WO2010129964A1 - Drug targets for prevention of arrhythmia in heart disease - Google Patents

Drug targets for prevention of arrhythmia in heart disease Download PDF

Info

Publication number
WO2010129964A1
WO2010129964A1 PCT/US2010/034271 US2010034271W WO2010129964A1 WO 2010129964 A1 WO2010129964 A1 WO 2010129964A1 US 2010034271 W US2010034271 W US 2010034271W WO 2010129964 A1 WO2010129964 A1 WO 2010129964A1
Authority
WO
WIPO (PCT)
Prior art keywords
scn5a
rbm25
hluc7a
cell
perk
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2010/034271
Other languages
French (fr)
Inventor
Samuel Dudley
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Illinois at Urbana Champaign
University of Illinois System
Original Assignee
University of Illinois at Urbana Champaign
University of Illinois System
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Illinois at Urbana Champaign, University of Illinois System filed Critical University of Illinois at Urbana Champaign
Publication of WO2010129964A1 publication Critical patent/WO2010129964A1/en
Priority to US13/291,826 priority Critical patent/US20120129179A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/06Antiarrhythmics
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/33Alteration of splicing

Definitions

  • Heart disease is the number one cause of death in the United States, surpassing even cancer.
  • the National Center for Chronic Disease Prevention and Health Promotion estimates that approximately 950,000 Americans die of cardiovascular disease every year, accounting for more than 40 percent of all deaths.
  • One form of cardiovascular disease, arrhythmia is associated with very high levels of morbidity and mortality. Sudden arrhythmic death claims more than 300,000 lives each year.
  • Arrhythmia is defined as abnormal beating of the heart.
  • Heart beat a complex process of contraction and expansion, is controlled by electrical impulses, which are, in turn, regulated by the flow of specific ions (K + , Na + and Ca 2+ ) across cellular membranes.
  • Integral membrane proteins, or channels act as gates, controlling the flow of ions in and out of cells.
  • Sodium, calcium and potassium channels play pivotal roles in generating cardiac action potential, which triggers contraction. Ion channel dysfunction resulting from genetic mutation is a primary cause of arrhythmia.
  • Voltage-gated sodium channels are pore-forming membrane proteins responsible for the initiation and propagation of action potentials in excitable membranes in nerve, skeletal muscle and heart cells.
  • the controlled gating of sodium channels in response to membrane depolarization is necessary for normal electrical signaling and establishing of intercellular communication.
  • the cardiac voltage- sensitive sodium (Na + ) channel is composed of ⁇ and ⁇ subunits.
  • the gene encoding the ⁇ -subunit, SCN5A has been cloned and found to consist of 28 exons spanning over 80 kb of DNA.
  • the ⁇ -subunit (or its isoforms) contains four homologous repeated domains (D1-D4), each with six transmembrane segments (S1-S6).
  • the ⁇ -subunit protein alone forms a functional channel when expressed in mammalian expression systems.
  • the four repeated domains are hypothesized to assemble as a pseudotetrameric structure with the permeation pathway situated at the center.
  • the protein is responsible for the rapid influx of sodium ions that initiate and propagate action potential in the heart and the large peak sodium influxes responsible for excitability and conduction in myocardium and special conduction tissues.
  • the human voltage-gated cardiac Sodium channel ⁇ -subunit which is encoded by the gene SCN5A, is by far the most abundant Sodium channel protein in the human heart.
  • the SCN5A gene has been cloned and characterized in 1992 by Gellens et al. (Proceedings of the National Academy of Sciences of the United States of America 89:554-558 (1992)).
  • SCN5A consists of 28 exons spanning approximately 80 kb found by Wang et al. (Genomics 34:9-16 (1996)), which described the sequences of all intron/exon boundaries and a dinucleotide repeat polymorphism in intron 16. George et al. (Cytogenet.
  • Navl.5 is responsible for the rapid influx of sodium ions that initiates and propagates action potentials in heart, large peak inward sodium current that underlies excitability and conduction in working myocardium and special conduction tissue. Interventions that modulate sodium current have potent physiologic effects. Mutations in the human SCN5A gene cause the long QT syndrome (LQT) and idiopathic ventricular fibrillation (IVF).
  • Alternative splicing the process by which multiple messenger RNA (mRNA) isoforms are generated from a single pre-mRNA species is an important means of regulating gene expression.
  • Alternative splicing plays a central role in numerous biological processes such as sexual differentiation in Drosophila and apoptosis in mammals [Lopez (1998) Ann. Rev. Genet. 32:279-305].
  • Aberrant splicing generates abnormal mRNAs which are either unstable or code for defective or deleterious protein isoforms which are frequently implicated in the development of human disease [Lopez (1998) Ann. Rev. Genet. 32:279-305; Charlet (2002) MoI. Cell 10:45-53].
  • the present disclosure is based on the discovery that splicing factors hLuc7a and RBM 25 play a role in the abnormal splicing of the voltage-gated sodium channel ⁇ -subunit (SCN5A) gene.
  • SCN5A voltage-gated sodium channel ⁇ -subunit
  • the presence of abnormal SCN5A splice variants downregulates expression of the SCNA gene.
  • a method of inhibiting downregulation of the SCN5A gene in a cell comprising contacting the cell with a compound that inhibits activity of splicing factor hLuc7a, splicing factor RBM25 and/or protein kinase R-like ER kinase (PERK) in an amount effective to inhibit downregulation of the SCN5A gene.
  • the method is an in vivo method.
  • the method inhibits or reverses an effect of hypoxia or angiotensin II in the cell.
  • downregulation of splicing factor hLuc7A or splicing factor RBM25 downregulates expression of abnormal SCN5A splice variants.
  • the abnormal SCNA splice variant is selected from the group consisting of E28B, E28C and E28D.
  • downregulation of PERK upregulates expression of full-length SCN5A.
  • RBM25 is a splicing factor that binds tightly to the canonical RNA sequence CGGGC(A) (Zhou et al., MoI. Cell. Biol., 28:5924-5936, 2008). Therefore, in some embodiments, the compound that inhibits activity of splicing factor hLuc7a, splicing factor RBM25 and/or PERK reduces splicing factor interaction with the canonical sequence CGGGCA in a genomic polynucleotide encoding SCN5A.
  • a method of identifying a compound that inhibits transcription of an abnormal SCN5A splice variant in a cell comprising the step of contacting the cell that comprises a SCN5A gene with a test compound in the presence and absence of a splicing factor selected from the group consisting of hLuc7a and RBM25, wherein the splicing factor binds to the SCN5A gene in the absence of the test compound, and determining the presence or absence of an abnormal splice variant in the cell, wherein the absence of the abnormal splice variant in the cell identifies the test compound as a compound that inhibits transcription of an abnormal splice variant.
  • the cell is a blood cell, a muscle cell or a neuron. In some embodiments, the cell is a leukocyte, a macrophage or a cardiac cell.
  • Any compound that inhibits the activity of hLuc7a, RBM25 and/or PERK is contemplated for use in the methods described herein.
  • exemplary compounds include, but are not limited to, inhibitory oligonucleotides, antibodies and small molecules.
  • a prophylactic method of treating arrhythmia in a subject comprising identifying the subject as being at risk for developing arrhythmia and administering to a subject at risk of arrhythmia a compound that inhibits the activity of hLuc7a, RBM25 and/or PERK in an amount effective to prevent arrhythmia.
  • the method alternatively comprises the step of identifying an individual at risk of arrhythmia.
  • the identifying step comprises screening for the presence of an abnormal SCN5A splice variant in a biological sample of the subject, wherein the presence of the abnormal splice variant identifies the subject as being at risk for developing arrhythmia.
  • the presence of one or more SCNA splice variants E28B (SEQ ID NO: 7), E28C (SEQ ID NO: 8) and/or E28D (SEQ ID NO: 9) in the biological sample identifies the subject as being at risk for developing arrhythmia.
  • the screening step comprises obtaining a biological sample from the subject and analyzing nucleic acid from the sample for the presence of an abnormal splice variant.
  • the identifying step comprises determining a level of hLuc7a, RBM25 and/or PERK in a biological sample of a subject, wherein an increase in the level of hLuc7a, RBM25 and/or PERK in the sample identifies the subject as being at risk for developing arrhythmia.
  • Methods of treating arrhythmia in a subject are also provided.
  • the method comprises administering an effective amount of a compound that that inhibits activity of splicing factor hLuc7a, splicing factor RBM25 and/or PERK to the subject.
  • the subject is human. Practice of the methods described herein in other mammalian subjects, especially mammals that are conventionally used as models for demonstrating therapeutic efficacy in humans (e.g., primate, porcine, canine, or rabbit animals), is also contemplated.
  • the subject is suffering from a cardiac disorder, including but not limited to, heart failure, ischemia, myocardial infarction, congestive heart failure, arrhythmia, transplant rejection and the like.
  • the subject is suffering from heart failure. In another embodiment, the subject is suffering from arrhythmia.
  • a method to monitor the efficacy of treatment comprises determining a level of hLuc7a, RBM25 and/or PERK in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK.
  • a change in the level of hLuc7a, RBM25 and/or PERK in the sample taken after treatment compared to the level of hLuc7a, RBM25 and/or PERK before treatment indicates efficacy of the treatment.
  • a first biological sample is obtained from the subject to be treated prior to initiation of therapy or part way through a therapy regime.
  • a first biological sample is obtained from a subject known not to suffer from a condition being treated.
  • the second biological sample is obtained in a similar manner, but at a time following onset of therapy.
  • the second biological sample in some embodiments, is obtained at the completion of, or part way through therapy, provided that at least a portion of therapy takes place between the isolation of the first and second biological samples.
  • a decrease in the level of hLuc7a, RBM25 and/or PERK in the second biological sample (e.g., post-treatment) compared to the level of hLuc7a, RBM25 and/or PERK in the first biological sample (e.g., prior to treatment or from a subject known not to suffer from the condition being treated) indicates a degree of effective therapy.
  • the level of abnormal SCN5A splice variants in a biological sample is analyzed in a similar manner to monitor efficacy of treatment, with a decrease in the level of abnormal SCN5A splice variants in the sample indicates effective therapy.
  • the method to monitor efficacy of treatment comprises determining a level of abnormal SCN5A splice variants in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK.
  • a change in the level of abnormal SCN5A splice variants in the sample taken after treatment compared to the level of abnormal SCN5A splice variant in the sample before treatment indicates efficacy of treatment.
  • a decrease in the level of abnormal SCN5A splice variants in the second biological sample (e.g., post-treatment) compared to the level of abnormal SCN5A splice variants in the first biological sample (e.g., prior to treatment or from an individual known not to suffer from the condition being treated) indicates a degree of effective therapy.
  • the level of full-length SCN5A in a biological sample post- treatment is analyzed to monitor efficacy of treatment, with an increase in the level of full- length SCN5A in the sample indicates effective therapy.
  • the method to monitor efficacy of treatment comprises determining a level of full-length SCN5A in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK.
  • a change in the level of full- length SCN5A in the sample taken after treatment compared to the level of full-length SCN5A in the sample before treatment indicates efficacy of treatment.
  • An increase in the level of full-length SCN5A in the second biological sample (e.g., post-treatment) compared to the level of full-length SCN5A in the first biological sample (e.g., prior to treatment or from an individual known not to suffer from the condition being treated) indicates a degree of effective therapy.
  • a level of hypoxia and/or angiotensin II in a biological sample post-treatment is analyzed to monitor efficacy of treatment, with a decrease in the level of hypoxia and/or angiotensin II in the sample indicates effective therapy.
  • the method to monitor efficacy of treatment comprises determining a level of hypoxia or angiotensin II in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK.
  • a change in the level of hypoxia or angiotensin II in the sample taken after treatment compared to the level of hypoxia or angiotensin II in the sample before treatment indicates efficacy of treatment.
  • a decrease in the level of hypoxia or angiotensin II in the second biological sample (e.g., post-treatment) compared to the level of hypoxia or angiotensin II in the first biological sample (e.g., prior to treatment or from an individual known not to suffer from the condition being treated) indicates a degree of effective therapy.
  • the use of a compound that inhibits activity of hLuc7a, RBM25 and/or PERK in the manufacture of a medicament for the treatment of arrhythmia is also provided. Also provided is the use of a compound that inhibits activity of hLuc7a, RBM25 and/or PERK for the treatment of arrhythmia.
  • the compound is administered to a subject at risk for developing arrhythmia.
  • Figure 1 is a schematic representation of the splice variants identified in the 5' end of the human SCN5A gene.
  • the map shows the genomic structure of SCN5A with untranslated (open bars) or translated (closed bars) transcribed sequences and nontranscribed sequences (lines). Splicing patterns for each of the three exon 1 isoforms are identified.
  • Figure 2 provides cDNA sequences for ElA , ElBl, E1B2, E1B3, E1B4, E2A, E2B1 and E2B2.
  • Figure 3 is a schematic representation of the splice variants identified in the 3' end of the human SCN5A gene. Above the map shows the genomic structure of SCN5A with untranslated (open bars) or translated (closed bars) transcribed sequences and nontranscribed sequences (lines). Splicing patterns for each of the four exon 28 isoforms are identified.
  • Figure 4 provides cDNA sequences for E28A (Figure 4A and 4B), E28B (Figure 4C), E28C (Figure 4D), and E28D (Figure 4E).
  • the present disclosure is based on the discovery that splicing factors hLuc7a and RBM25 play a role in the abnormal splicing of the SCN5A gene.
  • the Examples provided herein demonstrate that upregulation of mRNA splicing factors hLuc7A and RBM25 mediate abnormal SCN5A splicing, and that the increased expression of abnormal SCN5A splice variants activates the unfolded protein response via protein kinase R-like endoplasmic reticulum kinase (PERK), leading to degradation of the full-length SCN5A mRNA through the unfolded protein response (UPR) pathway.
  • splicing factors hLuc7a and RBM25 and PERK are attractive targets for the treatment and/or prevention of arrhythmia in heart failure patients.
  • SCN5A splice variants in or near the 5' and 3' untranslated region (UTR) of the mRNA sequence of SCN5A are associated with heart diseases, such as arrhythmia and heart failure.
  • SCN5A splice variants include ElBl (SEQ ID NO. 1), E1B2 (SEQ ID NO. 2), E1B3 (SEQ ID NO. 3), E1B4 (SEQ ID NO. 4), E2B1 (SEQ ID NO. 5), E2B2 (SEQ ID NO. 6), E28B (SEQ ID NO. 7), E28C (SEQ ID NO. 8), or E28D (SEQ ID NO. 9).
  • ElBl, E1B2, E1B3, E1B4, E2B1, and E2B2 splice variants are from the 5' region, the locations of which in the SCN5A gene and mRNA are depicted in FIG. 1.
  • the nucleic acid sequences for ElBl, E1B2, E1B3, E1B4, E2B1, and E2B2 are shown in FIG. 2.
  • ElA SEQ ID NO. 10
  • ElBl, E1B2, E1B3, E1B4 are its various spliced variants.
  • E2A (SEQ ID NO. 11) is the wild-type (full-length) isoform in and/or near the 5'UTR of exon 2, while E2B1, and E2B2 are its various variants.
  • E28B, E28C, or E28D splice variants are from or near the 3' untranslated region, the locations of which in the SCN5A mRNA are depicted in FIG. 3.
  • the nucleic acid sequences for E28B, E28C, and E28D are set forth in SEQ ID NOs: 7-9, respectively.
  • E28A is the wild-type (or full-length) isoform of the 3' region of exon 28, while E28B, E28C, or E28D are its various truncated splice variant encoding shortened, dysfunctional channels.
  • E28A-short E28A-S
  • E28A-L E28A-long
  • E28A-L E28A-long
  • E28A-L E28A-long
  • E28A-L E28A-long
  • E28A-L E28A-long
  • E28A-S E28A-long
  • E28A-S contains only the first 834 base pairs of the 3'UTR.
  • E28B and E28C contains untranslated and translated regions while E28D contains only translated region of exon 28.
  • E28B, E28C and E28D splice variants are physiological significance supported by a premature stop codon in exon 28 of one of the two SCN5A alleles, resulting in an 86% reduction in the Na + current (Shang et al., Circ. Res., 101:1146-1154, 2007).
  • a method of inhibiting downregulation of full- length SCN5A (E28A) in a cell comprising contacting the cell with a compound that inhibits the activity of splicing factor hLuc7a, splicing factor RBM25 and/or PERK in an amount effective to inhibit down regulation of full-length SCN5A.
  • the method is an in vivo method.
  • the cell is a blood cell, a muscle cell or a neuron.
  • the cell is a leukocyte, a macrophage or a cardiac cell.
  • the method inhibits or reverses an effect of hypoxia or angiotensin II in the cell.
  • downregulation of splicing factor hLuc7A or splicing factor RBM25 downregulates expression of abnormal SCN5A splice variants.
  • downregulation of PERK upregulates expression of full-length SCN5A.
  • RBM25 is a splicing factor that binds tightly to the canonical RNA sequence CGGGC(A) (Zhou et al., MoI. Cell. Biol., 28:5924-5936, 2008). Therefore, in some embodiments, the compound that inhibits activity of splicing factor hLuc7a, splicing factor RBM25 and/or PERK reduces splicing factor interaction with the canonical sequence CGGGCA in a genomic polynucleotide encoding SCN5A.
  • the compound includes inhibitor oligonucleotides or polynucleotides, including pharmaceutically acceptable salts thereof, e.g., sodium salts.
  • Nonlimiting examples include antisense oligonucleotides (Eckstein, Antisense Nucleic Acid Drug Dev., 10: 117-121 (2000); Crooke, Methods Enzymol, 313: 3-45 (2000); Guvakova et al., /. Biol. Chem., 270: 2620-2627 (1995); Manoharan, Biochim. Biophys.
  • inhibitory oligonucleotides which are stable, have a high resistance to nucleases, possess suitable pharmacokinetics to allow them to traffic to target tissue site at non-toxic doses, and have the ability to cross through plasma membranes are contemplated for use as a therapeutic.
  • inhibitory oligonucleotides are complementary to the coding portion of a target gene, 3' or 5' untranslated regions, or intronic sequences in a gene, or alternatively coding or intron sequences in the target mRNA. Intron sequences are generally less conserved and thus may provide greater specificity.
  • the inhibitory oligonucleotide inhibits expression of a gene product of one species but not its homologue in another species; in other embodiments, the inhibitory oligonucleotide inhibits expression of a gene in two species, e.g. human and primate, or human and murine.
