WO2010133652A1 - Multimodal activity of g-quartet oligonucleotides and microbicide compositions - Google Patents

Multimodal activity of g-quartet oligonucleotides and microbicide compositions Download PDF

Info

Publication number
WO2010133652A1
WO2010133652A1 PCT/EP2010/056928 EP2010056928W WO2010133652A1 WO 2010133652 A1 WO2010133652 A1 WO 2010133652A1 EP 2010056928 W EP2010056928 W EP 2010056928W WO 2010133652 A1 WO2010133652 A1 WO 2010133652A1
Authority
WO
WIPO (PCT)
Prior art keywords
hiv
viral
composition
andevir
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2010/056928
Other languages
French (fr)
Inventor
Marie-Line Andreola
Michel Ventura
Aurelie Faure
Mathieu Metifiot
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Universite Victor Segalen Bordeaux 2
Original Assignee
Centre National de la Recherche Scientifique CNRS
Universite Victor Segalen Bordeaux 2
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS, Universite Victor Segalen Bordeaux 2 filed Critical Centre National de la Recherche Scientifique CNRS
Publication of WO2010133652A1 publication Critical patent/WO2010133652A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV

Definitions

  • the present invention relates to a composition for preventing and/or treating retrovirus associated infectious diseases such as human immunodeficiency virus.
  • Retroviruses like the Human immunodeficiency virus (HIV)-I continue to be a global pandemic of enormous consequence to civilization.
  • Acquired Immune Deficiency Syndrome (AIDS) was first recognized by the U.S. Centers for Disease Control and Prevention in 1981 and its cause HIV, identified in the early 1980s. AIDS is now a pandemic.
  • Antiretro viral therapy has markedly prolonged the survival of individuals, but there exists an urgent need for intervention in the transmission of the virus itself. There is a steady antigenic shift and hence continuously emerging drug resistant strains further augmented by exponential increase in HIV cases in developing and under developed countries where the currently available HIV therapies may be too expensive for wide spread use. Hence there is an urgent need for preventive treatment or prophylaxis.
  • Antiretro viral drugs are broadly classified by the phase of the retrovirus life-cycle that the drug inhibits. There are thus five broad classifications of antiretroviral drugs in development, though only the first three classes are currently marketed:
  • RTIs Reverse transcriptase inhibitors target construction of viral DNA by inhibiting activity of reverse transcriptase.
  • RTIs Reverse transcriptase inhibitors
  • nucleoside-analogue RTIs are incorporated into the viral DNA leading to chain termination, while non-nucleoside-analogue RTIs distort the binding potential of the reverse transcriptase enzyme.
  • Protease inhibitors target viral assembly by inhibiting the activity of protease, an enzyme used by HIV to cleave nascent proteins for final assembly of new virions.
  • Fusion inhibitors block HIV from fusing with a cell's membrane to enter and infect it.
  • Integrase inhibitors inhibit the enzyme integrase, which is responsible for integration of viral DNA into the DNA of the infected cell. There are several integrase inhibitors currently under clinical trial but only one is commercially available.
  • Entry inhibitors block HIV-I from the host cell by binding CCR5, a molecule on the viral membrane termed a co-receptor that HIV-I normally uses for entry into the cell.
  • numerous antiretro viral drugs were developed against different steps of HIV-I retroviral cycle, e.g., (i) the infection step and retrovirus entry, (ii) the reverse transcription, whereby the single stranded RNA genome of the retrovirus is reverse transcribed into a single strand cDNA and then copied into a dsDNA, (iii) the integration into the genome of infected cells, whereby the double-stranded viral DNA generated by reverse transcriptase is inserted by an integrase (IN) into a chromosome of the host cell establishing the proviral latent state, (iv) the completion of retrovirus replication cycle, synthesis of viral structural proteins and formation of viable new viruses.
  • RT inhibitors have been developed such as for example AZT, which is sold under the brand names of Retrovir ® and zidovudine ® by Glaxo Wellcome, RT inhibitor ddl, which is sold under the brand names of Videx ® and Didanosine ® by Bristol-Myers Squibb, RT inhibitor ddC, which is sold under the brand names of HIVID ® and dideoxycytidine by Hoffman-La-Roche, RT inhibitor d4T, which is sold under the brand names of Zerit ® and Stavudine ® by Bristol-Myers Squibb, RT inhibitor 3TC, which is sold under the brand names of Epivir ® and Lamivudine ® by Glaxo Wellcome, and the RT inhibitor Nevirapine ® , which is sold under the brand name of Viramune ® by Boehringer Ingelheim.
  • AZT which is sold under the brand names of Retrovir ® and zidovudine ® by Glaxo
  • Approved protease inhibitors include for example Saquinavir ® sold under the brand name of Invirase ® by Hoffman-LaRoche Laboratories, or Ritonavir ® , which is sold under the brand name of Norvir by Abbott Laboratories, and Indinavir ® sold under the brand name of Crixivan ® by Merck & Co.
  • IN integrase
  • IN is a protein of 32 kDa encoded by the 3' end of the pol gene and plays a key role in the viral replication. It catalyses the integration of proviral DNA in the genome of infected cells following two steps.
  • the 3' processing step consists in the removal of two nucleotides at the LTR, and secondly, the strand transfer step is achieved when the processed DNA is integrated in the cellular DNA. Due to its central role in replication, the search of inhibitors directed against IN has increased these last 10 years. Various families of IN inhibitors have been reported (Semenova, E. A., 2008, J MoI Biol 235:1532-1547). The diketo acids (DKA), show inhibition on in vitro integration process (especially on strand transfer reaction). Moreover, resistance mutations have appeared in the IN gene confirming IN as the target ex vivo.
  • DKA diketo acids
  • this enzyme is difficult to target because it is part of a multimeric preintegration complex (PIC) and because most of the inhibitors active on IN in vitro are not able to inhibit the enzyme inside the cell (Miller MD et al, 1997, J Virol. 71:5382-5390). Moreover the rational design of drugs undertaken for RT and protease is still not possible in the case of IN because of the lack of a full- length structure enzyme available.
  • PIC multimeric preintegration complex
  • ODN G-quartets oligonucleotides
  • RT reverse transcriptase
  • I integrase
  • these therapies include for example, combination of Saquinavir ® protease inhibitors and RT inhibitors, or combination of AZT, 3TC and Ritonavir ® protease inhibitors.
  • Some of these combinations have however been reported as being toxic or ineffective.
  • side effects are fairly common, including for example, gastrointestinal symptoms with nausea, vomiting, diarrhea, and liver inflammation.
  • such combinations of antiretrovirals with different modes of action are subject to positive and negative synergies, which limit the number of useful combinations.
  • microbicides for topical use may represent an efficacious means of control.
  • Such microbicide compounds or compositions are further used as preventive treatment against HIV infections. They are designed to destroy the viruses, reduce their ability to establish an infection, and/or to provide a physical barrier that keeps HIV from reaching the target cells.
  • These microbicides include for example, Cyanoviran ® , PRO 2000 ® ' Tenofovir ® , BufferGel ® .
  • the first compound to be tested in Phase III clinical trials as a microbicide candidate was nonoxynol-9, a popular spermicide that has been on the market for many years. This compound is frequently used with condoms and in diaphragm creams to provide additional contraceptive protection.
  • Nonoxynol-9 is capable of inactivating some sexually transmissible diseases (STD) pathogens in the lab, but phase III trials showed that nonoxynol-9 did not provide significant protection against HIV. In fact, there is evidence that nonoxynol-9 enhances the risk of transmitting the AIDS virus.
  • Another product that is being evaluated is Buffergel. Initial tests showed that Buffergel ® is capable of killing HIV in the lab.
  • BufferGel ® offered significant contraceptive protection, but did not prevent pregnancy in all cases.
  • Several microbicides in human clinical trials contain detergent-type ingredients, which may cause lesions at vaginal and cervical epithelia, although their efficacy is established in vitro, they exacerbate genital ulcers and facilitate HIV transmission when tested in vivo.
  • the present invention specifically focuses on G-quartet oligonucleotides (ODN), reported earlier in Jing, N. et al., 1998. J Biol Chem. 273:34992-34999; Jing, N., et al., 2000, J. Biol.Chem 275:21460-21467 ; Ojwang, J. O., et al, 1995, Antimicrob Agents Chemother 39:2426-2435 ; Este, J. A. et al., 1998, MoI Pharmacol 53:340-345 etc.
  • ODN G-quartet oligonucleotides
  • G-quartet oligonucleotides satisfy the above mentioned needs for providing an antiretroviral composition capable of targeting several steps of the retroviral replication cycle and was found to have a mutimodal activity. It has been further surprisingly found that G-quartet oligonucleotides (ODN), of the present invention exhibit microbicidal activity in that these compounds have the ability to prevent the infection by HIV. Hence, G- quartet oligonucleotides (ODN) provide microbicidal compositions that can effectively act as a means to prevent the viral infection.
  • microbicidal compositions of the present invention can be administered vaginally before sexual intercourse to kill HIV (and other STD pathogens).
  • the G-quartet oligonucleotide (ODN) microbicides of the current invention are expected to have little or no side effects at the effective microbicidal concentrations tested. Further, G-quartet oligonucleotides (ODN) microbicides are expected to have little or no immunosuppressive activity at their effective microbicidal concentrations.
  • G-quartets oligonucleotides (ODN) are ideal microbicides, since they withstand varying temperatures and acceptably function within varied pH ranges (ranges of alkaline and acidic levels in the vagina). Further, they are not expected to eliminate the natural beneficial lactobacilli that reside in the vagina and regulate vaginal health.
  • a first aspect of the present invention provides, a particular family of G-quartet ODN which have been surprisingly found to have a multimodal antiviral activity, Le_., targeting several steps of the retroviral life cycle in host cells.
  • the present invention is directed to the novel microbicide activity of G-quartet ODN and further provides novel microbicidal and/or spermicidal compositions comprising G-quartet ODNs optionally with other excipients.
  • the present invention provides dosage forms and methods of administering the novel compositions of the present invention.
  • the G-quartet ODNs according to the present invention thus represent an improved medical treatment and efficacious medicine for preventing retroviral infections and in case of infections for inhibiting retroviral replication and spread.
  • the G-quartet ODNs are useful when incorporated into pharmaceutical microbicide compositions.
  • use of the medical treatment and microbicide composition can be helpful to prevent the transmission of HIV and other viruses.
  • FIG. 1 Time of addition of different drugs.
  • HeLa P4 cells were infected by viral supernatant HIV- l La i as described in Example 1 below. Different times after beginning of HIV-I infection, 10 ⁇ M of Dextran Sulfate, or 10 ⁇ M of AZT or 500 nM of the oligonucleotide Andevir were added to infected cell culture. Then, infection was maintained for 24 h and revealed as described in Example 1. Values are the means of 3 different experiments. Results are expressed in comparison with HIV-I replication observed without drug.
  • Figures 2A and 2B Effects of Andevir on HIV-I infectivity.
  • HIV-I infectivity was revealed as detailed in Example 1 with 4-MUG. 10 ⁇ M of VD-84 and 1 ⁇ M of ODN TBA were used as controls. The values are the means of 3 different experiments.
  • Figure 3 Quantification of viral nucleic acids in the presence of Andevir
  • HeLa P4 cells were infected by HIV-I in the presence of serial dilutions of Andevir. After 2 h of infection, cells were washed, treated with trypsin and washed again. Total RNA were extracted and subjected to quantitative RT-PCR. For DNA quantification, cells were infected by HIV-I for 24 h, washed, treated with trypsin and washed again before total DNA extraction and quantification by real-time PCR.
  • Figure 4 Inhibition of HIV-I replication by transfected Andevir - (A) HeLa P4 cells were transfected in the presence of different cationic lipids according to manufacturer's instructions. After 24 h, cells were infected and viral replication was determined as described before using 4-MUG. Bar 1 corresponds to 100 % viral infection without transfection, Bars 2 to 4 correspond to transfection performed with DMRIE-C, Jet-PEI and Lipofectamin 2000 respectively.
  • Lanes 12, 13 and 14 uninfected cells transfected with 1000, 500 and 250 nM Andevir/Lipofectamin 2000 complex; Lanes 15, 16 and 17; infected cells transfected with 1000, 500 and 250 nM Andevir/Lipofectamin 2000 complex; Lane 18: uninfected cells incubated with 1000 nM of Andevir alone; Lane 19: cells infected in the presence of 1000 nM Andevir alone.
  • Figure 6 Sequences of viral gpl20 from Andevir resistant virus
  • Amino acids sequences of resistant virus obtained in the presence of increasing Andevir concentrations were compared with gpl20 sequence of H9 Lai genome (reference K 02013).
  • Figure 7 shows the effects of Andevir unconjugated or conjugated at the 3'end with cholesterol (Andevir- 3'chol) on HIV-I infectivity and provides % of viral replication with various concentrations of Andevir 3'chol
  • HeLa P4 cells were placed into contact with Andevir 3' chol either concomitantly with the virus HIV-I ( ⁇ ); or 5 hours before the virus without any washing step ( ⁇ ); or 5 hours before the virus with washing step (A).
  • a microbicide is any agent that kills or deactivates disease-causing microbes. According to the International Association of Physicians in AIDS CARE (IAPAC), the definition of microbicides also includes interventions that can block or prevent infection, as well as amplification of the body's natural defenses to prevent infection through sexual acts. Microbicides are designed to destroy the viruses, reduce their ability to establish an infection, and/or to provide a physical barrier that keeps HIV from reaching the target cells. Microbicides can be applied to the vagina or rectum during sexual activity to prevent the spread of HIV and other sexually- transmitted diseases and/or to act as a contraceptive.
  • microbicides should be designed to be inexpensive, convenient, unobtrusive, and non-irritating to both partners.
  • microbicide preparations which can be in the form of creams, foams or gels, should be available in contraceptive and non-contraceptive formulas. This would allow women to protect themselves from contracting sexually-transmitted diseases whether or not they wish to conceive children.
  • Oligonucleotide (ODN) is meant to refer to a molecule comprised of two or more deoxyribonucleotides or ribonucleotides and modified ribo- or deoxyribonucleic acids.
  • the core structure of the ODN has a minimal length of 15 nucleotides.
  • bases refers to pyrimidines and purines, or modified or derivatized versions thereof.
  • A refers to adenine, but depending on the context, may also refer to its ribose, deoxyribose or modified ribose or deoxyribose form.
  • T refers to thymine or thymidine
  • U refers to uracil or uridine
  • G refers to guanine or guanosine
  • C refers to cytosine or cytidine.
