation (Asp265Arg in E. coli tyrosyl-tRNA synthetase) can generally transplanted to other synthetases specific for different unnatural amino acids to improve their incorporation efficiencies in mammalian or other eukaryotic cells. Using the enhanced synthetase specific for /?-azidophenylalanine (Azi), site-specific photocros slinking of interacting proteins in mammalian cells was achieved with high efficiency. The efficiency of an orthogonal synthetase in charging the orthogonal tRNA with an unnatural amino acid depends on the affinity of the synthetase toward both the unnatural amino acid and the tRNA. To decode the amber stop codon UAG used for specifying the unnatural amino acid, the anticodon of the orthogonal tRNA is changed to CUA. This change would decrease the affinity of the tRNA toward its cognate orthogonal synthetase, because the anticodon is a major recognition element of most synthetases in distinguishing tRNAs. The E. coli tRNAjjA /tyrosyl-tRNA synthetase (TyrRS) pair has been the candidate for
evolving orthogonal tRNA/synthetase pairs for incorporating various unnatural amino acids in yeast and mammalian cells. Thus the inventors mutated the E. coli TyrRS to increase the recognition of the E. coli TyrRS toward the tRNAjjA .
Described herein is a general strategy for increasing the efficiency and incorporation rate of UAAs in eukaryotic cells (such as mammalian cells) using mutated orthogonal aminoacyl-tRNA sythetases. By mutating the anticodon binding domain of a prokaryotic O-RS, the incorporation efficiency of UAAs into proteins in vivo (as evidenced by the produced amount of protein containing the UAA) increased by 1.6 to 5.2 fold depending on the particular UAA. Therefore, the methods can be used to increase UAA incorporation by at least 1.5-fold, at least 2- fold, at least 3-fold, at least 4-fold, or even at least 5-fold, relative to the corresponding wt O-RS. For example, in an E. coli tyrosyl-tRNA synthetase, an Asp265Arg mutation was successful. Based on the results presented herein, one skilled in the art will appreciate that a corresponding mutation can be made in other prokaryotic synthetases to achieve similar results. For example, by examining the 3D structure of the interface between the O-RS and the anticodon region of the O- tRNA, particular amino acids to be mutagenized can be identified. Methods of making point mutations to a sequence are well-known in the art. In addition, the results were verified using several different UAAs, demonstrating that the method can be extended to other O-RS (for example a prokaryotic O-RS, but in some examples not an archaeal O-RS) specific for other UAAs (as well as natural amino acids).
In specific examples, the MO-RS is selected for the particular UAA to be incorporated. The MO-RS can be expressed in a eukaryotic cell using standard molecular biology methods. For example, a nucleic acid encoding the MO-RS can be introduced into the eukaryotic cell, such as under the control of a promoter. The cell also includes an orthogonal tRNA (O-tRNA) corresponding to the MO-RS, thereby permitting formation of an orthogonal tRNA-orthogonal mutant synthetase pair in the cell. For example, the MO-RS/O-tRNA can be selected for the particular unnatural amino acid to be incorporated into proteins. The cell is then incubated in growth medium that includes the UAA under conditions that permit the MO-RS to
charge the O-tRNA with the UAA, thereby generating acylated tRNA which can incorporate the UAA into proteins in the cell.
The O-tRNA (such as a prokaryotic or archaebacterial tRNA), regardless of the internal promoter elements, can be expressed in eukaryotic cells by using a pol III promoter. Exemplary pol III promoters include those that are not transcribed and do not require downstream transcriptional elements, but have a defined starting transcription site for direct RNA transcription, and those that are transcribed together with the tRNA, and are then cleaved post-transcriptionally to yield the tRNA. For example, a pol III promoter can be operably linked to a prokaryotic O- tRNA, and the resulting construct introduced into a eukaryotic cell, thereby permitting expression of the O-tRNA in the cell. The type 3 pol III promoters do not require downstream transcriptional elements, and have a well-defined transcription initiation site for generating the correct 5 '-end of tRNA. For example, the Hl promoter can drive the expression of different tRNAs (for instance, EctRNA^A and
EctRNApuA ) in various cell types (e.g., HeLa, HEK293, mouse and rat primary neurons) for the incorporation of diverse natural or unnatural amino acids. Other members of the type-3 class of pol III promoters, such as the promoter for U6 snRNA, 7SK, and MRP/7-2, also work in a similar manner. In another example, an internal leader promoter can be operably linked to the
O-tRNA, and the resulting construct introduced into a eukaryotic cell, thereby permitting expression of the prokaryotic tRNA in the cell. Internal leader promoters are transcribed together with the O-tRNA, and are then cleaved post- transcriptionally to yield the O-tRNA. For instance internal leader promoters such as the SNR52 promoter and the RPRl promoter can drive the efficient expression of different prokaryotic tRNAs (for instance, EctRNA|^A and EctRNA^A ) in yeast cells for the incorporation of diverse natural or unnatural amino acids.
Co-expression of the O-tRNA and mutated O-tRNA synthetase in the same eukaryotic cell can be used to drive the incorporation of unnatural amino acids (UAAs) into proteins in the cell. For instance, the eukaryotic cell can genetically encode an UAA when: (1) the O-tRNA/MO-RS pair is specific for the UAA, (2) the
O-tRNA decodes a blank codon unused by a common amino acid (such as stop codons or extended codons), (3) the O-tRNA/synthetase pair works with the protein biosynthesis machinery of the host cell, and (4) there is little or no crosstalk between the O-tRNA/synthetase and endogenous tRNA/synthetase pairs (i.e., the tRNA/synthetase pair is orthogonal).
To evolve a synthetase specific for a desired UAA, mutant synthetase libraries containing more than 109 members previously were made and selected in E. coli, and later in yeast. Due to the low transfection efficiency, it is impractical to generate such huge libraries in mammalian cells and neurons. However, as described herein, synthetases evolved in yeast can be successfully transferred for use in mammalian cells and in neurons. This transfer strategy facilitates the incorporation of diverse UAAs tailored for mammalian and neuronal studies. Using these strategies, it is now possible, to genetically encode UAAs in different eukaryotic cells, for example, mammalian cells and primary neurons and stem cells. Furthermore, the method offers a dramatic improvement in the efficiency of UAA expression in yeast, for example in yeast substantially Nonsense-Mediated mRNA Decay- (NMD)-deficient.
The NMD pathway is a cellular mechanism of mRNA surveillance used by the cell to detect nonsense mutations and prevent the expression of truncated or erroneous proteins. Disruption of this pathway results in a higher efficiency of incorporation of UAAs in cells such as yeast cells and mammalian cells. The NMD pathway mediates the rapid degradation of mRNAs that contain premature stop codons in yeast, whereas no such pathway exists in E. coli. When stop codons are used to encode UAAs, in some examples, NMD results in a shorter lifetime for the target mRNA, and thus a lower protein yield in yeast. An NMD-deficient yeast strain is used in some embodiments to overcome this problem, and to enable high- yield production of UAAs in yeast.
This strategy also can be used effectively in mammalian cells. In mammalian cells, the efficacy of disrupting the NMD pathway depends on the presence of exon-intron junctions in the DNA sequence. Thus, if there are introns in the gene of interest, disrupting the NMD pathway increases the efficiency of UAA incorporation.
Genetically encoding UAAs removes restrictions imposed by in vitro semisynthetic and biosynthetic unnatural-amino-acid incorporation methods on protein type, size, quantity and location (Muir (2003) Annu. Rev. Biochem. 72, 249- 289; Cornish et al., (1995) Angewandte Chemie- International Edition in English 34, 621-633). The compatibility of this method with living systems is valuable for proteins whose function requires native complex cellular environments such as integral membrane proteins and proteins involved in signaling. Genetic stability and inheritance are well-suited for researching long-term biological processes such as developmental and evolutionary studies. In addition, this technology does not require special expertise, and is easily transferable to the scientific community in the form of plasmid DNA or stable cell lines. Thus, unnatural amino acids can be designed and encoded to probe and control proteins and protein-related biological processes. For instance, fluorescent unnatural amino acids can be used to sense local environmental changes and serve as reporters for enzyme activity, membrane potential or neurotransmitter release; unnatural amino acids bearing photocrosslinking agents can be applied to identify protein-protein and protein-nucleic acid interactions in cells; and photocaged and photoisomerizable amino acids can be designed to switch on and off signal initiation and transduction noninvasively. Many of these unnatural amino acids previously have been encoded in E. coli and in yeast, albeit with low efficiency (Wang et al., (2006) Annu. Rev. Biophys. Biomol. Struct. 35, 225-249). The compositions and methods described herein enable the genetic encoding of such novel amino acids in mammalian cells and neurons, thus making possible more precise molecular studies of cell biology and neurobiology. Furthermore, improvements in the efficiency of unnatural amino acid expression in yeast enable large-scale preparation of modified polypeptides.
B. Orthogonal tRNA/Aminoacyl-tRNA Synthetase Pairs
An understanding of the novel compositions and methods disclosed herein is facilitated by an understanding of the activities associated with orthogonal tRNA and orthogonal aminoacyl-tRNA synthetase pairs. Discussions of orthogonal tRNA and aminoacyl-tRNA synthetase technologies can be found, for example, in International Publications WO 2002/085923, WO 2002/086075, WO 204/09459,
WO 2005/019415, WO 2005/007870 and WO 2005/007624. See also, Wang & Schultz (2005) Angewandte Cheinie mt. Ed., 44(l):34-66, and Wang et al, Chem. Biol. 16:323-36, 2009, the content of which are incorporated by reference in their entirety. In order to add additional reactive unnatural amino acids to the genetic code, orthogonal pairs including an aminoacyl-tRNA synthetase (such as an MO-RS) and a suitable tRNA are needed that can function efficiently in the host translational machinery, but that are "orthogonal" to the translation system at issue, meaning that it functions independently of the synthetases and tRNAs endogenous to the translation system. In particular examples, characteristics of the orthologous pair include tRNAs that decode or recognize only a specific codon, for instance, a selector codon, that is not decoded by any endogenous tRNA, and mutated aminoacyl-tRNA synthetases that preferentially aminoacylate (or "charge") its cognate tRNA with only one specific unnatural amino acid. The O-tRNA also typically is not aminoacylated by endogenous synthetases. For example, in a eukaryotic cell, an orthogonal pair will, in certain examples, include an aminoacyl- tRNA synthetase that does not cross-react with endogenous tRNA, and an orthogonal tRNA that is not aminoacylated by endogenous synthetases. In some embodiments, the exogenous tRNA and MO-RS are prokaryotic. When expressed in a eukaryotic cell, the exogenous MO-RS aminoacylates the exogenous suppressor tRNA with its respective UAA and not with any of the common twenty amino acids.
The ability to express UAAs in eukaryotic cells and incorporate an UAA into a protein expressed in a eukaryotic cell can facilitate the study of proteins, as well as enable the engineering of proteins with novel properties. For example, expression of proteins containing one or more UAAs can facilitate the study of proteins by specific labeling, alter catalytic function of enzymes, improve biological activity or reduce cross-reactivity to a substrate, crosslink a protein with other proteins, small molecules or biomolecules, reduce or eliminate protein degradation, improve half- life of proteins in vivo (for instance, by pegylation or other modifications of introduced reactive sites), etc.
In general, when an orthogonal pair recognizes a selector codon and loads an amino acid in response to the selector codon, the orthogonal pair is said to
"suppress" the selector codon. That is, a selector codon that is not recognized by the translation system's (for instance, the eukaryotic cell's) endogenous machinery is not ordinarily translated, which can result in blocking production of a peptide that would otherwise be translated from the nucleic acid. An O-tRNA of the disclosure recognizes a selector codon and includes at least about, for instance, a 45%, a 50%, a 60%, a 75%, a 80%, or a 90% or more suppression efficiency in the presence of a cognate synthetase in response to a selector codon as compared to the suppression efficiency of an O-tRNA comprising or encoded by a nucleic acid molecule sequence, for instance as set forth in SEQ ID NOs 33 and 34. The MO-RS aminoacylates the O-tRNA with an UAA of interest, and the cell uses the O-tRNA/MO-RS pair to incorporate the UAA into a growing peptide chain, for instance, via a nucleic acid molecule that includes a nucleic acid molecule that encodes a peptide of interest, where the nucleic acid molecule includes a selector codon that is recognized by the O-tRNA. In certain embodiments, the cell can include an additional O-tRNA/MO-RS pair, where the additional O-tRNA is loaded by the additional MO-RS with a different UAA. For example, one of the O- tRNAs can recognize a four-base codon and the other can recognize a stop codon. Alternately, multiple different stop codons or multiple different four base codons can specifically recognize different selector codons. In one embodiment, the suppression efficiency of the O-RS and the MO-tRNA together is at least 5-fold, 10- fold, 15-fold, 20-fold, or 25-fold (or more) greater than the suppression efficiency of the O-tRNA lacking the MO-RS.
Suppression efficiency can be determined by any of a number of assays known in the art, for example, a β-galactosidase reporter assay. A cognate synthetase can also be introduced (either as a peptide or a nucleic acid molecule that encodes the cognate synthetase when expressed). The cells are grown in media to a desired density, and β-galactosidase assays are performed. Percent suppression can be calculated as the percentage of activity for a sample relative to a suitable control, for instance, the value observed from the derivatized lacZ construct, where the construct has a corresponding sense codon at desired position rather than a selector codon.
The O-tRNA and/or the MO-RS can be naturally occurring or can be derived by mutation of a naturally occurring tRNA and/or RS, for instance, by generating libraries of tRNAs and/or libraries of RSs, from any of a variety of organisms and/or by using any of a variety of available mutation methods. For example, one method for producing an orthogonal tRNA/aminoacyl-tRNA synthetase pair involves importing a heterologous (to the host cell) tRNA/synthetase pair from a source other than the host cell, or multiple sources, into the host cell. The properties of the heterologous synthetase candidate include that it does not charge any host cell tRNA, and the properties of the heterologous tRNA candidate include that it is not aminoacylated by any host cell synthetase. In addition, the heterologous tRNA is orthogonal to all host cell synthetases. A second strategy for generating an orthogonal pair involves generating mutant libraries from which to screen and/or select an O-tRNA or MO-RS. These strategies also can be combined.
A number of orthogonal tRNA/aminoacyl-tRNA synthetase pairs have been identified, including but not limited to the tyrosyl tRNA/TyrRS derived from E. coli, the leucyl tRNA/TyrRS derived from E. coli, the glutaminyl tRNA/GlnRS derived from E. coli (Kohrer et al, (2004) Nucleic Acids Res. 32(21):6200-l 1), the tryptophanyl tRNA/TrpRS derived from B. subtilis (Zhang et al, (2004) Proc Natl Acad Sci U SA. 101(24):8882-7), the E. coli tyrosyl tRNA/TyrRS for use in yeast, and the pyrrolysyl tRNA/PylRS pair from Methanosarcina barken or
Methanosarcina mazei for use in E. coli and mammalian cells (Blight et al., (2004) Nature 431: 333-5).. In a particular example, the tRNA/aminoacyl-tRNA synthetase pair is not from M. jannaschii.
C. Source and Host Cells The orthogonal translational components (O-tRNA and MO-RS) of the disclosure can be derived from any organism (or a combination of organisms) for use in a host translation system from any other species, with the caveat that the O- tRNA/MO-RS components and the host system work in an orthogonal manner. IN one example, one or more of the orthogonal translational components are non- Archaeal. It is not a requirement that the O-tRNA and the MO-RS from an orthogonal pair be derived from the same organism. In some embodiments, the
orthogonal components are derived from prokaryotic genes (for instance, E. coli) for use in a eukaryotic host system.
For example, the O-tRNA and the MO-RS can be derived from a eubacterium, such as Escherichia coli, Thermus thermophilics, Bacillus stearotherinphilus, or the like. The individual components of an O-tRNA/MO-RS pair can be derived from the same organism or different organisms.