  • the constitutive expression of antisense oligonucleotides in cells has been shown to inhibit gene expression, possibly via the blockage of translation or prevention of splicing.
  • the inhibitory oligonucleotide is capable of hybridizing to at least 8, 9, 10, 11, or 12 consecutive bases of the hLuc7A, RBM25 and/or PERK genes or mRNA (or the reverse strand thereof) under moderate or high stringency conditions.
  • suitable inhibitory oligonucleotides are single stranded and contain a segment, e.g.
  • At least 12, 13, 14, 15, 16, 17 or 18 bases in length that is sufficiently complementary to, and specific for, an mRNA or DNA molecule such that it hybridizes to the mRNA or DNA molecule and inhibits transcription, splicing or translation.
  • complementarity over a length of less than 30 bases is more than sufficient.
  • stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 0 C for short nucleic acids (e.g., 10 to 50 nucleotides) and at least about 60 0 C for longer nucleic acids (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • Exemplary moderate stringency conditions include hybridization in 40% to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55°C to 60 0 C.
  • Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 0 C to 65°C. Duration of hybridization is generally less than about 24 hours, usually about 4 hours to about 12 hours.
  • the inhibitory oligonucleotide is an antisense oligonucleotide, an inhibitory RNA (including siRNA or RNAi, or shRNA), a DNA enzyme, a ribozyme (optionally a hammerhead ribozyme), an aptamer, or pharmaceutically acceptable salts thereof.
  • the oligonucleotide targets the nucleotides located in the vicinity of the 3' untranslated region of the SCN5A mRNA.
  • the oligonucleotide is complementary to at least 10 bases of the hLuc7A mRNA sequence (Genbank Accession Nos. NM_006107 and NM_016424), the RBM25 mRNA sequence (Genbank Accession No.: NM_021239) or a PERK mRNA sequence (including, but not limited to, Genbank Accession Nos: NM_003094.2, NM_004320.3, NM_0173201.2, NM_203463.1, NM_006850.2, NM_003329.2, NM_181339.1, NM_006260.3, NG_016424.1, NM_004836.5, NMJ)Ol 122752.1, NM_005025.4, NM_033266.3, NM_032025.3, NM_005130.3, NM_001013703.2, BC126356.1 and BC126354.1).
  • Genbank Accession Nos. NM_006107 and NM_016424
  • oligonucleotides may be any contiguous sequence of nucleotides contained within the expressed gene message of the target.
  • sequences that can be targeted for inhibition based on the full-length hLuc7A Genbank Accession Nos.
  • NM_006107 and NM_016424 include RBM25 (Genbank Accession No.: NM_021239) and PERK mRNA sequence (including, but not limited to, Genbank Accession Nos: NM_003094.2, NM_004320.3, NM_0173201.2, NM_203463.1, NM_006850.2, NM_003329.2, NM_181339.1, NM_006260.3, NG_016424.1, NM_004836.5, NM_001122752.1, NM_005025.4, NM_033266.3, NM_032025.3, NM_005130.3, NM_001013703.2, BC126356.1 and BC126354.1) sequences known in the art.
  • Factors that govern a target site for the inhibitory oligonucleotide sequence include the length of the oligonucleotide, binding affinity, and accessibility of the target sequence.
  • sequences are screened in vitro for potency of their inhibitory activity by measuring inhibition of target protein translation and target related phenotype, e.g., inhibition of cell proliferation in cells in culture.
  • target protein translation and target related phenotype e.g., inhibition of cell proliferation in cells in culture.
  • target protein translation and target related phenotype e.g., inhibition of cell proliferation in cells in culture.
  • target protein translation and target related phenotype e.g., inhibition of cell proliferation in cells in culture.
  • target protein translation and target related phenotype e.g., inhibition of cell proliferation in cells in culture.
  • AUG initiation, coding, splice junctions and introns can be targeted using antisense oligonucleotides.
  • Programs and algorithms known in the art, may be used to select
  • optimal sequences may be selected utilizing programs designed to predict the secondary structure of a specified single stranded nucleic acid sequence and allowing selection of those sequences likely to occur in exposed single stranded regions of a folded mRNA.
  • Methods and compositions for designing appropriate oligonucleotides may be found, for example, in U.S. Patent No. 6,251,588, the contents of which are incorporated herein by reference in its entirety.
  • Short interfering (si) RNA technology generally involves degradation of an mRNA of a particular sequence induced by double-stranded RNA (dsRNA) that is homologous to that sequence, thereby "interfering" with expression of the corresponding gene.
  • dsRNA double-stranded RNA
  • Any selected gene may be repressed by introducing a dsRNA which corresponds to all or a substantial part of the mRNA for that gene. It appears that when a long dsRNA is expressed, it is initially processed by a ribonuclease III into shorter dsRNA oligonucleotides of as few as 21 to 22 base pairs in length. Accordingly, siRNA may be affected by introduction or expression of relatively short homologous dsRNAs.
  • siRNAs have sense and antisense strands of about 21 nucleotides that form approximately 19 nucleotides of double stranded RNA with overhangs of two nucleotides at each 3' end. Indeed the use of relatively short homologous dsRNAs may have certain advantages.
  • the double stranded oligonucleotides used to effect RNAi are preferably less than 30 base pairs in length, for example, about 25, 24, 23, 22, 21, 20, 19, 18, or 17 base pairs or less in length, and contain a segment sufficiently complementary to the target mRNA to allow hybridization to the target mRNA.
  • the dsRNA oligonucleotides may include 3' overhang ends.
  • Exemplary 2-nucleotide 3' overhangs may be composed of ribonucleotide residues of any type and may even be composed of 2'-deoxythymidine resides, which lowers the cost of RNA synthesis and may enhance nuclease resistance of siRNAs in the cell culture medium and within transfected cells (see Elbashi et al., supra).
  • Exemplary dsRNAs may be synthesized chemically or produced in vitro or in vivo using appropriate expression vectors (see, e.g., Elbashir et al., Genes Dev., i5:188-200 (2001)). Longer RNAs may be transcribed from promoters, such as T7 RNA polymerase promoters, known in the art.
  • dsRNAs Longer dsRNAs of 50, 75, 100, or even 500 base pairs or more also may be utilized in certain embodiments of the invention.
  • Exemplary concentrations of dsRNAs for effecting RNAi are about 0.05 nM, 0.1 nM, 0.5 nM, 1.0 nM, 1.5 nM, 25 nM, or 100 nM, although other concentrations may be utilized depending upon the nature of the cells treated, the gene target and other factors readily discernable to the skilled artisan.
  • shRNA may comprise sequences that were selected at random, or according to any rational design selection procedure.
  • rational design algorithms are described in International Patent Publication No. WO 2004/045543 and U.S. Patent Publication No. 20050255487, the disclosures of which are incorporated herein by reference in their entireties. Additionally, it may be desirable to select sequences in whole or in part based on average internal stability profiles (“AISPs”) or regional internal stability profiles (“RISPs”) that may facilitate access or processing by cellular machinery.
  • AISPs average internal stability profiles
  • RISPs regional internal stability profiles
  • Ribozymes are enzymatic RNA molecules capable of catalyzing specific cleavage of mRNA, thus preventing translation.
  • the mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage event.
  • the ribozyme molecules preferably include (1) one or more sequences complementary to a target mRNA, and (2) the well known catalytic sequence responsible for mRNA cleavage or a functionally equivalent sequence (see, e.g., U.S. Patent No. 5,093,246, which is incorporated herein by reference in its entirety).
  • Gene targeting ribozymes may contain a hybridizing region complementary to two regions of a target mRNA, each of which is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides (but which need not both be the same length).
  • Ribozymes for use in a method described herein also include RNA endoribonucleases (“Czech-type ribozymes”) such as the one which occurs naturally in Tetrahymena thermophila (known as the IVS, or L- 19 IVS RNA) and which has been extensively described in Zaug et al., Science, 224:514-518 (1984); Zaug, et al., Science, 231- ⁇ 1Q-A15 (1986); Zaug et al., Nature, 524:429-433 (1986); International Patent Publication No. WO 88/04300; and Been et al., Cell, 47:201-216 (1986)).
  • Czech-type ribozymes such as the one which occurs naturally in Tetrahymena thermophila (known as the IVS, or L- 19 IVS RNA) and which has been extensively described in Zaug et al., Science, 224:514-518 (1984); Zaug, et
  • the Cech-type ribozymes have an eight base pair active site which hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place.
  • the inventive method employs those Cech-type ribozymes which target eight base-pair active site sequences that are present in a target gene or nucleic acid sequence.
  • target gene expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the gene (i.e., the promoter and/or enhancers) to form triple helical structures that prevent transcription of the gene in target cells in the body.
  • deoxyribonucleotide sequences complementary to the regulatory region of the gene i.e., the promoter and/or enhancers
  • triple helical structures that prevent transcription of the gene in target cells in the body.
  • DNA enzymes may be used to inhibit expression of target gene, such as the sclerostin gene.
  • DNA enzymes incorporate some of the mechanistic features of both antisense and ribozyme technologies. DNA enzymes are designed so that they recognize a particular target nucleic acid sequence, much like an antisense oligonucleotide. They are, however, also catalytic and specifically cleave the target nucleic acid.
  • DNA enzymes include two basic types identified by Santoro and Joyce (see, for example, U.S. Patent No. 6,110,462).
  • the 10-23 DNA enzyme comprises a loop structure which connect two arms. The two arms provide specificity by recognizing the particular target nucleic acid sequence while the loop structure provides catalytic function under physiological conditions.
  • DNA enzymes can be found, for example, in U.S. Patent No. 6,110,462. Additionally, one of skill in the art will recognize that, like antisense oligonucleotide, DNA enzymes can be optionally modified to improve stability and improve resistance to degradation.
  • Inhibitory oligonucleotides can be administered directly or delivered to cells by transformation or transfection via a vector, including viral vectors or plasmids, into which has been placed DNA encoding the inhibitory oligonucleotide with the appropriate regulatory sequences, including a promoter, to result in expression of the inhibitory oligonucleotide in the desired cell.
  • a vector including viral vectors or plasmids
  • Known methods include standard transient transfection, stable transfection and delivery using viruses ranging from retroviruses to adenoviruses. Delivery of nucleic acid inhibitors by replicating or replication-deficient vectors is contemplated.
  • Expression can also be driven by either constitutive or inducible promoter systems (Paddison et al., Methods MoL Biol, 265:85-100 (2004)). In other embodiments, expression may be under the control of tissue or development- specific promoters.
  • the promoter sequence comprises a cardiac-specific or skeletal muscle-specific promoter.
  • vectors may be introduced by transfection using carrier compositions such as Lipofectamine 2000 (Life Technologies) or Oligofectamine (Life Technologies). Transfection efficiency may be checked using fluorescence microscopy for mammalian cell lines after co-transfection of hGFP-encoding pAD3 (Kehlenback et al., /. Cell Biol, 141:863- 74 (1998)).
  • carrier compositions such as Lipofectamine 2000 (Life Technologies) or Oligofectamine (Life Technologies).
  • Transfection efficiency may be checked using fluorescence microscopy for mammalian cell lines after co-transfection of hGFP-encoding pAD3 (Kehlenback et al., /. Cell Biol, 141:863- 74 (1998)).
  • the delivery route will be the one that provides the best inhibitory effect as measured according to the criteria described above. Delivery mediated by cationic liposomes, delivery by retroviral vectors and direct delivery are efficient.
  • the effectiveness of the inhibitory oligonucleotide may be assessed by any of a number of assays, including reverse transcriptase polymerase chain reaction or Northern blot analysis to determine the level of existing SCN5A splice variants mRNA.
  • the compound that inhibits the activity of hLuc7a, RBM25 and/or PERK is an antibody.
  • antibody is used in the broadest sense and includes fully-assembled antibodies, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (including bispecific antibodies), chimeric antibodies, human antibodies, humanized antibodies, antibody fragments that can bind an antigen (including, Fab', F'(ab) 2 , Fv, single chain antibodies, diabodies), and recombinant peptides comprising the foregoing as long as they exhibit the desired biological activity. Multimers or aggregates of intact antibodies and/or fragments, including chemically derivatized antibodies, are contemplated.
  • Antibodies of any isotype class or subclass including IgG, IgM, IgD, IgA, and IgE, IgGl, IgG2, IgG3, IgG4, IgAl and Ig A2, or any allotype, are contemplated.
  • Standard techniques are employed to generate polyclonal or monoclonal antibodies directed against hLuc7a, RBM25 and/or PERK and to generate useful antigen-binding fragments thereof or variants thereof. Such protocols can be found, for example, in Sambrook et al., Molecular Cloning: a Laboratory Manual. Second Edition, Cold Spring Harbor, N. Y.: Cold Spring Harbor Laboratory (1989); Harlow et al.
  • Peptibodies are also contemplated.
  • the term "peptibody” refers to a molecule comprising an antibody Fc domain attached to at least one peptide, which has specific binding properties. The production of peptibodies is generally described in PCT publication WO 00/24782, the disclosure of which is incorporated herein by reference.
  • Small molecules that inhibit the activity of hLuc7a, RBM25 and/or PERK are also contemplated.
  • the small molecule in some embodiments, is a compound that acts directly or indirectly on exon 28 of the SCN5A gene (without interfering with transcription of full- length SCN5A), hLuc7a, RBM25 and or PERK or that decreases the level of at least one of hypoxia and/or angiotensin II in vivo.
  • the term "small molecule” includes a compound or molecular complex, either synthetic, naturally derived, or partially synthetic, and which preferably has a molecular weight of less than 5,000 Daltons (e.g., between about 100 and 1,500 Daltons).
  • Agents can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection (see, e.g., Lam, Anticancer Drug Des., 12:145 (1997) and U.S. Patent Nos. 5,738,996; 5,807,683; and 7,261,892).
  • Methods for identifying modulators of the expression of abnormal splice variants are also provided.
  • a method of identifying a compound that inhibits expression of an abnormal SCN5A splice variant in a cell comprising the step of determining a level of a SCN5A splice variant in the cell in the presence and absence of a test compound, wherein a reduced level of the splice variant in the presence of the test compound compared to the level of the splice variant in the absence of the test compound identifies the test compound as an inhibitor of the expression of a SCN5A splice variant.
  • Such screening techniques are useful in the general identification of a compound that will inhibit abnormal splicing of SCN5A in a cell, with such compounds being useful as therapeutic agents.
  • a method of identifying a compound that inhibits transcription of an abnormal SCN5A splice variant in a cell comprising the step of contacting the cell that comprises a SCN5A gene with a test compound in the presence and absence of a splicing factor selected from the group consisting of hLuc7a and RBM25, wherein the splicing factor binds to the SCN5A gene in the absence of the test compound, and determining the presence or absence of an abnormal splice variant in the cell, wherein the absence of the abnormal splice variant in the cell identifies the test compound as a compound that inhibits transcription of an abnormal splice variant.
  • the abnormal SCNA splice variant is selected from the group consisting of E28B (SEQ ID NO: 7), E28C (SEQ ID NO: 8) and E28D (SEQ ID NO: 9).
  • the test compound is an antisense oligonucleotide, an antibody or small molecule as described elsewhere herein.
  • RNA splicing can be detected by any of a variety of assays that detect the presence or absence of an exon in an RNA, including, without limitation, detection of protein domains encoded by particular exons (or introduced into particular exons) in translated proteins, electrophoretic separation and gel analysis of RNA or protein, polymerase chain reaction- based assays, Northern analysis or RNase protection using exon-specific probes, invasion cleavage assay (Eis et al. Nature Biotechnol. 19: 673-676 (2001), radionucleotide or fluorescently labeled nucleotide incorporation, etc.
  • Both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder associated with aberrant or unwanted target gene expression or activity e.g., in exemplary embodiments, expression of abnormal SCN5A splice variants.
  • Treatment means the application or administration of a therapeutic agent (e.g., an oligonucleotide, an antibody or a small molecule) or vector or transgene encoding same, etc.) to a subject or application or administration of a therapeutic agent to an isolated tissue (including, but not limited to, cardiac tissue) or cells (including, but not limited to, cardiac cells) from a subject, who has a disease or disorder, a symptom of disease or disorder or a predisposition toward a disease or disorder, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease or disorder, the symptoms of the disease or disorder, or the predisposition toward disease.
  • a therapeutic agent e.g., an oligonucleotide, an antibody or a small molecule
  • a prophylactic method of treating arrhythmia in a subject comprising identifying the subject as being at risk for developing arrhythmia and administering to a subject at risk of arrhythmia a compound that inhibits the activity of hLuc7a, RBM25 and/or PERK in an amount effective to prevent arrhythmia.
  • the method alternatively comprises the step of identifying an individual at risk of arrhythmia.
  • the method comprises identifying a subject at risk for developing arrhythmia.
  • the identifying comprises screening for the presence of an abnormal SCN5A splice variant in a biological sample of the subject, wherein the presence of the abnormal splice variant identifies the subject as being at risk for developing arrhythmia.
  • the presence of one or more of the SCNA splice variants E28B (SEQ ID NO: 7), E28C (SEQ ID NO: 8) and/or E28D (SEQ ID NO: 9) identifies in the biological sample identifies the subject as being at risk for developing arrhythmia.
  • the screening step comprises obtaining a biological sample from the subject and analyzing nucleic acid from the sample for the presence of an abnormal splice variant.
  • arrhythmia also known as “cardiac arrhythmia,” refers to a heterogenous group of conditions affecting the electrical behavior of the heart, e.g., a heart beat that is too fast (“tachycardias”), too slow (“bradycardias”) or of irregular pattern. It will be appreciated that arrhythmias may be classified based on their rate (normal, tachycardia, bradycardia), their mechanism (automaticity, re-entry, fibrillation), or by their site of origin (atrial, ventricular, junctional, or atrio-ventricular).
