WO2010135836A1 - Novel beta-glucosidase enzymes - Google Patents
Novel beta-glucosidase enzymes Download PDFInfo
- Publication number
- WO2010135836A1 WO2010135836A1 PCT/CA2010/000807 CA2010000807W WO2010135836A1 WO 2010135836 A1 WO2010135836 A1 WO 2010135836A1 CA 2010000807 W CA2010000807 W CA 2010000807W WO 2010135836 A1 WO2010135836 A1 WO 2010135836A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- beta
- trceba
- modified
- glucosidase
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/22—Processes using, or culture media containing, cellulose or hydrolysates thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2445—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/02—Monosaccharides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/06—Ethanol, i.e. non-beverage
- C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
- C12P7/10—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01021—Beta-glucosidase (3.2.1.21)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Definitions
- the present invention relates to modified beta-glucosidases. More specifically, the invention relates to modified beta-glucosidases with improved kinetic parameters for the conversion of cellobiose to glucose.
- the present invention also relates to genetic constructs comprising nucleotide sequences encoding for modified beta-glucosidases, methods for the production of the modified beta-glucosidases from host strains and the use of the modified beta- glucosidase in industrial applications, including the hydrolysis of cellulose.
- Lignocellulosic feedstocks are a promising alternative to corn starch for the production of fuel ethanol. These raw materials are widely available, inexpensive and several studies have concluded that cellulosic ethanol generates close to zero greenhouse gas emissions.
- cellulase broadly refers to enzymes that catalyze the hydrolysis of the beta-l,4-glucosidic bonds joining individual glucose units in the cellulose polymer.
- the catalytic mechanism involves the synergistic actions of endoglucanases (E.C. 3.2.1.4), cellobiohydrolases (E.C. 3.2.1.91) and beta-glucosidases (E.C. 3.2.1.21) (Henrissat et al, 1994; Knowles et al., 1987; Lynd et al., 2002; Teeri, 1997; Wood and Garcia-Campayo, 1990; Zhang and Lynd, 2004).
- Endoglucanases hydrolyze accessible glucosidic bonds in the middle of the cellulose chain, while cellobiohydrolases processively release cellobiose from these chain ends.
- Beta-glucosidases hydrolyze cellobiose to glucose thus minimizing product inhibition of the cellobiohydrolases and endoglucanases.
- Beta-glucosidases are produced by many organisms occurring in all five living kingdoms. Generally these enzymes hydrolyze aryl-beta-glucosides, among which is included cellobiose (gluco-beta-(l,4)-glucoside). Some also catalyze transglycosylation reactions to varying extents.
- Filamentous fungi including Trichoderrna ssp., Aspergillus ssp., Hypocrea ssp.,
- Hwnicola ssp. Neurospora ssp., Orpinomyces ssp., Gibber ella ssp., Emericella ssp., Chaetomium ssp., Fusarium ssp., Penicillium ssp., Magnaporthe ssp., Chrysosporium ssp., Myceliophthora ssp., Theilavia ssp., Sporotrichum ssp. and Phanerochaete ssp. are effective producers of cellulase enzymes. Many of these organisms secrete beta-glucosidase enzymes. Trichoderma spp.
- Trichoderma longibrachiatum or Trichoderma reesei secrete small amounts of beta-glucosidase I or Cel3A (Chirico et al., 1987) and likely also secrete two other beta- glucosidases, CeBB and CeBE (Foreman et al., 2003).
- Cellobiohydrolases are strongly inhibited by cellobiose and to a lesser degree by glucose. Conversion of cellobiose to glucose is a rate-limiting step in cellulose hydrolysis because filamentous fungi, such as Trichoderma reesei, produce very low levels of beta- glucosidase and beta-glucosidases are highly sensitive to glucose inhibition (Chirico et al., 1987; Berghem et al., 1974). One technique for reducing cellulase inhibition is to increase the amount of beta-glucosidase in the system (U.S. Patent No.
- Beta-glucosidases from most fungi have binding constants for cellobiose (K G2 ) that range from 0.2-2.0 mM (Chirico et al., 1987; Berghem et al., 1974; Enari et al., 1981; Christakopoulos et al., 1994). These enzymes are highly sensitive to glucose inhibition; KQ values for glucose ranging from 0.6-8.0 mM have been reported for these enzymes.
- K G >8.0 mM Several microbial beta-glucosidases with higher tolerance to glucose inhibition (K G >8.0 mM) have been reported (Riou et al., 1998; U.S. Patent 6,087,131; Saha et al., 1996; U.S.
- these enzymes generally have a lower affinity for cellobiose (i.e., higher K G2 values).
- the concentration of cellobiose at steady state would be higher using these beta-glucosidases, increasing the degree of cellobiose inhibition on cellulase activity. Therefore, these particular glucose tolerant beta-glucosidase enzymes have limited utility for the production of cellulosic ethanol.
- beta-glucosidase enzymes in order to generate enzyme mixtures with higher sustained hydrolysis activity on pretreated lignocellulosic feedstock.
- the absence of such improved beta-glucosidase enzymes represents a large hurdle in the commercialization of cellulose conversion to glucose and other soluble fermentable sugars for the production of ethanol and other products.
- the present invention relates to modified beta-glucosidases. More specifically, the invention relates to modified beta-glucosidases with improved kinetic parameters for the conversion of cellobiose to glucose. Beta-glucosidases of the present invention find utility in industrial processes requiring efficient conversion of cellobiose to glucose in the presence of glucose concentrations that would otherwise inhibit a parental beta-glucosidase.
- An embodiment of the invention relates to a modified beta-glucosidase of Trichoderma reesei produced by substitution of the amino acid at one or more of positions 43, 101, 260 and 543 in the beta-glucosidase I or TrCeBA sequence (SEQ ID NO: 1) and comprising an amino acid sequence that is from about 80% to 99.9% to that TrCeBA amino acid sequence defined by SEQ ID NO: 1.
- the modified TrCeBA beta-glucosidase may be derived from a parental TrCeBA beta-glucosidase that is otherwise identical to the modified TrCeBA beta-glucosidase and includes the substitution of the naturally occurring amino acid at one or more of positions 43, 101, 260 and 543.
- the modified TrCeBA beta-glucosidase may contain one or more amino acid substitutions at positions other than at positions 43, 101 , 260 and 543, provided that the amino acid sequence of the modified TrCeBA is from about 80% to about 99.9% identical to the TrCeBA amino acid sequence (SEQ ID NO: 1).
- this invention includes the modified TrCeBA as defined above and further comprising an amino acid substitution at one or more of positions 66, 72, 96, 235, 248 and 369.
- the present invention also relates to a modified TrCeBA beta-glucosidase comprising an amino acid sequence that is from about 80% to about 99.9% identical to that of the wild-type TrCeBA of SEQ ID NO: 1 and which exhibits (a) at least a 20% increase in the K 0 , (b) at least a 20% decrease in K G2 , or (c) at least a 10% increase in k cat ⁇ ox cellobiose relative to the K G , KQ 2 and/or k cat of a parental TrCeBA beta-glucosidase from which is derived.
- the present invention also relates to a modified TrCeBA consisting of the amino acid sequence defined by:
- SEQ ID NO: 2 (TrCeBA-V43I); SEQ ID NO: 3 (TrCeBA- V43C); SEQ ID NO: 4 (TrCeBA-VlOlA); SEQ ID NO: 5 (TrCeBA-VlOlG); SEQ ID NO: 6 (TrCeB A-F260I); SEQ ID NO: 7 (TrCel3A-F260V); SEQ ID NO: 8 (TrCel3A-F260Q); SEQ ID NO: 9 (TrCeB A-F260D); SEQ ID NO: 10 (TrCeB A-I543N);
- SEQ ID NO: 18 (TrCeBA-S72N-V101M-I543N);
- SEQ ID NO: 70 (TrCeB A-S72N-V101 M-F260I-I543L).
- the genetic constructs of the present invention comprise a nucleic acid sequence encoding a modified TrCeBA with an amino acid sequence that is from about 80% to about 99.9% amino acid sequence identity to SEQ ID NO: 1 and that comprises an amino acid substitution at one or more of positions 43, 101, 260 and 543, which nucleic acid sequence is operably linked to nucleic acid sequences regulating its expression and secretion from a host microbe.
- the nucleic acid sequences regulating the expression and secretion of the modified TrCeBA beta-glucosidase may be derived from the host microbe used for expression of the modified TrCeBA beta-glucosidase.
- the host microbe may be a yeast, such as Saccharomyces cerevisiae, or a filamentous fungus, such as Trichoderma reesei.
- the invention also relates to a genetic construct as defined above, wherein the modified TrCeBA beta-glucosidase comprises an amino acid sequence that is from about 90% to about 99.9% identical to SEQ ID NO: 1.
- the modified TrCeBA beta-glucosidase may further comprise substitutions at one or more of positions 66, 72, 96, 235, 248, 369 and 386 or any other additional mutations.
- the invention also relates to a genetically modified microbe comprising a genetic construct encoding the modified TrCeBA beta-glucosidase..
- the genetically modified microbe may be capable of expression and secretion of the modified TrCeBA beta- glucosidase further comprising substitution at one or more of positions 66, 72, 96, 235, 248, 369 and 386 or any other additional mutations.
- the genetically modified microbe may be a yeast or filamentous fungus.
- the genetically modified microbe may be a species of Saccharomyces, Pichia, Hansenula, Trichoderma, Hyprocrea, Aspergillus, Fusarium, Humicola, Chrysosporium, Myceliophthora, Thielavia, Sporotrichum or Neurospora.
- the present invention also relates to the use of the modified TrCeBA beta- glucosidase in a hydrolysis reaction containing a cellulosic substrate and a cellulase mixture comprising the modified TrCeBA beta-glucosidase.
- the invention also relates to a process of producing the modified TrCeBA beta- glucosidase as defined above, including providing a yeast or fungal host with a genetic construct comprising a nucleic acid sequence encoding the modified TrCeBA beta-glucosidase, selection of recombinant yeast or fungal strains expressing the modified TrCeBA beta-glucosidase, culturing the selected recombinant strains in submerged liquid fermentations under conditions that induce the expression of the modified TrCeBA beta-glucosidase and recovering the modified TrCeBA beta-glucosidase.
- modified TrCeBA beta-glucosidases find use in a variety of applications in industrial processes requiring enzymes that can retain high activity in the presence of normally inhibitory concentrations of the glucose.
- modified TrCeBA beta-glucosidases, as described herein may be used for the purposes of saccharification of lignocellulosic feedstocks for the production of fermentable sugars or in the production of compounds such as those used in the medical and food industries.
- the invention relates to a modified Family 3 beta-glycosidase comprising one or more of the amino acid substitutions selected from the group consisting of V43I, V43C, VlOlA, VlOlG, F260I, F260V, F260Q, F260D, I543N, I543A, I543S, I543G and 1543 L and having an amino acid sequence that is at least 80% identical to the amino acid sequence of a parental Family 3 beta-glycosidase from which it is derived.
- the positions of the amino acid substitution(s) are determined from sequence alignment of the Family 3 beta- glycosidase with a Trichoderma reesei CeBA amino acid sequence as defined in SEQ ID NO: 1.
- the modified Family 3 beta-glycosidase of the present invention exhibits (a) an increase in the K p , (b) a decrease in K s , or (c) an increase in k cat relative to the Kp, Ks or k cat of the parental Family 3 beta-glycosidase from which it is derived.
- FIGURE 1 depicts plasmid vector YEp352/PGK91 - 1 / ⁇ ss 6H-TrCel3 A directing the expression and secretion of native and modified TrCeBA from recombinant Saccharomyces cerevisiae.
- FIGURE 2 shows a Saccharomyces cerevisiae growth plate containing synthetic complete medium plus 0.1% esculin hydrate and 0.03% FeCl 3 . Colonies which turned black after incubation for 3-4 days at 3O 0 C were identified as expressing active TrCel3A beta- glucosidase.
- FIGURE 3 is a scatter plot of beta-glucosidase activity in assay 1 (30 mM cellobiose) versus beta-glucosidase activity in assay 2 (5 mM cellobiose + 1.25 mM glucose).
- the data relate to the screening of one 96-well culture plate containing wild-type TrCel3 A (wt), filtrates from empty vector transformants (EV) and modified TrCel3As (variants).
- the wild-type TrCel3A data were fit by linear regression in which the y-intercept was fixed to zero.
- FIGURE 4 shows an SDS-PAGE gel of the parental (wt) and modified TrCeBA beta-glucosidases expressed from yeast and purified as described in Example 7, as well as a cellulase enzyme mixture from Trichoderma reesei (cellulase) and the wild-type TrCeBA purified from T. reesei cellulase (CeBA). After SDS-PAGE separation, the proteins were visualized by Coomassie Blue stain.
- FIGURE 5 is a diagram illustrating the reaction scheme of the/?NPG competitive substrate/inhibitor kinetic assay.
- FIGURE 6 shows the competitive substrate/inhibitor assay results for parental TrCeBA (Wt).
- FIGURE 7 shows the competitive substrate/inhibitor assay results for the modified TrCel3A-V43I beta-glucosidase.
- FIGURE 8 shows the competitive substrate/inhibitor assay results for the modified TrCeBA-V 101 A beta-glucosidase.
- FIGURE 9 shows the competitive substrate/inhibitor assay results for the modified TrCel3A-F260I beta-glucosidase.
- FIGURE 10 shows the competitive substrate/inhibitor assay results for the modified TrCel3A-I543N beta-glucosidase.
- FIGURE 11 shows an alignment of the amino acid sequences of 45 fungal Family 3 beta-glucosidases, including the parental TrCeBA of SEQ ID NO: 1, a consensus Family 3 beta-glucosidase sequence, and the % sequence identity of each amino acid sequence to that of TrCeBA.
- the positions of V43, VlOl, F260, and 1543 are indicated by asterisks (*); the positions of the catalytic amino acids D236 and E447 are indicated by arrows ( I ).
- a graphical representation of the frequency of occurrence of the amino acid at each position of the consensus Family 3 beta-glucosidase sequence of Figure 11 among the 45 fungal Family 3 beta- glucosidases is provided below the aligned sequences.
- FIGURE 12 is a Michaelis-Menton plot comparing the rates of cellobiose hydrolysis by wild-type parental TrCeBA and modified TrCeB A-F260I at different substrate concentrations.
- FIGURE 13 depicts plasmid vector pc/xCel3A-S72N-V101M-F260I-pyr4-TV directing the expression and secretion of modified TrCeBA beta-glucosidase from genetically modified Trichoderma reesei.
- FIGURE 14 shows the relative abundance of modified TrCeBA beta-glucosidases in cellulase mixtures produced by genetically modified Trichoderma reesei.
- FIGURE 15 is a plot showing the conversion of cellulose in a pretreated lignocellulosic substrate by cellulase mixtures comprising parental (WT TrCeBA) or modified (Modified TrCeBA) beta-glucosidases produced by genetically modified Trichoderma reesei. Leu Ser Tyr Thr Lys Phe 580
- Lys Ala Ala Leu Ala Lys Leu Asn Leu GIn Asp Lys VaI GIy lie VaI 20 25 30
- Beta-glucosidases are a subset of beta-glycosidases belonging to glycoside hydrolase (GH) Families 1 and 3, using the classification system developed by Henrissat and coworkers (Henrissat, B. (1991); Henrissat, B. and Bairoch, A. (1996)).
- Family 1 comprises beta-glycosidases from archaebacteria, plants and animals. Beta-glycosidases from some bacteria, mold and yeast belong to Family 3.
- a "beta-glycosidase” is therefore defined as any protein that is categorized as a Family 3 glycoside hydrolase according to the CAZy system.
- beta-D-glucan exohydrolase a Family 3 glycosyl hydrolase
- the structure was of a two domain globular protein comprising a N-terminal ( ⁇ / ⁇ ) 8 TIM-barrel domain and a C-terminal a six-stranded beta- sandwich, which contains a beta-sheet of five parallel beta-strands and one antiparallel beta- strand, with three alpha-helices on either side of the sheet. This structure is likely shared by other Family 3 enzymes.
- the primary amino acid sequence of Family 3 beta- glucosidases show a high degree of similarity.
- Multiple alignment across 45 Family 3 beta- glucosidase amino acid sequences shows that the most naturally occurring Family 3 beta- glucosidases of fungal origin show from about 40% to about 100% amino acid sequence identity to the amino acid sequence of TrCeDA ( Figure 11).
- there are several regions of very high amino acid sequence conservation within the Family 3 beta-glucosidases including, for example, from amino acids 225-256 and 439-459, containing the catalytic amino acids D236 and E447, respectively.
- TrCeBA beta-glucosidase or “TrCeBA” it is meant the Family 3 glycosyl hydrolase produced by Trichoderma reesei defined by the amino acid sequence of SEQ ID NO: 1. TrCeBA beta-glucosidase is also known as Trichoderma reesei beta-glucosidase or BGLl. By “native” or “wild type” TrCeBA (also annotated as TrCeB A wt ), it is meant the TrCeBA of SEQ ID NO: 1 without any amino acid substitutions.
- modified TrCeOA beta-glucosidase or “modified TrCeBA”
- TrCeBA beta-glucosidase which comprises one or more of the amino acid substitutions, introduced by genetic engineering techniques, selected from the group consisting of V43X, VlOlX, F260X, and I543X.
- the modified modified TrCeBA beta-glucosidase may comprising one or more amino acid substitutions selected from the group consisting ofV43I, V43C. VlOlA. VlOlG, F260I. F260V. F260O. F260D. I543N. 1543 A. I543S. I543G and I543L.
- Genetic engineering techniques for altering amino acid sequences include, but are not limited to, site-directed mutagenesis, cassette mutagenesis, random mutagenesis, synthetic oligonucleotide construction, cloning and other genetic engineering techniques as would be known by those of skill in the art (Eijsink VG, et al. 2005).
- Modified TrCeBA beta-glucosidases of the present invention include those comprising amino acid substitutions at any one of V43X, VlOlX, F260X and I543X, at any two of V43X, VlOlX, F260X and I543X, any three of V43X, VlOlX, F260X and I543X, or all four of V43X, VlOlX, F260X and I543X.
- the modified TrCeBA beta-glucosidase may be derived from wild-type TrCeBA beta-glucosidase of SEQ ID NO: 1 or from a TrCeBA beta-glucosidase that contains other amino acid substitutions.
- the modified TrCeBA beta- glucosidase may contain amino acid substitution at one or more of positions 66, 73, 96, 235, 248, and 369.
- it may be subsequently further modified to contain additional amino acid substitutions, including but not limited to those set forth above.
- modified TrCeBA beta-glucosidase amino acid sequences "derived from” refers to the isolation of a target nucleic acid sequence element encoding the desired modified TrCeBA beta-glucosidase using genetic material or nucleic acid or amino acid sequence information specific to the parental TrCeBA beta-glucosidase. As is known by one of skill in the art, such material or sequence information can be used to generate a nucleic acid sequence encoding the desired modified TrCeBA beta-glucosidase using one or more molecular biology techniques including, but not limited to, cloning, sub-cloning, amplification by PCR, in vitro synthesis, and the like.
- the amino acid sequence of the modified TrCeBA beta-glucosidase is from about 80% to about 99.9% identical to SEQ ID NO: 1.
- the amino acid sequence of the modified TrCel3A beta-glucosidase may be from about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.9% identical to SEQ ID NO: 1.
- the number of amino acid substitutions in the modified TrCeBA beta-glucosidase may not exceed 20% of the total number amino acids in the parental TrCeBA beta-glucosidase sequence.
- the amino acid sequence of modified TrCeBA beta-glucosidase may be from about 90% to about 99.9% identical to SEQ ID NO: 1.
- the amino acid sequence of the modified TrCeBA beta-glucosidase may be from about 95% to about 100% identical to SEQ ID NO: 1.
- the amino acid sequence of the modified TrCeBA beta- glucosidase may be from about 80% to about 99.9% identical to SEQ ID NO: 1 and the modified TrCeBA beta-glucosidase may exhibit (a) at least about a 20% increase in K G , (b) at least about a 20% decrease in KQ 2 , or (c) at least about a 10% increase in k cat for cellobiose relative to the KQ, KQ 2 and/or k cat of a parental TrCeBA beta-glucosidase from which it is derived.
- the modified TrCeBA beta-glucosidase may exhibit (a) from about a 20% to about a 800% increase in KQ, or any increase therebetween, (b) from about a 20% to about an 80% decrease in K G2 , any decrease therebetween, or (c) from about a 10% to about a 50% increase in kcat for cellobiose relative to the KQ, KQ 2 and/or k cat of a parental TrCeBA beta-glucosidase from which is derived
- parental TrCeBA beta-glucosidase or “parental TrCeBA”
- TrCeBA beta-glucosidase that does not contain a substitution of its original amino acid(s) at positions 43, 101, 260 or 543.
- the parental TrCeBA beta-glucosidase may comprise amino acid substitutions at one or more of positions 66, 72, 96, 235, 248, and 369.
- regions of low sequence conservation to other Family 3 beta-glucosidases and choose such regions for introduction of amino acid substitutions that are not likely to compromise significantly the function of the enzyme.
- Non-limiting examples of such regions include, for example, the regions between positions 1-20, 303-323 and 403-414 and select amino acid positions within these regions.
- modified TrCeBA beta-glucosidases have been prepared that exhibit (a) at least a 20% increase in K G , (b) at least a 20% decrease in K G2 , or (c) at least a 10% increase in k ca ,for cellobiose relative to the K 0 , K 02 and/or k cat of a parental TrCeBA beta-glucosidase from which is derived.
- Table 1 A list of several modified TrCeBA beta- glucosidases, which is not to be considered limiting in any manner, is presented in Table 1.
- TrCel3A beta-glucosidases Improved Kinetic Parameters
- the modified TrCeBA beta-glucosidases of the present invention exhibit improvements in at least one of the following kinetic parameters: K 0 , KQ 2 and k cat .
- K 0 is defined as the concentration of glucose which reduces the enzymatic activity of the beta- glucosidase by 50%.
- K G2 is defined as the concentration of cellobiose at which the beta- glucosidase exhibits half its maximal rate.
- the k cat is the catalytic rate constant for the hydrolysis of cellobiose.
- Example 8 details an assay for measuring the K 0 and KQ 2 of parental and modified TrCeBA beta-glucosidases.
- Example 9 details an assay for measuring the k ca! of parental and modified TrCeBA beta-glucosidases.
- KG of the parental and modified TrCeBA beta-glucosidases can be determined by measuring the rate of hydrolysis of a chromogenic substrate, such as p-nitrophenyl-beta-D- glucopyranoside (pNPG), in the presence of various concentrations of glucose as described in Example 8.
- a chromogenic substrate such as p-nitrophenyl-beta-D- glucopyranoside (pNPG)
- the K 0 is the concentration of glucose that reduces the rate of p-nitrophenol (pNP) release from pNPG by 50% compared to the rate of pNPG hydrolysis in the absence of glucose.
- the KQ 2 constants for parental and modified TrCeBA beta-glucosidases can be determined by measuring the rate of hydrolysis of cellobiose in reactions containing increasing concentrations of cellobiose or, alternatively, by measuring the rate of hydrolysis of a chromogenic substrate, such as pNPG, in the presence of various concentrations of a cellobiose as described in Example 8.
- the K 02 is the concentration of cellobiose that reduces the rate of pNP release from pNPG by 50% compared to the rate of pNPG hydrolysis in the absence of cellobiose.
- the k cat values for parental and modified TrCeBA beta-glucosidases can be determined by measuring the rate of cellobiose hydrolysis at varying concentrations of a cellobiose substrate, for example, as described in Example 9.
- the present invention also relates to genetic constructs comprising a nucleic acid sequence encoding the modified TrCeBA beta-glucosidase operably linked to regulatory nucleic acid sequences directing the expression and secretion of the modified TrCeBA beta-glucosidase from a host microbe.
- regulatory nucleic acid sequences it is meant nucleic acid sequences directing the transcription and translation of the modified TrCel3A-encoding nucleic acid sequence and a nucleic acid sequence encoding a secretion signal peptide capable of directing the secretion of the modified TrCel3A beta-glucosidase from a host microbe.