The eukaryotic host cell in which the recombinant MO-RS and O-tRNA are expressed can be from any eukaryotic species, for example, animals (for instance, mammals, insects, reptiles, birds, etc.), plants (for instance, monocots, dicots, algae, etc.), fungi, yeasts, flagellates, microsporidia, and protists, etc. In certain embodiments, the eukaryotic host cell is a mammalian cell, for example a human, cat, dog, mouse, rat, sheep, cow, or horse cell. In certain embodiments, the host cell is a neuron. In other embodiments, the host cell is a stem cell. In a particular embodiment, the host cell is a yeast cell, for instance an S. cerevisiae, S. pombe, C. albicans, or Saccharomycetale cell. In some examples, the cell is a eukaryotic cell that is substantially Nonsense-Mediated mRNA Decay- (NMD)-deficient, such as a yeast or mammalian cell that is NMD-deficient. In fact, cell lines from ATCC (Manassas, VA) can be used, as well as primary cell lines.
As described at greater length below in Example 6, the NMD pathway is an evolutionarily conserved mRNA surveillance pathway that recognizes and eliminates aberrant mRNAs harboring premature termination codons, thereby preventing the accumulation of nonfunctional or potentially deleterious truncated proteins in the cells. In addition to mRNAs with premature termination codons, NMD degrades a variety of naturally occurring transcripts to suppress genomic noise. One step in NMD is the translation-dependent recognition of transcripts with aberrant termination events and then targeting those mRNAs for destruction.
As is well known in the art, the three Upf proteins, Upfl, Upf2 and UpO, constitute the core NMD machinery as they are conserved and required for NMD in Saccharomyces cerevisiae, Drosophila melanogaster, and in mammalian cells. Upfl appears to recognize aberrant translation termination events and, then in a subsequent step, interacts with Upf2 and UpO to trigger degradation of mRNA. Specific, non-limiting examples of Upfl sequences include GenBank Accession
Nos: AAF48115 (D. melanogaster), EAW84742 (human), AAH52149 (mouse), and CAA91194 (S. pombe). Specific, non-limiting examples of Upf2 sequences include GenBank Accession Nos: AAF46314 (D. melanogaster), AAG60689 (human), CAM23670 (mouse), and CABl 1644 (S. pombe). Specific, non-limiting examples of UpO sequences include GenBank Accession Nos: AAM68275 (D. melanogaster), AAG60690 (human), AAI19036 (mouse), and CAA97074 (S. cerevisiae).
In yeast, a lack of mRNA stability of the target gene can interfere with the efficiency of UAA incorporation. The NMD pathway mediates the rapid degradation of mRNAs that contain premature stop codons in yeast, whereas no such pathway exists in E. coli. When stop codons are used to encode UAAs, in some examples, NMD results in a shorter lifetime for the target mRNA, and thus a lower protein yield in yeast. Thus, an NMD-deficient yeast strain is used in some embodiments to overcome this problem, and to enable high-yield production of UAAs in yeast.
This strategy also can be used effectively in mammalian cells. In mammalian cells, the efficacy of disrupting the NMD pathway depends on the presence of exon-intron junctions in the DNA sequence. Thus, if there are introns in the gene of interest, disrupting the NMD pathway increases the efficiency of UAA incorporation.
Complete NMD deficiency in the cell is not required, and in some examples is avoided (for example if complete NMD deficiency is toxic to the cell). For example, partial NMD deficiency can be sufficient to achieve the desired result, such as enhancing prokaryotic tRNA expression in a eukaryotic cell, enhancing the efficiency of incorporation of a UAA a eukaryotic cell, or both.
Methods of decreasing expression or activity of a gene in a eukaryotic cell are well known in the molecular biology arts. In addition, such methods are enabled by the public availability of genes in the NMD-pathway (for example on GenBank or EMBL). In addition, such methods are enabled by the public availability of genes in the NMD-pathway (for example on GenBank or EMBL).
For example, NMD-deficient cells (such as yeast or mammalian cells) can be engineered to lack the UPFl gene, which in some examples is essential for the
function of the NMD pathway. Other methods for deactivating the NMD pathway include the complete knock out, partial deletion, partial mutation, or silencing (e.g., through RNA interference) of any genes involved in the NMD pathway, such as upfl, upf2, upf3, hrpl, nmd2, etc., and using small molecules to inhibit the function of proteins involved in the NMD pathway, such as the function of Upf Ip, Upf2p, UpOp, Hrplp, Nmd2p, etc. Methods of reducing the expression of a protein using molecular biological techniques are conventional, and are well known in the art.
Some embodiments include cell lines that are substantially NMD-deficient, such as NMD-deficient mammalian cell lines and NMD-deficient yeast cell lines. A labeled UAA, such as a fluorescent UAA, can be incorporated in the NMD-deficient strain, and the intensity of the label can be used as a measure of UAA incorporation efficiency.
D. Promoters
A promoter is a region of DNA that generally is located upstream (towards the 5' region of a gene) and is needed for transcription. Promoters permit the proper activation or repression of the gene which they control. A promoter contains specific sequences that are recognized by transcription factors. These factors bind to the promoter DNA sequences and result in the recruitment of RNA polymerase, the enzyme that synthesizes the RNA from the coding region of the gene. Promoters can be used to express MO-RS and O-tRNA molecules.
Promoters useful in carrying out the methods described herein include RNA polymerase III (also called pol III) promoters, which transcribe DNA to synthesize ribosomal 5S rRNA, tRNA, and other small RNAs, generally structural or catalytic RNAs that are, generally, shorter than 400 base pairs. Pol III is unusual in that it requires no control sequences upstream of the gene. Instead it normally relies on internal control sequences.
The classification of pol III genes by their promoter structure has been covered in several reviews (see, for example, Geiduschek & Tocchini-Valentini (1988) Annu. Rev. Biochem. 57, 873-914). Most genes transcribed by pol III fall into one of three well defined groups, depending on the location or type of cis-acting elements which constitute their promoters. Type-1 genes include 5s RNA genes whose promoters are distinguished by three intragenic sequence elements; a 5' A
block, an intermediate element and a 3' C block. These elements span a region of approximately 50 bp beginning at about position +45. Type-2 genes are identified by well conserved A and B block elements. The A block is invariantly intragenic and, in contrast to 5s genes, is positioned closer to the transcription start site (usually at about 10-20 bp). Type-3 genes are characterized by promoter sequences that reside upstream of the coding sequence. The prototypes of this group include metazoan U6 small-nuclear RNA genes and the human 7SK gene. The promoters of these genes contain a TATA sequence near position -30 that determines the polymerase specificity of the transcription unit, and a proximal sequence element at around position -60. Together, these two elements constitute a basal promoter which is subject to activation by a variety of factors that bind to distal sequence elements.
A dichotomy exists concerning the transcription of genes identified initially as belonging to the type-3 class in metazoans and these same genes in yeast. Instead of the upstream control regions that are the hallmark of the type-3 class, the homologs of type-3 genes in yeast rely on A-block and B-block promoter elements typical of type-2 transcription units. The first reported example was the U6 gene from Saccharomyces cerevisiae, which contains a B-block element positioned 120- bp downstream of the coding sequence, beyond the site of transcription termination. Fission yeast also are likely to use A-block and B-block elements to direct U6 gene transcription.
Another example of a gene whose mode of transcription differs depending on the organism from which it is derived is the gene encoding the RNA component of RNase P. The human gene for this RNA, designated Hl, contains multiple cis-acting elements upstream of the start site and does not require internal sequences for transcription in vitro. By this criterion, the Hl RNA gene is a typical type-3 gene. However, the homologous gene from S. cerevisiae (RPRl) relies on A-block and B- block elements positioned upstream of the mature RNase P RNA sequence to direct transcription. In some embodiments described herein, the promoter is a type-3 pol III Hl promoter. The Hl promoter can drive the expression of different tRNAs in various cell types (for instance, HeLa, HEK293, mammalian primary neurons) for the
incorporation of diverse natural or UAAs. Other members of the type-3 class of pol III promoter are also useful in the practice of the disclosed methods, and include, for instance, the promoters for U6 snRNA, 7SK, and MRP/7-2, as well as internal leader promoters of yeast. Certain yeast pol III type 3 promoters are transcribed together with the tRNA, and are then cleaved post-transcriptionally to yield the mature RNA. Such promoters, for instance, the SNR52 promoter and the RPRl promoter, can be used for efficient incorporation of UAAs in yeast cells. Internal leader promoters, such as SNR52 and RPRl, share a promoter organization that includes a leader sequence in which the A- and B-boxes are internal to the primary transcript, but are external to the mature RNA product.
E. Selector Codons
Selector codons of the disclosure expand the genetic codon framework of protein biosynthetic machinery. Exemplary selector codons include a unique three base codon, a nonsense codon, such as a stop codon, for instance, an ochre codon (UAA), an amber codon (UAG), or an opal codon (UGA), a missense or frameshift codon, an unnatural codon, a four-base codon, a rare codon, or the like. A number of selector codons can be introduced into a desired gene, and by using different selector codons, multiple orthogonal tRNA/synthetase pairs can be used that allow the simultaneous site- specific incorporation of multiple UAAs.
In one embodiment, the methods include the use of a selector codon that is a stop codon for the incorporation of a UAA in vivo in a cell. For example, an O- tRNA is produced that recognizes the stop codon and is aminoacylated by an O-RS with a UAA. This O-tRNA is not recognized by the naturally occurring host's aminoacyl- tRNA synthetases. When the O-RS, O-tRNA and the nucleic acid molecule that encodes a peptide of interest are combined, for instance, in vivo, the UAA is incorporated in response to the stop codon to give a peptide containing the UAA at the specified position. In one embodiment, the stop codon used as a selector codon is an amber codon, UAG, and/or an opal codon, UGA. F. Unnatural Amino Acids (UAAs)
As used herein, an unnatural amino acid (UAA) refers to any amino acid, modified amino acid, or amino acid analogue other than selenocysteine and/or
pyrrolysine and the following twenty genetically encoded alpha- amino acids: alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine. The generic structure of an alpha- amino acid is illustrated by Formula I: H2NCH(R)COOH. Such UAAs can be included the growth medium of the cells expressing the MO-RS and O-tRNA, thereby permitting incorporation of the UAA into proteins.
A UAA typically is any structure having Formula I wherein the R group is any substituent other than one used in the twenty natural amino acids. See for instance, Biochemistry by L. Stryer, 31(1 ed. 1988), Freeman and Company, New York, for structures of the twenty natural amino acids. UAAs also can be naturally occurring compounds other than the twenty alpha-amino acids above.
Specific, non-limiting examples of UAAs include p- ethylthiocarbonyl- L- phenylalanine, p-(3-oxobutanoyl)-L- phenylalanine, 1, 5-dansyl-alanine, 7-amino- coumarin amino acid, 7- hydroxy-coumarin amino acid, nitrobenzyl-serine, 0-(2- nitrobenzyl)-L- tyrosine, p-carboxymethyl- L-phenylalanine, p-cyano-L- phenylalanine, m- cyano-L-phenylalanine, biphenylalanine, 3-amino-L-tyrosine, bipyridyl alanine, p-(2- amino-i - hydroxyethyl)-L-phenylalanine, p- isopropylthiocarbonyl-L-phenylalanine, 3- nitro- L-tyrosine and p-nitro-L- phenylalanine. Both the L and D- enantiomers of these UAAs are included in the disclosure. Many additional UAAs and suitable orthogonal pairs are known. For example, see Wang & Schultz (2005) Angewandte Cheinie mt. Ed., 44(l):34-66, the content of which is incorporated by reference in its entirety.
In some UAAs, R in Formula I optionally includes an alkyl-, aryl-, acyl-, hydrazine, cyano-, halo-, hydrazide, alkenyl, ether, borate, boronate, phospho, phosphono, phosphine, enone, imine, ester, hydroxylamine, or amine group or the like, or any combination thereof. Other UAAs of interest include, but are not limited to, amino acids comprising a crosslinking amino acid, photoactivatable crosslinking amino acids, spin-labeled amino acids, fluorescent amino acids, metal binding amino acids, metal-containing amino acids, radioactive amino acids, amino acids with novel functional groups, amino acids that covalently or noncovalently interact with other molecules, photocaged and/or photoisomerizable amino acids, photoaffinity
labeled amino acids, biotin or biotin-analogue containing amino acids, polymer- containing amino acids, cytotoxic molecule-containing amino acids, saccharide- containing amino acids, heavy metal-binding element-containing amino acids, amino acids containing a heavy atom, amino acids containing a redox group, amino acids containing an infrared probe, amino acids containing an azide group, amino acids containing an alkyne group, keto containing amino acids, glycosylated amino acids, a saccharide moiety attached to the amino acid side chain, amino acids comprising polyethylene glycol or polyether, heavy atom substituted amino acids, chemically cleavable or photocleavable amino acids, amino acids with an elongated side chain as compared to natural amino acids (for instance, polyethers or long chain hydrocarbons, for instance, greater than about 5, greater than about 10 carbons, etc.), carbon-linked sugar-containing amino acids, amino thioacid containing amino acids, and amino acids containing one or more toxic moieties.
In addition to UAAs that contain novel side chains, UAAs also can optionally include modified backbone structures, for instance, as illustrated by the structures of Formulas II and III:
II: ZCH(R)C(X)YH
III: H2NC(R1)(R2)CO2H wherein Z typically includes OH, NH2, SH, NH-R2, or S-R2; X and Y, which can be the same or different, typically include S or O, and R1 and R2, which are optionally the same or different, are typically selected from the same list of constituents for the R group described above for the UAAs having Formula I as well as hydrogen. For example, unnatural amino optionally include substitutions in the amino or carboxyl group as illustrated by Formulas II and III. UAAs of this type include, but are not limited to, α-hydroxy acids, α-thioacids α-aminothiocarboxylates, for instance, with side chains corresponding to the common twenty natural amino acids or unnatural side chains. In addition, substitutions at the α-carbon optionally include L, D, or α- disubstituted amino acids such as D-glutamate, D-alanine, D-methyl-O-tyrosine, aminobutyric acid, and the like. Other structural alternatives include cyclic amino acids, such as proline analogues as well as 3, 4, 6, 7, 8, and 9 membered ring proline analogues, 3 and γ amino acids such as substituted 3-alanine and γ-amino butyric acid. In some embodiments, the UAAs are used in the L-configuration. However,
the disclosure is not limited to the use of L-configuration UAAs, and D-enantiomers of these UAAs also can be used.
Tyrosine analogs include para-substituted tyrosines, ortho- substituted tyrosines, and meta substituted tyrosines, wherein the substituted tyrosine includes an alkynyl group, acetyl group, a benzoyl group, an amino group, a hydrazine, an hydroxyamine, a thiol group, a carboxy group, an isopropyl group, a methyl group, a C6 - C20 straight chain or branched hydrocarbon, a saturated or unsaturated hydrocarbon, an O-methyl group, a polyether group, a nitro group, or the like. In addition, multiply substituted aryl rings are also contemplated. Glutamine analogs include, but are not limited to, α-hydroxy derivatives, γ-substituted derivatives, cyclic derivatives, and amide substituted glutamine derivatives. Example phenylalanine analogs include, but are not limited to, para-substituted phenylalanines, ortho- substituted phenyalanines, and meta- substituted phenylalanines, wherein the substituent includes an alkynyl group, a hydroxy group, a methoxy group, a methyl group, an allyl group, an aldehyde, a nitro, a thiol group, or keto group, or the like. Specific examples of UAAs include, but are not limited to, p-ethylthiocarbonyl-L- phenylalanine, p-(3-oxobutanoyl)-L-phenylalanine, 1,5- dansyl-alanine, 7- amino-coumarin amino acid, 7-hydroxy-coumarin amino acid, nitrobenzyl- serine, O-(2-nitrobenzyl)-L-tyrosine, p-carboxymethyl-L- phenylalanine, p- cyano-L-phenylalanine, m-cyano-L-phenylalanine, biphenylalanine, 3-amino- L-tyrosine, bipyridyl alanine, p-(2-amino- 1 - hydroxyethyl)-L- phenylalanine, p-isopropylthiocarbonyl-L- phenylalanine, 3-nitro- L- tyrosine and p-nitro-L-phenyl alanine. Also, a p- propargyloxyphenylalanine, a 3,4-dihydroxy-L-phenyalanine (DIHP), a 3, 4, 6-trihydroxy-L- phen ylalanine, a 3,4,5-trihydroxy-L-phenylalanine, 4- nitro-phenylalanine, a p-acetyl-L- phenylalanine, O-methyl-L-tyrosine, an L-3 -(2-naphthyl)alanine, a 3-methyl- phenylalanine, an O-4-allyl-L- tyrosine, a 4-propyl-L-tyrosine, a 3-nitro-tyrosine, a 3-thiol-tyrosine, a tn-O- acetyl-GlcNAc-serine, an L-Dopa, a fluorinated phenylalanine, an isopropyl-L- phenylalanine, a p-azi do-L-phenyl alanine, a p-acyl- L- phenylalanine, a p-benzoyl-L- phenylalanine, an L-phosphoserifle, a phosphonoserine, a phosphonotyrosine, a p-iodo- phenylalanine, a p- bromophenylalanine, a p-amino-L-phenylalanine, and an isopropyl-L-
phenylalanine, and the like. See also, Published International Application WO 2004/094593.