  • the identifying step comprises determining a level of hLuc7a, RBM25 and/or PERK in a biological sample (e.g., white blood cell or cardiac tissue) of a subject, wherein an increase in the level of hLuc7a, RBM25 and/or PERK in the sample identifies the subject as being at risk for developing arrhythmia.
  • a biological sample e.g., white blood cell or cardiac tissue
  • Methods are also provided wherein the biological sample is blood or cardiac tissue.
  • the biological sample is blood and white blood cells in the blood are analyzed for the presence of an abnormal SCN5A splice variant.
  • Methods of treating arrhythmia in a subject comprises administering an effective amount of a compound that that inhibits activity of splicing factor hLuc7a, splicing factor RBM25 and/or PERK to the subject.
  • the subject is human. Practice of methods of the invention in other mammalian subjects, especially mammals that are conventionally used as models for demonstrating therapeutic efficacy in humans (e.g., primate, porcine, canine, or rabbit animals), is also contemplated.
  • the subject is suffering from a cardiac disorder, including but not limited to, heart failure, ischemia, myocardial infarction, congestive heart failure, arrhythmia, transplant rejection and the like.
  • the subject is suffering from heart failure. In another embodiment, the subject is suffering from arrhythmia.
  • the method comprises determining a level of hLuc7a, RBM25 and/or PERK in a biological sample (e.g., white blood cell or cardiac tissue) of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK.
  • a change in the level of hLuc7am RMB25 and/or PERK in the sample taken after treatment compared to the level of hLuc7am RMB25 and/or PERK in the sample taken before treatment indicates efficacy of the treatment.
  • a first biological sample is obtained from the subject to be treated prior to initiation of therapy or part way through a therapy regime.
  • a first biological sample is obtained from a subject known not to suffer from a condition being treated.
  • the second biological sample is obtained in a similar manner, but at a time following onset of therapy.
  • the second biological sample in some embodiments, is obtained at the completion of, or part way through therapy, provided that at least a portion of therapy takes place between the isolation of the first and second biological samples.
  • a decrease in the level of hLuc7a, RBM25 and/or PERK in the second biological sample (e.g., post- treatment) compared to the level of hLuc7a, RBM25 and/or PERK in the first biological sample (e.g., prior to treatment or from an subject known not to suffer from the condition being treated) indicates a degree of effective therapy.
  • the level of abnormal SCN5A splice variants in a biological sample is analyzed in a similar manner to monitor efficacy of treatment, with a decrease in the level of abnormal SCN5A splice variants in the sample indicates effective therapy.
  • the method to monitor efficacy of treatment comprises determining a level of abnormal SCN5A splice variants in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK.
  • a change in the level of abnormal SCN5A splice variants in the sample taken after treatment compared to the level of abnormal SCN5A splice variant in the sample before treatment indicates efficacy of treatment.
  • a decrease in the level of abnormal SCN5A splice variants in the second biological sample (e.g., post-treatment) compared to the level of abnormal SCN5A splice variants in the first biological sample (e.g., prior to treatment or from an individual known not to suffer from the condition being treated) indicates a degree of effective therapy.
  • the level of full-length SCN5A in a biological sample post-treatment is analyzed to monitor efficacy of treatment, with an increase in the level of full-length SCN5A in the sample indicates effective therapy.
  • the method to monitor efficacy of treatment comprises determining a level of full-length SCN5A in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK.
  • a change in the level of full- length SCN5A in the sample taken after treatment compared to the level of full-length SCN5A in the sample before treatment indicates efficacy of treatment.
  • An increase in the level of full-length SCN5A in the second biological sample (e.g., post-treatment) compared to the level of full-length SCN5A in the first biological sample (e.g., prior to treatment or from an individual known not to suffer from the condition being treated) indicates a degree of effective therapy.
  • a level of hypoxia and/or angiotensin II in a biological sample post-treatment is analyzed to monitor efficacy of treatment, with a decrease in the level of hypoxia and/or angiotensin II in the sample indicates effective therapy.
  • the method to monitor efficacy of treatment comprises determining a level of hypoxia or angiotensin II in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK.
  • a change in the level of hypoxia or angiotensin II in the sample taken after treatment compared to the level of hypoxia or angiotensin II in the sample before treatment indicates efficacy of treatment.
  • a decrease in the level of hypoxia or angiotensin II in the second biological sample (e.g., post-treatment) compared to the level of hypoxia or angiotensin II in the first biological sample (e.g., prior to treatment or from an individual known not to suffer from the condition being treated) indicates a degree of effective therapy.
  • the prophylactic and therapeutic methods described herein are used in combination with standard of care therapeutics of heart failure including, but not limited to, diuretics, inotropes, coronary vasodilators and beta blockers or conventional therapeutics of circulatory diseases such as hypertension (e.g. angiotensin converting enzyme (ACE) inhibitors, angiotensin receptor blockers (ARBs) and/or calcium channel blockers), either simultaneously or at different times.
  • diuretics are generally used for relief of congestive symptoms and help the kidneys rid the body of excess fluid, thereby reducing blood volume and the heart's workload.
  • Diuretics can include, but are not limited to loop diuretics (e.g.
  • inotropes such as a cardiac glycoside, a beta-adrenergic agonist or a phosphodiesterase inhibitor, strengthen the heart's pumping action in patients with low cardiac output; inotropes can include but are not limited to digoxin, dobutamine, milrinone, istaroxime, omecamtiv mecarbil.
  • Vasodilators cause the peripheral arteries to dilate, making it easier for blood to flow; examples of vasodilators include, but are not limited, nitroglycerin, nitorprusside, and neseritide.
  • Activation of neurohormonal systems that include the renin-andiotensin-aldosterone system (RAAS) and the sympathetic nervous system also contribute to the pathophysiology of heart failure.
  • RAAS renin-andiotensin-aldosterone system
  • sympathetic nervous system also contribute to the pathophysiology of heart failure.
  • Drugs that inhibit activation of RAAS fall into three major categories: ACE inhibitors (including but not limited to ramipril, enalapril, and captopril), ARBs (including but not limited to valsarten, candesarten, irbesart and losart), and aldosterone receptor blockers (e.g., spironolactone and eplerenone.)
  • Beta blockers counter the effects of activation of the sympathetic nervous system and slow the heart rate by blocking the effects of adrenalin; beta blockers include, but are not limited to carvedilol, metoprolol, bisoprolol, atenolol, propranolol, timolol and bucindolol.
  • the compound that inhibits activity of hLuc7a, RBM25 and/or PERK and standard of care therapeutic are administered concurrently or sequentially.
  • the compound that inhibits activity of hLuc7a, RBM25 and/or PERK and standard of care therapeutic are administered separately, one would generally ensure that a significant period of time did not expire between the times of each delivery, such that the compound and standard of care therapeutic(s) would still be able to exert an advantageously combined effect.
  • both modalities would be administered within about 12-24 hours of each other. In some situations, it may be desirable to extend the time period for treatment significantly, from several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8). Repeated treatments with one or both agents is specifically contemplated.
  • compositions for use in accordance with the present invention may be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of a therapeutic composition into preparations which can be used pharmaceutically.
  • “Therapeutic compositions” or “therapeutic compound” as used herein refers to a composition comprising a therapeutic compound that inhibits activity of splicing factor hLuc7a, splicing factor RBM25 an/or PERK.
  • the therapeutic compound may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, carriers, diluents, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
  • such antisense compound encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • prodrug indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
  • prodrug versions of the oligonucleotides of the invention are prepared as SATE ((S acetyl-2-thioethyl) phosphate) derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published December 9, 1993 or in WO 94/26764 and U.S. 5,770,713 to Imbach et al.
  • pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • pharmaceutically acceptable salts for oligonucleotides, preferred examples of pharmaceutically acceptable salts and their uses are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
  • compositions comprising the therapeutic compound may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
  • Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration.
  • Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • Coated condoms, gloves and the like may also be useful.
  • compositions of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • the compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
  • compositions useful in the present invention include, but are not limited to, solutions, emulsions, foams and liposome-, micelle-, or nanoparticle-containing formulations.
  • the pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients, diluents, or other active or inactive ingredients.
  • Emulsions and their uses are well known in the art and are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
  • Formulations useful in the present invention include liposomal formulations.
  • liposome means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH sensitive or negatively charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells, and can be used to deliver compounds of the invention.
  • formulations are routinely designed according to their intended use, i.e. route of administration.
  • the therapeutic composition is delivered to the subject via one or more routes of administration.
  • the multiple administrations may be rendered simultaneously or may be administered over a period of several hours or days. Additional therapy may be administered on a period basis, for example, daily, weekly or monthly.
  • a therapeutically effective dose refers to that ingredient alone.
  • a therapeutically effective dose refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
  • compositions and their subsequent administration are believed to be within the skill of those in the art, and determined, e.g., by dose- response, toxicity, and pharmacokinetic studies. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. .
  • Microarray data analysis Changes in splicing factor mRNA abundances were evaluated by microarray analysis comparing human HF to normal myocardium. The data was uploaded to GeneSifter using Batch Upload with the option to use Affymetrix probe IDs. The data was Iog2 transformed and quantile normalized. Statistically significant genes were identified by using an unpaired Student t test (p value ⁇ 0.05 and a 5% Benjamini and Hochberg false discovery rate correction). A range of fold change cut offs were used. Genes associated with RNA splicing were found under the biological process GO term "GO: 0008380 : RNA splicing". The significance of the observed number of genes associated with RNA splicing was determined using z scores.
  • the culture medium consisted of DMEM/F12 (Invitrogen, Carlsbad, CA) supplemented with 15% knockout serum, 1% non-essential amino acids, 1 mmol/L L-glutamine, 0.1 mmol/L ⁇ -mercaptoethanol, and basic fibroblast growth factor of 20 ng/mL.
  • Real-Time PCR quantification Total RNA was isolated from cultured cells using the Qiagen RNeasy Mini Kit (Valencia, CA). Total RNA from human ventricles was isolated using the RNeasy Lipid Tissue Mini Kit (Qiagen). Reverse transcription was carried out at 42 0 C for 1 h with Powerscript reverse transcriptase (Roche). ⁇ -Actin was used as a reference when making quantitative comparison.
  • the primers for target genes are listed in Table 1.
  • RNA substrates (CAGCAGGCGGGCAGCGGCCU) and mutant (CAGCAGGUUAGAGGCGGCCU) RNA substrates (SEQ ID NOs: 32 and 33, respectively) were synthesized by Invitrogen. Binding of biotinylated RNA to RBM25 was achieved by incubating 0.2 nM RNA and variable amounts of protein for 30 min at 4 0 C in 20 ⁇ L of binding buffer (10 mM Tris-HCl, 10 mM HEPES, 100 mM NaCl, 0.1% Triton X-100, 2 mM MgC12, 1.5 mM dithiothreitol (DTT) pH 7.5, 7% glycerol).
  • binding buffer (10 mM Tris-HCl, 10 mM HEPES, 100 mM NaCl, 0.1% Triton X-100, 2 mM MgC12, 1.5 mM dithiothreitol (DTT) pH 7.5, 7% gly
  • RNAs were fractionated in a native 5% polyacrylamide gel, transferred to Hybond-N+nylon membrane (Amersham Biosciences), and detected with a LightShift chemiluminescent electrophoretic mobility shift assay kit (Pierce) by following the manufacturer's protocol.
  • Example 1 Splicing factors hLuc7A and RMB 25 are associated with abnormal splicing of
  • Hormone level SF4 BAT1 , RBM8A, SNRPD3 changing related genes
  • splicing factors are regulated by hypoxia or inflammation, both conditions usually present in heart failure.
  • hLuc7a and RBM25 were upregulated by 1.7 and 1.5 fold, respectively.
  • the upregulation of splicing factors RBM25 and hLuc7A in human heart failure tissue was confirmed by RT- PCR. Compared to the normal heart tissue, the results indicated that the relative abundances of RBM25 and hLuc7A were increased by 109.5+4.8% and 57.2+3.5% in heart failure tissue respectively (p ⁇ 0.05).
  • mRNA findings were correlated with protein expression by Western blot.
  • hLuc7a and RBM25 act together to mediate splicing of SCN5A and RBM25 binds target RNA (Zhou et al., MoI. Cell. Biol., 28:5924-5936, 2008).
  • RBM25 site in SCN5A
  • hLuc7a was absent from mouse heart. Therefore, splicing factors hLuc7a and RBM25 were upregulated in heart failure, recognized a sequence in SCN5A near the abnormal splicing, and a component was missing in mouse, potentially explaining why mice do not show abnormal SCN5A splicing in heart failure.
  • hLuc7a and RBM25 became favored candidate factors mediating abnormal SCN5A splicing in HF.
  • Binding of biotinylated RNA to RBM25 was achieved by incubating 0.2 nM RNA and variable amounts of protein for 30 min at 4 0 C in 20 ⁇ L binding buffer. For the competition assays, a molar excess of unlabeled competitor RNAs at various fold levels was added to the pre-incubated reaction mixture. Results showed RBM25 binding with the CGGGCA sequence. Specificity was confirmed by showing a lack of this binding to a mutated canonical binding sequence. RBM25 bound the wild-type SCN5A sequence in a concentration-dependent manner. Specificity was inferred from the inability of RBM25 to bind the mutant sequence and for unlabeled probe to compete with labeled probe for RBM25 binding. In summary, splicing factors hLuc7A and RBM25 are upregulated in human heart failurs and bind a sequence in the SCN5A exon 28, where pathological splicing occurs.
  • Example 2 - Ang-II and hypoxia regulate RBM25, hLuc7A, and SCN5A mRNA splicing.
  • AngII and hypoxia are common in heart failure, we investigated whether these two conditions could influence RBM25 and hLuc7A levels. Since only human white blood cells and cardiac cells express SCN5A and have demonstrated similar SCN5A mRNA splicing (Shang et al., Circ. Res., 101:1146-1154, 2007), Jurkat cells and H9 hESC- cardiomyocytes (CMs) were used for further testing. The Jurkat cells and H9 hESC-CMs were divided into three experiment groups: normoxia, hypoxia-treated (1% O 2 ), and Ang II- treated (100 nmol/L).
  • the cells were harvested from each experiment group at four time points (30 min, 24 h, 48 h, and 72 h), and total mRNA extracted. Results indicated that mRNA abundances of both RBM25 and hLuc7A were increased in both cell types. Under hypoxia-treated condition, the expressions of RBM25 and hLuc7A in Jurkat cells were increased by 53.7+5.1% and 487.5+8.2%, respectively (p ⁇ 0.05), and the expressions of RBM25 and hLuc7A in ES cells were increased by 57.9+5.2% and 389.5+7.9%, respectively (p ⁇ 0.05).
  • the upregulation of splicing factors RBM25 and hLuc7A in Jurkat cells was further confirmed by Western blot.
  • the Jurkat cells were divided into three experiment groups: normoxia, hypoxia-treated (1% O 2 ), and Ang II-treated (100 nmol/L).
  • the expressions of RBM25 and hLuc7A were analyzed by Western blot at three time points (12 h, 24 h, and 48 h) for hypoxia-treated group and at four time points (24 h, 48 h, 72 h, and 96 h) for Ang II-treated group.
  • the density of hLuc7A was increased by 242.3+9.5%, 236.1+8.4% and 268.8+9.8% in hypoxia-treated group at time points 12 h, 24 h and 48 h, respectively, and was increased by 256.3+9.1%, 246.5+8.6%, 279.7+9.3% and 283.6+9.9% in Ang II-treated group at time points 24 h, 48 h, 72 h and 96 h, respectively (p ⁇ 0.05).
  • PERK The expression of PERK was measures by RT-PCR in each group at the time point 48 h. Results indicated that the expression of PERK was increased by 6.3+0.4 (p ⁇ 0.05) fold and 7.9+0.5 fold (p ⁇ 0.05) when the variants E28C or E28D were overexpressed.
  • the upregulation of PERK in Jurkat cells was further confirmed by Western blot. Compared to the control group, Western blot analysis showed that the density of PERK was increased by 437.9+11.2%, 383.2+10.7% under hypoxia-treated and Ang II-treated conditions respectively (p ⁇ 0.05), and was increased by 262.6+9.6% and 359.5+10.1% in cells overexpressing variants E28C or E28D respectively (p ⁇ 0.05).
  • siRNA against PERK partially reversed the downregulation of full- length SCN5A expression after hypoxia or Ang II treatment. siRNA knockdown efficiency not less than 50%.
  • the UPR is a series of interrelated signaling pathways that occur when the ER experiences excess secretory load, accumulates misfolded proteins, or is subject to other pathological conditions.
  • the UPR acts on several levels: it rapidly attenuates general protein synthesis, induces the expression of ER chaperone proteins, and enhances the degradation of misfolded proteins. These changes are presumably designed to restore protein folding and ER health.
  • UPR transmembrane ER proteins
  • PERK protein kinase R-like ER kinase
  • IREl inositol- requiring protein 1
  • ATF-6 activating transcription factor 6
  • IREl While activated by endoribonuclease domain, IREl splices a 26 nucleotide fragment out of the XBPl mRNA and generates sXBPl (frame-shift splice variant of XBPl). Therefore, the increase of sXBPl in cells can be used as an indicator for the activation of ATF6 or IREl. In this work, sXBPl was observed as an indicator for UPR mediated by both ATF6 and IREl.
  • the UPR has been shown to play a role during development, hypertrophy, ischemia, and heart failure.
  • Heart failure is associated with hypoxia, elevated Ang II, and increased catecholamines, all of which have been shown to activate the UPR.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Cardiology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Described herein are methods of inhibiting down regulation of the SCN5A gene in a cell. Methods of treating arrhythmia are also provided.

