WO2010135558A1 - Systhetic polypeptide libraries and methods for generating naturally diversified polypeptide variants - Google Patents
Systhetic polypeptide libraries and methods for generating naturally diversified polypeptide variants Download PDFInfo
- Publication number
- WO2010135558A1 WO2010135558A1 PCT/US2010/035619 US2010035619W WO2010135558A1 WO 2010135558 A1 WO2010135558 A1 WO 2010135558A1 US 2010035619 W US2010035619 W US 2010035619W WO 2010135558 A1 WO2010135558 A1 WO 2010135558A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- sequences
- human
- sequence
- region
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/005—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies constructed by phage libraries
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
- C40B40/08—Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
Definitions
- the invention relates to the generation of libraries of DNA sequences encoding homologous polypeptides and to the use of such libraries.
- This invention in particular relates to the generation of collections of synthetic antibody fragments in which one or several complementary determining regions (CDR) are replaced by a collection of the corresponding CDR captured from a natural source.
- CDR complementary determining regions
- the invention further relates to the generation of collections of antibody fragments containing CDR derived from an immunized animal and their use as a better source to derive high affinity antibody fragments.
- the invention further relates to the diversification of a portion of a polypeptide by inserting a diversified sequence of synthetic or natural origin without the need for modification of the original polypeptide coding sequence.
- An antibody is composed of four polypeptides: two heavy chains and two light chains.
- the antigen binding portion of an antibody is formed by the light chain variable domain (VL) and the heavy chain variable domain (VH). At one extremity of these domains six loops form the antigen binding site and also referred to as the complementarity determining regions (CDR). Three CDRs are located on the VH domain (Hl, H2 and H3) and the three others are on the VL domain (Ll, L2 and L3).
- V(D)J complementarity determining regions
- the heavy chain is encoded by three segments called variable (V), diversity (D) and joining (J) segments whereas the light chain variable is formed by the recombination of only two segments V and J.
- V variable
- D diversity
- J joining
- a large number of antibody paratopes can be generated by recombination between one of the multiple copies of the V, D and J segments that are present in the genome.
- the V segment encodes the CDRl and CDR2 whereas the CDR3 is generated by the recombination events.
- somatic hypermutation SHM
- point mutations are introduced in the variable genes of the heavy and light chains and in particular into the regions encoding the CDRs. This additional variability allows for the selection and expansion of B cells expressing antibody variants with improved affinity for their cognate antigen.
- a first approach is to capture by gene amplification rearranged immunoglobulin genes from natural repertoires using either tissues or cells from humans or other mammals as a source of genetic diversity. These collections of rearranged heavy and light chains (VH and VL) are then combined to generate libraries of binding pairs that can be displayed on bacteriophage or on other display packages such as bacteria, yeast or mammalian cells. In this case a large fraction of the immunoglobulin repertoire found in the donor is captured. Thus all of the frameworks encoded by the donor germline genes can be found in such repertoires as well as diversity generated both by V(D)J recombination and by somatic hypermutation (Marks JD et al., J MoI Biol. 1991 Dec 5;222(3):581-97; McCaffety US Patent No. 5,969,108).
- a limitation of natural repertoires is that naturally occurring antibodies can be based on frameworks with low intrinsic stability that limit their expression levels, shelf life and their usefulness as reagents or therapeutic molecules.
- a number of methods have been developed to generate synthetic antibody libraries.
- a unique or a limited number of selected antibody framework encoded by their corresponding germline genes are selected.
- the selection of these frameworks is commonly based on their biochemical stability and/or their frequency of expression in natural antibody repertoires.
- synthetic diversity is then introduced in all or a subset of CDRs. Typically either the whole or part of the CDR is diversified using different strategies.
- Targeted residues can be those frequently involved in antigen contact, those displaying maximal diversity in natural antibody repertoires or even residues that would be preferentially targeted by the cellular machinery involved in generating somatic hypermutations during the natural affinity maturation process (Balint RF, Larrick JW. Gene. 1993 Dec 27;137(l):109-18.).
- the present invention provides methods of generating libraries of nucleic acid sequences that combine the benefits of stable framework selection and the insertion of naturally encoded complementarity determining regions (CDRs) or amino acid sequences that can fulfill the role of a CDR that have been selected in a natural context of a functional polypeptide such as an antibody.
- the method allows for the recovery of long CDRs or amino acid sequences that can fulfill the role of a CDR that are very difficult to encode using synthetic approaches.
- This invention by combining stable frameworks and properly folded CDRs or amino acid sequences that can fulfill the role of a CDR, maximizes the proportion of functional antibodies in the library and therefore the performance of the selection process and the quality of selected clones.
- the invention provides a method to capture naturally expressed CDRs from different species and to insert them into a human antibody framework. This allows for the use of CDR H3 repertoires that differ significantly in length and composition when compared to the human repertoire.
- the invention enables the generation of human antibody fragments featuring structural repertoires derived from other species and thus the capacity to sample different structural spaces.
- the present methods are also used to introduce CDRs of synthetic origin or amino acid sequences that can fulfill the role of a CDR with a higher success frequency than alternative methods introducing fewer errors causing frame shifts in the coding sequence. Libraries generated using the present methods contain a high frequency of functional variants. Libraries of variants generated according to this method are used for selection and screening with any described display, selection and screening technology.
- CDR H3 composition and length The analysis of immune repertoires from different species or, within a species, at different development stages has revealed some striking differences in the characteristics of CDR H3 composition and length. For instance the average CDRH3 length in humans is longer in adult when compared to fetal life or to newborns (Schroeder Jr, HW et al., 2001 Blood 98; 2745-2751). Interestingly despite large similarities between human and primate antibody germline genes, the evolution of the CDRH3 length during development differs (Link JM et al., Molecular Immunol. 2005 42; 943-955).
- mice and humans clearly shows that the average length is significantly shorter in mice (Rock EP et al., J Exp Med 1994 179; 323- 328).
- the average CDR H3 length increases in mice whereas it tends to decrease in humans and in addition the amino acid composition of the murine and human CDRH3 repertoires differ (Zemlin M et al., 2003 J MoI Biol 334; 733-749; Ivanov I et al., 2005 J Immunol 174; 7773-7780).
- the methods and antibody libraries provided herein are designed to exploit the various repertoires expressed by different species for the generation of therapeutic antibodies. These repertoires that explore different tridimensional spaces might allow for the generation of antibodies against a wider variety of target classes and epitopes. Methods to generate libraries form na ⁇ ve or immunized animals are well described and these methods allow for the capturing of the corresponding repertoires and the generation of antibodies. However, antibodies derived from these libraries are not of human origin and are therefore not well suited for human therapy without performing further engineering work such as humanization. There is therefore a need for novel methods to harness the diversity expressed in the repertoire from different species and to exploit this diversity in the therapeutically useful context of a human antibody.
- the methods and antibody libraries provided herein address several of the limitations described above and are an improvement over the current art.
- the methods provided herein combine the benefits of stable framework selection and the insertion of naturally encoded CDRs that have been selected in a natural context of a functional antibody.
- the methods allow for a highly efficient insertion of synthetic or natural CDRs sequences into an antibody framework that significantly minimizes the number of frame shifts in the library and therefore improves its quality.
- the invention allows for a novel way to use naturally occurring antibody structural diversity by capturing naturally expressed CDR H3 repertoires from different species and to insert them into human antibody frameworks. It is thus possible to exploit these structurally diverse repertoires in a productive way for the generation of antibodies for human therapy.
- the methods provided herein generate antibodies that contain a stable framework and correctly folded CDRs or amino acid sequences that can fulfill the role of a CDR.
- the methods capture the natural diversity of sequences in stable frameworks.
- the germline sequences for framework regions 1, 2 and 3 are selected from the desired organism, for example, from the human genome (see e.g., Figures 2 and 6).
- selected antibody variable domains are modified by introducing a stuffer sequence that will serve as an integration site for diversified sequences.
- Diversity is introduced into the sequence outside of the immunoglobulin coding region by introducing restriction enzyme recognition sites, for example, Type Hs restriction sites, at a desired location such as the variable heavy chain complementarity determining region 3 (CDR H3), the variable light chain complementarity determining region 3 (CDR L3), the variable heavy chain complementarity determining region 1 (CDR Hl), the variable light chain complementarity determining region 1 (CDR Ll), the variable heavy chain complementarity determining region 2 (CDR H2) or the variable light chain complementarity determining region 2 (CDR L2).
- restriction enzyme recognition sites for example, Type Hs restriction sites
- Diversified DNA sequences are generated with flanking sequences that include Type Hs restriction sites.
- the cohesive ends generated by the restriction enzymes are compatible and the reading frame is maintained, thus allowing the diversified DNA fragments to be ligated into an acceptor framework.
- the methods provided herein are also useful for generating amino acid sequences having diversified regions encoded therein.
- the sequences for the non-diversified portions of the encoded amino acid are selected from the desired organism, for example, from the human sequence.
- a portion of the encoded amino acid sequence is modified by introducing a stuff er sequence that will serve as an integration site for diversified sequences.
- Diversity is introduced into the sequence at the desired location(s) by introducing restriction enzyme recognition sites, for example, Type Hs restriction sites, at a desired location within the encoded amino acid sequence.
- Diversified DNA sequences are generated with flanking sequences that include Type Hs recognition sites.
- an "Acceptor Framework” is generated using a "stuffer fragment" of DNA that contain and are, preferably, bordered by two Type Hs restriction enzyme sites. (See e.g., Figure 6).
- these two Type Hs restriction enzyme sites digest sequences at the boundary of the site at which diversity is desired, such as, for example, the CDR H3 region, the CDR L3 region, the CDR Hl region, the CDR Ll region, the CDR H2 region or the CDR L2 region.
- the term "Acceptor Framework” refers to a nucleic acid sequence that include the nucleic acid sequences encoding the FRl, FR2, FR3 and FR4 regions, the nucleic acid sequences encoding two CDRs or amino acid sequences that can fulfill the role of these CDRs, and a "stuffer fragment" that serves as the site of integration for diversified nucleic acid sequence.
- the Acceptor Framework includes the nucleic acid sequences encoding the FRl, FR2, FR3 and FR4 regions, the nucleic acid sequences encoding the CDRl and CDR2 regions, and a "stuffer fragment" that serves as the site of integration for diversified nucleic acid sequence.
- the Acceptor Framework includes the nucleic acid sequences encoding the FRl, FR2, FR3 and FR4 regions, the nucleic acid sequences encoding the CDRl and CDR3 regions, and a "stuffer fragment" that serves as the site of integration for diversified nucleic acid sequence.
- the Acceptor Framework includes the nucleic acid sequences encoding the FRl, FR2, FR3 and FR4 regions, the nucleic acid sequences encoding the CDR2 and CDR3 regions, and a "stuffer fragment" that serves as the site of integration for diversified nucleic acid sequence.
- the terms "stuffer fragment”, “stuffer DNA fragment” and “stuffer sequence” or any grammatical variation thereof are used interchangeably herein to refer to a nucleic acid sequence that includes at least two Type Hs recognition sites and a diversified sequence.
- the Acceptor Framework can be a variable heavy chain (VH) Acceptor Framework or a variable light chain (VL) Acceptor Framework.
- VH variable heavy chain
- VL variable light chain
- the use of the Acceptor Frameworks and the stuffer fragments contained therein allow for the integration of a CDR sequence (natural or synthetic) or an amino acid sequence that can fulfill the role of the CDR into the acceptor framework with no donor framework nucleotides or residues contained therein or needed for integration.
- the use of the Acceptor Frameworks and the stuffer fragments contained therein allow for the integration of a CDR sequence (natural or synthetic) selected from CDR H3, CDR L3, CDR H2, CDR L2, CDR Hl and CDR Ll, or an amino acid sequence that can fulfill the role of a CDR selected from CDR H3, CDR L3, CDR H2, CDR L2, CDR Hl and CDR Ll into the acceptor framework with no donor framework nucleotides or residues contained therein or needed for integration.
- the stuffer fragment is removed in full, and the coding region of the acceptor protein and the inserted proteins fragments (i.e., the CDRs) are intact.
- the methods provided herein use primers that are designed to contain cleavage sites for Type Hs restriction enzymes at the boundary of the site of at which diversity is desired, for example, the CDR H3 region, the CDR L3 region, the CDR H2 region, the CDR L2, the CDR Hl region or the CDR Ll region.
- Random, naturally occurring CDR clones see e.g., Figure 10) or synthetic CDR sequences (see e.g., Example 6) or amino acid sequences that can fulfill the role of the CDR are captured in the Acceptor Frameworks used herein.
- random, naturally occurring CDR3 clones see e.g., Figure 10
- synthetic CDR3 sequences see e.g., Example 6
- amino acid sequences that can fulfill the role of a CDR3 are captured in the Acceptor Frameworks used herein.
- random, naturally occurring CDR2 clones see e.g., methods shown in Figure 10
- synthetic CDR2 sequences see e.g., methods shown in Example 6
- amino acid sequences that can fulfill the role of a CDR2 are captured in the Acceptor Frameworks used herein.
- random, naturally occurring CDRl clones see e.g., methods shown in Figure 10
- synthetic CDRl sequences see e.g., methods shown in Example 6
- amino acid sequences that can fulfill the role of a CDRl are captured in the Acceptor Frameworks used herein.
- oligonucleotides primers specific for flanking regions of the DNA sequence encoding the CDR H3 of immunoglobulins, i.e., specific for the FR3 and FR4 of the variable region were designed.
- Oligonucleotide primers specific for flanking regions of the DNA sequences encoding other regions can also be designed. These oligonucleotides contain at their 5 ' end a site for a Type Hs restriction enzyme whereas their 3' portion matches the targeted DNA sequence.
- the primer is a nucleic acid selected from the group consisting of SEQ ID NOs: 120-254.
- Type Hs restriction enzymes such as, for example, Fokl
- natural CDR sequences such as, for example, natural CDR H3, CDR L3, CDR Hl, CDR Ll, CDR H2, or CDR L2 sequences into the acceptor frameworks described herein.
- Type Hs restriction enzymes such as, for example, Fokl
- synthetic CDR sequences such as, for example, synthetic CDR H3, CDR L3, CDR Hl, CDR Ll, CDR H2, or CDR L2 sequences into the acceptor frameworks described herein.
- Type Hs restriction enzymes such as, for example, Fokl
- a desired CDR region such as, for example, an amino acid sequence that can fulfill the role of a natural or synthetic CDR H3, CDR L3, CDR Hl, CDR Ll, CDR H2, or CDR L2 region into the acceptor frameworks described herein.
- the Type Hs restriction enzymes are enzymes that cleave outside of their recognition sequence to one side. These enzymes are intermediate in size, typically 400-650 amino acids in length, and they recognize sequences that are continuous and asymmetric.
- Type Hs restriction enzymes also known as Type Hs restriction endonucleases, and the sequences they identify are described, for example, in Szybalski et al., "Class-IIS Restriction Enzymes - a Review.” Gene, vol. 100: 13-26 (1991), the contents of which are hereby incorporated in their entirety by reference.
- Primary Libraries include a VH Acceptor Framework and a fixed VL sequence (also referred to as a "dummy VL” sequence) or a VL Acceptor Framework and a fixed VH sequence (also referred to as a "dummy VH” sequence).
- Primary Libraries exhibit diversity in only one of the heavy or light chains.
- Secondary Libraries are generated by ligating a VH Acceptor Framework and a VL Acceptor Framework together (see e.g., Example 7). Secondary Libraries have diversity in both the heavy and light chains.
- the invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin heavy chain variable domain containing a plurality of heavy chain complementarity determining region 3 (CDR H3) isolated from the immunoglobulin variable domain repertoire from a non-human species.
- CDR H3 heavy chain complementarity determining region 3
- the method includes the steps of: (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct human immunoglobulin heavy chain variable domains, each Acceptor Framework nucleic acid sequence containing a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a complementarity determining region 1 (CDRl), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence including at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding heavy chain complementarity determining region 3 (CDR H3) sequences isolated from a non- human species immunoglobulin repertoire wherein each of the plurality
- step (b) as set forth above is performed by amplifying the CDR H3 sequence from a non human species using oligonucleotide primers containing a Type Hs restriction site. In some embodiments, step (b) as set forth above is performed by amplifying the CDR H3 sequence from a non human species using oligonucleotide primers containing a Fokl Hs restriction site. In some embodiments, the non-human species is non-human primate, rodent, canine, feline, sheep, goat, cattle, horse, or pig.
- the invention provides methods for producing a library of nucleic acids, wherein each nucleic acid encodes an immunoglobulin variable domain by (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a complementarity determining region 1 (CDRl), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence containing at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) regions or en
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by the same Type Hs restriction enzyme.
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by different Type Hs restriction enzymes.
- the Type Hs restriction enzyme recognition sites are Fokl recognition sites, Bsal recognition sites, and/or BsmBI recognition sites.
- the Acceptor Framework nucleic acid sequence is derived from a human gene sequence.
- the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence.
- the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.
- the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VKl -33, VKl -39, VK3-11, VK3- 15, and VK3-20.
- the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL 1-44 and VL 1-51.