G. Chemical Synthesis of Unnatural Amino Acids (UAAs)
Many of the UAAs provided above are commercially available, for instance, from Sigma (USA) or Aldrich (Milwaukee, WI, USA). Those that are not commercially available are optionally synthesized as provided in various publications or using standard methods. For organic synthesis techniques, see, for instance, Organic Chemistry by Fessendon and Fessendon, (1982, Second Edition, Willard Grant Press, Boston Mass.); Advanced Organic Chemistry by March (Third Edition, 1985, Wiley and Sons, New York); and Advanced Organic Chemistry by Carey and Sundberg (Third Edition, Parts A and B, 1990, Plenum Press, New York). Additional publications describing the synthesis of UAAs include, for instance, WO 2002/085923 entitled "In vivo incorporation of Unnatural Amino Acids;" Matsoukas et al, (1995) J. Med. Chem., 38, 4660-4669; King & Kidd (1949) J. Chem. Soc, 3315-3319; Friedman & Chatterrji (1959) J. Am. Chem. Soc. 81, 3750-3752; Craig et al, (1988) J. Org. Chem. 53, 1167-1170; Azoulay et al, (1991) Eur. J. Med. Chem. 26, 201-5; Koskinen & Rapoport (1989) J. Org. Chem. 54, 1859- 1866; Christie & Rapoport (1985) J. Org. Chem. 1989: 1859- 1866; Barton et al, (1987) Tetrahedron Lett. 43:4297-4308; and Subasinghe et al, (1992) J. Med. Chem. 3 5:4602- 7.
H. Cellular Uptake of Unnatural Amino Acids (UAAs) UAA uptake by a cell can be considered when designing and selecting UAAs, for instance, for incorporation into a protein. For example, the high charge density of α-amino acids indicates that these compounds are unlikely to be cell permeable. Natural amino acids are taken up into the cell via a collection of protein- based transport systems often displaying varying degrees of amino acid specificity. A rapid screen can be done to identify which UAAs, if any, are taken up by cells. See, for instance, the toxicity assays in International Publication WO 2004/058946, entitled "PROTEIN ARRAYS," filed on December 22, 2003; and Liu & Schultz (1999) PNAS 96:47 80-4785. Although uptake is easily analyzed with various assays, an alternative to designing UAAs that are amenable to cellular uptake pathways is to provide biosynthetic pathways to create amino acids in vivo.
I. Biosynthesis of Unnatural Amino Acids (UAAs)
Many biosynthetic pathways already exist in cells for the production of amino acids and other compounds. While a biosynthetic method for a particular UAA may not exist in nature, for instance, in a cell, such methods are contemplated. In some examples, the UAA is not added to the growth medium of cells expressing MO-RS and O-tRNA; instead the cell also makes the UAA. For example, biosynthetic pathways for UAAs can be optionally generated in host cell by adding new enzymes or modifying existing host cell pathways. Additional new enzymes are optionally naturally occurring enzymes or artificially evolved enzymes. For example, the biosynthesis of p-aminophenylalanine (as presented in an example in WO 2002/085923) relies on the addition of a combination of known enzymes from other organisms. The genes for these enzymes can be introduced into a cell by transforming the cell with a plasmid that includes the genes. The genes, when expressed in the cell, provide an enzymatic pathway to synthesize the desired compound. Artificially evolved enzymes are also optionally added into a cell in the same manner. In this manner, the cellular machinery and resources of a cell are manipulated to produce UAAs.
J. Nucleic Acid Sequences and Variants
The present disclosure provides nucleic acid molecules that encode for MO- RS proteins and O-tRNAs. As any molecular biology textbook teaches, a peptide of interest is encoded by its corresponding nucleic acid sequence (for instance, an mRNA or genomic DNA). Accordingly, nucleic acid sequences encoding O-tRNAs and MO-RSs are contemplated herein, at least, to make and use the O-tRNAs and MO-RS peptides of the disclosed compositions and methods. In one example, in vitro nucleic acid amplification (such as polymerase chain reaction (PCR)) can be utilized as a method for producing nucleic acid sequences encoding O-tRNAs and MO-RSs. PCR is a standard technique, which is described, for instance, in PCR Protocols: A Guide to Methods and Applications (Innis et al., San Diego, CA:Academic Press, 1990), or PCR Protocols, Second Edition (Methods in Molecular Biology, Vol. 22, ed. by Bartlett and Stirling, Humana Press, 2003).
A representative technique for producing a nucleic acid sequence encoding an O-tRNA or MO-RS by PCR involves preparing a sample containing a target
nucleic acid molecule that includes the O-tRNA or MO-RS sequence. For example, DNA or RNA (such as mRNA or total RNA) can serve as a suitable target nucleic acid molecule for PCR reactions. Optionally, the target nucleic acid molecule can be extracted from cells by any one of a variety of methods well known to those of ordinary skill in the art (for instance, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989; Ausubel et al., Current Protocols in Molecular Biology, Greene Publ. Assoc, and Wiley-Intersciences, 1992). O-tRNAs and MO-RSs are expressed in a variety of cell types; for example, prokaryotic and eukaryotic cells. In examples where RNA is the initial target, the RNA is reverse transcribed (using one of a myriad of reverse transcriptases commonly known in the art) to produce a double-stranded template molecule for subsequent amplification. This particular method is known as reverse transcriptase (RT)-PCR. Representative methods and conditions for RT-PCR are described, for example, in Kawasaki et al. (In PCR Protocols, A Guide to Methods and Applications, Innis et al. (eds.), 21-27, Academic Press, Inc., San Diego, California, 1990).
The selection of amplification primers will be made according to the portion(s) of the target nucleic acid molecule that is to be amplified. In various embodiments, primers (typically, at least 10 consecutive nucleotides of an O-tRNA or MO-RS nucleic acid sequence) can be chosen to amplify all or part of an O-tRNA or MO-RS -encoding sequence. Variations in amplification conditions may be required to accommodate primers and amplicons of differing lengths and composition; such considerations are well known in the art and are discussed for instance in Innis et al. (PCR Protocols, A Guide to Methods and Applications, San Diego, CA:Academic Press, 1990). From a provided O-tRNA or MO-RS nucleic acid sequence, one skilled in the art can easily design many different primers that can successfully amplify all or part of an O-tRNA or MO-RS -encoding sequence.
As described herein, disclosed are nucleic acid sequences encoding O-tRNAs and MO-RSs. (See, for instance, SEQ ID NOs: 33 and 34.) Though particular nucleic acid sequences are disclosed herein, one of skill in the art will appreciate that also provided are many related sequences with the functions described herein, for
instance, nucleic acid molecules encoding conservative variants of an O-tRNA or an MO-RS disclosed herein. One indication that two nucleic acid molecules are closely related (for instance, are variants of one another) is sequence identity, a measure of similarity between two nucleic acid sequences or between two amino acid sequences expressed in terms of the level of sequence identity shared between the sequences. Sequence identity is typically expressed in terms of percentage identity; the higher the percentage, the more similar the two sequences.
Methods for aligning sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman, Adv. Appl. Math. 2:482, 1981; Needleman and Wunsch, J. MoI. Biol. 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. ScL USA 85:2444, 1988; Higgins and Sharp, Gene 73:237-244, 1988; Higgins and Sharp, CABIOS 5:151-153, 1989; Corpet et al., Nucleic Acids Research 16:10881-10890, 1988; Huang, et al., Computer Applications in the Biosciences 8:155-165, 1992; Pearson et al., Methods in Molecular Biology 24:307-331, 1994; Tatiana et al., (1999), FEMS Microbiol. Lett., 174:247-250, 1999. Altschul et al. present a detailed consideration of sequence- alignment methods and homology calculations (J. MoI. Biol. 215:403-410, 1990).
The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST™, Altschul et al., J. MoI. Biol. 215:403-410, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use in connection with the sequence-analysis programs blastp, blastn, blastx, tblastn and tblastx. A description of how to determine sequence identity using this program is available on the internet under the help section for BLAST™. For comparisons of amino acid sequences of greater than about 30 amino acids, the "Blast 2 sequences" function of the BLAST™ (Blastp) program is employed using the default BLOSUM62 matrix set to default parameters (cost to open a gap [default = 5]; cost to extend a gap [default = 2]; penalty for a mismatch [default = -3]; reward for a match [default = 1]; expectation value (E) [default = 10.0]; word size [default = 3]; number of one-line descriptions (V)
[default = 100]; number of alignments to show (B) [default = 100]). When aligning short peptides (fewer than around 30 amino acids), the alignment should be
performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the sequence of interest, for example the MO-RS of interest.
For comparisons of nucleic acid sequences, the "Blast 2 sequences" function of the BLAST™ (Blastn) program is employed using the default BLOSUM62 matrix set to default parameters (cost to open a gap [default = 11]; cost to extend a gap [default = I]; expectation value (E) [default = 10.0]; word size [default = 11]; number of one-line descriptions (V) [default = 100]; number of alignments to show (B) [default = 100]). Nucleic acid sequences with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the O-tRNA or MO-RS of interest.
Another indication of sequence identity is hybridization. In certain embodiments, O-tRNA or MO-RS nucleic acid variants hybridize to a disclosed (or otherwise known) O-tRNA or MO-RS nucleic acid sequence, for example, under low stringency, high stringency, or very high stringency conditions. Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization, although wash times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and 11.
The following are representative hybridization conditions and are not meant to be limiting.
Very High Stringency (detects sequences that share at least 90% sequence identity)
Hybridization: 5x SSC at 65°C for 16 hours
Wash twice: 2x SSC at room temperature (RT) for 15 minutes each
Wash twice: 0.5x SSC at 65°C for 20 minutes each
High Stringency (detects sequences that share at least 80% sequence identity)
Hybridization: 5x-6x SSC at 65°C-70°C for 16-20 hours
Wash twice: 2x SSC at RT for 5-20 minutes each
Wash twice: Ix SSC at 55°C-70°C for 30 minutes each
Low Stringency (detects sequences that share at least 50% sequence identity)
Hybridization: 6x SSC at RT to 55°C for 16-20 hours Wash at least twice: 2x-3x SSC at RT to 55°C for 20-30 minutes each.
K. Peptides
This disclosure further provides compositions and methods involving MORS peptides. In some embodiments, MO-RS variants include the substitution of one or several amino acids for amino acids having similar biochemical properties (so-called conservative substitutions). However the mutation engineered to increase the interaction between the MO-RS and the O-tRNA is retained (e.g., the
Asp265Arg substitution in SEQ ID NO: 36). Conservative amino acid substitutions are likely to have minimal impact on the activity of the resultant protein. Further information about conservative substitutions can be found, for instance, in Ben Bassat et al. (J. BacterioL, 169:751-757, 1987), O'Regan et al. (Gene, 77:237-251, 1989), Sahin-Toth et al. (Protein ScL, 3:240-247, 1994), Hochuli et al. (Bio/Technology, 6:1321-1325, 1988) and in widely used textbooks of genetics and molecular biology. In some examples, MO-RS variants can have no more than 3, 5, 10, 15, 20, 25, 30, 40, or 50 conservative amino acid changes. The following table shows exemplary conservative amino acid substitutions that can be made to an MO- RS peptide:
In some examples, the MO-RS protein has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to SEQ ID NO: 36 and includes an Asp265Arg substitution. For example, the MO-RS protein can include an Asp265Arg substitution as well as other substitutions that generate an MO-RS specific for a particular UAA. Exemplary other substitutions that can be made to SEQ ID NO: 36, along with the Asp265Arg substitution, include but are not limited to: Y37G, D182G, L186A; Y37L, D182S, F183A, L186A; Y37T, D182T, L183M; or Y37G, D182S, F183M. Nucleic acids that encode such proteins are also encompassed by this disclosure. L. Vectors
Eukaryotic host cells are provided that are genetically engineered (for instance, transformed, transduced or transfected) with one or more nucleic acid molecules encoding O-tRNA, and/or an MO-RS (for instance, an O-RS that is specific for a UAA), or constructs which include a nucleic acid molecule encoding an O-tRNA and/or a MO-RS (for instance, a vector) which can be, for example, an expression vector. For example, the coding regions for the orthogonal tRNA, the mutated orthogonal tRNA synthetase, and the protein to be derivatized are operably linked to gene expression control elements that are co-transduced into the desired host cell, for instance a eukaryotic pol III promoter such as a type-3 pol III promoter or an internal leader promoter.
Methods of expressing proteins in heterologous expression systems are well known in the art. Typically, a nucleic acid molecule encoding all or part of a protein
of interest is obtained using methods such as those described herein. The protein-encoding nucleic acid sequence is cloned into an expression vector that is suitable for the particular host cell of interest using standard recombinant DNA procedures. Expression vectors include (among other elements) regulatory sequences (for instance, eukaryotic promoters, such as a pol II promoter or internal leader promoter) that can be operably linked to the desired protein-encoding nucleic acid molecule to cause the expression of such nucleic acid molecule in the host cell. Together, the regulatory sequences and the protein-encoding nucleic acid sequence are an "expression cassette." Expression vectors can also include an origin of replication, marker genes that provide phenotypic selection in transformed cells, one or more other promoters, and a polylinker region containing several restriction sites for insertion of heterologous nucleic acid sequences.
Expression vectors useful for expression of heterologous protein(s) (such as those that include a UAA) in a multitude of host cells are well known in the art, and some specific examples are provided herein. The host cell is transfected with (or infected with a virus containing) the expression vector using any method suitable for the particular host cell. Such transfection methods are also well known in the art and non-limiting exemplar methods are described herein. The transfected (also called, transformed) host cell is capable of expressing the protein encoded by the corresponding nucleic acid sequence in the expression cassette. Transient or stable transfection of the host cell with one or more expression vectors is contemplated by the present disclosure.
Many different types of cells can be used to express heterologous proteins, such as yeasts and vertebrate cells (such as mammalian cells), including (as appropriate) primary cells and immortal cell lines. Numerous representatives of each cell type are commonly used and are available from a wide variety of commercial sources, including, for example, ATCC, Pharmacia, and Invitrogen.
Various yeast strains and yeast-derived vectors are used commonly for the expression of heterologous proteins. For instance, Pichia pastoris expression systems, obtained from Invitrogen (Carlsbad, California), can be used to express a MO-RS peptide. Such systems include suitable Pichia pastoris strains, vectors, reagents, transformants, sequencing primers, and media. Available strains include
KM71H (a prototrophic strain), SMDl 168H (a prototrophic strain), and SMDl 168 (a pep4 mutant strain) (Invitrogen).