- the regulatory nucleic acid sequences may be derived from genes that are highly expressed and secreted in the host microbe under industrial fermentation conditions.
- the regulatory nucleic acid sequences may be derived from any one or more of the Trichoderma reesei cellulase or hemicellulase genes.
- the genetic construct may further comprise a selectable marker gene to enable isolation of a genetically modified microbe transformed with the construct as is commonly known to those of skill in the art.
- the selectable marker gene may confer resistance to an antibiotic or the ability to grow on medium lacking a specific nutrient to the host organism that otherwise could not grow under these conditions.
- the present invention is not limited by the choice of selectable marker gene, and one of skill in the art may readily determine an appropriate gene.
- the selectable marker gene may confer resistance to hygromycin, phleomycin, kanamycin, geneticin, or G418, or may complement a deficiency of the host microbe in one of the trp, arg, leu, pyr4, pyr, ura3, ura5, his, or ade genes or may confer the ability to grow on acetamide as a sole nitrogen source.
- the genetic construct may further comprise other nucleic acid sequences as is commonly known to those of skill in the art, for example, transcriptional terminators, nucleic acid sequences encoding peptide tags, synthetic sequences to link the various other nucleic acid sequences together, origins of replication, and the like.
- the practice of the present invention is not limited by the presence of any one or more of these other nucleic acid sequences.
- the modified TrCeBA beta-glucosidase may be expressed and secreted from a genetically modified microbe produced by transformation of a host microbe with a genetic construct encoding the modified TrCel3 A beta-glucosidase.
- the host microbe may be a yeast or a filamentous fungus, particularly those classified as Ascomycota.
- Genera of yeasts useful as host microbes for the expression of modified TrCeBA beta-glucosidases of the present invention include Saccharomyces, Pichia, Hansenula, Kluyveromyces, Yarrowia, and Arxula.
- Genera of fungi useful as microbes for the expression of modified TrCeBA beta-glucosidases of the present invention include Trichoderma, Hypocrea, Aspergillus, Fusarium, Humicola, Neurospora, Chrysosporium, Myceliophthora, Thielavia, Sporotrichum and Penicillium.
- the host microbe may be an industrial strain of Trichoderma reesei.
- the host microbe is one which does not express a parental TrCeBA beta-glucosidase.
- the genetic construct may be introduced into the host microbe by any number of methods known by one skilled in the art of microbial transformation, including but not limited to, treatment of cells with CaCl 2 , electroporation, biolistic bombardment, PEG-mediated fusion of protoplasts (e.g. White et al., WO 2005/093072, which is incorporated herein by reference).
- the selected recombinant strains may be cultured in submerged liquid fermentations under conditions that induce the expression of the modified TrCeBA. Production of Modified TrCeB A Beta-glucosidases
- the modified TrCeB A beta-glucosidase of the present invention may be produced in a fermentation process in which a genetically modified microbe comprising a genetic construct encoding the modified TrCel3 A beta-glucosidase is grown in submerged liquid culture fermentation.
- Submerged liquid fermentations of microorganisms are typically conducted as a batch, fed-batch or continuous process.
- all the necessary materials with the exception of oxygen for aerobic processes, are placed in a reactor at the start of the operation and the fermentation is allowed to proceed until completion, at which point the product is harvested.
- a batch process for producing the modified TrCeBA beta-glucosidase of the present invention may be carried out in a shake-flask or a bioreactor.
- the culture is fed continuously or sequentially with one or more media components without the removal of the culture fluid.
- fresh medium is supplied and culture fluid is removed continuously at volumetrically equal rates to maintain the culture at a steady growth rate.
- fermentation medium comprises a carbon source, a nitrogen source as well as other nutrients, vitamins and minerals which can be added to the fermentation media to improve growth and enzyme production of the host cell. These other media components may be added prior to, simultaneously with or after inoculation of the culture with the host cell.
- the carbon source may comprise a carbohydrate that will induce the expression of the modified TrCeBA beta-glucosidase from a genetic construct in the genetically modified microbe.
- the genetically modified microbe is a strain of a cellulolytic fungus such as Trichoderma
- the carbon source may comprise one or more of cellulose, cellobiose, sophorose, xylan, xylose, xylobiose and related oligo- or poly-saccharides known to induce expression of cellulases and beta-glucosidase in such cellulolytic fungi.
- the carbon source may be added to the fermentation medium prior to or simultaneously with inoculation, hi the cases of fed-batch or continuous operations, the carbon source may also be supplied continuously or intermittently during the fermentation process.
- the carbon feed rate is between 0.2 and 2.5 g carbon/L of culture/h, or any amount therebetween.
- the process for producing the modified TrCel3A beta-glucosidase of the present invention may be carried at a temperature from about 20°C to about 40°C, or any temperature therebetween, for example from about 25°C to about 37°C, or any temperature therebetween, or from 20, 22, 25, 26, 27, 28, 29, 30, 32, 35, 37, 40°C or any temperature therebetween.
- the process for producing the modified TrCeBA beta-glucosidase of the present invention may be carried out at a pH from about 3.0 to 6.5, or any pH therebetween, for example from about pH 3.5 to pH 5.5, or any pH therebetween, for example from about pH 3.0, 3.2, 3.4, 3.5, 3.7, 3.8, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.2, 5.4, 5.5, 5.7, 5.8, 6.0, 6.2, 6.5 or any pH therebetween.
- the fermentation broth containing the modified TrCel3 A beta-glucosidase may be used directly, or the modified TrCeBA beta-glucosidase may be separated from the fungal cells, for example by filtration or centrifugation. Low molecular solutes such as unconsumed components of the fermentation medium may be removed by ultrafiltration.
- the modified TrCeBA beta-glucosidase may be concentrated, for example, by evaporation, precipitation, sedimentation or filtration. Chemicals such as glycerol, sucrose, sorbitol and the like may be added to stabilize the modified TrCeBA beta-glucosidase. Other chemicals, such as sodium benzoate or potassium sorbate, may be added to the modified TrCeBA beta-glucosidase to prevent growth of microbial contamination.
- the modified TrCeBA beta-glucosidase of the present invention may be used in the hydrolysis of cellulose or in the production of compounds such as those used in the medical and food industries [0073]
- the modified TrCeBA beta- glucosidase of the invention may be combined with one or more cellulases to produce a cellulase mixture.
- the modified TrCeBA beta-glucosidase is one of many proteins expressed from a host cell, including, but not limited to, cellulase enzymes.
- the one or more cellulases in the cellulase enzyme mixture and the modified TrCeBA beta- glucosidase may be secreted from a single genetically modified microbe or by different microbes in combined or separate fermentations.
- the one or more cellulases in the cellulase enzymes mixture with which the modified TrCeBA beta-glucosidase may be combined may be expressed individually or in sub-groups from different strains of different organisms and the enzymes combined to make the cellulase enzyme mixture.
- the enzyme mixture may be expressed individually or in sub-groups from different strains of a single organism, such as from different strains of Saccharomyces, Pichia, Hansenula Trichoderma, Hyprocrea, Aspergillus, Fusarium, Humicola, Chrysosporium, Myceliophthora, Thielavia, Sporotrichum or Neurospora, and the enzymes combined to make the cellulase enzyme mixture.
- all of the enzymes are expressed from a single host organism, such as a strain of cellulolytic fungus belonging to a species of Trichoderma, Hyprocrea, Aspergillus, Fusarium, Humicola, Chrysosporium, Myceliophthora, Thielavia, Sporotrichum or Neurospora.
- a single host organism such as a strain of cellulolytic fungus belonging to a species of Trichoderma, Hyprocrea, Aspergillus, Fusarium, Humicola, Chrysosporium, Myceliophthora, Thielavia, Sporotrichum or Neurospora.
- the cellulase mixture may comprise two or more of such modified beta-glucosidases as described here in, each with a unique set of improved kinetic parameters. Such a cellulase mixture would be expected to maintain a constant beta-glucosidase activity across a broad range of conditions.
- a cellulase mixture may comprise one modified TrCeBA beta-glucosidase with low substrate affinity and low product inhibition (i.e., higher values OfK 02 and K 0 than the parental beta-glucosidase) and one modified TrCeBA beta- glucosidase with high substrate affinity and high product inhibition (i.e., lower values of K G2 and KQ than the parental beta-glucosidase).
- modified TrCeBA beta-glucosidase with low substrate affinity and low product inhibition i.e., higher values OfK 02 and K 0 than the parental beta-glucosidase
- TrCeBA beta- glucosidase with high substrate affinity and high product inhibition i.e., lower values of K G2 and KQ than the parental beta-glucosidase.
- Such a cellulase mixture would exhibit a near level apparent beta-glucosidase activity across a wide range of cellobiose and glucose concentrations.
- a pretreated lignocellulosic feedstock is a material of plant origin that, prior to pretreatment, contains at least 20% cellulose (dry weight), more preferably greater than about 30% cellulose, even more preferably greater than 40% cellulose, for example 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 55, 60, 65, 70, 75, 80, 85, 90% or any percent therebetween, and at least 10% lignin (dry wt), more typically at least 12% (dry wt) and that has been subjected to physical and/or chemical processes to make the fiber more accessible and/or receptive to the actions of cellulolytic enzymes.
- the lignocellulosic feedstock may contain higher levels of cellulose.
- the hemicellulose component is hydrolyzed, which increases the relative level of cellulose.
- the pretreated feedstock may contain greater than about 20% cellulose and greater than about 12% lignin.
- Lignocellulosic feedstocks that may be used in the invention include, but are not limited to, agricultural residues such as corn stover, wheat straw, barley straw, rice straw, oat straw, canola straw, sugarcane straw and soybean stover; fiber process residues such as corn fiber, sugar beet pulp, pulp mill fines and rejects or sugar cane bagasse; forestry residues such as aspen wood, other hardwoods, softwood, and sawdust; or grasses such as switch grass, miscanthus, cord grass, and reed canary grass.
- agricultural residues such as corn stover, wheat straw, barley straw, rice straw, oat straw, canola straw, sugarcane straw and soybean stover
- fiber process residues such as corn fiber, sugar beet pulp, pulp mill fines and rejects or sugar cane bagasse
- forestry residues such as aspen wood, other hardwoods, softwood, and sawdust
- grasses such as switch grass, miscanthus, cord grass, and ree
- the lignocellulosic feedstock may be first subjected to size reduction by methods including, but not limited to, milling, grinding, agitation, shredding, compression/expansion, or other types of mechanical action. Size reduction by mechanical action can be performed by any type of equipment adapted for the purpose, for example, but not limited to, a hammer mill.
- the enzymatic hydrolysis of cellulose using a cellulase enzyme mixture, as defined above, comprising the modified TrCel3 A beta-glucosidase may be batch hydrolysis, continuous hydrolysis, or a combination thereof.
- the hydrolysis may be agitated, unmixed, or a combination thereof.
- the enzymatic hydrolysis may be carried out at a temperature of about 30 0 C to about 80 0 C, or any temperature therebetween, for example a temperature of 30, 35, 40, 45, 50, 55, 60, 65, 70, 75°C, 80 0 C or any temperature therebetween, and a pH of about 3.0 to about 8.0, or any pH therebetween, for example at a pH of 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0 or pH therebetween.
- the initial concentration of cellulose in the hydrolysis reactor, prior to the start of hydrolysis is preferably about 2% (w/w) to about 15% (w/w), or any amount therebetween, for example 2, 4, 6, 8, 10, 12, 14, 15% or any amount therebetween.
- the dosage of the cellulase enzyme mixture comprising the modified TrCeBA beta- glucosidase may be about 0.1 to about 100 mg protein per gram cellulose, or any amount therebetween, for example 0.1, 0.5, 1, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 mg protein per gram cellulose or any amount therebetween.
- the hydrolysis may be carried out for a time period of about 1 hours to about 200 hours, or any time therebetween; for example, the hydrolysis may be carried out for a period of 15 hours to 100 hours, or any time therebetween, or it may be carried out for 1, 2, 4, 8, 12, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 120, 140, 160, 180, 200 or any time therebetween. It should be appreciated that the reaction conditions are not meant to limit the invention in any manner and may be adjusted as desired by those of skill in the art.
- the enzymatic hydrolysis is typically carried out in a hydrolysis reactor.
- the enzyme mixture is added to the pretreated lignocellulosic feedstock (also referred to as the "substrate") prior to, during, or after the addition of the substrate to the hydrolysis reactor.
- Beta-glucosidases are just one or several classes of hydrolytic enzymes belong to glycoside hydrolase Family 3.
- Family 3 includes other enzymes that catalyse the hydrolysis of beta-glycosidic bonds such as xylan 1 ,4-beta-xylosidase (EC 3.2.1.37), beta -N- acetylhexosaminidase (EC 3.2.1.52), glucan 1,3- beta -glucosidase (EC 3.2.1.58), and glucan 1 ,4- beta -glucosidase (EC 3.2.1.74).
- a "Family 3 beta-glycosidase” is any xylan 1,4-beta-xylosidase (EC 3.2.1.37), beta-N-acetylhexosaminidase (EC 3.2.1.52), glucan 1,3- beta -glucosidase (EC 3.2.1.58), and glucan 1,4- beta -glucosidase (EC 3.2.1.74) that is classified as a Family 3 glycoside hydrolase under the CAZy system (see URL afmb.cnrs-mrs.fr/CAZY/index.html for reference).
- modified Family 3 beta-glycosidase it is meant a Family 3 beta-glycosidase which comprises one or more of the amino acid substitutions, introduced by genetic engineering techniques, selected from the group consisting of V43I, V43C, VlOlA, VlOlG, F260I, F260V, F260Q, F260D, I543N, I543A, I543S, I543G and I543L (TrCeBA numbering) and which amino acid sequence is at least 80% identical to the amino acid sequence of the parental Family 3 beta- glycosidase from which it is derived
- the amino acid sequence of the modified Family 3 beta-glycosidase may be from about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.9% identical to the amino acid sequence of the modified Family 3 beta-glyco
- Sequence identity can be readily determined by alignment of the amino acids of the two sequences, either using manual alignment, or any sequence alignment algorithm as known to one of skill in the art, for example but not limited to, BLAST algorithm (BLAST and BLAST 2.0; Altschul et al., 1997 and 1990), the algorithm disclosed by Smith & Waterman (1981), by the homology alignment algorithm of Needleman & Wunsch (1970), by the search for similarity method of Pearson & Lipman (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection.
- BLAST algorithm BLAST and BLAST 2.0; Altschul et al., 1997 and 1990
- Altschul et al., 1997 and 1990 the algorithm disclosed by Smith & Waterman (1981), by the homology alignment algorithm of Needleman & Wunsch (1970), by the search for similarity method of Pearson & Lipman (1988
- the modified Family 3 beta-glycosidase may be derived from wild-type Family 3 beta-glycosidase or from a Family 3 beta-glycosidase that contains other amino acid substitutions.
- the modified Family 3 beta- glycosidase comprising mutations selected from the group consisting of V43I, V43C, VlOlA, VlOlG, F260I, F260V, F260Q, F260D, I543N, I543A, I543S, I543G and I543L, it may be subsequently further modified to contain additional amino acid substitutions, including but not limited to those set forth above.
- TrCel3A numbering it is meant the numbering corresponding to the position of amino acids based on the amino acid sequence of TrCeOA (SEQ ID NO:1) based on alignment of the amino acid sequence of the Family 3 beta-glycosidase with the TrCel3A amino acid sequence.
- SEQ ID NO:1 amino acid sequence of TrCeOA
- An example of the alignment of 44 other Family 3 beta-glycosidase amino acid sequences with the TrCeBA beta-glucosidase amino acid sequence is provided in Figure 11.
- modified Family 3 beta-glycosidase amino acid sequences "derived from” refers to the isolation of a target nucleic acid sequence element encoding the desired modified Family 3 beta-glycosidase using genetic material or nucleic acid or amino acid sequence information specific to the corresponding parental Family 3 beta- glycosidase. As is known by one of skill in the art, such material or sequence information can be used to generate a nucleic acid sequence encoding the desired modified Family 3 beta- glycosidase using one or more molecular biology techniques including, but not limited to, cloning, sub-cloning, amplification by PCR, in vitro synthesis, and the like.
- the amino acid sequence of the modified Family 3 beta-glycosidase is from about 80% to about 99.9% identical to the amino acid sequence of the parental Family 3 beta-glycosidase from which it is derived.
- the amino acid sequence of the Family 3 beta-glycosidase may be from about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.9% identical to the amino acid sequence of the parental Family 3 beta-glycosidase from which it is derived, hi other words, the number of amino acid substitutions in the modified Family 3 beta-glycosidase does not exceed 20% of the total number amino acids in the parental Family 3 beta-glycosidase sequence.
- the modified Family 3 beta-glycosidase of the present invention exhibit improvements in at least on of the following kinetic parameters: K P , Ks and k cat .
- K P is defined as the concentration of product which reduces the enzymatic activity of the Family 3 beta- glycosidase by 50%.
- Ks is defined as the concentration of substrate at which the Family 3 beta- glycosidase exhibits half its maximal rate.
- the k cat is the catalytic rate constant for the hydrolysis of substrate.
- the amino acid sequence of the modified Family 3 beta-glycosidase is from about 90% to about 99.9% identical to the amino acid sequence of the parental Family 3 beta-glycosidase from which it is derived.
- the amino acid sequence of the modified Family 3 beta-glycosidase may be from about 95% to about 100% identical to SEQ ID NO: 1.
- the amino acid sequence of the modified Family 3 beta- glycosidase may be from about 80% to about 99.9% identical to the amino acid sequence of the parental Family 3 beta-glycosidase from which it is derived, and the modified Family 3 beta- glycosidase may exhibit (a) an increase in the K P , (b) a decrease in Ks, or (c) an increase in k cat relative to the K P , Ks and/or k cat of a parental Family 3 beta-glycosidase from which is derived .
- parental Family 3 beta-glycosidase it is meant a Family 3 beta-glycosidase that does not contain:
- the modified Family 3 beta-glycosidase may be derived from a parental Family 3 beta-glycosidase that comprises one or more naturally-occurring amino acid(s) at the substituted positions corresponding to that of the modified Family 3 beta-glycosidase, but that is otherwise identical to the modified Family 3 beta-glycosidase, for example a native Family 3 beta- glycosidase from A nidulans -AN 1804.2, B. fuckeliana, T. aurantiacus levisporus.
- the parental Family 3 beta-glycosidase may contain one or more amino acid substitutions at other positions, given that these substitutions are also present in the corresponding modified Family 3 beta- glycosidase.
- Family 3 beta-glycosidases suitable as parental beta-glycosidases from which modified Family 3 beta-glycosidases may be derived are provided in Table 3.
- Aspergillus niger Bl b-glucosidase / tannase CAB75696.1 (Bgll;BG3;BGs;SP188)
- Botryotinia fuckeliana b-glucosidase (Sapl) CAB61489 1 Coccidioides posadasii C735 b-glucosidase/ exo-b-1,3- AAF21242.1 glucosidase (Bgl2)
- Example 1 describes the strains and vectors used in the following examples.
- Example 2 describes the cloning of the TrCeBA gene and transformation in yeast.
- Example 3 summarizes the preparation of the error prone-PCR and site-saturation mutagenesis libraries of TrCel3A.
- Example 4 describes the selection and expression of wild-type and modified TrCeDA beta-glucosidases from microculture.
- Example 5 describes the high-throughput screening assays to identify modified TrCel3 A beta-glucosidases with improved kinetic parameters.
- Example 6 describes the construction of modified TrCeBA beta-glucosidases comprising multiple amino acid substitutions.
- Example 7 describes the expression and purification of wild-type and modified TrCeBA beta-glucosidases from large scale flask cultures.
- Example 8 describes the measurement of the K G and K 02 of modified and native TrCeBA beta-glucosidases and the calculation of kinetic parameters.
- Example 9 describes the measurement and calculation of k cat for wild-type and modified TrCeBA beta-glucosidases.
- Example 10 describes the construction of genetically modified Trichoderma reesei strains expressing cellulase mixtures comprising modified TrCeBA beta-glucosidases and the production of such cellulase mixtures in submerged liquid culture fermentation.
- Example 11 describes the hydrolysis of pretreated lignocellulosic substrates with cellulase mixtures comprising parental and modified TrCeBA beta-glucosidases.
- Saccharomyces cerevisiae strain BJ3505 (pep4::HIS3 prb- ⁇ l .6R HIS3 lys2-208 trp 1 - ⁇ 101 ura3-52 gal2 canl ) was obtained from Sigma and was a part of the Amino-Terminal Yeast FLAG Expression Kit.
- the YEp352/PGK91-l vector was obtained from the National Institute of Health.
- the pGEM T-easy vector was obtained from Promega.
- the vector pC/XBGl-TV is described in U.S. Patent No. 6,105,703.
- TrCeBA gene contains two introns. One intron is located in the secretion signal at position 323 bp to 391 bp, while the other is located within the gene at position 2152 bp to 2215 bp.
- the TrCeBA gene contains a unique MeI site located at position 1203 bp. In order to facilitate expression from yeast and cloning using MeI and Kpnl restriction enzymes, the unique MeI located within TrCeBA at position 1203 bp and the second intron were removed by a three step PCR.
- the TrCeBA gene was amplified in three segments from a plasmid containing a genomic subclone of the coding region, including introns, of the mature TrCeBA beta-glucosidase, pC/XBGl-TV using iPROOF DNA polymerase (BioRad).
- the first fragment (A) was amplified using primers which introduced an MeI site at the 5' end of the gene downstream of the secretion signal (AT048) and which removed the internal MeI site (AT051).
- the second fragment (B) was amplified using primers which removed the internal MeI site (AT050) and the intron at position 2152 to 2215 bp (AT053).
- the third fragment (C) was amplified using primers which removed the intron at position 2152 to 2215 bp (AT052) and introduced a. Kpnl site at the 3' end of the gene, downstream of the stop codon (AT049).
- Gene products B and C were joined together (to make gene product D) using PCR with primers AT050 and AT049.
- Gene product D was joined with gene product A using PCR with primers AT048 and AT049 to obtain TrCeBA without introns and with unique MeI and Kpnl sites at the 5' and 3 ' ends, respectively.
- the final gene product was cloned into the pGEM T-easy vector (Promega) as per the manufacturer's instructions to make plasmid pGEM-TrCeBA. Primer sequences are shown below:
- AT051 5' CCAACG ACG GCA ATACTA GCG GGC TTC (SEQ IDNO: 27)
- AT053 5' GTT GAACTT GGT GTA AGA CAG TCC ATA GCC GAACTC (SEQ IDNO: 29)
- YEp352/PGK91-l/ ⁇ ss TrCel3A was conducted as follows.
- a DNA adapter containing MeI, Kpnl, and EcoRl restriction sites was prepared by annealing primers AT046 and AT047 together.
- the adapter was inserted into a YEp based-plasmid containing the pgkl promoter, alpha mating factor secretion signal, andpgkl terminator sequences to make plasmid YEp352/PGK91-l/ ⁇ ss NKE.
- the adapter was inserted as an NheVEcoRl fragment into the MeI and EcoRl sites located downstream of the alpha mating factor secretion signal and upstream of thepgkl terminator. Primer sequences are shown below:
- Plasmid pGEM-TrCeBA was digested with MeI and EcoRl to release the 2235 bp TrCeBA gene. The fragment was purified and ligated into the MeI and EcoRl sites of YEp352/PGK91-l/ ⁇ ss NKE to obtain YEp352/PGK91-l/ ⁇ ss TrCel3A. The resulting vector YEp352/PGK91-l/ ⁇ ss -TrCel3A was transformed in yeast strain BJ3505 using the procedure described by Gietz, R. D. and Woods, R. A. (2002).
- YEp352/PGK91-l/ ⁇ ss 6H-TrCel3A was conducted as follows.
- a DNA adapter containing Spel, Nhel, Kpnl, and EcoRl restriction sites was prepared by annealing primers AT044 and AT045 together.