- the plurality of diversified nucleic acids encodes
- CDR3 regions and the plurality of diversified nucleic acids includes naturally occurring sequences or sequences derived from immunized animals.
- the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR3 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the plurality of diversified nucleic acids encodes
- the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor
- the methods provided include the additional step of
- step (e) transforming the expression vector of step (d) into a host cell and culturing the host cell under conditions sufficient to express the plurality of Acceptor Framework sequences.
- the host cell is E. coli.
- the expression vector is a phagemid vector.
- the phagemid vector is pNDS 1.
- the invention also provides methods for producing a library of nucleic acids, wherein each nucleic acid encodes an immunoglobulin variable domain, by (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a stuffer nucleic acid sequence including at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 1 (CDRl) regions or
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by the same Type Hs restriction enzyme.
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by different Type Hs restriction enzymes.
- the Type Hs restriction enzyme recognition sites are Fokl recognition sites, Bsal recognition sites, and/or BsmBI recognition sites.
- the Acceptor Framework nucleic acid sequence is derived from a human gene sequence.
- the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence.
- the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.
- the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3- 15, and VK3-20.
- the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL 1-44 and VL 1-51.
- CDRl regions, and the plurality of diversified nucleic acids include naturally occurring sequences or sequences derived from immunized animals.
- the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDRl sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the plurality of diversified nucleic acids encodes
- the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDRl region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDRl region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.
- VH variable heavy chain
- the methods provided include the additional steps of
- step (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library.
- the host cell is E. coli.
- the expression vector is a phagemid vector.
- the phagemid vector is pNDS 1.
- the invention also provides methods for producing a library of nucleic acids, wherein each nucleic acid encodes an immunoglobulin variable domain, by (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a complementarity determining region 1 (CDRl), the FR2 and FR3 regions are interspaced by a stuffer nucleic acid sequence including at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 2 (CDR2) regions or
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by the same Type Hs restriction enzyme.
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by different Type Hs restriction enzymes.
- the Type Hs restriction enzyme recognition sites are Fokl recognition sites, Bsal recognition sites, and/or BsmBI recognition sites.
- the Acceptor Framework nucleic acid sequence is derived from a human gene sequence.
- the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence.
- the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.
- the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3- 15, and VK3-20.
- the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL 1-44 and VL 1-51.
- the plurality of diversified nucleic acids encodes
- CDR2 regions and the plurality of diversified nucleic acids includes naturally occurring sequences or sequences derived from immunized animals.
- the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR2 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the plurality of diversified nucleic acids encode CDR2 regions, and the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR2 region, and the plurality of diversified nucleic acids include synthetic sequences.
- the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.
- VH variable heavy chain
- the methods provided include the additional steps of
- step (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library.
- the host cell is E. coli.
- the expression vector is a phagemid vector.
- the phagemid vector is pNDS 1.
- the invention also provides methods for making a target-specific antibody, antibody variable region or a portion thereof, by (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a complementarity determining region 1 (CDRl), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence including at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) regions or encoding amino acid sequences that can fulfill the
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by the same Type Hs restriction enzyme.
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by different Type Hs restriction enzymes.
- the Type Hs restriction enzyme recognition sites are Fokl recognition sites, Bsal recognition sites, and/or BsmBI recognition sites.
- the Acceptor Framework nucleic acid sequence is derived from a human gene sequence.
- the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence.
- the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.
- the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3- 15, and VK3-20.
- the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL 1-44 and VL 1-51.
- the plurality of diversified nucleic acids encodes
- the plurality of diversified nucleic acids includes naturally occurring sequences or sequences derived from immunized animals.
- the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR3 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the plurality of diversified nucleic acids encodes
- the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids include synthetic sequences.
- the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.
- VH variable heavy chain
- the expression vector is a phagemid vector.
- the phagemid vector is pNDSl.
- the host cell is E. coli.
- the method includes the additional step of (i) sequencing the immunoglobulin variable domain encoding sequences that bind the target antigen.
- the invention also provides methods for making a target-specific antibody, antibody variable region or a portion thereof, by (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a stuffer nucleic acid sequence including at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 1 (CDRl) regions or encoding amino acid sequences that can fulfill
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by the same Type Hs restriction enzyme.
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by different Type Hs restriction enzymes.
- the Type Hs restriction enzyme recognition sites are Fokl recognition sites Bsal recognition sites, and/or BsmBI recognition sites.
- the Acceptor Framework nucleic acid sequence is derived from a human gene sequence.
- the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence.
- the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.
- the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VKl -33, VKl -39, VK3-11, VK3- 15, and VK3-20.
- the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL 1-44 and VL 1-51.
- the plurality of diversified nucleic acids encodes
- CDRl regions and the plurality of diversified nucleic acids includes naturally occurring sequences or sequences derived from immunized animals.
- the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDRl sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the plurality of diversified nucleic acids encodes
- the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDRl region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor
- the expression vector is a phagemid vector.
- the phagemid vector is pNDSl.
- the host cell is E. coli.
- the method includes the additional step of (i) sequencing the immunoglobulin variable domain encoding sequences that bind the target antigen.
- the invention provides methods for making a target-specific antibody, antibody variable region or a portion thereof, by (a) providing a plurality of Acceptor
- Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a complementarity determining region 1 (CDRl), the FR2 and FR3 regions are interspaced by a stuffer nucleic acid sequence including at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 2 (CDR2) regions or encoding amino acid sequences that can fulfill the role of a CDR2 region, wherein each of the plurality of diversified nucleic acid sequences includes a Type Hs restriction enzyme recognition site at each extrem
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by the same Type Hs restriction enzyme.
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by different Type Hs restriction enzymes.
- the Type Hs restriction enzyme recognition sites are Fokl recognition sites, Bsal recognition sites, and/or BsmBI recognition sites.
- the Acceptor Framework nucleic acid sequence is derived from a human gene sequence.
- the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence.
- the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.
- the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3- 15, and VK3-20.
- the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL 1-44 and VL 1-51.
- the plurality of diversified nucleic acids encodes
- CDR2 regions and the plurality of diversified nucleic acids includes naturally occurring sequences or sequences derived from immunized animals.
- the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR2 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the plurality of diversified nucleic acids encodes
- the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR2 region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR2 region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.
- VH variable heavy chain
- the host cell is E. coli.
- the expression vector is a phagemid vector.
- the phagemid vector is pNDS 1.
- the method includes the additional step of (i) sequencing the immunoglobulin variable domain encoding sequences that bind the target antigen.
- the invention also provides methods for producing a library of nucleic acids, wherein each nucleic acid encodes an immunoglobulin variable domain. These methods include the steps of (a) providing a plurality of Ig Acceptor Framework nucleic acid sequences into which a source of diversity is introduced at a single complementarity determining region (CDR) selected from the group consisting of complementarity determining region 1 (CDRl), complementarity determining region 2 (CDR2), and complementarity determining region 3 (CDR3), wherein the Ig Acceptor Framework sequence includes a stuffer nucleic acid sequence including at least two Type Hs restriction enzyme recognition sites, and wherein the source of diversity is a CDR selected from naturally occurring CDR sequences that contain Type Hs restriction enzyme recognition sites outside the CDR region, (b) introducing the source of diversity within each Ig Acceptor Framework by digesting both the source of diversity and the Ig Acceptor Frameworks with a Type Hs restriction enzyme; and (c) ligating the digested source of diversity into the Ig
- the naturally occurring CDR region sequences are substantially unaltered from their wild-type, i.e., natural state. These naturally occurring CDR region sequences are flanked by amino acid sequences that have been engineered (or otherwise artificially manipulated) to contain two Type Hs restriction enzyme recognition sites, with one Type Hs restriction enzyme recognition site on each of side of the naturally occurring CDR region sequence.
- the Type IIS restriction enzyme recognition sites are outside the CDR encoding region.
- the sequence of CDR regions are unaltered at the boundaries of the CDR encoding region — the restriction enzymes recognize and splice at a region that is up to the boundary of the CDR encoding region, but does not splice within the CDR encoding region.
- the Type Hs restriction enzyme recognition sites within the stuffer nucleic acid sequences and flanking the naturally occurring CDR sequences are recognized by the same Type Hs restriction enzyme.
- the Type Hs restriction enzyme recognition sites within the stuffer nucleic acid sequences and flanking the naturally occurring CDR sequences are recognized by different Type Hs restriction enzymes.
- the Type Hs restriction enzyme recognition sites are Fokl recognition sites, Bsal recognition sites, and/or BsmBI recognition sites.
- the Ig Acceptor Framework nucleic acid sequence is derived from a human gene sequence.
- the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence.
- the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.
- the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3- 15, and VK3-20.
- the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL 1-44 and VL 1-51.
- the set of naturally occurring nucleic acids includes or is derived from sequences selected from naturally occurring CDR3 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the set of naturally occurring nucleic acids encode
- CDR3 regions and the set of naturally occurring nucleic acids include immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the set of naturally occurring nucleic acids includes or is derived from sequences selected from naturally occurring CDRl sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the set of naturally occurring nucleic acids encode
- the set of naturally occurring nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the set of naturally occurring nucleic acids includes or is derived from sequences selected from naturally occurring CDR2 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the set of naturally occurring nucleic acids encodes
- the set of naturally occurring nucleic acids includes immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of Ig Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor
- VL variable light chain
- the methods provided include the additional steps of
- the expression vector is a phagemid vector.
- the phagemid vector is pNDS 1.
- the invention also provides methods for producing a library of nucleic acids, wherein each nucleic acid encodes an immunoglobulin variable domain. These methods include the steps of (a) providing a plurality of Ig Acceptor Framework nucleic acid sequences into which a source of diversity is introduced at a single complementarity determining region (CDR) selected from the group consisting of complementarity determining region 1 (CDRl), complementarity determining region 2 (CDR2), and complementarity determining region 3 (CDR3), where the Ig Acceptor Framework sequence includes a stuffer nucleic acid sequence including at least two Type Hs restriction enzyme recognition sites, and wherein the source of diversity is a CDR selected from synthetically produced CDR sequences that contain Type Hs restriction enzyme recognition sites outside the CDR region, (b) introducing the source of diversity within each Ig Acceptor Framework by digesting both the source of diversity and the Ig Acceptor Framework with a Type Hs restriction enzyme; and (c) ligating the digested source of diversity into the Ig Accept
- the Type Hs restriction enzyme recognition sites within the stuffer nucleic acid sequences and the synthetically produced CDR sequences are recognized by the same Type Hs restriction enzyme.
- the Type Hs restriction enzyme recognition sites within the stuffer nucleic acid sequences and the synthetically produced CDR sequences are recognized by different Type Hs restriction enzymes.
- the Type Hs restriction enzyme recognition sites are Fokl recognition sites, Bsal recognition sites, and/or BsmBI recognition sites.
- the Ig Acceptor Framework nucleic acid sequence is derived from a human sequence.
- the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence.
- the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.
- the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VKl- 33, VK1-39, VK3-11, VK3- 15, and VK3-20.
- the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL 1-44 and VLl -51.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDRl region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of diversified nucleic acids encode amino acid sequences that can fulfill the role of a CDR2 region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of Ig Acceptor Framework nucleic acid sequences includes a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.
- VH variable heavy chain
- the methods provided include the additional steps of
- step (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library.
- the host cell is E. coli.
- the expression vector is a phagemid vector.
- the phagemid vector is pNDS 1.
- the invention also provides methods for making an immunoglobulin polypeptide. These methods include the steps of (a) providing a plurality of Ig Acceptor Framework nucleic acid sequences into which a source of diversity is introduced at a single complementarity determining region (CDR) selected from the group consisting of complementarity determining region 1 (CDRl), complementarity determining region 2 (CDR2), and complementarity determining region 3 (CDR3), wherein the Ig Acceptor Framework sequence includes a stuffer nucleic acid sequence including at least two Type Hs restriction enzyme recognition sites, and wherein the source of diversity is a CDR selected from naturally occurring CDR sequences that contain Type Hs restriction enzyme recognition sites outside the CDR region, (b) introducing the source of diversity within each Ig Acceptor Framework by digesting both the source of diversity and the Ig Acceptor Frameworks with a Type Hs restriction enzyme; (c) ligating the digested source of diversity into the Ig Acceptor Framework such that a complete immunoglobulin variable gene encoding sequence
- the naturally occurring CDR region sequences are substantially unaltered from their wild-type, i.e., natural state. These naturally occurring CDR region sequences are flanked by amino acid sequences that have been engineered (or otherwise artificially manipulated) to contain two Type Hs restriction enzyme recognition sites, with one Type Hs restriction enzyme recognition site on each of side of the naturally occurring CDR region sequence.
- the Type Hs restriction enzyme recognition sites within the stuffer nucleic acid sequences and flanking the naturally occurring CDR sequences are recognized by the same Type Hs restriction enzyme.
- the Type Hs restriction enzyme recognition sites within the stuffer nucleic acid sequences and flanking the naturally occurring CDR sequences are recognized by different Type Hs restriction enzymes.
- the Type Hs restriction enzyme recognition sites are Fokl recognition sites, Bsal recognition sites, and/or BsmBI recognition sites.
- the Acceptor Framework nucleic acid sequence is derived from a human gene sequence.
- the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence.
- the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.
- the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VKl -33, VKl -39, VK3-11, VK3- 15, and VK3-20.
- the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL 1-44 and VL 1-51.
- the set of naturally occurring nucleic acids includes or is derived from sequences selected from naturally occurring CDR3 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the set of naturally occurring nucleic acids encode
- CDR3 regions and the set of naturally occurring nucleic acids include immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the set of naturally occurring nucleic acids includes or is derived from sequences selected from naturally occurring CDRl sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the set of naturally occurring nucleic acids encode
- the set of naturally occurring nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the set of naturally occurring nucleic acids includes or is derived from sequences selected from naturally occurring CDR2 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the set of naturally occurring nucleic acids encodes
- the set of naturally occurring nucleic acids includes immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor
- the expression vector is a phagemid vector.
- the host cell is E. coli.
- the method also includes the steps of contacting the host cell with a target antigen, and determining which expressed complete Ig variable gene encoding sequences bind to the target antigen, thereby identifying target specific antibodies, antibody variable regions or portions thereof. In some embodiments, the method includes the additional step of (i) sequencing the immunoglobulin variable domain encoding sequences that bind the target antigen.
- the invention also provides methods for making an immunoglobulin polypeptide. These methods include the steps of (a) providing a plurality of Ig Acceptor Framework nucleic acid sequences into which a source of diversity is introduced at a single complementarity determining region (CDR) selected from the group consisting of complementarity determining region 1 (CDRl), complementarity determining region 2 (CDR2), and complementarity determining region 3 (CDR3), wherein the Ig Acceptor Framework sequence includes a stuffer nucleic acid sequence including at least two Type Hs restriction enzyme recognition sites, and wherein the source of diversity is a CDR selected from synthetically produced CDR sequences that contain Type Hs restriction enzyme recognition sites outside the CDR region, (b) introducing the source of diversity within each Ig Acceptor Framework by digesting both the source of diversity and the Ig Acceptor Framework with a Type Hs restriction enzyme; (c) ligating the digested source of diversity into the Ig Acceptor Framework such that a complete immunoglobulin variable gene encoding sequence
- the Type Hs restriction enzyme recognition sites within the stuffer nucleic acid sequences and the synthetically produced CDR sequences are recognized by the same Type Hs restriction enzyme. In some embodiments, the Type Hs restriction enzyme recognition sites within the stuffer nucleic acid sequences and the synthetically produced CDR sequences are recognized by different Type Hs restriction enzymes. For example, the Type Hs restriction enzyme recognition sites are Fokl recognition sites, Bsal recognition sites, and/or BsmBI recognition sites.
- the Ig Acceptor Framework nucleic acid sequence is derived from a human gene sequence.
- the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence.
- the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.
- the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3- 15, and VK3-20.
- the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL 1-44 and VL 1-51.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDRl region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of diversified nucleic acids encode amino acid sequences that can fulfill the role of a CDR2 region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of Ig Acceptor Framework nucleic acid sequences includes a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.
- VH variable heavy chain
- the expression vector is a phagemid vector.
- the host cell is E. coli.
- the method also includes the steps of contacting the host cell with a target antigen, and determining which expressed complete Ig variable gene encoding sequences bind to the target antigen, thereby identifying target specific antibodies, antibody variable regions or portions thereof.
- the method includes the additional step of (i) sequencing the immunoglobulin variable domain encoding sequences that bind the target antigen.
- the invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from the immunoglobulin variable domain repertoire from a mammalian species.
- CDR3 complementarity determining region 3
- the invention also provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 2 (CDR2) sequences isolated separately from the immunoglobulin variable domain repertoire from a mammalian species.
- CDR2 complementarity determining region 2
- the invention also provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 1 (CDRl) sequences isolated separately from the immunoglobulin variable domain repertoire from a mammalian species.
- the invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from the immunoglobulin variable domain repertoire from a non-human mammalian species.
- CDR3 complementarity determining region 3
- the invention also provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 2 (CDR2) sequences isolated separately from the immunoglobulin variable domain repertoire from a non-human mammalian species.