Schizosaccharomyces pombe and Saccharomyces cerevisiae are other yeasts that are commonly used. The plasmid YRp7 (Stinchcomb et al., Nature, 282:39,1979; Kingsman et al., Gene, 7:141, 1979; Tschemper et al., Gene, 10:157, 1980) is commonly used as an expression vector in Saccharomyces. This plasmid contains the trpl gene that provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, such as strains ATCC No. 44,076 and PEP4-1 (Jones, Genetics, 85:12, 1977). The presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
Yeast host cells can be transformed using the polyethylene glycol method, as described by Hinnen (Proc. Natl. Acad. ScL USA, 75:1929, 1978). Additional yeast transformation protocols are set forth in Gietz et al. (Nucl. Acids Res., 20(17): 1425, 1992) and Reeves et al. (FEMS, 99(2-3): 193- 197, 1992).
In the construction of suitable expression vectors, the termination sequences associated with these genes are also ligated into the expression vector 3' of the sequence desired to be expressed to provide polyadenylation of the mRNA and termination. Any plasmid vector containing a yeast-compatible promoter (such as a pol II promoter) capable of efficiently transcribing a nucleic acid sequence encoding a MO-RS, an origin of replication, and a termination sequence is suitable.
Mammalian host cells can also be used for heterologous expression of an MO-RS peptide. Examples of suitable mammalian cell lines include, without limitation, monkey kidney CVI line transformed by SV40 (COS -7, ATCC CRL 1651); human embryonic kidney line 293S (Graham et al., J. Gen. Virol., 36:59, 1977); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells (Urlab and Chasin, Proc. Natl. Acad. Sci USA, 77:4216, 1980); mouse Sertoli cells (TM4, Mather, Biol. Reprod., 23:243, 1980); monkey kidney cells (CVI-76, ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065);
mouse mammary tumor cells (MMT 060562, ATCC CCL 5 1); rat hepatoma cells (HTC, MI.54, Baumann et al, J. Cell Biol, 85:1, 1980); and TRI cells (Mather et al, Annals N.Y. Acad. Sci., 383:44, 1982), and primary culture cells such as neurons, for instance hippocampal neurons, spinal neurons, cortical neurons, cerebellar neurons, motorneurons, sensory neurons, pyramidal neurons, and retinal neurons. Expression vectors for these cells ordinarily include (if necessary) DNA sequences for an origin of replication, a promoter capable of transcribing a nucleic acid sequence encoding a prokaryotic tRNA, wherein the promoter sequence usually is located 5' of the nucleic acid sequence to be expressed, a ribosome binding site, an RNA splice site, a polyadenylation site, and/or a transcription terminator site. M. Kits
Kits are also a feature of this disclosure. For example, a kit for producing a protein that includes at least one UAA in a eukaryotic cell is provided, where the kit includes a plasmid that includes a nucleic acid molecule that encodes an MO-RS, for example, a mutated orthogonal aminoacyl-tRNA synthetase specific for the UAA to be incorporated. In one embodiment, the kit further includes a nucleic acid molecule that encodes an O-tRNA. The tRNA and the MO-RS form an orthogonal pair.
A kit can also include, in certain embodiments, eukaryotic cells (for example, but not limited to yeast or mammalian cell lines) with orthogonal tRNA and unnatural-amino-acid-specific MO-RS genes integrated into the chromosome. In a specific example, the kit includes eukaryotic cells (for examples mammalian cells or yeast cells) with an inactivated NMD pathway. Kits such as these enable a user to transfect a gene of interest to make proteins containing UAAs. In some examples, the elements of a kit are provided in separate containers. The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.
EXAMPLES Example 1: Materials and Methods
This Example describes materials and methods that were used in performing Examples 2-4. Although particular methods are described, one of skill in the art will understand that other, similar methods also can be used.
Chemicals
OmeTyr and Bpa were purchased from Chem-Impex. DanAla was synthesized using a procedure previously described (see, for instance, Summerer et al. (2006) Proc. Natl. Acad. ScL U. S. A. 103, 9785-9789). AU other chemicals were purchased from Sigma- Aldrich.
Constructs
All constructs were assembled by standard cloning methods and confirmed by DNA sequencing. Plasmid pCLHF is a derivative of pCLNCX (Imgenex), and contains the hygromycin resistance gene instead of the neomycin resistance gene. The amber stop codon TAG was introduced into the enhanced GFP (EGFP) gene at position 182 through site-directed mutagenesis. The woodchuck hepatitis virus posttranscriptional regulatory element (WPRE; Zufferey et al., (1999) J. Virol. 73, 2886-2892) was added to the 3' end of the GFP-TAG mutant gene. The GFP-TAG- WPRE gene fragment was ligated into the Hind III and CIa I sites of pCLHF to generate plasmid pCLHF-GFP-TAG.
The E. coli TyrRS gene was amplified from E. coli genomic DNA using the primer sequences CCACCATGGAACTCGAGATTTTGATGGCAAGCAGTAACTTGATTAAAC (SEQ ID NO: 1) and
ACAAGATCTGCTAGCTTATTTCCAGCAAATCAGACAGTAATTC (SEQ ID NO: 2). Genes for Ome-TyrRS (Y37T, D182T, and F183M) and Bpa-TyrRS (Y37G, D182G, and Ll 86A) were made from E. coli TyrRS gene through site- directed mutagenesis using overlapping PCR. The gene for EctRNA<^A in construct tRNA2 was amplified using the primer sequences
GTGGGATCCCCGGTGGGGTTCCCGAGCGGCCAAAGGGAG
CAGACTCTAAATCTGCCGTCATCGACTTCG (SEQ ID NO: 3) and GATAAGCTTTTCCAAAAATGGTGGTGGG
GGAAGGATTCGAACCTTCGAAGTCGATGACGGCAGATTTAG (SEQ ID NO: 4) through Klenow extension. Other tRNA constructs were made by PCR using tRNA2 as the template. Genes for EctRNA^A and the mutant synthetase specific for DanAla were amplified from plasmid pLeuRSB8T252A 20 using PCR. E. coli LeuRS gene was amplified from E. coli genomic DNA using the primers GCCTCGAGAAGAGCAATACCGCCCGG (SEQ ID NO: 5) and CGCTAGCTTAGCCAACGACCAGATTGAGGAG (SEQ ID NO: 6). The Hl promoter was amplified from plasmid pSUPER (OligoEngine).
To make the tRNA/aaRS expression plasmid pEYCUA-YRS, pBluescript II KS (Stratagene) was used as the backbone for construction. The PGK promoter and the SV40 polyA signal were inserted between EcoR I and Not I sites. The E. coli TyrRS gene was inserted between the PGK and SV40 polyA sequences using the introduced Xho I and Nde I sites. The Hl promoter containing the BgI II and Hind III sites at the 3' end was cloned into the EcoR I and CIa I sites. The EctRNA<^A was then inserted between the BgI II and Hind III sites. Finally, a gene cassette containing the SV40 promoter followed by the neomycin resistance gene and the SV40 poly A signal was amplified from pCDNA3 (Invitrogen) and inserted into the CIa I and Kpn I sites. Other tRNA/synthetase plasmids were modified from plasmid pEYCUA-YRS by swapping the synthetase gene and/or the tRNA gene, or by inserting various 3 '-flanking sequences after the tRNA.
Cell culture and transfection HeLa cells, HEK293T and HEK293 cells were cultured and maintained with
Dulbecco's modified Eagle's medium (DMEM, Mediatech) supplemented with 10% fetal bovine serum.
For the establishment of a GFP-TAG HeLa stable cell line, 293T cells were co-transfected with the retroviral vector pCLHF-GFP-TAG and the packaging vector pCL-Ampho (Imgenex) using FuGENE 6 transfection reagent (Roche). Viruses were harvested after 48 hours and used to infect HeLa cells grown in 50%
conditioned medium in the presence of 8 ng/ml hexadimethrine bromide (Sigma). From the next day on, cells were split to a very low confluence. Stably infected cells were selected with 200 ng/ml hygromycin (Invitrogen). Hygromycin (50 ng/ml) was always present in subsequent cell culture to ascertain plasmid DNA maintenance.
Hippocampi of postnatal day 0 Sprague-Dawley rats or mice were removed and treated with 2.5% trypsin (Invitrogen) for 15 minutes at 37 0C. The digestion was stopped with 10 mL of DMEM containing 10% heat-inactivated fetal bovine serum. The tissue was triturated in a small volume of this solution with a fire- polished Pasteur pipette, and -100,000 cells in 1 mL neuronal culture medium were plated per coverslip in 24-well plates. Glass coverslips were prewashed overnight in HCl followed by several rinses with 100% ethanol and flame sterilization. They were subsequently coated overnight at 37 0C with Poly-D-Lysine. Cells were plated and grown in Neurobasal-A (Invitrogen) containing 2% B-27 (Life Technologies), 1.8% HEPES, and 2 mM glutamine (Life Technologies). Half of the medium was replaced next day. For imaging, the cells cultured for 3 days were transfected with Lipofecamine 2000, changed into fresh medium with 1 mM OmeTyr or Bpa after 5 hours, and cultured for another 24 hours prior to testing.
Northern blot analysis
RNA was prepared from the GFP-TAG HeLa cells transfected with different tRNA/aaRS constructs using PureLink miRNA Kit (Invitrogen). The RNA was denatured, electrophoresed on 15% PAGE gel, blotted onto Hybond-N (Amersham) membrane, and crosslinked by ultraviolet fixation. 32P-labeled DNA probes specific for the EctRNA<^A were made using Klenow extension with the primer sequences:
AACCTTCGAAGTCGATGACGGCAGATTTACAGTCTGC (SEQ ID NO: 7) and primer CCGTCTAAATGTCAGACGAGGGAAACCGGCGAG (SEQ ID NO: 8). After pre-hybridization for 4 hours in the hybridization buffer [5x sodium chloride- sodium citrate buffer, 40 mM Na2HPO4 (pH7.2), 7% sodium dodecylsulfate (SDS), 2x Denhardt's], membranes were hybridized with 32P-labeled cDNA probes (0.5-2 x 107 c.p.m./mL) in the same buffer plus 50 μg/mL salmon sperm DNA at 58 0C overnight. Hybridized membrane was sequentially washed with high stringency
buffer (40 niM Na2HPO4, 1 niM EDTA, 1% SDS, 58 0C) twice and exposed to an X-ray film (Kodak) for 48 hours. To control the total RNA amount loaded in each lane, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript was used as an internal standard.
Flow cytometry
GFP-TAG HeLa cells were transfected with plasmid DNA by lipofection 2000 according to the protocol of the vendor (Invitrogen). UAAs (1 mM) were added into the medium immediately after transfection. Cells were collected after 48 hours, washed twice, and resuspended in 1 mL of PBS containing 0.05 μg/mL propidium iodide. Samples were analyzed with a FACScan (Becton & Dickinson).
Fluorescence microscopy
Fluorescence images were acquired on an Olympus X81 inverted microscope using a 2Ox objective. For the GFP channel, filters were 480/30 nm for excitation and 535/40 nm for emission. For the mCherry channel, filters were 580/20 nm for excitation and 675/130 nm for emission.
Example 2: Expression of Orthogonal tRNAs in Mammalian Cells This Example demonstrates efficient expression of prokaryotic orthogonal tRNAs in mammalian cells. Although particular methods of expressing prokaryotic orthogonal tRNAs in mammalian cells are described, one of skill in the art will appreciate that similar methods can be used to express prokaryotic tRNAs in other eukaryotic cells using other pol III promoters. One way to generate an orthogonal tRNA/synthetase pair is to import a tRNA/synthetase pair from species in a different kingdom because the cross aminoacylation between different species is often low. However, expression of functional E. coli tRNAs in mammalian cells is challenging. E. coli and mammalian cells differ significantly in tRNA transcription and processing. E. coli tRNAs are transcribed by the sole RNA polymerase through promoters upstream of the tRNA structural gene. The transcription of mammalian tRNA genes, however, depends principally on promoter elements within the tRNA known as the A and B box
sequences, which are recognized by RNA polymerase III (pol III) and its associated factors (Galli et al, (1981) Nature 294, 626-631). While all E. coli tRNA genes encode full tRNA sequences, mammalian tRNAs have the 3'-CCA sequence added enzymatically by the tRNA nucleotidyltransferase after transcription. In addition, the 5' and 3' flanking sequences, the removal of introns, and the export from nucleus to cytoplasm also affect mammalian tRNA expression and function. Due to these differences, E. coli tRNAs, especially those diverge from the preserved eukaryotic A and B box sequences, are not efficiently biosynthesized or correctly processed in mammalian cells. As demonstrated herein, a pol III promoter lacking any requirement for intragenic elements can efficiently transcribe prokaryotic tRNAs without the preserved internal A and B boxes that are present in mammalian cells. The Hl promoter, type-3 pol III promoter (which does not have any downstream transcriptional elements; Myslinski et al., (2001) Nucleic Acids Res. 29, 2502- 2509), was used for this purpose. The Hl promoter drives the expression of the human HlRNA gene, and thus is of mammalian origin. The transcription initiation site of Hl promoter is well-defined, and it can be used to generate the 5' end of the tRNA without further posttranscriptional processing.
A fluorescence-based functional assay in mammalian cells was developed to identify the expression elements that can efficiently drive the transcription of E. coli tRNAs to generate functional tRNAs in mammalian cells (FIG. IA). The gene for the candidate E. coli amber suppressor tRNA ( EctRNA^A , whose anticodon was changed to CUA to decode the amber stop codon TAG) was co-expressed with its cognate synthetase (aaRS). A TAG stop codon was introduced at a permissive site of the green fluorescent protein (GFP) gene, and this mutant GFP gene was co- expressed with the EctRNA^A /aaRS pair in mammalian cells. In this assay, if the
EctRNA^a UA is expressed and correctly processed to a functional tRNA, the synthetase aminoacylates this tRNA with the cognate amino acid. The acylated EctRNA^a UA then suppresses the TAG codon in the GFP gene, producing full-length GFP and rendering the cells fluorescent. By comparing the fluorescence intensities of cells, this method also serves as a sensitive in vivo assay for the orthogonality of
the EctRNA^A to endogenous synthetases of host cells when the cognate E. coli synthetase is not expressed, and for the activity of the orthogonal EctRNA^A toward unnatural-amino-acid specific mutant synthetase when the mutant synthetase is expressed in place of the cognate synthetase. The E. coli tyrosyl amber suppressor tRNA ( EctRNA^A ) was chosen as the candidate orthogonal tRNA because it is orthogonal to yeast synthetases and suppresses the amber stop codon efficiently in yeast when coexpressed with E. coli TyrRS (Edwards & Schimmel, (1990) MoI. Cell. Biol. 10, 1633-1641). In vitro aminoacylation assays indicate that E. coli TyrRS does not charge eukaryotic tRNAs (Doctor & Mudd, (1963) J. Biol. Chem. 238, 3677-3681). For 3' end processing of the EctRNAgjA , the 3' flanking sequence of the human tRNA™61 was used. The 5' and 3' flanking sequences of the human tRNAfMet were found to drive the functional expression of E. coli EctRNA^A (which has the A box and B box) in mammalian cells (Drabkin et al, (1996) MoI. Cell. Biol. 16, 907-913). To determine the importance of the 3'-CCA trinucleotide, they were included or removed in the tRNA gene, resulting in four expression cassettes (tRNA-1 to tRNA- 4) (FIG. IB). For comparison, a control plasmid tRNA-5 was made, in which the EctRNA^A was placed downstream of the 5 '-flanking sequence of the human tRNATyr. To accurately compare the ability of different expression cassettes to generate functional tRNAs, a clonal stable HeLa cell line was established that expressed the GFP gene with a TAG stop codon introduced at the permissive site 182 (GFP-TAG HeLa). The tRNA/aaRS expression plasmid was transfected into the stable GFP-TAG HeLa cell line, and cells were analyzed with flow cytometry after 48 hours. The total fluorescence intensity of the green fluorescent cells indicated the amount of GFP produced, and is shown in FIG. 1C.