Description

DRUG TARGETS FOR PREVENTION OF ARRHYTHMIA IN HEART DISEASE CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims the benefit of priority of U.S. Provisional Application Nos. 61/176,665 and 61/253,916 filed May 8, 2009 and October 22, 2009, respectively. The disclosure of each priority application is incorporated herein by reference in its entirety.
STATEMENT OF U.S. GOVERNMENTAL INTEREST
[0002] This invention was made with U.S. government support under National Institutes of Health Grant Nos. ROl HL085558 and ROl HL085520. The government has certain rights in this invention.
BACKGROUND
[0003] Heart disease is the number one cause of death in the United States, surpassing even cancer. The National Center for Chronic Disease Prevention and Health Promotion estimates that approximately 950,000 Americans die of cardiovascular disease every year, accounting for more than 40 percent of all deaths. One form of cardiovascular disease, arrhythmia, is associated with very high levels of morbidity and mortality. Sudden arrhythmic death claims more than 300,000 lives each year.
[0004] Arrhythmia is defined as abnormal beating of the heart. Heart beat, a complex process of contraction and expansion, is controlled by electrical impulses, which are, in turn, regulated by the flow of specific ions (K+, Na+ and Ca2+) across cellular membranes. Integral membrane proteins, or channels, act as gates, controlling the flow of ions in and out of cells. Sodium, calcium and potassium channels play pivotal roles in generating cardiac action potential, which triggers contraction. Ion channel dysfunction resulting from genetic mutation is a primary cause of arrhythmia.
[0005] Voltage-gated sodium channels are pore-forming membrane proteins responsible for the initiation and propagation of action potentials in excitable membranes in nerve, skeletal muscle and heart cells. The controlled gating of sodium channels in response to membrane depolarization is necessary for normal electrical signaling and establishing of intercellular communication. The cardiac voltage- sensitive sodium (Na+) channel is composed of α and β subunits. The gene encoding the α-subunit, SCN5A, has been cloned and found to consist of 28 exons spanning over 80 kb of DNA. The α-subunit (or its isoforms) contains four homologous repeated domains (D1-D4), each with six transmembrane segments (S1-S6). The α-subunit protein alone forms a functional channel when expressed in mammalian expression systems. The four repeated domains are hypothesized to assemble as a pseudotetrameric structure with the permeation pathway situated at the center. The protein is responsible for the rapid influx of sodium ions that initiate and propagate action potential in the heart and the large peak sodium influxes responsible for excitability and conduction in myocardium and special conduction tissues.
[0006] The human voltage-gated cardiac Sodium channel α-subunit, referred to as Navl.5, which is encoded by the gene SCN5A, is by far the most abundant Sodium channel protein in the human heart. The SCN5A gene has been cloned and characterized in 1992 by Gellens et al. (Proceedings of the National Academy of Sciences of the United States of America 89:554-558 (1992)). SCN5A consists of 28 exons spanning approximately 80 kb found by Wang et al. (Genomics 34:9-16 (1996)), which described the sequences of all intron/exon boundaries and a dinucleotide repeat polymorphism in intron 16. George et al. (Cytogenet. Cell Genet. 68:67-70 (1995)) mapped the SCN5A gene to 3p21 by fluorescence in situ hybridization, thus making it an important candidate gene for long QT syndrome-3 in 1995. Navl.5 is responsible for the rapid influx of sodium ions that initiates and propagates action potentials in heart, large peak inward sodium current that underlies excitability and conduction in working myocardium and special conduction tissue. Interventions that modulate sodium current have potent physiologic effects. Mutations in the human SCN5A gene cause the long QT syndrome (LQT) and idiopathic ventricular fibrillation (IVF). Mutations in SCN5A that generate truncated, misprocessed, or dysfunctional proteins produce the Brugada variant of idiopathic ventricular fibrillation. Schott et al. (Nat. Genet. 23:20-21 (1999)) reported a mutation in the SCN5A gene that segregated with progressive cardiac conduction defect (PCCD) in an autosomal dominant manner in a large French family.
[0007] Alternative splicing, the process by which multiple messenger RNA (mRNA) isoforms are generated from a single pre-mRNA species is an important means of regulating gene expression. Alternative splicing plays a central role in numerous biological processes such as sexual differentiation in Drosophila and apoptosis in mammals [Lopez (1998) Ann. Rev. Genet. 32:279-305]. Aberrant splicing generates abnormal mRNAs which are either unstable or code for defective or deleterious protein isoforms which are frequently implicated in the development of human disease [Lopez (1998) Ann. Rev. Genet. 32:279-305; Charlet (2002) MoI. Cell 10:45-53].
[0008] Shang et al. (Circ. Res., 101 : 1146-1154, 2007) reported the detection of three SCN5A mRNA variants in human heart in addition to the full length form, and two of them were found to be increased in heart failure patients. SCN5A mRNA variants resulted from splicing at cryptic splice sequences in the terminal exon of SCN5A (i.e., exon 28). In comparison with the full-length Na+ channel, all three new variants were shorter and encoded prematurely truncated Na+ channel proteins missing the segments from domain IV, S3 or S4 to the C-terminus. The presence of the variants caused the reduced abundance of the full- length SCN5A mRNA.
SUMMARY OF THE INVENTION
[0009] The present disclosure is based on the discovery that splicing factors hLuc7a and RBM 25 play a role in the abnormal splicing of the voltage-gated sodium channel α-subunit (SCN5A) gene. The presence of abnormal SCN5A splice variants downregulates expression of the SCNA gene. Thus, in one embodiment, provided herein is a method of inhibiting downregulation of the SCN5A gene in a cell comprising contacting the cell with a compound that inhibits activity of splicing factor hLuc7a, splicing factor RBM25 and/or protein kinase R-like ER kinase (PERK) in an amount effective to inhibit downregulation of the SCN5A gene. In some embodiments, the method is an in vivo method.
[0010] In one embodiment, the method inhibits or reverses an effect of hypoxia or angiotensin II in the cell. In another embodiment, downregulation of splicing factor hLuc7A or splicing factor RBM25 downregulates expression of abnormal SCN5A splice variants. In some embodiments, the abnormal SCNA splice variant is selected from the group consisting of E28B, E28C and E28D. In another embodiment, downregulation of PERK upregulates expression of full-length SCN5A.
[0011] It has been shown that RBM25 is a splicing factor that binds tightly to the canonical RNA sequence CGGGC(A) (Zhou et al., MoI. Cell. Biol., 28:5924-5936, 2008). Therefore, in some embodiments, the compound that inhibits activity of splicing factor hLuc7a, splicing factor RBM25 and/or PERK reduces splicing factor interaction with the canonical sequence CGGGCA in a genomic polynucleotide encoding SCN5A.
[0012] In another embodiment, described herein is a method of identifying a compound that inhibits transcription of an abnormal SCN5A splice variant in a cell comprising the step of contacting the cell that comprises a SCN5A gene with a test compound in the presence and absence of a splicing factor selected from the group consisting of hLuc7a and RBM25, wherein the splicing factor binds to the SCN5A gene in the absence of the test compound, and determining the presence or absence of an abnormal splice variant in the cell, wherein the absence of the abnormal splice variant in the cell identifies the test compound as a compound that inhibits transcription of an abnormal splice variant.
[0013] In some embodiments, the cell is a blood cell, a muscle cell or a neuron. In some embodiments, the cell is a leukocyte, a macrophage or a cardiac cell.
[0014] Any compound that inhibits the activity of hLuc7a, RBM25 and/or PERK is contemplated for use in the methods described herein. Exemplary compounds include, but are not limited to, inhibitory oligonucleotides, antibodies and small molecules.
[0015] Both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder associated with aberrant or unwanted target gene expression or activity (e.g., in exemplary embodiments, expression of abnormal SCN5A splice variants) are provided. For example, in one embodiment, a prophylactic method of treating arrhythmia in a subject is provided, the method comprising identifying the subject as being at risk for developing arrhythmia and administering to a subject at risk of arrhythmia a compound that inhibits the activity of hLuc7a, RBM25 and/or PERK in an amount effective to prevent arrhythmia. In another aspect, the method alternatively comprises the step of identifying an individual at risk of arrhythmia. In such embodiments, the identifying step comprises screening for the presence of an abnormal SCN5A splice variant in a biological sample of the subject, wherein the presence of the abnormal splice variant identifies the subject as being at risk for developing arrhythmia. For example, the presence of one or more SCNA splice variants E28B (SEQ ID NO: 7), E28C (SEQ ID NO: 8) and/or E28D (SEQ ID NO: 9) in the biological sample identifies the subject as being at risk for developing arrhythmia. Thus the screening step, in some embodiments, comprises obtaining a biological sample from the subject and analyzing nucleic acid from the sample for the presence of an abnormal splice variant.
[0016] In some embodiments, the identifying step comprises determining a level of hLuc7a, RBM25 and/or PERK in a biological sample of a subject, wherein an increase in the level of hLuc7a, RBM25 and/or PERK in the sample identifies the subject as being at risk for developing arrhythmia. [0017] Methods of treating arrhythmia in a subject are also provided. For example, in one embodiment, the method comprises administering an effective amount of a compound that that inhibits activity of splicing factor hLuc7a, splicing factor RBM25 and/or PERK to the subject.
[0018] In some embodiments, the subject is human. Practice of the methods described herein in other mammalian subjects, especially mammals that are conventionally used as models for demonstrating therapeutic efficacy in humans (e.g., primate, porcine, canine, or rabbit animals), is also contemplated. In some embodiments, the subject is suffering from a cardiac disorder, including but not limited to, heart failure, ischemia, myocardial infarction, congestive heart failure, arrhythmia, transplant rejection and the like. In one embodiment, the subject is suffering from heart failure. In another embodiment, the subject is suffering from arrhythmia.
[0019] In some embodiments, a method to monitor the efficacy of treatment is provided. In such embodiments, the method comprises determining a level of hLuc7a, RBM25 and/or PERK in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK. In such a method, a change in the level of hLuc7a, RBM25 and/or PERK in the sample taken after treatment compared to the level of hLuc7a, RBM25 and/or PERK before treatment indicates efficacy of the treatment. In some embodiments, a first biological sample is obtained from the subject to be treated prior to initiation of therapy or part way through a therapy regime. Alternatively, in some embodiments, a first biological sample is obtained from a subject known not to suffer from a condition being treated. In some embodiments, the second biological sample is obtained in a similar manner, but at a time following onset of therapy. The second biological sample, in some embodiments, is obtained at the completion of, or part way through therapy, provided that at least a portion of therapy takes place between the isolation of the first and second biological samples. A decrease in the level of hLuc7a, RBM25 and/or PERK in the second biological sample (e.g., post-treatment) compared to the level of hLuc7a, RBM25 and/or PERK in the first biological sample (e.g., prior to treatment or from a subject known not to suffer from the condition being treated) indicates a degree of effective therapy.
[0020] The level of abnormal SCN5A splice variants in a biological sample, in some embodiments, is analyzed in a similar manner to monitor efficacy of treatment, with a decrease in the level of abnormal SCN5A splice variants in the sample indicates effective therapy. In such embodiments, the method to monitor efficacy of treatment comprises determining a level of abnormal SCN5A splice variants in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK. In such a method, a change in the level of abnormal SCN5A splice variants in the sample taken after treatment compared to the level of abnormal SCN5A splice variant in the sample before treatment indicates efficacy of treatment. A decrease in the level of abnormal SCN5A splice variants in the second biological sample (e.g., post-treatment) compared to the level of abnormal SCN5A splice variants in the first biological sample (e.g., prior to treatment or from an individual known not to suffer from the condition being treated) indicates a degree of effective therapy.
[0021] Alternatively, the level of full-length SCN5A in a biological sample post- treatment is analyzed to monitor efficacy of treatment, with an increase in the level of full- length SCN5A in the sample indicates effective therapy. In such embodiments, the method to monitor efficacy of treatment comprises determining a level of full-length SCN5A in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK. In such a method, a change in the level of full- length SCN5A in the sample taken after treatment compared to the level of full-length SCN5A in the sample before treatment indicates efficacy of treatment. An increase in the level of full-length SCN5A in the second biological sample (e.g., post-treatment) compared to the level of full-length SCN5A in the first biological sample (e.g., prior to treatment or from an individual known not to suffer from the condition being treated) indicates a degree of effective therapy.
[0022] In yet another alternative embodiment, a level of hypoxia and/or angiotensin II in a biological sample post-treatment is analyzed to monitor efficacy of treatment, with a decrease in the level of hypoxia and/or angiotensin II in the sample indicates effective therapy. In such embodiments, the method to monitor efficacy of treatment comprises determining a level of hypoxia or angiotensin II in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK. In such a method, a change in the level of hypoxia or angiotensin II in the sample taken after treatment compared to the level of hypoxia or angiotensin II in the sample before treatment indicates efficacy of treatment. A decrease in the level of hypoxia or angiotensin II in the second biological sample (e.g., post-treatment) compared to the level of hypoxia or angiotensin II in the first biological sample (e.g., prior to treatment or from an individual known not to suffer from the condition being treated) indicates a degree of effective therapy. [0023] The use of a compound that inhibits activity of hLuc7a, RBM25 and/or PERK in the manufacture of a medicament for the treatment of arrhythmia is also provided. Also provided is the use of a compound that inhibits activity of hLuc7a, RBM25 and/or PERK for the treatment of arrhythmia. In some embodiments, the compound is administered to a subject at risk for developing arrhythmia.
BRIEF DESCRIPTION OF THE FIGURES
[0024] Figure 1 is a schematic representation of the splice variants identified in the 5' end of the human SCN5A gene. The map shows the genomic structure of SCN5A with untranslated (open bars) or translated (closed bars) transcribed sequences and nontranscribed sequences (lines). Splicing patterns for each of the three exon 1 isoforms are identified.
[0025] Figure 2 provides cDNA sequences for ElA , ElBl, E1B2, E1B3, E1B4, E2A, E2B1 and E2B2.
[0026] Figure 3 is a schematic representation of the splice variants identified in the 3' end of the human SCN5A gene. Above the map shows the genomic structure of SCN5A with untranslated (open bars) or translated (closed bars) transcribed sequences and nontranscribed sequences (lines). Splicing patterns for each of the four exon 28 isoforms are identified.
[0027] Figure 4 provides cDNA sequences for E28A (Figure 4A and 4B), E28B (Figure 4C), E28C (Figure 4D), and E28D (Figure 4E).
DETAILED DESCRIPTION
[0028] The present disclosure is based on the discovery that splicing factors hLuc7a and RBM25 play a role in the abnormal splicing of the SCN5A gene. The Examples provided herein demonstrate that upregulation of mRNA splicing factors hLuc7A and RBM25 mediate abnormal SCN5A splicing, and that the increased expression of abnormal SCN5A splice variants activates the unfolded protein response via protein kinase R-like endoplasmic reticulum kinase (PERK), leading to degradation of the full-length SCN5A mRNA through the unfolded protein response (UPR) pathway. Thus, splicing factors hLuc7a and RBM25 and PERK are attractive targets for the treatment and/or prevention of arrhythmia in heart failure patients.
[0029] SCN5A splice variants in or near the 5' and 3' untranslated region (UTR) of the mRNA sequence of SCN5A are associated with heart diseases, such as arrhythmia and heart failure. SCN5A splice variants include ElBl (SEQ ID NO. 1), E1B2 (SEQ ID NO. 2), E1B3 (SEQ ID NO. 3), E1B4 (SEQ ID NO. 4), E2B1 (SEQ ID NO. 5), E2B2 (SEQ ID NO. 6), E28B (SEQ ID NO. 7), E28C (SEQ ID NO. 8), or E28D (SEQ ID NO. 9).
[0030] The ElBl, E1B2, E1B3, E1B4, E2B1, and E2B2 splice variants are from the 5' region, the locations of which in the SCN5A gene and mRNA are depicted in FIG. 1. The nucleic acid sequences for ElBl, E1B2, E1B3, E1B4, E2B1, and E2B2 are shown in FIG. 2. ElA (SEQ ID NO. 10) is the wild-type (or full-length) isoform in and/or near the 5'UTR of exon 1, while ElBl, E1B2, E1B3, E1B4 are its various spliced variants. Similarly, E2A (SEQ ID NO. 11) is the wild-type (full-length) isoform in and/or near the 5'UTR of exon 2, while E2B1, and E2B2 are its various variants.
[0031] The E28B, E28C, or E28D splice variants are from or near the 3' untranslated region, the locations of which in the SCN5A mRNA are depicted in FIG. 3. The nucleic acid sequences for E28B, E28C, and E28D are set forth in SEQ ID NOs: 7-9, respectively. E28A is the wild-type (or full-length) isoform of the 3' region of exon 28, while E28B, E28C, or E28D are its various truncated splice variant encoding shortened, dysfunctional channels. There are two isoforms of the E28A: E28A-short (E28A-S) (SEQ ID NO. 12) and E28A-long (E28A-L) (SEQ ID NO. 13). Both isoforms of E28A contains 1239 base pairs in the translated region. The difference between E28-L and E28-S resides in the UTR where E28A- L contains 2295 base pairs of the 3'UTR, while E28A-S contains 834 base pairs of the 3'UTR. E28A-S contains only the first 834 base pairs of the 3'UTR. Both E28B and E28C contains untranslated and translated regions while E28D contains only translated region of exon 28.