- CDR2 complementarity determining region 2
- the invention also provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 1 (CDRl) sequences isolated separately from the immunoglobulin variable domain repertoire from a non-human mammalian species.
- CDRl complementarity determining region 1
- the non-human species is non-human primate, rodent, canine, feline, sheep, goat, cattle, horse, a member of the Camelidae family, llama, camel, dromedary, or pig.
- the invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from the immunoglobulin variable domain repertoire from a human.
- CDR3 complementarity determining region 3
- the invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 2 (CDR2) sequences isolated separately from the immunoglobulin variable domain repertoire from a human.
- CDR2 complementarity determining region 2
- the invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 1 (CDRl) sequences isolated separately from the immunoglobulin variable domain repertoire from a human.
- CDRl complementarity determining region 1
- the invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from the immunoglobulin variable domain repertoire from a non-human species.
- CDR3 complementarity determining region 3
- these methods includes the steps of (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct human immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence comprising a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a complementarity determining region 1 (CDRl), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence comprising at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) sequences isolated from the mammalian species immunoglobulin repertoire wherein each of the plurality of
- CDR2 complementarity determining region 2
- CDRl complementarity determining region 1
- step (b) is performed by amplifying the CDR3 sequence from a mammalian species using oligonucleotide primers containing a Type Hs restriction site.
- the oligonucleotide primer is designed to enhance compatibility between the mammalian CDR3 sequence and the Acceptor Framework encoding a human immunoglobulin variable domain.
- the oligonucleotide primer is designed to modify the sequence at the boundaries of the mammalian CDR3 sequences to allow efficient ligation via compatible cohesive ends into the Acceptor Framework encoding a human immunoglobulin variable domain.
- the mammalian DNA sequences flanking the CDR3 regions might not upon cleavage by Type IIS restriction enzymes generate cohesive ends compatible with the cohesive ends of the digested Acceptor Frameworks.
- the oligonucleotides used for amplification are designed to modify the target mammalian sequence so that after cleavage with a Type IIS restriction enzyme, the cohesive ends are compatible and efficient ligation can occur.
- These steps can also be performed by amplifying the CDR2 sequence from a mammalian species using oligonucleotide primers containing a Type Hs restriction site.
- These steps can also be performed by amplifying the CDRl sequence from a mammalian species using oligonucleotide primers containing a Type Hs restriction site.
- step (b) is performed by amplifying the CDR3 sequence from a non human species using oligonucleotide primers containing a Fokl Hs restriction site. These steps can also be performed by amplifying the CDR2 sequence from a mammalian species using oligonucleotide primers containing a Fokl Hs restriction site. These steps can also be performed by amplifying the CDRl sequence from a mammalian species using oligonucleotide primers containing a Fokl Hs restriction site.
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by a different Type Hs restriction enzyme.
- the Type Hs restriction enzyme recognition sites are BsmBI recognition sites, Bsal recognition sites, Fokl recognition sites or a combination thereof.
- CDR3 sequences encode heavy chain CDR3 (CDR H3) sequences.
- the diversified nucleic acid sequences encoding CDR3 sequences encode light chain CDR3 (CDR L3) sequences.
- the diversified nucleic acid sequences encoding CDR2 sequences encode heavy chain CDR2 (CDR H2) sequences.
- the diversified nucleic acid sequences encoding CDR2 sequences encode light chain CDR2 (CDR L2) sequences.
- the diversified nucleic acid sequences encoding CDRl sequences encode heavy chain CDRl (CDR Hl) sequences.
- the diversified nucleic acid sequences encoding CDRl sequences encode light chain CDRl (CDR Ll) sequences.
- the Acceptor Framework nucleic acid sequence includes or is derived from at least a portion of a human heavy chain variable gene sequence selected from VH1-2, VHl -69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5- 51.
- the Acceptor Framework nucleic acid sequence includes is derived from at least a portion of a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VK1-33, VKl -39, VK3-11, VK3- 15, and VK3-20.
- the Acceptor Framework nucleic acid sequence includes or is derived from at least a portion of a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL 1-44 and VLl -51.
- the plurality of Acceptor Framework nucleic acid sequences comprises a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.
- VH variable heavy chain
- the methods described herein also include the steps of (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library.
- the expression vector is a phagemid or phage vector.
- the host cell is E. coli.
- the invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from immunoglobulin variable domains from an immunized non-human mammal or non- human species.
- CDR3 complementarity determining region 3
- the invention also provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 2 (CDR2) sequences isolated separately from immunoglobulin variable domains from an immunized non-human mammal.
- CDR2 complementarity determining region 2
- the invention also provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 1 (CDRl) sequences isolated separately from immunoglobulin variable domains from an immunized non-human mammal.
- the non-human species is non-human primate, rodent, canine, feline, sheep, goat, cattle, horse, a member of the Camelidae family, llama, camel, dromedary, or pig.
- the methods include the steps of (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct human immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence comprising a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a complementarity determining region 1 (CDRl), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence comprising at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) sequences isolated from the immunized non-human mammal wherein each of the plurality of
- CDR2 complementarity determining region 2
- CDRl complementarity determining region 1
- step (b) is performed by amplifying the CDR3 sequence from the immunized non-human mammal using oligonucleotide primers containing a Type Hs restriction site.
- the oligonucleotide primer is designed to enhance compatibility between the mammalian CDR3 sequence and the Acceptor Framework encoding a human immunoglobulin variable domain.
- the oligonucleotide primer is designed to modify the sequence at the boundaries of the mammalian CDR3 sequences to allow efficient ligation via compatible cohesive ends into the Acceptor Framework encoding a human immunoglobulin variable domain.
- the mammalian DNA sequences flanking the CDR3 regions might not upon cleavage by Type IIS restriction enzymes generate cohesive ends compatible with the cohesive ends of the digested Acceptor Frameworks.
- the oligonucleotides used for amplification are designed to modify the target mammalian sequence so that after cleavage with a Type IIS restriction enzyme, the cohesive ends are compatible and efficient ligation can occur.
- These steps can also be performed by amplifying the CDR2 sequence from the immunized non-human mammal using oligonucleotide primers containing a Type Hs restriction site.
- step (b) is performed by amplifying the CDR H3 sequence from the non-human mammal using oligonucleotide primers containing a Fokl Hs restriction site.
- step (b) is performed by amplifying the CDR H3 sequence from the non-human mammal using oligonucleotide primers containing a Fokl Hs restriction site.
- steps can also be performed by amplifying the CDR2 sequence from the non-human mammal using oligonucleotide primers containing a Fokl Hs restriction site.
- These steps can also be performed by amplifying the CDRl sequence from the non-human mammal using oligonucleotide primers containing a Fokl Hs restriction site.
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by a different Type Hs restriction enzyme.
- the Type Hs restriction enzyme recognition sites are BsmBI recognition sites, Bsal recognition sites, Fokl recognition sites or a combination thereof.
- CDR3 sequences encode heavy chain CDR3 (CDR H3) sequences.
- the diversified nucleic acid sequences encoding CDR3 sequences encode light chain CDR3 (CDR L3) sequences.
- the diversified nucleic acid sequences encoding CDR2 sequences encode heavy chain CDR2 (CDR H2) sequences.
- the diversified nucleic acid sequences encoding CDR2 sequences encode light chain CDR2 (CDR L2) sequences.
- the diversified nucleic acid sequences encoding CDRl sequences encode heavy chain CDRl (CDR Hl) sequences.
- the diversified nucleic acid sequences encoding CDRl sequences encode light chain CDRl (CDR Ll) sequences.
- the Acceptor Framework nucleic acid sequence includes or is derived from at least a portion of a human heavy chain variable gene sequence selected from VH1-2, VHl -69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.
- the Acceptor Framework nucleic acid sequence includes or is derived from at least a portion of a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VKl -33, VKl -39, VK3-11, VK3- 15, and VK3-20.
- the Acceptor Framework nucleic acid sequence includes or is derived from at least a portion of a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.
- the plurality of Acceptor Framework nucleic acid sequences comprises a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.
- the methods also include the steps of (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library.
- the host cell is E. coli.
- the expression vector is a phagemid or phage vector.
- Figure IA is a schematic representation of a protein domain with a framework and loops providing contact residues with another protein or molecule. Several situations are depicted: A stable protein domain with properly folded loop regions; properly folded loops inserted into a domain of limited intrinsic stability; an intrinsically stable protein domain which stability is affected by the loop regions.
- Figure IB is a schematic representation of different types of libraries of protein repertoires generated using different diversification strategies.
- Figure 2 is a schematic representation of an antibody variable Acceptor
- Framework Framework regions, CDRs and type IIS-RM restriction site are indicated.
- Figure 3 is a schematic representation of a strategy used for capturing
- Figure 4 is a schematic representation of the benefit of using primers containing Type IIS-RM restriction enzymes for the amplification and insertion of natural
- Figure 5 is an illustration depicting the germline gene sequences of the variable heavy and light chain domain selected for the generation of Acceptor
- Figure 6 is a schematic representation of an amplification strategy used for the generation of Acceptor Frameworks by addition to the germline sequences of a stuff er fragment and a FR4 region.
- Figure 7 is an illustration depicting the sequence detail of Stuffer fragments of VH acceptor Framework. DNA sequences recognized and cleaved by the restriction enzyme BsmBI are boxed in red and black respectively and indicated in the lower panel of the figure. The reading frame corresponding to the antibody variable sequence is underlined.
- Figure 8 is an illustration depicting the sequences of the 20 Acceptor
- Figure 9 is a schematic representation of the pNDSl vector alone or combined with a dummy heavy chain variable region or a dummy light variable region.
- Figure 10 is a table depicting the sequences of CDRH3 sequences that were retrieved from a human cDNA source and inserted into human Acceptor Frameworks.
- Figure 11 is a table representing the design of synthetic CDR sequences for
- VH, VK and V ⁇ The positions are numbered according to the Kabat numbering scheme.
- Figure 12 is a schematic representation and sequence detail of synthetic
- Figure 13 is a schematic representation of Primary libraries and the chain recombination performed to generate Secondary libraries.
- Figure 14 is a schematic representation of the generation of Acceptor VH libraries combined with VL synthetic libraries and the capture of CDRH3 repertoires of human or non-human origin.
- Figure 15 is a schematic representation of the MnA, MiB and MiC library generation using the CDRH3 repertoire from na ⁇ ve mice or mice immunized with hlFN ⁇ or hCCL5/RANTES as a source of diversity.
- the size of the libraries is indicated in the top panels.
- the bottom panels show the distribution of CDRH3 lengths found in these libraries.
- Figure 16 is a series of graphs depicting phage output titration during selection against hlFN ⁇ with the secondary libraries ADl and AEl .
- Figure 17 is a series of graphs depicting phage output titration during selection against monoclonal antibody 5E3 with the secondary libraries ADl and AEl.
- Figure 18 is a series of graphs depicting the frequency of CDR H3 lengths found in the AEl and ADl libraries and after three rounds of selection against the monoclonal antibody 5E3. The distribution of each CDR H3 length within the different
- FIG. 19 is a series of graphs depicting dose response ELISA using purified 6 scFv preparations against mouse 5E3 or an irrelevant mouse antibody 1 A6. The seven clones encode different scFvs. Clone A6 is a scFv specific for hlFN ⁇ and was used as a negative control.
- Figure 20 is a graph that depicts dose response ELISA using purified scFv preparations against hlFN ⁇ and compared to a positive scFv specific for hlFN ⁇ (A6).
- Figure 21 is a graph that depicts the inhibitory effect of purified scFv preparations in a luciferase reporter gene assay driven by hlFN ⁇ .
- the neutralizing activity of two scFv candidates (AD1R4P1A9 and AE14R3P2E4) was compared to the activity of a positive control scFv (G9) and a negative control scFv (Dl 1).
- Figure 22 is a graph that depicts the inhibitory effect of purified scFv preparations in a MHCII induction assay in response to hlFN ⁇ .
- the neutralizing activity of two scFv candidates (AD1R4P1A9 and AE14R3P2E4) was compared to the activity of a negative control scFv (Dl 1).
- Figure 23 is a series of graphs depicting the inhibitory effect of the two candidates AD1R4P1A9 and AE14R3P2E4 reformatted into IgG in a luciferase reporter gene assay driven by hlFN ⁇ .
- the neutralizing activity of two IgGs was compared to the activity of an irrelevant IgG directed against human RANTES (NI-0701).
- Figure 24 is a series of graphs depicting a dose response ELISA using the
- Figure 25 is a series of graphs depicting an ELISA for the detection of mouse 5E3 in different dilutions of mouse serum using the anti-idiotypic IgGs GI l and
- Figure 26 is a graph that depicts phage output/input ratios during selection against hlFN ⁇ with the libraries MnA and MiB.
- Figure 27 is a graph depicting the hit rates obtained in a scFv ELISA screening with clones derived from the MnA, MiB and MiC libraries after each round of selection against hlFN ⁇ . The threshold was set to half the signal obtained with the A6 control scFv.
- Figure 28 is a graph that represents the distribution frequency of scFv giving different levels of signal in binding experiments against hlFN ⁇ obtained with clones derived from the MnA and MiB libraries.
- Figure 29 is a graph that depicts dose response ELISA using purified scFv preparations from clones derived from the MnA and MiB libraries against hlFN ⁇ and compared to a positive scFv specific for hlFN ⁇ (A6).
- Synthetic protein libraries and in particular synthetic antibody libraries are attractive as it is possible during the library generation process to select the building blocks composing these synthetic proteins and include desired characteristics.
- An important limitation, however, is that the randomization of portions of these synthetic proteins to generate a collection of variants often leads to non- functional proteins and thus can dramatically decrease the functional library size and its performance.
- Another limitation of synthetic diversity is that the library size needed to cover the theoretical diversity of randomized amino acid stretches cannot be covered because of practical limitations. Even with display systems such as ribosome display a diversity of 10 13 to 10 14 can be generated and sampled which can maximally cover the complete randomization of stretches of 9 amino acids.
- CDR H3 also referred to herein as the heavy chain CDR3 or VH CDR3
- VH CDR3 the heavy chain CDR3
- synthetic diversity is not a practicable approach to generate such CDRs.
- antibody libraries generated using assembly of DNA fragments by PCR and/or restriction cloning contain between 15% and 45% sequences that are not in the correct reading frame for protein translation.
- non- functional library members can compromise the efficiency of the antibody selection and identification process and are thus recognized as a limitation in the field.
- the methods described allow for a more robust introduction of diversity into an antibody library by using an alternative cloning strategy. Typically the frequency of in- frame sequences is approximately 90%.
- Another advantage of the invention is that it combines selected acceptor antibody variable frameworks with CDR loops that have a high probability of correct folding. It allows for the capture of long CDRs that are difficult to cover with synthetic randomization approaches.
- the methods described do not employ any modification within the coding region of acceptor antibody variable for cloning of the diversified sequences.
- Another advantage of this method is that several sources of diversity can be captured into the same set of acceptor antibody frameworks.
- CDRs of human or other mammal origin include but are not limited to: natural antibody CDRs of human or other mammal origin, CDR from chicken antibodies, CDRs of antibody-like molecules such as VHH from camelids, IgNARs from sharks, variable loops from T cell receptors.
- natural CDRs can be derived from na ⁇ ve or immunized animals. In the latter case, the CDRs retrieved are enriched in sequences that were involved in recognition of the antigen used for immunization.
- a unique feature of the methods described herein is the efficient capture of heavy chain CDR3 coding sequences from non-human species and their insertion into human immunoglobulin frameworks. Using these methods, it is therefore possible to generate different antibody combining sites that are shaped by the captured CDRH3 repertoire from another species and allow for the sampling of a different tri dimensional space. These methods allow for the generation of human antibodies with novel specificities targeting a different range of target classes and epitopes than those accessible to a human CDRH3 repertoire. Furthermore, these novel antibodies encode human framework as well as CDRl and CDR2 regions and thus are suitable for human therapy.
- selected protein domains are modified by introducing a stuffer sequence that will serve as an integration site for diversified sequences.
- the stuffer fragment is removed in full, thus leaving intact the coding region of the acceptor protein and the inserted proteins fragments (i.e., the CDRs).
- This integration event is mediated by a the use of Type Hs restriction enzyme that recognizes a defined site in the DNA sequence but cleave the DNA at a defined distance from this site.
- This approach has two major advantages: (1) it allows for the digestion of acceptors framework without affecting their coding sequences (no need to engineer silent restrictions sites); and (2) it allows for the digestion and cloning of naturally diversified sequences that by definition do not possess compatible restriction sites.
- sequences from a mouse is added to a human framework, such that the resulting antibody has CDRl and CDR2 regions of murine origin and a CDR3 region of human origin.
- Other methods such as those described in US Patent Application Publication No. 20030232333, generate antibodies that have synthetic CDRl and/or CDR1/CDR2 regions along with a natural CDR3 region.
- these methods fail to provide libraries that contain stable framework regions and correctly folded CDRs.
- the methods provided herein design the antibody acceptor frameworks for diversity cloning.
- a strategy was designed to introduce diversity into the CDR3 of selected human antibody domains that avoids the modification of the sequence of the original framework.