When no EctRNA|^A /TyrRS was expressed, the fluorescence intensity of the GFP-TAG HeLa cell line was similar to that of HeLa cells, indicating the background readthrough of the TAG codon in GFP is negligible. Using the 5'- flanking sequence of human tRNATyr in tRNA-5, only weak amber suppression was
detected, confirming that bacterial tRNAs without the preserved A and B boxes could not be functionally expressed in mammalian cells. The highest fluorescence intensity was found in cells transfected with tRNA-4, which was 71 -fold higher than that of tRNA-5, indicating the Hl promoter can drive the functional biosynthesis of EctRNA^A much more efficiently than the 5 '-flanking sequence of the human tRNATyr. This also indicates that the Hl promoter can generate the correct 5 '-end of the tRNA directly from the transcription initiation site without the posttranscriptional processing that is necessary for endogenously expressed tRNAs.
The intensity of cells transfected with tRNA-2 was 10% of that of cells transfected with tRNA-4, indicating that the 3 '-flanking sequence of the human tRNA™61 also is needed for the efficient expression of the EctRNA|^A . Functional tRNA was produced in mammalian cells transfected with tRNA-1 (21% of tRNA-4), in which the CCA trinucleotide but no 3 '-flanking sequence is included, which was unexpected, since mammalian cells do not encode the CCA in the tRNA gene. However, when both the CCA trinucleotide and the 3 '-flanking sequence were included in tRNA-3, the fluorescence intensity dropped dramatically to 1.3%.
Northern blotting was performed to examine the transcription levels of the EctRNAgjA expressed by different constructs in GFP-TAG HeLa cells (FIG. ID).
Very low levels of EctRNA|^A were detected using a EctRNA^A -specific probe in samples transfected with tRNA-5, tRNA-3, or tRNA-2. In contrast, in cells transfected with tRNA-4 and tRNA-1, the amounts EctRNAgjA were about 93-fold and 19-fold higher than that of tRNA-5, respectively. The Northern blot data confirmed that the EctRNA^A was transcribed in HeLa cells, and the increase of tRNA transcription was consistent with the increase of fluorescence intensity measured by cytometry in different samples.
To examine the orthogonality of the EctRNA^A to endogenous synthetases in HeLa cells, the E. coli TyrRS was removed in tRNA-4 so that only EctRNAgjA was expressed. Transfection of the resultant plasmid in the GFP-TAG HeLa cell line did not change the fluorescence intensity of the cells, demonstrating that EctRNA^A was not aminoacylated by any synthetases in HeLa cells.
To determine whether the Hl promoter, together with the 3 '-flanking sequence, can be used to express other E. coli tRNAs, the EctRNA|^A in tRNA-4 construct was replaced with the E. coli leucyl amber suppressor tRNA (EctRNAj^A ), and the TyrRS was replaced with the cognate leucyl-tRNA synthetase (LeuRS). When only the EctRNA^A was expressed, no fluorescence changed was observed in the GFP-TAG HeLa cells, demonstrating that EctRNA^A is orthogonal in HeLa cells. In contrast, when the EctRNA^A /LeuRS were coexpressed, the GFP-TAG HeLa cells became very bright. The total fluorescence intensity was 104% of that of cells transfected with the EctRNAgjA /TyrRS pair. The EctRNA^A does not have the conserved A box, while the EctRNA^A has no
A or B box sequences.
Taken together, these results demonstrate that, regardless of the internal promoter elements, the Hl promoter can efficiently drive the expression of E. coli tRNAs in mammalian cells, and the transcribed tRNAs are functional for amber suppression.
Example 3: Use of Unnatural Amino Acid (UAA) Specific Synthetase in
Eukaryotes
This Example describes the use of an UAA specific synthetase in mammalian cells. Although particular methods of using orthogonal synthetases in mammalian cells are described, one of skill in the art will appreciate that similar methods can be used to express and use orthogonal synthetases in other eukaryotic cells.
Synthetases specific for a variety of UAAs have been evolved in E. coli and in yeast from large mutant synthetase libraries containing of >109 members (Wang & Schultz, (2004) Angew. Chem. Int. Ed. Engl. 44, 34-66). Similar strategies cannot be practically employed in mammalian cells and neurons because the transfection efficiencies of these cells are lower by several orders of magnitude than that of E. coli and yeast.
To demonstrate the feasibility of transferring the mutant synthetases evolved in yeast to mammalian cells, the E. coli TyrRS gene in the tRNA/aaRS expression plasmid (FIG. IA) was replaced with the gene of Ome-TyrRS, a synthetase specific for the UAA o-methyl-L-tyrosine (OmeTyr). The resultant plasmid was transfected into the GFP-TAG HeLa cell line, and cells were grown in the presence and absence of OmeTyr. As shown in FIG. 2B, without adding OmeTyr, these cells were virtually nonfluorescent and similar to the GFP-TAG HeLa cells, indicating that the expression of the EctRNA^A /Ome-TyrRS pair does not suppress amber codons efficiently. When OmeTyr was added, 71% of cells (normalized to total number of fluorescent cells transfected with the EctRNA|^A and wild type TyrRS) became fluorescent, indicating OmeTyr was incorporated into the GFP. The incorporation efficiency was about 41% when measured by comparing the total fluorescence intensity of these cells to the intensity of cells transfected with the EctRNAgjA /TyrRS pair. To demonstrate that the transfer strategy could be generally applied to other synthetases evolved in yeast, the BpaRS, a synthetase specific for p- benzoylphenylalanine (Bpa), was tested. When the BpaRS was coexpressed with the EctRNAgjA in the GFP-TAG HeLa cell line, 47% of cells were fluorescent in the presence of Bpa, and virtually no fluorescent cells (< 4%) were detected in the absence of Bpa. The incorporation efficiency of this UAA was about 13%. In addition to tRNA/aaRS pairs derived from the E. coli tRNATyr/TyrRS, a tRNA/aaRS pair derived from E. coli tRNA^/LeuRS also was tested. The EctRNApuA and a mutant synthetase specific for a fluorescent UAA 2-amino-3-(5-
(dimethylamino)naphthalene-l-sulfonamido)propanoic acid (DanAla; Summerer et al. (2006) Proc. Natl. Acad. ScL U. S. A. 103, 9785-9789) were expressed in GFP-
TAG HeLa cell line (FIG. 2C). DanAla was incorporated in 13% efficiency, and
42% of cells became fluorescent.
These results confirm that UAA specific synthetases evolved in yeast can be used in mammalian cells to incorporate UAAs.
Example 4: Genetic Encoding of Unnatural Amino Acids (UAAs) in Neurons
This Example describes the genetic encoding of UAAs in neurons. Although particular methods of genetic encoding of UAAs in mouse hippocampal and cortical neurons are described, one of skill in the art will appreciate that similar methods can be used to genetically encode UAAsin other types of neurons, and in neurons from other mammalian species, such as humans.
First, it was confirmed that the Hl promoter and the 3 '-flanking sequence identified in HeLa cells also could generate functional amber suppressor tRNAs in neurons. Mouse hippocampal neurons were transfected with two plasmids simultaneously (FIG. 3A): the reporter plasmid pCLHF-GFP-TAG encoding a mutant GFP (182TAG) gene, and the expression plasmid encoding the E. coli TyrRS, the EctRNA^A driven by either the Hl promoter or the 5' flanking sequence of human tRNATyr, and a red fluorescent protein, mCherry, as an internal marker for transfection. Fluorescence microscopy was used to look for red transfected cells, and then to image their green fluorescence. The presence of green fluorescence in transfected cells indicated that functional EctRNA^A was biosynthesized to incorporate Tyr at the 182TAG position of the GFP gene. As shown in FIG. 3B, neurons transfected with the expression plasmid in which the EctRNA^A was driven by the Hl promoter showed intense green fluorescence, whereas no green fluorescence could be detected in neurons in which the
EctRNA^A was driven by the 5' flanking sequence of the human tRNATyr.
Next, it was confirmed that UAAs could be genetically encoded in neurons using the EctRNA|^A and mutant synthetases specific for different UAAs. Synthetases evolved in yeast and proven functional in HeLa cells were used. When the Ome-TyrRS was coexpressed with the EctRNA|^A , transfected neurons showed no green fluorescence in the absence of the corresponding unnatural amino acid OmeTyr (FIG. 3C), indicating that the EctRNA|^A is orthogonal to endogenous synthetases in neurons. Bright green fluorescence was observed from transfected neurons only when OmeTyr was fed to the growth media. These results indicate that OmeTyr, but no common amino acid, was incorporated into GFP at the 182TAG
position. The same results were obtained for the unnatural amino acid Bpa when the BpaRS was coexpressed with the EctRNA|^A (FIG. 3D). Using this approach,
OmeTyr and Bpa were also genetically encoded in hippocampal and cortical neurons isolated from rats.
Example 5: Materials and Methods
This Example describes materials and methods that were used in performing
Example 6. Although particular methods are described, one of skill in the art will understand that other, similar methods also can be used.
Strains and chemicals
DHlOB E. coli cells (In vitro gen, Carlsbad, CA) were used for cloning and
DNA preparation. Phusion™ high-fidelity DNA polymerase (New England
Biolabs, Ipswich, MA) was used for polymerase chain reaction (PCR). OmeTyr was purchased from Chem-Impex, Wood Dale, IL. DanAla was synthesized using a procedure previously described (see, for instance, Summerer et al. (2006) Proc.
Natl. Acad. ScL U. S. A. 103, 9785-9789). AU other chemicals were purchased from
Sigma-Aldrich, St. Louis, MO.
Construction ofplasmids
All plasmids were assembled by standard cloning methods and confirmed by DNA sequencing. A plasmid containing the 2μ ori, TRPl, Kanr, the CoIEl ori, and multiple cloning sites (MCS) was used as the backbone to construct plasmids expressing tRNA and synthetase. To separate the tRNA expression cassette from the synthetase expression cassette, a spacer sequence was amplified from pCDNA3 (Invitrogen, Carlsbad, CA) using primer FW19 (SEQ ID NO: 9) 5'-ATA CTA GTG CGG GCG CTA GGG CGC TG-3' and primer FW20 (SEQ ID NO: 10) 5'-ATG GTA CCC CTG GAA GGT GCC ACT CC-3'. This spacer was digested with Kpn I and Spe I, and inserted at the Kpn I and Xba I site of the backbone plasmid to make plasmid p-Xd. The E. coli TyrRS gene was amplified from E. coli genomic DNA using primer FW21 (SEQ ID NO: 11) 5'-CAA CTA GTA TGG AGA TTT TGA
TGG CAA GC-3' and primer FW22 (SEQ ID NO: 12) 5'-AAC TCG AGT TAT
TTC CAG CAA ATC AGA CAG-3'. The PCR product was digested with Sp e I and Xho I and ligated into the precut vector p415 (American Type Culture Collection, Manassas, VA) to make p415-EY. The gene cassette containing the GPD promoter, the E. coli TyrRS gene, and the CYCl terminator was cut from p415-EY with Sac I and Kpn I, and inserted into plasmid p-Xd to make plasmid p-TyrRS.
The SNR52 promoter was amplified from yeast genomic DNA using primer FW16 (SEQ ID NO: 13) 5'-CAC TGC AGT CTT TGA AAA GAT AAT GTA TGA TTA TG-3' and primer FW17 (SEQ ID NO: 14) 5'-GGC CGC TCG GGA ACC CCA CCG ATC ATT TAT CTT TCA CTG CGG AG-3'. The EctRNA^ gene followed by the 3'-flanking sequence of the SUP4 suppressor tRNA was amplified from pEYCUA-YRS (Wang et al., (2007) Nat. Neurosci. 10, 1063-1072) using primer FW14 (SEQ ID NO: 15) 5'-GGT GGG GTT CCC GAG CGG CCA AAG-3' and primer FW15 (SEQ ID NO: 16) 5'-GGT CGA CAG ACA TAA AAA ACA AAA AAA TGG TGG GGG AAG GAT TCG AAC CTT C-3'. These two PCR fragments were pieced together through overlapping PCR to make the SNR52- EctRNA^ -3' flanking sequence cassette. This tRNA expression cassette was digested with Pst I and Sal I, and ligated into the precut p-TyrRS to make pSNR- TyrRS.
The RPRl promoter was amplified from yeast genomic DNA using primer FW12 (SEQ ID NO: 17) 5'-CAC TGC AGT CTG CCA ATT GAA CAT AAC ATG G-3' and primer FW13 (SEQ ID NO: 18) 5'-GGC CGC TCG GGA ACC CCA CCT GCC AAT CGC AGC TCC CAG AGT TTC-3'. It was pieced with the above EctRNA^ -3' flanking sequence through overlapping PCR to make the RPRl-
EctRNA^ -3' flanking sequence cassette. The cassette was digested with Pst I and Sal I, and ligated into the precut p-TyrRS to make pRPR-TyrRS.
The gene cassette containing the 5' flanking sequence of the SUP4 suppressor tRNA, the EctRNA^ , and the 3' flanking sequence of the SUP4 suppressor tRNA was amplified from plasmid pEYCUA-YRS-tRNA-5 (Wang et al.,
(2007) Nat. Neurosci. 10, 1063-1072) using primer (SEQ ID NO: 19) 5'-CAC TGC AGC TCT TTT TCA ATT GTA ATG TGT TAT G-3' and primer FW 15. The
cassette was digested with Pst I and Sal I, and ligated into the precut p-TyrRS to make pFS-TyrRS.
The OmeRS gene was made from E. coli TyrRS gene through site-directed mutagenesis to introduce the following mutations: Y37T, D182T, and F183M. The OmeRS gene was digested with Spe I and Xho I, and ligated into the precut pSNR- TyrRS to make pSNR-OmeRS.
The gene cassette containing the 5' flanking sequence of the SUP4 suppressor tRNA, the EctRNA^A , and the 3' flanking sequence of the SUP4 suppressor tRNA was amplified from plasmid pLeuRSB8T252A (Summerer et ah, (2006) Proc. Natl. Acad. ScL U.S.A. 103, 9785-9789) using primer FW27 (SEQ ID NO: 20) 5'-CAA AGC TTC TCT TTT TCA ATT GTA TAT GTG-3' and primer FW28 (SEQ ID NO: 21) 5'-GAG TCG ACA GAC ATA AAA AAC AAA AAA ATA C-3'. The PCR product was digested with Hind III and Sal I, and ligated into the precut pSNR-TyrRS to make ptRNA^-TyrRS. The E. coli LeuRS gene was amplified from E. coli genomic DNA using primer FW29 (SEQ ID NO: 22) 5'-AGC TCG AGT TAG CCA ACG ACC AGA TTG AG-3' and FW30 (SEQ ID NO: 23) 5'-AGA CTA GTA TGC AAG AGC AAT ACC GCC CG-3' . The PCR product was digested with Spe I and Xho I, and ligated into the precut ptRNALeu-TyrRS to make pFS -LeuRS. The SNR52 promoter was amplified from pSNR-TyrRS using primer FW 16 and primer FW31 (SEQ ID NO: 24) 5'-CTA CCG ATT CCA CCA TCC GGG CGA TCA TTT ATC TTT CAC TGC GG-3'. The EctRNA^°A -3' flanking sequence fragment was amplified from pLeuRSB8T252A using primer FW32 (SEQ ID NO: 25) 5'-GCC CGG ATG GTG GAA TCG GTA G-3' and primer FW28. These two PCR fragments were pieced together through overlapping PCR to make the gene cassette SNR52- EctRNA^°A -3' flanking sequence. The gene cassette was digested with Pst I and Sal I, and ligated into the precut pSNR-TyrRS to make pSNRtRNALeu-TyrRS. The TyrRS gene was then replaced with the E. coli LeuRS gene using Spe I and Xho I sites to make pSNR-LeuRS. The DanRS gene was amplified from plasmid pLeuRSB8T252A using primer FW29 and primer FW30. The PCR product was digested with Spe I and Xho
I, and ligated into the precut pSNR- LeuRS to make pSNR-DanRS.