[0032] The physiological significance of the E28B, E28C and E28D splice variants is supported by a premature stop codon in exon 28 of one of the two SCN5A alleles, resulting in an 86% reduction in the Na+ current (Shang et al., Circ. Res., 101:1146-1154, 2007).
[0033] In one aspect, described herein is a method of inhibiting downregulation of full- length SCN5A (E28A) in a cell comprising contacting the cell with a compound that inhibits the activity of splicing factor hLuc7a, splicing factor RBM25 and/or PERK in an amount effective to inhibit down regulation of full-length SCN5A. In some embodiments, the method is an in vivo method. In some embodiments, the cell is a blood cell, a muscle cell or a neuron. In other embodiments, the cell is a leukocyte, a macrophage or a cardiac cell.
[0034] In one embodiment, the method inhibits or reverses an effect of hypoxia or angiotensin II in the cell. In another embodiment, downregulation of splicing factor hLuc7A or splicing factor RBM25 downregulates expression of abnormal SCN5A splice variants. In another embodiment, downregulation of PERK upregulates expression of full-length SCN5A.
[0035] It has been shown that RBM25 is a splicing factor that binds tightly to the canonical RNA sequence CGGGC(A) (Zhou et al., MoI. Cell. Biol., 28:5924-5936, 2008). Therefore, in some embodiments, the compound that inhibits activity of splicing factor hLuc7a, splicing factor RBM25 and/or PERK reduces splicing factor interaction with the canonical sequence CGGGCA in a genomic polynucleotide encoding SCN5A.
[0036] Any compound that inhibits the activity of hLuc7a, RBM25 and/or PERK is contemplated for use in the methods described herein. In one embodiment, the compound includes inhibitor oligonucleotides or polynucleotides, including pharmaceutically acceptable salts thereof, e.g., sodium salts. Nonlimiting examples include antisense oligonucleotides (Eckstein, Antisense Nucleic Acid Drug Dev., 10: 117-121 (2000); Crooke, Methods Enzymol, 313: 3-45 (2000); Guvakova et al., /. Biol. Chem., 270: 2620-2627 (1995); Manoharan, Biochim. Biophys. Acta, 1489: 117-130 (1999); Baker et al., /. Biol. Chem., 272: 11994-12000 (1997); Kurreck, Eur. J. Biochem., 270: 1628-1644 (2003); Sierakowska et al., Proc. Natl. Acad. ScL USA, 93: 12840-12844 (1996); Marwick, /. Am. Med. Assoc, 280: 871 (1998); Tomita and Morishita, Curr. Pharm. Des., 10: 797-803 (2004); Gleave and Monia, Nat. Rev. Cancer, 5: 468-479 (2005) and Patil, AAPS J. , 7: E61-E77 (2005)), triplex oligonucleotides (Francois et al., Nucleic Acids Res., 16: 11431-11440 (1988) and Moser and Dervan, Science, 238: 645-650 (1987)), ribozymes/deoxyribozymes (DNAzymes) (Kruger et al., Tetrahymena. Cell, 31: 147-157 (1982); Uhlenbeck, Nature, 328: 596-600 (1987); Sigurdsson and Eckstein, Trends Biotechnol, 13: 286-289 (1995); Kumar et al., Gene Ther., 12: 1486-1493 (2005); Breaker and Joyce, Chem. Biol, 1: 223-229 (1994); Khachigian, Curr. Pharm. Biotechnol, 5: 337-339 (2004); Khachigian, Biochem. Pharmacol, 68: 1023-1025 (2004) and Trulzsch and Wood, /. Neurochem., 88: 257-265 (2004)), small-interfering RNAs/RNAi (Fire et al., Nature, 391: 806-811 (1998); Montgomery et al., Proc. Natl. Acad. ScL U.S.A., 95: 15502-15507 (1998); Cullen, Nat. Immunol, 3: 597-599 (2002); Hannon, Nature, 418: 244-251 (2002); Bernstein et al., Nature, 409: 363-366 (2001); Nykanen et al., Cell, 107: 309-321 (2001); Gilmore et al., /. Drug Target., 12: 315-340 (2004); Reynolds et al., Nat. Biotechnol, 22: 326-330 (2004); Soutschek et al., Nature, 432173-178 (2004); Ralph et al., Nat. Med., 11: 429-433 (2005); Xia et al., Nat. Med., 10816-820 (2004) and Miller et al., Nucleic Acids Res., 32: 661-668 (2004)), aptamers (Ellington and Szostak, Nature, 346: 818-822 (1990); Doudna et al., Proc. Natl. Acad. ScL U.S.A., 92: 2355-2359 (1995); Tuerk and Gold, Science, 249: 505-510 (1990); White et al., MoL Ther., 4: 567-573 (2001); Rusconi et al., Nature, 419: 90-94 (2002); Nimjee et al., MoL Ther., 14: 408-415 (2006); Gragoudas et al., N. Engl. J. Med., 351: 3805-2816 (2004); Vinores, Curr. Opin. MoL Ther., 5673-679 (2003) and Kourlas and Schiller et al., CHn. Ther., 28: 36-AA (2006)) or decoy oligonucleotides (Morishita et al., Proc. Natl. Acad. ScL U.S.A., 92: 5855-5859 (1995); Alexander et al., /. Am. Med. Assoc, 294: 2446-2454 (2005); Mann and Dzau, /. Clin. Invest, 106: 1071-1075 (2000) and Nimjee et al., Annu. Rev. Med., 56: 555-583 (2005)). The foregoing documents are hereby incorporated by reference in their entirety herein, with particular emphasis on those sections of the documents relating to methods of designing, making and using inhibitory oligonucleotides. Commercial providers such as Ambion Inc. (Austin, TX), Darmacon Inc. (Lafayette, CO), InvivoGen (San Diego, CA), and Molecular Research Laboratories, LLC (Herndon, VA) generate custom siRNA molecules. In addition, commercial kits are available to produce custom siRNA molecules, such as SILENCER™ siRNA Construction Kit (Ambion Inc., Austin, TX) or psiRNA System (InvivoGen, San Diego, CA).
[0037] Inhibitory oligonucleotides which are stable, have a high resistance to nucleases, possess suitable pharmacokinetics to allow them to traffic to target tissue site at non-toxic doses, and have the ability to cross through plasma membranes are contemplated for use as a therapeutic. In some embodiments, inhibitory oligonucleotides are complementary to the coding portion of a target gene, 3' or 5' untranslated regions, or intronic sequences in a gene, or alternatively coding or intron sequences in the target mRNA. Intron sequences are generally less conserved and thus may provide greater specificity. In one embodiment, the inhibitory oligonucleotide inhibits expression of a gene product of one species but not its homologue in another species; in other embodiments, the inhibitory oligonucleotide inhibits expression of a gene in two species, e.g. human and primate, or human and murine.
[0038] The constitutive expression of antisense oligonucleotides in cells has been shown to inhibit gene expression, possibly via the blockage of translation or prevention of splicing. In certain embodiments, the inhibitory oligonucleotide is capable of hybridizing to at least 8, 9, 10, 11, or 12 consecutive bases of the hLuc7A, RBM25 and/or PERK genes or mRNA (or the reverse strand thereof) under moderate or high stringency conditions. In some embodiments, suitable inhibitory oligonucleotides are single stranded and contain a segment, e.g. at least 12, 13, 14, 15, 16, 17 or 18 bases in length, that is sufficiently complementary to, and specific for, an mRNA or DNA molecule such that it hybridizes to the mRNA or DNA molecule and inhibits transcription, splicing or translation. Generally complementarity over a length of less than 30 bases is more than sufficient.
[0039] Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 300C for short nucleic acids (e.g., 10 to 50 nucleotides) and at least about 600C for longer nucleic acids (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30% to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in IX to 2X SSC (2OX SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 500C to 55°C. Exemplary moderate stringency conditions include hybridization in 40% to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55°C to 600C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 600C to 65°C. Duration of hybridization is generally less than about 24 hours, usually about 4 hours to about 12 hours.
[0040] In some cases, depending on the length of the complementary region, one, two or more mismatches are tolerated without affecting inhibitory function. In certain embodiments, the inhibitory oligonucleotide is an antisense oligonucleotide, an inhibitory RNA (including siRNA or RNAi, or shRNA), a DNA enzyme, a ribozyme (optionally a hammerhead ribozyme), an aptamer, or pharmaceutically acceptable salts thereof. In one embodiment, the oligonucleotide targets the nucleotides located in the vicinity of the 3' untranslated region of the SCN5A mRNA. In one embodiment, the oligonucleotide is complementary to at least 10 bases of the hLuc7A mRNA sequence (Genbank Accession Nos. NM_006107 and NM_016424), the RBM25 mRNA sequence (Genbank Accession No.: NM_021239) or a PERK mRNA sequence (including, but not limited to, Genbank Accession Nos: NM_003094.2, NM_004320.3, NM_0173201.2, NM_203463.1, NM_006850.2, NM_003329.2, NM_181339.1, NM_006260.3, NG_016424.1, NM_004836.5, NMJ)Ol 122752.1, NM_005025.4, NM_033266.3, NM_032025.3, NM_005130.3, NM_001013703.2, BC126356.1 and BC126354.1).
[0041] The specific sequence utilized in design of the oligonucleotides may be any contiguous sequence of nucleotides contained within the expressed gene message of the target. The worker of ordinary skill in the art will readily appreciate sequences that can be targeted for inhibition based on the full-length hLuc7A (Genbank Accession Nos. NM_006107 and NM_016424), RBM25 (Genbank Accession No.: NM_021239) and PERK mRNA sequence (including, but not limited to, Genbank Accession Nos: NM_003094.2, NM_004320.3, NM_0173201.2, NM_203463.1, NM_006850.2, NM_003329.2, NM_181339.1, NM_006260.3, NG_016424.1, NM_004836.5, NM_001122752.1, NM_005025.4, NM_033266.3, NM_032025.3, NM_005130.3, NM_001013703.2, BC126356.1 and BC126354.1) sequences known in the art. Factors that govern a target site for the inhibitory oligonucleotide sequence include the length of the oligonucleotide, binding affinity, and accessibility of the target sequence. In some embodiments, sequences are screened in vitro for potency of their inhibitory activity by measuring inhibition of target protein translation and target related phenotype, e.g., inhibition of cell proliferation in cells in culture. In general it is known that most regions of the RNA (5' and 3' untranslated regions, AUG initiation, coding, splice junctions and introns) can be targeted using antisense oligonucleotides. Programs and algorithms, known in the art, may be used to select appropriate target sequences. In addition, optimal sequences may be selected utilizing programs designed to predict the secondary structure of a specified single stranded nucleic acid sequence and allowing selection of those sequences likely to occur in exposed single stranded regions of a folded mRNA. Methods and compositions for designing appropriate oligonucleotides may be found, for example, in U.S. Patent No. 6,251,588, the contents of which are incorporated herein by reference in its entirety.
[0042] Short interfering (si) RNA technology (also known as RNAi) generally involves degradation of an mRNA of a particular sequence induced by double-stranded RNA (dsRNA) that is homologous to that sequence, thereby "interfering" with expression of the corresponding gene. Any selected gene may be repressed by introducing a dsRNA which corresponds to all or a substantial part of the mRNA for that gene. It appears that when a long dsRNA is expressed, it is initially processed by a ribonuclease III into shorter dsRNA oligonucleotides of as few as 21 to 22 base pairs in length. Accordingly, siRNA may be affected by introduction or expression of relatively short homologous dsRNAs. Exemplary siRNAs have sense and antisense strands of about 21 nucleotides that form approximately 19 nucleotides of double stranded RNA with overhangs of two nucleotides at each 3' end. Indeed the use of relatively short homologous dsRNAs may have certain advantages.
[0043] The double stranded oligonucleotides used to effect RNAi are preferably less than 30 base pairs in length, for example, about 25, 24, 23, 22, 21, 20, 19, 18, or 17 base pairs or less in length, and contain a segment sufficiently complementary to the target mRNA to allow hybridization to the target mRNA. Optionally the dsRNA oligonucleotides may include 3' overhang ends. Exemplary 2-nucleotide 3' overhangs may be composed of ribonucleotide residues of any type and may even be composed of 2'-deoxythymidine resides, which lowers the cost of RNA synthesis and may enhance nuclease resistance of siRNAs in the cell culture medium and within transfected cells (see Elbashi et al., supra). Exemplary dsRNAs may be synthesized chemically or produced in vitro or in vivo using appropriate expression vectors (see, e.g., Elbashir et al., Genes Dev., i5:188-200 (2001)). Longer RNAs may be transcribed from promoters, such as T7 RNA polymerase promoters, known in the art.
[0044] Longer dsRNAs of 50, 75, 100, or even 500 base pairs or more also may be utilized in certain embodiments of the invention. Exemplary concentrations of dsRNAs for effecting RNAi are about 0.05 nM, 0.1 nM, 0.5 nM, 1.0 nM, 1.5 nM, 25 nM, or 100 nM, although other concentrations may be utilized depending upon the nature of the cells treated, the gene target and other factors readily discernable to the skilled artisan.
[0045] Further compositions, methods and applications of siRNA technology are provided in U.S. Patent Nos. 6,278,039; 5,723,750; and 5,244,805, which are incorporated herein by reference in its entirety.
[0046] shRNA may comprise sequences that were selected at random, or according to any rational design selection procedure. For example, rational design algorithms are described in International Patent Publication No. WO 2004/045543 and U.S. Patent Publication No. 20050255487, the disclosures of which are incorporated herein by reference in their entireties. Additionally, it may be desirable to select sequences in whole or in part based on average internal stability profiles ("AISPs") or regional internal stability profiles ("RISPs") that may facilitate access or processing by cellular machinery.
[0047] Ribozymes are enzymatic RNA molecules capable of catalyzing specific cleavage of mRNA, thus preventing translation. (For a review, see Rossi, Current Biology, 4:469-471 (1994)). The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage event. The ribozyme molecules preferably include (1) one or more sequences complementary to a target mRNA, and (2) the well known catalytic sequence responsible for mRNA cleavage or a functionally equivalent sequence (see, e.g., U.S. Patent No. 5,093,246, which is incorporated herein by reference in its entirety). [0048] Gene targeting ribozymes may contain a hybridizing region complementary to two regions of a target mRNA, each of which is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides (but which need not both be the same length).
[0049] Ribozymes for use in a method described herein also include RNA endoribonucleases ("Czech-type ribozymes") such as the one which occurs naturally in Tetrahymena thermophila (known as the IVS, or L- 19 IVS RNA) and which has been extensively described in Zaug et al., Science, 224:514-518 (1984); Zaug, et al., Science, 231-Λ1Q-A15 (1986); Zaug et al., Nature, 524:429-433 (1986); International Patent Publication No. WO 88/04300; and Been et al., Cell, 47:201-216 (1986)). The Cech-type ribozymes have an eight base pair active site which hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place. In one embodiment, the inventive method employs those Cech-type ribozymes which target eight base-pair active site sequences that are present in a target gene or nucleic acid sequence.
[0050] Alternatively, target gene expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the gene (i.e., the promoter and/or enhancers) to form triple helical structures that prevent transcription of the gene in target cells in the body. (See generally Helene, C, Anticancer Drug Des., 6:569-84 (1991); Helene et al., Ann. N.Y. Acad. ScL, 660:21-36 (1992); and Maher, L. J., Bioassays, 14:801-15 (1992)).
[0051] Alternatively, DNA enzymes may be used to inhibit expression of target gene, such as the sclerostin gene. DNA enzymes incorporate some of the mechanistic features of both antisense and ribozyme technologies. DNA enzymes are designed so that they recognize a particular target nucleic acid sequence, much like an antisense oligonucleotide. They are, however, also catalytic and specifically cleave the target nucleic acid.
[0052] DNA enzymes include two basic types identified by Santoro and Joyce (see, for example, U.S. Patent No. 6,110,462). The 10-23 DNA enzyme comprises a loop structure which connect two arms. The two arms provide specificity by recognizing the particular target nucleic acid sequence while the loop structure provides catalytic function under physiological conditions.
[0053] Methods of making and administering DNA enzymes can be found, for example, in U.S. Patent No. 6,110,462. Additionally, one of skill in the art will recognize that, like antisense oligonucleotide, DNA enzymes can be optionally modified to improve stability and improve resistance to degradation.
[0054] Inhibitory oligonucleotides can be administered directly or delivered to cells by transformation or transfection via a vector, including viral vectors or plasmids, into which has been placed DNA encoding the inhibitory oligonucleotide with the appropriate regulatory sequences, including a promoter, to result in expression of the inhibitory oligonucleotide in the desired cell. Known methods include standard transient transfection, stable transfection and delivery using viruses ranging from retroviruses to adenoviruses. Delivery of nucleic acid inhibitors by replicating or replication-deficient vectors is contemplated. Expression can also be driven by either constitutive or inducible promoter systems (Paddison et al., Methods MoL Biol, 265:85-100 (2004)). In other embodiments, expression may be under the control of tissue or development- specific promoters. For example, in one embodiment, the promoter sequence comprises a cardiac-specific or skeletal muscle-specific promoter.
[0055] For example, vectors may be introduced by transfection using carrier compositions such as Lipofectamine 2000 (Life Technologies) or Oligofectamine (Life Technologies). Transfection efficiency may be checked using fluorescence microscopy for mammalian cell lines after co-transfection of hGFP-encoding pAD3 (Kehlenback et al., /. Cell Biol, 141:863- 74 (1998)).
[0056] The delivery route will be the one that provides the best inhibitory effect as measured according to the criteria described above. Delivery mediated by cationic liposomes, delivery by retroviral vectors and direct delivery are efficient.
[0057] The effectiveness of the inhibitory oligonucleotide may be assessed by any of a number of assays, including reverse transcriptase polymerase chain reaction or Northern blot analysis to determine the level of existing SCN5A splice variants mRNA.