- the strategy relies on the introduction outside of the immunoglobulin coding region of Type Hs restriction sites.
- This class of restriction enzymes recognizes asymmetric and uninterrupted sequence of 4-7 base pairs but cleave DNA at a defined distance of up to 20 bases independently of the DNA sequence found at the cleavage site.
- acceptor frameworks containing a stuffer DNA fragment, instead of the CDR3, that includes two Type Hs restriction sites were designed.
- flanking sequences that include Type Us.
- the DNA fragments can be ligated into the acceptor framework and restore the encoded CDR3 in the new context of the acceptor antibody framework ( Figure 2).
- the methods provided herein capture natural CDR diversity.
- the strategy that was developed to capture naturally diversified protein fragments as a source of diversity also takes advantage of Type Hs restriction enzymes.
- Type Hs restriction enzymes As an example, oligonucleotides primers specific for flanking regions of the DNA sequence encoding the CDR H3 of immunoglobulins, i.e., specific for the FR3 and FR4 of the variable region, were designed. These oligonucleotides contain at their 5' end a site for a Type Hs restriction enzyme whereas their 3' portion matches the targeted DNA sequence.
- the restriction enzyme site used is preferably an enzyme that cleaves DNA far away from the DNA recognition site such as Fokl.
- This precise excision of the CDR coding sequence is very difficult using Type II enzymes that cleave DNA at their recognition site as the corresponding restriction site is not present in the natural DNA sequences and that introduction of such sites during amplification would be difficult due poor primer annealing.
- this method allows for the amplification of diversified protein sequences and their insertion into any the acceptor antibody framework regardless of origin of amplified diversity (Figure 4).
- each nucleic acid encodes an immunoglobulin variable domain by: (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a complementarity determining region 1 (CDRl), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence containing at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) regions or
- each nucleic acid encodes an immunoglobulin variable domain by: (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a stuffer nucleic acid sequence containing at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3);(b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 1 (CDR2)
- each nucleic acid encodes an immunoglobulin variable domain
- each Acceptor Framework nucleic acid sequence including a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a complementarity determining region 1 (CDRl), the FR2 and FR3 regions are interspaced by a stuffer nucleic acid sequence including at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 2 (CDR2) regions or
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) in the methods set forth above are recognized by a different Type Hs restriction enzyme.
- the Type Hs restriction enzyme recognition sites are BsmBI recognition sites, Bsal recognition sites, Fokl recognition sites or a combination thereof.
- the Acceptor Framework nucleic acid sequence is derived from a human gene sequence.
- the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence.
- the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3- 48, VH3-23, and VH5-51.
- the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VKl -33, VKl -39, VK3-11, VK3- 15, and VK3-20.
- the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL 1-44 and VLl -51.
- the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR3 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the plurality of diversified nucleic acids encodes
- the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDRl sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the plurality of diversified nucleic acids encodes
- the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDRl region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR2 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the plurality of diversified nucleic acids encodes
- the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR2 region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of Acceptor Framework nucleic acid sequences includes a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.
- VH variable heavy chain
- the methods provided herein further include the steps of (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library.
- the host cell is E. coli.
- the expression vector is a phagemid vector.
- the methods provided herein generate or otherwise produce a target- specific antibody, antibody variable region or a portion thereof, by: (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a complementarity determining region 1 (CDRl), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence having at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) regions or encoding amino acid sequences that
- the methods provided herein generate or otherwise produce a target- specific antibody, antibody variable region or a portion thereof, by: (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a stuffer nucleic acid sequence including at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 1 (CDRl) regions or encoding amino acid sequence
- the methods provided herein generate or otherwise produce a target- specific antibody, antibody variable region or a portion thereof, by: (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FRl), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FRl and FR2 regions are interspaced by a complementarity determining region 1 (CDRl), the FR2 and FR3 regions are interspaced by a stuffer nucleic acid sequence including at least two Type Hs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 2 (CDR2) regions or encoding amino acid sequences that
- the Type Hs restriction enzyme recognition sites of step (a) and step (b) are recognized by a different Type Hs restriction enzyme.
- the Type Hs restriction enzyme recognition sites are
- the Acceptor Framework nucleic acid sequence is derived from a human gene sequence.
- the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence.
- the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.
- the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence.
- the human kappa light chain variable gene sequence is selected from VKl -33, VKl -39, VK3-11, VK3- 15, and VK3-20.
- the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence.
- the human lambda light chain variable gene sequence is selected from VL 1-44 and VLl -51.
- the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR3 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the plurality of diversified nucleic acids encodes
- the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDRl sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.
- the plurality of diversified nucleic acids encodes
- the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDRl region, and the plurality of diversified nucleic acids includes synthetic sequences.
- the plurality of diversified nucleic acids encodes
- the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.
- the plurality of Acceptor Framework nucleic acid sequences includes a mixture of at least one variable heavy chain (VH) Acceptor
- the expression vector is a phagemid vector.
- the host cell is E. coli.
- Enzymatic reactions and purification techniques are performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein.
- the foregoing techniques and procedures are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See e.g., Sambrook et al. Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. (1989)).
- the nomenclatures utilized in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.
- the term “antibody” refers to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen.
- immunoglobulin immunoglobulin
- Ig immunoglobulin
- bind or “immunoreacts with” or “immunospecifically bind” is meant that the antibody reacts with one or more antigenic determinants of the desired antigen and does not react with other polypeptides or binds at much lower affinity (Kd > 10 ⁇ 6 ).
- Antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, dAb (domain antibody), single chain, F ab , F ab' and F (ab')2 fragments, scFvs, and an F ab expression library.
- the basic antibody structural unit is known to comprise a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kDa) and one "heavy" chain (about 50-70 kDa).
- the amino-terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition.
- the carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function.
- antibody molecules obtained from humans relate to any of the classes IgG, IgM, IgA, IgE and IgD, which differ from one another by the nature of the heavy chain present in the molecule. Certain classes have subclasses as well, such as IgG 1 , IgG 2 , and others. Furthermore, in humans, the light chain may be a kappa chain or a lambda chain.
- the complementarity determining regions (CDRs) of the monoclonal antibody are identical in all the molecules of the population.
- MAbs contain an antigen binding site capable of immunoreacting with a particular epitope of the antigen characterized by a unique binding affinity for it.
- the term "antigen-binding site,” or “binding portion” refers to the part of the immunoglobulin molecule that participates in antigen binding.
- the antigen binding site is formed by amino acid residues of the N-terminal variable ("V") regions of the heavy (“H”) and light (“L”) chains.
- FR refers to amino acid sequences which are naturally found between, and adjacent to, hypervariable regions in immunoglobulins.
- the three hypervariable regions of a light chain and the three hypervariable regions of a heavy chain are disposed relative to each other in three dimensional space to form an antigen-binding surface.
- the antigen-binding surface is complementary to the three-dimensional surface of a bound antigen, and the three hypervariable regions of each of the heavy and light chains are referred to as "complementarity-determining regions," or "CDRs.”
- CDRs complementarity-determining regions
- epitopic determinants includes any protein determinant capable of specific binding to an immunoglobulin, an scFv, or a T-cell receptor.
- epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. For example, antibodies may be raised against N-terminal or C-terminal peptides of a polypeptide.
- an antibody is said to specifically bind an antigen when the dissociation constant is ⁇ 1 ⁇ M; e.g., ⁇ 100 nM, preferably ⁇ 10 nM and more preferably ⁇ I nM.
- the terms "immunological binding,” and “immunological binding properties” refer to the non-covalent interactions of the type which occur between an immunoglobulin molecule and an antigen for which the immunoglobulin is specific. The strength, or affinity of immunological binding interactions can be expressed in terms of the dissociation constant (IQ) of the interaction, wherein a smaller IQ represents a greater affinity. Immunological binding properties of selected polypeptides can be quantified using methods well known in the art.
- One such method entails measuring the rates of antigen-binding site/antigen complex formation and dissociation, wherein those rates depend on the concentrations of the complex partners, the affinity of the interaction, and geometric parameters that equally influence the rate in both directions.
- both the "on rate constant” (K 0n ) and the “off rate constant” (K o ff) can be determined by calculation of the concentrations and the actual rates of association and dissociation.
- the ratio of IQ ff /K 0n enables the cancellation of all parameters not related to affinity, and is equal to the dissociation constant K d . (See, generally, Davies et al. (1990) Annual Rev Biochem 59:439-473).
- An antibody of the present invention is said to specifically bind to its target, when the equilibrium binding constant (K d ) is ⁇ l ⁇ M, e.g., ⁇ 100 nM, preferably ⁇ 10 nM, and more preferably ⁇ 1 nM, as measured by assays such as radioligand binding assays or similar assays known to those skilled in the art.
- K d equilibrium binding constant
- isolated polynucleotide shall mean a polynucleotide of genomic, cDNA, or synthetic origin or some combination thereof, which by virtue of its origin the "isolated polynucleotide” (1) is not associated with all or a portion of a polynucleotide in which the "isolated polynucleotide” is found in nature, (2) is operably linked to a polynucleotide which it is not linked to in nature, or (3) does not occur in nature as part of a larger sequence.
- Polynucleotides in accordance with the invention include the nucleic acid molecules encoding the heavy chain immunoglobulin molecules, and nucleic acid molecules encoding the light chain immunoglobulin molecules described herein.
- isolated protein means a protein of cDNA, recombinant RNA, or synthetic origin or some combination thereof, which by virtue of its origin, or source of derivation, the "isolated protein” (1) is not associated with proteins found in nature, (2) is free of other proteins from the same source, e.g., free of marine proteins, (3) is expressed by a cell from a different species, or (4) does not occur in nature.
- polypeptide is used herein as a generic term to refer to native protein, fragments, or analogs of a polypeptide sequence. Hence, native protein fragments, and analogs are species of the polypeptide genus.
- Polypeptides in accordance with the invention comprise the heavy chain immunoglobulin molecules, and the light chain immunoglobulin molecules described herein, as well as antibody molecules formed by combinations comprising the heavy chain immunoglobulin molecules with light chain immunoglobulin molecules, such as kappa light chain immunoglobulin molecules, and vice versa, as well as fragments and analogs thereof.
- naturally-occurring refers to the fact that an object can be found in nature.
- a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory or otherwise is naturally-occurring.
- operably linked refers to positions of components so described are in a relationship permitting them to function in their intended manner.
- a control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.
- control sequence refers to polynucleotide sequences which are necessary to effect the expression and processing of coding sequences to which they are ligated. The nature of such control sequences differs depending upon the host organism in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence in eukaryotes, generally, such control sequences include promoters and transcription termination sequence.
- control sequences is intended to include, at a minimum, all components whose presence is essential for expression and processing, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences.
- polynucleotide as referred to herein means a polymeric boron of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide.
- the term includes single and double stranded forms of DNA.
- Stereoisomers e.g., D- amino acids
- conventional amino acids unnatural amino acids such as ⁇ -, ⁇ -disubstituted amino acids, N-alkyl amino acids, lactic acid, and other unconventional amino acids may also be suitable components for polypeptides of the present invention.
- Examples of unconventional amino acids include: 4 hydroxyproline, ⁇ - carboxyglutamate, ⁇ -N,N,N-trimethyllysine, ⁇ -N-acetyllysine, O-phosphoserine, N- acetylserine, N-formylmethionine, 3-methylhistidine, 5-hydroxylysine, ⁇ -N- methylarginine, and other similar amino acids and imino acids (e.g., 4- hydroxyproline).
- the left-hand direction is the amino terminal direction and the right-hand direction is the carboxy-terminal direction, in accordance with standard usage and convention.
- the term "substantial identity” means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least 80 percent sequence identity, preferably at least 90 percent sequence identity, more preferably at least 95 percent sequence identity, and most preferably at least 99 percent sequence identity.
- residue positions which are not identical differ by conservative amino acid substitutions.
- Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains.
- a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide- containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur- containing side chains is cysteine and methionine.
- Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine valine, glutamic- aspartic, and asparagine-glutamine.
- minor variations in the amino acid sequences of antibodies or immunoglobulin molecules are contemplated as being encompassed by the present invention, providing that the variations in the amino acid sequence maintain at least 75%, more preferably at least 80%, 90%, 95%, and most preferably 99%.
- conservative amino acid replacements are contemplated.
- Conservative replacements are those that take place within a family of amino acids that are related in their side chains.
- amino acids are generally divided into families: (1) acidic amino acids are aspartate, glutamate; (2) basic amino acids are lysine, arginine, histidine; (3) non-polar amino acids are alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, and (4) uncharged polar amino acids are glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine.
- the hydrophilic amino acids include arginine, asparagine, aspartate, glutamine, glutamate, histidine, lysine, serine, and threonine.
- the hydrophobic amino acids include alanine, cysteine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, tyrosine and valine.
- Other families of amino acids include (i) serine and threonine, which are the aliphatic-hydroxy family; (ii) asparagine and glutamine, which are the amide containing family; (iii) alanine, valine, leucine and isoleucine, which are the aliphatic family; and (iv) phenylalanine, tryptophan, and tyrosine, which are the aromatic family.
- Structural and functional domains can be identified by comparison of the nucleotide and/or amino acid sequence data to public or proprietary sequence databases.
- computerized comparison methods are used to identify sequence motifs or predicted protein conformation domains that occur in other proteins of known structure and/or function. Methods to identify protein sequences that fold into a known three-dimensional structure are known. Bowie et al. Science 253:164 (1991).
- sequence motifs and structural conformations that may be used to define structural and functional domains in accordance with the invention.
- Preferred amino acid substitutions are those which: (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter binding affinities, and (4) confer or modify other physicochemical or functional properties of such analogs.
- Analogs can include various muteins of a sequence other than the naturally-occurring peptide sequence. For example, single or multiple amino acid substitutions (preferably conservative amino acid substitutions) may be made in the naturally- occurring sequence (preferably in the portion of the polypeptide outside the domain(s) forming intermolecular contacts.
- a conservative amino acid substitution should not substantially change the structural characteristics of the parent sequence (e.g., a replacement amino acid should not tend to break a helix that occurs in the parent sequence, or disrupt other types of secondary structure that characterizes the parent sequence).
- Examples of art-recognized polypeptide secondary and tertiary structures are described in Proteins, Structures and Molecular Principles (Creighton, Ed., W. H. Freeman and Company, New York (1984)); Introduction to Protein Structure (C. Branden and J. Tooze, eds., Garland Publishing, New York, N.Y. (1991)); and Thornton et at. Nature 354:105 (1991).
- label refers to incorporation of a detectable marker, e.g., by incorporation of a radiolabeled amino acid or attachment to a polypeptide of biotinyl moieties that can be detected by marked avidin (e.g., streptavidin containing a fluorescent marker or enzymatic activity that can be detected by optical or calorimetric methods). In certain situations, the label or marker can also be therapeutic. Various methods of labeling polypeptides and glycoproteins are known in the art and may be used.
- labels for polypeptides include, but are not limited to, the following: radioisotopes or radionuclides (e.g., 3 H, 14 C, 15 N, 35 S, 90 Y, 99 Tc, 111 In, 125 1, 131 I), fluorescent labels (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic labels (e.g., horseradish peroxidase, p-galactosidase, luciferase, alkaline phosphatase), chemiluminescent, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags).
- radioisotopes or radionuclides e.g., 3 H, 14 C, 15 N, 35 S, 90 Y, 99 Tc, 111 In, 125 1, 131 I
- fluorescent labels
- labels are attached by spacer arms of various lengths to reduce potential steric hindrance.
- pharmaceutical agent or drug refers to a chemical compound or composition capable of inducing a desired therapeutic effect when properly administered to a patient.
- Other chemistry terms herein are used according to conventional usage in the art, as exemplified by The McGraw-Hill Dictionary of Chemical Terms (Parker, S., Ed., McGraw-Hill, San Francisco (1985)).
- substantially pure means an object species is the predominant species present (i.e., on a molar basis it is more abundant than any other individual species in the composition), and preferably a substantially purified fraction is a composition wherein the object species comprises at least about 50 percent (on a molar basis) of all macromolecular species present.
- a substantially pure composition will comprise more than about
- the object species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species.
- patient includes human and veterinary subjects.
- Antibodies are purified by well-known techniques, such as affinity chromatography using protein A or protein G, which provide primarily the IgG fraction of immune serum. Subsequently, or alternatively, the specific antigen which is the target of the immunoglobulin sought, or an epitope thereof, may be immobilized on a column to purify the immune specific antibody by immunoaffmity chromatography. Purification of immunoglobulins is discussed, for example, by D. Wilkinson (The Engineer, published by The Engineer, Inc., Philadelphia PA, Vol. 14, No. 8 (April 17, 2000), pp. 25-28). [00253] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
- VH 1-2 Seven human heavy chain variable germline genes (VH 1-2, VH 1-69, VHl-
- VH3-30, VH3-48, VH3-23, VH5-51 five human kappa light chain variable germline genes (VK1-33, VK1-39, VK3-11, VK3- 15, VK3-20) and two human lambda light chain variable germline genes (VL 1-44, VL 1-51) were selected to construct the libraries (Lefranc, M. -P. et al., 1999 Nucleic Acids Research, 27, 209-212 ). These genes were selected because they are often used in human expressed antibody repertoires and the frameworks they encode show favorable stability and expression profiles as individual domains or in the context of a VH/VL pair (Ewert S et al., J MoI Biol.