- the adapter contains sequences coding for six histidine residues downstream of the Spel site and upstream of the MeI site.
- the adapter was inserted into a YEp based-plasmid containing thepgkl promoter, alpha mating factor secretion signal, andpgkl terminator sequences to make plasmid YEp352/PGK91-l/ ⁇ ss 6HNKE.
- the adapter was inserted as an NheVEcoRl fragment into the MeI and EcoRl sites located downstream of the alpha mating factor secretion signal and upstream of thepgkl terminator. Primer sequences are shown below:
- Plasmid pGEM-TrCel3A was digested with MeI and EcoRl to release the 2235 bp TrCel3 A gene. The fragment was purified and ligated into the MeI and EcoRl sites of YEp352/PGK91-l/ ⁇ ss 6HNKE to obtain YEp352/PGK91-l/ ⁇ ss 6H-TrCel3A. The resulting vector YEp352/PGK91-l/ ⁇ ss 6H-TrCel3A ( Figure 1) was transformed in yeast strain BJ35O5 using the procedure described by Gietz, R. D. and Woods, R. A. (2002). Example 3: Random Mutagenesis of TrCeBA a. Error Prone-PCR
- a random mutagenesis library was generated by error-prone PCR using a Mutazyme® II DNA polymerase method.
- a series of four independent PCRs was performed using 5, 10, 15, 20 ⁇ g of YEp352/PGK91-l/ ⁇ ss 6H-TrCel3A vector and the Mutazyme® II DNA polymerase with primers Y ⁇ N21 and 3'PGK-term.
- Annealing temperature was set to 5O 0 C.
- the amplification was done for 20 cycles.
- the four PCR products were pooled and diluted to 16 ⁇ g/ ⁇ L.
- the YEp352/PGK91 - l/ ⁇ ss 6H-TrCel3A vector was digested with Nhel and Kpnl and the empty vector fragment was isolated. This linear fragment and the final amplicon were transformed simultaneously and cloned by in vivo recombination into yeast strain BJ3505 (Butler, T. and Alcalde, M. ,2003).
- 3'PGK-term 5'GCAACA CCT GGC AAT TCC TTA CC (SEQ IDNO: 35)
- TrCeBA libraries were created using site-saturation mutagenesis (SSM) with degenerate primers (NNS) targeting amino acid positions V43, VlOl, F260, and 1543.
- SSM site-saturation mutagenesis
- NGS degenerate primers
- PCR reactions were carried out using the High Fidelity iProof Taq Polymerase (BioRad).
- YEp352/PGK91-l/ ⁇ ss 6H-TrCel3A was used as the template for the V43X, F260X, and I543X libraries, while YEp352/PGK91-l/ ⁇ ss 6H-TrCel3A (S72N, F96L, VlOlM, N369K, A386T) served as the template for the VlOlX library.
- MegaPrimer A was amplified using the external primer Y ⁇ N21 with an internal reverse primer, while MegaPrimer B was derived by combining the external primer PGKterm with an internal forward primer.
- the internal forward primers contained a degenerate codon sequence to introduce random amino acid substitutions within their target sites.
- the megaprimers were purified using the Wizard® SV Gel and PCR Clean-Up System. Y ⁇ N21 : 5'AGC ACA AAT AAC GGG TTA TTG (SEQ ID NO: 34)
- V43X-F 5 'TGG AAC GGC GGT CCT TGC NNS GGA AAC ACA TCT CCG GCC TC
- V43X-R 5'GCA AGG ACC GCC GTT CCA(SEQ IDNO: 37)
- MlOlX-F 5'C GGT GAG GAGNNS AAG GCC TCG G (SEQ IDNO: 38)
- F260X-F 5'TG TCA ATG CCTGGC ACAGAC NNS AAC GGTAAC AATCGG (SEQIDNO:
- I543X-F 5'CCC AAT GAC TAT AAC ACTCGC NNS GTT TCC GGC GGC AGT GAC (SEQ IDNO: 42)
- I543X-R 5'GCG AGT GTT ATA GTC ATT GGG (SEQ IDNO: 43)
- both megaprimers for a given SSM library were allowed to anneal and extend for 10 cycles to generate the final template.
- the external primers Y ⁇ N21 and PGKterm were then added for another 25 cycles to amplify the final product, which was subsequently purified using the Wizard® SV Gel and PCR Clean-Up System.
- Both the purified PCR product and the linearized vector YEp352/PGK91-l ⁇ ss -6H-TrCel3A (Nhel + Nrul) were transformed and cloned via in vivo recombination within the BJ3505 yeast strain using the procedure described by Gietz, R. D. and Woods (2002).
- Example 4 Selection and growth of yeast strains expressing parental and modified TrCeBA beta-glucosidases.
- TrCeB A Wt parental and modified TrCel3 A beta-glucosidase from Saccharomyces cerevisiae for use in high-throughput screening assays.
- S. cerevisiae transformants were grown on plates containing synthetic complete medium (SC: 2% agar w/v, 0.17% yeast nitrogen base w/v, 0.192% -Ura drop-out supplement w/v, 2% glucose w/v, 2% casamino acids w/v, 0.5% ammonium sulfate w/v, pH 5.5) for 3-4 days at 30 0 C.
- SC synthetic complete medium
- Colonies which turned black after incubation for 3-4 days at 30°C were identified as expressing active beta-glucosidase (Figure 2). Colonies were correlated back to their original growth plate and selected for liquid media expression cultures by toothpick inoculation of 1 mL SC media in sterile 96-deepwell plates containing one glass bead (1.5 - 2.0 mm diameter). Expression cultures were grown for 3 days at 3O 0 C and 245 rpm with humidity control (New Brunswick Scientific Innova g 44 incubator shaker series). Glycerol stocks were prepared by transferring 50 ⁇ L of liquid culture to the corresponding wells of a microplate containing 50 ⁇ L of 40% glycerol and stored at -8O 0 C. Expression culture plates were centrifuged at 1600 X g for 5 minutes to pellet cells and supernatant was aspirated for screening assays (Example 5).
- This example describes the screening of modified TrCel3A beta-glucosidases for increased higher catalytic efficiency by comparison to parental TrCel3 A that had been cloned into Saccharomyces cerevisiae.
- TrCeBA beta-glucosidases expressed from yeast as described in Example 4 were tested in two 80 ⁇ L citrate buffered (pH 5) cellobiose hydrolysis assays using a 96-well PCR plate format.
- a 40 ⁇ L aliquot of supernatant containing a parental or modified TrCeBA beta-glucosidase was incubated with 30 mM cellobiose (Assay 1) and 5.0 mM cellobiose plus 1.25 mM glucose (Assay 2) for 5, 10, 20 and 40 min at 50 0 C in an MJ Research TetradTM2 Peltier Thermal Cycler. Contained in each 96-well PCR plate were six parental TrCeBA controls used for comparison.
- Enzyme activity was measured through the detection of glucose using a glucose oxidase- peroxidase coupled assay (Trinder P., 1969). Exogenous glucose (1.25 mM) included in Assay 2 was subtracted from the total amount of glucose measured following the incubation. An Assay 2/ Assay 1 enzyme activity ratio was calculated for the parental (TrCeBA Wt or Wt) and all modified TrCeBA beta-glucosidases by dividing the enzyme activity in Assay 2 by the enzyme activity in Assay 1.
- the Assay 2/ Assay 1 activity ratio for each modified TrCeBA beta- glucosidase was then compared to that of the average of six parental TrCeBA beta-glucosidase controls on a particular microplate and positives were selected at the 95% confidence level using a t-test. . All positive modified TrCeBA beta-glucosidases were produced again in microculture and re-screened to reduce the number of false positives (Figure 3).
- Table 4 lists the positive modified TrCeBA beta-glucosidases obtained from screening the error-prone and site-saturation libraries (Example 3) and the Assay 2/Assay 1 enzyme activity ratios compared to the parental, wild-type TrCeBA beta-glucosidase.
- the final product was digested with Nhel + Kpnl and ligated into vector YEp352/PGK91-l/ ⁇ ss 6H-TrCel3A linearized with Nhel + Kpnl.
- the ligation mix was transformed into DH5a chemically-competent E. coli cells, plasmid extracted, and sequenced. Plasmids encoding the modified beta-glucosidases were transformed into yeast strain BJ3505.
- Modified TrCeDA beta-glucosidases that passed the selection criteria in Example 5, along with the modified TrCel3A-F260X beta-glucosidases produced by site-saturation mutagenesis at position 260 (Example 4) or by combining two or more amino acid substitutions (Example 6), were purified for further analysis.
- 50 mL of sterile YPD medium (10 g/L yeast extract, 20 g/L peptone and 20 g/L glucose
- TrCeBA in each spent culture medium was then purified by immobilized metal affinity chromatography (IMAC) using His-Trap NTA/Ni 2+ columns from GE Healthcare (catalogue #17-5247-01). Purified proteins were concentrated and buffer exchanged using Vivaspin 20 centrifugal concentrators (Sartorius Stedim Biotech, catalogue No. VS2012). Protein concentrations were measured using the method of Bradford (1976) and stored at -20 0 C. Samples of each purified Modified TrCeBA were separated by SDS-PAGE and visualized by Coomassie Blue stain ( Figure 4).
- Example 8 Measuring the Kc and K G2 constants of Parental and Modified TrCeBA Beta- glucosidases
- each modified TrCeBA beta-glucosidase was determined using a/j-nitrophenyl-beta-D-glucopyranoside (pNPG) competitive substrate/inhibitor real-time kinetic assay.
- pNPG a/j-nitrophenyl-beta-D-glucopyranoside
- Assays were buffered using 50 mM citrate, pH 5.0. Incubations were done at 5O 0 C for up to 40 min in a Varian Cary UV/Vis spectrophotometer. Absorbance measurements collected at 340 nm during the time course were converted top-nitrophenol (pNP) concentration using Equation 1.
- pNP is the concentration of p-mtrophenol (mM)
- ⁇ pNPG is the the extinction coefficient at 340 nm of pNPG at pH 5 0 (3.33 L mol ' cm ' ⁇ 0 04)
- pNPG is the initial concentration of pNPG (mM)
- ⁇ pNP is the extinction coefficient at 340 nm of pNP at pH 5 0 (5 96 L mol ' cra ' ⁇ 0.02)
- dpNP/dt is the rate of conversion of pNPG to pNP (mM/min)
- k pNPG is the catalytic rate constant for the conversion of pNPG to pNP ( ⁇ mol/min/mg protein)
- E is the concentration of TrCel3A (mg/mL)
- pNPG is the concentration of p-nitrophenyl-beta-D-glucopyranoside (mM)
- K pNPG is the Michaelis constant (or K m ) for pNPG (mM)
- G2 is the concentration of cellobiose (mM)
- K G2 is the Michaelis constant (or K m )for cellobiose (mM)
- G is the concentration of glucose (mM)
- K G is the glucose inhibition constant (mM).
- TrCeBA beta-glucosidases with a lower K G2 value are more affected by the addition of cellobiose, compared to TrCel3A Wt , and will have relatively lower rates of pNPG hydrolysis under these conditions.
- TrCeB A-V43C 4.20 mM
- TrCeB A-F260I (0.92 mM
- TrCeBA-F260D (0.70 mM
- TrCel3A-F260Q (0.69 mM
- TrCeBA-F260V (0.72 mM)
- TrCeB A-I543N (0.94 mM)
- TrCeB A- V43I (0.62 mM)
- TrCeBA-VlOlA (0.82 mM)
- K G2 of wild-type TrCeBA 1.18 mM
- most of the modified TrCeBAs with different combinations of more than one amino acid substitution had lower KQ 2 than wild-type.
- These modified TrCeBA beta- glucosidases exhibit maximum activity at lower concentrations of cellobiose, indicating that they have a higher affinity for cellobiose.
- TrCeBA In a cellulose hydrolysis system, such as the conversion of cellulose to fermentable sugars utilizing cellulase such as that from Trichoderma reesei or other cellulolytic fungi, the use of a TrCeBA with a lower K 02 would contribute to lowering steady- state concentrations of cellobiose and lower product inhibition of cellulase enzymes.
- dG2/dt is the rate of conversion of cellobiose (G2) to two glucose molecules (2G) (mM G2 consumed/min)
- k cat is the catalytic rate constant for the conversion of cellobiose to glucose ( ⁇ mol of G2 consumed/min/mg protein)
- TrCeBA concentration of TrCeBA (mg/mL)
- G2 is the concentration of cellobiose (mM)
- K 02 is the Michaelis constant (or Km) for cellobiose (mM)
- K Si is the cellobiose substrate inhibition constant (mM)
- the k cat is the TrCeBA rate constant on cellobiose and K 8 ; is the parameter that describes the substrate inhibition.
- the data for the parental and each modified TrCeBA beta- glucosidase were fit to this model by non-linear regression using the method of least squares as known to those of skill in the art.
- the parental and each modified TrCeBA beta-glucosidase were assayed in triplicate on three different occasions.
- the mean values of k cat , K 8 ; and their standard deviations are shown in Table 6.
- TrCeB A-F260I 11.06 ⁇ mol/min/mg
- TrCel3A-I543S 9.76 ⁇ mol/min/mg
- TrCel3A-I543L 11.50 ⁇ mol/min/mg
- TrCeBA In a cellulose hydrolysis system, such as the conversion of cellulose to fermentable sugars utilizing cellulase such as that from Trichoderma reesei, the use of a TrCeBA with a higher k ca , would contribute to lowering steady- state concentrations of cellobiose and lower product inhibition of cellulase enzymes.
- K 02 , K G /K G2 , k cat and Ks parameters for parental (TrCeBA-Wt) and modified beta-glucosidases were determined as described in Examples 8 and 9. Significant improvements (P value ⁇ 0.05) in any of these parameters are shown in bold text.
- Strain P59G is a genetically modified strain that produces and secretes high levels of the beta-glucosidase encoded by T. reesei bgll as described in U.S. Patent No. 6,015,703.
- the parent strain of P59G and modified Cel3A over-expressing transformant 4115 A, is strain BTR213aux.
- the strain BTR213 is a derivative of RutC30 (ATCC #56765; Montenecourt and Eveleigh, 1979) produced by random mutagenesis and first selected for ability to produce larger clearing zones on minimal media agar containing 1% acid swollen cellulose and 4 g L 4 2- deoxyglucose and then selected for the ability to grow on lactose media containing 0.2 ⁇ g/mL carbendazim.
- a undine auxotroph of BTR213, BTR213aux was obtained through selection of mutants spontaneously resistant to 0.15% w/v 5-fluoroorotic-acid (FOA).
- the T. reesei expression vector was generated using pUCl 9 vector (Fermentas) as a backbone.
- pUCl 9 vector Fermentas
- two DNA fragments were amplified using pCAMBIABOl plasmid (see URL: cambia.org/daisy/cambia/materials/vectors.SZS.htrn ⁇ syS ⁇ S) as a template and two pairs of primers ACl 66/AC 167 and ACl 68/AC 169 (Table 7).
- the first fragment was cloned into the EcoRVSacl sites of pUC19 introducing two new PacVA ⁇ ll restriction sites.
- the second fragment was cloned into the SacVBamUl sites introducing Notl/Mlul restriction sites and generating pUC19-GDR vector.
- TrCeBA expression cassette a fragment containing the TrCel7A promoter and xylanase 2 secretion signal (Pcel7a-Xyn2ss fragment) was amplified using primers AC230 / AC231 (Table 7) and pC/XBG -TV vector (US 6,015,703) as template.
- the gene encoding TrCel3A-S72N-V101M-F260I was amplified using primers AC232 and AC233 (Table 7).
- the Pcel7a-Xyn2ss fragment was ligated to the TrCeBA- S72N-V101M-F260I encoding gene in two subsequent PCR reactions using primers AC230 and AC233 (Table 7) to produce the resulting c/xCel3A- S72N-V101M-F260I fragment.
- a fragment comprising the cel ⁇ a terminator (Tcel ⁇ a fragment) was amplified from the pC/XBG -TV (US 6,015,703) template using primers Tcel6a-F and Tcel6a-R (Table 7), which introduced BamHl I Kpnl restriction sites, respectively.
- the c/xCeBA- S72N-V101M-F260I and Tcel ⁇ a fragments were cloned into pGEM-Teasy vectors generating vectors pGEM-c/xCel3A- S72N-V101M- F260I and pGEM-Tcel ⁇ a which were then digested with MIuV Kpnl and BamHVKpnl restriction enzymes to release the c/xCel3A- S72N-V101M-F260I and Tcel ⁇ a fragments, respectively.
- crassa orotidine-5' -phosphate decarboxylase (pyr4) gene was amplified from pNcBgl (U.S. Patent No.6,939,704) containing N. crassa pyr4 gene under control of its native promoter and terminator using primers AC323 and AC343 (Table 7).
- the pyr4 cassette was cloned into pGEM-T-easy, digested with PacVNotl restriction enzymes, gel purified and cloned into PacVNotl sites of pc/xCeBA- S72N-V101M-F260I -Sbf generating final transformation vector pc/xCel3A-S72N-V101M-F260I-pyr4-TV ( Figure 13).
- Table 7 Primers used for construction of T. reesei transformation vector pc/xCel3A-AT012;F260I-pyr4-TV.
- Trichoderma strain 4115 A was generated by transformation of pc/xCel3 A-S72N- V101M-F260I-pyr4-TV into strain BTR213aux by biolistic gold particle bombardment using the PDS-1000/He system (BioRad; E.I. DuPont de Nemours and Company). Gold particles (median diameter of 0.6 um, BioRad Cat. No. 1652262) were used as microcarriers. The following parameters were used in the optimization of the transformation: a rupture pressure of 1100 psi, a helium pressure of 29 mm Hg, a gap distance of 6 mm and a target distance of 6 cm. The spore suspension was prepared by washing T.
- MM* Minimal medium (MM*) agar:
- MMSS agar contains the same components as MM agar plus 1.2 M sorbitol, 4 mM MgSO 4 , 1 g/L YNB (Yeast Nitrogen Base w/o Amino Acids from DIFCO Cat. No.291940) and 0.12 g/L amino acids (-Ura DO Supplement from CLONTECH Cat. No.8601-1).
- T. reesei transformants were pre-screened for production of active modified TrCel3A beta-glucosidase using Esculin ( ⁇ -D-glucose-6,7-dihydroxycoumarin) plate assay.
- Esculin ⁇ -D-glucose-6,7-dihydroxycoumarin
- An esculin stock solution was made by mixing 2 g of Esculin and 0.6 g FeCl 3 in 200 mL of deionized water. The mixture was heated until dissolved, cooled to approximately 40 0 C and filter sterilized.
- Transformants were plated on minimal media agar plates containing 1% cellobiose and grown for 3 to 4 days at 30°C.
- the esculin stock solution was diluted four-fold with 250 mM citrate buffer, pH 4.8 and 15 mL of the diluted esculin solution were overlaid onto the plates. Plates were incubated at 30 0 C for one hour. Positive transformants were selected according to formation of black precipitate formed around T. reesei colonies.
- the cultures were incubated at a temperature of 30 0 C with shaking at 250 rpm for 6 days.
- the biomass was separated from growth media containing the secreted protein by centrifugation at 12000 rpm.
- the protein concentration was determined using the Bio-Rad Protein Assay (Cat. No. 500-0001).
- TrCel3A Rabbit polyclonal antisera specific for TrCel3A was diluted (1:8,000) in PBS/BSA, added to separate microtitre plates and incubated for 2 h at room temperature. Plates were washed and incubated with a goat anti-rabbit antibody coupled to horseradish peroxidase (Sigma #A6154), diluted 1/2000 in PBS/BSA, for 1 h at room temperature. After washing, tetramethylbenzidine was added to each plate and incubated for 30 min at room temperature. The absorbance at 360 nm was measured in each well and converted into protein concentration using a TrCeBA standard curve. 10.4: Trichoderma reesei pilot fermentation
- T. reesei strains were grown on Potato Dextrose Agar at 28-3O 0 C until a confluent lawn of spores was obtained. Spores were collected and used to inoculate 750 ml of Berkeley media (10 g/L glucose, 1.4 g/L (NH 4 ) 2 SO 4 , 2.0 g/L KH 2 PO 4 , 0.31 g/L MgSO 4 -7H 2 0, 0.53 g/L CaCl 2, 5.1 g/L dry corn steep, 5 mg/L FeSO 4 -7H 2 O, 0.8 mg/L MnSO 4 -H 2 O, 0.7 mg/L ZnSO 4 -7H 2 O) in a 2 L baffled flask.
- Berkeley media 10 g/L glucose, 1.4 g/L (NH 4 ) 2 SO 4 , 2.0 g/L KH 2 PO 4 , 0.31 g/L MgSO 4 -7H 2 0, 0.53 g/L CaCl 2, 5.1 g
- this culture was used to inoculate 10 L of fermentation medium with the following initial composition: 13 g/1 glucose, 2.2 g/1 (NH 4 ) 2 SO 4 , 1.39 g/1 KH 2 PO 4 , 0.7 g/1 MgSO 4 -7H 2 0, 0.185 g/1 CaCl 2 , 6 g/1 dry corn steep, 1.75 mg/1 FeSO 4 -7H 2 O, 0.56 mg/1 MnSO 4 -H 2 O, 0.49 g/1 ZnSO 4 -7H 2 O.
- a fed-batch aerobic fermentation using an inducing carbohydrate source was run for 6 days at pH 5 and 28°C in a 14 L New Brunswick Microferm fermentor. After 6 days, the culture was filtered over Harborlite 1500S and the culture filtrate saved.
- Example 11 Measuring the cellulose hydrolysis activity of a whole cellulase secreted by a strain of Trichoderma that expresses high levels of a modified beta-glucosidase.
- concentrations of the wild-type and the modified beta-glucosidase in their respective whole cellulase mixtures were 31.1 ⁇ 1.7% and 28.2 ⁇ 1.3% of total protein, respectively.
- Trinder P. (1969) Determination of glucose in blood using glucose oxidase with an alternative oxygen accepter. Annals of Clinical Biochemistry, 6:24-27.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Provided are modified beta-glucosidase enzymes, derived from the Trichoderma reesei CeBA beta-glucosidase, that exhibit improvements in one or more kinetic parameters (KG, KG2, kcat) comprising amino acid substitutions at one or more of positions 43, 101, 260 and 543. Also provided are genetic constructs comprising nucleotide sequences encoding for modified beta-glucosidase enzymes, methods for the production of modified beta-glucosidase enzymes from host strains and the use of the modified beta-glucosidase enzymes in the hydrolysis of cellulose.
Description
NOVEL BETA-GLUCOSIDASE ENZYMES
FIELD OF THE INVENTION
[0001] The present invention relates to modified beta-glucosidases. More specifically, the invention relates to modified beta-glucosidases with improved kinetic parameters for the conversion of cellobiose to glucose. The present invention also relates to genetic constructs comprising nucleotide sequences encoding for modified beta-glucosidases, methods for the production of the modified beta-glucosidases from host strains and the use of the modified beta- glucosidase in industrial applications, including the hydrolysis of cellulose.
BACKGROUND OF THE INVENTION
[0002] Lignocellulosic feedstocks are a promising alternative to corn starch for the production of fuel ethanol. These raw materials are widely available, inexpensive and several studies have concluded that cellulosic ethanol generates close to zero greenhouse gas emissions.
[0003] However, these feedstocks are not easily broken down into their composite sugar molecules. Recalcitrance of lignocellulose can be partially overcome by physical and/or chemical pretreatment. An example of a chemical pretreatment is steam explosion in the presence of dilute sulfuric acid (U.S. Patent No. 4,461,648). This process removes most of the hemicellulose, but there is little conversion of the cellulose to glucose. The pretreated material may then be hydrolyzed by cellulase enzymes.