A plasmid containing the 2μ ori, LEU2, Ampr, the CoIEl ori, and MCS was used as the backbone to construct the GFP-TAG reporter plasmids. Site-directed mutagenesis was used to introduce Tyr39TAG and Tyrl82TAG mutations into the EGFP gene. The mutant GFP-TAG gene was amplified with primer JT171 (SEQ ID NO: 26) 5'-TAG TCG GAT CCT CAG TGA TGG TGA TGG TGA TGC TTG TAC AGC TCG TCC ATG CC-3' and primer JT172 (SEQ ID NO: 27) 5'-TAG TCG TCG ACA TGG ATT ACA AAG ATG ATG ATG ATA AAG TGA GCA AGG GCG AGG AG-3' to add a His6 tag at the C-terminus and a HA tag at the N- terminus. The PCR product was then flanked by the ADHl promoter and ADHl terminator, and the whole gene cassette was cloned into the backbone plasmid using the Hind III and EcoR I sites to make pGFP-39TAG or pGFP-182TAG.
Northern blot analysis
RNA was prepared from yeast cells transformed with different tRNA expressing constructs using PureLink miRNA Isolation Kit (Invitrogen, Carlsbad, CA). The RNA was denatured and electrophoresed on 8% PAGE gel with 8 M urea. A large DNA sequencing gel (15 inches in length) was used to obtain high resolution. After electrophoresis, the samples were blotted onto Hybond-N+ (Amersham Biosciences, Uppsala, Sweden) membrane, and crosslinked by ultraviolet fixation. The membrane was hybridized overnight at 55 0C with a biotinylated probe FW39 (SEQ ID NO: 28) 5'-TCT GCT CCC TTT GGC CGC TCG GGA ACC CC-biotin-3', which is specific for the E. coli tRNATyr and the EctRNApuA . The hybridized probe was detected using the North2South® chemiluminescent hybridization and detection kit (Pierce Biotechnology, Inc., Rockford, IL) according to the manufacturer's protocol. The amount of cell pellet was used to control the total RNA loaded in each lane.
Flow cytometry
A single yeast clone was selected and cultured in 5 mL liquid medium at 30 0C for 48 hours. These cells were used to inoculate 10 mL of fresh medium with a starting ODOOO of 0.2. Cells were grown at 30 0C in an orbital shaker (250 rpm) for 6 hours. Cells were then pelleted, washed once with PBS, and resuspended in PBS.
Samples were analyzed with a FACScan™ (Becton & Dickinson, Franklin Lakes,
NJ).
Generation of the upflΔ strain A gene cassette containing -200 bp upstream of UPFl, the Kan-MX6, and
-200 bp downstream of UPFl was made using primer FW5 (SEQ ID NO: 29) 5'- AAT GAA AAG CTT ACC AGA AAC TTA CG-3' and primer FW6 (SEQ ID NO: 30) 5'-GGC TAG GAT ATC AAG TCC ATG CC-3' . The PCR product was transformed into yeast strain YVL2968 (MATa ura3-52 lys2-801 trpΔl his3Δ200 leu2Δl) using the lithium acetate method. Transformed cells were plated on G418 YPAD plates for selection. The genomic DNA of surviving clones were amplified with primers -300 bp away from the UPFl gene (FORWARD (SEQ ID NO: 31) 5'- GAT TTG GGA GGG ACA CCT TTA TAC GC-3', REVERSE (SEQ ID NO: 32) 5'-TTC ATT AGA AGT ACA ATG GTA GCC C-3'), and the PCR products were sequenced to confirm that the UPFl gene was replaced with the Kan-MX6 through homologous recombination. The resultant upflΔ strain was designated as LWUPF1Δ. YVL2968 is a wild type, protease-proficient haploid strain that is derived from S288C, and it was used as the wild type strain in all of Example 6.
Protein expression and purification
Yeast culture (5 mL) was started from a single clone and grown for 48 hours. These cells were used to inoculate 200 mL fresh medium with or without 1 mM DanAla. After incubating at 30 0C for 48 hours, cells were pelleted and lysed with Y-PER (Pierce Biotechnology, Inc., Rockford, IL) in the presence of EDTA-free protease inhibitor (Roche, Basel, Switzerland). After agitating at room temperature for 20 minutes, the mixture was sonicated for 1 minute using a Sonic Dismembrator (Fisher Scientific, Pittsburgh, PA). After centrifugation, a second Y-PER extraction and sonication was applied to the pellet. Cleared cell lysates were combined and incubated with 2 mL Ni-NTA slurry (Qiagen, Hilden, Germany) for 1 hour at 4 0C. The column was washed with 10 bed volumes of PBS buffer (pH7.5, 140 mM NaCl) followed by 10 bed volumes of washing buffer (PBS pH7.5, 140 mM NaCl, 20 mM imidazole). The His6-tagged GFP protein was eluted with the elution buffer (PBS
pH7.5, 140 niM NaCl, 250 niM imidazole), and exchanged into the PBS buffer using Amicon Centricon™ concentrators (Millipore, Billerica, MA). Protein concentration was determined by the Bradford assay (Bio-Rad, Hercules, CA).
Western blot analysis
Wild type EGFP with a His6 tag at the C-terminus and a HA tag at the N- terminus was purified and used as the positive control. The same amounts of yeast cells from each sample were lysed with Y-PER in the presence of EDTA-free protease inhibitor. After centrifugation at 14,000 g for 10 minutes, 5 μl of the supernatants were loaded and separated by SDS-PAGE. A monoclonal penta His antibody (Invitrogen, Carlsbad, CA) was used to detect the His6-containing proteins.
Example 6: Expression of Orthogonal tRNA in yeast and De-activation of the NMD Pathway Increases UAA Incorporation Efficiency This Example describes methods of improving the efficiency of methods of incorporation of unnatural amino acids. Although the results described below are demonstrate increased UAA incorporation efficiency when used with orthogonal tRNA/synthetase pairs and a pol III promoter, the efficiency of any strategy for the incorporation of UAAs (for instance, using a 5' flanking sequence methodology) is improved by de-activation of the NMD pathway in a eukaryotic cell in which the UAA is expressed, as described herein
As described above in the foregoing Examples, unnatural amino acids (UAAs) with novel chemical and physical properties have been genetically encoded in cells by using orthogonal tRNA-codon-synthetase sets. However, in some embodiments the UAA incorporation efficiency is further improved or optimized. For instance, although tens of milligrams of UAA-containing proteins were produced from 1 liter of E. coli culture, in some embodiments, the yield in yeast is only tens of micrograms.
It is particularly challenging to express orthogonal bacterial tRNAs in yeast, because yeast and bacterium differ significantly in tRNA transcription and processing. Bacterial tRNAs expressed in yeast using the conventional method are not competent in translation, thus, as described herein, a new method was developed
to express different orthogonal bacterial tRNAs in yeast with high activity. In addition, mRNA stability of the target gene is a unique, unaddressed issue for UAA incorporation in yeast. The Nonsense-Mediated mRNA Decay (NMD) pathway mediates the rapid degradation of mRNAs that contain premature stop codons in yeast, whereas no such pathway exists in E. coli. When stop codons are used to encode UAAs, in some examples NMD results in a shorter lifetime for the target mRNA, and thus a lower protein yield in yeast. An NMD-deficient yeast strain was generated, and, as disclosed herein, this strain indeed increased the UAA incorporation efficiency in comparison to the wild-type (wt) yeast. These strategies enabled UAAs to be incorporated into proteins in yeast in high yields of tens of miligrams per liter.
This strategy also can be used effectively in mammalian cells. In mammalian cells, the efficacy of disrupting the NMD pathway depends on the presence of exon-intron junctions in the DNA sequence. Thus, if there are introns in the gene encoding the UAA of interest, disrupting the NMD pathway increases the efficiency of UAA incorporation.
E. coli tRNAs are transcribed by the sole RNA polymerase (Pol) through promoters upstream of the tRNA gene. However, the transcription of yeast tRNAs by Pol III depends principally on promoter elements within the tRNA known as the A- and B-box (FIG. 4A). The A- and B-box identity elements are conserved among eukaryotic tRNAs, but are lacking in many E. coli tRNAs. Creating the consensus A- and B-box sequences in E. coli tRNAs through mutation could cripple the tRNA, as these nucleotides make up the conserved tertiary base pairs bridging the tRNA D- and T-loop. In addition, all E. coli tRNA genes encode full tRNA sequences, whereas yeast tRNAs have the 3'-CCA trinucleotide enzymatically added after transcription. Therefore, transplanting E. coli tRNA into the tRNA gene cassette in yeast does not generate functional tRNA.
However, as disclosed herein, E. coli tRNAs are expressed efficiently in yeast using the following strategy: a promoter containing the consensus A- and B- box sequences is placed upstream of the E. coli tRNA to drive transcription, and is cleaved post-transcriptionally to yield the mature tRNA (FIG. 4B). Two internal leader promoters, SNR52 and RPRl, share a promoter organization consisting of a
leader sequence in which the A- and B-boxes are internal to the primary transcript but are external to the mature RNA product. It is shown herein that the SNR52 and RPRl promoter can be exploited to express E. coli tRNAs in yeast.
The gene for E. coli tyrosyl amber suppressor tRNA ( EctRNA^ ) lacking the 3'-CCA trinucleotide was placed after the candidate promoter and followed by the 3'-flanking sequence of the yeast tRNA SUP4 (FIG. 4C). This tRNA gene cassette was coexpressed with the cognate E. coli tyrosyl-tRNA synthetase (TyrRS) in S. cerevisiae. An in vivo fluorescence assay was developed to test whether the expressed EctRNA^ is functional for protein translation in yeast. A TAG stop codon was introduced at a permissive site (Tyr39) of the green fluorescent protein (GFP) gene, and this mutant gene is coexpressed with the EctRNA^A /TyrRS. If the
EctRNA^ is transcribed and correctly processed into a functional tRNA, the TyrRS will aminoacylate it with tyrosine, and the acylated EctRNA^ will then suppress the TAG codon, producing full-length GFP and rendering cells fluorescent. The fluorescence intensities of cells indicate how efficiently a promoter can drive the functional expression of the EctRNA^ in yeast. When the EctRNA^ was expressed using the conventional method, the 5 '-flanking sequence of an endogenous yeast tRNA SUP4, weak fluorescence could be detected, confirming that the 5 '-flanking sequence expressed functional EctRNA^A with low efficiency only (FIG. 4D). In contrast, when the EctRNA^ was driven by the SNR52 or
RPRl promoter, cells showed strong fluorescence, the mean intensities of which were increased 9- and 6-fold, respectively, in comparison to cells containing the 5'- flanking sequence. These results indicate that both the SNR52 and RPRl promoter can drive the EctRNA^A expression in yeast efficiently, and the expressed EctRNA^A is functional in translation.
The transcription levels of the EctRNA^ driven by different promoters were measured by Northern blot. Unexpectedly, the 5 '-flanking sequence of SUP4 generated -100 fold more EctRNA^ than the SNR52 or RPRl promoter (FIG. 4E).
The fact that these EctRNA^ were much less active in protein translation than
those expressed by the SNR52 or RPRl promoter indicates that the EctRNA^ expressed by the 5 '-flanking sequence is not correctly processed or modified.
To determine whether this method can be generally used to express other E. coli tRNAs, the EctRNA^ were replaced with the E. coli leucyl amber suppress tRNA ( EctRNA ^A ) and the TyrRS with the E. coli leucyl-tRNA synthetase (LeuRS). The 5'-flanking sequence of SUP4 could also drive the EctRNA^°A expression in yeast, but the fluorescence intensity increased 4-fold when the SNR52 promoter was used (FIG. 4D). According to the yeast A- and B-box identity elements, the EctRNA ^ does not have a fully matched A-box, while the EctRNA ^°A has matched A- and B-box. Regardless of the identity elements, the SNR52 promoter significantly increased the functional expression of both types of E. coli tRNAs in yeast.
Next, the effect of NMD inactivation on the UAA incorporation efficiency was examined in yeast. The amber stop codon TAG is the most frequently used to encode UAAs, but mRNAs containing premature stop codons are rapidly degraded in yeast by the NMD pathway, a surveillance mechanism to prevent the synthesis of truncated proteins. Inactivation of NMD preserved the stability of the UAG- containing target mRNA and thus enhanced the incorporation efficiency of UAAs. The yeast UPFl gene has been shown to be essential for NMD, deletion of which restores wild-type decay rates to nonsense-containing mRNA transcripts. Therefore, a upflΔ strain of S. cerevisiae was generated, and the UAA incorporation efficiency was compared in this strain to the wild-type strain.
The EctRNA ^°A driven by the SNR52 promoter and the DanRS 11 were used to incorporate the fluorescent UAA DanAla (FIG. 5C) into the GFP at site 39. When DanAla was added to the growth media, the fluorescence intensity of the upflΔ strain was doubled compared to that of the wt strain (FIG. 5A). In the absence of DanAla, the intensities dropped to low background levels, suggesting high specificity of the EctRNA ^°A /DanRS pair for DanAla. The incorporation of
UAA OmeTyr also was tested using the EctRNA ^ /OmeRS pair. When OmeTyr was added, the fluorescence intensity of the upflΔ strain was also increased twofold compared to the wild-type strain. However, in the absence of OmeTyr, the
fluorescence intensities in both strains were still quite high. The EctRNA^ only were then expressed, without the OmeRS, and cell fluorescence intensities dropped down to the background. This result shows that the OmeRS still charges natural amino acids to the EctRNA^ , consistent with the mass spectrometric analysis, in which -7% of the incorporated amino acids were found to be natural ones. The upflΔ strain with the GFP-TAG reporter thus also provides a sensitive assay for the specificity of evolved synthetases toward the UAA.
To examine how the above improvements correlate with protein yield, the GFP(39TAG) gene was expressed in the upflΔ strain using the DanRS and the EctRNA^°A was driven by the SNR52 promoter (FIG. 5B). In the presence of 1 mM DanAla, the full-length GFP was produced in an overall purified yield of 15 ± 2 mg/1, about 300-fold higher than the previous system and comparable to the yield in E. coli.
These results demonstrate a new method for expressing orthogonal bacterial tRNA in yeast, which is general for various tRNAs and produces tRNAs highly competent in translation. In addition, inactivation of NMD pathway increases UAA incorporation efficiency in eukaryotic cells. These new approaches dramatically improved the yield of UAA-containing proteins in yeast. In addition, orthogonal tRNA/synthetase pairs evolved in yeast have been used to genetically encode UAAs in mammalian cells.
Example 7: Using Orthogonal tRNA/MO-RS Pairs to Express Unnatural Amino Acids in Eukaryotic Cells
This example demonstrates expression in eukaryotic cells of a prokaryotic orthogonal tRNA, together with an unnatural-amino-acid specific MO-RS, in order to incorporate unnatural amino acids in the eukaryotic cells. Although particular methods are described, one of skill in the art will appreciate that variations to these methods can be used to express unnatural amino acids in eukaryotic cells.
A tRNA/mutated synthetase pair is selected that will be orthogonal to the eukaryotic cell in which incorporation of the unnatural amino acid is desirable. One way to identify a tRNA/ mutated synthetase pair that will be orthogonal to the
eukaryotic cell is to select a tRNA/mutated synthetase pair from species in a different kingdom, for example a prokaryotic tRNA/mutated synthetase pair, since the cross aminoacylation between different species often is low. An orthogonal tRNA/mutated synthetase pair will exhibit little or no crosstalk with endogenous eukaryotic tRNA/synthetase pairs.