- the amino acid sequence of VH FR4 corresponds to the FR4 region encoded by the germline J genes JHl, JH3, JH4 and JH5.
- the amino acid sequence of VK FR4 corresponds to the FR4 region encoded by the germline J genes JKl.
- the amino acid sequence of V ⁇ FR4 corresponds to the FR4 region encoded by the germline J genes JL2 and JL3.
- Two variants of the Vk FR4 sequence were generated with a single amino acid substitution at position 106 (Arginine or Glycine).
- Arginine or Glycine For the Acceptor Framework based on the germline gene VH3-23, two variants were also constructed differing by a single amino acid (Lysine to Arginine) at position 94, the last residue of FR3.
- Sfil/Ncol and Xhol sites were introduced at the 5' and 3' end of the VH, respectively.
- VH3-23 CTTACCGTTATTCGTCTCATTTCGCACAGTAATATAC (SEQ ID NO: 172)
- VHext3 CCTCCACCGCTCGAGACTGTGACCAGGGTTCCCTGGCCCCAAGAG (SEQ ID NO: 1
- VK1-33 CCTTACCGTTATTCGTCTCGCTGCTGACAGTAATATGTTGCAATA (SEQ ID NO: 182)
- VL1-44 CGGGTCGACGCAGTCTGTGCTGACTCAGCCAC SEQ ID NO: 189) 5 VL1-51 CGGGTCGACGCAGTCTGTGTTGACGCAGCCGC ( SEQ ID NO: 190) 3 VL1-44 CCTTACCGTTATTCGTCTCCTGCTGCACAGTAATAATC (SEQ ID NO: 191) 3 VL1-51 CCTTACCGTTATTCGTCTCCTGTTCCGCAGTAATAATC (SEQ ID NO: 192) 3 Vlext2 CCCTCCGCCGAACACAGAGACGCGCCTTCCCAATACGCGTTTAAAC (SEQ ID NO: 193) 3 Vlext3 GTGCGGCCGCCCCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACAGA (SEQ ID NO: 194)
- EXAMPLE 3 Generation of phagemid Acceptor vectors containing an invariant variable domain
- the phagemid vector pNDS 1 used for the expression of scFv was first modified to remove two BsmBI sites.
- a VH3-23 domain containing a defined CDR3 sequence was cloned into the modified pNDSl using the Sf ⁇ l and Xhol restriction sites to obtain the phagemid vector pNDS VHdummy.
- This domain contained a BsmBI site in the FR4 region, which was corrected by silent site directed mutagenesis.
- a VKl -39 domain containing a defined CDR3 sequence was then cloned into the modified pNDSl using the Sail and Notl restriction sites to obtain the phagemid vector pNDS VKdummy ( Figure 9).
- the 8 VH Acceptor Frameworks were cloned into pNDS VKdummy using the Sail and Notl restrictions sites.
- the 12 VL Acceptor Frameworks were cloned into pNDS VHdummy using the Sf ⁇ l and Xhol restrictions sites.
- the resulting 20 pNDS phagemid vectors that are listed below could at this stage be used for cloning of diversified CDR3 using the BsmBI sites present in the stuffer DNA fragments.
- VH Acceptors pNDS VH 1 -2 VKd; pNDS VH 1 - 18 VKd; pNDS VH 1 -
- VL Acceptors pNDS_VHd_VKl-33G; pNDS_VHd_VKl-33R; pNDS_VHd_VKl-39G; pNDS_VHd_VKl-39R; pNDS_VHd_VK3-l lG; pNDS_VHd_VK3-l lR; pNDS_VHd_VK3-15G; pNDS_VHd_VK3-15R; pNDS_VHd_VK3-20G; pNDS_VHd_VK3-20R; pNDS_VHd_VLl-44; pNDS_VHd_VKl-51.
- CDR H3 sequences Multiple sources of human cDNA were used as a template for amplification of CDR H3 sequences. These sources included human fetal spleen as well as pools of male and female normal adult peripheral blood purified cells. Several strategies for amplification have been used in order to recover CDR H3 sequences originating from rearranged VH cDNA encoded by a specific germline gene or CDR H3 sequences originating from any VH cDNA.
- annealing temperature of 55-58°C in combination with GoTaq polymerase was found to be optimal for this set of primers.
- the second amplification product was separated on a 2% agarose gel and resulted in a smear in the lower part of the gel corresponding to CDR H3 of different length. Either the complete DNA smear was extracted from the gel or a region corresponding to larger DNA fragments in order to enrich for long CDR H3.
- the first amplification step was performed using the 5 ' primer
- VH3-23H2 (SEQ ID NO: 201 shown below), which is specific for the sequence encoding the CDR H2 of the germline VH3-23.
- VH cDNAs encoded by the selected germline gene can be preferentially amplified. The subsequent purification and amplification steps were identical. In this way, it is possible to retrieve CDRs originating from a specific framework environment and to re-introduce them into the same, a similar or different framework.
- EXAMPLE 5 Generation of primary libraries by cloning natural human CDR H3 into acceptor frameworks
- the amplified CDR H3 were digested with Fokl, and the cleaved extremities as well as undigested DNA was removed using streptavidin coated magnetic beads.
- pNDS VH Acceptor vectors were digested using BsmBI. As the overhangs generated by these digestions are compatible, the collection of natural CDR H3 was able to be ligated into the VH Acceptor Framework restoring the appropriate reading frame.
- the ligated DNA was purified and concentrated for transformation into competent E. coli XLl Blue cells, and random clones analyzed by sequencing in order to check that
- 2xTYAG containing 50% glycerol was added to the cell suspension to obtain a final concentration of 17% glycerol.
- Aliquots of the libraries were stored at - 80 0 C. In this process, 14 primary libraries were generated representing a total of 8.IxIO 9 transformants. 180 randomly picked clones were sequenced to determine the quality and diversity of the libraries. All clones encoded different VH sequences and >89% were in frame. These primary libraries contain diversity in the CDR H3 only as they are combined with a dummy VL domain.
- EXAMPLE 6 Generation of primary libraries by cloning synthetic CDR3 into acceptor frameworks
- NNS, NVT, DVK or DVT randomized codons For each CDR H3, two oligonucleotides were synthesized encoding either a methionine or a phenylalanine at position 10Oz ( Figure 11). Each oligonucleotide was extended and amplified with two external biotinylated primers to generate double stranded DNA fragments encoding the designed CDRs. These external primers contain BsmBI restriction sites for subsequent excision of the CDR sequence and insertion into the Acceptor Frameworks ( Figure 12). The assembled DNA fragments were processed without gel purification and digested with BsmBI. The cleaved extremities as well as undigested DNA was removed using streptavidin coated magnetic beads.
- the digested DNA fragments were concentrated by ethanol precipitation and ligated into the corresponding pNDS VH, VK or V ⁇ Acceptor vectors. Ligation products were purified and concentrated for transformation into electrocompetent E. coli TGl cells and plated on 2xTYAG Bioassay plates (2xTY media containing 100 ⁇ g/ml ampicilin and 2% glucose). After overnight incubation at 30 0 C, 10 ml of 2xTYAG liquid medium was added to the plates and the cells were scraped from the surface and transferred to a 50 ml polypropylene tube.
- H3_4nnsF GCTGGCACGTCTCCGAGANNSNNSNNSNNSTTTGATTATTGGGGGAGACG (SEQ ID NO:
- H3_4nnsM GCTGGCACGTCTCCGAGANNSNNSNNSNNSATGGATTATTGGGGGAGACG (SEQ ID NO:
- H3_5nnsF GCTGGCACGTCTCCGAGANNSNNSNNSNNSNNSTTTGATTATTGGGGGAGACG (SEQ ID NO:
- H3_5nnsM GCTGGCACGTCTCCGAGANNSNNSNNSNNSNNSATGGATTATTGGGGGAGACG (SEQ ID NO:
- H3_6nnsF GCTGGCACGTCTCCGAGANNSNNSNNSNNSNNSNNSTTTGATTATTGGGGGAGACG
- H3_7nvtM GCTGGCACGTCTCCGAGANVTNVTNVTNVTNVTNVTNVTATGGATTATTGGGGGAGACG
- the Primary synthetic light chain libraries were combined with either the Primary synthetic heavy chain libraries or the Primary natural heavy chain libraries ( Figure 13).
- Phagemid DNA was prepared from each primary library and digested with Xhol/Notl restriction enzymes.
- the DNA fragments corresponding to the linker and light chains from the Primary synthetic libraries were inserted by ligation into the digested Primary natural or synthetic heavy chain vectors.
- the Linker- VL sequence was also amplified with specific primers before digestion with Xhol/Notl and ligation.
- the ligation products were purified by phenol/chloroform extraction and precipitation before transformation into electrocompetent E.
- 2xTYAG Bioassay plates (2xTY media containing 100 ⁇ g/ml ampicilin and 2% glucose). After overnight incubation at 30 0 C, 10 ml of 2xTYAG liquid medium was added to the plates and the cells were scraped from the surface and transferred to a 50 ml polypropylene tube. 2xTYAG containing 50% glycerol was added to the cell suspension to obtain a final concentration of 17% glycerol. Aliquots of the libraries were stored at -80 0 C.
- EXAMPLE 8 Generation of human antibody libraries displaying a CDRH3 repertoire derived from a non-human species.
- a library was created by capturing the CDRH3 of mice and introduced them into a collection of human antibody frameworks.
- an acceptor library containing a collection of VL genes with synthetic CDR L3 diversity was constructed and combined with a collection of acceptor sequences containing a stuffer DNA sequence ready suitable for Type IIS restriction cloning as described in Example 2.
- This library represents the starting point for rapid generation of secondary libraries with multiple sources of natural (human as well as non-human) or synthetic CDR H3.
- natural CDR H3 diversity was captured from na ⁇ ve Balb/c mice and mice that had been immunized with hlFN ⁇ or hCCL5 (hRANTES).
- the first step was the generation of acceptor libraries by cloning a collection of VL containing synthetic CDR L3 diversity into acceptor VH framework vectors ( Figure 14).
- the VL sequences were derived from the seven Primary Synthetic Libraries described in Example 6 by PCR amplification using primers 5'biot-VHdummy and 3 'biot-fdtseq.
- the resulting VL containing fragments of approximately 400 bp were digested using Xhol/Notl and purified on spin columns to remove primers and enzymes.
- the pNDS VH acceptor vectors containing a CDRH3 stuffer and a dummy light chain were digested with Xhol/Notl and Swal (Swal cutting inside the VL dummy) and purified on Chroma Spin TE columns with a cutoff of 1000 bp to get rid of the VL dummy fragment.
- the digested VL fragments were then ligated into the VH acceptor vectors ( Figure 14).
- VH acceptor vectors and VL fragments were pooled by chain subclasses (i.e., VHl, VH3, VH5, V ⁇ l, V ⁇ 3, V ⁇ l) and thus nine library combinations were performed (i.e., VHIXVKI , VH1XVK3, VHlxV ⁇ l, VH3xV ⁇ l, VH3xV ⁇ 3, VH3xV ⁇ l, VH5xV ⁇ l, VH5xV ⁇ 3, VH5xV ⁇ l).
- chain subclasses i.e., VHl, VH3, VH5, V ⁇ l, V ⁇ 3, V ⁇ l
- nine library combinations i.e., VHIXVKI , VH1XVK3, VHlxV ⁇ l, VH3xV ⁇ l, VH3xV ⁇ 3, VH3xV ⁇ l, VH5xV ⁇ l, VH5xV ⁇ 3, VH5xV ⁇ l.
- the ligation products were transformed into electrocompetent E.coli TGl cells and plated on 2xTYAG Bioassay plates (2xTY medium containing 100 ⁇ g/ml ampicillin and 2% glucose). After overnight incubation at 30 0 C, 6 ml of 2xTYAG liquid medium was added to the plates and the cells were scraped from the surface and transferred to a 50 ml polypropylene tube. Glycerol 50% was added to the cell suspension to obtain a final concentration of 17% glycerol. Aliquots of the libraries were stored at -80 0 C. The total size of this acceptor library, carrying synthetic diversity in the CDR L3, was 1.9x10 9 transformants.
- RNA was purified.
- cDNA was obtained from the extracted RNA by RT-PCR. This cDNA was used as template to isolate and amplify mouse VH by PCR.
- a series of PCRs were performed using 15 different 5' primers (one for each mouse VH subgroup) specific for the beginning of the FRl region and a pool of 3' primers (four primers covering the JH region). These first PCRs were pooled and purified on a 2% agarose gel. The purified DNA served as template to perform a second PCR to isolate the mouse CDR H3 region.
- the 5 ' and 3 ' primers for this second PCR target the FR3 and FR4 regions of mouse VH, respectively. These primers added a Fokl restriction site in order to allow for precise excision of the CDR H3 and cloning into the human acceptor vectors.
- alignments of murine VH sequences revealed that sequence at the 5' boundary of murine CDR-H3 and that are located at the cleavage site of Fokl almost always differ from human sequence by one base, whereas the 3 ' end matched between these two species.
- the sequences cleaved by Fokl are boxed in Table below:
- the ligated DNA was purified by phenol/chloroform extractions and concentrated by precipitation before transformation into competent E. coli TGl cells and plated on 2xTYAG Bioassay plates (2xTY medium containing 100 ⁇ g/ml ampicillin and 2% glucose). After overnight incubation at 30 0 C, 6 ml of 2xTYAG liquid medium was added to the plates and the cells were scraped from the surface and transferred to a 50 ml polypropylene tube. Glycerol 50% was added to the cell suspension to obtain a final concentration of 17% glycerol. Aliquots of the libraries were stored at -80 0 C.
- MnA 2.5x10 transformants (carrying a restricted natural human framework diversity, na ⁇ ve mouse diversity in the CDR H3 and synthetic diversity in the CDR L3); MiB, 7.3x10 7 transformants (carrying a restricted natural human framework diversity, immune mouse diversity against hlFN ⁇ in the CDR H3 and synthetic diversity in the CDR L3) and MiC, 1.8x10 8 transformants (carrying a restricted natural human framework diversity, immune mouse diversity against hCCL5 in the CDR H3 and synthetic diversity in the CDR L3). Random clones were analyzed by sequencing in order to check that CDR H3 sequence had been reconstituted and that junctions between the CDR and the Framework regions were correct.
- Each Primary and Secondary library was rescued independently according to standard phage display procedures briefly summarized hereafter.
- a volume of cell from the frozen library aliquots sufficient to cover at least 10 times the theoretical diversity of the library was added to 500 ml of 2xTYAG and grown at 37 0 C with agitation (240 rpm) until an OD600 of 0.3 to 0.5 was reached.
- the culture was then super-infected with MK13K07 helper phage and incubated for one hour at 37 0 C (150 rpm).
- the medium was then changed by centrifuging the cells at 2000 rpm for 10 minutes, removing the medium and resuspending the pellet in 500 ml of 2xTY-AK (lOO ⁇ g/ml ampicilin; 50 ⁇ g/ml kanamycin).
- the culture was then grown overnight at 30 0 C (240 rpm).
- the culture was centrifuged at 4000 rpm for 20 minutes to pellet the cells.
- the supernatant was collected and 30% (vol/vol) of PEG 8000 (20%)/2.5M NaCl was added to precipitate the phage particles by incubating the mixture 1 hour on ice.
- the phage particles were collected by centrifugation at 10,000 rpm for 30 minutes and resuspended in 10ml of TE buffer (10 mM tris-HCl pH 8.0; ImM EDTA). The resuspended solution was centrifuged at 10,000 rpm to clear the bacterial debris and the precipitation procedure was repeated. After final resuspension, phage was titrated by infection of E. coli and absorption at 280 nm. The display level of scFv at the surface of phage was also evaluated by Western blot analysis using an anti-c-myc monoclonal antibody.
- Purified phage from different libraries was stored frozen at -80 0 C after addition of glycerol to a final concentration of 15% (w/v).
- the purified phage was pooled into 4 working libraries: AAl - Phage from all Primary synthetic VH libraries; ABl - Phage from all Primary synthetic VL libraries; ACl - Phage from all Primary natural VH libraries; ADl - Phage from all Secondary natural libraries; AEl - Phage from all Secondary synthetic libraries; MnA - Libraries with diversity captured from na ⁇ ve mice; MiB - Libraries with diversity captured from mice immunized with hlFN ⁇ ; MiC - Libraries with diversity captured from mice immunized with hCCL5/RANTES.
- next generation sequencing technology was used to analyze a more representative number of library members.
- DNA isolated from the library AEl was used as a template for high throughput sequencing using an illumina Genome Analyzer instrument. This next- generation DNA sequencing system allows for billions of bases to be read in a few days. The sequencing reads are relatively short (about 70 bases) but perfectly compatible with our library design.