  • the "inhibition" of viral replication is meant to include partial and total inhibition of viral replication as well as decreases in the rate of viral replication.
  • the inhibitory dose or "therapeutic dose” of the compounds in the present invention may be determined by assessing the effects of the oligonucleotide on viral replication in tissue culture or viral growth in an animal. The amount of oligonucleotide administered in a therapeutic dose is dependent upon the age, weight, kind of concurrent treatment and nature of the viral condition being treated.
  • the terms "therapeutic effective dose” as used herein refer to the dose of a G-quartet ODN which causes a therapeutic effect when given to an animal or human.
  • the therapeutic dose introduced into the animal or human to be treated will provide a sufficient quantity of oligonucleotide to provide a specific effect, ej*., (1) microbicide effect, (2) inhibition of viral entry, (3) inhibition of viral protein or enzymes, (4) inhibition of the reverse transcriptase, and (5) inhibition of the integrase.
  • a specific effect ej*.
  • the dose will be dependent upon a variety of parameters, including the age, sex, height and weight of the human or animal to be treated. Given any set of parameters, one skilled in the art will be able to readily determine the appropriate dose.
  • G-quartet ODN correspond to oligonucleotides having a three dimensional structure stabilized by guanosine tetrads.
  • guanosine tetrads refers to the structure that is formed of eight hydrogen bonds by coordination of the four O 6 atoms of guanine. Beyond hydrogen bonding among guanines, the stability of quadruplexes derives from interactions among stacked quartets as well as coordination by quartets of centrally located cations (e.g. Na + or K + ).
  • the present invention is directed to the novel and previously undisclosed properties of "G-quartet ODN".
  • the Applicants have characterized that particular G-quartet ODN having superior multimodal activity thereby targeting multiple steps of the retrovirus life cycle. Indeed, G-quartet ODNs were showed to inhibit viral entry into cells, reverse transcription of the viral genome, and integration thereof into the host cell chromosome.
  • the present study also demonstrates for the first time that these G-quartet ODN exhibited potent microbicide activity when incubated with the virus alone. These findings clearly represent a major breakthrough for treating viral infection.
  • the present invention thus relates to a microbicide composition comprising a therapeutically effective amount of G-quartet ODN and optionally a pharmaceutically acceptable excipient.
  • G-quartet ODN has a core structure 5'-(G) 3 (H) n (G) 3 (H) n (G) 2 H(G) 3 H-S' (core 1) or 5'-(G) 4 (H) n (G) 3 (H) n (G) 2 H(G) 3 -3' (core 2) wherein H represents a base either an adenine (A) or a pyrimidine, and wherein n is 1 or 2.
  • H is a thymidine or an adenine.
  • nucleotide at positions 4 and 15 may be a thymidine, nucleotide at positions 8 and 11 may be an adenine.
  • nucleotide at position 5 may be a thymidine, nucleotide at positions 9 and 12 may be an adenine.
  • the minimum length of the core structure is 15 nucleotides. Additional random sequences may be added on 5' and/or 3' ends.
  • Preferred sequences may be 5' -GGGGTGGGAGGAGGGT-S' (SEQ ID NO: 1), 5' -GGGGAGGGAGGAGGGT-S' (SEQ ID NO: 2), 5' -GGGGTGGGTGGAGGGT-S' (SEQ ID NO: 3), 5' -GGGGTGGGAGGTGGGT-S' (SEQ ID NO: 4), or 5'-GGGGTGGGTG GTGGGT-3' (SEQ ID NO:5).
  • Nucleotides at position 5 may be T, A, AA, TT, TA, AT, or TTA.
  • Nucleotides at position 9 may be A, T, TT, AT, TA or AA.
  • oligonucleotide has a core sequence 5' -GGGGTGGGAGGAGGGT-S' (SEQ ID NO: 1) of 16 nucleotides and has been named herein below Andevir.
  • the oligonucleotides may have phosphorothioated internucleoside backbones or may contain chemically modified bases.
  • the chemistry can be DNA or RNA or cDNA.
  • the oligonucleotides may optionally be modified at the 3' or 5' terminus by attachment of a substituent moiety selected from the group consisting of propylamine, poly-L -lysine, cholesterol, fatty acid chains having C 2 -C 24 carbons, cholesterol with a triglycyl linker, and vitamin E.
  • a substituent moiety selected from the group consisting of propylamine, poly-L -lysine, cholesterol, fatty acid chains having C 2 -C 24 carbons, cholesterol with a triglycyl linker, and vitamin E.
  • the minimal guanine -rich ODN sequence responsible for the best inhibition was found to comprise core 1 or 2 sequences as above described with 15 nucleotides, and most preferred sequence is 16 nucleotides long and was named Andevir.
  • the NMR structure of the oligonucleotides according to the present invention in the presence of K + ions was determined.
  • IC 50 range is between 1 nM to 30 nM, specifically between 15 nM to 25 nM, most specifically 20 nM. Indeed, it was demonstrated that ODN according to the present invention were able to block HIV replication in infected cells cultures with an IC 50 between 15 nM to 25 nM, most specifically 20 nM.
  • G-quartet ODNs of the present invention specifically Andevir, were evidenced for the first time to also have a potent microbicide effect.
  • the present invention relates to a multimodal antiviral composition
  • a multimodal antiviral composition comprising a therapeutically effective amount of at least one G-quartet oligonucleotide and optionally a pharmaceutically acceptable excipient wherein said G-quartet oligonucleotide inhibit at least 2 steps selected from: (i) the infection step and virus entry, (ii) the viral replication or reverse transcription,
  • the present invention provides a multimodal antiviral composition comprising a therapeutically effective amount of at least one G-quartet oligonucleotide, wherein the G-quartet oligonucleotide has a core structure chosen from 5'- (G) 3 (H) n (G) 3 (H) n (G) 2 H(G) 3 H-S' or 5'-(G) 4 (H) n (G) 3 (H) n (G) 2 H(G) 3 -S' wherein H represents an Adenine or Thymidine or an Uracil, and wherein n is 1 or 2 and a pharmaceutically acceptable excipient wherein the inhibitory action is at least 2 steps selected from:
  • compositions of the present invention have the ability to prevent the transmission of HIV. In particular, they can prevent sexual or vaginal transmission of HIV by preventing either the production of infectious viral particles or infection of uninfected cells.
  • the compounds of the present invention can prevent HIV infection of host cells, such as macrophages, lymphocytes, Langerhans etc.
  • host cells such as macrophages, lymphocytes, Langerhans etc.
  • the present compounds prevent systemic HIV infection of a human being, exhibiting a preventive or a prophylactic action against the HIV virus.
  • the G-quartet ODNs according to the present invention are useful in the manufacture of a medicament useful for preventing the transmission of or infection with HIV, particularly via sexual intercourse or related intimate contact between partners.
  • the use of G-quartet ODNs is paramount in the manufacture of a topical medicament useful for preventing the transmission of or infection with HIV.
  • Andevir is able to act on early viral steps. The best inhibition was obtained when inhibitor and virus were added together to the cells and complete inhibition was reached with as low as 200 nM of compound. Preincubation of viral particles with Andevir prior to infection decreased infectivity of viruses, thereby indicating an action as microbicidal agent. This effect was obtained with higher concentrations of inhibitor than when Andevir and viruses were added together to the cells ( Figure 2).
  • ODNs of the present invention such as for example Andevir were also found to be inhibiting at the very early steps of viral replication like viral entry. Inhibitory activity of Andevir after transfection assays was monitored to prove this effect.
  • Andevir has also been seen to have an important effect on viral nucleic acids.
  • entry was affected by this inhibitor because only 50 % of viral RNA quantity was detected in all the concentrations tested ( Figure 3).
  • Figure 3 Even with concentrations as high as 3200 nM, total inhibition of viral entry is never obtained in presence of Andevir.
  • a dose-dependent inhibition was observed on HIV-I DNA quantity ( Figure 3). This experiment underlines a clear effect on HIV-I DNA synthesis, which takes place during the reverse transcription step.
  • mutants resistant to Andevir were obtained by addition of Andevir at the time of infection.
  • Mutation N269K was already described in viral resistance against bicyclam, which acts at the interaction between gpl20 and the co-receptor CXCR4 and also for viral resistance against DS, a non-specific inhibitor of viral entry that acts on the adsorption step.
  • numerous wild type viruses showed an asparagin at this position, so mutation N269K could be due to the impact of Andevir on the virus.
  • Mutation Q278H was localized at a position described in the viral resistance against T30177 (Este JA, et al., 1998, MoI Pharmacol 53:340-34), against bicyclams (de Vreese, K., V. et al., 1996, J Virol 70:689-696) and against DS (Este JA, et al., 1997, MoI Pharmacol 52:98-104). All these HIV-I inhibitors are polyanionic molecules. This position is therefore a common resistance position to polyanions. However, in most cases, thie mutation is associated with a deletion in position 364-368 (FNSTW), yet this deletion could not be find in this case.
  • positions 428 are very variable sequences in wild type viruses.
  • a clear N428I mutation in the resistant virus sequence emerged at position 428. This could be an evolution of the viral population according to pressure selection due to an increased concentration of Andevir in the culture media, even if this position is highly variable in the sequence of wild type viruses.
  • the position was located in a domain involved in CD 4 interaction. Andevir might therefore have a different and distinct inhibition mechanism from those of the polyanionic molecules cited, and this could be linked to interaction between gpl20 and CXCR4 and/or CD 4 .
  • G-quartet ODNs and preferably Andevir which have shown as being in vitro inhibitor of HIV-I IN (de Soultrait VR et al., 2002, J MoI Biol 324:195-203), were also evidenced by the Applicants as interfering with additional and multiple steps of the viral cycle, and importantly as being potent microbicidal agent. It is indeed crucial to propose multimodal drugs targeting several steps of viral replication cycle and having in additional potent microbicidal effect.
  • Microbicide compositions of the present invention are particularly useful for dramatically preventing and/or treating HIV co-infections or diseases, which are associated with human immunodeficiency virus (HIV).
  • HIV human immunodeficiency virus
  • microbicide compositions may be administered intravenously, topically, or orally. These compositions may be in the form of foam, cream, pastes, wash, gel, jellies, suppository, ovule, lotion, ointment, emulsion, dispersions, powders, film, tablet, foaming tablet, tampon, spray, sponges, cervical caps, implants, patches, pessaries, vaginal ring, aerosol, vaginal or rectal or buccal tablets, mouthwashes, intravaginal rings or other intravaginal drug delivery systems.
  • Microbicide formulations according to the present invention may be applied to the body cavities, to the skin, mucous membranes.
  • compositions may be in forms adapted to be applied to the site where sexual intercourse or related intimate contact takes place or is going to take place, such as the genitals, vagina, vulva, cervix, rectum, mouth, hands, lower abdomen, upper thighs, especially the vagina, vulva, cervix, and ano-rectal mucosae.
  • Preferred administrations are topical, Le_., vaginal, anorectic and rectum applications, these can be in different dosage forms with appropriate apparatus, for example the gel could be applied to vulvar, vagina, cervical, ano-rectal, mouth, skin or rectum by hand, suppositories, or conventional tampon or, applicator or syringe techniques.
  • compositions of the invention can also be incorporated into douches.
  • compositions can also be incorporated into wipes.
  • microbicides of the present invention when formulated for men may be in the form of penile wipes [for use before and/or after sex.
  • an effective amount of the particular ODN as the active ingredient may optionally be combined with a pharmaceutically acceptable carrier/excipient/adjuvant/cosmetically acceptable base, which carrier/ excipient/adjuvant/base, may take a wide variety of forms depending on the form of administration.
  • a pharmaceutically acceptable carrier/excipient/adjuvant/cosmetically acceptable base which carrier/ excipient/adjuvant/base
  • any of the usual pharmaceutical media may be employed such as, for example, water, glycols, oils, alcohols, polymers and the like.
  • Solid carriers such as starches, sugars, kaolin, diluents, lubricants, binders, disintegrating agents and the like will be adequate in the case of tablets.
  • the carrier optionally comprises a suitable wetting agent, optionally combined with suitable additives of any nature in minor proportions, which additives do not introduce a significant deleterious effect on the skin. Said additives may facilitate the administration to the skin and/or may be helpful for preparing the desired compositions.
  • suitable gel formulations may contain natural or synthetic polymers as gelifying agents, and hydrophobic or hydrophilic liquids. These compositions may be administered in various ways, e.g., as a cream or gel.
  • the active ingredient may be present in the pharmaceutical formulations as a free agent or alternatively, encapsulated into drug carriers like liposomes, nanoparticles or cyclodextrins, which encapsulation results in an increased concentration of the compounds within the microbe target site.
  • the active ingredient may also be present as nanoparticles.
  • the compositions according to the present invention may be formulated as immediate release, controlled release, sustained release, extended release or a combination of the above, for examples the same dosage form providing a immediate release over a limited period of time, followed by a controlled or a extended release of the ODN from the composition. If the residence time of the topical compositions needs to be increased suitable, suitable polymers and adhesives may be added to the composition to achieve the effect.
  • Topic administrations are preferred for a preventive effect of the composition. Intravenous or oral administrations are preferred for a curative effect. [0029] In a preferred embodiment topical administrations may be employed for a preventive effect of the composition according to the invention. Intravenous or oral administrations are preferred for a curative effect, wherein a multimodal action according to the present invention is desired.
  • the present compositions may further comprise additional microbicidal agents directed against a wide variety of bacteria, viruses, fungi, parasites, and spermicide.
  • the present composition may be combined with other active ingredients, such as antivirals, antibiotics, immunomodulators or vaccines.
  • compositions of the present invention can also be used as spermicides. These compositions then comprise spermicides and may be incorporated into contraceptive devices such as condoms, sponges, vaginal inserts, contraceptive films, diaphragms, suppositories, contraceptive patches or sustained release devices. For use as spermicides, these compositions of the invention can be applied alone; with other microbicides; and with or incorporated into the contraceptive devices described above.
  • the spermicidal property may be the inherent property of the compound of the invention or an additional spermicidal agent may be added.
  • Microbicide compositions of the present invention are particularly useful for dramatically preventing and/or treating HIV co-infections or diseases, which are associated with human immunodeficiency virus (HIV).
  • HIV human immunodeficiency virus