[0004] The term cellulase broadly refers to enzymes that catalyze the hydrolysis of the beta-l,4-glucosidic bonds joining individual glucose units in the cellulose polymer. The catalytic mechanism involves the synergistic actions of endoglucanases (E.C. 3.2.1.4), cellobiohydrolases (E.C. 3.2.1.91) and beta-glucosidases (E.C. 3.2.1.21) (Henrissat et al, 1994; Knowles et al., 1987; Lynd et al., 2002; Teeri, 1997; Wood and Garcia-Campayo, 1990; Zhang and Lynd, 2004). Endoglucanases hydrolyze accessible glucosidic bonds in the middle of the cellulose chain, while cellobiohydrolases processively release cellobiose from these chain ends.
Beta-glucosidases hydrolyze cellobiose to glucose thus minimizing product inhibition of the cellobiohydrolases and endoglucanases.
[0005] Beta-glucosidases are produced by many organisms occurring in all five living kingdoms. Generally these enzymes hydrolyze aryl-beta-glucosides, among which is included cellobiose (gluco-beta-(l,4)-glucoside). Some also catalyze transglycosylation reactions to varying extents.
[0006] Filamentous fungi, including Trichoderrna ssp., Aspergillus ssp., Hypocrea ssp.,
Hwnicola ssp., Neurospora ssp., Orpinomyces ssp., Gibber ella ssp., Emericella ssp., Chaetomium ssp., Fusarium ssp., Penicillium ssp., Magnaporthe ssp., Chrysosporium ssp., Myceliophthora ssp., Theilavia ssp., Sporotrichum ssp. and Phanerochaete ssp. are effective producers of cellulase enzymes. Many of these organisms secrete beta-glucosidase enzymes. Trichoderma spp. (Trichoderma longibrachiatum or Trichoderma reesei) secrete small amounts of beta-glucosidase I or Cel3A (Chirico et al., 1987) and likely also secrete two other beta- glucosidases, CeBB and CeBE (Foreman et al., 2003).
[0007] The enzymatic hydrolysis of pretreated lignocellulosic feedstocks is an inefficient step in the production of cellulosic ethanol and its cost constitutes one of the major barriers to commercial viability. Improving enzymatic activity has been widely regarded as an opportunity for significant cost savings.
[0008] Cellobiohydrolases are strongly inhibited by cellobiose and to a lesser degree by glucose. Conversion of cellobiose to glucose is a rate-limiting step in cellulose hydrolysis because filamentous fungi, such as Trichoderma reesei, produce very low levels of beta- glucosidase and beta-glucosidases are highly sensitive to glucose inhibition (Chirico et al., 1987; Berghem et al., 1974). One technique for reducing cellulase inhibition is to increase the amount of beta-glucosidase in the system (U.S. Patent No. 6,015,703), as cellobiose is more inhibitory to cellulases than glucose (Holtzapple et al., 1990; Teleman et al., 1995). However, over- expressing a beta-glucosidase in an organism such as Trichoderma may reduce the production of other cellulase enzymes and, in turn, may limit the rate of cellulose conversion to cellobiose. In addition, this approach does not specifically address the effect of glucose inhibition on beta- glucosidase activity. A complementary approach would be to use a beta-glucosidase with a
higher specific activity which is also less sensitive to glucose inhibition. This enzyme would mitigate cellobiose product inhibition, but do so with lower amounts of beta-glucosidase (relative to the amount of cellulase(s)) and maintain its catalytic efficiency in the presence of high glucose concentrations.
[0009] Beta-glucosidases from most fungi have binding constants for cellobiose (KG2) that range from 0.2-2.0 mM (Chirico et al., 1987; Berghem et al., 1974; Enari et al., 1981; Christakopoulos et al., 1994). These enzymes are highly sensitive to glucose inhibition; KQ values for glucose ranging from 0.6-8.0 mM have been reported for these enzymes. Several microbial beta-glucosidases with higher tolerance to glucose inhibition (KG>8.0 mM) have been reported (Riou et al., 1998; U.S. Patent 6,087,131; Saha et al., 1996; U.S. Patent 5,747,320; Gueguen et al., 1995; Li et al., 1991; Perez-Pons et al., 1994; Chen et al., 1994; US Patent 6,184,018 Bl). However, these enzymes generally have a lower affinity for cellobiose (i.e., higher KG2 values). As a result, the concentration of cellobiose at steady state would be higher using these beta-glucosidases, increasing the degree of cellobiose inhibition on cellulase activity. Therefore, these particular glucose tolerant beta-glucosidase enzymes have limited utility for the production of cellulosic ethanol.
[0010] In spite of much research effort, there remains a need for improved beta-glucosidase enzymes in order to generate enzyme mixtures with higher sustained hydrolysis activity on pretreated lignocellulosic feedstock. The absence of such improved beta-glucosidase enzymes represents a large hurdle in the commercialization of cellulose conversion to glucose and other soluble fermentable sugars for the production of ethanol and other products.
SUMMARY OF THE INVENTION
[0011] The present invention relates to modified beta-glucosidases. More specifically, the invention relates to modified beta-glucosidases with improved kinetic parameters for the conversion of cellobiose to glucose. Beta-glucosidases of the present invention find utility in industrial processes requiring efficient conversion of cellobiose to glucose in the presence of glucose concentrations that would otherwise inhibit a parental beta-glucosidase.
[0012] An embodiment of the invention relates to a modified beta-glucosidase of Trichoderma reesei produced by substitution of the amino acid at one or more of positions 43, 101, 260 and 543 in the beta-glucosidase I or TrCeBA sequence (SEQ ID NO: 1) and comprising an amino acid sequence that is from about 80% to 99.9% to that TrCeBA amino acid sequence defined by SEQ ID NO: 1.
[0013] The modified TrCeBA beta-glucosidase may be derived from a parental TrCeBA beta-glucosidase that is otherwise identical to the modified TrCeBA beta-glucosidase and includes the substitution of the naturally occurring amino acid at one or more of positions 43, 101, 260 and 543. For example, the modified TrCeBA beta-glucosidase may contain one or more amino acid substitutions at positions other than at positions 43, 101 , 260 and 543, provided that the amino acid sequence of the modified TrCeBA is from about 80% to about 99.9% identical to the TrCeBA amino acid sequence (SEQ ID NO: 1). For example, this invention includes the modified TrCeBA as defined above and further comprising an amino acid substitution at one or more of positions 66, 72, 96, 235, 248 and 369.
[0014] The present invention also relates to a modified TrCeBA beta-glucosidase comprising an amino acid sequence that is from about 80% to about 99.9% identical to that of the wild-type TrCeBA of SEQ ID NO: 1 and which exhibits (a) at least a 20% increase in the K0, (b) at least a 20% decrease in KG2, or (c) at least a 10% increase in kcatϊox cellobiose relative to the KG, KQ2 and/or kcat of a parental TrCeBA beta-glucosidase from which is derived.
[0015] The present invention also relates to a modified TrCeBA consisting of the amino acid sequence defined by:
SEQ ID NO: 2 (TrCeBA-V43I); SEQ ID NO: 3 (TrCeBA- V43C); SEQ ID NO: 4 (TrCeBA-VlOlA); SEQ ID NO: 5 (TrCeBA-VlOlG); SEQ ID NO: 6 (TrCeB A-F260I); SEQ ID NO: 7 (TrCel3A-F260V); SEQ ID NO: 8 (TrCel3A-F260Q); SEQ ID NO: 9 (TrCeB A-F260D);
SEQ ID NO: 10 (TrCeB A-I543N);
SEQ ID NO: 11 (TrCel3A-I543W);
SEQ ID NO: 12 (TrCeB A-I543 A);
SEQ ID NO: 13 (TrCeB A-I543 S);
SEQ ID NO: 14 (TrCeBA-I543G);
SEQ ID NO: 15 (TrCeB A-I543 L);
SEQ ID NO: 16 (TrCeB A-S72N-V101 M-F260I);
SEQ ID NO: 17 (TrCeBA-V43I-S72N-V101M);
SEQ ID NO: 18 (TrCeBA-S72N-V101M-I543N);
SEQ ID NO: 19 (TrCeBA-S72N-V101M-I543D);
SEQ ID NO: 20 (TrCeBA-S72N-V101M-I543L);
SEQ ID NO: 21 (TrCeBA-V43I-S72N-V101M-F260I);
SEQ ID NO: 22 (TrCeBA-V43I-S72N-V101M-F260I-I543N);
SEQ ID NO: 23 (TrCeBA- V43I-S72E-V101M-I543N);
SEQ ID NO: 69 (TrCeBA-S72N-V101M-F260I-I543N); or
SEQ ID NO: 70 (TrCeB A-S72N-V101 M-F260I-I543L).
[0016] The genetic constructs of the present invention comprise a nucleic acid sequence encoding a modified TrCeBA with an amino acid sequence that is from about 80% to about 99.9% amino acid sequence identity to SEQ ID NO: 1 and that comprises an amino acid substitution at one or more of positions 43, 101, 260 and 543, which nucleic acid sequence is operably linked to nucleic acid sequences regulating its expression and secretion from a host microbe. For example, the nucleic acid sequences regulating the expression and secretion of the modified TrCeBA beta-glucosidase may be derived from the host microbe used for expression of the modified TrCeBA beta-glucosidase. The host microbe may be a yeast, such as Saccharomyces cerevisiae, or a filamentous fungus, such as Trichoderma reesei.
[0017] The invention also relates to a genetic construct as defined above, wherein the modified TrCeBA beta-glucosidase comprises an amino acid sequence that is from about 90% to about 99.9% identical to SEQ ID NO: 1. The modified TrCeBA beta-glucosidase may further comprise substitutions at one or more of positions 66, 72, 96, 235, 248, 369 and 386 or any other additional mutations.
[0018] The invention also relates to a genetically modified microbe comprising a genetic construct encoding the modified TrCeBA beta-glucosidase.. For example, the genetically modified microbe may be capable of expression and secretion of the modified TrCeBA beta- glucosidase further comprising substitution at one or more of positions 66, 72, 96, 235, 248, 369 and 386 or any other additional mutations. The genetically modified microbe may be a yeast or filamentous fungus. For example, the genetically modified microbe may be a species of Saccharomyces, Pichia, Hansenula, Trichoderma, Hyprocrea, Aspergillus, Fusarium, Humicola, Chrysosporium, Myceliophthora, Thielavia, Sporotrichum or Neurospora.
[0019] The present invention also relates to the use of the modified TrCeBA beta- glucosidase in a hydrolysis reaction containing a cellulosic substrate and a cellulase mixture comprising the modified TrCeBA beta-glucosidase.
[0020] The invention also relates to a process of producing the modified TrCeBA beta- glucosidase as defined above, including providing a yeast or fungal host with a genetic construct comprising a nucleic acid sequence encoding the modified TrCeBA beta-glucosidase, selection of recombinant yeast or fungal strains expressing the modified TrCeBA beta-glucosidase, culturing the selected recombinant strains in submerged liquid fermentations under conditions that induce the expression of the modified TrCeBA beta-glucosidase and recovering the modified TrCeBA beta-glucosidase.
[0021 ] Such modified TrCeBA beta-glucosidases find use in a variety of applications in industrial processes requiring enzymes that can retain high activity in the presence of normally inhibitory concentrations of the glucose. For example, modified TrCeBA beta-glucosidases, as described herein, may be used for the purposes of saccharification of lignocellulosic feedstocks for the production of fermentable sugars or in the production of compounds such as those used in the medical and food industries.
[0022] In another embodiment, the invention relates to a modified Family 3 beta-glycosidase comprising one or more of the amino acid substitutions selected from the group consisting of V43I, V43C, VlOlA, VlOlG, F260I, F260V, F260Q, F260D, I543N, I543A, I543S, I543G and 1543 L and having an amino acid sequence that is at least 80% identical to the amino acid sequence of a parental Family 3 beta-glycosidase from which it is derived. The positions of the
amino acid substitution(s) are determined from sequence alignment of the Family 3 beta- glycosidase with a Trichoderma reesei CeBA amino acid sequence as defined in SEQ ID NO: 1. The modified Family 3 beta-glycosidase of the present invention exhibits (a) an increase in the Kp, (b) a decrease in Ks, or (c) an increase in kcat relative to the Kp, Ks or kcat of the parental Family 3 beta-glycosidase from which it is derived.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023 ] FIGURE 1 depicts plasmid vector YEp352/PGK91 - 1 /αss6H-TrCel3 A directing the expression and secretion of native and modified TrCeBA from recombinant Saccharomyces cerevisiae.
[0024] FIGURE 2 shows a Saccharomyces cerevisiae growth plate containing synthetic complete medium plus 0.1% esculin hydrate and 0.03% FeCl3. Colonies which turned black after incubation for 3-4 days at 3O0C were identified as expressing active TrCel3A beta- glucosidase.
[0025] FIGURE 3 is a scatter plot of beta-glucosidase activity in assay 1 (30 mM cellobiose) versus beta-glucosidase activity in assay 2 (5 mM cellobiose + 1.25 mM glucose). The data relate to the screening of one 96-well culture plate containing wild-type TrCel3 A (wt), filtrates from empty vector transformants (EV) and modified TrCel3As (variants). The wild-type TrCel3A data were fit by linear regression in which the y-intercept was fixed to zero.
[0026] FIGURE 4 shows an SDS-PAGE gel of the parental (wt) and modified TrCeBA beta-glucosidases expressed from yeast and purified as described in Example 7, as well as a cellulase enzyme mixture from Trichoderma reesei (cellulase) and the wild-type TrCeBA purified from T. reesei cellulase (CeBA). After SDS-PAGE separation, the proteins were visualized by Coomassie Blue stain.
[0027] FIGURE 5 is a diagram illustrating the reaction scheme of the/?NPG competitive substrate/inhibitor kinetic assay.
[0028] FIGURE 6 shows the competitive substrate/inhibitor assay results for parental TrCeBA (Wt).
[0029] FIGURE 7 shows the competitive substrate/inhibitor assay results for the modified TrCel3A-V43I beta-glucosidase.
[0030] FIGURE 8 shows the competitive substrate/inhibitor assay results for the modified TrCeBA-V 101 A beta-glucosidase.
[0031 ] FIGURE 9 shows the competitive substrate/inhibitor assay results for the modified TrCel3A-F260I beta-glucosidase.
[0032] FIGURE 10 shows the competitive substrate/inhibitor assay results for the modified TrCel3A-I543N beta-glucosidase.
[0033] FIGURE 11 shows an alignment of the amino acid sequences of 45 fungal Family 3 beta-glucosidases, including the parental TrCeBA of SEQ ID NO: 1, a consensus Family 3 beta-glucosidase sequence, and the % sequence identity of each amino acid sequence to that of TrCeBA. The positions of V43, VlOl, F260, and 1543 are indicated by asterisks (*); the positions of the catalytic amino acids D236 and E447 are indicated by arrows ( I ). A graphical representation of the frequency of occurrence of the amino acid at each position of the consensus Family 3 beta-glucosidase sequence of Figure 11 among the 45 fungal Family 3 beta- glucosidases is provided below the aligned sequences.
[0034] FIGURE 12 is a Michaelis-Menton plot comparing the rates of cellobiose hydrolysis by wild-type parental TrCeBA and modified TrCeB A-F260I at different substrate concentrations.
[0035] FIGURE 13 depicts plasmid vector pc/xCel3A-S72N-V101M-F260I-pyr4-TV directing the expression and secretion of modified TrCeBA beta-glucosidase from genetically modified Trichoderma reesei.
[0036] FIGURE 14 shows the relative abundance of modified TrCeBA beta-glucosidases in cellulase mixtures produced by genetically modified Trichoderma reesei.
[0037] FIGURE 15 is a plot showing the conversion of cellulose in a pretreated lignocellulosic substrate by cellulase mixtures comprising parental (WT TrCeBA) or modified (Modified TrCeBA) beta-glucosidases produced by genetically modified Trichoderma reesei.
Leu Ser Tyr Thr Lys Phe 580
<210> 5
<211> 582
<212> PRT
<213> Trichoderma reesei
<400> 5
VaI VaI Pro Pro Ala GIy Thr Pro Trp GIy Thr Ala Tyr Asp Lys Ala 1 5 10 15
Lys Ala Ala Leu Ala Lys Leu Asn Leu GIn Asp Lys VaI GIy lie VaI 20 25 30
Ser GIy VaI GIy Trp Asn GIy GIy Pro Cys VaI GIy Asn Thr Ser Pro 35 40 45
Ala Ser Lys lie Ser Tyr Pro Ser Leu Cys Leu GIn Asp GIy Pro Leu 50 55 60
GIy VaI Arg Tyr Ser Thr GIy Ser Thr Ala Phe Thr Pro GIy VaI GIn 65 70 75 80
Ala Ala Ser Thr Trp Asp VaI Asn Leu lie Arg GIu Arg GIy GIn Phe 85 90 95
He GIy GIu GIu GIy Lys Ala Ser GIy He His VaI He Leu GIy Pro 100 105 HO
VaI Ala GIy Pro Leu GIy Lys Thr Pro GIn GIy GIy Arg Asn Trp GIu 115 120 125
GIy Phe GIy VaI Asp Pro Tyr Leu Thr GIy He Ala Met GIy GIn Thr 130 135 140
He Asn GIy He GIn Ser VaI GIy VaI GIn Ala Thr Ala Lys His Tyr 145 150 155 160
He Leu Asn GIu GIn GIu Leu Asn Arg GIu Thr He Ser Ser Asn Pro 165 170 175
Asp Asp Arg Thr Leu His GIu Leu Tyr Thr Trp Pro Phe Ala Asp Ala 180 185 190
VaI GIn Ala Asn VaI Ala Ser VaI Met Cys Ser Tyr Asn Lys VaI Asn 195 200 205
Thr Thr Trp Ala Cys GIu Asp GIn Tyr Thr Leu GIn Thr VaI Leu Lys 210 215 220
Asp GIn Leu GIy Phe Pro GIy Tyr VaI Met Thr Asp Trp Asn Ala GIn 225 230 235 240
His Thr Thr VaI GIn Ser Ala Asn Ser GIy Leu Asp Met Ser Met Pro 245 250 255
GIy Thr Asp Phe Asn GIy Asn Asn Arg Leu Trp GIy Pro Ala Leu Thr 260 265 270
[0041 ] Beta-glucosidases are a subset of beta-glycosidases belonging to glycoside hydrolase (GH) Families 1 and 3, using the classification system developed by Henrissat and coworkers (Henrissat, B. (1991); Henrissat, B. and Bairoch, A. (1996)). There are currently over 115 GH families that have been identified using this classification system, which are listed in the database of Carbohydrate Active Enzymes (CAZy) (see http://afmb.cnrs- mrs.fr/CAZY/index.html for reference). Family 1 comprises beta-glycosidases from archaebacteria, plants and animals. Beta-glycosidases from some bacteria, mold and yeast belong to Family 3. For the purpose of this invention, a "beta-glycosidase" is therefore defined as any protein that is categorized as a Family 3 glycoside hydrolase according to the CAZy system.
[0042] The three dimensional structure of beta-D-glucan exohydrolase, a Family 3 glycosyl hydrolase, was described by Varghese et al. (1999). The structure was of a two domain globular protein comprising a N-terminal (α/β)8 TIM-barrel domain and a C-terminal a six-stranded beta- sandwich, which contains a beta-sheet of five parallel beta-strands and one antiparallel beta- strand, with three alpha-helices on either side of the sheet. This structure is likely shared by other Family 3 enzymes.
[0043] As shown in Figure 11, the primary amino acid sequence of Family 3 beta- glucosidases show a high degree of similarity. Multiple alignment across 45 Family 3 beta- glucosidase amino acid sequences shows that the most naturally occurring Family 3 beta- glucosidases of fungal origin show from about 40% to about 100% amino acid sequence identity to the amino acid sequence of TrCeDA (Figure 11). In particular, there are several regions of very high amino acid sequence conservation within the Family 3 beta-glucosidases including, for example, from amino acids 225-256 and 439-459, containing the catalytic amino acids D236 and E447, respectively.
[0044] By "TrCeBA beta-glucosidase" or "TrCeBA" it is meant the Family 3 glycosyl hydrolase produced by Trichoderma reesei defined by the amino acid sequence of SEQ ID NO: 1. TrCeBA beta-glucosidase is also known as Trichoderma reesei beta-glucosidase or BGLl. By "native" or "wild type" TrCeBA (also annotated as TrCeB Awt), it is meant the TrCeBA of SEQ ID NO: 1 without any amino acid substitutions.
[0045] By "modified TrCeOA beta-glucosidase" or "modified TrCeBA", it is meant a TrCeBA beta-glucosidase which comprises one or more of the amino acid substitutions, introduced by genetic engineering techniques, selected from the group consisting of V43X, VlOlX, F260X, and I543X. For example, the modified modified TrCeBA beta-glucosidase may comprising one or more amino acid substitutions selected from the group consisting ofV43I, V43C. VlOlA. VlOlG, F260I. F260V. F260O. F260D. I543N. 1543 A. I543S. I543G and I543L.
[0046] Genetic engineering techniques for altering amino acid sequences include, but are not limited to, site-directed mutagenesis, cassette mutagenesis, random mutagenesis, synthetic oligonucleotide construction, cloning and other genetic engineering techniques as would be known by those of skill in the art (Eijsink VG, et al. 2005). Modified TrCeBA beta-glucosidases of the present invention include those comprising amino acid substitutions at any one of V43X, VlOlX, F260X and I543X, at any two of V43X, VlOlX, F260X and I543X, any three of V43X, VlOlX, F260X and I543X, or all four of V43X, VlOlX, F260X and I543X.
[0047] It will be understood that the modified TrCeBA beta-glucosidase may be derived from wild-type TrCeBA beta-glucosidase of SEQ ID NO: 1 or from a TrCeBA beta-glucosidase that contains other amino acid substitutions. For example, the modified TrCeBA beta- glucosidase may contain amino acid substitution at one or more of positions 66, 73, 96, 235, 248, and 369. Alternatively, after production of the modified TrCeBA beta-glucosidase comprising mutations at one or more of positions 43, 101, 260 and 543, it may be subsequently further modified to contain additional amino acid substitutions, including but not limited to those set forth above.
[0048] As used herein in respect of modified TrCeBA beta-glucosidase amino acid sequences, "derived from" refers to the isolation of a target nucleic acid sequence element encoding the desired modified TrCeBA beta-glucosidase using genetic material or nucleic acid or amino acid sequence information specific to the parental TrCeBA beta-glucosidase. As is known by one of skill in the art, such material or sequence information can be used to generate a nucleic acid sequence encoding the desired modified TrCeBA beta-glucosidase using one or more molecular biology techniques including, but not limited to, cloning, sub-cloning, amplification by PCR, in vitro synthesis, and the like.
[0049] In one embodiment of the invention, the amino acid sequence of the modified TrCeBA beta-glucosidase is from about 80% to about 99.9% identical to SEQ ID NO: 1. For example, the amino acid sequence of the modified TrCel3A beta-glucosidase may be from about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.9% identical to SEQ ID NO: 1. In other words, the number of amino acid substitutions in the modified TrCeBA beta-glucosidase may not exceed 20% of the total number amino acids in the parental TrCeBA beta-glucosidase sequence.
[0050] In another embodiment of the invention, the amino acid sequence of modified TrCeBA beta-glucosidase may be from about 90% to about 99.9% identical to SEQ ID NO: 1. For example, the amino acid sequence of the modified TrCeBA beta-glucosidase may be from about 95% to about 100% identical to SEQ ID NO: 1.
[0051] In another embodiment, the amino acid sequence of the modified TrCeBA beta- glucosidase may be from about 80% to about 99.9% identical to SEQ ID NO: 1 and the modified TrCeBA beta-glucosidase may exhibit (a) at least about a 20% increase in KG, (b) at least about a 20% decrease in KQ2, or (c) at least about a 10% increase in kcat for cellobiose relative to the KQ, KQ2 and/or kcat of a parental TrCeBA beta-glucosidase from which it is derived. For example, the modified TrCeBA beta-glucosidase may exhibit (a) from about a 20% to about a 800% increase in KQ, or any increase therebetween, (b) from about a 20% to about an 80% decrease in KG2, any decrease therebetween, or (c) from about a 10% to about a 50% increase in kcat for cellobiose relative to the KQ, KQ2 and/or kcat of a parental TrCeBA beta-glucosidase from which is derived
[0052] By "parental TrCeBA beta-glucosidase" or "parental TrCeBA", it is meant a TrCeBA beta-glucosidase that does not contain a substitution of its original amino acid(s) at positions 43, 101, 260 or 543. For example, the parental TrCeBA beta-glucosidase may comprise amino acid substitutions at one or more of positions 66, 72, 96, 235, 248, and 369.