- Immunotubes were coated with 5E3 at lO ⁇ g/ml in PBS over night at 4°C and immunotubes for phage deselection were coated with an irrelevant rat antibody under the same conditions. After washing immunotubes were blocked with PBS containing 3% (w/v) skimmed milk for one hour at room temperature. Aliquots of ADl and AEl phage libraries (10 ⁇ -10 12 Pfu) were blocked with PBS containing 3% (w/v) skimmed milk for one hour at room temperature on a rotary mixer. Blocked phage was then deselected in the immunotubes coated with an irrelevant rat antibody for one hour at room temperature on a rotary mixer.
- Deselected phage was then transferred to the immunotubes coated with 5E3 and incubated for two hours at room temperature on a rotary mixer. Tubes were washed five times with PBS/0.1% Tween 20 and 3 times with PBS. Phage was eluted with TEA 10OmM for 10 minutes and neutralized with IM Tris HCl pH 7.5. Phage was added to 10 ml of exponentially growing TGl cells and incubated for one hour at 37 0 C with slow shaking (100 rpm). An aliquot of the infected TGl was serial diluted to titer the selection output.
- Rounds of selection were performed by alternating between rat 5E3 and a chimeric version of 5E3 in which the variable region were fused to mouse constant domains. These alternating rounds were performed in order to enrich for clones specific for the variable region of 5E3 and generate anti-idiotypic antibodies. Phage outputs were titrated after each round and the progressive increase in outputs indicated that the enrichment of clones specific for the target was occurring ( Figure 17).
- Phage rescue 100 ⁇ l of cell suspension obtained from previous selection rounds were added to 20 ml of 2xTYAG and grown at 37 0 C with agitation (240 rpm) until an OD600 of 0.3 to 0.5 was reached. The culture was then super-infected with 3.3 x 10 10 MK13K07 helper phage and incubated for one hour at 37 0 C (150 rpm). The medium was then changed by centrifuging the cells at 2000 rpm for 10 minutes, removing the medium and resuspending the pellet in 20 ml of 2xTY-AK (100 ⁇ g/ml ampicilin; 50 ⁇ g/ml kanamycin).
- Monoclonal phage rescue for ELISA Single clones were picked into a microtiter plate containing 150 ⁇ l of 2xTYAG media (2% glucose) per well and grown at 37°C (100-120 rpm) for 5-6h. M13KO7 helper phage was added to each well to obtain a multiplicity of infection (MOI) of 10 ⁇ i.e., 10 phage for each cell in the culture) and incubated at 37°C (100 rpm) for Ih. Following growth, plates were centrifuged at 3,200 rpm for 10 min.
- MOI multiplicity of infection
- Phage ELISA ELISA plates (Maxisorb, NUNC) were coated overnight with 2 ⁇ g/ml hlFN ⁇ in PBS or 2 ⁇ g/ml rat 5E3 in PBs.
- Control plates were coated with 2 ⁇ g/ml BSA or an irrelevant rat monoclonal antibody. Plates were then blocked with 3% skimmed milk / PBS at room temperature for Ih. Plates were washed 3 times with PBS 0.05% Tween 20 before transferring the pre-b locked phage supernatants and incubation for one hour at room temperature. Plates were then washed 3 times with PBS 0.05% Tween 20. 50 ⁇ l of 3% skimmed milk / PBS containing (HRP)-conjugated anti-M13 antibody (Amersham, diluted 1 : 10,000) to each well. Following incubation at room temperature for 1 hr, the plates were washed 5 times with PBS 0.05% Tween 20.
- the ELISA was then revealed by adding 50 ⁇ l of TMB (Sigma) and 50 ⁇ l of 2N H 2 SO 4 to stop the reaction. Absorption intensity was read at 450nm. Clones specific for hlFN ⁇ could be identified and the hit rates ranged between 10% and 30% after the third round of selection. Clones specific for the variable region of 5E3 could also be identified and the hit rates ranged between 7 and 48% after the third round of selection.
- Phage clone sequencing Single clones were grown in 5 ml of 2xTYAG media (2% glucose) per well and grown at 37 0 C (120 rpm) overnight. The next day phagemid DNA was purified and used for DNA sequencing using a primer specific for pNDSl : mycseq, 5 '-CTCTTCTGAGATGAGTTTTTG. (SEQ ID NO: 255).
- Large scale scFv purification A starter culture of 1 ml of 2xTYAG was inoculated with a single colony from a freshly streaked 2xTYAG agar plate and incubated with shaking (240 rpm) at 37 0 C for 5 hours. 0.9 ml of this culture was used to inoculate a 400 ml culture of the same media and was grown overnight at 30 0 C with vigorous shaking (300 rpm).
- Imidazole was added to the supernatant to a final concentration of 10 mM.
- 1 ml of Ni-NTA resin (Qiagen), equilibrated in PBS was added to each tube and incubated on a rotary mixer at 4 0 C (20 rpm) for 1 hour.
- the tubes were centrifuged at 2,000 rpm for 5 minutes and the supernatant carefully removed.
- the pelleted resin was resuspended in 10 ml of cold (4 0 C) Wash buffer 1 (50 mM NaH 2 PO 4 , 300 mM NaCl, 10 mM imidazole, pH to 8.0).
- the suspension was added to a polyprep column (Biorad).
- EXAMPLE 13 Evaluating Identified scFvs in binding assays.
- scFvs preparations of clones having different sequences and that were identified positive against the variable region of 5E3 were tested for binding against chimeric 5E3 in a dose response ELISA. These preparations were also tested against an irrelevant mouse antibody (1 A6).
- ELISA plates Maxisorb, NUNC
- Control plates were coated with 2 ⁇ g/ml 1 A6 monoclonal antibody. Plates were then blocked with 3% skimmed milk / PBS at room temperature for Ih. Plates were washed 3 times with PBS 0.05% Tween 20 before adding different concentrations of purified scFv and incubation for one hour at room temperature.
- scFvs preparations of clones having different sequences and that were identified in phage ELISA as binders against hlFN ⁇ were tested for binding against hlFN ⁇ in a dose response experiment .
- ELISA plates (Maxisorb, NUNC) were coated overnight with 2 ⁇ g/ml hlFN ⁇ in PBS and control plates were coated with 2 ⁇ g/ml BSA in PBS. Plates were then blocked with 3% skimmed milk / PBS at room temperature for Ih. Plates were washed 3 times with PBS 0.05% Tween 20 before adding different concentration of purified scFv and incubation for one hour at room temperature.
- a panel of selected scFv specific for hlFN ⁇ was produced and purified as described above and tested for the capacity to block the biological activity of hlFN ⁇ .
- a reporter gene firefly luciferase
- IFN ⁇ -inducible GBPl promoter was trans fected into the human melanoma cell line, Me67.8.
- concentrations of scFv were incubated with 2ng/ml of hlFN ⁇ and then added to the cell culture. Following a 6 hour incubation time, the luciferase reporter assay was performed and the intensity of the luminescence measured.
- the activity was compared to a scFv isolated from another human scFv antibody library constructed by traditional capturing of the VH/VL repertoires form human donors (clone G9).
- the data shows that scFv isolated either from synthetic or natural human diversity libraries (AEl and ADl) were capable of neutralizing the biological activity of hlFN ⁇ in a dose dependent manner ( Figure 21).
- the neutralization potential of these scFv was superior to the benchmark scFv clone G9.
- EXAMPLE 15 scFv Inhibition of Interferon Gamma-Induced MHC Class II Expression
- a flow cytometric assay was implemented to identify fully human IgG antibodies, or fragments thereof, capable of blocking the expression of IFN ⁇ -induced MHC class II molecules.
- 5 ng/ml recombinant human IFN ⁇ was added to cultures in the presence of various concentrations of candidate fully human anti-IFN ⁇ monoclonal antibodies.
- HLA-DR fluorescently labeled anti-human MHC class II antibody
- FACSCalibur ® FACSCalibur ®
- V H and V L sequence of selected scFv were amplified with specific oligonucleotides introducing a leader sequence and a HindIII restriction site at the 5 ' end.
- An Apal site was introduced at the 3' end of the heavy whereas an Avrll and a BsiWI site were introduced at the 3' end of the lambda or kappa light chain sequences, respectively.
- the amplified V H sequences were digested HindIII/ Apal and cloned into the pCon gammal expression vector (LONZA, Basel, Switzerland).
- the amplified V L lambda sequences were digested HindIII/ Avrll and cloned into the pCon_lambda2 expression vector and the amplified V L kappa sequences were digested HindIII/ BsiWI and cloned into the pCon kappa expression vector (LONZA, Basel, Switzerland). The constructions were verified by sequencing before trans fection into mammalian cells. [00299] The V H and V L CDNA sequences in their appropriate expression vectors were transfected into mammalian cells using the Fugene 6 Transfection Reagent (Roche, Basel, Switzerland).
- Peak cells were cultured in 6-well plates at a concentration of 6 x 10 5 cells per well in 2 ml culture media containing fetal bovine serum.
- the expression vectors, encoding the candidate V H and V L sequences, were co-transfected into the cells using the Fugene 6 Transfection Reagent according to manufacturer's instructions.
- the culture media was aspirated, and 3 ml of fresh serum- free media was added to cells and cultured for three days at 37 0 C.
- the supernatant was harvested for IgG purified on protein G- Sepharose 4B fast flow columns (Sigma, St. Louis, MO) according to manufacturer's instructions.
- EXAMPLE 17 IgG inhibition of interferon gamma biological activity
- EXAMPLE 18 Development of a pharmacokinetic assay for the detection of 5E3 in mouse serum.
- mice serum were spiked with 5 ⁇ g/ml of mouse 5E3 antibody and serially diluted in such a way that serum concentration was maintained constant throughout the dilution series.
- Maxisorb plates (Nunc, Denmark) were coated overnight with 1 ⁇ g/ml of IgG DA4 or IgG Gl 1. After blocking with PBS; 1% BSA dilution series of the spiked serum preparations were added to the wells.
- EXAMPLE 19 Phage selection using libraries containing CDRH3 diversity captured from naive and immunized mice.
- scFv expression in microliter plate format Single clones were picked into a microtiter plate containing 150 ⁇ l of 2xTYAG media (2% glucose) per well and grown at 37°C (100-120 rpm) for 5-6h. Plates were centrifuged at 280 rpm, the medium discarded and the cell pellets resuspended in 100 ⁇ l of 2xTYA medium containing ImM IPTG. The plates were incubated overnight at 30 0 C with shaking (100 rpm). Following growth, plates were centrifuged at 3,200 rpm for 10 min and the supernatant carefully transferred to a plate containing 2x concentrated PBS containing 5% skimmed milk powder for blocking.
- scFv ELISA ELISA plates (Maxisorb, NUNC) were coated overnight with 2 ⁇ g/ml hlFN ⁇ in PBS. Control plates were coated with 2 ⁇ g/ml recombinant BSA (Sigma). Plates were then blocked with 3% skimmed milk / PBS at room temperature for Ih. Plates were washed 3 times with PBS 0.05% Tween 20 before transferring the pre- blocked scFv supernatants and incubation for one hour at room temperature. Plates were then washed 3 times with PBS 0.05% Tween 20.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- General Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MX2011012299A MX2011012299A (en) | 2009-05-20 | 2010-05-20 | Systhetic polypeptide libraries and methods for generating naturally diversified polypeptide variants. |
| CA2762837A CA2762837C (en) | 2009-05-20 | 2010-05-20 | Synthetic polypeptide libraries and methods for generating naturally diversified polypeptide variants |
| JP2012512040A JP5797642B2 (en) | 2009-05-20 | 2010-05-20 | Synthetic polypeptide libraries and methods for generating naturally diversified polypeptide variants |
| EP10731846.1A EP2432878B2 (en) | 2009-05-20 | 2010-05-20 | Synthetic polypeptide libraries and methods for generating naturally diversified polypeptide variants |
| CN201080030489.7A CN102459591B (en) | 2009-05-20 | 2010-05-20 | Systhetic polypeptide libraries and methods for generating naturally diversified polypeptide variants |
| RU2011151974/10A RU2562163C2 (en) | 2009-05-20 | 2010-05-20 | Libraries of synthetic polypeptides and methods of obtaining versions of polypeptides with natural diversity |
| AU2010249470A AU2010249470B2 (en) | 2009-05-20 | 2010-05-20 | Synthetic Polypeptide Libraries And Methods For Generating Naturally Diversified Polypeptide Variants |
| ES10731846T ES2545792T5 (en) | 2009-05-20 | 2010-05-20 | Synthetic polypeptide banks and methods to generate naturally diversified polypeptide variants |
| BRPI1011195-6A BRPI1011195B1 (en) | 2009-05-20 | 2010-05-20 | methods to produce a collection of nucleic acids |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17985009P | 2009-05-20 | 2009-05-20 | |
| US61/179,850 | 2009-05-20 | ||
| US28733609P | 2009-12-17 | 2009-12-17 | |
| US61/287,336 | 2009-12-17 | ||
| US31479410P | 2010-03-17 | 2010-03-17 | |
| US61/314,794 | 2010-03-17 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010135558A1 true WO2010135558A1 (en) | 2010-11-25 |
Family
ID=42561627
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/035619 Ceased WO2010135558A1 (en) | 2009-05-20 | 2010-05-20 | Systhetic polypeptide libraries and methods for generating naturally diversified polypeptide variants |
Country Status (11)
| Country | Link |
|---|---|
| US (2) | US8921281B2 (en) |
| EP (1) | EP2432878B2 (en) |
| JP (1) | JP5797642B2 (en) |
| CN (1) | CN102459591B (en) |
| AU (1) | AU2010249470B2 (en) |
| BR (1) | BRPI1011195B1 (en) |
| CA (1) | CA2762837C (en) |
| ES (1) | ES2545792T5 (en) |
| MX (1) | MX2011012299A (en) |
| RU (1) | RU2562163C2 (en) |
| WO (1) | WO2010135558A1 (en) |
Cited By (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012023053A2 (en) | 2010-08-16 | 2012-02-23 | Novimmune S.A. | Methods for the generation of multispecific and multivalent antibodies |
| EP2513312A4 (en) * | 2009-12-17 | 2013-05-15 | Novimmune Sa | SYNTHETIC POLYPEPTIDE LIBRARIES AND METHODS FOR PRODUCING NATURALLY DIVERSIFIED POLYPEPTIDE VARIANTS |
| WO2014087248A2 (en) | 2012-12-03 | 2014-06-12 | Novimmune S.A. | Anti-cd47 antibodies and methods of use thereof |
| JP2015526495A (en) * | 2012-08-31 | 2015-09-10 | アルゲン−エックス エヌ.ブイ. | Highly diverse combinatorial antibody library |
| WO2016083793A1 (en) * | 2014-11-24 | 2016-06-02 | Genevillage Kft | Method |
| WO2016146594A1 (en) | 2015-03-13 | 2016-09-22 | Novimmune Sa | Methods of purifying bispecific antibodies |
| WO2018083535A1 (en) | 2016-11-04 | 2018-05-11 | Novimmune Sa | Anti-cd19 antibodies and methods of use thereof |
| US10047144B2 (en) | 2011-10-19 | 2018-08-14 | Novimmune Sa | Methods of purifying antibodies |
| WO2018215835A1 (en) | 2017-05-26 | 2018-11-29 | Novimmune Sa | Anti-cd47 x anti-mesothelin antibodies and methods of use thereof |
| WO2019175658A1 (en) | 2018-03-14 | 2019-09-19 | Novimmune Sa | Anti-cd3 epsilon antibodies and methods of use thereof |
| EP3588089A1 (en) * | 2013-03-01 | 2020-01-01 | Technophage, Investigação E Desenvolvimento Em Biotecnologia, SA | Cell-based methods for coupling protein interactions and binding molecule selection and diversification |