  • Preferred subjects are individuals who are exposed to HIV but have not been infected by it yet. Examples of such a preventive measure include (but not limited to) the prevention of mother-baby transmittal of the viruses; and the prevention of HIV infection in other situations, such as in medical workers handling HIV-contaminated blood, blood products, and body fluid in a medical accident.
  • the formulations of the invention may be applied into the vagina prior to intercourse.
  • the formulations of the invention may be inserted into the rectum prior to intercourse.
  • the present topical formulations such as the gel formulations described herein may also act as a lubricant.
  • the present topical formulations such as the gel formulations described herein can be applied as soon as possible after completion of the sexual activity.
  • treatment and prevention methods and microbicide compositions as per the present invention is particularly useful for inhibiting HIV and other retroviral infectious diseases in human beings, they can also be useful for veterinary purposes for infectious diseases in animals, such as: dogs, cats, birds, horses, cows, sheep, swine, and other farm animals, as well as rodents and other animals.
  • Dextran sulphate sodium salt and AZT (3'-azido-3'deoxy-thymidine) were obtained from Sigma.
  • GGGGTGGGTGGAGGGT-3' (SEQ ID NO: 3), 5' -GGGGTGGGAGGTGGGT-S' (SEQ ID NO: 4), or 5'-GGGGTGGGTGG TGGGT-3' (SEQ ID NO: 5) were prepared.
  • Example 2 Cell lines and viruses
  • HeLa P4 cells encoding a Tat-inducible ⁇ -galactosidase were maintained in DMEM medium (Invitrogen) supplemented with 10 % inactivated FCS, 1 mg/ml geneticin (G418, Gibco-BRL).
  • MT4 and H9 Lai cells were grown in RPMI 1640 glutamax medium (Invitrogen) supplemented with 10 % inactivated FCS.
  • HIV-I viruses were obtained after 48 h co-culture of MT4 cells (0,5 xlO 6 /ml) and H9 Lai cells (1 x 10 6 /ml), chronically infected by HIV-l Lai isolate, in RPMI 1640 glutamax medium supplemented with 10 % inactivated FCS, at 37°C under humidified atmosphere and 5 % CO 2 . The culture was then centrifuged and the supernatant was clarified by filtration on a 0.45 ⁇ m membrane before freezing at -80 0 C.
  • HeLa P4 The infectivity was assayed on HeLa P4 cells expressing CD 4 receptor and the ⁇ -galactosidase gene under the control of the HIV-I LTR.
  • HeLa P4 were plated using 200 ⁇ l of DMEM medium supplemented with 10 % inactivated FCS in 96-multi-well plates at 10 000 cells per well. After overnight incubation at 37°C, under humidified atmosphere and 5 % CO 2 , the supernatant was discarded and 200 ⁇ l of viral preparation were added in serial dilutions. After 24 h of infection, the supernatant was discarded and the wells were washed 3 times with 200 ⁇ l of PBS.
  • reaction buffer containing 50 mM Tris-HCl pH 8,5, 100 mM ⁇ - mercaptoethanol, 0,05 % Triton X-100 and 5 mM 4-methylumbelliferyl-B-D-galactopyranoside (4-MUG) (Sigma). After 24 h, the reaction was measured in a fluorescence microplate reader (Cytofluor II, Applied Biosystems) at 360/460 nm Ex/Em.
  • HIV-l La i virions 200 ⁇ l were ultrafiltrated through a 0.02 ⁇ m Anopore membrane in 1.5 ml vectaspin tube (Whatman) for 11 min at 5 000 g (34). After 3 washes with PBS, the viral concentrate was re-suspended in 200 ⁇ l of RPMI 1640 glutamax medium supplemented with 10 % inactivated FCS. 100 ⁇ l of each viral concentrate condition were used to infect 10 000 HeLa P4 cells per well in a 96 multi-well plate.
  • Example 5 Transfection assay HeLa P4 cells were transfected with DMRIE-C, Jet-PEI and Lipofectamin 2000 (Invitrogen). ODN/cationic lipid complexes were obtained as indicated by the manufacturers. ODN concentration used for complexes was 2 ⁇ M. 24 h before transfection, cells were plated into 24- well plates at 100 000 cells/well and incubated for 24 h at 37°C under humidified atmosphere and 5 % CO 2 Next day, when cells were at 60-80 % confluence, transfection complexes were prepared and added to 150 ⁇ l of fresh DMEM medium without FCS. After 4 h, 150 ⁇ l of fresh DMEM medium containing 20 % FCS were added per well. Cells were incubated 20 h at 37°C under humidified atmosphere and 5 % CO 2 and then infected by HIV-I.
  • Example 6 Time-of-addition experiment HeLa P4 cells were plated using 200 ⁇ l of DMEM medium supplemented with 10 % inactivated FCS, 1 mg/ml G418, in a 96-multiwell plate at 10 000 cells per well. After overnight incubation at 37°C, under humidified atmosphere and 5 % CO 2 , the supernatant was discarded and replaced by fresh medium in the presence of HIV-I. Drug was added at different time after infection (from 0 to 10 h), and culture was maintained for 24 h. ⁇ -galactosidase activity was measured in a fluorescence microplate reader after substrate addition.
  • Example 7 Viral RNA extraction and quantitative RT-PCR
  • HeLa P4 cells were plated into 24-well plates at 100 000 cells per well and infected with HIV- l Lai virus. After 2 h, cells were washed 3 times with PBS and trypsin treatment was performed in order to remove HIV-I viruses attached to cellular surface membrane and to recover infected cells from the well. Cells were again washed 3 times with PBS. Total RNA was extracted with the Trizol method (Gibco-BRL) according to the manufacturer's recommendations. The RNA pellet obtained was washed with 75 % ethanol and dissolved in DEPC -treated water for quantitative RT-PCR experiments.
  • RNA extract Specific primers for the GAPDH cellular mRNA (sense primer 5'- GGAAGGTGAAGGTCGGAGTCAACGG-3' (SEQ ID NO: 7); antisense primer 5'- TCCTGGAAGATGG TGATGGGATTTC-3' (SEQ ID NO: 8) were used for amplification by SYBR Green real-time RT-PCR. Quantitative RT-PCR was set up with "IscriptTM One-step RT- PCR kit" (Biorad) in a 25 ⁇ l final volume with 300 nM of each primer, 0.5 ⁇ l of RT and 10 ⁇ l of RNA extract.
  • PCR program was 50 0 C for 10 min, 95°C for 5 min, (95°C 10 sec; 62°C 30 sec; 72°C 30 sec) for 40 cycles in a MyiQ real-time PCR thermocycler (Biorad).
  • specific primers sense primer LTRNecOOl 5' GCCTCAATAAAGCTTGCCT 3' (SEQ ID NO: 9); antisense primer LTR131 5' GGCGCCACTGCTAGAGAT 3'(SEQ ID NO: 10) were used with a real-time TaqMan MGB RT-PCR method (Applied Biosystems).
  • the internal HIV-I TaqMan probe (6-FAM AAGTRGTGTGTGCCC-MGB; SEQ ID NO: 11) carried the 5' reporter 6-carboxyfluorescein and the 3' quencher 6-carboxytetramethylrhodamine (Applied Biosystems).
  • Quantitative RT-PCR was set up in a 50 ⁇ l final volume with 25 ⁇ l buffer of "Superscript III Platinum One-step qRT- PCR" (Applied Biosystems), 200 nM of each primer, 200 nM of probe MGB, 1 ⁇ l of ROX (passive reference dye), 1 ⁇ l of RT and 10 ⁇ l of RNA extract and analyzed in a ABI Prism 7 000 Sequence Detection System thermocycler (Applied Biosystems). The programmed cycling was 48°C for 15 min, (95°C 2 min; 95°C 15 sec; 60 0 C 30 sec) for 55 cycles.
  • Example 8 Viral DNA extraction and quantitative PCR
  • HeLa P4 cells were placed into 96-well plates at 10 000 cells per well and infected with HIV-l La i virus. After 24 h, cells were washed 3 times with PBS and trypsin was applied to eliminate HIV-I viruses attached to the cellular surface membrane and to recover infected cells from the well. Moreover, cells were washed 3 times with PBS. Total DNA was extracted using the "High pure viral nucleic acid" kit (Roche Applied Science) and subjected to quantitative PCR.
  • Quantitative PCR was set up in a 25 ⁇ l final volume with 12.5 ⁇ l buffer of "PCR Quantitative SYBR Green kit” (Biorad), 300 nM of each primer and 10 ⁇ l of DNA extract. Cycling was programmed as 95°C for 1 min 30 sec, (95°C 10 sec; 60 0 C 20 sec; 72°C 10 sec) for 42 cycles using a MyiQ real-time PCR thermocycler (Biorad). To determine gene copy number, a standardization curve was previously performed with serial dilutions from non-infected cells DNA (GAPDH gene) and from pNL4-3 plasmid dilutions encoding all viral genes (gag gene).
  • GPDH gene non-infected cells DNA
  • pNL4-3 plasmid dilutions encoding all viral genes
  • Phusion high fidelity DNA polymerase (Ozyme) was used for this PCR. 20 ⁇ l of DNA were added to a mix containing 500 nM of primers, 200 nM dNTP, and 10 ⁇ l of 5X HF buffer in a final volume of 50 ⁇ l.
  • Primers were AIu- 164 (5' TCCCAGCTACTCGGGAGGCTGAGG 3'; SEQ ID NO: 14) and PBS (5' TTTCAGTCCCTGTTCGGGCGCCA 3' ; SEQ ID NO: 15). The program was 30 sec at 98°C, 35 cycles (10 sec 98°C, 20 sec 60 0 C, 2 min 30 sec at 72°C) and 72°C for 5 min.
  • a nested PCR was performed with the primers NI-I (5' CACACACAAGGCT ACTTCCCT 3'; SEQ ID NO: 16) and NI-2 (5' GCCACTCCCCAGTCCCGCCC 3'; SEQ ID NO: 17) using 5 ⁇ l of the products of AIu- PCR.
  • the Ampli Taq Gold enzyme from Promega was used according to the following program 12 min at 94°C, 42 cycles (94°C 1 min, 60 0 C 1 min, 72°C 1 min) and 7 min at 72°C.
  • MT4 cells were first infected with HIV- l La i virus in the presence of Andevir at the 50 % Inhibitory Concentration (IC 50 ). Cultures were incubated at 37°C under humidified atmosphere and 5% CO 2 , until a cytopathic effect was detected. The culture supernatants were used to infect new MT4 cells in the presence of increasing concentrations of Andevir up to 10 ⁇ M (500 times IC 50 concentration of Andevir).
  • IC 50 Inhibitory Concentration
  • Example 10 DNA sequence analysis of viral resistant strains Viral RNA wild-type HIV-I and Andevir-resistant HIV-I containing supernatants were extracted with the "High Pure Viral RNA kit” (Roche Applied Science). RT-PCR was performed with the "Titan One Tube RT-PCR kit” from Roche Applied Science during a cycling program with 45 min 45°C, 5 min 94°C, (1 min 6O 0 C; 2 min 68 0 C) for 40 cycles and 7 min 68 0 C. Two ⁇ l of the RT-PCR products were submitted to a PCR reaction with "AmpliTaq Gold with GeneAmp" (Roche Applied Science). Cycling program was 12 min 94°C, (30 sec 94°C; 30 sec 55°C; 2 min 72°C) for 40 cycles and 7 min 72°C. A purification step was done with S-400 HR column (Pharmacia) prior to sequencing.
  • Sequencing was performed with "BigDyeTM Terminator Cycle Sequencing Ready Reaction” (PE Biosystems). The cycling program was 1 min 96°C, (10 sec 96°C; 5 sec 50 0 C; 4 min 6O 0 C) for 25 cycles. Sequencing products were purified using Sephadex (Sigma) prior to sequencing analysis with the Beckman genetic sequencer and "CEQTM 2000XL DNA Analysis System” (Beckmen Coulter). The primer sets used for PCR amplification and sequence analysis are summarized in the Table 2.
  • HeLa P4 cells were infected at time 0. Then 500 nM of Andevir, which totally inhibited HIV-I replication, were added to cell culture at different times from 0 to 1O h after HIV-I infection. The infected culture was maintained for 24 h and HIV-I infectivity was then measured through the ⁇ - galactosidase activity driven by the HIV-I LTR as described above. Dextran Sulfate (DS), which inhibits the adsorption of the virus on the surface cell, and 3'-azido-3'deoxy-thymidine (AZT) which acts on reverse transcription were used as controls.
  • DS Dextran Sulfate
  • AAT 3'-azido-3'deoxy-thymidine
  • Example 12 Inhibition the infectivity of HIV-I isolated particles
  • Andevir inhibitory activity was obtained when virus and inhibitor were added together to the cell.
  • the capacity of Andevir to inhibit HIV-I infectivity of isolated particles was then evaluated. Briefly, HIV-I viruses were incubated at room temperature in the presence of different concentrations of inhibitor. Viruses were separated from unbound Andevir by centrifugation through Vectaspin membranes. Then, the infectivity of treated particles was studied by infecting HeLa P4 cells as described previously.
  • Similar experiments on the inhibition of the infectivity of HIV-I and HIV -2 isolates are conducting using other preferred ODNs such as 5' -GGGGAGGGAGGAGGGT-S' (SEQ ID NO: 2), 5 '-GGGGTGGGTGGAGGGT-S '(SEQ ID NO: 3), 5' -GGGGTGGGAGGTGGGT-S '(SEQ ID NO: 4), or 5'-GGGGTGGGTGGTGGGT-S' (SEQ ID NO: 5).
  • the capacity of these ODNs to inhibit HIV-I infectivity of isolated particles is then evaluated. HIV-I or HIV -2 viruses are incubated at room temperature in the presence of different concentrations of the ODNs inhibitor.
  • Viruses are separated from unbound ODNs by centrifugation through Vectaspin membranes, and the infectivity of treated particles is studied by infecting HeLa P4 cells as described previously.
  • viral incubation at room temperature may decrease the infectivity by damaging the virus. This point was checked by incubating the viral particles at room temperature in diluted media and for different times.
  • viruses were centrifuged in Vectaspin membranes, washed three times with PBS resuspended in culture media and used for HeLa P4 cells infection (centrifugated viruses).
  • Viruses which were submitted to room temperature incubations but not to Vectaspin centrifugation were used as control (untreated viruses).
  • virus infectivity of untreated viruses was not affected by 60 min incubation at room temperature, although 120 min incubation showed a 20 % decrease of replication.
  • centrifugation affected viral infectivity. Indeed, a > 20% loss of viral replication was observed with 60 min incubation followed by centrifugation. As a result, 30 min incubation at room temperature was chosen for further investigations.
  • ODN TBA is a 15- mer ODN able to form G-quartets, for which we could not detect any inhibitory effect on HIV-I replication.
  • ODN TBA showed only a weak inhibition of HIV-I infectivity ( Figure 2 B).
  • Figure 2 B pre -incubation of Andevir with viral particles showed a large and specific inhibitory effect on HIV-I infectivity.
  • this inhibition was obtained with concentrations in the micromolar range.
  • As complete inhibition of HIV-I replication was attained with nanomolar concentrations of the inhibitor this suggests that inhibition of infectivity cannot be the only process involved in HIV-I inhibition mediated by Andevir.
  • HeLa P4 cells were infected in the presence of various inhibitor concentrations, and the culture was maintained for 24 h. Cells were washed and total DNA was then extracted as described in Example 1. Amplification of gag gene was used to determine HIV-I DNA quantity by quantitative PCR. As shown in Figure 3, a dose-dependent inhibition was observed with increasing Andevir concentrations. When the Andevir concentration able to inhibit HIV-I replication totally was added (from 200 nM), the HIV-I DNA quantity detected in infected cells was very weak, around 5 %. Viral RNA was still present even for Andevir concentrations as high as 3200 nM, while DNA is totally absent.
  • Example 14 Specific inhibition by the ODNs of the integration step
  • Results showed a bimodal mechanism of action of Andevir: inhibition on viral entry and inhibition on viral DNA synthesis when ODN is added on cell culture at the time of infection. As the steps previous to integration are inhibited, it is impossible in such conditions to know whether Andevir is able to inhibit the integration process. Therefore, we monitored inhibition in conditions where the effect on viral entry is bypassed. For this purpose, a transfection assay was used, thereby avoiding any interaction between the virus and ODN outside of the cell. Several transfection agents were assayed, but not all were suitable to perform infection after transfection. Lipofectamin2000 showed a weak stimulation on HIV-I replication ( Figure 4 A, bar 4). This agent, which is non-cytotoxic in our conditions, was thus chosen for further investigations.
  • Example 15 Viral resistant strains against Andevir
  • Andevir-resistant strains were selected by passing the virus in the presence of increasing drug concentrations. Resistant viruses were cultivated with a 10 ⁇ M Andevir final concentration of. gpl20, IN and RT genes were sequenced (Table 2). In the gpl20 encoding gene, three mutations were found (N269K, Q278H, N428I; Figure 6) confirming the inhibitory effect of Andevir on viral entry. /N and RT genes were also sequenced, but no mutation was observed on these two genes. Table 2:
  • Example 16 Effect of G-quartet ODNs on viral entry and viral replication