[0053] In order to assist one of skill in the art regarding those amino acid positions of the TrCeBA beta-glucosidase at which amino acid substitutions (other than V43X, VlOlX, F260X, and I543X) may be made and produce an active beta-glucosidase, an alignment of 45 Family 3 beta-glucosidases derived from fungal sources along with a consensus beta-glucosidase sequence
consisting of the amino acids that naturally occur with the highest frequency at each position is provided in Figure 11 along with a graph showing the frequency of occurrence of each amino acid of the consensus sequence at each position. Using the information provided in Figure 11, one of skill in the art would recognize regions of low sequence conservation to other Family 3 beta-glucosidases and choose such regions for introduction of amino acid substitutions that are not likely to compromise significantly the function of the enzyme. Non-limiting examples of such regions include, for example, the regions between positions 1-20, 303-323 and 403-414 and select amino acid positions within these regions.
[0054] As described in more detail herein, several modified TrCeBA beta-glucosidases have been prepared that exhibit (a) at least a 20% increase in KG, (b) at least a 20% decrease in KG2, or (c) at least a 10% increase in kca,for cellobiose relative to the K0, K02 and/or kcat of a parental TrCeBA beta-glucosidase from which is derived. A list of several modified TrCeBA beta- glucosidases, which is not to be considered limiting in any manner, is presented in Table 1.
Table 1: TrCeBA beta-glucosidases with improved catalytic efficiency
Modified TrCel3A beta-glucosidases Improved Kinetic Parameters
[0055] The modified TrCeBA beta-glucosidases of the present invention exhibit improvements in at least one of the following kinetic parameters: K0, KQ2 and kcat. K0 is defined as the concentration of glucose which reduces the enzymatic activity of the beta- glucosidase by 50%. KG2 is defined as the concentration of cellobiose at which the beta- glucosidase exhibits half its maximal rate. The kcat is the catalytic rate constant for the hydrolysis of cellobiose. Example 8 details an assay for measuring the K0 and KQ2 of parental and modified TrCeBA beta-glucosidases. Example 9 details an assay for measuring the kca! of parental and modified TrCeBA beta-glucosidases.
[0056] KG of the parental and modified TrCeBA beta-glucosidases can be determined by measuring the rate of hydrolysis of a chromogenic substrate, such as p-nitrophenyl-beta-D- glucopyranoside (pNPG), in the presence of various concentrations of glucose as described in Example 8. The K0 is the concentration of glucose that reduces the rate of p-nitrophenol (pNP) release from pNPG by 50% compared to the rate of pNPG hydrolysis in the absence of glucose. The KQ2 constants for parental and modified TrCeBA beta-glucosidases can be determined by measuring the rate of hydrolysis of cellobiose in reactions containing increasing concentrations of cellobiose or, alternatively, by measuring the rate of hydrolysis of a chromogenic substrate, such as pNPG, in the presence of various concentrations of a cellobiose as described in Example 8. The K02 is the concentration of cellobiose that reduces the rate of pNP release from pNPG by
50% compared to the rate of pNPG hydrolysis in the absence of cellobiose. The kcat values for parental and modified TrCeBA beta-glucosidases can be determined by measuring the rate of cellobiose hydrolysis at varying concentrations of a cellobiose substrate, for example, as described in Example 9.
[0057] The effect of amino acid substitutions at positions 43, 101, 260 and 543 were determined by a comparative study of the modified and parental TrCeBA beta-glucosidases. The relative values of K0, K02 and kcat for the parental and modified TrCeBA beta-glucosidases are shown in Table 2, below. Reaction curves for the hydrolysis of pNPG substrate alone and in the presence of glucose or cellobiose by parental and modified TrCeBA beta-glucosidases are shown in Figures 6 through 10. Reaction curves for the hydrolysis of cellobiose substrate by parental and modified TrCeBA beta-glucosidases are shown in Figure 12.
Table 2: Modified TrCel3A Beta-glucosidases with Improved Kinetic Parameters
Genetic Constructs Encoding Modified TrCel3A Beta-glucosidases
[0058] The present invention also relates to genetic constructs comprising a nucleic acid sequence encoding the modified TrCeBA beta-glucosidase operably linked to regulatory nucleic acid sequences directing the expression and secretion of the modified TrCeBA beta-glucosidase from a host microbe. By "regulatory nucleic acid sequences" it is meant nucleic acid sequences directing the transcription and translation of the modified TrCel3A-encoding nucleic acid sequence and a nucleic acid sequence encoding a secretion signal peptide capable of directing the secretion of the modified TrCel3A beta-glucosidase from a host microbe. The regulatory nucleic acid sequences may be derived from genes that are highly expressed and secreted in the host microbe under industrial fermentation conditions. For example, the regulatory nucleic acid sequences may be derived from any one or more of the Trichoderma reesei cellulase or hemicellulase genes.
[0059] The genetic construct may further comprise a selectable marker gene to enable isolation of a genetically modified microbe transformed with the construct as is commonly known to those of skill in the art. The selectable marker gene may confer resistance to an antibiotic or the ability to grow on medium lacking a specific nutrient to the host organism that otherwise could not grow under these conditions. The present invention is not limited by the choice of selectable marker gene, and one of skill in the art may readily determine an appropriate gene. For example, the selectable marker gene may confer resistance to hygromycin,
phleomycin, kanamycin, geneticin, or G418, or may complement a deficiency of the host microbe in one of the trp, arg, leu, pyr4, pyr, ura3, ura5, his, or ade genes or may confer the ability to grow on acetamide as a sole nitrogen source.
[0060] The genetic construct may further comprise other nucleic acid sequences as is commonly known to those of skill in the art, for example, transcriptional terminators, nucleic acid sequences encoding peptide tags, synthetic sequences to link the various other nucleic acid sequences together, origins of replication, and the like. The practice of the present invention is not limited by the presence of any one or more of these other nucleic acid sequences.
Genetically Modified Microbes Expressing Modified TrCel3A Beta-glucosidases
[0061] The modified TrCeBA beta-glucosidase may be expressed and secreted from a genetically modified microbe produced by transformation of a host microbe with a genetic construct encoding the modified TrCel3 A beta-glucosidase. The host microbe may be a yeast or a filamentous fungus, particularly those classified as Ascomycota. Genera of yeasts useful as host microbes for the expression of modified TrCeBA beta-glucosidases of the present invention include Saccharomyces, Pichia, Hansenula, Kluyveromyces, Yarrowia, and Arxula. Genera of fungi useful as microbes for the expression of modified TrCeBA beta-glucosidases of the present invention include Trichoderma, Hypocrea, Aspergillus, Fusarium, Humicola, Neurospora, Chrysosporium, Myceliophthora, Thielavia, Sporotrichum and Penicillium. For example, the host microbe may be an industrial strain of Trichoderma reesei. Typically, the host microbe is one which does not express a parental TrCeBA beta-glucosidase.
[0062] The genetic construct may be introduced into the host microbe by any number of methods known by one skilled in the art of microbial transformation, including but not limited to, treatment of cells with CaCl2, electroporation, biolistic bombardment, PEG-mediated fusion of protoplasts (e.g. White et al., WO 2005/093072, which is incorporated herein by reference). After selecting the recombinant fungal strains expressing the modified TrCeBA, the selected recombinant strains may be cultured in submerged liquid fermentations under conditions that induce the expression of the modified TrCeBA.
Production of Modified TrCeB A Beta-glucosidases
[0063] The modified TrCeB A beta-glucosidase of the present invention may be produced in a fermentation process in which a genetically modified microbe comprising a genetic construct encoding the modified TrCel3 A beta-glucosidase is grown in submerged liquid culture fermentation.
[0064] Submerged liquid fermentations of microorganisms, including Trichoderma and related filamentous fungi, are typically conducted as a batch, fed-batch or continuous process. In a batch process, all the necessary materials, with the exception of oxygen for aerobic processes, are placed in a reactor at the start of the operation and the fermentation is allowed to proceed until completion, at which point the product is harvested. A batch process for producing the modified TrCeBA beta-glucosidase of the present invention may be carried out in a shake-flask or a bioreactor.
[0065] In a fed-batch process, the culture is fed continuously or sequentially with one or more media components without the removal of the culture fluid. In a continuous process, fresh medium is supplied and culture fluid is removed continuously at volumetrically equal rates to maintain the culture at a steady growth rate.
[0066] One of skill in the art is aware that fermentation medium comprises a carbon source, a nitrogen source as well as other nutrients, vitamins and minerals which can be added to the fermentation media to improve growth and enzyme production of the host cell. These other media components may be added prior to, simultaneously with or after inoculation of the culture with the host cell.
[0067] For the process for producing the modified TrCel3 A beta-glucosidase of the present invention, the carbon source may comprise a carbohydrate that will induce the expression of the modified TrCeBA beta-glucosidase from a genetic construct in the genetically modified microbe. For example, if the genetically modified microbe is a strain of a cellulolytic fungus such as Trichoderma, the carbon source may comprise one or more of cellulose, cellobiose, sophorose, xylan, xylose, xylobiose and related oligo- or poly-saccharides known to induce expression of cellulases and beta-glucosidase in such cellulolytic fungi.
[0068] In the case of batch fermentation, the carbon source may be added to the fermentation medium prior to or simultaneously with inoculation, hi the cases of fed-batch or continuous operations, the carbon source may also be supplied continuously or intermittently during the fermentation process. For example, when the genetically modified microbe is a strain of Trichoderma, the carbon feed rate is between 0.2 and 2.5 g carbon/L of culture/h, or any amount therebetween.
[0069] The process for producing the modified TrCel3A beta-glucosidase of the present invention may be carried at a temperature from about 20°C to about 40°C, or any temperature therebetween, for example from about 25°C to about 37°C, or any temperature therebetween, or from 20, 22, 25, 26, 27, 28, 29, 30, 32, 35, 37, 40°C or any temperature therebetween.
[0070] The process for producing the modified TrCeBA beta-glucosidase of the present invention may be carried out at a pH from about 3.0 to 6.5, or any pH therebetween, for example from about pH 3.5 to pH 5.5, or any pH therebetween, for example from about pH 3.0, 3.2, 3.4, 3.5, 3.7, 3.8, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.2, 5.4, 5.5, 5.7, 5.8, 6.0, 6.2, 6.5 or any pH therebetween.
[0071 ] Following fermentation, the fermentation broth containing the modified TrCel3 A beta-glucosidase may be used directly, or the modified TrCeBA beta-glucosidase may be separated from the fungal cells, for example by filtration or centrifugation. Low molecular solutes such as unconsumed components of the fermentation medium may be removed by ultrafiltration. The modified TrCeBA beta-glucosidase may be concentrated, for example, by evaporation, precipitation, sedimentation or filtration. Chemicals such as glycerol, sucrose, sorbitol and the like may be added to stabilize the modified TrCeBA beta-glucosidase. Other chemicals, such as sodium benzoate or potassium sorbate, may be added to the modified TrCeBA beta-glucosidase to prevent growth of microbial contamination.
The Use of Modified TrCel3A Beta-glucosidases
[0072] The modified TrCeBA beta-glucosidase of the present invention may be used in the hydrolysis of cellulose or in the production of compounds such as those used in the medical and food industries
[0073] For use in the enzymatic hydrolysis of cellulose, such as in the production of fermentable sugars from a pretreated lignocellulosic feedstock, the modified TrCeBA beta- glucosidase of the invention may be combined with one or more cellulases to produce a cellulase mixture. In one embodiment of the invention, the modified TrCeBA beta-glucosidase is one of many proteins expressed from a host cell, including, but not limited to, cellulase enzymes. The one or more cellulases in the cellulase enzyme mixture and the modified TrCeBA beta- glucosidase may be secreted from a single genetically modified microbe or by different microbes in combined or separate fermentations. Similarly, the one or more cellulases in the cellulase enzymes mixture with which the modified TrCeBA beta-glucosidase may be combined may be expressed individually or in sub-groups from different strains of different organisms and the enzymes combined to make the cellulase enzyme mixture. It is also contemplated that the enzyme mixture may be expressed individually or in sub-groups from different strains of a single organism, such as from different strains of Saccharomyces, Pichia, Hansenula Trichoderma, Hyprocrea, Aspergillus, Fusarium, Humicola, Chrysosporium, Myceliophthora, Thielavia, Sporotrichum or Neurospora, and the enzymes combined to make the cellulase enzyme mixture. Preferably, all of the enzymes are expressed from a single host organism, such as a strain of cellulolytic fungus belonging to a species of Trichoderma, Hyprocrea, Aspergillus, Fusarium, Humicola, Chrysosporium, Myceliophthora, Thielavia, Sporotrichum or Neurospora.
[0074] It is further contemplated that the cellulase mixture may comprise two or more of such modified beta-glucosidases as described here in, each with a unique set of improved kinetic parameters. Such a cellulase mixture would be expected to maintain a constant beta-glucosidase activity across a broad range of conditions. For example, a cellulase mixture may comprise one modified TrCeBA beta-glucosidase with low substrate affinity and low product inhibition (i.e., higher values OfK02 and K0 than the parental beta-glucosidase) and one modified TrCeBA beta- glucosidase with high substrate affinity and high product inhibition (i.e., lower values of KG2 and KQ than the parental beta-glucosidase). Such a cellulase mixture would exhibit a near level apparent beta-glucosidase activity across a wide range of cellobiose and glucose concentrations. Many possible combinations of two or more beta-glucosidase enzymes might be envisioned to maintain a constant activity across a variety of conditions that could occur across many different processes and applications.
[0075] A pretreated lignocellulosic feedstock is a material of plant origin that, prior to pretreatment, contains at least 20% cellulose (dry weight), more preferably greater than about 30% cellulose, even more preferably greater than 40% cellulose, for example 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 55, 60, 65, 70, 75, 80, 85, 90% or any percent therebetween, and at least 10% lignin (dry wt), more typically at least 12% (dry wt) and that has been subjected to physical and/or chemical processes to make the fiber more accessible and/or receptive to the actions of cellulolytic enzymes. After pretreatment, the lignocellulosic feedstock may contain higher levels of cellulose. For example, if acid pretreatment is employed, the hemicellulose component is hydrolyzed, which increases the relative level of cellulose. In this case, the pretreated feedstock may contain greater than about 20% cellulose and greater than about 12% lignin.
[0076] Lignocellulosic feedstocks that may be used in the invention include, but are not limited to, agricultural residues such as corn stover, wheat straw, barley straw, rice straw, oat straw, canola straw, sugarcane straw and soybean stover; fiber process residues such as corn fiber, sugar beet pulp, pulp mill fines and rejects or sugar cane bagasse; forestry residues such as aspen wood, other hardwoods, softwood, and sawdust; or grasses such as switch grass, miscanthus, cord grass, and reed canary grass. The lignocellulosic feedstock may be first subjected to size reduction by methods including, but not limited to, milling, grinding, agitation, shredding, compression/expansion, or other types of mechanical action. Size reduction by mechanical action can be performed by any type of equipment adapted for the purpose, for example, but not limited to, a hammer mill.
[0077] The enzymatic hydrolysis of cellulose using a cellulase enzyme mixture, as defined above, comprising the modified TrCel3 A beta-glucosidase may be batch hydrolysis, continuous hydrolysis, or a combination thereof. The hydrolysis may be agitated, unmixed, or a combination thereof.
[0078] The enzymatic hydrolysis may be carried out at a temperature of about 300C to about 800C, or any temperature therebetween, for example a temperature of 30, 35, 40, 45, 50, 55, 60, 65, 70, 75°C, 800C or any temperature therebetween, and a pH of about 3.0 to about 8.0, or any pH therebetween, for example at a pH of 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0
or pH therebetween. The initial concentration of cellulose in the hydrolysis reactor, prior to the start of hydrolysis, is preferably about 2% (w/w) to about 15% (w/w), or any amount therebetween, for example 2, 4, 6, 8, 10, 12, 14, 15% or any amount therebetween.
[0079] The dosage of the cellulase enzyme mixture comprising the modified TrCeBA beta- glucosidase may be about 0.1 to about 100 mg protein per gram cellulose, or any amount therebetween, for example 0.1, 0.5, 1, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 mg protein per gram cellulose or any amount therebetween. The hydrolysis may be carried out for a time period of about 1 hours to about 200 hours, or any time therebetween; for example, the hydrolysis may be carried out for a period of 15 hours to 100 hours, or any time therebetween, or it may be carried out for 1, 2, 4, 8, 12, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 120, 140, 160, 180, 200 or any time therebetween. It should be appreciated that the reaction conditions are not meant to limit the invention in any manner and may be adjusted as desired by those of skill in the art.
[0080] In practice, the enzymatic hydrolysis is typically carried out in a hydrolysis reactor. The enzyme mixture is added to the pretreated lignocellulosic feedstock (also referred to as the "substrate") prior to, during, or after the addition of the substrate to the hydrolysis reactor.
Modified Family 3 Beta-glycosidases
[0081] Beta-glucosidases are just one or several classes of hydrolytic enzymes belong to glycoside hydrolase Family 3. For example, Family 3 includes other enzymes that catalyse the hydrolysis of beta-glycosidic bonds such as xylan 1 ,4-beta-xylosidase (EC 3.2.1.37), beta -N- acetylhexosaminidase (EC 3.2.1.52), glucan 1,3- beta -glucosidase (EC 3.2.1.58), and glucan 1 ,4- beta -glucosidase (EC 3.2.1.74). For the purposes of the present invention, a "Family 3 beta-glycosidase" is any xylan 1,4-beta-xylosidase (EC 3.2.1.37), beta-N-acetylhexosaminidase (EC 3.2.1.52), glucan 1,3- beta -glucosidase (EC 3.2.1.58), and glucan 1,4- beta -glucosidase (EC 3.2.1.74) that is classified as a Family 3 glycoside hydrolase under the CAZy system (see URL afmb.cnrs-mrs.fr/CAZY/index.html for reference).
[0082] By "modified Family 3 beta-glycosidase", it is meant a Family 3 beta-glycosidase which comprises one or more of the amino acid substitutions, introduced by genetic engineering
techniques, selected from the group consisting of V43I, V43C, VlOlA, VlOlG, F260I, F260V, F260Q, F260D, I543N, I543A, I543S, I543G and I543L (TrCeBA numbering) and which amino acid sequence is at least 80% identical to the amino acid sequence of the parental Family 3 beta- glycosidase from which it is derived For example, the amino acid sequence of the modified Family 3 beta-glycosidase may be from about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.9% identical to the amino acid sequence of the parental Family 3 beta-glycosidase from which it is derived.
[0083] Sequence identity can be readily determined by alignment of the amino acids of the two sequences, either using manual alignment, or any sequence alignment algorithm as known to one of skill in the art, for example but not limited to, BLAST algorithm (BLAST and BLAST 2.0; Altschul et al., 1997 and 1990), the algorithm disclosed by Smith & Waterman (1981), by the homology alignment algorithm of Needleman & Wunsch (1970), by the search for similarity method of Pearson & Lipman (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection. An alignment of 45 Family 3 beta-glycosidase sequences is provided in Figure 11.
[0084] It will be understood that the modified Family 3 beta-glycosidase may be derived from wild-type Family 3 beta-glycosidase or from a Family 3 beta-glycosidase that contains other amino acid substitutions. Alternatively, after production of the modified Family 3 beta- glycosidase comprising mutations selected from the group consisting of V43I, V43C, VlOlA, VlOlG, F260I, F260V, F260Q, F260D, I543N, I543A, I543S, I543G and I543L, it may be subsequently further modified to contain additional amino acid substitutions, including but not limited to those set forth above.
[0085] By "TrCel3A numbering" it is meant the numbering corresponding to the position of amino acids based on the amino acid sequence of TrCeOA (SEQ ID NO:1) based on alignment of the amino acid sequence of the Family 3 beta-glycosidase with the TrCel3A amino acid sequence. An example of the alignment of 44 other Family 3 beta-glycosidase amino acid sequences with the TrCeBA beta-glucosidase amino acid sequence is provided in Figure 11.
[0086] As used herein in respect of modified Family 3 beta-glycosidase amino acid sequences, "derived from" refers to the isolation of a target nucleic acid sequence element encoding the desired modified Family 3 beta-glycosidase using genetic material or nucleic acid or amino acid sequence information specific to the corresponding parental Family 3 beta- glycosidase. As is known by one of skill in the art, such material or sequence information can be used to generate a nucleic acid sequence encoding the desired modified Family 3 beta- glycosidase using one or more molecular biology techniques including, but not limited to, cloning, sub-cloning, amplification by PCR, in vitro synthesis, and the like.
[0087] In one embodiment of the invention of the invention, the amino acid sequence of the modified Family 3 beta-glycosidase is from about 80% to about 99.9% identical to the amino acid sequence of the parental Family 3 beta-glycosidase from which it is derived. For example, the amino acid sequence of the Family 3 beta-glycosidase may be from about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.9% identical to the amino acid sequence of the parental Family 3 beta-glycosidase from which it is derived, hi other words, the number of amino acid substitutions in the modified Family 3 beta-glycosidase does not exceed 20% of the total number amino acids in the parental Family 3 beta-glycosidase sequence.
[0088] The modified Family 3 beta-glycosidase of the present invention exhibit improvements in at least on of the following kinetic parameters: KP, Ks and kcat . KP is defined as the concentration of product which reduces the enzymatic activity of the Family 3 beta- glycosidase by 50%. Ks is defined as the concentration of substrate at which the Family 3 beta- glycosidase exhibits half its maximal rate. The kcat is the catalytic rate constant for the hydrolysis of substrate.
[0089] In another embodiment of the invention, the amino acid sequence of the modified Family 3 beta-glycosidase is from about 90% to about 99.9% identical to the amino acid sequence of the parental Family 3 beta-glycosidase from which it is derived. For example, the amino acid sequence of the modified Family 3 beta-glycosidase may be from about 95% to about 100% identical to SEQ ID NO: 1.
[0090] In another embodiment, the amino acid sequence of the modified Family 3 beta- glycosidase may be from about 80% to about 99.9% identical to the amino acid sequence of the
parental Family 3 beta-glycosidase from which it is derived, and the modified Family 3 beta- glycosidase may exhibit (a) an increase in the KP, (b) a decrease in Ks, or (c) an increase in kcat relative to the KP, Ks and/or kcat of a parental Family 3 beta-glycosidase from which is derived .
[0091] By "parental Family 3 beta-glycosidase", it is meant a Family 3 beta-glycosidase that does not contain:
isoleucine or cysteine at position 43,
alanine or glycine at position 101;
isoleucine, valine, glutamine, aspartic acid at position 260; or
asparagine, alanine, serine, glycine or leucine at position 543.
[0092] The modified Family 3 beta-glycosidase may be derived from a parental Family 3 beta-glycosidase that comprises one or more naturally-occurring amino acid(s) at the substituted positions corresponding to that of the modified Family 3 beta-glycosidase, but that is otherwise identical to the modified Family 3 beta-glycosidase, for example a native Family 3 beta- glycosidase from A nidulans -AN 1804.2, B. fuckeliana, T. aurantiacus levisporus. The parental Family 3 beta-glycosidase may contain one or more amino acid substitutions at other positions, given that these substitutions are also present in the corresponding modified Family 3 beta- glycosidase. Family 3 beta-glycosidases suitable as parental beta-glycosidases from which modified Family 3 beta-glycosidases may be derived are provided in Table 3.