A promoter also is chosen that will drive expression of the O-tRNA. Expression of functional prokaryotic tRNAs in eukaryotic cells can be difficult because of the different tRNA transcription and processing involved in prokaryotes and eukaryotes. However, a pol III that lacks any requirement for intragenic elements can efficiently transcribe prokaryotic tRNAs in eukaryotic cells. Different pol III polymerases are chosen depending on the type of eukaryotic cell and the prokaryotic tRNA to be expressed. In some embodiments, the pol III promoter is a type-3 promoter. Specific non-limiting examples of promoters of use include the Hl promoter, as well as the promoters for U6 snRNA, 7SK, and MRP/7-2. A promoter also is selected that will drive expression of the MO-RS. Numerous promoters will accomplish this goal. One specific, non-limiting example is a PGK promoter.
In some examples, for high-efficiency incorporation of UAA in yeast, an internal leader promoter is selected. Certain type 3 Pol III promoters from yeast (e.g., internal leader Pol III promoters), are transcribed together with the RNA, and are then cleaved post-transcriptionally to yield the mature RNA. Specific, non- limiting examples of internal leader pol III promoters of yeast include the SNR52 promoter and the RPRl promoter.
The O-tRNA chosen is one that recognizes a suppressor codon, such as a stop codon or an extended codon, for example amber, ochre, or opal. The MO-RS chosen is specific for an unnatural amino acid. One or more vectors (such as an expression plasmid or viral vector) are selected for transforming the eukaryotic cell with the O-tRNA and the MO-RS. The pol III promoter is inserted upstream of the O-tRNA gene using standard molecular biology techniques, the promoter that will drive expression of the MO-RS is inserted upstream of the MO-RS gene in the same or a different vector. The eukaryotic cell is then transformed with the vector(s) using conventional techniques.
A source of the unnatural amino acid is provided to the transformed cell, for example in the cell culture medium. When the eukaryotic cell expresses both the O- tRNA and MO-RS, the MO-RS charges the O-tRNA with the unnatural amino acid, the O-tRNA recognizes the stop or extended codon, and the unnatural amino acid is inserted into peptide.
Example 8: Genetic Incorporation of Unnatural Amino Acids (UAA) in Stem Cells
This Example describes the use of an UAA specific synthetase in stem cells. Although particular methods of using orthogonal synthetases in stem cells are described, one of skill in the art will appreciate that similar methods can be used for other stem cells and other UAAs (as well as with other synthetases, such as the MORS s described herein). These results also demonstrate that the Hl promoter strategy for expressing orthogonal tRNA works in stem cells. It was confirmed that the Hl promoter and the 3 '-flanking sequence identified in HeLa cells also can generate functional amber suppressor tRNAs in neural stem cells. HCN- A94 cells were transfected with two plasmids simultaneously (FIG. 6): the reporter plasmid pCLHF-GFP-TAG encoding a mutant GFP (182TAG) gene, and the expression plasmid encoding the E. coli TyrRS, the EctRNA^A driven by either the Hl promoter or the 5' flanking sequence of human tRNATyr. Fluorescence microscopy was used to image green fluorescence. The presence of green fluorescence in transfected cells indicated that functional EctRNA^A was biosynthesized to incorporate Tyr at the 182TAG position of the GFP gene. As shown in FIG. 6A, HCN cells transfected with the expression plasmid in which the EctRNA|^A was driven by the Hl promoter showed intense green fluorescence, whereas no green fluorescence could be detected in neurons in which the EctRNA|^A was driven by the 5' flanking sequence of the human tRNATyr.
Next, it was confirmed that UAAs could be genetically encoded in stem cells using the EctRNA|^A and mutant synthetases specific for different UAAs.
Synthetases evolved in yeast and proven functional in HeLa cells were used. When
the Ome-TyrRS was coexpressed with the EctRNA|^A , transfected stem cells showed no green fluorescence in the absence of the corresponding unnatural amino acid OmeTyr (FIG. 6B), indicating that the EctRNA|^A is orthogonal to endogenous synthetases in HCN stem cells. Bright green fluorescence was observed from transfected stem cells only when OmeTyr was fed to the growth media. These results indicate that OmeTyr, but no common amino acid, was incorporated into GFP at the 182TAG position. The same results were obtained for the unnatural amino acid Bpa when the BpaRS was coexpressed with the EctRNA^A (FIG. 7A), and for the unnatural amino acid dansylalanine when the Dansyl-RS was coexpressed with the EctRNA^A .
These results confirm that UAA specific synthetases evolved in yeast can be used in stem cells to express UAAs.
EXAMPLE 9: Mutant Synthetase Improves UAA Incorporation in Mammalian Cells
This example describes methods used to mutate the E. coli synthetase (TyrRS; SEQ ID NO: 36) to improve improve the recognition of the E. coli TyrRS toward tRNA|^A , thereby improving UAA incorporation in vitro and in vivo. Optimizing the anticodon recognition between orthogonal tRNA and synthetase significantly increased the incorporation efficiencies of various unnatural amino acids in mammalian cells, and this enhanced incorporation enabled in vivo photocros slinking of interacting proteins in mammalian cells with high efficiency.
As there is no crystal structure available for the E. coli tRNATyr«TyrRS complex, the E. coli TyrRS (Kobayashi et al, J. MoI. Biol, 2005, 346: 105-117) was superimposed on the homologous Thermus thermophilics TyrRS in the tRNATyr«TyrRS complex of the latter (Yaremchuk et al, EMBO J., 2002, 21:3829-3840) using the Secondary-Structure Matching method (Krissinel and Henrick, Acta Crystallogr. D. Biol. Crystallogr., 2004, 60:2256-68). The two TyrRS superposed well with an r.m.s.d. of 2.2 A for the main chain atoms (FIG.
8A). Only G34 in the anticodon of tRNATyr needs to be changed to C34 to make
tRNAjJA . The G34 base of T. thermophilus tRNATyr is recognized by the carboxyl group of Asp259 in T. thermophilus TyrRS, which corresponds to Asp265 in E. coli TyrRS. Mutation of G34 to C34 would create a gap between the base and the Asp residue, disrupting the recognition (FIG. 8B). Asp265 in E. coli TyrRS was mutated to five different amino acids with side chains longer than Asp (Tyr, Arg, GIn, Phe, and Leu) in the hope to restore the interaction with C34. These five mutants were first screened in yeast to determine their ability to suppress the amber codon together with the E. coli tRNAjJA . An amber stop codon was introduced into a permissive site (Lys5) in the HIS3 gene. If the E coli tRNAjjA /mutant TyrRS suppresses the amber codon, yeast cells will be able to make full length HIS 3 protein and survive in media lacking histidine. Yeast harboring mutant Asp265Phe and Asp265Leu could not grow, indicating these two mutations could abolish the recognition for the tRNAjJA . The other three mutants grew as good as the wt TyrRS, and were further characterized in mammalian cells using an in vivo fluorescence assay.
In this assay, genes for the E. coli tRNAjJA and the synthetase mutant to be tested were transfected into a stable clonal HeLa cell line, in which the green fluorescent protein (GFP) gene containing a premature UAG stop codon at a permissive site (Tyr39) was integrated into the genome (FIG. 9A). Suppression of UAG39 by the tRNAjjA /synthetase pair results in full-length fluorescent GFP. The total fluorescence intensity of cells measured by fluorescence-activated cell sorting (FACS) reports the incorporation efficiency and thus the affinity of the mutant synthetase for the tRNAjjA . Compared with the wt TyrRS, the Asp265Gln and Asp265Tyr mutants decreased the fluorescence intensity to below 10%, while the Asp265Arg mutant increased the fluorescence intensity to 186%, indicating that the Asp265Arg mutant TyrRS (EwtYRS) has higher activity toward the IRNA^A than wt TyrRS (FIG. 9C).
To demonstrate that the Asp265Arg mutation could be transplanted to improve the incorporation efficiency of different unnatural amino acids in mammalian cells, this mutation was introduced into four synthetases derived from the E. coli TyrRS for the incorporation of unnatural amino acid Bzo, Azi,
Ome, and Pyo, respectively (FIG. 9B) (Deiters et al., J. Am. Chem. Soc, 2003, 125: 11782-3; Chin, et al, Science, 2003, 301:964-7). The resultant mutant synthetases (referred to as Enhanced synthetases EBzoRS, EAziRS, EOmeRS, and EPyoRS) were individually coexpressed with the E. coli tRNAjjA in the clonal GFP reporter HeLa cell line in the absence and presence of the unnatural amino acid. The incorporation efficiency was quantified with the total fluorescence intensity of cells using FACS (FIG. 9C). In comparison to the original synthetases, all four enhanced mutant synthetases improved the incorporation efficiency of respective unnatural amino acids, with the increase ranging from 1.6 fold to 5.2 fold. The EOmeRS and EPyoRS could incorporate the corresponding unnatural amino acid more efficiently than the wt E. coli TyrRS. The background misincorporation in the absence of the unnatural amino acid did not increase significantly, indicating that the Asp265Arg mutation did not affect the amino acid specificity of the wt and evolved synthetases. That all four mutants showed improvement indicates that the Asp265Arg mutation can generally be transplanted to other TyrRS -derived synthetases (for example, synthetases specific for p-iodo-phenylalanine, p-acetyl-phenylalanine, p-nitro- phenylalanine, p-amino-phenylalanine, p-carboxylmethyl-phenylalanine, L-(7- hydroxycoumarin-4-yl) ethylglycine, and so on.) The mutation can be made at Asp265Arg for all synthetases.
Prokaryotic TyrRS differ distinctly from archaeal and eukaryotic TyrRS in anticodon recognition (Tsunoda et al., Nucleic Acids Res., 2007, 35:4289- 4300). In prokaryotic tRNATyr, base ψ35 is flipped oppositely to G34 and A36 and recognized by the extra C-terminal domain characteristic of prokaryotic TyrRS, and base G34 is stacked directly on base A36. In contrast, in archaeal and eukaryotic tRNATyr, all three anticodon bases are in the same side, and G34 is stacked with hydrophobic residues of the TyrRS (for example compare FIGS. 5B and D of Kobayashi et al., Nat. Struct. Biol, 2003, 10:425-32). Although G34 is recognized by the carboxyl group of Asp in both prokaryotic and archaeal/eukaryotic TyrRS, the helices in which this Asp residue locates do not correspond (for example compare FIGS. 5 A and C of Kobayashi et al., Nat. Struct. Biol, 2003, 10:425-32). By mutating the residue interacting with G34,
Kobayashi et al, (Id.) showed that the initial aminoacylation rate of the cognate tRNAjJA by the archaeal Methanococcus jannaschii TyrRS can be increased. However, Kobayashi et al. did not show whether this mutation can increase unnatural amino acid incorproation. In fact, an increase in aminoacylation rate does not necessarily mean an increase in unnatural amino acid incorporation, because unnatural amino acid incorporation involves multiple steps and aminoacylation is merely one of those steps. Using an in vivo translational assay that directly reports the yield of proteins containing unnatural amino acids, we demonstrated that, despite the different anticodon recognition mode, the prokaryotic TyrRS could be optimized for its cognate tRNAjJA that lead to higher incorporation efficiency for Tyr and various unnatural amino acids into proteins. In addition, we showed that the Asp265Arg mutation can be generally transplanted into multiple synthetases that are specific for different unnatural amino acids. To demonstrate that the enhanced mutant synthetases would facilitate the application of unnatural amino acids in mammalian cells, EAziRS was used to incorporate Azi into glutathione ^-transferase (GST) and photocros slinking in HEK293T cells. E. coli GST is homodimer (Nishida et al, J. MoI. Biol, 1998, 281: 135-147). Three sites at the dimer interface, Asn87 in a loop and Tyr92 and Vall25 in α-helices were chosen for incorporating Azi (FIG. 10A). GST genes with TAG mutation at these sites and a C-terminal His6 tag were cotransfected with the orthogonal tRNAjJA /EAziRS pair in HEK293 cells, and the cells were grown in the presence of ImM of Azi. Photocros slinking was performed by exposing the cells under 365 nm UV light for 10 minutes. Cell lysates were separated on SDS-PAGE and probed with an antibody against the His6 tag.
As shown in FIG. 1OB, GST monomers (23kD) could be detected for all three mutants before UV exposure. After photocros slinking, higher molecular weight bands around 46 kD emerged, accompanied by the intensity decrease of the monomer band (several faint bands between 23 kD and 46 kD were proteins in the cell lysate recognized by the penta-His antibody nonspecifically, which were also seen in samples without exposure to UV light). Based on the intensity ratio of these bands, the crosslinking efficiency was calculated to be 33%, 40%,
and 98% for site 87, 92, and 125, respectively. Crosslinked GST migrated at different positions in the gel depending on where Azi was incorporated.
Several faint bands between 23 kD and 46 kD were observed on the GST- His6 blot, which can be due to proteins recognized nonspecifically by the penta- His antibody or non-GST proteins crosslinked to GST. To distinguish this, the His6 tag was replaced with the FLAG tag at the C-terminus of GST, and the blot probed with an anti-FLAG antibody after photocrosslinking (FIG. 10C). These bands disappeared, indicating that they are caused by the nonspecificity of the penta-His antibody. Compared with the original TyrRS and AziRS, the ETyrRS and EAziRS increased GST protein yields to 2.2 fold and -2.3 fold, respectively. More crosslinked GST products were detected in the EAziRS than the AziRS samples (2.1 fold for 87TAG and 1.8 fold for 125TAG). Interestingly, crosslinked GST migrated at different positions in the gel depending on where Azi was incorporated. One possible explanation is that the crosslinking of GST dimer with 2 Azis generates an interlocked polypeptide with a core and 4 arms. Different Azi incorporation sites will change the core size and arm length in the crosslinked product, thus leading to different mobility in gel. This effect may be analogous to how disulfide bonds influence protein mobility in nonreducing electrophoresis conditions. Another possibility to be excluded by mass spectrometry is that GST was crosslinked to other proteins.
These results demonstrate the ability of using genetically encoded Azi for detecting protein-protein interactions directly in live mammalian cells. Bzo, but not Azi, has been previously used to crosslink proteins in mammalian cells (Hino et al., Nat Methods, 2005, 2:201-6). Benzophenone can be photoactivated at wavelength longer than aryl azides (350 - 365 nm vs. <330 nm). However, these results showed that Azi could also be activated at the long wavelength 365 nm for crosslinking. One advantage of Azi over Bzo is its smaller size. For the three selected incorporation sites Asn87, Tyr92, and V125, the closest residue on the opposite monomer is 6.50 A, 6.36 A, and 9.70 A (distance between the α carbons) away, respectively. That site 125 has the highest crosslinking efficiency suggests that space for proper accommodating the photocrosslinker is important. The bulky side chain of Bzo is more likely to disrupt the protein
interaction under study. Moreover, GST crosslinked at different sites showed different migration positions in the gel, indicating that one should not look for the crosslinked product at positions corresponding to the sum of molecular weight of interacting proteins only. In addition, cells were exposed to UV light for 10 minutes and detection was performed on cell lysate directly in the Azi crosslinking experiment. The previously reported Bzo experiments used 15-30 minutes exposure and immunoprecipitation was used to enrich the target proteins for detection. Although crosslinking efficiency also depends on target protein and interaction strength, these results demonstrate that Azi incorporated using the EAziRS provides high photocrosslinking efficiency in mammalian cells and should prove useful for detecting protein-protein interactions in vivo.
In summary, it is demonstrated herein that the recognition of E. coli TyrRS for its cognate tRNAjJA was optimized by engineering the anticodon- binding region. This optimization could be transplanted to multiple TyrRS- derived synthetases, and the resultant enhanced synthetases improved the incorporation efficiency of various unnatural amino acids in mammalian cells. This strategy should also be generally applicable to other orthogonal tRNA/synthetase pairs (for example, the tRNALeu/LeuRS pair, the tRNAG17GlnRS pair, the tRNAAsp/AspRS pair, the tRNATrp/TrpRS pair, the tRNAPyl/PylRS pair, and so on). It was also shown that an enhanced synthetase allowed in vivo photocrosslinking in mammalian cells with high efficiency, which should help detect protein-involved interactions in native celluar sourroundings.