| WO2020115281A1 (en) | 2018-12-07 | 2020-06-11 | Baxalta GmbH | Proteinaceous molecules binding factor ixa and factor x |
| WO2020114615A1 (en) | 2018-12-07 | 2020-06-11 | Baxalta GmbH | Bispecific antibodies binding factor ixa and factor x |
| WO2020114614A1 (en) | 2018-12-07 | 2020-06-11 | Baxalta GmbH | Proteinaceous molecules binding factor ixa and factor x |
| WO2020115283A1 (en) | 2018-12-07 | 2020-06-11 | Baxalta GmbH | Bispecific antibodies binding factor ixa and factor x |
| WO2022200389A1 (en) | 2021-03-22 | 2022-09-29 | Novimmune S.A. | Bispecific antibodies targeting cd47 and pd-l1 and methods of use thereof |
| WO2022200387A1 (en) | 2021-03-22 | 2022-09-29 | Novimmune S.A. | Bispecific antibodies targeting cd47 and pd-l1 and methods of use thereof |
| WO2023178357A1 (en) | 2022-03-18 | 2023-09-21 | Evolveimmune Therapeutics, Inc. | Bispecific antibody fusion molecules and methods of use thereof |
| US11932673B2 (en) | 2017-07-12 | 2024-03-19 | Maxion Therapeutics Limited | Sodium channel inhibitors |
| US11952424B2 (en) | 2018-03-30 | 2024-04-09 | Merus N.V. | Multivalent antibody |
| WO2024084052A1 (en) | 2022-10-21 | 2024-04-25 | Novimmune Sa | Pd-l1xcd28 bispecific antibodies for immune checkpoint-dependent t cell activation |
| WO2024173607A2 (en) | 2023-02-14 | 2024-08-22 | Evolveimmune Therapeutics, Inc. | Combination of bispecific antibodies and chimeric antigen receptor t cells for treatment |
| US12122850B2 (en) | 2022-03-14 | 2024-10-22 | LamKap Bio gamma AG | Bispecific GPC3xCD28 and GPC3xCD3 antibodies and their combination for targeted killing of GPC3 positive malignant cells |
| WO2025059037A1 (en) | 2023-09-11 | 2025-03-20 | Evolveimmune Therapeutics, Inc. | Bispecific antibody fusion molecules targeting b7-h4 and cd3 and methods of use thereof |
| WO2025064885A1 (en) | 2023-09-20 | 2025-03-27 | Evolveimmune Therapeutics, Inc. | Multispecific antibodies that bind cd3 and cd2 and methods of use thereof |
| WO2025064890A1 (en) | 2023-09-20 | 2025-03-27 | Evolveimmune Therapeutics, Inc. | Bispecific antibody fusion molecules targeting cd180 and cd3 and methods of use thereof |
| WO2025114357A1 (en) | 2023-11-28 | 2025-06-05 | Novimmune Sa | Method of treating disease using anti-cd47 x anti-mesothelin antibodies as a sole agent and in combination with anti-pd-1 antibodies |
| US12577327B2 (en) | 2018-12-31 | 2026-03-17 | Merus B.V. | Mixed binding domains |
| WO2026082966A1 (en) | 2024-10-18 | 2026-04-23 | Novimmune Sa | Methods of treating disease using anti-cd47 x anti-mesothelin antibodies in combination with chemotherapy |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK2744931T3 (en) | 2011-08-18 | 2018-08-06 | Affinity Biosciences Pty Ltd | SOLUBLE POLYPEPTIDES |
| DK3126384T3 (en) * | 2014-04-01 | 2021-01-18 | Adimab Llc | MULTISPECIFIC ANTIBODY ANALOGS INCLUDING A COMMON LIGHT CHAIN, AND METHODS FOR THEIR PREPARATION AND USE |
| EP3288973B1 (en) * | 2015-04-30 | 2021-10-20 | AbCheck s.r.o. | Method for mass humanization of rabbit antibodies |
| WO2017118761A1 (en) * | 2016-01-08 | 2017-07-13 | Iontas Ltd | Binding members with altered diversity scaffold domains |
| KR102115300B1 (en) | 2018-06-01 | 2020-05-26 | 재단법인 목암생명과학연구소 | Antibody library and Screening Method of Antibody by Using the Same |
| JP7812367B2 (en) * | 2020-08-10 | 2026-02-09 | インテグラル・モレキュラー・インコーポレイテッド | Methods and compositions for generating antibody libraries and antibodies isolated therefrom |
| CN114539422B (en) * | 2020-11-25 | 2024-03-29 | 安升(上海)医药科技有限公司 | Construction method and application of nucleic acid multimerization mediated multivalent protein medicine and vaccine |
| CN114775065B (en) * | 2022-04-22 | 2026-01-06 | 武汉华美生物工程有限公司 | A method for constructing a semi-synthetic nanobody library and a nanobody library |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020068276A1 (en) * | 1997-10-20 | 2002-06-06 | Greg Winter | Methods for selecting functional polypeptides |
| US6828422B1 (en) * | 1995-08-18 | 2004-12-07 | Morphosys Ag | Protein/(poly)peptide libraries |
Family Cites Families (84)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US5618920A (en) | 1985-11-01 | 1997-04-08 | Xoma Corporation | Modular assembly of antibody genes, antibodies prepared thereby and use |
| US5576195A (en) | 1985-11-01 | 1996-11-19 | Xoma Corporation | Vectors with pectate lyase signal sequence |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US6548640B1 (en) | 1986-03-27 | 2003-04-15 | Btg International Limited | Altered antibodies |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US5260203A (en) | 1986-09-02 | 1993-11-09 | Enzon, Inc. | Single polypeptide chain binding molecules |
| US5869620A (en) | 1986-09-02 | 1999-02-09 | Enzon, Inc. | Multivalent antigen-binding proteins |
| WO1988001649A1 (en) | 1986-09-02 | 1988-03-10 | Genex Corporation | Single polypeptide chain binding molecules |
| DE3852304T3 (en) | 1987-03-02 | 1999-07-01 | Enzon Labs Inc., Piscataway, N.J. | Organism as carrier for "Single Chain Antibody Domain (SCAD)". |
| AU612370B2 (en) | 1987-05-21 | 1991-07-11 | Micromet Ag | Targeted multifunctional proteins |
| CA1341235C (en) | 1987-07-24 | 2001-05-22 | Randy R. Robinson | Modular assembly of antibody genes, antibodies prepared thereby and use |
| WO1989006283A1 (en) | 1988-01-11 | 1989-07-13 | Ingene (International Genetic Engineering, Inc.) | Novel plasmid vector with pectate lyase signal sequence |
| EP0768377A1 (en) | 1988-09-02 | 1997-04-16 | Protein Engineering Corporation | Generation and selection of recombinant varied binding proteins |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| ES2052027T5 (en) | 1988-11-11 | 2005-04-16 | Medical Research Council | IMMUNOGLOBULINE VARIABLE DOMAIN SEQUENCE CLONING. |
| CA2016842A1 (en) | 1989-05-16 | 1990-11-16 | Richard A. Lerner | Method for tapping the immunological repertoire |
| US6291158B1 (en) | 1989-05-16 | 2001-09-18 | Scripps Research Institute | Method for tapping the immunological repertoire |
| CA2016841C (en) | 1989-05-16 | 1999-09-21 | William D. Huse | A method for producing polymers having a preselected activity |
| US6291161B1 (en) | 1989-05-16 | 2001-09-18 | Scripps Research Institute | Method for tapping the immunological repertiore |
| AU7247191A (en) | 1990-01-11 | 1991-08-05 | Molecular Affinities Corporation | Production of antibodies using gene libraries |
| US5780225A (en) | 1990-01-12 | 1998-07-14 | Stratagene | Method for generating libaries of antibody genes comprising amplification of diverse antibody DNAs and methods for using these libraries for the production of diverse antigen combining molecules |
| US5427908A (en) | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
| US6172197B1 (en) | 1991-07-10 | 2001-01-09 | Medical Research Council | Methods for producing members of specific binding pairs |
| GB9015198D0 (en) | 1990-07-10 | 1990-08-29 | Brien Caroline J O | Binding substance |
| GB9206318D0 (en) | 1992-03-24 | 1992-05-06 | Cambridge Antibody Tech | Binding substances |
| US7063943B1 (en) | 1990-07-10 | 2006-06-20 | Cambridge Antibody Technology | Methods for producing members of specific binding pairs |
| US6916605B1 (en) | 1990-07-10 | 2005-07-12 | Medical Research Council | Methods for producing members of specific binding pairs |
| CA2109602C (en) | 1990-07-10 | 2002-10-01 | Gregory P. Winter | Methods for producing members of specific binding pairs |
| ES2113940T3 (en) | 1990-12-03 | 1998-05-16 | Genentech Inc | ENRICHMENT METHOD FOR PROTEIN VARIANTS WITH ALTERED UNION PROPERTIES. |
| DE69233769D1 (en) | 1991-03-01 | 2009-09-24 | Dyax Corp | Chimeric protein with microprotein having two or more disulfide bonds and embodiments thereof |
| US5955341A (en) | 1991-04-10 | 1999-09-21 | The Scripps Research Institute | Heterodimeric receptor libraries using phagemids |
| AU662148B2 (en) | 1991-04-10 | 1995-08-24 | Scripps Research Institute, The | Heterodimeric receptor libraries using phagemids |
| US5512463A (en) | 1991-04-26 | 1996-04-30 | Eli Lilly And Company | Enzymatic inverse polymerase chain reaction library mutagenesis |
| US5514568A (en) | 1991-04-26 | 1996-05-07 | Eli Lilly And Company | Enzymatic inverse polymerase chain reaction |
| US5858657A (en) | 1992-05-15 | 1999-01-12 | Medical Research Council | Methods for producing members of specific binding pairs |
| US6492160B1 (en) | 1991-05-15 | 2002-12-10 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| US5962255A (en) | 1992-03-24 | 1999-10-05 | Cambridge Antibody Technology Limited | Methods for producing recombinant vectors |
| US6225447B1 (en) | 1991-05-15 | 2001-05-01 | Cambridge Antibody Technology Ltd. | Methods for producing members of specific binding pairs |
| US5871907A (en) | 1991-05-15 | 1999-02-16 | Medical Research Council | Methods for producing members of specific binding pairs |
| DE4122599C2 (en) | 1991-07-08 | 1993-11-11 | Deutsches Krebsforsch | Phagemid for screening antibodies |
| ES2130177T3 (en) | 1991-08-10 | 1999-07-01 | Medical Res Council | TREATMENT OF CELL POPULATIONS. |
| US5565332A (en) | 1991-09-23 | 1996-10-15 | Medical Research Council | Production of chimeric antibodies - a combinatorial approach |
| EP0605522B1 (en) | 1991-09-23 | 1999-06-23 | Medical Research Council | Methods for the production of humanized antibodies |
| DE69233528T2 (en) | 1991-11-25 | 2006-03-16 | Enzon, Inc. | Process for the preparation of multivalent antigen-binding proteins |
| US6027725A (en) | 1991-11-25 | 2000-02-22 | Enzon, Inc. | Multivalent antigen-binding proteins |
| JP3949712B2 (en) | 1991-12-02 | 2007-07-25 | メディカル リサーチ カウンシル | Production of anti-autoantibodies derived from antibody segment repertoire and displayed on phage |
| PT1696031E (en) | 1991-12-02 | 2010-06-25 | Medical Res Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| US5667988A (en) | 1992-01-27 | 1997-09-16 | The Scripps Research Institute | Methods for producing antibody libraries using universal or randomized immunoglobulin light chains |
| US7067284B1 (en) | 1992-01-27 | 2006-06-27 | The Scripps Research Institute | Methods for producing antibody libraries using universal or randomized immunoglobulin light chains |
| US5225339A (en) * | 1992-02-26 | 1993-07-06 | The Scripps Research Institute | Lactobacillus kefir alcohol dehydrogenase |
| US5733743A (en) | 1992-03-24 | 1998-03-31 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| JP3507073B2 (en) | 1992-03-24 | 2004-03-15 | ケンブリッジ アンティボディー テクノロジー リミティド | Methods for producing members of a specific binding pair |
| AU689755B2 (en) | 1992-09-22 | 1998-04-09 | Biofocus Discovery Limited | Recombinant viruses displaying a nonviral polypeptide on their external surface |
| US5565325A (en) | 1992-10-30 | 1996-10-15 | Bristol-Myers Squibb Company | Iterative methods for screening peptide libraries |
| JP3720353B2 (en) | 1992-12-04 | 2005-11-24 | メディカル リサーチ カウンシル | Multivalent and multispecific binding proteins, their production and use |
| US5855885A (en) | 1993-01-22 | 1999-01-05 | Smith; Rodger | Isolation and production of catalytic antibodies using phage technology |
| AU6235294A (en) | 1993-02-02 | 1994-08-29 | Scripps Research Institute, The | Methods for producing polypeptide binding sites |
| DE614989T1 (en) | 1993-02-17 | 1995-09-28 | Morphosys Proteinoptimierung | Method for in vivo selection of ligand binding proteins. |
| GB9313509D0 (en) | 1993-06-30 | 1993-08-11 | Medical Res Council | Chemisynthetic libraries |
| US5922545A (en) | 1993-10-29 | 1999-07-13 | Affymax Technologies N.V. | In vitro peptide and antibody display libraries |
| FR2715940B1 (en) | 1994-02-10 | 1996-04-26 | Pasteur Merieux Serums Vacc | Process for the preparation of a multi-combinatorial library of expression vectors of antibody genes, library and expression systems of "colonic" antibodies obtained. |
| US5502145A (en) * | 1994-03-02 | 1996-03-26 | Dsm Desotech. Inc. | Coating system for glass strength retention |
| US6326155B1 (en) | 1995-03-20 | 2001-12-04 | Dyax Corp. | Engineering affinity ligands for macromolecules |
| US5702892A (en) | 1995-05-09 | 1997-12-30 | The United States Of America As Represented By The Department Of Health And Human Services | Phage-display of immunoglobulin heavy chain libraries |
| ATE219517T1 (en) | 1995-08-18 | 2002-07-15 | Morphosys Ag | PROTEIN/(POLY)PEPTIDE LIBRARIES |
| FR2741892B1 (en) | 1995-12-04 | 1998-02-13 | Pasteur Merieux Serums Vacc | METHOD FOR PREPARING A MULTI-COMBINED BANK OF ANTIBODY GENE EXPRESSION VECTORS, BANK AND COLICLONAL ANTIBODY EXPRESSION SYSTEMS |
| GB9712818D0 (en) | 1996-07-08 | 1997-08-20 | Cambridge Antibody Tech | Labelling and selection of specific binding molecules |
| DE69637484T2 (en) | 1996-08-19 | 2010-06-24 | Morphosys Ip Gmbh | Vectors / DNA sequences from human combinatorial antibody libraries |
| JP2001512560A (en) | 1996-10-08 | 2001-08-21 | ユー―ビスイス ベスローテン フェンノートシャップ | Methods and means for the selection of peptides and proteins with specific affinity for a target |
| GB9701425D0 (en) | 1997-01-24 | 1997-03-12 | Bioinvent Int Ab | A method for in vitro molecular evolution of protein function |
| TR199902553T2 (en) | 1997-04-14 | 2000-03-21 | Micromet Gesellschaft F�R Biomedizinische Forschung Mbh | New methods and uses for the production of antigen receptors against the human body. |
| AU2291700A (en) | 1999-01-19 | 2000-08-07 | Unilever Plc | Method for producing antibody fragments |
| US8288322B2 (en) | 2000-04-17 | 2012-10-16 | Dyax Corp. | Methods of constructing libraries comprising displayed and/or expressed members of a diverse family of peptides, polypeptides or proteins and the novel libraries |
| US6610472B1 (en) | 2000-10-31 | 2003-08-26 | Genetastix Corporation | Assembly and screening of highly complex and fully human antibody repertoire in yeast |
| CA2440044A1 (en) * | 2001-03-02 | 2002-09-12 | Riken | Cloning vectors and method for molecular cloning |
| ATE364632T1 (en) † | 2001-10-05 | 2007-07-15 | Affimed Therapeutics Ag | ANTIBODIES OF HUMAN ORIGIN FOR INHIBITING THROMBOCYTE AGGREGATION |
| AR038568A1 (en) * | 2002-02-20 | 2005-01-19 | Hoffmann La Roche | ANTI-A BETA ANTIBODIES AND ITS USE |
| US20040038304A1 (en) | 2002-03-28 | 2004-02-26 | Gala Design, Inc. | Antibody libraries |
| US7135310B2 (en) * | 2002-04-24 | 2006-11-14 | The Regents Of The University Of California | Method to amplify variable sequences without imposing primer sequences |
| US7914792B2 (en) | 2003-02-14 | 2011-03-29 | Exothera L.L.C. | Methods and compounds for raising antibodies and for screening antibody repertoires |
| JP4782700B2 (en) * | 2004-01-20 | 2011-09-28 | カロバイオス ファーマシューティカルズ インコーポレイティッド | Transfer of antibody specificity using minimally required binding determinants |
| EP2343380B1 (en) | 2004-11-16 | 2019-06-12 | Humanigen, Inc. | Immunoglobulin variable region cassette exchange |
| US20090143247A1 (en) * | 2007-03-15 | 2009-06-04 | Pierre Emile Ulysse Martineau | Methods for Producing Active scFv Antibodies and Libraries Therefor |