Table 3: Family 3 beta-2lvcosidases
Aspergillus niger CBS 513 88 Anl8gO357O (BgIl) CAK48740.1 Aspergillus oryzae b-glucosidase CAD67686.1 Aspergillus oryzae RIB 40 b-glucosidase BAE54829.1 (AO090009000356)
Aspergillus oryzae RIB 40 b-glucosidase 5 BAE57053.1
(Bgl5; AO090001000544) Aspergillus oryzae RIB 40 b-glucosidase 1 BAE58551.1 (Bgll;AO090003001511)
Botryotinia fuckeliana b-glucosidase (Sapl) CAB61489 1 Coccidioides posadasii C735 b-glucosidase/ exo-b-1,3- AAF21242.1 glucosidase (Bgl2)
Coccidioides posadasii C735 b-glucosidase (BgIl) AAB67972.1 Dictyostelium discoideum Ax3 b-glucosidase AAA74233.1 Hordeum vidgare exo-l,3-gUicanase π AAC49170.1
(EII;ExoII)
Hypocreajeconna QM6a Cel3c - Cel3C AAP57756.1 Hypocreajeconna QM6a Cel3e - Cel3E AAP57760.1 Hypocreajeconna QM6a Cel3d (fragment) - CeBD AAP57759.1 Hypocreajeconna QM6a b-glucosidase - CeBB AAP57755.1 Hypocreajeconna RutC-30 b-xylosidase (BxIl) CAA93248.1 Kluyveromyces fragilis b-glucosidase CAA29353.1 Kuraishia capsulata 35M5N b-glucosidase (BgIN) AAA91297.1 Nicotiana tabacum b-glucosidase BAA33065 1 Pericoma sp BCC 2871 b-glucosidase ABX84365.1 Phaeosphaena avenana WACl 293 b-glucosidase (BgIl) CAB82861.1 Phanerochaete chrysosponum K-3 glucan b-l,3-glucosidase (BgI) BAB85988.1 Phanerochaete chrysosponum glucan 1,3-b-glucosidase (CbgL) AAC26489.1 OGClOl - BgIlA
Pichia anomala var acetaethenus b-glucosidase CAA26662.1 Piromyces sp E2 b-glucosidase (Cel3A) - Cel3A AAO41704.1 Saccharomycopsis fibuhgera b-glucosidase 2 (Bgl2) AAA34315.1 Saccharomycopsis fibuligera b-glucosidase 1 (BgIl) AAA34314.1 Schizosaccharomyces pombe 972h- b-glucosidase (SPBCl 683 04) CAB91166.1 Septoπa lycopersici b-glucosidase AAB08445.1
(tomatinase;B2Tom)
Talaromyces emersonn b-glucosidase - Cel3A AAL69548 3 Thermoascus aurantiacus b-glucosidase (Bg2,BGII) AAY33982.1 Thermoascus aurantiacus IFO 9748 b-glucosidase (Bgll;Bgl) AAZ95587.1 Thermoascus aurantiacus var b-l,4-glucosidase (BgIl) ABX79552 1 levisporus
Thermoascus aurantiacus var b-I,4-glucosidase (Bgl2) ABX56926.1 levisporus
Trichoderma vinde AS 3 3711 b-D-glucoside glucohydrolase AAQ76093 1 (BgIl)
Tropaeolum majus b-glucosidase CAA07070.1 Uromyces viciae-fabae b-glucosidase (BgIl) CAE01320.1 Volvanella υolvacea V14 b-glucosidase (Bgl,BGL-II) AAG59831 1
EXAMPLES
[0093] The present invention will be further illustrated in the following examples. However, it is to be understood that these examples are for illustrative purposes only and should not be used to limit the scope of the present invention in any manner.
[0094] Example 1 describes the strains and vectors used in the following examples.
Example 2 describes the cloning of the TrCeBA gene and transformation in yeast. Example 3 summarizes the preparation of the error prone-PCR and site-saturation mutagenesis libraries of TrCel3A. Example 4 describes the selection and expression of wild-type and modified TrCeDA beta-glucosidases from microculture. Example 5 describes the high-throughput screening assays to identify modified TrCel3 A beta-glucosidases with improved kinetic parameters. Example 6 describes the construction of modified TrCeBA beta-glucosidases comprising multiple amino acid substitutions. Example 7 describes the expression and purification of wild-type and modified TrCeBA beta-glucosidases from large scale flask cultures. Example 8 describes the measurement of the KG and K02 of modified and native TrCeBA beta-glucosidases and the calculation of kinetic parameters. Example 9 describes the measurement and calculation of kcat for wild-type and modified TrCeBA beta-glucosidases. Example 10 describes the construction of genetically modified Trichoderma reesei strains expressing cellulase mixtures comprising modified TrCeBA beta-glucosidases and the production of such cellulase mixtures in submerged liquid culture fermentation. Example 11 describes the hydrolysis of pretreated lignocellulosic substrates with cellulase mixtures comprising parental and modified TrCeBA beta-glucosidases.
Example 1: Strains and Vectors
[0095] Saccharomyces cerevisiae strain BJ3505 (pep4::HIS3 prb-Δl .6R HIS3 lys2-208 trp 1 -Δ 101 ura3-52 gal2 canl ) was obtained from Sigma and was a part of the Amino-Terminal Yeast FLAG Expression Kit. The YEp352/PGK91-l vector was obtained from the National Institute of Health. The pGEM T-easy vector was obtained from Promega. The vector pC/XBGl-TV is described in U.S. Patent No. 6,105,703.
Example 2: Cloning of the TrCel3A gene into YEp352/PGK91-l and transformation in yeast
[0096] The TrCeBA gene (SEQ ID NO: 44) contains two introns. One intron is located in the secretion signal at position 323 bp to 391 bp, while the other is located within the gene at position 2152 bp to 2215 bp. The TrCeBA gene contains a unique MeI site located at position 1203 bp. In order to facilitate expression from yeast and cloning using MeI and Kpnl restriction enzymes, the unique MeI located within TrCeBA at position 1203 bp and the second intron were removed by a three step PCR. The TrCeBA gene was amplified in three segments from a plasmid containing a genomic subclone of the coding region, including introns, of the mature TrCeBA beta-glucosidase, pC/XBGl-TV using iPROOF DNA polymerase (BioRad). The first fragment (A) was amplified using primers which introduced an MeI site at the 5' end of the gene downstream of the secretion signal (AT048) and which removed the internal MeI site (AT051). The second fragment (B) was amplified using primers which removed the internal MeI site (AT050) and the intron at position 2152 to 2215 bp (AT053). The third fragment (C) was amplified using primers which removed the intron at position 2152 to 2215 bp (AT052) and introduced a. Kpnl site at the 3' end of the gene, downstream of the stop codon (AT049). Gene products B and C were joined together (to make gene product D) using PCR with primers AT050 and AT049. Gene product D was joined with gene product A using PCR with primers AT048 and AT049 to obtain TrCeBA without introns and with unique MeI and Kpnl sites at the 5' and 3 ' ends, respectively. The final gene product was cloned into the pGEM T-easy vector (Promega) as per the manufacturer's instructions to make plasmid pGEM-TrCeBA. Primer sequences are shown below:
AT048: 5' CGC CAG GCTAGC GTTGTA CCTCCTGC (SEQ IDNO: 24)
AT049: 5' CTG AGGGTACCG CTA CGC TAC CGA C (SEQ IDNO: 25)
AT050: 5' CCC GCTAGTATTGCC GTC GTTGGATC (SEQ ID NO: 26)
AT051: 5' CCAACG ACG GCA ATACTA GCG GGC TTC (SEQ IDNO: 27)
AT052: 5' GTT CGG CTA TGGACT GTC TTA CAC CAA GTT CAA CTA C (SEQIDNO: 28)
AT053: 5' GTT GAACTT GGT GTA AGA CAG TCC ATA GCC GAACTC (SEQ IDNO: 29)
[0097] Preparation of YEp352/PGK91-l/αssTrCel3A was conducted as follows. A DNA adapter containing MeI, Kpnl, and EcoRl restriction sites was prepared by annealing primers AT046 and AT047 together. The adapter was inserted into a YEp based-plasmid containing the pgkl promoter, alpha mating factor secretion signal, andpgkl terminator sequences to make
plasmid YEp352/PGK91-l/αssNKE. Specifically, the adapter was inserted as an NheVEcoRl fragment into the MeI and EcoRl sites located downstream of the alpha mating factor secretion signal and upstream of thepgkl terminator. Primer sequences are shown below:
AT046: 5' CTA GCT GAT CAC TGA GGT ACC G (SEQ ID NO: 30) AT047: 5' AAT TCG GTA CCT CAG TGA TCA G (SEQ ID NO: 31)
[0098] Plasmid pGEM-TrCeBA was digested with MeI and EcoRl to release the 2235 bp TrCeBA gene. The fragment was purified and ligated into the MeI and EcoRl sites of YEp352/PGK91-l/αssNKE to obtain YEp352/PGK91-l/αssTrCel3A. The resulting vector YEp352/PGK91-l/αss-TrCel3A was transformed in yeast strain BJ3505 using the procedure described by Gietz, R. D. and Woods, R. A. (2002).
[0099] Preparation of YEp352/PGK91-l/αss6H-TrCel3A was conducted as follows. A DNA adapter containing Spel, Nhel, Kpnl, and EcoRl restriction sites was prepared by annealing primers AT044 and AT045 together. The adapter contains sequences coding for six histidine residues downstream of the Spel site and upstream of the MeI site. The adapter was inserted into a YEp based-plasmid containing thepgkl promoter, alpha mating factor secretion signal, andpgkl terminator sequences to make plasmid YEp352/PGK91-l/αss6HNKE. Specifically, the adapter was inserted as an NheVEcoRl fragment into the MeI and EcoRl sites located downstream of the alpha mating factor secretion signal and upstream of thepgkl terminator. Primer sequences are shown below:
AT044: 5' CTA GTC ATC ACC ATC ACC ATC ACG CTA GCT GAT CAC TGA GGT ACC G (SEQ ID NO: 32)
AT045: 5' AAT TCG GTA CCT CAG TGA TCA GCT AGC GTG ATG GTG ATG GTG ATG A (SEQ ID NO: 33)
[00100] Plasmid pGEM-TrCel3A was digested with MeI and EcoRl to release the 2235 bp TrCel3 A gene. The fragment was purified and ligated into the MeI and EcoRl sites of YEp352/PGK91-l/αss6HNKE to obtain YEp352/PGK91-l/αss6H-TrCel3A. The resulting vector YEp352/PGK91-l/αss6H-TrCel3A (Figure 1) was transformed in yeast strain BJ35O5 using the procedure described by Gietz, R. D. and Woods, R. A. (2002).
Example 3: Random Mutagenesis of TrCeBA a. Error Prone-PCR
[00101] A random mutagenesis library was generated by error-prone PCR using a Mutazyme® II DNA polymerase method. A series of four independent PCRs was performed using 5, 10, 15, 20 ηg of YEp352/PGK91-l/αss6H-TrCel3A vector and the Mutazyme® II DNA polymerase with primers YαN21 and 3'PGK-term. Annealing temperature was set to 5O0C. The amplification was done for 20 cycles. The four PCR products were pooled and diluted to 16 ηg/μL. The YEp352/PGK91 - l/αss6H-TrCel3A vector was digested with Nhel and Kpnl and the empty vector fragment was isolated. This linear fragment and the final amplicon were transformed simultaneously and cloned by in vivo recombination into yeast strain BJ3505 (Butler, T. and Alcalde, M. ,2003).
YαN21: 5'AGC ACA AATAAC GGG TTA TTG(SEQ IDNO: 34)
3'PGK-term: 5'GCAACA CCT GGC AAT TCC TTA CC (SEQ IDNO: 35)
b. Site-Saturation Mutagenesis
[00102] Four TrCeBA libraries were created using site-saturation mutagenesis (SSM) with degenerate primers (NNS) targeting amino acid positions V43, VlOl, F260, and 1543. SSM was performed using a two-step PCR method involving megaprimer synthesis followed by PCR- mediated overlap extension. PCR reactions were carried out using the High Fidelity iProof Taq Polymerase (BioRad). YEp352/PGK91-l/αss6H-TrCel3A was used as the template for the V43X, F260X, and I543X libraries, while YEp352/PGK91-l/αss6H-TrCel3A (S72N, F96L, VlOlM, N369K, A386T) served as the template for the VlOlX library.
[00103] For each SSM library, MegaPrimer A was amplified using the external primer YαN21 with an internal reverse primer, while MegaPrimer B was derived by combining the external primer PGKterm with an internal forward primer. The internal forward primers contained a degenerate codon sequence to introduce random amino acid substitutions within their target sites. The megaprimers were purified using the Wizard® SV Gel and PCR Clean-Up System.
YαN21 : 5'AGC ACA AAT AAC GGG TTA TTG (SEQ ID NO: 34)
PGKterm: 5 'GCA ACA CCT GGC CCT TAC C (SEQ ID NO: 35)
V43X-F: 5 'TGG AAC GGC GGT CCT TGC NNS GGA AAC ACA TCT CCG GCC TC
(SEQ ID NO: 36)
V43X-R: 5'GCA AGG ACC GCC GTT CCA(SEQ IDNO: 37)
MlOlX-F: 5'C GGT GAG GAGNNS AAG GCC TCG G (SEQ IDNO: 38)
MlOlX-R: 5'ATG AAC TGT CCACGT TCG CGG (SEQ IDNO: 39)
F260X-F: 5'TG TCA ATG CCTGGC ACAGAC NNS AAC GGTAAC AATCGG (SEQIDNO:
40)
F260X-R: 5'GT CTG TGC CAG GCATTG ACA (SEQIDNO: 41)
I543X-F: 5'CCC AAT GAC TAT AAC ACTCGC NNS GTT TCC GGC GGC AGT GAC (SEQ IDNO: 42)
I543X-R: 5'GCG AGT GTT ATA GTC ATT GGG (SEQ IDNO: 43)
[00104] In the second round of PCR, both megaprimers for a given SSM library were allowed to anneal and extend for 10 cycles to generate the final template. The external primers YαN21 and PGKterm were then added for another 25 cycles to amplify the final product, which was subsequently purified using the Wizard® SV Gel and PCR Clean-Up System. Both the purified PCR product and the linearized vector YEp352/PGK91-lαss-6H-TrCel3A (Nhel + Nrul) were transformed and cloned via in vivo recombination within the BJ3505 yeast strain using the procedure described by Gietz, R. D. and Woods (2002).
Example 4: Selection and growth of yeast strains expressing parental and modified TrCeBA beta-glucosidases.
[00105] This example describes the selection and expression of parental (TrCeB AWt) and modified TrCel3 A beta-glucosidase from Saccharomyces cerevisiae for use in high-throughput screening assays.
[00106] S. cerevisiae transformants were grown on plates containing synthetic complete medium (SC: 2% agar w/v, 0.17% yeast nitrogen base w/v, 0.192% -Ura drop-out supplement w/v, 2% glucose w/v, 2% casamino acids w/v, 0.5% ammonium sulfate w/v, pH 5.5) for 3-4 days at 300C. Each growth plate was replicated by transferring a portion of each colony, using sterilized velvet, to a screen-out plate containing SC medium plus 0.1 % esculin hydrate and 0.03% FeCl3. Colonies which turned black after incubation for 3-4 days at 30°C were identified
as expressing active beta-glucosidase (Figure 2). Colonies were correlated back to their original growth plate and selected for liquid media expression cultures by toothpick inoculation of 1 mL SC media in sterile 96-deepwell plates containing one glass bead (1.5 - 2.0 mm diameter). Expression cultures were grown for 3 days at 3O0C and 245 rpm with humidity control (New Brunswick Scientific Innovag44 incubator shaker series). Glycerol stocks were prepared by transferring 50 μL of liquid culture to the corresponding wells of a microplate containing 50 μL of 40% glycerol and stored at -8O0C. Expression culture plates were centrifuged at 1600 X g for 5 minutes to pellet cells and supernatant was aspirated for screening assays (Example 5).
Example 5: Screening of TrCel3A Gene Libraries for Modified TrCel3A beta-glucosidases with Higher Catalytic Efficiency
[00107] This example describes the screening of modified TrCel3A beta-glucosidases for increased higher catalytic efficiency by comparison to parental TrCel3 A that had been cloned into Saccharomyces cerevisiae.
[00108] Modified TrCeBA beta-glucosidases expressed from yeast as described in Example 4 were tested in two 80 μL citrate buffered (pH 5) cellobiose hydrolysis assays using a 96-well PCR plate format. A 40 μL aliquot of supernatant containing a parental or modified TrCeBA beta-glucosidase was incubated with 30 mM cellobiose (Assay 1) and 5.0 mM cellobiose plus 1.25 mM glucose (Assay 2) for 5, 10, 20 and 40 min at 500C in an MJ Research Tetrad™2 Peltier Thermal Cycler. Contained in each 96-well PCR plate were six parental TrCeBA controls used for comparison. Enzyme activity was measured through the detection of glucose using a glucose oxidase- peroxidase coupled assay (Trinder P., 1969). Exogenous glucose (1.25 mM) included in Assay 2 was subtracted from the total amount of glucose measured following the incubation. An Assay 2/ Assay 1 enzyme activity ratio was calculated for the parental (TrCeBAWt or Wt) and all modified TrCeBA beta-glucosidases by dividing the enzyme activity in Assay 2 by the enzyme activity in Assay 1. The Assay 2/ Assay 1 activity ratio for each modified TrCeBA beta- glucosidase was then compared to that of the average of six parental TrCeBA beta-glucosidase controls on a particular microplate and positives were selected at the 95% confidence level using a t-test. . All positive modified TrCeBA beta-glucosidases were produced again in microculture and re-screened to reduce the number of false positives (Figure 3). Table 4 lists the positive
modified TrCeBA beta-glucosidases obtained from screening the error-prone and site-saturation libraries (Example 3) and the Assay 2/Assay 1 enzyme activity ratios compared to the parental, wild-type TrCeBA beta-glucosidase.
Table 4. Modified TrCeBA beta-glucosidases selected random libraries.
Example 6: Construction and expression of modified TrCeDA beta-glucosidases with multiple amino acid substitutions
[00109] Using YEp352/PGK91-l/αss6H-TrCel3A(S72N-F96L-V101M (U.S. Publication No. 2010/0093040A1) as a template, additional mutations were introduced using a two-step PCR method involving megaprimer synthesis followed by megaprimer PCR using High Fidelity iProof Tag Polymerase (Table 5). The internal primers were modified to introduce the desired amino acid substitutions into the TrCeBA construct. The external plasmid primers (YαN21 and PGKterm) were used to amplify the final product. The megaprimers and final products were purified using the Wizard® SV Gel and PCR Clean-Up System.
[00110] To facilitate cloning, the final product was digested with Nhel + Kpnl and ligated into vector YEp352/PGK91-l/αss6H-TrCel3A linearized with Nhel + Kpnl. The ligation mix was transformed into DH5a chemically-competent E. coli cells, plasmid extracted, and sequenced. Plasmids encoding the modified beta-glucosidases were transformed into yeast strain BJ3505.
YαN21 5 '-AGCACAAATAACGGGTTATTG-S ' (SEQ ID NO: 34)
3'PGKterm 5'-GCAACACCTGGCCCTTACC-S' (SEQ ID NO: 35)
5OK067 5'-CGCGAACGTGGACAGTICATCGGTGAGGAGATG-S' (SEQ ID NO: 45)
3 'DK068 5'-CATCTCCTCACCGATGAACTGTCCACGTTCGCG-S ' (SEQ ID NO: 46)
5OK105 5'-CAATGCCTGGCACAGACATCAACGGTAACAATC-S' (SEQ ID NO: 47)
3'DKl 06 5'-GATTGTTACCGTTGATGTCTGTGCCAGGCATTG-S' (SEQ ID NO: 48)
5OK221 5'-GGCGGTCCTTGCATTGGAAACACAT-S' (SEQ ID NO: 49)
3 'DK222 5 '-ATGTGTTTCCAATGC AAGGACCGCC-3 ' (SEQ ID NO: 50)
5OK223 5 '-GACTATAACACTCGCGACGTTTCCGGCGGCAG-S ' (SEQ ID NO: 51)
3OK224 5'-CTGCCGCCGGAAACGICGCGAGTGTTATAGTC-S' (SEQ ID NO: 52)
5OK229 5'-GACTATAACACTCGCAACGTTTCCGGCGGCAG-S' (SEQ ID NO: 53)
3 'DK230 5 '-CTGCCGCCGGAAACGTJGCGAGTGTTATAGTC-S ' (SEQ ID NO: 54)
5OK231 5'-GACTATAACACTCGCCTGGTTTCCGGCGGCAG-S' (SEQ ID NO: 55)
3'DK232 5'-CTGCCGCCGGAAACCAGGCGAGTGTTATAGTC-S' (SEQ ID NO: 56)
Example 7: Purification of Modified TrCel3A Beta-glucosidases
[00111] Modified TrCeDA beta-glucosidases that passed the selection criteria in Example 5, along with the modified TrCel3A-F260X beta-glucosidases produced by site-saturation mutagenesis at position 260 (Example 4) or by combining two or more amino acid substitutions (Example 6), were purified for further analysis. For each modified TrCel3A beta-glucosidase, 50 mL of sterile YPD medium (10 g/L yeast extract, 20 g/L peptone and 20 g/L glucose) was inoculated with 10 mL of overnight cultures of transformed Saccharomyces cerevisiae grown from cells freshly picked from an agar plate. The cultures were then incubated for 96 hours at 300C with shaking at 200 rpm.
[00112] After incubation, the broth from each culture was centrifuged for 10 minutes at 9000 rpm and the pellet (containing yeast cells) discarded. The pH of the supernatant was adjusted to 5.0. The TrCeBA in each spent culture medium was then purified by immobilized metal affinity chromatography (IMAC) using His-Trap NTA/Ni2+ columns from GE Healthcare (catalogue #17-5247-01). Purified proteins were concentrated and buffer exchanged using Vivaspin 20 centrifugal concentrators (Sartorius Stedim Biotech, catalogue No. VS2012). Protein concentrations were measured using the method of Bradford (1976) and stored at -200C. Samples of each purified Modified TrCeBA were separated by SDS-PAGE and visualized by Coomassie Blue stain (Figure 4).
Example 8: Measuring the Kc and KG2 constants of Parental and Modified TrCeBA Beta- glucosidases
[00113] The KG and K02 constants of each modified TrCeBA beta-glucosidase were determined using a/j-nitrophenyl-beta-D-glucopyranoside (pNPG) competitive substrate/inhibitor real-time kinetic assay. Each modified TrCeBA (3 μg/reaction) was incubated with 0.4 mMpNPG in a stirred cuvette; the total reaction volume was 3 mL. Assays were buffered using 50 mM citrate, pH 5.0. Incubations were done at 5O0C for up to 40 min in a Varian Cary UV/Vis spectrophotometer. Absorbance measurements collected at 340 nm during the time course were converted top-nitrophenol (pNP) concentration using Equation 1.
pNp = Abs34Onm - εpNPG pNPG Equat]on l
EpNP ~ εpNPG
where, pNP is the concentration of p-mtrophenol (mM),
Abs340nmls the absorbance at 340 nm, εpNPG is the the extinction coefficient at 340 nm of pNPG at pH 5 0 (3.33 L mol ' cm ' ± 0 04) pNPG is the initial concentration of pNPG (mM), εpNP is the extinction coefficient at 340 nm of pNP at pH 5 0 (5 96 L mol ' cra ' ± 0.02)
[00114] Three different incubations were done for each modified TrCeBA: 1) with/>NPG alone, 2) with/?NPG and 3 mM cellobiose, and 3) withpNPG and 5 mM glucose. The/?NP concentration as a function of time in each of the three reactions was modeled according to
Equation 2 using a fourth order Runge-Kutta workbook in MS Excel and using the method of least squares.