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Oncology (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • AIDS & HIV (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to microbicide compositions comprising a therapeutically effective amount of a G-quartet oligonucleotide and a pharmaceutically acceptable excipient for preventing and/or treating retrovirus associated infectious diseases such as human immunodeficiency virus. These compositions also incorporate a multimodal activity in a single molecule and/or drug. Furthermore, they are particularly useful for topical administration.

Description

MULTIMODAL ACTIVITY OF G-QUARTET OLIGONUCLEOTIDES AND MICROBICIDE COMPOSITIONS
Technical field of the invention
[001] The present invention relates to a composition for preventing and/or treating retrovirus associated infectious diseases such as human immunodeficiency virus.
Background of the invention [001] Retroviruses like the Human immunodeficiency virus (HIV)-I continue to be a global pandemic of enormous consequence to humanity. Acquired Immune Deficiency Syndrome (AIDS) was first recognized by the U.S. Centers for Disease Control and Prevention in 1981 and its cause HIV, identified in the early 1980s. AIDS is now a pandemic. [002] Antiretro viral therapy has markedly prolonged the survival of individuals, but there exists an urgent need for intervention in the transmission of the virus itself. There is a steady antigenic shift and hence continuously emerging drug resistant strains further augmented by exponential increase in HIV cases in developing and under developed nations where the currently available HIV therapies may be too expensive for wide spread use. Hence there is an urgent need for preventive treatment or prophylaxis. [003] Antiretro viral drugs are broadly classified by the phase of the retrovirus life-cycle that the drug inhibits. There are thus five broad classifications of antiretroviral drugs in development, though only the first three classes are currently marketed:
• Reverse transcriptase inhibitors (RTIs) target construction of viral DNA by inhibiting activity of reverse transcriptase. There are two subtypes of RTIs with different mechanisms of action: nucleoside-analogue RTIs are incorporated into the viral DNA leading to chain termination, while non-nucleoside-analogue RTIs distort the binding potential of the reverse transcriptase enzyme.
• Protease inhibitors (PIs) target viral assembly by inhibiting the activity of protease, an enzyme used by HIV to cleave nascent proteins for final assembly of new virions. • Fusion inhibitors block HIV from fusing with a cell's membrane to enter and infect it.
• Integrase inhibitors inhibit the enzyme integrase, which is responsible for integration of viral DNA into the DNA of the infected cell. There are several integrase inhibitors currently under clinical trial but only one is commercially available.
• Entry inhibitors block HIV-I from the host cell by binding CCR5, a molecule on the viral membrane termed a co-receptor that HIV-I normally uses for entry into the cell. [004] Therefore, since the discovery in 1983 of HIV-I, the causal agent of AIDS, numerous antiretro viral drugs were developed against different steps of HIV-I retroviral cycle, e.g., (i) the infection step and retrovirus entry, (ii) the reverse transcription, whereby the single stranded RNA genome of the retrovirus is reverse transcribed into a single strand cDNA and then copied into a dsDNA, (iii) the integration into the genome of infected cells, whereby the double-stranded viral DNA generated by reverse transcriptase is inserted by an integrase (IN) into a chromosome of the host cell establishing the proviral latent state, (iv) the completion of retrovirus replication cycle, synthesis of viral structural proteins and formation of viable new viruses. [005] Many reverse transcriptase (RT) inhibitors have been developed such as for example AZT, which is sold under the brand names of Retrovir® and zidovudine® by Glaxo Wellcome, RT inhibitor ddl, which is sold under the brand names of Videx® and Didanosine® by Bristol-Myers Squibb, RT inhibitor ddC, which is sold under the brand names of HIVID® and dideoxycytidine by Hoffman-La-Roche, RT inhibitor d4T, which is sold under the brand names of Zerit® and Stavudine® by Bristol-Myers Squibb, RT inhibitor 3TC, which is sold under the brand names of Epivir® and Lamivudine® by Glaxo Wellcome, and the RT inhibitor Nevirapine®, which is sold under the brand name of Viramune® by Boehringer Ingelheim. Under drug selection pressure, resistant viruses however rapidly emerged due to the poor fidelity of RT (Reverse Transcriptase) and the high rate of HIV-I multiplication (Clavel, F. et al., 2004, N Engl J Med 350:1023-1035). [006] Also, numerous protease inhibitors have been used for the treatment of HIV infection. Protease inhibitors block the enzyme which HIV requires for the completion of its replication cycle and formation of viable new viruses. Approved protease inhibitors include for example Saquinavir® sold under the brand name of Invirase® by Hoffman-LaRoche Laboratories, or Ritonavir®, which is sold under the brand name of Norvir by Abbott Laboratories, and Indinavir® sold under the brand name of Crixivan® by Merck & Co. [007] Recently, some integrase (IN) inhibitors have entered the therapeutic phase. IN is a protein of 32 kDa encoded by the 3' end of the pol gene and plays a key role in the viral replication. It catalyses the integration of proviral DNA in the genome of infected cells following two steps. First, the 3' processing step consists in the removal of two nucleotides at the LTR, and secondly, the strand transfer step is achieved when the processed DNA is integrated in the cellular DNA. Due to its central role in replication, the search of inhibitors directed against IN has increased these last 10 years. Various families of IN inhibitors have been reported (Semenova, E. A., 2008, J MoI Biol 235:1532-1547). The diketo acids (DKA), show inhibition on in vitro integration process (especially on strand transfer reaction). Moreover, resistance mutations have appeared in the IN gene confirming IN as the target ex vivo. An IN inhibitor, Raltegravir®, is now involved in the HAART (Highly Active Antiretroviral Therapy) of patients with AIDS. This molecule is also, as DKA, more specific of the strand transfer reaction (Hicks C et al, Clin Infect Dis, 2009, 48:931-9). However, numerous of these anti IN drugs show a high cytotoxicity. However, the use of these inhibitors leads to the emergence of resistant strains against IN inhibitors (Malet, L, et al., 2009. J Antimicrob Chemother 63:795-804). Also, this enzyme is difficult to target because it is part of a multimeric preintegration complex (PIC) and because most of the inhibitors active on IN in vitro are not able to inhibit the enzyme inside the cell (Miller MD et al, 1997, J Virol. 71:5382-5390). Moreover the rational design of drugs undertaken for RT and protease is still not possible in the case of IN because of the lack of a full- length structure enzyme available.
[008] Another class of IN inhibitor on which we bring our interest is composed of G-quartets oligonucleotides (ODN). These molecules form in vitro very resistant structure, responsible for the IN inhibition in vitro (Jing, N. et al., 1998. J Biol Chem. 273:34992-34999; Jing, N., et al., 2000, J. Biol.Chem 275:21460-21467). The ex vivo inhibitory effect of ODN T30177 (Zintevir®) was studied and first attributed to its activity against viral entry and also on integration (Ojwang, J. O., et al, 1995, Antimicrob Agents Chemother 39:2426-2435). However, studies on viral resistant strains obtained against T30177 have shown mutations only on the gpl20 gene, implicated in the viral entry process (Este, J. A. et al., 1998, MoI Pharmacol 53:340-345).
[009] Further, several combinations of antiretroviral drugs were developed in a "cocktail" to target the three viral enzymes, reverse transcriptase (RT), protease and integrase (IN). These therapies include for example, combination of Saquinavir® protease inhibitors and RT inhibitors, or combination of AZT, 3TC and Ritonavir® protease inhibitors. Some of these combinations have however been reported as being toxic or ineffective. Also, side effects are fairly common, including for example, gastrointestinal symptoms with nausea, vomiting, diarrhea, and liver inflammation. Also, such combinations of antiretrovirals with different modes of action are subject to positive and negative synergies, which limit the number of useful combinations. For example, ddl and AZT inhibit each other, so taking them together is less effective than taking either one separately. Other issues further limit some people's treatment options from antiretroviral drug combinations, including their complicated dosing schedules and often severe side effects. Hence, there is a need for development of anti-HIV therapeutic agents which incorporate multimodal activity in a single molecule and/or drug. [0010] The above strategies of managing retroviral infections have in common that they are intended for the use in infected cells. Consequently, these strategies are not suitable for the prevention of retroviral infection. To defeat further spreading of retroviral infections there is a strong need for methods and means that are capable of stopping for example HIV transmission before a cell can be entered by the viral particles. In the absence of an effective HIV vaccine, this need is of paramount importance. Development of microbicides for topical use may represent an efficacious means of control. Such microbicide compounds or compositions are further used as preventive treatment against HIV infections. They are designed to destroy the viruses, reduce their ability to establish an infection, and/or to provide a physical barrier that keeps HIV from reaching the target cells. These microbicides include for example, Cyanoviran®, PRO 2000®' Tenofovir®, BufferGel®.
[0011] The first compound to be tested in Phase III clinical trials as a microbicide candidate was nonoxynol-9, a popular spermicide that has been on the market for many years. This compound is frequently used with condoms and in diaphragm creams to provide additional contraceptive protection. Nonoxynol-9 is capable of inactivating some sexually transmissible diseases (STD) pathogens in the lab, but phase III trials showed that nonoxynol-9 did not provide significant protection against HIV. In fact, there is evidence that nonoxynol-9 enhances the risk of transmitting the AIDS virus. Another product that is being evaluated is Buffergel. Initial tests showed that Buffergel® is capable of killing HIV in the lab. The product was well-received and tolerated by women in human safety trials. However in rabbits, BufferGel® offered significant contraceptive protection, but did not prevent pregnancy in all cases. Several microbicides in human clinical trials contain detergent-type ingredients, which may cause lesions at vaginal and cervical epithelia, although their efficacy is established in vitro, they exacerbate genital ulcers and facilitate HIV transmission when tested in vivo.
[0012] Total eradication of the HIV (particularly HIV-I) has however never been reached because of the existence of reservoirs, which permit virus survival in spite of a good efficient immune response (Chun, T. W. et al., L. Proc Natl Acad Sci U S A 94:13193-13197). All these reasons underline the need to discover new antiretroviral drugs and to propose potentially new therapeutic way of HIV inhibition.
[0013] The present invention specifically focuses on G-quartet oligonucleotides (ODN), reported earlier in Jing, N. et al., 1998. J Biol Chem. 273:34992-34999; Jing, N., et al., 2000, J. Biol.Chem 275:21460-21467 ; Ojwang, J. O., et al, 1995, Antimicrob Agents Chemother 39:2426-2435 ; Este, J. A. et al., 1998, MoI Pharmacol 53:340-345 etc. It has been surprisingly found by the present inventors that the G-quartet oligonucleotides (ODN) satisfy the above mentioned needs for providing an antiretroviral composition capable of targeting several steps of the retroviral replication cycle and was found to have a mutimodal activity. It has been further surprisingly found that G-quartet oligonucleotides (ODN), of the present invention exhibit microbicidal activity in that these compounds have the ability to prevent the infection by HIV. Hence, G- quartet oligonucleotides (ODN) provide microbicidal compositions that can effectively act as a means to prevent the viral infection. For examples, microbicidal compositions of the present invention can be administered vaginally before sexual intercourse to kill HIV (and other STD pathogens). The G-quartet oligonucleotide (ODN) microbicides of the current invention are expected to have little or no side effects at the effective microbicidal concentrations tested. Further, G-quartet oligonucleotides (ODN) microbicides are expected to have little or no immunosuppressive activity at their effective microbicidal concentrations. In addition, G-quartets oligonucleotides (ODN) are ideal microbicides, since they withstand varying temperatures and acceptably function within varied pH ranges (ranges of alkaline and acidic levels in the vagina). Further, they are not expected to eliminate the natural beneficial lactobacilli that reside in the vagina and regulate vaginal health.
Summary of the invention
[0014] A first aspect of the present invention provides, a particular family of G-quartet ODN which have been surprisingly found to have a multimodal antiviral activity, Le_., targeting several steps of the retroviral life cycle in host cells. [0015] In a second aspect, the present invention is directed to the novel microbicide activity of G-quartet ODN and further provides novel microbicidal and/or spermicidal compositions comprising G-quartet ODNs optionally with other excipients.
[0016] In a further aspect the present invention provides dosage forms and methods of administering the novel compositions of the present invention. The G-quartet ODNs according to the present invention thus represent an improved medical treatment and efficacious medicine for preventing retroviral infections and in case of infections for inhibiting retroviral replication and spread. The G-quartet ODNs are useful when incorporated into pharmaceutical microbicide compositions. Advantageously, use of the medical treatment and microbicide composition can be helpful to prevent the transmission of HIV and other viruses.
[0017] Brief summary of the Figures
[0018] Figure 1 Time of addition of different drugs. HeLa P4 cells were infected by viral supernatant HIV- lLai as described in Example 1 below. Different times after beginning of HIV-I infection, 10 μM of Dextran Sulfate, or 10 μM of AZT or 500 nM of the oligonucleotide Andevir were added to infected cell culture. Then, infection was maintained for 24 h and revealed as described in Example 1. Values are the means of 3 different experiments. Results are expressed in comparison with HIV-I replication observed without drug. [0019] Figures 2A and 2B: Effects of Andevir on HIV-I infectivity.
[0020] (A)- Effect of HIV-I incubation at room temperature on viral infectivity. Viruses were incubated in culture media during different times at room temperature. Then viruses were centrifuged on Vectaspin membranes (Whatman), washed three times with PBS, resuspended in culture media before addition on HeLa P4 cells (Centrifugated virus). HIV-I replication was investigated as described before using HeLa P4 cells and compared to untreated virus replication (Untreated virus). (B)- Effect of Andevir on HIV-I particles infectivity. Isolated HIV-I particles were incubated for 30 min at room temperature with different concentrations of Andevir. After three intensive washings with PBS, viruses recovered in the initial volume were used to infect HeLa P4 cell culture. After 24 h of infection, HIV-I infectivity was revealed as detailed in Example 1 with 4-MUG. 10 μM of VD-84 and 1 μM of ODN TBA were used as controls. The values are the means of 3 different experiments.