While this disclosure has been described with an emphasis upon particular embodiments, it will be obvious to those of ordinary skill in the art that variations of the particular embodiments can be used and it is intended that the disclosure can be practiced otherwise than as specifically described herein. Accordingly, this disclosure includes all modifications encompassed within the spirit and scope of the disclosure as defined by the following claims:
Claims
1. A method of incorporating an unnatural amino acid (UAA) into a protein in a eukaryotic cell, comprising: expressing a recombinant orthogonal mutant aminoacyl-tRNA synthetase
(MO-RS) in the cell, wherein the MO-RS comprises an Asp265Arg or equivalent mutation, wherein the amino acid numbering corresponds to wild-type E. coli tyrosyl synthetase (TyrRS) (SEQ ID NO: 36); expressing an orthogonal tRNA (O-tRNA) corresponding to the MO-RS, thereby permitting formation of an orthogonal tRNA-orthogonal mutant synthetase pair in the cell; and incubating the cell in growth medium comprising the UAA under conditions that permit the MO-RS to charge the O-tRNA with the UAA, thereby generating acylated tRNA which can incorporate the UAA into proteins in the cell.
2. The method of claim 1, wherein the recombinant MO-RS comprises a recombinant non-archaeal MO-RS.
3. The method of claim 1 or 2, wherein the recombinant MO-RS comprises a recombinant prokaryotic MO-RS .
4. The method of claim 3, wherein the prokaryotic MO-RS comprises an E. coli mutant synthetase.
5. The method of claim 4, wherein the E. coli mutant synthetase comprises an MO-RS tyrosyl, glutamyl, or leucyl, E. coli synthetase.
6. The method of any of claims 1-5, wherein the recombinant MO-RS comprises a recombinant eukaryotic MO-RS.
7. The method of claim 6, wherein the recombinant eukaryotic MO-RS comprises a yeast MO-RS.
8. The method of any of claims 1-7, wherein the recombinant MO-RS comprises a mutant pyrrolysyl synthetase.
9. The method of any of claims 1-7, wherein the recombinant MO-RS comprises a mutant tyrosyl synthetase and the tRNA comprises tRNAjJA .
10. The method of any of claims 1-7, wherein the recombinant MO-RS comprises a mutant leucyl synthetase and the tRNA comprises tRNA^A .
11. The method of any of claims 1-10, wherein the equivalent mutation improves the affinity of the synthetase to the orthogonal tRNA.
12. The method of any of claims 1-11, wherein the O-tRNA is expressed from a nucleic acid molecule encoding an external RNA polymerase III promoter
(pol III) operably linked to the O-tRNA, thereby expressing the O-tRNA in the cell.
13. The method of claim 12, wherein the pol III promoter is a type-3 pol III promoter or an internal leader pol III promoter.
14. The method of any of claims 1-13, wherein the O-tRNA is an E. coli tRNA.
15. The method of any of claims 1-14, wherein the O-tRNA is a suppressor tRNA.
16. The method of any of claims 1-14, wherein the O-tRNA is an archaebacterial tRNA.
17. The method of any of claims 1-16, wherein the eukaryotic cell is a mammalian cell or a yeast cell.
18. The method of any of claims 1-17, wherein the cell is substantially Nonsense-Mediated mRNA Decay (NMD)-deficient.
19. An isolated orthogonal synthetase protein consisting of the amino acid sequence shown in SEQ ID NO: 36 with an Asp265Arg substitution and one to ten additional amino acid substitutions that generate an orthogonal synthetase for a UAA.
20. The isolated orthogonal synthetase protein of claim 19, wherein the one to ten additional amino acid substitutions consist of:
Y37G, D182G, L186A; Y37L, D182S, F183A, L186A; Y37I, D182G, F183M, L186A; Y37T, D182T, L183M; or Y37G, D182S, F183M.
21. An isolated nucleic acid encoding the protein of claim 19 or 20.
22. A stable eukaryotic cell line expressing the nucleic acid molecule of claim 21.
23. The stable cell line of claim 22, wherein the cell line is a mammalian cell line or a yeast cell line.
24. The yeast cell line of claim 23, wherein the yeast cell line is substantially
NMD-deficient.
25. The stable cell line of claim 24, wherein stable cell line further expresses an O-tRNA that forms an orthogonal pair with the synthetase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/376,371 US20120077224A1 (en) | 2009-06-05 | 2010-06-04 | unnatural amino acid incorporation in eukaryotic cells |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US18441709P | 2009-06-05 | 2009-06-05 | |
| US61/184,417 | 2009-06-05 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010141851A1 true WO2010141851A1 (en) | 2010-12-09 |
Family
ID=43298187
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/037449 Ceased WO2010141851A1 (en) | 2009-06-05 | 2010-06-04 | Improving unnatural amino acid incorporation in eukaryotic cells |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20120077224A1 (en) |
| WO (1) | WO2010141851A1 (en) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012038706A1 (en) * | 2010-09-24 | 2012-03-29 | Medical Research Council | Methods for incorporating unnatural amino acids in eukaryotic cells |
| EP3081646A4 (en) * | 2013-12-09 | 2016-12-14 | Jiangsu Micromedmark Biotech Co Ltd | NON-CODING SALMONELLA RNA AND CORRESPONDING IDENTIFICATION AND USE |
| WO2017093254A1 (en) * | 2015-11-30 | 2017-06-08 | European Molecular Biology Laboratory | Means and methods for preparing engineered proteins by genetic code expansion in insect cells |
| WO2020138336A1 (en) | 2018-12-26 | 2020-07-02 | 中外製薬株式会社 | Mutated trna for codon expansion |
| WO2020150608A1 (en) * | 2019-01-18 | 2020-07-23 | Flagship Pioneering, Inc. | Trem compositions and uses thereof |
| WO2020219708A1 (en) * | 2019-04-23 | 2020-10-29 | Trustees Of Boston College | Genetically encoded tyrosine sulfation of proteins in eukaryotes |
| WO2021132546A1 (en) | 2019-12-26 | 2021-07-01 | 中外製薬株式会社 | Composition for translation, and method for producing peptide |
| WO2021261577A1 (en) | 2020-06-25 | 2021-12-30 | 中外製薬株式会社 | Translation system provided with modified genetic code table |
| CN115003810A (en) * | 2019-11-04 | 2022-09-02 | 旗舰创业股份有限公司 | TREM compositions for CON-rare codons and related uses |
| JP2022549931A (en) * | 2019-09-30 | 2022-11-29 | ザ スクリプス リサーチ インスティテュート | eukaryotic semisynthetic organisms |
| WO2023077058A1 (en) * | 2021-10-29 | 2023-05-04 | Trustees Of Boston College | Engineered bacterial tyrosyl-trna synthetase mutants for incorporating unnatural amino acids into proteins |
| CN116716294A (en) * | 2022-11-18 | 2023-09-08 | 天津大学 | Construction and application of variant tRNA for recognizing TAG by yeast |
| US11851662B2 (en) | 2017-06-02 | 2023-12-26 | Ambrx, Inc. | Methods and compositions for promoting non-natural amino acid-containing protein production |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112553239B (en) * | 2019-09-25 | 2023-10-13 | 深圳华大生命科学研究院 | Genome rearrangement regulation systems and methods based on unnatural amino acids |
| WO2022245902A2 (en) * | 2021-05-19 | 2022-11-24 | Trustees Of Tufts College | Aminoacyl transfer rna synthetases |
| CN118879754B (en) * | 2024-07-18 | 2025-05-09 | 北京理工大学 | A method for in situ detection of the quaternary structure of oligomeric enzymes displayed on the yeast surface based on FRET |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040265952A1 (en) * | 2003-06-18 | 2004-12-30 | The Scripps Research Institute | Unnatural reactive amino acid genetic code additions |
| US20080254540A1 (en) * | 2007-04-13 | 2008-10-16 | The Salk Institute Ofr Biological Studies | METHODS OF GENETICALLY ENCODING UNNATURAL AMINO ACIDS IN EUKARYOTIC CELLS USING ORTHOGONAL tRNA/SYNTHETASE PAIRS |
-
2010
- 2010-06-04 US US13/376,371 patent/US20120077224A1/en not_active Abandoned
- 2010-06-04 WO PCT/US2010/037449 patent/WO2010141851A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040265952A1 (en) * | 2003-06-18 | 2004-12-30 | The Scripps Research Institute | Unnatural reactive amino acid genetic code additions |
| US20080254540A1 (en) * | 2007-04-13 | 2008-10-16 | The Salk Institute Ofr Biological Studies | METHODS OF GENETICALLY ENCODING UNNATURAL AMINO ACIDS IN EUKARYOTIC CELLS USING ORTHOGONAL tRNA/SYNTHETASE PAIRS |
Non-Patent Citations (2)
| Title |
|---|
| DATABASE GENBANK [online] September 2001 (2001-09-01), PERNA N.T. ET AL: "Tyrosine tRNA Synthetase [Imported] - Escherichia coli (Strain O157:H7, Substrain EDL933)", retrieved from http://www.ncbi.nlm.nih.gov/protein/25292889 Database accession no. F85770 * |
| KOBAYASHI T. ET AL: "Structural Basis for Orthogonal tRNA Specificities of Tyrosyl-tRNA Synthetases for Genetic Code Expansion", NATURE STRUCTURAL BIOLOGY, vol. 10, no. 6, June 2003 (2003-06-01), pages 425 - 432, XP002375045, DOI: doi:10.1038/nsb934 * |
Cited By (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130183761A1 (en) * | 2010-09-24 | 2013-07-18 | North Carolina State University | Methods for Incorporating Unnatural Amino Acids in Eukaryotic Cells |
| WO2012038706A1 (en) * | 2010-09-24 | 2012-03-29 | Medical Research Council | Methods for incorporating unnatural amino acids in eukaryotic cells |
| EP3081646A4 (en) * | 2013-12-09 | 2016-12-14 | Jiangsu Micromedmark Biotech Co Ltd | NON-CODING SALMONELLA RNA AND CORRESPONDING IDENTIFICATION AND USE |
| WO2017093254A1 (en) * | 2015-11-30 | 2017-06-08 | European Molecular Biology Laboratory | Means and methods for preparing engineered proteins by genetic code expansion in insect cells |
| CN108368499A (en) * | 2015-11-30 | 2018-08-03 | 欧洲分子生物学实验室 | Means and methods for preparing engineered proteins by amplifying the genetic code in insect cells |
| US11851662B2 (en) | 2017-06-02 | 2023-12-26 | Ambrx, Inc. | Methods and compositions for promoting non-natural amino acid-containing protein production |
| US12577575B2 (en) | 2017-06-02 | 2026-03-17 | Ambrx, Inc. | Methods and compositions for promoting non-natural amino acid-containing protein production |
| AU2018275152B2 (en) * | 2017-06-02 | 2025-01-23 | Ambrx, Inc. | Methods and compositions for promoting non-natural amino acid-containing protein production |
| EP4382124A3 (en) * | 2017-06-02 | 2024-10-16 | Ambrx, Inc. | Methods and compositions for promoting non-natural amino acid-containing protein production |
| EP3630977B1 (en) * | 2017-06-02 | 2024-02-21 | Ambrx, Inc. | Methods and compositions for promoting non-natural amino acid-containing protein production |
| WO2020138336A1 (en) | 2018-12-26 | 2020-07-02 | 中外製薬株式会社 | Mutated trna for codon expansion |
| WO2020150608A1 (en) * | 2019-01-18 | 2020-07-23 | Flagship Pioneering, Inc. | Trem compositions and uses thereof |
| CN113795580A (en) * | 2019-01-18 | 2021-12-14 | 旗舰创业股份有限公司 | TREM compositions and uses thereof |
| IL284878B2 (en) * | 2019-01-18 | 2026-04-01 | Flagship Pioneering Inc | Trem compositions and uses thereof |
| IL284878B1 (en) * | 2019-01-18 | 2025-12-01 | Flagship Pioneering Inc | Trem preparations and their uses |
| JP2022517275A (en) * | 2019-01-18 | 2022-03-07 | フラッグシップ パイオニアリング, インコーポレイテッド | TREM composition and its use |
| WO2020219708A1 (en) * | 2019-04-23 | 2020-10-29 | Trustees Of Boston College | Genetically encoded tyrosine sulfation of proteins in eukaryotes |
| US12435327B2 (en) | 2019-04-23 | 2025-10-07 | Trustees Of Boston College | Genetically encoded tyrosine sulfation of proteins in eukaryotes |
| JP2025118780A (en) * | 2019-09-30 | 2025-08-13 | ザ スクリプス リサーチ インスティテュート | Eukaryotic semisynthetic organisms |
| JP7692900B2 (en) | 2019-09-30 | 2025-06-16 | ザ スクリプス リサーチ インスティテュート | Eukaryotic semisynthetic organisms |
| JP2022549931A (en) * | 2019-09-30 | 2022-11-29 | ザ スクリプス リサーチ インスティテュート | eukaryotic semisynthetic organisms |
| CN115003810A (en) * | 2019-11-04 | 2022-09-02 | 旗舰创业股份有限公司 | TREM compositions for CON-rare codons and related uses |
| WO2021132546A1 (en) | 2019-12-26 | 2021-07-01 | 中外製薬株式会社 | Composition for translation, and method for producing peptide |
| WO2021261577A1 (en) | 2020-06-25 | 2021-12-30 | 中外製薬株式会社 | Translation system provided with modified genetic code table |
| WO2023077058A1 (en) * | 2021-10-29 | 2023-05-04 | Trustees Of Boston College | Engineered bacterial tyrosyl-trna synthetase mutants for incorporating unnatural amino acids into proteins |
| CN116716294A (en) * | 2022-11-18 | 2023-09-08 | 天津大学 | Construction and application of variant tRNA for recognizing TAG by yeast |
Also Published As
| Publication number | Publication date |
|---|---|
| US20120077224A1 (en) | 2012-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8183037B2 (en) | Methods of genetically encoding unnatural amino acids in eukaryotic cells using orthogonal tRNA/synthetase pairs | |
| US20120077224A1 (en) | unnatural amino acid incorporation in eukaryotic cells | |
| AU2022200130B2 (en) | Engineered Cas9 systems for eukaryotic genome modification | |
| US8198044B2 (en) | Systems for the expression of orthogonal translation components eubacterial host cells | |
| JP6294368B2 (en) | Methods and compositions for producing orthogonal tRNA-aminoacyl tRNA synthetase pairs | |
| JP5385143B2 (en) | Genetically programmed expression of selectively sulfated proteins in eubacteria | |
| JP7692900B2 (en) | Eukaryotic semisynthetic organisms | |
| WO2016201155A1 (en) | Crispr-cas compositions and methods | |
| KR20080113226A (en) | Genetically Programmed Expression of Proteins Containing Unnatural Amino Acids Phenylselenocysteine | |
| KR20090094812A (en) | Genetic incorporation of unnatural amino acids into proteins in mammalian cells | |
| US20120077186A1 (en) | Use of cysteine-derived suppressor trnas for non-native amino acid incorporation | |
| US20060084136A1 (en) | Production of fusion proteins by cell-free protein synthesis | |
| AU2020295571B2 (en) | Enhanced platforms for unnatural amino acid incorporation in mammalian cells | |
| US20240384267A1 (en) | Compositions and methods for multiplex decoding of quadruplet codons | |
| CN114867854A (en) | Peptides | |
| AU769879B2 (en) | Method for producing in vivo proteins chemically diversified by incorporating non-standard amino acids | |
| WO2026072527A1 (en) | Highly specialized and fully orthogonal translation system | |
| WO2025259780A1 (en) | Polypeptides and methods for modifying nucleic acids | |
| WO2025259864A1 (en) | Expression of proteins containing non-standard amino acids | |
| Qi | Engineering the Translation Apparatus to Incorporate Nonnatural Amino Acids | |
| Magliery | Engineering the Escherichia coli translational apparatus: New genetic signals for site-specific insertion of unnatural amino acids and methodology for in vivo site-selective incorporation of unnatural amino acids |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10784173 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13376371 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10784173 Country of ref document: EP Kind code of ref document: A1 |