[0058] In another embodiment, the compound that inhibits the activity of hLuc7a, RBM25 and/or PERK is an antibody. The term "antibody" is used in the broadest sense and includes fully-assembled antibodies, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (including bispecific antibodies), chimeric antibodies, human antibodies, humanized antibodies, antibody fragments that can bind an antigen (including, Fab', F'(ab)2, Fv, single chain antibodies, diabodies), and recombinant peptides comprising the foregoing as long as they exhibit the desired biological activity. Multimers or aggregates of intact antibodies and/or fragments, including chemically derivatized antibodies, are contemplated. Antibodies of any isotype class or subclass, including IgG, IgM, IgD, IgA, and IgE, IgGl, IgG2, IgG3, IgG4, IgAl and Ig A2, or any allotype, are contemplated. Standard techniques are employed to generate polyclonal or monoclonal antibodies directed against hLuc7a, RBM25 and/or PERK and to generate useful antigen-binding fragments thereof or variants thereof. Such protocols can be found, for example, in Sambrook et al., Molecular Cloning: a Laboratory Manual. Second Edition, Cold Spring Harbor, N. Y.: Cold Spring Harbor Laboratory (1989); Harlow et al. (Eds), Antibodies A Laboratory Manual; Cold Spring Harbor Laboratory; Cold Spring Harbor, N. Y. (1988). Peptibodies are also contemplated. The term "peptibody" refers to a molecule comprising an antibody Fc domain attached to at least one peptide, which has specific binding properties. The production of peptibodies is generally described in PCT publication WO 00/24782, the disclosure of which is incorporated herein by reference.
[0059] Small molecules that inhibit the activity of hLuc7a, RBM25 and/or PERK are also contemplated. The small molecule, in some embodiments, is a compound that acts directly or indirectly on exon 28 of the SCN5A gene (without interfering with transcription of full- length SCN5A), hLuc7a, RBM25 and or PERK or that decreases the level of at least one of hypoxia and/or angiotensin II in vivo. The term "small molecule" includes a compound or molecular complex, either synthetic, naturally derived, or partially synthetic, and which preferably has a molecular weight of less than 5,000 Daltons (e.g., between about 100 and 1,500 Daltons). Agents can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound" library method, and synthetic library methods using affinity chromatography selection (see, e.g., Lam, Anticancer Drug Des., 12:145 (1997) and U.S. Patent Nos. 5,738,996; 5,807,683; and 7,261,892).
Assaying for modulators of the expression of abnormal SCN5A splice variants
[0060] Methods for identifying modulators of the expression of abnormal splice variants are also provided. In one aspect, described herein is a method of identifying a compound that inhibits expression of an abnormal SCN5A splice variant in a cell comprising the step of determining a level of a SCN5A splice variant in the cell in the presence and absence of a test compound, wherein a reduced level of the splice variant in the presence of the test compound compared to the level of the splice variant in the absence of the test compound identifies the test compound as an inhibitor of the expression of a SCN5A splice variant. Such screening techniques are useful in the general identification of a compound that will inhibit abnormal splicing of SCN5A in a cell, with such compounds being useful as therapeutic agents.
[0061] In another aspect, described herein is a method of identifying a compound that inhibits transcription of an abnormal SCN5A splice variant in a cell comprising the step of contacting the cell that comprises a SCN5A gene with a test compound in the presence and absence of a splicing factor selected from the group consisting of hLuc7a and RBM25, wherein the splicing factor binds to the SCN5A gene in the absence of the test compound, and determining the presence or absence of an abnormal splice variant in the cell, wherein the absence of the abnormal splice variant in the cell identifies the test compound as a compound that inhibits transcription of an abnormal splice variant.
[0062] In some embodiments, the abnormal SCNA splice variant is selected from the group consisting of E28B (SEQ ID NO: 7), E28C (SEQ ID NO: 8) and E28D (SEQ ID NO: 9).
[0063] In some embodiments, the test compound is an antisense oligonucleotide, an antibody or small molecule as described elsewhere herein.
[0064] The test compounds can be screened for their ability to promote splicing or inhibit splicing. RNA splicing can be detected by any of a variety of assays that detect the presence or absence of an exon in an RNA, including, without limitation, detection of protein domains encoded by particular exons (or introduced into particular exons) in translated proteins, electrophoretic separation and gel analysis of RNA or protein, polymerase chain reaction- based assays, Northern analysis or RNase protection using exon-specific probes, invasion cleavage assay (Eis et al. Nature Biotechnol. 19: 673-676 (2001), radionucleotide or fluorescently labeled nucleotide incorporation, etc.
Therapeutic Methods and Methods of Monitoring Efficacy of Treatment
[0065] Both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder associated with aberrant or unwanted target gene expression or activity (e.g., in exemplary embodiments, expression of abnormal SCN5A splice variants) is provided. "Treatment", or "treating" as used herein, means the application or administration of a therapeutic agent (e.g., an oligonucleotide, an antibody or a small molecule) or vector or transgene encoding same, etc.) to a subject or application or administration of a therapeutic agent to an isolated tissue (including, but not limited to, cardiac tissue) or cells (including, but not limited to, cardiac cells) from a subject, who has a disease or disorder, a symptom of disease or disorder or a predisposition toward a disease or disorder, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease or disorder, the symptoms of the disease or disorder, or the predisposition toward disease.
[0066] In one embodiment, a prophylactic method of treating arrhythmia in a subject is provided, the method comprising identifying the subject as being at risk for developing arrhythmia and administering to a subject at risk of arrhythmia a compound that inhibits the activity of hLuc7a, RBM25 and/or PERK in an amount effective to prevent arrhythmia. In some embodiment, the method alternatively comprises the step of identifying an individual at risk of arrhythmia. In some embodiments, the method comprises identifying a subject at risk for developing arrhythmia. In such embodiments, the identifying comprises screening for the presence of an abnormal SCN5A splice variant in a biological sample of the subject, wherein the presence of the abnormal splice variant identifies the subject as being at risk for developing arrhythmia. For example, the presence of one or more of the SCNA splice variants E28B (SEQ ID NO: 7), E28C (SEQ ID NO: 8) and/or E28D (SEQ ID NO: 9) identifies in the biological sample identifies the subject as being at risk for developing arrhythmia. The screening step, in some embodiments, comprises obtaining a biological sample from the subject and analyzing nucleic acid from the sample for the presence of an abnormal splice variant. As used herein, the term "arrhythmia," also known as "cardiac arrhythmia," refers to a heterogenous group of conditions affecting the electrical behavior of the heart, e.g., a heart beat that is too fast ("tachycardias"), too slow ("bradycardias") or of irregular pattern. It will be appreciated that arrhythmias may be classified based on their rate (normal, tachycardia, bradycardia), their mechanism (automaticity, re-entry, fibrillation), or by their site of origin (atrial, ventricular, junctional, or atrio-ventricular).
[0067] In some embodiments, the identifying step comprises determining a level of hLuc7a, RBM25 and/or PERK in a biological sample (e.g., white blood cell or cardiac tissue) of a subject, wherein an increase in the level of hLuc7a, RBM25 and/or PERK in the sample identifies the subject as being at risk for developing arrhythmia.
[0068] Methods are also provided wherein the biological sample is blood or cardiac tissue. In some embodiments, the biological sample is blood and white blood cells in the blood are analyzed for the presence of an abnormal SCN5A splice variant. [0069] Methods of treating arrhythmia in a subject is also provided. For example, in one embodiment, the method comprises administering an effective amount of a compound that that inhibits activity of splicing factor hLuc7a, splicing factor RBM25 and/or PERK to the subject.
[0070] In some embodiments, the subject is human. Practice of methods of the invention in other mammalian subjects, especially mammals that are conventionally used as models for demonstrating therapeutic efficacy in humans (e.g., primate, porcine, canine, or rabbit animals), is also contemplated. In some embodiments, the subject is suffering from a cardiac disorder, including but not limited to, heart failure, ischemia, myocardial infarction, congestive heart failure, arrhythmia, transplant rejection and the like. In one embodiment, the subject is suffering from heart failure. In another embodiment, the subject is suffering from arrhythmia.
[0071] Methods are also provided to monitor the efficacy of treatment. In such embodiments, the method comprises determining a level of hLuc7a, RBM25 and/or PERK in a biological sample (e.g., white blood cell or cardiac tissue) of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK. In such a method, a change in the level of hLuc7am RMB25 and/or PERK in the sample taken after treatment compared to the level of hLuc7am RMB25 and/or PERK in the sample taken before treatment indicates efficacy of the treatment. In some embodiments, a first biological sample is obtained from the subject to be treated prior to initiation of therapy or part way through a therapy regime. Alternatively, in some embodiments, a first biological sample is obtained from a subject known not to suffer from a condition being treated. In some embodiments, the second biological sample is obtained in a similar manner, but at a time following onset of therapy. The second biological sample, in some embodiments, is obtained at the completion of, or part way through therapy, provided that at least a portion of therapy takes place between the isolation of the first and second biological samples. A decrease in the level of hLuc7a, RBM25 and/or PERK in the second biological sample (e.g., post- treatment) compared to the level of hLuc7a, RBM25 and/or PERK in the first biological sample (e.g., prior to treatment or from an subject known not to suffer from the condition being treated) indicates a degree of effective therapy.
[0072] The level of abnormal SCN5A splice variants in a biological sample, in some embodiments, is analyzed in a similar manner to monitor efficacy of treatment, with a decrease in the level of abnormal SCN5A splice variants in the sample indicates effective therapy. In such embodiments, the method to monitor efficacy of treatment comprises determining a level of abnormal SCN5A splice variants in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK. In such a method, a change in the level of abnormal SCN5A splice variants in the sample taken after treatment compared to the level of abnormal SCN5A splice variant in the sample before treatment indicates efficacy of treatment. A decrease in the level of abnormal SCN5A splice variants in the second biological sample (e.g., post-treatment) compared to the level of abnormal SCN5A splice variants in the first biological sample (e.g., prior to treatment or from an individual known not to suffer from the condition being treated) indicates a degree of effective therapy.
[0073] Alternatively, the level of full-length SCN5A in a biological sample post-treatment is analyzed to monitor efficacy of treatment, with an increase in the level of full-length SCN5A in the sample indicates effective therapy. In such embodiments, the method to monitor efficacy of treatment comprises determining a level of full-length SCN5A in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK. In such a method, a change in the level of full- length SCN5A in the sample taken after treatment compared to the level of full-length SCN5A in the sample before treatment indicates efficacy of treatment. An increase in the level of full-length SCN5A in the second biological sample (e.g., post-treatment) compared to the level of full-length SCN5A in the first biological sample (e.g., prior to treatment or from an individual known not to suffer from the condition being treated) indicates a degree of effective therapy.
[0074] In yet another alternative, a level of hypoxia and/or angiotensin II in a biological sample post-treatment is analyzed to monitor efficacy of treatment, with a decrease in the level of hypoxia and/or angiotensin II in the sample indicates effective therapy. In such embodiments, the method to monitor efficacy of treatment comprises determining a level of hypoxia or angiotensin II in a biological sample of a subject before and after treatment with a compound that inhibits activity of hLuc7a, RBM25 and/or PERK. In such a method, a change in the level of hypoxia or angiotensin II in the sample taken after treatment compared to the level of hypoxia or angiotensin II in the sample before treatment indicates efficacy of treatment. A decrease in the level of hypoxia or angiotensin II in the second biological sample (e.g., post-treatment) compared to the level of hypoxia or angiotensin II in the first biological sample (e.g., prior to treatment or from an individual known not to suffer from the condition being treated) indicates a degree of effective therapy.
Combination Therapy
[0075] In some embodiments, the prophylactic and therapeutic methods described herein are used in combination with standard of care therapeutics of heart failure including, but not limited to, diuretics, inotropes, coronary vasodilators and beta blockers or conventional therapeutics of circulatory diseases such as hypertension (e.g. angiotensin converting enzyme (ACE) inhibitors, angiotensin receptor blockers (ARBs) and/or calcium channel blockers), either simultaneously or at different times. Diuretics are generally used for relief of congestive symptoms and help the kidneys rid the body of excess fluid, thereby reducing blood volume and the heart's workload. Diuretics can include, but are not limited to loop diuretics (e.g. furosemide, bumetanide); thiazide diuretics (e.g. hydrochlorothiazide, chlorthalidone, chlorthiazide); potassium-sparing diuretics (e.g. amiloride); spironolactone and eplerenone. Inotropes, such as a cardiac glycoside, a beta-adrenergic agonist or a phosphodiesterase inhibitor, strengthen the heart's pumping action in patients with low cardiac output; inotropes can include but are not limited to digoxin, dobutamine, milrinone, istaroxime, omecamtiv mecarbil. Vasodilators, cause the peripheral arteries to dilate, making it easier for blood to flow; examples of vasodilators include, but are not limited, nitroglycerin, nitorprusside, and neseritide. Activation of neurohormonal systems that include the renin-andiotensin-aldosterone system (RAAS) and the sympathetic nervous system also contribute to the pathophysiology of heart failure. Drugs that inhibit activation of RAAS fall into three major categories: ACE inhibitors (including but not limited to ramipril, enalapril, and captopril), ARBs (including but not limited to valsarten, candesarten, irbesarten and losarten), and aldosterone receptor blockers (e.g., spironolactone and eplerenone.) Beta blockers counter the effects of activation of the sympathetic nervous system and slow the heart rate by blocking the effects of adrenalin; beta blockers include, but are not limited to carvedilol, metoprolol, bisoprolol, atenolol, propranolol, timolol and bucindolol.
[0076] In various aspects, the compound that inhibits activity of hLuc7a, RBM25 and/or PERK and standard of care therapeutic are administered concurrently or sequentially. In embodiments where the compound that inhibits activity of hLuc7a, RBM25 and/or PERK and standard of care therapeutic are administered separately, one would generally ensure that a significant period of time did not expire between the times of each delivery, such that the compound and standard of care therapeutic(s) would still be able to exert an advantageously combined effect. In such instances, it is contemplated that both modalities would be administered within about 12-24 hours of each other. In some situations, it may be desirable to extend the time period for treatment significantly, from several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8). Repeated treatments with one or both agents is specifically contemplated.
Compositions and Formulations
[0077] Compositions for use in accordance with the present invention may be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of a therapeutic composition into preparations which can be used pharmaceutically. "Therapeutic compositions" or "therapeutic compound" as used herein refers to a composition comprising a therapeutic compound that inhibits activity of splicing factor hLuc7a, splicing factor RBM25 an/or PERK.
[0078] The therapeutic compound may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, carriers, diluents, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, U.S.: 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is herein incorporated by reference.
[0079] In embodiments where the therapeutic is an antisense compound, such antisense compound encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
[0080] The term "prodrug" indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE ((S acetyl-2-thioethyl) phosphate) derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published December 9, 1993 or in WO 94/26764 and U.S. 5,770,713 to Imbach et al.
[0081] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For oligonucleotides, preferred examples of pharmaceutically acceptable salts and their uses are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
[0082] Compositions comprising the therapeutic compound may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.
[0083] The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. [0084] The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
[0085] Pharmaceutical compositions useful in the present invention include, but are not limited to, solutions, emulsions, foams and liposome-, micelle-, or nanoparticle-containing formulations. The pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients, diluents, or other active or inactive ingredients. Emulsions and their uses are well known in the art and are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
[0086] Formulations useful in the present invention include liposomal formulations. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH sensitive or negatively charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells, and can be used to deliver compounds of the invention.
[0087] One of skill in the art will recognize that formulations are routinely designed according to their intended use, i.e. route of administration.