[0021] Figure 3: Quantification of viral nucleic acids in the presence of Andevir [0022] HeLa P4 cells were infected by HIV-I in the presence of serial dilutions of Andevir. After 2 h of infection, cells were washed, treated with trypsin and washed again. Total RNA were extracted and subjected to quantitative RT-PCR. For DNA quantification, cells were infected by HIV-I for 24 h, washed, treated with trypsin and washed again before total DNA extraction and quantification by real-time PCR. [0023] Figure 4: Inhibition of HIV-I replication by transfected Andevir - (A) HeLa P4 cells were transfected in the presence of different cationic lipids according to manufacturer's instructions. After 24 h, cells were infected and viral replication was determined as described before using 4-MUG. Bar 1 corresponds to 100 % viral infection without transfection, Bars 2 to 4 correspond to transfection performed with DMRIE-C, Jet-PEI and Lipofectamin 2000 respectively. (B) HeLa P4 were transfected in the presence of Lipofectamin 2000 alone ( A ) or with Lipofectamin 2000 complexed with serial dilutions of Andevir (D) 24 hours before infection, or infected in the presence of different concentrations of Andevir alone (o). [0024] Figure 5: Detection of integrated DNA in the presence of Andevir
[0025] Cells were transfected with different quantities of the complex Andevir /Lipofectamin 2000. Then infection was performed for 24 h and viral DNA was extracted as described in Example 1 below. A first AIu-PCR was performed, then a nested PCR was done using 5 μl of ALu-PCR amplification products. Amplification products were analyzed on 1 % agarose gel. Lane 1: marker; Lanes 2 and 3, uninfected cells. Lanes 4 and 5, infected cells. Lanes 6, 7 and 8: cells transfected with 1000, 500 and 250 nM Lipofectamin 2000; Lanes 9, 10 and 11: infected cells transfected with 1000, 500 and 250 nM Lipofectamin 2000. Lanes 12, 13 and 14: uninfected cells transfected with 1000, 500 and 250 nM Andevir/Lipofectamin 2000 complex; Lanes 15, 16 and 17; infected cells transfected with 1000, 500 and 250 nM Andevir/Lipofectamin 2000 complex; Lane 18: uninfected cells incubated with 1000 nM of Andevir alone; Lane 19: cells infected in the presence of 1000 nM Andevir alone. [0026] Figure 6: Sequences of viral gpl20 from Andevir resistant virus [0027] Amino acids sequences of resistant virus obtained in the presence of increasing Andevir concentrations were compared with gpl20 sequence of H9Lai genome (reference K 02013). Sequence of viruses obtained in the presence of 4 μM (virus 4 μM) or 10 μM (virus 10 μM) of Andevir are shown. The different domains of gpl20 protein are indicated by arrows. [0028] Figure 7: shows the effects of Andevir unconjugated or conjugated at the 3'end with cholesterol (Andevir- 3'chol) on HIV-I infectivity and provides % of viral replication with various concentrations of Andevir 3'chol [0029] HeLa P4 cells were placed into contact with Andevir 3' chol either concomitantly with the virus HIV-I (♦); or 5 hours before the virus without any washing step (■); or 5 hours before the virus with washing step (A).
[001] Detailed description of the invention
[002] The following terms as defined will be used in the description of the invention. [003] A microbicide is any agent that kills or deactivates disease-causing microbes. According to the International Association of Physicians in AIDS CARE (IAPAC), the definition of microbicides also includes interventions that can block or prevent infection, as well as amplification of the body's natural defenses to prevent infection through sexual acts. Microbicides are designed to destroy the viruses, reduce their ability to establish an infection, and/or to provide a physical barrier that keeps HIV from reaching the target cells. Microbicides can be applied to the vagina or rectum during sexual activity to prevent the spread of HIV and other sexually- transmitted diseases and/or to act as a contraceptive. To encourage the use of these products, microbicides should be designed to be inexpensive, convenient, unobtrusive, and non-irritating to both partners. Ideally, microbicide preparations, which can be in the form of creams, foams or gels, should be available in contraceptive and non-contraceptive formulas. This would allow women to protect themselves from contracting sexually-transmitted diseases whether or not they wish to conceive children. [004] "Oligonucleotide" (ODN) is meant to refer to a molecule comprised of two or more deoxyribonucleotides or ribonucleotides and modified ribo- or deoxyribonucleic acids. According to preferred embodiment, the core structure of the ODN has a minimal length of 15 nucleotides. The term "bases" as used refers to pyrimidines and purines, or modified or derivatized versions thereof. The following abbreviations are used: "A" refers to adenine, but depending on the context, may also refer to its ribose, deoxyribose or modified ribose or deoxyribose form. Similarly, "T" refers to thymine or thymidine, "U" refers to uracil or uridine, "G" refers to guanine or guanosine, and "C" refers to cytosine or cytidine.
[005] The "inhibition" of viral replication is meant to include partial and total inhibition of viral replication as well as decreases in the rate of viral replication. The inhibitory dose or "therapeutic dose" of the compounds in the present invention may be determined by assessing the effects of the oligonucleotide on viral replication in tissue culture or viral growth in an animal. The amount of oligonucleotide administered in a therapeutic dose is dependent upon the age, weight, kind of concurrent treatment and nature of the viral condition being treated. [006] The terms "therapeutic effective dose" as used herein refer to the dose of a G-quartet ODN which causes a therapeutic effect when given to an animal or human. The therapeutic dose introduced into the animal or human to be treated, will provide a sufficient quantity of oligonucleotide to provide a specific effect, ej*., (1) microbicide effect, (2) inhibition of viral entry, (3) inhibition of viral protein or enzymes, (4) inhibition of the reverse transcriptase, and (5) inhibition of the integrase. One skilled in the art will readily recognize that the dose will be dependent upon a variety of parameters, including the age, sex, height and weight of the human or animal to be treated. Given any set of parameters, one skilled in the art will be able to readily determine the appropriate dose.
[007] As used herein, "G-quartet ODN" correspond to oligonucleotides having a three dimensional structure stabilized by guanosine tetrads. The term "guanosine tetrads" refers to the structure that is formed of eight hydrogen bonds by coordination of the four O6 atoms of guanine. Beyond hydrogen bonding among guanines, the stability of quadruplexes derives from interactions among stacked quartets as well as coordination by quartets of centrally located cations (e.g. Na+ or K+). As predicted from numerous previous physical and biochemical studies, both the NMR and crystallographic studies suggest that folding is mediated by square planar Hoogsteen H-bonding among G-residues. Crystallography has shown that the structure is selectively stabilized by tight binding of a small monovalent cation to the O6 oxygen of guanosine. Such G-quartet oligonucleotides may be active as a monomer or as a dimer.
[008] The present invention is directed to the novel and previously undisclosed properties of "G-quartet ODN". The Applicants have characterized that particular G-quartet ODN having superior multimodal activity thereby targeting multiple steps of the retrovirus life cycle. Indeed, G-quartet ODNs were showed to inhibit viral entry into cells, reverse transcription of the viral genome, and integration thereof into the host cell chromosome. The present study also demonstrates for the first time that these G-quartet ODN exhibited potent microbicide activity when incubated with the virus alone. These findings clearly represent a major breakthrough for treating viral infection. [009] The present invention thus relates to a microbicide composition comprising a therapeutically effective amount of G-quartet ODN and optionally a pharmaceutically acceptable excipient.
[0010] In accordance with the present invention, G-quartet ODN has a core structure 5'-(G)3(H)n(G)3(H)n(G)2H(G)3H-S' (core 1) or 5'-(G)4(H)n(G)3(H)n(G)2H(G)3-3' (core 2) wherein H represents a base either an adenine (A) or a pyrimidine, and wherein n is 1 or 2. Preferably, H is a thymidine or an adenine. In some embodiments (core 1), nucleotide at positions 4 and 15 may be a thymidine, nucleotide at positions 8 and 11 may be an adenine. In core 2, nucleotide at position 5 may be a thymidine, nucleotide at positions 9 and 12 may be an adenine. The minimum length of the core structure is 15 nucleotides. Additional random sequences may be added on 5' and/or 3' ends. Preferred sequences may be 5' -GGGGTGGGAGGAGGGT-S' (SEQ ID NO: 1), 5' -GGGGAGGGAGGAGGGT-S' (SEQ ID NO: 2), 5' -GGGGTGGGTGGAGGGT-S' (SEQ ID NO: 3), 5' -GGGGTGGGAGGTGGGT-S' (SEQ ID NO: 4), or 5'-GGGGTGGGTG GTGGGT-3' (SEQ ID NO:5). Nucleotides at position 5 may be T, A, AA, TT, TA, AT, or TTA. Nucleotides at position 9 may be A, T, TT, AT, TA or AA. Most preferred oligonucleotide has a core sequence 5' -GGGGTGGGAGGAGGGT-S' (SEQ ID NO: 1) of 16 nucleotides and has been named herein below Andevir. The oligonucleotides may have phosphorothioated internucleoside backbones or may contain chemically modified bases. The chemistry can be DNA or RNA or cDNA. [0011] The oligonucleotides may optionally be modified at the 3' or 5' terminus by attachment of a substituent moiety selected from the group consisting of propylamine, poly-L -lysine, cholesterol, fatty acid chains having C2-C24 carbons, cholesterol with a triglycyl linker, and vitamin E. [0012] The oligonucleotides according to the present invention were recently shown to exhibit potent in vitro IN inhibition activity (de Soultrait VR et al, 2002, J MoI Biol 324:195-203). The minimal guanine -rich ODN sequence responsible for the best inhibition was found to comprise core 1 or 2 sequences as above described with 15 nucleotides, and most preferred sequence is 16 nucleotides long and was named Andevir. The NMR structure of the oligonucleotides according to the present invention in the presence of K+ ions was determined. The aptamer folds in an unusually stable dimeric parallel-stranded DNA quadruplex.
[0013] The Applicants have identified the unique multimodal mechanism of action of oligonucleotides according to the present invention at specific doses. A particularly effective IC50 range is between 1 nM to 30 nM, specifically between 15 nM to 25 nM, most specifically 20 nM. Indeed, it was demonstrated that ODN according to the present invention were able to block HIV replication in infected cells cultures with an IC50 between 15 nM to 25 nM, most specifically 20 nM. At these effective doses, besides their multimodal effect on the integration step, inhibition of the viral entry and the reverse transcription in infected cells, G-quartet ODNs of the present invention specifically Andevir, were evidenced for the first time to also have a potent microbicide effect. [0014] In a preferred embodiment the present invention relates to a multimodal antiviral composition comprising a therapeutically effective amount of at least one G-quartet oligonucleotide and optionally a pharmaceutically acceptable excipient wherein said G-quartet oligonucleotide inhibit at least 2 steps selected from: (i) the infection step and virus entry, (ii) the viral replication or reverse transcription,
(iii) the integration of viral genome into the genome of infected cells, and (iv) the synthesis of viral structural proteins and formation of viable new viruses. [0015] In a still further preferred embodiment the present invention provides a multimodal antiviral composition comprising a therapeutically effective amount of at least one G-quartet oligonucleotide, wherein the G-quartet oligonucleotide has a core structure chosen from 5'- (G)3(H)n(G)3(H)n(G)2H(G)3H-S' or 5'-(G)4(H)n(G)3(H)n(G)2H(G)3-S' wherein H represents an Adenine or Thymidine or an Uracil, and wherein n is 1 or 2 and a pharmaceutically acceptable excipient wherein the inhibitory action is at least 2 steps selected from:
1) Inhibition of the infection step and virus entry,
2) Inhibition of the viral replication or reverse transcription, 3) Inhibition of the integration of viral genome into the genome of infected cells, and 4) Inhibition of synthesis of viral structural proteins and formation of viable new viruses. [0016] Applicants have demonstrated for the first time that the G-quartet ODNs of the invention surprisingly exhibit potent microbicidal and/or spermicidal activity when incubated with the virus alone. These findings clearly represent a major breakthrough for treating viral infection. Hence, the compositions of the present invention have the ability to prevent the transmission of HIV. In particular, they can prevent sexual or vaginal transmission of HIV by preventing either the production of infectious viral particles or infection of uninfected cells. If infected cells in sperm can reach the mucosa, the compounds of the present invention can prevent HIV infection of host cells, such as macrophages, lymphocytes, Langerhans etc. Thus, the present compounds prevent systemic HIV infection of a human being, exhibiting a preventive or a prophylactic action against the HIV virus. The G-quartet ODNs according to the present invention are useful in the manufacture of a medicament useful for preventing the transmission of or infection with HIV, particularly via sexual intercourse or related intimate contact between partners. In particular, the use of G-quartet ODNs is paramount in the manufacture of a topical medicament useful for preventing the transmission of or infection with HIV.
[0017] As shown in Figure 1, Andevir is able to act on early viral steps. The best inhibition was obtained when inhibitor and virus were added together to the cells and complete inhibition was reached with as low as 200 nM of compound. Preincubation of viral particles with Andevir prior to infection decreased infectivity of viruses, thereby indicating an action as microbicidal agent. This effect was obtained with higher concentrations of inhibitor than when Andevir and viruses were added together to the cells (Figure 2). [0018] ODNs of the present invention, such as for example Andevir were also found to be inhibiting at the very early steps of viral replication like viral entry. Inhibitory activity of Andevir after transfection assays was monitored to prove this effect. Naked andevir was able to achieve this early inhibition at low concentrations (Figure 4). All these results confirm that oligonucleotides according to the present invention have a multimodal way of action, initially by interacting directly with or inside the viral particle and further also exhibit inhibitory actions inside the cell.
[0019] Andevir has also been seen to have an important effect on viral nucleic acids. On one hand, entry was affected by this inhibitor because only 50 % of viral RNA quantity was detected in all the concentrations tested (Figure 3). However, even with concentrations as high as 3200 nM, total inhibition of viral entry is never obtained in presence of Andevir. On the other hand, a dose-dependent inhibition was observed on HIV-I DNA quantity (Figure 3). This experiment underlines a clear effect on HIV-I DNA synthesis, which takes place during the reverse transcription step.