Α _±P*rG - ε- PNPG Equation 2 pNPG + KpNPG 1 + ^- + ~ -
where, dpNP/dt is the rate of conversion of pNPG to pNP (mM/min), kpNPG is the catalytic rate constant for the conversion of pNPG to pNP (μmol/min/mg protein),
E is the concentration of TrCel3A (mg/mL), pNPG is the concentration of p-nitrophenyl-beta-D-glucopyranoside (mM),
KpNPG is the Michaelis constant (or Km) for pNPG (mM),
G2 is the concentration of cellobiose (mM),
KG2 is the Michaelis constant (or Km)for cellobiose (mM),
G is the concentration of glucose (mM),
KG is the glucose inhibition constant (mM).
[00115] The reaction scheme for this assay is shown in Figure 5. In this model, CeBA hydrolyzes pNPG according to Michaelis-Menten kinetics. Cel3 A activity is assumed to be inhibited competitively by glucose as described by the inhibition constant, KG. Therefore, when glucose was added to a cuvette containing pNPG, the rate of pNPG catalysis decreased. The decrease in the rate of pNPG hydrolysis is accounted for by the KQ parameter. Modified TrCel3 A beta-glucosidases with a higher KQ value are less affected by glucose, compared to the parental TrCel3AWt, and will have relatively higher rates of pNPG hydrolysis under these conditions. Similarly, when cellobiose was included in the reaction with pNPG, the rate of pNPG hydrolysis decreased. Modified TrCeBA beta-glucosidases with a lower KG2 value are more affected by the addition of cellobiose, compared to TrCel3AWt, and will have relatively lower rates of pNPG hydrolysis under these conditions.
[00116] The rates of pNPG hydrolysis were assayed for each modified TrCel3A in each of the three conditions, pNPG alone, pNPG + G2 and pNPG + G, by using a global fit of these three data sets to the parameters £pNpG, KPNPG, hax, K02 and KQ in manner known by one of skill in the art. A KG/KQ2 ratio was also calculated using the values of KQ and KG2 from each global fit of the three data sets for each modified TrCel3 A.
Each modified TrCeBA was assayed in this manner between two and five times. The average KG, K02 and KG/KG2 values determined in this manner and their standard deviations are shown in Table 6. Student's t-test was used to identify modified TrCeBA beta-glucosidases with statistically significant improvements in KG, KG2 and KG/KG2 (P<0.05) compared to TrCeB Awt. Graphs showing representative pNPG hydrolysis data and model fits for TrCeBA-WT (Figure 6), TrCeBA-V43I (Figure 7), TrCeBA-VlOlA (Figure 8), TrCeBA-F260I (Figure 9) and TrCeB A-I543N (Figure 10) are also shown.
[00117] The K0 values of TrCeB A-V43C (4.20 mM), TrCeB A-F260I (0.92 mM), TrCeBA-F260D (0.70 mM), TrCel3A-F260Q (0.69 mM), TrCeBA-F260V (0.72 mM) and TrCeB A-I543N (0.94 mM) were higher than that of TrCeB Awτ (0.58 mM). This indicates that the activity of each of these modified TrCeBA beta-glucosidases is significantly less inhibited by glucose and that they maintain relatively higher activity in the presence of glucose than does the parental TrCeBA beta-glucosidase. The values of KG2 of several modified TrCeBAs with single amino acid substitutions, such as TrCeB A- V43I (0.62 mM) and TrCeBA-VlOlA (0.82 mM), were significantly (<0.001 and 0.001, respectively) lower than the KG2 of wild-type TrCeBA (1.18 mM). Similarly, most of the modified TrCeBAs with different combinations of more than one amino acid substitution had lower KQ2 than wild-type. These modified TrCeBA beta- glucosidases exhibit maximum activity at lower concentrations of cellobiose, indicating that they have a higher affinity for cellobiose. In a cellulose hydrolysis system, such as the conversion of cellulose to fermentable sugars utilizing cellulase such as that from Trichoderma reesei or other cellulolytic fungi, the use of a TrCeBA with a lower K02 would contribute to lowering steady- state concentrations of cellobiose and lower product inhibition of cellulase enzymes.
[00118] The value of KG, K02, K</KG2 and ko2 for each modified TrCeBA was divided by the value of the corresponding parameter for the parental TrCeBA in order to calculate the relative values shown in Table 2. These results show that the TrCeB A- V43I (1.41), TrCeBA- VlOlA (1.34), TrCeBA-F260I (1.52) and TrCeBA-I543N (1.35) beta-glucosidases have substantially improved KG/KG2; improvements ranged from 35-52%, relative to TrCeBAwt.
Example 9: Measuring the Catalytic Rate Constant of Parental and Modified TrCel3A beta-glucosidases.
[00119] Initial rate assays were used to measure the catalytic rate constant (kcat) of the parental and each modified TrCeBA beta-glucosidase on cellobiose. Purified wild-type parental and modified TrCeBA beta-glucosidases were incubated with 12 concentrations of cellobiose, ranging from 0.3 to 40 mM. The protein concentration in each of the reactions was 1 μg/mL. Samples were incubated at 500C for 15 min in deep well plates and then placed in a boiling water bath for 10 min to stop the reaction. The concentration of glucose produced at each concentration of substrate was measured as described in Example 7.
[00120] The rate of cellobiose consumption for the parental and each modified TrCeBA beta-glucosidase was plotted as a function of cellobiose concentration. As the cellobiose concentration increases from 0.4 mM to 10 mM, the reaction rate of wild-type TrCeBA increases until it reaches an apparent maximum reaction rate (Figure 12). Further increasing the substrate concentration results in a gradual decrease in the reaction rate, a phenomenon that is reportedly due to substrate inhibition (Cascalheira et al., 1999). As a result, data for the reaction rate as a function of cellobiose concentration were modeled using a modified form of the Michaelis- Menten equation which incorporates a Ksj term for uncompetitive substrate inhibition (Equation 3).
kcaCJ - G2
*∞ = *m Equation 3 dt Gl G22
1 + + --
KG2 KG2 ■ κsi
where, dG2/dt is the rate of conversion of cellobiose (G2) to two glucose molecules (2G) (mM G2 consumed/min), kcat is the catalytic rate constant for the conversion of cellobiose to glucose (μmol of G2 consumed/min/mg protein),
E is the concentration of TrCeBA (mg/mL),
G2 is the concentration of cellobiose (mM),
K02 is the Michaelis constant (or Km) for cellobiose (mM),
KSi is the cellobiose substrate inhibition constant (mM)
[00121] The kcat is the TrCeBA rate constant on cellobiose and K8; is the parameter that describes the substrate inhibition. The data for the parental and each modified TrCeBA beta- glucosidase were fit to this model by non-linear regression using the method of least squares as
known to those of skill in the art. The parental and each modified TrCeBA beta-glucosidase were assayed in triplicate on three different occasions. The mean values of kcat, K8; and their standard deviations are shown in Table 6.
[00122] The kcat of several modified TrCel3 As, including TrCeB A-F260I ( 11.06 μmol/min/mg), TrCel3A-I543S (9.76 μmol/min/mg) and TrCel3A-I543L (11.50 μmol/min/mg) was significantly higher than that of wild-type TrCeDA (8.92 μmol/min/mg) (Table 6 and Figure 12). Therefore, these modified beta-glucosidases catalyze the conversion of cellobiose to two glucose molecules at a faster rate than does wild-type TrCel3 A. In a cellulose hydrolysis system, such as the conversion of cellulose to fermentable sugars utilizing cellulase such as that from Trichoderma reesei, the use of a TrCeBA with a higher kca, would contribute to lowering steady- state concentrations of cellobiose and lower product inhibition of cellulase enzymes.
Table 6: Kinetic Parameters of Parental and Modified TrCeI3A beta-glucosidases. The KG,
K02, KG/KG2, kcat and Ks; parameters for parental (TrCeBA-Wt) and modified beta-glucosidases were determined as described in Examples 8 and 9. Significant improvements (P value < 0.05) in any of these parameters are shown in bold text.
Λvalue
TrCeBA- KG KG2 P-value KG/KQ2 P-value h
Heat P-value κsi (mM) (KG) (mM) (K02) (KG/KG2) (μmol/min/mg) (*«> (mM)
V431 0.42+0.04 <0.001 0.65+0.07 <0.001 0.66+0.06 <0.001 6.73±0.13 0.018 64.1
V43C 4.20±0.57 <0.001 2.39±0.33 <0.001 1.79+0.38 O.001 ND" - ND"
VlOlA 0.54+0.18 0.593 0.82±0.16 0.001 0.65+0.09 0.006 7.22±0.18 0.049 52.5
F260I 0.92±0.04 O.001 1.23+0.03 0.22 0.75+0.02 <0.001 11.06±0.29 0.017 60.8
F260D 0.70 - 1.31 - 0.53 - ND" - ND"
F260Q 0.69 - 1.34 - 0.51 - ND" - ND"
F260V 0.72 1.28 - 0.56 - ND" - ND"
I543N 0.87+0.12 0.001 1.39 + 0.21 0.064 0.64+0.11 0.019 6.53±0.17 0.006 85.5
1543 W 0.56+0.08 0.635 0.95±0.08 0.003 0.59+0.06 0.041 4.53+0.24 <0.01 42.3
1543S 0.63 - 1.08 - 0.59 - 9.76+0.15 <0.01 102.7
I543A 0.68 - 1.16 - 0.59 - 8.96±0.19 0.944 94.5
I543G 0.54 - 1.02 - 0.53 - 8.02±0.14 <0.01 98.7
I543L 0.61 - 1.13 - 0.55 - 11.50±0.12 <0.01 129.4
S72N- 0.44±0.03 <0.001 0.68±0.04 <0.001 0.65+0.05 0.019 8.45±0.35 0.605 38.3 VlOl M- F2601
V43I-S72N- 0.34+0.08 0.001 0.46±0.04 O.001 0.73±0.04 <0.001 7.55±0.19 0.034 38.0 Vl OlM
S72N- 0.43±0.05 0.001 0.64±0.04 <0.001 0.66+0.03 O.001 7.73±0.13 <0.01 40.8 VlOl M- I543N
S72N- 0.36+0.02 <0.001 0.53±0.04 <0.001 0.68±0.03 0.005 ND ND Vl Ol M- I543D
S72N- 0.42+0.04 <0.001 0.69±0.06 <0.001 0.61+0.06 0.004 8.57+0.30 0.638 35.0
Vl OlM- 1543L
V43I-S72N- 0.34+0.09 0.009 0.36±0.09 <0.001 0.93±0.08 <0.001 6.98+0.25 0.029 34.6 Vl Ol M- F2601
S72N- 0.64±0.04 0.108 0.84+0.04 <0.001 0.77+0.08 0.004 9.12±0.14 0.580 31.8 VlOlM- F260I-I543N
V43I-S72N- 0.41+0.02 <0.001 0.38+0.04 <0.001 1.10+0.11 0.001 6.14+0.04 <0.001 49.3 VlOlM- F260I-I543N
V431-S72N- 0.30+0.01 <0.001 0.32±0.03 <0.001 0.95±0.09 0.001 6.51 ±0.07 <0.001 51.7 VlOl M- 1543N
S72N- O.5O±O.O3 0.010 0.66±0.06 <0.001 0.77±0.10 0.008 8.88±0.24 0.816 53.6 VlOl M- F260I-1543L
Wt 0.58 +0.09 - 1.18 + 0.12 - 0.49±0.06 - 8.92±0.29 - 66.1 (parental)
" ND=not determined
Example 10. Expression of modified Cel3A in Trichoderma reesei
10.1: Trichoderma reesei strains
[00123] Strain P59G is a genetically modified strain that produces and secretes high levels of the beta-glucosidase encoded by T. reesei bgll as described in U.S. Patent No. 6,015,703. The parent strain of P59G and modified Cel3A over-expressing transformant 4115 A, is strain BTR213aux. The strain BTR213 is a derivative of RutC30 (ATCC #56765; Montenecourt and Eveleigh, 1979) produced by random mutagenesis and first selected for ability to produce larger clearing zones on minimal media agar containing 1% acid swollen cellulose and 4 g L4 2- deoxyglucose and then selected for the ability to grow on lactose media containing 0.2 μg/mL carbendazim. A undine auxotroph of BTR213, BTR213aux, was obtained through selection of mutants spontaneously resistant to 0.15% w/v 5-fluoroorotic-acid (FOA).
10.2: Generation of T. reesei transformation vector
[00124] The T. reesei expression vector was generated using pUCl 9 vector (Fermentas) as a backbone. To introduce spacers and cloning sites required for cloning of selection and expression cassettes two DNA fragments were amplified using pCAMBIABOl plasmid (see URL: cambia.org/daisy/cambia/materials/vectors.SZS.htrn^sySδS) as a template and two pairs
of primers ACl 66/AC 167 and ACl 68/AC 169 (Table 7). The first fragment was cloned into the EcoRVSacl sites of pUC19 introducing two new PacVAβll restriction sites. The second fragment was cloned into the SacVBamUl sites introducing Notl/Mlul restriction sites and generating pUC19-GDR vector.
[00125] For the construction of the TrCeBA expression cassette, a fragment containing the TrCel7A promoter and xylanase 2 secretion signal (Pcel7a-Xyn2ss fragment) was amplified using primers AC230 / AC231 (Table 7) and pC/XBG -TV vector (US 6,015,703) as template. The gene encoding TrCel3A-S72N-V101M-F260I (described in Example 6) was amplified using primers AC232 and AC233 (Table 7). The Pcel7a-Xyn2ss fragment was ligated to the TrCeBA- S72N-V101M-F260I encoding gene in two subsequent PCR reactions using primers AC230 and AC233 (Table 7) to produce the resulting c/xCel3A- S72N-V101M-F260I fragment. A fragment comprising the celόa terminator (Tcelόa fragment) was amplified from the pC/XBG -TV (US 6,015,703) template using primers Tcel6a-F and Tcel6a-R (Table 7), which introduced BamHl I Kpnl restriction sites, respectively. The c/xCeBA- S72N-V101M-F260I and Tcelόa fragments were cloned into pGEM-Teasy vectors generating vectors pGEM-c/xCel3A- S72N-V101M- F260I and pGEM-Tcelόa which were then digested with MIuV Kpnl and BamHVKpnl restriction enzymes to release the c/xCel3A- S72N-V101M-F260I and Tcelόa fragments, respectively. Both fragments were gel isolated and cloned by three fragment ligation into MIuV BamHl sites of the pUC-GDR vector, generating pc/xCel3A- S72N-V101M-F260I. To eliminate the Sbfl restriction site, pc/xCeBA- S72N-V101M-F260I was digested with Xball Sphl and the ends modified by removal of the 5' overhang and filling in of the 3' overhang. The linear plasmid was then ligated back together generating pc/xCeBA- S72N-V101M-F260I -Sbf. Next, a 2.2 kb fragment containing the N. crassa orotidine-5' -phosphate decarboxylase (pyr4) gene was amplified from pNcBgl (U.S. Patent No.6,939,704) containing N. crassa pyr4 gene under control of its native promoter and terminator using primers AC323 and AC343 (Table 7). The pyr4 cassette was cloned into pGEM-T-easy, digested with PacVNotl restriction enzymes, gel purified and cloned into PacVNotl sites of pc/xCeBA- S72N-V101M-F260I -Sbf generating final transformation vector pc/xCel3A-S72N-V101M-F260I-pyr4-TV (Figure 13).
Table 7. Primers used for construction of T. reesei transformation vector pc/xCel3A-AT012;F260I-pyr4-TV.
Primer name Primer sequence
AC166 ACTGAATTCTTAATTAAGAACCGACGACTCGTCCGTC (SEQ ID NO: 57)
AC167 GTGGAGCTCCTTAAGGTGACATCGGCTTCAAATGGC (SEQ ID NO: 58)
AC168 GCAGAGCTCGCGGCCGCGAACCGACGACTCGTCCGTC (SEQ ID NO: 59)
AC169 CTGGGATCCGATATCACGCGTGTGACATCGGCTTCAAATGGC (SEQ ID NO:
60)
AC230 TTTACGCGTGATTATGGCGTACTAGAGAGCGG (SEQ IDNO: 61)
AC231 CTGCAGGAGGTACAACCTGGCGCTTCTCCACAGCCACGG (SEQ IDNO: 62)
AC232 GTGGAGAAGCGCCAGGTTGTACCTCCTGCAGGGACTCCATG (SEQ IDNO: 63)
AC233 TTTGGTACCCTACGCTACCGACAGAGTGCTCG (SEQIDNO: 64)
AC323 TTTGCGGCCGCCATCATTCGTCGCTTTCGG (SEQ IDNO: 65)
AC343 TTCGATCGACTATACCACCACCCACCG (SEQ IDNO: 66)
Tcel6A-F CTGGGTACCGGCTTTCGTGACCGGGCTTC (SEQIDNO: 67)
Tcel6A-R CTGGGATCCGATGGACTAGTACAGCCATG (SEQIDNO: 68)
10.3: Trichodeπna reesei transformation and characterization of transformants
[OO 126] Trichoderma strain 4115 A was generated by transformation of pc/xCel3 A-S72N- V101M-F260I-pyr4-TV into strain BTR213aux by biolistic gold particle bombardment using the PDS-1000/He system (BioRad; E.I. DuPont de Nemours and Company). Gold particles (median diameter of 0.6 um, BioRad Cat. No. 1652262) were used as microcarriers. The following parameters were used in the optimization of the transformation: a rupture pressure of 1100 psi, a helium pressure of 29 mm Hg, a gap distance of 6 mm and a target distance of 6 cm. The spore suspension was prepared by washing T. reesei spores from PDA plates incubated for 4-5 days at 300C with sterile water. About 5x107 spores were plated on 60 mm diameter plates containing minimal media agar (MM). After particle delivery, all transformation plates were incubated at 300C for 5-10 days. All transformants were transferred to minimal media agar and incubated at 30°C.
Minimal medium (MM*) agar:
Component Amount for IL of medium
KH2PO4 1O g
(NH4)2SO4 6 g
Na3Citrate-2H2O 3 g
FeS(WH2O 5 mg
MnSO4-H2O 1.6 mg
ZnSO4-7H2O 1.4 mg
CaCl2-2H2O 2 mg
Agar 2O g
20% Glucose f.s. 50 ml
1 M MgSO4-7H2O f.s. 4 mL pH to 5.5
*MMSS agar contains the same components as MM agar plus 1.2 M sorbitol, 4 mM MgSO4, 1 g/L YNB (Yeast Nitrogen Base w/o Amino Acids from DIFCO Cat. No.291940) and 0.12 g/L amino acids (-Ura DO Supplement from CLONTECH Cat. No.8601-1).
[00127] All T. reesei transformants were pre-screened for production of active modified TrCel3A beta-glucosidase using Esculin (β-D-glucose-6,7-dihydroxycoumarin) plate assay. An esculin stock solution was made by mixing 2 g of Esculin and 0.6 g FeCl3 in 200 mL of deionized water. The mixture was heated until dissolved, cooled to approximately 400C and filter sterilized. Transformants were plated on minimal media agar plates containing 1% cellobiose and grown for 3 to 4 days at 30°C. The esculin stock solution was diluted four-fold with 250 mM citrate buffer, pH 4.8 and 15 mL of the diluted esculin solution were overlaid onto the plates. Plates were incubated at 300C for one hour. Positive transformants were selected according to formation of black precipitate formed around T. reesei colonies.
[00128] Individual Trichoderma colonies selected for the expression of active modified TrCeBA beta-glucosidases were transferred to potato dextrose agar (PDA) (Difco) plates and allowed to sporulate. At that time, about 104- 106 spores of each individual transformant, parental and P59G strains were used to inoculate 1 mL of microculture medium in 24- well micro-plates.
Microculture medium
Component g/L
(NH4)2SO4 12.7
KH2PO4 8.0
MgSO4«7H2O 4.0
CaCl2-2H2O 1.02
CSL 5.0
CaCO3 20.0
Carbon source** 30-35
Trace elements* 2mL/L pH 5.5
*Trace elements solution contains 5 g/L FeSO4 «7H20; 1.6 g/L MnSO4 «H20; 1.4 g/Ll ZnSO4«7H20. ** glucose, Solka floe, lactose, cellobiose, sophorose, com syrup, or Avicel. The carbon source can be sterilized separately as an aqueous solution at pH 2 to 7 and added to the remaining media initially or through the course of the fermentation.
[00129] The cultures were incubated at a temperature of 300C with shaking at 250 rpm for 6 days. The biomass was separated from growth media containing the secreted protein by centrifugation at 12000 rpm. The protein concentration was determined using the Bio-Rad Protein Assay (Cat. No. 500-0001).
[00130] The concentration of Cel3A in supernatants from Trichoderma reesei microcultures was determined by ELISA (Figure 14). Filtrate and purified component standard were diluted 0.01-10 μg/mL (based on total protein) in phosphate-buffered saline, pH 7.2 (PBS) and incubated overnight at 40C in microtitre plates (Costar EIA #9018). These plates were washed with PBS containing 0.1% Tween-20 (PBS/Tween) and then incubated in PBS containing 1% bovine serum albumin (PBS/BSA) for 1 hr at room temperature. Blocked microtitre wells were washed with PBS/Tween. Rabbit polyclonal antisera specific for TrCel3A was diluted (1:8,000) in PBS/BSA, added to separate microtitre plates and incubated for 2 h at room temperature. Plates were washed and incubated with a goat anti-rabbit antibody coupled to horseradish peroxidase (Sigma #A6154), diluted 1/2000 in PBS/BSA, for 1 h at room temperature. After washing, tetramethylbenzidine was added to each plate and incubated for 30 min at room temperature. The absorbance at 360 nm was measured in each well and converted into protein concentration using a TrCeBA standard curve.
10.4: Trichoderma reesei pilot fermentation
[00131] For 14 L pilot fermentations, T. reesei strains were grown on Potato Dextrose Agar at 28-3O0C until a confluent lawn of spores was obtained. Spores were collected and used to inoculate 750 ml of Berkeley media (10 g/L glucose, 1.4 g/L (NH4)2SO4, 2.0 g/L KH2PO4, 0.31 g/L MgSO4-7H20, 0.53 g/L CaCl2, 5.1 g/L dry corn steep, 5 mg/L FeSO4-7H2O, 0.8 mg/L MnSO4-H2O, 0.7 mg/L ZnSO4-7H2O) in a 2 L baffled flask. After 3 days of growth at 280C and 150 rpm, this culture was used to inoculate 10 L of fermentation medium with the following initial composition: 13 g/1 glucose, 2.2 g/1 (NH4)2SO4, 1.39 g/1 KH2PO4, 0.7 g/1 MgSO4-7H20, 0.185 g/1 CaCl2, 6 g/1 dry corn steep, 1.75 mg/1 FeSO4-7H2O, 0.56 mg/1 MnSO4-H2O, 0.49 g/1 ZnSO4-7H2O. A fed-batch aerobic fermentation using an inducing carbohydrate source was run for 6 days at pH 5 and 28°C in a 14 L New Brunswick Microferm fermentor. After 6 days, the culture was filtered over Harborlite 1500S and the culture filtrate saved.
[00132] The concentration of parental or modified TrCel3A beta-glucosidases in fermentation filtrate from Trichoderma reesei was determined by ELISA as described above (Example 10.3).
Example 11: Measuring the cellulose hydrolysis activity of a whole cellulase secreted by a strain of Trichoderma that expresses high levels of a modified beta-glucosidase.
[00133] A whole enzyme produced by a strain of Trichoderma that expresses high concentrations of a modified beta-glucosidase, TrCel3A-S72N-V101M-F260I, was compared to that from a strain that expresses similar concentrations of the parental, wild-type TrCel3A in an extended hydrolysis time course assay on a lignocellulosic substrate. The concentrations of the wild-type and the modified beta-glucosidase in their respective whole cellulase mixtures were 31.1±1.7% and 28.2±1.3% of total protein, respectively. Whole Trichoderma cellulase mixtures containing these TrCeBA beta-glucosidases were incubated with pretreated wheat straw at a concentration of 25 g/L cellulose at a dose of 10 mg of total cellulase mixture per gram of cellulose. Triplicate assays were performed for each cellulase mixture under the same conditions. The hydrolysis assays were buffered in 50 mM citrate, pH 5.0 containing 0.1% sodium benzoate. The assay was conducted at 500C for 96 hr with continuous orbital shaking.