[0088] In some embodiments, the therapeutic composition is delivered to the subject via one or more routes of administration. The multiple administrations may be rendered simultaneously or may be administered over a period of several hours or days. Additional therapy may be administered on a period basis, for example, daily, weekly or monthly.
[0089] Techniques for formulation and administration of the therapeutic compositions of the instant application may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest edition. When applied to an individual active ingredient, administered alone, a therapeutically effective dose refers to that ingredient alone. When applied to a combination, a therapeutically effective dose refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
Dosing
[0090] The formulation of therapeutic compositions and their subsequent administration (dosing) is believed to be within the skill of those in the art, and determined, e.g., by dose- response, toxicity, and pharmacokinetic studies. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. .
[0091] The invention is further described in the following Examples. The Examples serve only to illustrate the invention and are not intended to limit the scope of the invention in any way.
EXAMPLES
[0092] Material and Methods
[0093] Microarray data analysis : Changes in splicing factor mRNA abundances were evaluated by microarray analysis comparing human HF to normal myocardium. The data was uploaded to GeneSifter using Batch Upload with the option to use Affymetrix probe IDs. The data was Iog2 transformed and quantile normalized. Statistically significant genes were identified by using an unpaired Student t test (p value < 0.05 and a 5% Benjamini and Hochberg false discovery rate correction). A range of fold change cut offs were used. Genes associated with RNA splicing were found under the biological process GO term "GO: 0008380 : RNA splicing". The significance of the observed number of genes associated with RNA splicing was determined using z scores.
[0094] Cell culture assays: Jurkat T cell clones E6.1 (ATCC, Manassas, VA) were cultured at 37°C and 5% CO2 in RPMI 1640 medium supplemented with 10% heat inactivated fetal calf serum, 4 mM glutamine, 75 units/mL streptomycin and 100 units/mL penicillin. WA09 (H9) human undifferentiated ESCs were obtained through the National Stem Cell Bank and maintained on irradiated mouse embryonic fibroblasts at 37°C with 5% CO2. The culture medium consisted of DMEM/F12 (Invitrogen, Carlsbad, CA) supplemented with 15% knockout serum, 1% non-essential amino acids, 1 mmol/L L-glutamine, 0.1 mmol/L β-mercaptoethanol, and basic fibroblast growth factor of 20 ng/mL. [0095] Real-Time PCR quantification: Total RNA was isolated from cultured cells using the Qiagen RNeasy Mini Kit (Valencia, CA). Total RNA from human ventricles was isolated using the RNeasy Lipid Tissue Mini Kit (Qiagen). Reverse transcription was carried out at 420C for 1 h with Powerscript reverse transcriptase (Roche). β-Actin was used as a reference when making quantitative comparison. The primers for target genes are listed in Table 1.
[0096] Table 1. Primers for target genes.
[0097] Transfection Assays: Fugene 6 reagents (Roche, Indianapolis, IN) were used for transfection assays. Transfection methods followed the manufacturer's instructions. siRNA for hLuc7A and RBM25 were purchased from Invitrogen. The expression plasmid pCDNA3.1-HA-RBM25 was kindly provided by Dr. Huang (Dana-Farber Cancer Institute, Harvard, Boston, MA). Details of the E28C and E28D expression vectors have been discussed previously.
[0098] Gel mobility shift assays: The biotinylated wild- type
(CAGCAGGCGGGCAGCGGCCU) and mutant (CAGCAGGUUAGAGGCGGCCU) RNA substrates (SEQ ID NOs: 32 and 33, respectively) were synthesized by Invitrogen. Binding of biotinylated RNA to RBM25 was achieved by incubating 0.2 nM RNA and variable amounts of protein for 30 min at 40C in 20 μL of binding buffer (10 mM Tris-HCl, 10 mM HEPES, 100 mM NaCl, 0.1% Triton X-100, 2 mM MgC12, 1.5 mM dithiothreitol (DTT) pH 7.5, 7% glycerol). For the competition assays, a molar excess of unlabeled competitor RNAs at various fold levels was added to the pre-incubated reaction mixture. Samples were fractionated in a native 5% polyacrylamide gel, transferred to Hybond-N+nylon membrane (Amersham Biosciences), and detected with a LightShift chemiluminescent electrophoretic mobility shift assay kit (Pierce) by following the manufacturer's protocol.
[0099] Western blot analysis: The Mini-PROTEAN® Tetra Electrophoresis System from BioRad was used for Western blot analysis. Anti-Navl.5 antibody, recognizing all channel variants, was provided by Dr. Peter Mohler (University of Iowa, Iowa City, IA). Anti- RBM25 antibody was provided by Dr. Huang (Dana-Farber Cancer Institute, Harvard, Boston, MA). Anti-PERK and hLuc7A antibodies were purchased from R&D Systems (Minneapolis, MN) and Millipore, (Billerica, MA).
[00100] Statistical Evaluations: All data are presented as means + SEM. Means were compared by using Student t tests. A probability value of p<0.05 was considered statistically significant.
Example 1 - Splicing factors hLuc7A and RMB 25 are associated with abnormal splicing of
SCN5A
[00101] To identify SCN5A candidate splicing factors, microarray analysis of human heart samples from patients with and withoutheart failure was undertaken to look at changes in mRNA splicing factor abundance. Heart samples from mice with (n=10) and without (n=10) heart failure served to help limit the candidate splicing factors, since mice do not show SCN5A variants in either condition.
[00102] The data were uploaded to GeneSifter using Batch Upload with the option to use Affymetrix probe IDs. The data were Iog2 transformed and quantile normalized. Statistically significant genes were identified by using an unpaired Student t test (p value < 0.05) and a 5% Benjamini and Hochberg false discovery rate (FDR) correction. A range of fold change cut offs was used. Genes associated with RNA splicing were found under the biological process GO term "GO: 0008380: RNA splicing". The significance of the observed number of genes associated with RNA splicing was determined using z scores. When known, binding sequences of upregulated factors were compared with the genomic sequence of SCN5A.
[00103] From this analysis using a 1.2-fold cutoff, 47 splicing factors were identified as upregulated in HF (Table T).
Table 2. A comprehensive list of splicing factors altered in human heart failure
Hypoxia related genes SF4, CROP, SYF2, TARDBP, SF1 , SFRS7, HNRPH3, PPIE, PRPF40A, PPIG, CDC5L, HNRNPC, PRPF31 , RBM25
Inflammation related C19orf29, SRRM1 , FRG1 , BAT1 , RBM39, PNN, IVNS1 ABP, genes RBM8A
Hormone level SF4, BAT1 , RBM8A, SNRPD3 changing related genes
Pressure overload RBM39, SNRPD3 related genes
Others ZNF638, PRP4, TSEN34, YTHDC1 , RBM22, TFIP11 , RNPS1 ,
SFPQ, WBP4, DHX35, SFRS11 , QKI, SFRS14, DGCR14, SFRS12, RY1 , SNW1 , NCBP2, SF3B1 , WBP11 , MPHOSPH10, HNRNPA1 , TRA2A, SFRS5
[00104] Most of the 47 identified splicing factors are regulated by hypoxia or inflammation, both conditions usually present in heart failure. In heart failure samples, hLuc7a and RBM25 were upregulated by 1.7 and 1.5 fold, respectively. The upregulation of splicing factors RBM25 and hLuc7A in human heart failure tissue was confirmed by RT- PCR. Compared to the normal heart tissue, the results indicated that the relative abundances of RBM25 and hLuc7A were increased by 109.5+4.8% and 57.2+3.5% in heart failure tissue respectively (p<0.05). mRNA findings were correlated with protein expression by Western blot. Compared to the control group (mixture of 4 normal heart tissue samples), Western blot analysis showed that RBM25 was increased by 56.9+7.5%, 54.8+7.1%, 49.2+6.2% and 53.5+6.9% in heart failure tissue samples 1-4, respectively (p<0.05). hLuc7A was increased by 67.4+7.8%, 53.6+6.7%, 65.7+7.4% and 61.1+7.3% in the same heart failure samples (p<0.05).
[00105] As stated above, these hLuc7a and RBM25 act together to mediate splicing of SCN5A and RBM25 binds target RNA (Zhou et al., MoI. Cell. Biol., 28:5924-5936, 2008). There was only one canonical RBM25 site in SCN5A, and it was in exon 28 near the E28C and E28D splice sites. hLuc7a was absent from mouse heart. Therefore, splicing factors hLuc7a and RBM25 were upregulated in heart failure, recognized a sequence in SCN5A near the abnormal splicing, and a component was missing in mouse, potentially explaining why mice do not show abnormal SCN5A splicing in heart failure. Thus, hLuc7a and RBM25 became favored candidate factors mediating abnormal SCN5A splicing in HF.
[00106] Next, we showed that RMB25 bound to the canonical sequence, CGGGCA, in SCN5A exon 28. Gel mobility shift assays were performed as described previously with modification (Shang et al., Am. J. Physiol. Cell. Physiol., 292:C886-95, 2007, the disclosure of which is incorporated herein by reference in its entirety.). The biotinylated wild-type (CAGCAGGCGGGCAGCGGCCU) and mutant (CAGCAGGUUAGAGGCGGCCU) RNA substrates (SEQ ID NOs: 32 and 33, respectively) were synthesized. Binding of biotinylated RNA to RBM25 was achieved by incubating 0.2 nM RNA and variable amounts of protein for 30 min at 40C in 20 μL binding buffer. For the competition assays, a molar excess of unlabeled competitor RNAs at various fold levels was added to the pre-incubated reaction mixture. Results showed RBM25 binding with the CGGGCA sequence. Specificity was confirmed by showing a lack of this binding to a mutated canonical binding sequence. RBM25 bound the wild-type SCN5A sequence in a concentration-dependent manner. Specificity was inferred from the inability of RBM25 to bind the mutant sequence and for unlabeled probe to compete with labeled probe for RBM25 binding. In summary, splicing factors hLuc7A and RBM25 are upregulated in human heart failurs and bind a sequence in the SCN5A exon 28, where pathological splicing occurs.
Example 2 - Ang-II and hypoxia regulate RBM25, hLuc7A, and SCN5A mRNA splicing.
[00107] Because AngII and hypoxia are common in heart failure, we investigated whether these two conditions could influence RBM25 and hLuc7A levels. Since only human white blood cells and cardiac cells express SCN5A and have demonstrated similar SCN5A mRNA splicing (Shang et al., Circ. Res., 101:1146-1154, 2007), Jurkat cells and H9 hESC- cardiomyocytes (CMs) were used for further testing. The Jurkat cells and H9 hESC-CMs were divided into three experiment groups: normoxia, hypoxia-treated (1% O2), and Ang II- treated (100 nmol/L). The cells were harvested from each experiment group at four time points (30 min, 24 h, 48 h, and 72 h), and total mRNA extracted. Results indicated that mRNA abundances of both RBM25 and hLuc7A were increased in both cell types. Under hypoxia-treated condition, the expressions of RBM25 and hLuc7A in Jurkat cells were increased by 53.7+5.1% and 487.5+8.2%, respectively (p<0.05), and the expressions of RBM25 and hLuc7A in ES cells were increased by 57.9+5.2% and 389.5+7.9%, respectively (p<0.05). Under Ang II-treated condition, the expressions of RBM25 and hLuc7A in Jurkat cells were increased by 50.8+4.9% and 187.3+7.9%, respectively (p<0.05), and the expressions of RBM25 and hLuc7A in ES cells were increased by 42.1+4.7% and 181.2+6.7%, respectively (p<0.05).
[00108] The upregulation of splicing factors RBM25 and hLuc7A in Jurkat cells was further confirmed by Western blot. The Jurkat cells were divided into three experiment groups: normoxia, hypoxia-treated (1% O2), and Ang II-treated (100 nmol/L). The expressions of RBM25 and hLuc7A were analyzed by Western blot at three time points (12 h, 24 h, and 48 h) for hypoxia-treated group and at four time points (24 h, 48 h, 72 h, and 96 h) for Ang II-treated group. Compared to the control group, Western blot analysis showed that the density of RBM25 was increased by 188.4+8.6%, 196.5+8.9% and 147.7+8.1% in hypoxia- treated group at time points 12 h, 24 h and 48 h, respectively, and was increased by 209.5+8.8%, 212.6+9.7%, 181.3+8.3% and 198.8+8.7% in the Ang II-treated group at time points 24 h, 48 h, 72 h and 96 h, respectively (p<0.05). The density of hLuc7A was increased by 242.3+9.5%, 236.1+8.4% and 268.8+9.8% in hypoxia-treated group at time points 12 h, 24 h and 48 h, respectively, and was increased by 256.3+9.1%, 246.5+8.6%, 279.7+9.3% and 283.6+9.9% in Ang II-treated group at time points 24 h, 48 h, 72 h and 96 h, respectively (p<0.05).
[00109] Changes in hLuc7A and RBM25 correlated with SCN5A E28C and E28D variant abundances. Under hypoxia, the expression of SCN5A variants E28C and E28D were increased by 373.5+5.7% and 636.2+7.6%, respectively (p<0.05), while the expressions of the full length SCN5A transcript was decreased by 64.6+4.9% (p<0.05). With Ang II treatment, the expressions of the variants were increased by 291.4+5.2% and 433.7+6.5% for E28C and E28D, respectively (p<0.05), while the expression of the full length SCN5A transcipt was decreased by 78.9+5.4% (p<0.05).
[00110] In order to show that the increase in RBM25 and hLuc7A mediated the abnormal SCN5A mRNA splicing, RBM25 and hLuc7A expression was suppressed with siRNA. siRNA for the two splicing factors were found to partially reverse the expressions of the induced SCN5A variants E28C and E28D at 48 h. The siRNA knockdown efficiency was estimated by both RT-PCR and Western blot and was not less than 50%. The expressions of SCN5A and the variants E28C and E28D were measured by RT-PCR in all experiment groups at time points of maximal siRNA effect.
Example 3 — SCN5A variants activate the unfolded protein response
[00111] Previously, we have shown that SCN5A splicing variants have a dominant negative effect on Na+ current (Shang et al., Circ. Res., 101:1146-1154, 2007). Since the Na+ channel is encoded by a single mRNA, it is unclear how truncated forms might have a dominant negative effect on full-length channel production. The following Example investigated whether truncated SCN5A variant activate the unfolded protein response (UPR) pathway.
[00112] Hypoxia and AngII were used to increase abnormal SCN5A splicing. The expressions of PERK and sXBPl were measured by RT-PCR. The expression of PERK was increased at 48 h by 18.6+0.8 fold (p<0.05) and 14.2+0.6 fold (p<0.05) under hypoxia-treated and Ang II-treated conditions respectively, while no expression upregulation of sXBPl was observed. To test if this upregulation of one arm of the UPR was mediated by SCN5A mRNA variants, exogenous E28C and E28D were introduced. The Jurkat cells were divided into four experiment groups: normal control, empty vector control, variant E28C overexpressioned cells, and variant E28D overexpressioned cells. The expression of PERK was measures by RT-PCR in each group at the time point 48 h. Results indicated that the expression of PERK was increased by 6.3+0.4 (p<0.05) fold and 7.9+0.5 fold (p<0.05) when the variants E28C or E28D were overexpressed. The upregulation of PERK in Jurkat cells was further confirmed by Western blot. Compared to the control group, Western blot analysis showed that the density of PERK was increased by 437.9+11.2%, 383.2+10.7% under hypoxia-treated and Ang II-treated conditions respectively (p<0.05), and was increased by 262.6+9.6% and 359.5+10.1% in cells overexpressing variants E28C or E28D respectively (p<0.05). Furthermore, siRNA against PERK partially reversed the downregulation of full- length SCN5A expression after hypoxia or Ang II treatment. siRNA knockdown efficiency not less than 50%.
[00113] Discussion:
[00114] In order to explore the mechanism on downregulation of SCN5A full-length Na+ channel, the correlation of expression changes between UPR components and full-length Na+ channel as well as SCN5A variants is analyzed in the following. The UPR is a series of interrelated signaling pathways that occur when the ER experiences excess secretory load, accumulates misfolded proteins, or is subject to other pathological conditions. The UPR acts on several levels: it rapidly attenuates general protein synthesis, induces the expression of ER chaperone proteins, and enhances the degradation of misfolded proteins. These changes are presumably designed to restore protein folding and ER health. Nevertheless, prolonged activation of the UPR leads to apoptosis and has been implicated in the death of beta cells in type II diabetes mellitus. There appear to be three main sensor proteins that activate UPR. These transmembrane ER proteins are: protein kinase R-like ER kinase (PERK), inositol- requiring protein 1 (IREl), and activating transcription factor 6 (ATF-6). It is reported that activated ATF-6 will in turn induce the downstream molecule sXBPl. While activated by endoribonuclease domain, IREl splices a 26 nucleotide fragment out of the XBPl mRNA and generates sXBPl (frame-shift splice variant of XBPl). Therefore, the increase of sXBPl in cells can be used as an indicator for the activation of ATF6 or IREl. In this work, sXBPl was observed as an indicator for UPR mediated by both ATF6 and IREl.
[00115] Data demonstrated herein demonstrate that the downregulation of the full-length Na+ channel and the upregulation of SCN5A variants E28C and E28D correlate with the increase of PERK induced by hypoxia or Ang II. However, siRNA PERK can partially reverse the downregulation of SCN5A full-length Na+ channel. Additionally, exogenous SCN5A variants E28C and E28D are introduced with E28C or E28D constructs. The results show that SCN5A variant E28C or E28D alone could induce the expression level of PERK. The corresponding expression changes of PERK, SCN5A and the variants E28C and E28D are similar between the endogenous SCN5A variants induced by hypoxia or Ang II and the exogenous SCN5A variants. This manifests that PERK is involved in the SCN5A downregulation mediated by SCN5A variants E28C and E28D. The results also demonstrate that SCN5A is downregulated in UPR-activated cells despite the sXBPl inhibition. Negative results of sXBPl may exclude the possibility that other two arms of UPR are involved in this downregulation. Therefore, PERK-mediated UPR is most likely to be the major pathway involved in the downregulation of full-length Na+ channel.
[00116] In the heart tissues, the UPR has been shown to play a role during development, hypertrophy, ischemia, and heart failure. Heart failure is associated with hypoxia, elevated Ang II, and increased catecholamines, all of which have been shown to activate the UPR.
[00117] Thus, the inhibition of UPR through PERK is an attractive target for heart failure therapy.
[00118] Numerous modifications and variations in the practice of the invention are expected to occur to those of skill in the art upon consideration of the presently preferred embodiments thereof. Consequently, the only limitations which should be placed upon the scope of the invention are those which appear in the appended claims.
[00119] All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet, are incorporated herein by reference, in their entirety.
[00120] From the foregoing it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention.