[0020] The Applicants have also generated mutants resistant to Andevir. These mutants were obtained by addition of Andevir at the time of infection. Several mutations on gpl20 were detected (figure 6). Mutation N269K was already described in viral resistance against bicyclam, which acts at the interaction between gpl20 and the co-receptor CXCR4 and also for viral resistance against DS, a non-specific inhibitor of viral entry that acts on the adsorption step. Moreover, numerous wild type viruses showed an asparagin at this position, so mutation N269K could be due to the impact of Andevir on the virus.
[0021] Mutation Q278H was localized at a position described in the viral resistance against T30177 (Este JA, et al., 1998, MoI Pharmacol 53:340-34), against bicyclams (de Vreese, K., V. et al., 1996, J Virol 70:689-696) and against DS (Este JA, et al., 1997, MoI Pharmacol 52:98-104). All these HIV-I inhibitors are polyanionic molecules. This position is therefore a common resistance position to polyanions. However, in most cases, thie mutation is associated with a deletion in position 364-368 (FNSTW), yet this deletion could not be find in this case. Moreover, these positions are very variable sequences in wild type viruses. [0022] Finally, a clear N428I mutation in the resistant virus sequence emerged at position 428. This could be an evolution of the viral population according to pressure selection due to an increased concentration of Andevir in the culture media, even if this position is highly variable in the sequence of wild type viruses. The position was located in a domain involved in CD4 interaction. Andevir might therefore have a different and distinct inhibition mechanism from those of the polyanionic molecules cited, and this could be linked to interaction between gpl20 and CXCR4 and/or CD4.
[0023] Therefore, G-quartet ODNs, and preferably Andevir which have shown as being in vitro inhibitor of HIV-I IN (de Soultrait VR et al., 2002, J MoI Biol 324:195-203), were also evidenced by the Applicants as interfering with additional and multiple steps of the viral cycle, and importantly as being potent microbicidal agent. It is indeed crucial to propose multimodal drugs targeting several steps of viral replication cycle and having in additional potent microbicidal effect.
[0024] Microbicide compositions of the present invention are particularly useful for dramatically preventing and/or treating HIV co-infections or diseases, which are associated with human immunodeficiency virus (HIV).
[0025] The microbicide compositions may be administered intravenously, topically, or orally. These compositions may be in the form of foam, cream, pastes, wash, gel, jellies, suppository, ovule, lotion, ointment, emulsion, dispersions, powders, film, tablet, foaming tablet, tampon, spray, sponges, cervical caps, implants, patches, pessaries, vaginal ring, aerosol, vaginal or rectal or buccal tablets, mouthwashes, intravaginal rings or other intravaginal drug delivery systems. Microbicide formulations according to the present invention may be applied to the body cavities, to the skin, mucous membranes. Specifically the compositions may be in forms adapted to be applied to the site where sexual intercourse or related intimate contact takes place or is going to take place, such as the genitals, vagina, vulva, cervix, rectum, mouth, hands, lower abdomen, upper thighs, especially the vagina, vulva, cervix, and ano-rectal mucosae. Preferred administrations are topical, Le_., vaginal, anorectic and rectum applications, these can be in different dosage forms with appropriate apparatus, for example the gel could be applied to vulvar, vagina, cervical, ano-rectal, mouth, skin or rectum by hand, suppositories, or conventional tampon or, applicator or syringe techniques. Such coating of different types of mucosae with formulations according to the invention would prevent the penetration of pathogens especially HIV virus. The compositions of the invention can also be incorporated into douches. The compositions can also be incorporated into wipes. For example microbicides of the present invention when formulated for men, may be in the form of penile wipes [for use before and/or after sex.
[0026] To prepare the pharmaceutical compositions of this invention, an effective amount of the particular ODN as the active ingredient may optionally be combined with a pharmaceutically acceptable carrier/excipient/adjuvant/cosmetically acceptable base, which carrier/ excipient/adjuvant/base, may take a wide variety of forms depending on the form of administration. For example, in preparing the compositions for topical or oral administration, any of the usual pharmaceutical media may be employed such as, for example, water, glycols, oils, alcohols, polymers and the like. Solid carriers such as starches, sugars, kaolin, diluents, lubricants, binders, disintegrating agents and the like will be adequate in the case of tablets. Also included are solid form preparations which are intended to be converted, shortly before use, to liquid form preparations. In the compositions suitable for topical cutaneous administration, the carrier optionally comprises a suitable wetting agent, optionally combined with suitable additives of any nature in minor proportions, which additives do not introduce a significant deleterious effect on the skin. Said additives may facilitate the administration to the skin and/or may be helpful for preparing the desired compositions. Typical gel formulations may contain natural or synthetic polymers as gelifying agents, and hydrophobic or hydrophilic liquids. These compositions may be administered in various ways, e.g., as a cream or gel. The active ingredient may be present in the pharmaceutical formulations as a free agent or alternatively, encapsulated into drug carriers like liposomes, nanoparticles or cyclodextrins, which encapsulation results in an increased concentration of the compounds within the microbe target site. The active ingredient may also be present as nanoparticles. [0027] The compositions according to the present invention may be formulated as immediate release, controlled release, sustained release, extended release or a combination of the above, for examples the same dosage form providing a immediate release over a limited period of time, followed by a controlled or a extended release of the ODN from the composition. If the residence time of the topical compositions needs to be increased suitable, suitable polymers and adhesives may be added to the composition to achieve the effect.
[0028] Topic administrations are preferred for a preventive effect of the composition. Intravenous or oral administrations are preferred for a curative effect. [0029] In a preferred embodiment topical administrations may be employed for a preventive effect of the composition according to the invention. Intravenous or oral administrations are preferred for a curative effect, wherein a multimodal action according to the present invention is desired. The present compositions may further comprise additional microbicidal agents directed against a wide variety of bacteria, viruses, fungi, parasites, and spermicide. The present composition may be combined with other active ingredients, such as antivirals, antibiotics, immunomodulators or vaccines.
[0030] The compositions of the present invention can also be used as spermicides. These compositions then comprise spermicides and may be incorporated into contraceptive devices such as condoms, sponges, vaginal inserts, contraceptive films, diaphragms, suppositories, contraceptive patches or sustained release devices. For use as spermicides, these compositions of the invention can be applied alone; with other microbicides; and with or incorporated into the contraceptive devices described above.
[0031] The spermicidal property may be the inherent property of the compound of the invention or an additional spermicidal agent may be added. [0032] Microbicide compositions of the present invention are particularly useful for dramatically preventing and/or treating HIV co-infections or diseases, which are associated with human immunodeficiency virus (HIV). Preferred subjects are individuals who are exposed to HIV but have not been infected by it yet. Examples of such a preventive measure include (but not limited to) the prevention of mother-baby transmittal of the viruses; and the prevention of HIV infection in other situations, such as in medical workers handling HIV-contaminated blood, blood products, and body fluid in a medical accident. For vaginal heterosexual intercourse, the formulations of the invention may be applied into the vagina prior to intercourse. For anal intercourse (heterosexual or homosexual), the formulations of the invention may be inserted into the rectum prior to intercourse. For either vaginal or anal intercourse, the present topical formulations such as the gel formulations described herein may also act as a lubricant. For added protection it is generally preferred that the present the formulations of the invention be applied before intercourse or other sexual activity and that, if appropriate, a condom be used. For even further protection, the present topical formulations such as the gel formulations described herein can be applied as soon as possible after completion of the sexual activity.
[0033] While the treatment and prevention methods and microbicide compositions as per the present invention is particularly useful for inhibiting HIV and other retroviral infectious diseases in human beings, they can also be useful for veterinary purposes for infectious diseases in animals, such as: dogs, cats, birds, horses, cows, sheep, swine, and other farm animals, as well as rodents and other animals.
EXAMPLES
[0034] Example 1: Preparation of the ODNs
Dextran sulphate sodium salt and AZT (3'-azido-3'deoxy-thymidine) were obtained from Sigma. L-731,988 was obtained from a generous gift from Merck research laboratory. Andevir
(GGGGTGGGAGGAGGGT, SEQ ID NO: 1) and ODN TBA (GGTTGGTGTGGTTGG; SEQ ID
NO: 6) were obtained from MWG Biotech. Similarly, other preferred ODNs according to the present invention, such as 5'-GGGGAGGGAGGAGGGT-S' (SEQ ID NO: 2), 5'-
GGGGTGGGTGGAGGGT-3' (SEQ ID NO: 3), 5' -GGGGTGGGAGGTGGGT-S' (SEQ ID NO: 4), or 5'-GGGGTGGGTGG TGGGT-3' (SEQ ID NO: 5) were prepared.
[0035] Example 2: Cell lines and viruses
HeLa P4 cells encoding a Tat-inducible β-galactosidase were maintained in DMEM medium (Invitrogen) supplemented with 10 % inactivated FCS, 1 mg/ml geneticin (G418, Gibco-BRL). MT4 and H9Lai cells were grown in RPMI 1640 glutamax medium (Invitrogen) supplemented with 10 % inactivated FCS.
HIV-I viruses were obtained after 48 h co-culture of MT4 cells (0,5 xlO6 /ml) and H9Lai cells (1 x 106 /ml), chronically infected by HIV-lLai isolate, in RPMI 1640 glutamax medium supplemented with 10 % inactivated FCS, at 37°C under humidified atmosphere and 5 % CO2. The culture was then centrifuged and the supernatant was clarified by filtration on a 0.45 μm membrane before freezing at -800C.
[0036] Example 3: Viral infectivity
The infectivity was assayed on HeLa P4 cells expressing CD4 receptor and the β-galactosidase gene under the control of the HIV-I LTR. HeLa P4 were plated using 200 μl of DMEM medium supplemented with 10 % inactivated FCS in 96-multi-well plates at 10 000 cells per well. After overnight incubation at 37°C, under humidified atmosphere and 5 % CO2, the supernatant was discarded and 200 μl of viral preparation were added in serial dilutions. After 24 h of infection, the supernatant was discarded and the wells were washed 3 times with 200 μl of PBS. Each well was refilled with 200 μl of a reaction buffer containing 50 mM Tris-HCl pH 8,5, 100 mM β- mercaptoethanol, 0,05 % Triton X-100 and 5 mM 4-methylumbelliferyl-B-D-galactopyranoside (4-MUG) (Sigma). After 24 h, the reaction was measured in a fluorescence microplate reader (Cytofluor II, Applied Biosystems) at 360/460 nm Ex/Em.
[0037] Example 4: Viral purification
HIV-lLai virions (200 μl) were ultrafiltrated through a 0.02 μm Anopore membrane in 1.5 ml vectaspin tube (Whatman) for 11 min at 5 000 g (34). After 3 washes with PBS, the viral concentrate was re-suspended in 200 μl of RPMI 1640 glutamax medium supplemented with 10 % inactivated FCS. 100 μl of each viral concentrate condition were used to infect 10 000 HeLa P4 cells per well in a 96 multi-well plate.
[0038] Example 5: Transfection assay HeLa P4 cells were transfected with DMRIE-C, Jet-PEI and Lipofectamin 2000 (Invitrogen). ODN/cationic lipid complexes were obtained as indicated by the manufacturers. ODN concentration used for complexes was 2 μM. 24 h before transfection, cells were plated into 24- well plates at 100 000 cells/well and incubated for 24 h at 37°C under humidified atmosphere and 5 % CO2 Next day, when cells were at 60-80 % confluence, transfection complexes were prepared and added to 150 μl of fresh DMEM medium without FCS. After 4 h, 150 μl of fresh DMEM medium containing 20 % FCS were added per well. Cells were incubated 20 h at 37°C under humidified atmosphere and 5 % CO2 and then infected by HIV-I.
[0039] Example 6: Time-of-addition experiment HeLa P4 cells were plated using 200 μl of DMEM medium supplemented with 10 % inactivated FCS, 1 mg/ml G418, in a 96-multiwell plate at 10 000 cells per well. After overnight incubation at 37°C, under humidified atmosphere and 5 % CO2, the supernatant was discarded and replaced by fresh medium in the presence of HIV-I. Drug was added at different time after infection (from 0 to 10 h), and culture was maintained for 24 h. β-galactosidase activity was measured in a fluorescence microplate reader after substrate addition.
[0040] Example 7: Viral RNA extraction and quantitative RT-PCR
HeLa P4 cells were plated into 24-well plates at 100 000 cells per well and infected with HIV- lLai virus. After 2 h, cells were washed 3 times with PBS and trypsin treatment was performed in order to remove HIV-I viruses attached to cellular surface membrane and to recover infected cells from the well. Cells were again washed 3 times with PBS. Total RNA was extracted with the Trizol method (Gibco-BRL) according to the manufacturer's recommendations. The RNA pellet obtained was washed with 75 % ethanol and dissolved in DEPC -treated water for quantitative RT-PCR experiments. Specific primers for the GAPDH cellular mRNA (sense primer 5'- GGAAGGTGAAGGTCGGAGTCAACGG-3' (SEQ ID NO: 7); antisense primer 5'- TCCTGGAAGATGG TGATGGGATTTC-3' (SEQ ID NO: 8) were used for amplification by SYBR Green real-time RT-PCR. Quantitative RT-PCR was set up with "Iscript™ One-step RT- PCR kit" (Biorad) in a 25 μl final volume with 300 nM of each primer, 0.5 μl of RT and 10 μl of RNA extract. PCR program was 500C for 10 min, 95°C for 5 min, (95°C 10 sec; 62°C 30 sec; 72°C 30 sec) for 40 cycles in a MyiQ real-time PCR thermocycler (Biorad). To determine the amount of HIV-I RNA by quantitative RT-PCR, specific primers (sense primer LTRNecOOl 5' GCCTCAATAAAGCTTGCCT 3' (SEQ ID NO: 9); antisense primer LTR131 5' GGCGCCACTGCTAGAGAT 3'(SEQ ID NO: 10) were used with a real-time TaqMan MGB RT-PCR method (Applied Biosystems). The internal HIV-I TaqMan probe (6-FAM AAGTRGTGTGTGCCC-MGB; SEQ ID NO: 11) carried the 5' reporter 6-carboxyfluorescein and the 3' quencher 6-carboxytetramethylrhodamine (Applied Biosystems). Quantitative RT-PCR was set up in a 50 μl final volume with 25 μl buffer of "Superscript III Platinum One-step qRT- PCR" (Applied Biosystems), 200 nM of each primer, 200 nM of probe MGB, 1 μl of ROX (passive reference dye), 1 μl of RT and 10 μl of RNA extract and analyzed in a ABI Prism 7 000 Sequence Detection System thermocycler (Applied Biosystems). The programmed cycling was 48°C for 15 min, (95°C 2 min; 95°C 15 sec; 600C 30 sec) for 55 cycles.
To determine cellular and viral RNA copy number, a standardization curve was previously performed with serial dilution of in vitro transcribed GAPDH RNA ("MEGAscript" kit Ambion) and from commercialized solutions of HIV-I RNA (AcroMetrix).
[0041] Example 8: Viral DNA extraction and quantitative PCR