Aliquots of 0.7 mL were taken at various time points from each flask and the glucose concentration in the soluble portion was assayed and converted into a measure of fractional cellulose conversion. The conversion data were then fit with a rectangular hyperbola with an additional linear term using minimization of the sum of squared residuals of fit. The equation was of the following form: conversion = (max*time)/(halfmax + time) + c*time. Both sets of data were fit globally with unique max and halfmax values and a shared value of the variable c.
[00134] The results are shown in Figure 15. This figure demonstrates that the fractional cellulose conversion measured for the cellulase mixture containing the modified TrCeBA beta- glucosidase was higher at 96 hr (0.99±0.03) than for the cellulase mixture containing the wild- type TrCeBA beta-glucosidase (0.89±0.02). This increase in fractional cellulose conversion was statistically significant (P<0.05, Student's T-Test).
References
Berghem, L.E. and Pettersson, L.G. (1974) The mechanism of enzymatic cellulose degradation. Isolation and some properties of a beta-glucosidase from Trichoderma viride. European Journal of Biochemistry, 46(2):295-305.
Bhatia, Y., Mishra, S. and Bisaria, V.S. (2002) Microbial beta-Glucosidases: Cloning, Properties and Applications. Critical Reviews in Biotechnology, 22(4):375-407)
Bradford, M.M. (1976) A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry, 72:248-254.
Butler, T. and Alcalde, M. (2003) In Methods in Molecular Biology, vol. 231: (F. H. Arnold and G. Georgiou, editors), Humana Press Inc. Totowa (New Jersey), pages 17-22.
Cascalheira, J.F., Queiroz, J. A. (1999) Kinetic study of the cellobiase activity of Trichoderma reesei cellulase complex at high substrate concentrations. Biotechnology Letters, 21(8):651-655
Chen, H., Li, X. and Ljungdahl, L.G. (1994) Isolation and properties of an extracellular beta- glucosidase from the polycentric rumen fungus Orpinomyces sp. strain PC-2. Applied and Environmental Microbiology, 60(l):64-70.
Chirico, WJ. and Brown, R.D. Jr. (1987) Purification and characterization of a beta-glucosidase from Trichoderma reesei. European Journal of Biochemistry, 165(2):333-341.
Christakopoulos, P., Goodenough, P.W., Kekos, D., Macris, BJ., Claeyssens, M. and Bhat, M.K. (1994) Purification and characterization of an extracellular beta-glucosidase with transglycosylation and exo-glucosidase activities from Fusarium oxysporum. European Journal of Biochemistry, 224(2):279-385.
Eijsink VG, Gaseidnes C, Borchert TV, van den Burg B. 2005. Directed Evolution of Enzyme Stability. Biomol. Eng. 22:21-30
Enari, T.-M., Niku-Paavola, M.-L., Harju, L., Lappalainen, A. and Nummi, M. (1981) Purification of Trichoderma reesei and Aspergillus niger beta-glucosidase. Journal of Applied Biochemistry, 3:157-163.
Foreman, P.K., Brown, D., Dankmeyer, L., Dean, R., Diener, S., Dunn-Coleman, N.S., Goedegebuur, F., Houfek, T.D., England, G.J., Kelley, A.S., Meerman, H.J., Mitchell, T., Mitchinson, C, Olivares, H.A., Teunissen, P.J., Yao, H. and Ward, M. (2003) Transcriptional regulation of biomass-degrading enzymes in the filamentous fungus Trichoderma reesei. Journal of Biological Chemistry, 278(34):31988-31997.
Gietz, R.D. and Woods, R. A. (2002) Transformation of yeast by the Liac/ss carrier DNA/PEG method. In Methods in Enzymology, 350:87-96.
Gueguen, Y., Chemardin, P., Arnaud, A. and Galzy, P. (1995) Purification and characterization of an intracellular beta-glucosidase from Botrytis cinerea. Enzyme and Microbial Technology, 78:900-906.
Henrissat, B. (1991) A classification of glycosyl-dydrolases based on amino acid sequence similarities. Biochemical Journal, 293:781-788;
Henrissat, B. (1994) Cellulases and their interaction with cellulose. Cellulose, 1:169-196.
Henrissat, B. and Bairoch, A. (1996) Updating the sequence-based classification of glycosyl hydrolases. Biochemical Journal, 316:695-696
Holtzapple, M., Cognata, M., Shu, Y., and Hendrickson, C. (1990) Inhibition of Trichoderma reesei cellulase by sugars and solvents. Biotechnology and Bioengineering, 36:275.
Knowles, J., Lehtovaara, P. and Teeri, T. Cellulase families and their genes. (1987) Trends in Biotechnology, 5:255-261.
Li, X.L. and Calza, R.E. (1991) Purification and characterization of an extracellular beta- glucosidase from the Rumen Fungus Neocallimastix frontalis EB 188. Enzyme and Microbial Technology, 13:622-628.
Lynd, L.R., Weimer, P. J., van ZyI, W.H. and Preterms I. S. (2002) Microbial cellulose utilization: fundamentals and biotechnology. Microbiology and Molecular Biology Reviews, 66:506-577.
Perez-Pons, J.A., Cayetano, A., Rebordosa, X., Lloberas, J., Guasch, A. and Querol, E. (1994) A beta-glucosidase gene (bgl3) from Streptomyces sp. strain QM-B814. Molecular cloning, nucleotide sequence, purification and characterization of the encoded enzyme, a new member of family 1 glycosyl hydrolases. European Journal of Biochemistry, 223(2):557-565.
Riou, C, Salmon, J.M., Valuer, M.J., Gunata, Z. and Barre, P. (1998) Purification, characterization and substrate specificity of a novel highly glucose-tolerant beta-glucosidase from Aspergillus oryzae. Applied and Environmental Microbiology, 64(10):3607-3614.
Saha, B.C. and Bothast, RJ. (1996) Production, purification and characterization of a highly glucose-tolerant novel beta-glucosidase from Candida peltata. Applied and Environmental Microbiology, 62(9): 3165-3170.
Teeri, T.T. (1997) Crystalline cellulose degradation: new insight into the function of cellobiohydrolases. Trends in Biotechnology, 15(5): 160- 167.
Teleman, A., Koivula, A., Reinikainen, T., Valkeajarvi, A., Teeri, T.T., Drakenberg, T., and Teleman, O. (1995) Progress-curve analysis shows that glucose inhibits the cellotriose hydrolysis catalysed by cellobiohydrolase II from Trichoderma reesei. European Journal of Biochemistry, 231:250.
Trinder, P. (1969) Determination of glucose in blood using glucose oxidase with an alternative oxygen accepter. Annals of Clinical Biochemistry, 6:24-27.
Varghese, J.N., Hrmova, M., Fincher, G.B. (1999) Three-dimensional structure of a barley beta- D-glucan exohydrolase, a family 3 glycosyl hydrolase. Structure Fold.Des. 7: 179-190
Wood, T.M. and Garcia-Campayo, V. (1990) Enzymology of cellulose degradation. Biodegradation, 1:147-161.
Zhang, Y.H. and Lynd, L.R. (2004) Toward an aggregated understanding of enzymatic hydrolysis of cellulose. Biotechnology and Bioengineering, 88(7):797-824.
Claims
1. A modified Trichoderma reesei TrCeBA beta-glucosidase comprising one or more amino acid substitutions selected from the group consisting of V43X, VlOlX, F260X and I543X, the modified TrCeBA beta-glucosidase comprising an amino acid sequence which is from about 80% to about 99.9% identical to SEQ ID NO: 1.
2. The modified Trichoderma reesei TrCeBA beta-glucosidase of claim 1, comprising an amino acid sequence which from about 90% to about 99.9% identical to SEQ ID NO: 1.
3. The modified Trichoderma reesei TrCeBA beta-glucosidase of claim 1 or 2, wherein the one or more of the amino acid substitutions is selected from the group consisting of V43I, V43C, VlOlA, VlOlG, F260I, F260V, F260Q, F260D, I543N, I543W, I543A, I543S, I543G, and I543L.
4. The modified Trichoderma reesei TrCeBA beta-glucosidase of any one of claims 1 to 3, wherein the modified Trichoderma reesei TrCeBA beta-glucosidase exhibits: a. at least a 20% increase in KG , b. at least a 20% decrease in K02, or c. at least a 10% increase in kcat
relative to the KQ KQ2, or kcat of a parental Trichoderma reesei TrCeBA from which the modified Trichoderma reesei TrCeBA is derived.
5. The modified Trichoderma reesei TrCeBA beta-glucosidase of claim 4, wherein the modified Trichoderma reesei TrCeBA beta-glucosidase exhibits:
a. from about a 30% increase in Ko , b. from about a 30% decrease in K02, or c. from about a 20% increase in kcat
relative to the KG, KG2, or kcat of a parental Trichoderma reesei TrCeBA from which the modified Trichoderma reesei TrCel3A is derived.
6. The modified Trichoderma reesei TrCeBA beta-glucosidase of of any one of claims 1 to 5, further comprising one or more amino acid substitutions selected from the group consisting of V66X, S72X, F96X, T235X, N248X, N369X and A386X.
7. An isolated genetic construct comprising a nucleic acid sequence encoding a modified Trichoderma reesei TrCeBA beta-glucosidase comprising one or more of the amino acid substitutions selected from the group consisting of V43X, VlOlX, F260X and I543Xτ, wherein the amino acid sequence of the modified TrCeBA beta-glucosidase encoded by the construct is from about 80% to about 99.9% identical to SEQ ID NO: 1
8. An isolated genetic construct comprising a nucleic acid encoding a modified Trichoderma reesei TrCeBA beta-glucosidase comprising one or more of the amino acid substitutions selected from the group consisting of V43X, VlOlX, F260X and I543X., wherein the amino acid sequence of the modified TrCeBA beta-glucosidase encoded by the construct is from about 80% to about 99.9% identical to SEQ ID NO:, the modified Trichoderma reesei TrCeBA beta- glucosidase exhibiting:
a. at least a 20% increase in KG , b. at least a 20% decrease in KQ2, or c. at least a 10% increase in kcat
relative to a parental Trichoderma reesei TrCeBA from which the modified Trichoderma reesei TrCeBA is derived.
9. The isolated genetic construct of claim 8, wherein the modified TrCeBA beta-glucosidase encoded by the construct exhibits:
a. at least a 30% increase in KG b. at least a 30% decrease in KQ2, or
c. at least a 20% increase in kcat
relative to a parental Trichoderma reesei TrCeBA from which the modified Trichoderma reesei TrCeBA is derived.
10. An isolated genetically modified microbe comprising the genetic construct of any one of claims 7 to 9.
11. The isolated genetically modified microbe of claim 10, wherein said microbe is a species of yeast or filamentous fungus.
12. A process for producing a modified Trichoderma reesei TrCeBA beta-glucosidase, comprising the steps of (i) providing a genetically modified microbe comprising the genetic construct of any one of claims 7 to 9; (ii) culturing the genetically modified microbe in submerged liquid fermentations under conditions that induce the expression of the modified Trichoderma reesei TrCeBA beta-glucosidase; and (iii) recovering the modified Trichoderma reesei TrCeBA beta-glucosidase.
13. A process for enzymatic hydrolysis of a cellulose substrate comprising contacting the substrate with one or more cellulase enzymes and the modified Trichoderma reesei TrCeBA beta-glucosidase of any one of claims 1 to 6.
14. The process of claim 13, wherein the cellulose substrate is a pretreated lignocellulosic feedstock and wherein the process produces fermentable sugars.
15. The process of claim 14, wherein the pretreated lignocellulose feedstock is selected from the group consisting of corn stover, wheat straw, barley straw, rice straw, oat straw, canola straw, sugarcane straw, soybean stover, corn fiber, sugar beet pulp, pulp mill fines and rejects, sugar cane bagasse, hardwood , softwood, sawdust, switch grass, miscanthus, cord grass, and reed canary grass.
16. A modified Trichoderma reesei TrCeBA beta-glucosidase comprising the amino acid sequence of one of:
SEQ ID NO: 2 (TrCel3A-V43I);
SEQ ID NO: 3 (TrCel3A0V43C);
SEQ ID NO: 4 (TrCeBA-VlOlA);
SEQ ID NO: 5 (TrCeBA-VlOlG);
SEQ ID NO: 6 (TrCeBA-F260I);
SEQ ID NO: 7 (TrCeB A-F260V);
SEQ ID NO: 8 (TrCeB A-F260Q);
SEQ ID NO: 9 (TrCeBA-F260D);
SEQ ID NO: 10 (TrCeB A-I543N);
SEQ ID NO: 11 (TrCeBA-I543W);
SEQ ID NO: 12 (TrCeB A-I543 A);
SEQ ID NO: 13 (TrCeB A-I543S);
SEQ ID NO: 14 (TrCel3A-I543G);
SEQ ID NO: 15 (TrCeB A-I543 L);
SEQ ID NO: 16 (TrCeBA-S72N-V101M-F260I);
SEQ ID NO: 17 (TrCeBA-V43I-S72N-V101M);
SEQ ID NO: 18 (TrCeBA-S72N-V101M-I543N);
SEQ ID NO: 19 (TrCeBA-S72N-V101M-I543D);
SEQ ID NO: 20 (TrCeBA-S72N-V101M-I543L);
SEQ ID NO: 21 (TrCeBA- V43I-S72N-V101M-F260I);
SEQ ID NO: 22 (TrCeBA- V43I-S72N-V101M-F260I-I543N);
SEQ ID NO: 23 (TrCeBA-V43I-S72E-V101M-I543N);
SEQ ID NO: 69 (TrCeBA-S72N-V101M-F260I-I543N); or
SEQ ID NO: 70 (TrCeB A-S72N-V101 M-F260I-I543L).
17. A modified Family 3 beta-glycosidase comprising one or more of the amino acid substitutions at a position selected from the group consisting of V43I, V43C, VlOlA, VlOlG, F260I, F260V, F260Q, F260D, I543N, I543W, I543A, I543S, I543G, and I543L, theposition determined from alignment of a parental Family 3 beta-glycosidase with the TrCeBA amino acid sequence as defined in SEQ ID NO: 1, wherein the amino acid sequence of the modified Family 3 beta-glycosidase comprises a sequence which is from about 80% to about 99.9% identical to an
amino acid sequence of a parental Family 3 beta-glycosidase from which the modified Family 3 beta-glycosidase is derived.
18. The modified Family 3 beta-glycosidase of claim 17, wherein the amino acid sequence of the modified Family 3 beta-glycosidase is from about 80% to about 99.9% identical to an amino acid sequence of a parental Family 3 beta-glycosidase from which the modified Family 3 beta- glycosidase is derived, the modified Family 3 beta-glycosidase exhibiting
a. an increase in Kp b. a decrease in Ks, or c. an increase in kcat.
relative to the KP, Ks, or kcat of a parental Family 3 beta-glycosidase from which the modified Family 3 beta-glycosidase is derived.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2763836A CA2763836A1 (en) | 2009-05-29 | 2010-05-28 | Novel beta-glucosidase enzymes |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US18227509P | 2009-05-29 | 2009-05-29 | |
| US61/182,275 | 2009-05-29 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2010135836A1 true WO2010135836A1 (en) | 2010-12-02 |
| WO2010135836A8 WO2010135836A8 (en) | 2011-07-21 |
Family
ID=43220682
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CA2010/000807 Ceased WO2010135836A1 (en) | 2009-05-29 | 2010-05-28 | Novel beta-glucosidase enzymes |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US8486683B2 (en) |
| CA (1) | CA2763836A1 (en) |
| WO (1) | WO2010135836A1 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015075391A1 (en) | 2013-11-22 | 2015-05-28 | IFP Energies Nouvelles | Endoglucanase variants having improved activity, and uses of same |
| WO2015193587A1 (en) | 2014-06-20 | 2015-12-23 | IFP Energies Nouvelles | Variants of exoglucanases having improved activity and uses thereof |
| WO2015193588A1 (en) | 2014-06-20 | 2015-12-23 | IFP Energies Nouvelles | Variants of exoglucanases having improved activity and uses thereof |
| WO2017147690A1 (en) * | 2016-03-02 | 2017-09-08 | Valorbec Société en Commandite | Engineered beta-glucosidases and methods of use thereof |
| WO2017177289A1 (en) | 2016-04-15 | 2017-10-19 | Vtt International Oy | Process for conversion of biomass into fermentable sugars with integrated enzyme |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BRPI0918823A2 (en) * | 2008-08-29 | 2019-09-24 | Iogen Energy Corp | modified beta-glycosidases with improved stability |
| EP2599862B1 (en) * | 2009-11-20 | 2017-08-02 | Danisco US Inc. | Beta-glucosidase variants with improved properties |
| WO2011097713A1 (en) | 2010-02-11 | 2011-08-18 | Iogen Energy Corporation | Carbohydrate binding modules with reduced binding to lignin |
| CN103189516A (en) | 2010-11-02 | 2013-07-03 | 科德克希思公司 | Compositions and methods for production of fermentable sugars |
| US9562222B2 (en) * | 2011-11-18 | 2017-02-07 | Novozymes A/S | Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same |
| FR2994981B1 (en) * | 2012-09-05 | 2014-09-12 | Centre Nat Rech Scient | POLYPEPTIDE WITH BETA-GLUCOSIDASE ACTIVITY REINFORCED AT LOW TEMPERATURE |
| US9617574B2 (en) | 2013-03-15 | 2017-04-11 | Auburn University | Efficient process for producing saccharides and ethanol from a biomass feedstock |
| WO2015042064A1 (en) * | 2013-09-17 | 2015-03-26 | Edeniq, Inc. | Improved beta-glucosidase enzymes for increased biomass saccharification |
| EP4022076A1 (en) | 2019-08-29 | 2022-07-06 | Danisco US Inc. | Expression of beta-glucosidase in yeast for improved ethanol production |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008151079A2 (en) * | 2007-05-31 | 2008-12-11 | Novozymes, Inc. | Compositions for degrading cellulosic material |
| WO2010022518A1 (en) * | 2008-08-29 | 2010-03-04 | Iogen Energy Corporation | Modified beta-glucosidases with improved stability |
| FR2935986A1 (en) * | 2008-09-12 | 2010-03-19 | Inst Francais Du Petrole | BETA-GLUCOSIDASE VARIANTS WITH IMPROVED ACTIVITY AND USES THEREOF |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4461648A (en) * | 1980-07-11 | 1984-07-24 | Patrick Foody | Method for increasing the accessibility of cellulose in lignocellulosic materials, particularly hardwoods agricultural residues and the like |
| FR2736359B1 (en) * | 1995-07-06 | 1997-10-03 | Agronomique Inst Nat Rech | BETA-GLUCOSIDASE OF FILAMENTAL FUNGI, AND USES THEREOF |
| CA2165041C (en) | 1995-12-12 | 2005-07-05 | The University Of British Columbia | Methods and compositions for synthesis of oligosaccharides, and the products formed thereby |
| US5747320A (en) * | 1996-08-02 | 1998-05-05 | The United States Of America, As Represented By The Secretary Of Agriculture | Glucose and cellobiose tolerant β-glucosidase from Candida peltata |
| US6015703A (en) * | 1998-03-10 | 2000-01-18 | Iogen Corporation | Genetic constructs and genetically modified microbes for enhanced production of beta-glucosidase |
| EP1080204A2 (en) * | 1998-05-06 | 2001-03-07 | University of Georgia Research Foundation, Inc. | Beta-glucosidase coding sequences and protein from orpinomyces pc-2 |
| KR20030046570A (en) | 2001-12-05 | 2003-06-18 | 학교법인 경희대학교 | β-glucosidase gene derived from Trichoderma sp. and yeast transformant introduced with the gene |
| DK2228440T3 (en) * | 2003-05-02 | 2013-01-02 | Novozymes Inc | Variants of beta-glucosidases |
-
2010
- 2010-05-28 WO PCT/CA2010/000807 patent/WO2010135836A1/en not_active Ceased
- 2010-05-28 CA CA2763836A patent/CA2763836A1/en not_active Abandoned
- 2010-05-28 US US12/790,079 patent/US8486683B2/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008151079A2 (en) * | 2007-05-31 | 2008-12-11 | Novozymes, Inc. | Compositions for degrading cellulosic material |
| WO2010022518A1 (en) * | 2008-08-29 | 2010-03-04 | Iogen Energy Corporation | Modified beta-glucosidases with improved stability |
| FR2935986A1 (en) * | 2008-09-12 | 2010-03-19 | Inst Francais Du Petrole | BETA-GLUCOSIDASE VARIANTS WITH IMPROVED ACTIVITY AND USES THEREOF |
Non-Patent Citations (1)
| Title |
|---|
| SAHA B.C. ET AL.: "Production, Purification, and Characterization of a Highly Glucose- Tolerant Novel P-Glucosidase from Candida peltata", APPL. ENVIRON. MICROBIOL., vol. 62, no. 9, September 1996 (1996-09-01), pages 3165 - 3170 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015075391A1 (en) | 2013-11-22 | 2015-05-28 | IFP Energies Nouvelles | Endoglucanase variants having improved activity, and uses of same |
| WO2015193587A1 (en) | 2014-06-20 | 2015-12-23 | IFP Energies Nouvelles | Variants of exoglucanases having improved activity and uses thereof |
| WO2015193588A1 (en) | 2014-06-20 | 2015-12-23 | IFP Energies Nouvelles | Variants of exoglucanases having improved activity and uses thereof |
| FR3073230A1 (en) | 2014-06-20 | 2019-05-10 | Centre National De La Recherche Scientifique - Cnrs - | EXOGLUCANASE VARIANTS WITH IMPROVED ACTIVITY AND USES THEREOF |
| WO2017147690A1 (en) * | 2016-03-02 | 2017-09-08 | Valorbec Société en Commandite | Engineered beta-glucosidases and methods of use thereof |
| WO2017177289A1 (en) | 2016-04-15 | 2017-10-19 | Vtt International Oy | Process for conversion of biomass into fermentable sugars with integrated enzyme |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Also Published As
| Publication number | Publication date |
|---|---|
| US20100304438A1 (en) | 2010-12-02 |
| WO2010135836A8 (en) | 2011-07-21 |
| US8486683B2 (en) | 2013-07-16 |
| CA2763836A1 (en) | 2010-12-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8486683B2 (en) | Beta-glucosidase enzymes | |
| Harnpicharnchai et al. | A thermotolerant β-glucosidase isolated from an endophytic fungi, Periconia sp., with a possible use for biomass conversion to sugars | |
| Larue et al. | Directed evolution of a fungal β-glucosidase in Saccharomyces cerevisiae | |
| EP2076594B1 (en) | Process for enzymatic hydrolysis of pretreated lignocellulosic feedstocks | |
| US9885028B2 (en) | Carbohydrate binding modules with reduced binding to lignin | |
| US8143049B2 (en) | Modified beta-glucosidases with improved stability | |
| US8012734B2 (en) | Cellulase variants with reduced inhibition by glucose | |
| EP2357227A1 (en) | Optimized cellulase enzymes | |
| EP3212776B1 (en) | Compositions and methods related to beta-glucosidase | |
| EP2401370A1 (en) | Novel lignin-resistant cellulase enzymes | |
| US20150252340A1 (en) | Compositions and methods of us | |
| CN111094562A (en) | Polypeptides with trehalase activity and their use in methods for producing fermentation products | |
| US20160298157A1 (en) | Compositions comprising a beta-glucosidase polypeptide and methods of use | |
| WO2014070837A1 (en) | Beta-glucosidase from magnaporthe grisea | |
| US20150252344A1 (en) | Beta-glucosidase from neurospora crassa | |
| US8110389B2 (en) | Family 6 cellulase with decreased inactivation by lignin | |
| US8263379B2 (en) | Modified family 6 glycosidases with altered substrate specificity | |
| EP2764098A2 (en) | Variant cbh i polypeptides with reduced product inhibition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10779979 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2763836 Country of ref document: CA |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10779979 Country of ref document: EP Kind code of ref document: A1 |