-
2010
- 2010-05-20 AU AU2010249470A patent/AU2010249470B2/en active Active
- 2010-05-20 BR BRPI1011195-6A patent/BRPI1011195B1/en active IP Right Grant
- 2010-05-20 RU RU2011151974/10A patent/RU2562163C2/en active
- 2010-05-20 EP EP10731846.1A patent/EP2432878B2/en active Active
- 2010-05-20 US US12/784,190 patent/US8921281B2/en active Active
- 2010-05-20 ES ES10731846T patent/ES2545792T5/en active Active
- 2010-05-20 CA CA2762837A patent/CA2762837C/en active Active
- 2010-05-20 JP JP2012512040A patent/JP5797642B2/en active Active
- 2010-05-20 MX MX2011012299A patent/MX2011012299A/en active IP Right Grant
- 2010-05-20 WO PCT/US2010/035619 patent/WO2010135558A1/en not_active Ceased
- 2010-05-20 CN CN201080030489.7A patent/CN102459591B/en active Active
-
2014
- 2014-12-30 US US14/585,551 patent/US20150119294A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6828422B1 (en) * | 1995-08-18 | 2004-12-07 | Morphosys Ag | Protein/(poly)peptide libraries |
| US20020068276A1 (en) * | 1997-10-20 | 2002-06-06 | Greg Winter | Methods for selecting functional polypeptides |
Non-Patent Citations (35)
| Title |
|---|
| AL-LAZIKANI B ET AL., J MOL BIOL., vol. 273, no. 4, 7 November 1997 (1997-11-07), pages 927 - 48 |
| BALINT RF; LARRICK JW, GENE, vol. 137, no. 1, 27 December 1993 (1993-12-27), pages 109 - 18 |
| BODER ET; WITTRUP KD., NAT BIOTECHNOL., vol. 15, no. 6, June 1997 (1997-06-01), pages 553 - 7 |
| BOWIE ET AL., SCIENCE, vol. 253, 1991, pages 164 |
| CHOTHIA ET AL., NATURE, vol. 342, 1989, pages 878 - 883 |
| CHOTHIA; LESK, J. MOL. BIOL., vol. 196, 1987, pages 901 - 917 |
| COLLIS A ET AL., J MOL BIOL, vol. 325, 2003, pages 337 - 354 |
| DAUGHERTY PS ET AL., PROTEIN ENG, vol. 11, no. 9, September 1998 (1998-09-01), pages 825 - 32 |
| DAVIES ET AL., ANNUAL REV BIOCHEM, vol. 59, 1990, pages 439 - 473 |
| DE BRUIN R ET AL., NAT BIOTECHNOL, 17 April 1999 (1999-04-17), pages 397 - 399 |
| DE KRUIF J ET AL., J MOL BIOL., vol. 248, no. 1, 21 April 1995 (1995-04-21), pages 97 - 105 |
| EWERT S ET AL., J MOL BIOL., vol. 325, no. 3, 17 January 2003 (2003-01-17), pages 531 - 53 |
| FAGETE SEVERINE ET AL: "Specificity tuning of antibody fragments to neutralize two human chemokines with a single agent", MABS, vol. 1, no. 3, 7 April 2009 (2009-04-07), pages 288 - 296, XP002598001, ISSN: 1942-0862 * |
| HANES J; PLACKTHUN A, PROC NATL ACAD SCI U S A., vol. 94, no. 10, 13 May 1997 (1997-05-13), pages 4937 - 42 |
| IVANOV I ET AL., J IMMUNOL, vol. 174, 2005, pages 7773 - 7780 |
| KNAPPIK A ET AL., J MOL BIOL., vol. 296, no. 1, 11 February 2000 (2000-02-11), pages 57 - 86 |
| LEE CV ET AL., J MOL BIOL., vol. 340, no. 5, 23 July 2004 (2004-07-23), pages 1073 - 93 |
| LEFRANC, M.-P. ET AL., NUCLEIC ACIDS RESEARCH, vol. 27, 1999, pages 209 - 212 |
| LINK JM ET AL., MOLECULAR IMMUNOL., vol. 42, 2005, pages 943 - 955 |
| MARKS JD ET AL., J MOL BIOL., vol. 222, no. 3, 5 December 1991 (1991-12-05), pages 581 - 97 |
| NATURE, vol. 361, 1993, pages 186 - 87 |
| PCRSSON MA, PROC NATL ACAD SCI U S A., vol. 88, no. 6, 15 March 1991 (1991-03-15), pages 2432 - 6 |
| ROCK EP ET AL., J EXP MED, vol. 179, 1994, pages 323 - 328 |
| ROTHE ET AL., J MOL BIOL., vol. 376, no. 4, 29 February 2008 (2008-02-29), pages 1182 - 200 |
| SCHOONBROODT S ET AL., NUCLEIC ACIDS RES., vol. 33, no. 9, 19 May 2005 (2005-05-19), pages E81 |
| SCHROEDER JR, HW ET AL., BLOOD, vol. 98, 2001, pages 2745 - 2751 |
| SIDHU S S ET AL: "Phage-displayed Antibody Libraries of Synthetic Heavy Chain Complementarity Determining Regions", JOURNAL OF MOLECULAR BIOLOGY, LONDON, GB LNKD- DOI:10.1016/J.JMB.2004.02.050, vol. 338, no. 2, 23 April 2004 (2004-04-23), pages 299 - 310, XP004500301, ISSN: 0022-2836 * |
| SIDHU SS ET AL., J MOL BIOL., vol. 338, no. 2, 23 April 2004 (2004-04-23), pages 299 - 310 |
| SIDHU SS ET AL., METHODS ENZYMOL., vol. 328, 2000, pages 333 - 63 |
| SMITH GP, SCIENCE, vol. 228, no. 4705, 14 June 1985 (1985-06-14), pages 1315 - 7 |
| SODERLIND E ET AL M ET AL: "Recombining germline-derived CDR sequences for creating diverse single-framework antibody libraries", NATURE BIOTECHNOLOGY 2000 US LNKD- DOI:10.1038/78458, vol. 18, no. 8, 2000, pages 852 - 856, XP002598002, ISSN: 1087-0156 * |
| SODERLING E ET AL., NAT BIOTECHNOL., vol. 18, no. 8, August 2000 (2000-08-01), pages 852 - 6 |
| SZYBALSKI ET AL.: "Class-IIS Restriction Enzymes - a Review", GENE, vol. 100, 1991, pages 13 - 26, XP023541416, DOI: doi:10.1016/0378-1119(91)90345-C |
| THORNTON, NATURE, vol. 354, 1991, pages 105 |
| ZCMLIN M, J MOL BIOL, vol. 334, 2003, pages 733 - 749 |
Cited By (47)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2513312A4 (en) * | 2009-12-17 | 2013-05-15 | Novimmune Sa | SYNTHETIC POLYPEPTIDE LIBRARIES AND METHODS FOR PRODUCING NATURALLY DIVERSIFIED POLYPEPTIDE VARIANTS |
| WO2012023053A2 (en) | 2010-08-16 | 2012-02-23 | Novimmune S.A. | Methods for the generation of multispecific and multivalent antibodies |
| WO2012023053A3 (en) * | 2010-08-16 | 2012-05-24 | Novimmune S.A. | Methods for the generation of multispecific and multivalent antibodies |
| US10597465B2 (en) | 2010-08-16 | 2020-03-24 | Novimmune Sa | Methods for the generation of multispecific and multivalent antibodies |
| US9926382B2 (en) | 2010-08-16 | 2018-03-27 | Novimmune S.A. | Methods for the generation of multispecific and multivalent antibodies |
| US9834615B2 (en) | 2010-08-16 | 2017-12-05 | Novimmune Sa | Methods for the generation of multispecific and multivalent antibodies |
| US10047144B2 (en) | 2011-10-19 | 2018-08-14 | Novimmune Sa | Methods of purifying antibodies |
| JP2015526495A (en) * | 2012-08-31 | 2015-09-10 | アルゲン−エックス エヌ.ブイ. | Highly diverse combinatorial antibody library |
| WO2014087248A2 (en) | 2012-12-03 | 2014-06-12 | Novimmune S.A. | Anti-cd47 antibodies and methods of use thereof |
| US11840553B2 (en) | 2012-12-03 | 2023-12-12 | Novimmune Sa | Anti-CD47 antibodies and methods of use thereof |
| EP3725807A1 (en) | 2012-12-03 | 2020-10-21 | NovImmune SA | Anti-cd47 antibodies and methods of use thereof |
| US11059910B2 (en) | 2012-12-03 | 2021-07-13 | Novimmune Sa | Anti-CD47 antibodies and methods of use thereof |
| EP4706769A2 (en) | 2012-12-03 | 2026-03-11 | NovImmune SA | Anti-cd47 antibodies and methods of use thereof |
| EP3588089A1 (en) * | 2013-03-01 | 2020-01-01 | Technophage, Investigação E Desenvolvimento Em Biotecnologia, SA | Cell-based methods for coupling protein interactions and binding molecule selection and diversification |
| US10605814B2 (en) | 2014-11-24 | 2020-03-31 | Genevillage Kft | Detecting protein-protein interactions |
| CN107430130A (en) * | 2014-11-24 | 2017-12-01 | 吉尼维拉基公司 | Method |
| KR20170086627A (en) * | 2014-11-24 | 2017-07-26 | 제네빌라지 케이에프티 | Method |
| US11421347B2 (en) | 2014-11-24 | 2022-08-23 | Genevillage Kft | Methods for labelling, analyzing, detecting and measuring protein-protein interactions |
| KR102422494B1 (en) | 2014-11-24 | 2022-07-19 | 제네빌라지 케이에프티 | Method |
| WO2016083793A1 (en) * | 2014-11-24 | 2016-06-02 | Genevillage Kft | Method |
| US10457749B2 (en) | 2015-03-13 | 2019-10-29 | Novimmune Sa | Methods of purifying bispecific antibodies |
| WO2016146594A1 (en) | 2015-03-13 | 2016-09-22 | Novimmune Sa | Methods of purifying bispecific antibodies |
| WO2018083535A1 (en) | 2016-11-04 | 2018-05-11 | Novimmune Sa | Anti-cd19 antibodies and methods of use thereof |
| WO2018215835A1 (en) | 2017-05-26 | 2018-11-29 | Novimmune Sa | Anti-cd47 x anti-mesothelin antibodies and methods of use thereof |
| US11260117B2 (en) | 2017-05-26 | 2022-03-01 | Novimmune Sa | Anti-CD47 x anti-mesothelin antibodies and methods of use thereof |
| US11932673B2 (en) | 2017-07-12 | 2024-03-19 | Maxion Therapeutics Limited | Sodium channel inhibitors |
| WO2019175658A1 (en) | 2018-03-14 | 2019-09-19 | Novimmune Sa | Anti-cd3 epsilon antibodies and methods of use thereof |
| US11203646B2 (en) | 2018-03-14 | 2021-12-21 | Novimmune Sa | Anti-CD3 epsilon antibodies and methods of use thereof |
| US11952424B2 (en) | 2018-03-30 | 2024-04-09 | Merus N.V. | Multivalent antibody |
| WO2020115283A1 (en) | 2018-12-07 | 2020-06-11 | Baxalta GmbH | Bispecific antibodies binding factor ixa and factor x |
| WO2020114614A1 (en) | 2018-12-07 | 2020-06-11 | Baxalta GmbH | Proteinaceous molecules binding factor ixa and factor x |
| WO2020114615A1 (en) | 2018-12-07 | 2020-06-11 | Baxalta GmbH | Bispecific antibodies binding factor ixa and factor x |
| WO2020115281A1 (en) | 2018-12-07 | 2020-06-11 | Baxalta GmbH | Proteinaceous molecules binding factor ixa and factor x |
| US12577327B2 (en) | 2018-12-31 | 2026-03-17 | Merus B.V. | Mixed binding domains |
| WO2022200389A1 (en) | 2021-03-22 | 2022-09-29 | Novimmune S.A. | Bispecific antibodies targeting cd47 and pd-l1 and methods of use thereof |
| US12583922B2 (en) | 2021-03-22 | 2026-03-24 | Novimmune Sa | Bispecific antibodies targeting CD47 and PD-L1 and methods of use thereof |
| WO2022200387A1 (en) | 2021-03-22 | 2022-09-29 | Novimmune S.A. | Bispecific antibodies targeting cd47 and pd-l1 and methods of use thereof |
| US12448444B2 (en) | 2021-03-22 | 2025-10-21 | Novimmune Sa | Bispecific antibodies targeting CD47 and PD-L1 and methods of use thereof |
| US12122850B2 (en) | 2022-03-14 | 2024-10-22 | LamKap Bio gamma AG | Bispecific GPC3xCD28 and GPC3xCD3 antibodies and their combination for targeted killing of GPC3 positive malignant cells |
| WO2023178357A1 (en) | 2022-03-18 | 2023-09-21 | Evolveimmune Therapeutics, Inc. | Bispecific antibody fusion molecules and methods of use thereof |
| WO2024084052A1 (en) | 2022-10-21 | 2024-04-25 | Novimmune Sa | Pd-l1xcd28 bispecific antibodies for immune checkpoint-dependent t cell activation |
| WO2024173607A2 (en) | 2023-02-14 | 2024-08-22 | Evolveimmune Therapeutics, Inc. | Combination of bispecific antibodies and chimeric antigen receptor t cells for treatment |
| WO2025059037A1 (en) | 2023-09-11 | 2025-03-20 | Evolveimmune Therapeutics, Inc. | Bispecific antibody fusion molecules targeting b7-h4 and cd3 and methods of use thereof |
| WO2025064890A1 (en) | 2023-09-20 | 2025-03-27 | Evolveimmune Therapeutics, Inc. | Bispecific antibody fusion molecules targeting cd180 and cd3 and methods of use thereof |
| WO2025064885A1 (en) | 2023-09-20 | 2025-03-27 | Evolveimmune Therapeutics, Inc. | Multispecific antibodies that bind cd3 and cd2 and methods of use thereof |
| WO2025114357A1 (en) | 2023-11-28 | 2025-06-05 | Novimmune Sa | Method of treating disease using anti-cd47 x anti-mesothelin antibodies as a sole agent and in combination with anti-pd-1 antibodies |
| WO2026082966A1 (en) | 2024-10-18 | 2026-04-23 | Novimmune Sa | Methods of treating disease using anti-cd47 x anti-mesothelin antibodies in combination with chemotherapy |
Also Published As
| Publication number | Publication date |
|---|---|
| ES2545792T3 (en) | 2015-09-15 |
| EP2432878A1 (en) | 2012-03-28 |
| EP2432878B2 (en) | 2018-05-16 |
| US20150119294A1 (en) | 2015-04-30 |
| US20110065610A1 (en) | 2011-03-17 |
| BRPI1011195A2 (en) | 2018-12-11 |
| CN102459591B (en) | 2015-05-13 |
| CN102459591A (en) | 2012-05-16 |
| CA2762837C (en) | 2021-08-03 |
| CA2762837A1 (en) | 2011-11-25 |
| US8921281B2 (en) | 2014-12-30 |
| RU2562163C2 (en) | 2015-09-10 |
| MX2011012299A (en) | 2012-03-29 |
| BRPI1011195B1 (en) | 2020-10-13 |
| JP5797642B2 (en) | 2015-10-21 |
| AU2010249470A1 (en) | 2011-12-15 |
| AU2010249470B2 (en) | 2015-06-25 |
| JP2012527246A (en) | 2012-11-08 |
| EP2432878B1 (en) | 2015-05-20 |
| ES2545792T5 (en) | 2018-09-14 |
| RU2011151974A (en) | 2013-06-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8921281B2 (en) | Synthetic polypeptide libraries and methods for generating naturally diversified polypeptide variants | |
| EP2513312B1 (en) | Synthetic polypeptide libraries and methods for generating naturally diversified polypeptide variants | |
| US9062305B2 (en) | Generation of human de novo pIX phage display libraries | |
| Prassler et al. | HuCAL PLATINUM, a synthetic Fab library optimized for sequence diversity and superior performance in mammalian expression systems | |
| US8257705B2 (en) | Single-domain antigen-binding antibody fragments derived from llama antibodies | |
| CA2988001C (en) | Method for mass humanization of rabbit antibodies | |
| CA2758356C (en) | A collection of vh and vl pairs having favourable biophysical properties and methods for its use | |
| US9541559B2 (en) | Collection and methods for its use | |
| US10919955B2 (en) | Rodent combinatorial antibody libraries | |
| US20150005201A1 (en) | Synthetic polypeptide libraries and methods for generating naturally diversified polypeptide variants | |
| AU2017428737A1 (en) | Dynamic human heavy chain antibody libraries | |
| GB2470433A (en) | Immunoglobulin variable domain production using type IIs restriction enzymes | |
| Bostrom et al. | Design and construction of synthetic phage-displayed Fab libraries | |
| KR20220026869A (en) | A novel method for generating an antibody library and the generated library therefrom |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201080030489.7 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10731846 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2762837 Country of ref document: CA Ref document number: 2012512040 Country of ref document: JP Ref document number: MX/A/2011/012299 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010249470 Country of ref document: AU Ref document number: 4820/KOLNP/2011 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010731846 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2010249470 Country of ref document: AU Date of ref document: 20100520 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2011151974 Country of ref document: RU Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: PI1011195 Country of ref document: BR |
|
| ENPW | Started to enter national phase and was withdrawn or failed for other reasons |
Ref document number: PI1011195 Country of ref document: BR |
|
| ENPZ | Former announcement of the withdrawal of the entry into the national phase was wrong |
Ref document number: PI1011195 Country of ref document: BR Free format text: FOI ANULADO O DESPACHO 1.2 DA RPI 2390DE 25/10/2016 POR TER SIDO INDEVIDO. |
|
| ENP | Entry into the national phase |
Ref document number: PI1011195 Country of ref document: BR Kind code of ref document: A2 Effective date: 20111121 |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: PI1011195 Country of ref document: BR Kind code of ref document: A2 Free format text: COM BASE NA RESOLUCAO 228/09, SOLICITA-SE QUE SEJA APRESENTADO NOVO CONTEUDO DE LISTAGEM DE SEQUENCIA, POIS OS CDS APRESENTADOS ENCONTRAVAM-SE VAZIOS. Ref country code: BR Ref legal event code: B01E Ref document number: PI1011195 Country of ref document: BR Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: PI1011195 Country of ref document: BR Kind code of ref document: A2 Effective date: 20111121 |