To quantify HIV-I DNA, HeLa P4 cells were placed into 96-well plates at 10 000 cells per well and infected with HIV-lLai virus. After 24 h, cells were washed 3 times with PBS and trypsin was applied to eliminate HIV-I viruses attached to the cellular surface membrane and to recover infected cells from the well. Moreover, cells were washed 3 times with PBS. Total DNA was extracted using the "High pure viral nucleic acid" kit (Roche Applied Science) and subjected to quantitative PCR.
Quantification of viral DNA by gag PCR: Specific primers for the GAPDH cellular gene (sense primer 5' GGAAGGTGAAGGTCGGAGTCAACGG 3' (SEQ ID NO: 7); antisense primer 5' TCCTGGAAGATGGTGATGGGATTTC 3' (SEQ ID NO: 8) were used to verify by SYBR Green real-time PCR that equal DNA quantities were used in each assay. Primers specific to a region of the gag gene (sense primer 5' GCCTATTGCACCAGGCCAGAT 3' (SEQ ID NO: 12); antisense primer 5' GTGAAGCTTGCTCGGCTCTTAGA 3' (SEQ ID NO: 13) were used to quantify total HIV-I DNA present in cells infected by SYBR Green method. Quantitative PCR was set up in a 25 μl final volume with 12.5 μl buffer of "PCR Quantitative SYBR Green kit" (Biorad), 300 nM of each primer and 10 μl of DNA extract. Cycling was programmed as 95°C for 1 min 30 sec, (95°C 10 sec; 600C 20 sec; 72°C 10 sec) for 42 cycles using a MyiQ real-time PCR thermocycler (Biorad). To determine gene copy number, a standardization curve was previously performed with serial dilutions from non-infected cells DNA (GAPDH gene) and from pNL4-3 plasmid dilutions encoding all viral genes (gag gene). Quantification of integrated DNA by AIu-PCR: Phusion high fidelity DNA polymerase (Ozyme) was used for this PCR. 20 μl of DNA were added to a mix containing 500 nM of primers, 200 nM dNTP, and 10 μl of 5X HF buffer in a final volume of 50 μl. Primers were AIu- 164 (5' TCCCAGCTACTCGGGAGGCTGAGG 3'; SEQ ID NO: 14) and PBS (5' TTTCAGTCCCTGTTCGGGCGCCA 3' ; SEQ ID NO: 15). The program was 30 sec at 98°C, 35 cycles (10 sec 98°C, 20 sec 600C, 2 min 30 sec at 72°C) and 72°C for 5 min. A nested PCR was performed with the primers NI-I (5' CACACACAAGGCT ACTTCCCT 3'; SEQ ID NO: 16) and NI-2 (5' GCCACTCCCCAGTCCCGCCC 3'; SEQ ID NO: 17) using 5 μl of the products of AIu- PCR. The Ampli Taq Gold enzyme from Promega was used according to the following program 12 min at 94°C, 42 cycles (94°C 1 min, 600C 1 min, 72°C 1 min) and 7 min at 72°C.
[0042] Example 9: Viral resistant strains selection
MT4 cells were first infected with HIV- lLai virus in the presence of Andevir at the 50 % Inhibitory Concentration (IC50). Cultures were incubated at 37°C under humidified atmosphere and 5% CO2, until a cytopathic effect was detected. The culture supernatants were used to infect new MT4 cells in the presence of increasing concentrations of Andevir up to 10 μM (500 times IC50 concentration of Andevir).
[0043] Example 10: DNA sequence analysis of viral resistant strains Viral RNA wild-type HIV-I and Andevir-resistant HIV-I containing supernatants were extracted with the "High Pure Viral RNA kit" (Roche Applied Science). RT-PCR was performed with the "Titan One Tube RT-PCR kit" from Roche Applied Science during a cycling program with 45 min 45°C, 5 min 94°C, (1 min 6O0C; 2 min 680C) for 40 cycles and 7 min 680C. Two μl of the RT-PCR products were submitted to a PCR reaction with "AmpliTaq Gold with GeneAmp" (Roche Applied Science). Cycling program was 12 min 94°C, (30 sec 94°C; 30 sec 55°C; 2 min 72°C) for 40 cycles and 7 min 72°C. A purification step was done with S-400 HR column (Pharmacia) prior to sequencing.
Sequencing was performed with "BigDye™ Terminator Cycle Sequencing Ready Reaction" (PE Biosystems). The cycling program was 1 min 96°C, (10 sec 96°C; 5 sec 500C; 4 min 6O0C) for 25 cycles. Sequencing products were purified using Sephadex (Sigma) prior to sequencing analysis with the Beckman genetic sequencer and "CEQ™ 2000XL DNA Analysis System" (Beckmen Coulter). The primer sets used for PCR amplification and sequence analysis are summarized in the Table 2.
[0044] Example 11: Time of addition experiments
The mode of action of our compound was examined by a time-of-addition experiment. HeLa P4 cells were infected at time 0. Then 500 nM of Andevir, which totally inhibited HIV-I replication, were added to cell culture at different times from 0 to 1O h after HIV-I infection. The infected culture was maintained for 24 h and HIV-I infectivity was then measured through the β- galactosidase activity driven by the HIV-I LTR as described above. Dextran Sulfate (DS), which inhibits the adsorption of the virus on the surface cell, and 3'-azido-3'deoxy-thymidine (AZT) which acts on reverse transcription were used as controls. As shown in Figure 1, total inhibition of HIV-I replication was obtained when DS was added at the same time as the virus. The inhibitory effect of DS rapidly decreased, and only 60 % inhibition remained when the drug was added 4 h post infection. AZT was active when added at the time of infection and inhibition decreased to 70 % when added 4 h post infection; 50 % inhibition still remained 6 h post infection. Andevir was also active when added at the time of infection, and remained active for several hours post infection (50 % inhibition when added 4 h post infection). Inhibition of HIV-I replication with a very low efficiency was still observed when the drug was added 1O h post infection, while AZT and DS were not efficient in the conditions used. These results suggest an effect of Andevir when added in the very first hours post infection.
[0045] Example 12: Inhibition the infectivity of HIV-I isolated particles
Andevir inhibitory activity was obtained when virus and inhibitor were added together to the cell. The capacity of Andevir to inhibit HIV-I infectivity of isolated particles was then evaluated. Briefly, HIV-I viruses were incubated at room temperature in the presence of different concentrations of inhibitor. Viruses were separated from unbound Andevir by centrifugation through Vectaspin membranes. Then, the infectivity of treated particles was studied by infecting HeLa P4 cells as described previously.
Similar experiments on the inhibition of the infectivity of HIV-I and HIV -2 isolates are conducting using other preferred ODNs such as 5' -GGGGAGGGAGGAGGGT-S' (SEQ ID NO: 2), 5 '-GGGGTGGGTGGAGGGT-S '(SEQ ID NO: 3), 5' -GGGGTGGGAGGTGGGT-S '(SEQ ID NO: 4), or 5'-GGGGTGGGTGGTGGGT-S' (SEQ ID NO: 5). The capacity of these ODNs to inhibit HIV-I infectivity of isolated particles is then evaluated. HIV-I or HIV -2 viruses are incubated at room temperature in the presence of different concentrations of the ODNs inhibitor. Viruses are separated from unbound ODNs by centrifugation through Vectaspin membranes, and the infectivity of treated particles is studied by infecting HeLa P4 cells as described previously. First, viral incubation at room temperature may decrease the infectivity by damaging the virus. This point was checked by incubating the viral particles at room temperature in diluted media and for different times. Then viruses were centrifuged in Vectaspin membranes, washed three times with PBS resuspended in culture media and used for HeLa P4 cells infection (centrifugated viruses). Viruses which were submitted to room temperature incubations but not to Vectaspin centrifugation were used as control (untreated viruses). As shown in Figure 2 A, virus infectivity of untreated viruses was not affected by 60 min incubation at room temperature, although 120 min incubation showed a 20 % decrease of replication. For the same times of incubation, centrifugation affected viral infectivity. Indeed, a > 20% loss of viral replication was observed with 60 min incubation followed by centrifugation. As a result, 30 min incubation at room temperature was chosen for further investigations.
The effect of different Andevir concentrations on infectivity of isolated particles was then studied. Incubation of HIV-I particles with serial dilutions of Andevir showed a clear inhibitory effect in a dose dependent manner (Figure 2 B). Complete inhibition was attained with an Andevir concentration of 10 μM, whereas 50 % inhibition was around 1 μM. The effect of two others molecules was also investigated. VD-84 is a curie-pyridinone compound which acts as a non nucleoside inhibitor of RT (1, 13, 35). In a previous work, we showed that it inhibits the viral infectivity of isolated particles probably due to its high affinity for RT. As expected, VD84 completely inhibited the infectivity of pre -treated viral particles (Figure 2 B). ODN TBA is a 15- mer ODN able to form G-quartets, for which we could not detect any inhibitory effect on HIV-I replication. At a concentration of 1 μM, ODN TBA showed only a weak inhibition of HIV-I infectivity (Figure 2 B). In conclusion, pre -incubation of Andevir with viral particles showed a large and specific inhibitory effect on HIV-I infectivity. However, this inhibition was obtained with concentrations in the micromolar range. As complete inhibition of HIV-I replication was attained with nanomolar concentrations of the inhibitor, this suggests that inhibition of infectivity cannot be the only process involved in HIV-I inhibition mediated by Andevir.
[0046] Example 13: Effect of ODNs on viral entry and reverse transcription steps
The Andevir effect on HIV-I entry into cells was assessed. HeLa P4 cells were infected in the presence of increasing Andevir concentrations. After 2 h of infection, total RNA was extracted and viral RNA was quantified by real-time RT-PCR. Figure 3 shows that around 50 % of HIV-I RNA were recovered whatever the concentration of Andevir used.
We next evaluated the effect of Andevir on HIV-I reverse-transcribed DNA. HeLa P4 cells were infected in the presence of various inhibitor concentrations, and the culture was maintained for 24 h. Cells were washed and total DNA was then extracted as described in Example 1. Amplification of gag gene was used to determine HIV-I DNA quantity by quantitative PCR. As shown in Figure 3, a dose-dependent inhibition was observed with increasing Andevir concentrations. When the Andevir concentration able to inhibit HIV-I replication totally was added (from 200 nM), the HIV-I DNA quantity detected in infected cells was very weak, around 5 %. Viral RNA was still present even for Andevir concentrations as high as 3200 nM, while DNA is totally absent. Therefore, as HIV-I RNA was still detected and viral DNA was almost absent in the same conditions, we conclude that viral DNA synthesis is strongly affected by Andevir. Similarly, effect of other preferred ODNs according to the present invention (such as 5'- GGGGAGGGAGGAGGGT-3' (SEQ ID NO: 2), 5' -GGGGTGGGTGGAGGGT-S' (SEQ ID NO: 3), 5'-GGGGTGGG AGGTGGGT-3' (SEQ ID NO: 4), or 5' -GGGGTGGGTGGTGGGT-S' (SEQ ID NO:5) on HIV-I entry into cells is assessed. HeLa P4 cells are infected in the presence of increasing ODNs concentrations. After 2 h of infection, total RNA is extracted and viral RNA is quantified by real-time RT-PCR.
[0047] Example 14: Specific inhibition by the ODNs of the integration step
Results showed a bimodal mechanism of action of Andevir: inhibition on viral entry and inhibition on viral DNA synthesis when ODN is added on cell culture at the time of infection. As the steps previous to integration are inhibited, it is impossible in such conditions to know whether Andevir is able to inhibit the integration process. Therefore, we monitored inhibition in conditions where the effect on viral entry is bypassed. For this purpose, a transfection assay was used, thereby avoiding any interaction between the virus and ODN outside of the cell. Several transfection agents were assayed, but not all were suitable to perform infection after transfection. Lipofectamin2000 showed a weak stimulation on HIV-I replication (Figure 4 A, bar 4). This agent, which is non-cytotoxic in our conditions, was thus chosen for further investigations. Different quantities of the pre-formed complex Andevir/Lipofectamin 2000 were incubated with HeLa P4 cells for 24 h. Cells were then infected with HIV-I. After 24 h, viral infectivity was determined as described above. Lipofectamin 2000 alone did not inhibit HIV-I infectivity up to 1 μM concentration (Figure 4 B). In the presence of naked Andevir, a dose-response inhibition curve was obtained with complete inhibition at 200 nM Andevir. The inhibition observed in the presence of dilutions of transfected Andevir was much weaker, with 60 % inhibition obtained with 2 μM Andevir/Lipofectamin 2000. Hence, total HIV-I infectivity inhibition was not obtained with 2 μM Andevir as concentration used in complex formation, while 100 % inhibition was observed with only 200 nM of naked Andevir. No inhibition was observed with transfection in the presence of a control ODN (not shown).
Taken all together, these results show that the level of HIV-I replication inhibition produced by the transfection complex was much lower compared to inhibition of the Andevir alone, and that this likely reflects inhibition on an intracellular target. To verify this point, viral DNA was quantified to determine the target of inhibition after transfection of Andevir in infected cells. Viral DNA was amplified using real time PCR with primers located in the gag gene. No changes in DNA quantities was detected in the presence or absence of increasing concentrations of transfected Andevir (Fig 5 and Table 1) suggesting that it does not inhibit the synthesis of viral DNA. In a second step, integrated DNA was specifically amplified using an AIu-PCR followed by a nested PCR as described in materials and methods section. Viral integration was affected in the presence of Andevir/Lipofectamin 2000 complexes (Figure 5). Therefore, Andevir clearly inhibits integration in a cellular context.
Table 1
Experimental conditions • Gag PCR
• (number of HIV-I copies
• for 106 GAPDH copies)
• Uninfected cells ND
Uninfected cells + Lipofectamine2000 ND
Uninfected cells + 1 μM Andevir ND
• Uninfected cells + 250, 500 nM or 1 μM ND
• Andevir/Lipofectamine 2000
• Infected cells • 10 x lO6 copies
• Infected cells + 1 μM Andevir • ND
• Infected cells + Lipofectamine 2000 8,3 x 106 copies
• Infected cells + 250 nM 5.2 x 106 Andevir/Lipofectamine 2000 copies
• Infected cells + 500 nM 6,5 x 106 Andevir/Lipofectamine 2000 copies
• Infected cells + 1 μM Andevir/Lipofectamine 6.3 x 106 2000 copies
[0048] Example 15: Viral resistant strains against Andevir
Andevir-resistant strains were selected by passing the virus in the presence of increasing drug concentrations. Resistant viruses were cultivated with a 10 μM Andevir final concentration of. gpl20, IN and RT genes were sequenced (Table 2). In the gpl20 encoding gene, three mutations were found (N269K, Q278H, N428I; Figure 6) confirming the inhibitory effect of Andevir on viral entry. /N and RT genes were also sequenced, but no mutation was observed on these two genes. Table 2:
• Primer name • Sequence
• RT-PCR (1) • Gpl20 + • CAGTACAATGTACACATGG
• (Nt from (SEQ ID NO: 18)
7002 at7587)
• Gpl20 - • ATGGGAGGGGCATACATTG
(SEQ ID NO: 19)
• PCR nested • Seqgpl20 + • AATGGCAGTCTATGCAGAAG
(D (SEQ ID NO:20)
• (Nt from
7055 at
7428)
• Seq gpl20 - • TTACAGTAGAAAAATTCCCCTC
(SEQ ID NO:21)
• RT-PCR (2) • RTPCR gpl20 (+) • AGAACAATTTGGAAATAATA
• (Nt from (SEQ ID NO:22)
7321 at
7860)
• RTPCR gpl20 (-) • ATAGTGCTTCCTGCTGCTC
(SEQ ID NO:23)
• PCR nested • Nested gpl20 (+) • CTTTAAGCAATCCTCAGGAG
(2) (SEQ ID NO:24)
• (Nt from
7351 at
7773)
• Nested gpl20 (-) • GCCTTGGTGGGTGCTACTC
(SEQ ID NO:25)
[0049] Example 16: Effect of G-quartet ODNs on viral entry and viral replication
[0050] As shown in Figure 7, increasing concentrations of Andevir conjugated with cholesterol at the 3' end (Andevir 3' chol) inhibited viral replication when contacted to the HeLa P4 cells concomitantly with the virus or 5h before adding the virus without any washing step. Interestingly, Andevir 3' chol inhibition of viral replication was also observed when an additional washing step was performed before the addition of the virus.

Claims

1. A microbicide composition comprising a therapeutically effective amount of at least one G-quartet oligonucleotide and optionally a pharmaceutically acceptable excipient.
2. The composition of claim 1 , wherein the G-quartet oligonucleotide has a core structure chosen from 5'-(G)3(H)n(G)3(H)n(G)2H(G)3H-S' or 5'-(G)4(H)n(G)3(H)n(G)2H(G)3-3' wherein H represents an Adenine or Thymidine or an Uracil, and wherein n is 1 or 2.
3. The composition of claim 1 or 2, wherein the G-quartet oligonucleotide has a sequence selected among 5' -GGGGTGGGAGGAGGGT-S' (SEQ ID NO: 1), 5'- GGGGAGGGAGGAGGGT-3' (SEQ ID NO: 2), 5' -GGGGTGGGTGGAGGGT-S' (SEQ ID NO: 3), 5' -GGGGTGGGAGGTGGGT-S' (SEQ ID NO: 4), and 5'-
GGGGTGGGTGGTGGGT-3' (SEQ ID NO: 5).
4. The composition of any one of the preceding claims, wherein said oligonucleotide has a minimal length of 15 nucleotides.
5. The composition of any one of the preceding claims, wherein said oligonucleotide has the sequence 5' -GGGGTGGGAGGAGGGT-S' (SEQ ID NO: 1).
6. The composition of any one of the preceding claims, wherein the 5' and 3' final internucleoside linkages are phosphorothioate.
7. The composition of any one of the preceding claims, wherein said oligonucleotide is optionally modified at the 3' or 5' terminus by attachment of a substituent moiety selected from the group consisting of propylamine, poly-L -lysine, cholesterol, fatty acid chains having C2-C24 carbons, cholesterol with a triglycyl linker, and vitamin E.
8. A composition according to any one of the preceding claims, wherein said composition has a multimodal activity and wherein said G-quartet oligonucleotide further inhibits at least 2 steps selected from: the infection step and virus entry, the viral replication or reverse transcription, - the integration of viral genome into the genome of infected cells, and the synthesis of viral structural proteins and formation of viable new viruses.
9. The composition of any one of the preceding claims, which is in a form appropriate for intravenous, oral, or topical administration.
10. A composition according to any one of the preceding claims, further comprising an additional microbicidal agent directed against bacteria, viruses, fungi, parasites, and/or additional spermicides, antivirals, antibiotics, immunomodulators or vaccines.
11. The composition of any one of the preceding claims, which is in the form of foam, cream, pastes, wash, gel, jellies, suppository, ovule, lotion, ointment, emulsion, dispersions, powders, film, tablet, foaming tablet, tampon, spray, sponges, cervical caps, implants, patches, pessaries, vaginal ring, aerosol, vaginal or rectal or buccal tablets, mouthwashes, intravaginal rings or other intravaginal drug delivery systems.
12. A composition according to any one of the preceding claims, wherein the dose of the G- quartet oligonucleotide may be 1 nM to 30 nM.
13. A method of preventing and/or treating HIV infection in a subject comprising administering a therapeutically effective dose of the composition of any one of the preceding claims to the subject in need of such treatment.
14. A method according to claim 13, for prevention of transmission of HIV infection, wherein the transmission is via sexual intercourse or related intimate contact between partners and wherein the composition is applied to the site where sexual intercourse or related intimate contact between partners takes place or is to take place.
15. The method of claim 13 or 14, wherein the infection is associated with human immunodeficiency virus type 1 (HIV-I) or human immunodeficiency virus type 2 (HIV-
2).
PCT/EP2010/056928 2009-05-19 2010-05-19 Multimodal activity of g-quartet oligonucleotides and microbicide compositions Ceased WO2010133652A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US17945809P 2009-05-19 2009-05-19
US61/179,458 2009-05-19
FR0954089 2009-06-17
FR0954089A FR2946881B1 (en) 2009-06-17 2009-06-17 MULTIMODAL ACTIVITY OF OLIGONUCLEOTIDES G-QUARTET AND MICROBICIDAL COMPOSITIONS.

Publications (1)

Publication Number Publication Date
WO2010133652A1 true WO2010133652A1 (en) 2010-11-25

Family

ID=41566104

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2010/056928 Ceased WO2010133652A1 (en) 2009-05-19 2010-05-19 Multimodal activity of g-quartet oligonucleotides and microbicide compositions

Country Status (2)

Country Link
FR (1) FR2946881B1 (en)
WO (1) WO2010133652A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8580294B2 (en) 2010-10-19 2013-11-12 International Partnership For Microbicides Platinum-catalyzed intravaginal rings
EP3147364A1 (en) 2015-09-28 2017-03-29 Institut d'Investigacions Biomédiques August Pi i Sunyer (IDIBAPS) Antiviral agents comprising an oligonucleotide-lipid conjugate forming g-quadruplex
US10137031B2 (en) 2013-11-14 2018-11-27 International Partnership For Microbicides, Inc. Combination therapy intravaginal rings

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994008053A1 (en) * 1992-09-29 1994-04-14 Isis Pharmaceuticals, Inc. Oligonucleotides having a conserved g4 core sequence
WO1994025037A1 (en) * 1993-04-23 1994-11-10 Triplex Pharmaceutical Corporation Anti-viral guanosine-rich oligonucleotides
WO2002076469A1 (en) * 2001-03-27 2002-10-03 Baylor College Of Medicine A novel technology of intracellular delivery of dna oligonucleotides to improve drug activity

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994008053A1 (en) * 1992-09-29 1994-04-14 Isis Pharmaceuticals, Inc. Oligonucleotides having a conserved g4 core sequence
WO1994025037A1 (en) * 1993-04-23 1994-11-10 Triplex Pharmaceutical Corporation Anti-viral guanosine-rich oligonucleotides
WO2002076469A1 (en) * 2001-03-27 2002-10-03 Baylor College Of Medicine A novel technology of intracellular delivery of dna oligonucleotides to improve drug activity

Non-Patent Citations (16)

* Cited by examiner, † Cited by third party
Title
CHUN, T. W. ET AL., L. PROC NATL ACAD SCI U S A, vol. 94, pages 13193 - 13197
CLAVEL, F. ET AL., N ENGL J MED, vol. 350, 2004, pages 1023 - 1035
DE SOULTRAIT V R ET AL: "DNA aptamers derived from HIV-1 RNase H inhibitors are strong anti-integrase agents.", JOURNAL OF MOLECULAR BIOLOGY, vol. 324, no. 2, 22 November 2002 (2002-11-22), pages 195 - 203, XP002565921, ISSN: 0022-2836 *
DE SOULTRAIT VR ET AL., J MOL BIOL, vol. 324, 2002, pages 195 - 203
DE VREESE, K., V. ET AL., J VIROL, vol. 70, 1996, pages 689 - 696
ESTE JA ET AL., MOL PHARMACOL, vol. 52, 1997, pages 98 - 104
ESTE JA ET AL., MOL PHARMACOL, vol. 53, 1998, pages 340 - 34
ESTE, J. A. ET AL., MOL PHARMACOL, vol. 53, 1998, pages 340 - 345
HICKS C ET AL., CLIN INFECT DIS, vol. 48, 2009, pages 931 - 9
JING, N. ET AL., J BIOL CHEM., vol. 273, 1998, pages 34992 - 34999
JING, N. ET AL., J. BIOL.CHEM, vol. 275, 2000, pages 21460 - 21467
MALET, I. ET AL., J ANTIMICROB CHEMOTHER, vol. 63, 2009, pages 795 - 804
METIFIOT MATHIEU ET AL: "Cellular uptake of ODNs in HIV-1 human-infected cells: A role for viral particles in DNA delivery?", OLIGONUCLEOTIDES, vol. 17, no. 2, 2007, pages 151 - 165, XP002565922, ISSN: 1545-4576 *
MILLER MD ET AL., J VIROL., vol. 71, 1997, pages 5382 - 5390
OJWANG, J. O. ET AL., ANTIMICROB AGENTS CHEMOTHER, vol. 39, 1995, pages 2426 - 2435
SEMENOVA, E. A., J MOL BIOL, vol. 235, 2008, pages 1532 - 1547

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8580294B2 (en) 2010-10-19 2013-11-12 International Partnership For Microbicides Platinum-catalyzed intravaginal rings
US9427400B2 (en) 2010-10-19 2016-08-30 International Partnership For Microbicides Platinum-catalyzed intravaginal rings
US10137031B2 (en) 2013-11-14 2018-11-27 International Partnership For Microbicides, Inc. Combination therapy intravaginal rings
US11259956B2 (en) 2013-11-14 2022-03-01 International Partnership For Microbicides, Inc. Combination therapy intravaginal rings
US11793669B2 (en) 2013-11-14 2023-10-24 The Population Council, Inc. Combination therapy intravaginal rings
EP3147364A1 (en) 2015-09-28 2017-03-29 Institut d'Investigacions Biomédiques August Pi i Sunyer (IDIBAPS) Antiviral agents comprising an oligonucleotide-lipid conjugate forming g-quadruplex

Also Published As

Publication number Publication date
FR2946881A1 (en) 2010-12-24
FR2946881B1 (en) 2013-04-26

Similar Documents

Publication Publication Date Title
Balzarini et al. Preclinical studies on thiocarboxanilide UC-781 as a virucidal agent
Bouchemal et al. Strategies for prevention and treatment of Trichomonas vaginalis infections
Chonco et al. Carbosilane dendrimer nanotechnology outlines of the broad HIV blocker profile
Neurath et al. Role of seminal plasma in the anti-HIV-1 activity of candidate microbicides
US7173014B2 (en) HIV-specific synthetic oligonucleotides and methods of their use
PL215128B1 (en) Microbicidal pyrimidine or triazine for preventing sexual hiv transmission
Friend et al. Combining prevention of HIV-1, other sexually transmitted infections and unintended pregnancies: development of dual-protection technologies
Briz et al. Development of water-soluble polyanionic carbosilane dendrimers as novel and highly potent topical anti-HIV-2 microbicides
Ariën et al. HIV sexual transmission and microbicides
Uckun et al. Prophylactic contraceptives for HIV/AIDS
US9289445B2 (en) Compositions and methods for treating or preventing a retrovirus infection
WO2010133652A1 (en) Multimodal activity of g-quartet oligonucleotides and microbicide compositions
PT2579871E (en) Topical antiviral formulations for prevention of transmission of hsv-2
Hughes et al. The search for a topical dual action spermicide/microbicide
Pani et al. DABOs as candidates to prevent mucosal HIV
Turpin et al. Topical microbicides: a promising approach for controlling the AIDS pandemic via retroviral zinc finger inhibitors
Zhang et al. Natural endogenous reverse transcription of HIV-1
Baptista et al. Spermicides, microbicides and antiviral agents: recent advances in the development of novel multi-functional compounds
JP2008163047A (en) 2,4-Dichlorobenzyl alcohol and amylmetacresol for HIV infection
Malcolm et al. Vaginal microbicides for the prevention of HIV transmission
Keller et al. Development of topical microbicides for prevention of human immunodeficiency virus and herpes simplex virus
WO2012094838A1 (en) Use and pharmaceutical composition of lignosulfonate
WO2013120414A1 (en) Hiv microbicide and use thereof
ES2225550T3 (en) DERIVATIVES OF DIFENIL CETOALDEHIDA WITH ANTI-HIV ACTIVITY.
Wainberg The need for vaginal microbicides with antiviral specificity

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10722057

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10722057

Country of ref document: EP

Kind code of ref document: A1