Claims

What is claimed is:
1. A method of inhibiting downregulation of voltage-gated sodium channel (SCN5a) gene in a cell comprising contacting the cell with a compound that inhibits activity of splicing factor hLuc7a, splicing factor RBM25 and/or protein kinase R-like ER kinase (PERK) in an amount effective to inhibit downregulation of the SCN5a gene.
2. The method of claim 1 which is an in vivo method.
3. The method of claim 2 which inhibits or reverses an effect of hypoxia or angiotensin II.
4. The method of claim 1, wherein downregulation of splicing factor hLuc7A or splicing factor RBM25 downregulates expression of abnormal SCN5a splice variants.
5. The method of claim 1, wherein downregulation of PERK upregulates expression of full-length SCN5a.
6. The method of claim 1, 2, or 3 which reduces splicing factor interaction with regulatory sequence CGGGCA in a genomic polynucleotide encoding
SCN5a.
7. The method of any one of claims 1-6, wherein the cell is a blood cell, a muscle cell or a neuron.
8. The method of claim 7, wherein the cell is a leukocyte, a macrophage, or a cardiac cell.
9. The method of any one of claims 2-8, wherein the compound is administered to an individual at risk of or suffering from arrhythmia.
10. The method of any one of claims 2-9, wherein the compound is administered to an individual at risk of heart failure.
11. A method of identifying a subject at risk for arrhythmia or heart failure comprising the step of determining a level of splicing factor hLuc7a, splicing factor RBM25 and/or PERKin a biological sample from the subject, wherein an increased level of hLuc7a, RBM25 and/or PERK in the sample compared to a comparable sample from an individual known not to be at risk for arrhythmia or heart failure indicates a risk for arrhythmia or heart failure.
12. The method of claim 11, wherein the biological sample is selected from the group consisting of blood and muscle tissue.
13. The method of claim 11 or 12 wherein the biological sample is cardiac muscle tissue.
PCT/US2010/034271 2009-05-08 2010-05-10 Drug targets for prevention of arrhythmia in heart disease Ceased WO2010129964A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/291,826 US20120129179A1 (en) 2009-05-08 2011-11-08 Scn5a splicing factors and splice variants for use in diagnostic and prognostic methods

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US17666509P 2009-05-08 2009-05-08
US61/176,665 2009-05-08
US25391609P 2009-10-22 2009-10-22
US61/253,916 2009-10-22

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/291,826 Continuation-In-Part US20120129179A1 (en) 2009-05-08 2011-11-08 Scn5a splicing factors and splice variants for use in diagnostic and prognostic methods

Publications (1)

Publication Number Publication Date
WO2010129964A1 true WO2010129964A1 (en) 2010-11-11

Family

ID=42338050

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/034271 Ceased WO2010129964A1 (en) 2009-05-08 2010-05-10 Drug targets for prevention of arrhythmia in heart disease

Country Status (1)

Country Link
WO (1) WO2010129964A1 (en)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8003324B2 (en) 2007-10-18 2011-08-23 U.S. Department Of Veterans Affairs Modulation of sodium channels by nicotinamide adenine dinucleotide
WO2012158123A1 (en) * 2011-05-13 2012-11-22 Agency For Science, Technology And Research Compounds and methods for treating insulin resistance syndrome
US8598156B2 (en) 2010-03-25 2013-12-03 Glaxosmithkline Llc Chemical compounds
WO2014152364A2 (en) 2013-03-15 2014-09-25 The Board Of Trustees Of The University Of Illinois Methods for detecting brugada syndrome
WO2015021376A1 (en) 2013-08-08 2015-02-12 Onyx Therapeutics, Inc. Immunoglobulin expression levels as biomarker for proteasome inhibitor response
US9050350B2 (en) 2007-10-18 2015-06-09 U.S. Department Of Veterans Affairs Method for modulating or controlling connexin 43(Cx43) level of a cell and reducing arrhythmic risk
US9114151B2 (en) 2007-10-18 2015-08-25 The United States Of America Dept. Of Veterans Affairs Method for modulating or controlling sodium channel current by reactive oxygen species (ROS) originating from mitochondria
US9211301B2 (en) 2007-10-18 2015-12-15 U.S. Department Of Veterans Affairs Method for ameliorating or preventing arrhythmic risk associated with cardiomyopathy by improving conduction velocity
US9220720B2 (en) 2007-10-18 2015-12-29 U.S. Department Of Veterans Affairs Method for ameliorating or preventing arrhythmic risk associated with cardiomyopathy
WO2017077391A2 (en) 2015-11-04 2017-05-11 Astrazeneca Ab Dipeptidyl peptidase-4 and periostin as predictors of clinical response to eosinophil-targeted therapeutic agents in eosinophilic diseases
WO2017112536A1 (en) 2015-12-22 2017-06-29 Amgen Inc. Ccl20 as a predictor of clinical response to il23-antagonists
US11016099B2 (en) 2015-09-17 2021-05-25 Amgen Inc. Prediction of clinical response to IL23-antagonists using IL23 pathway biomarkers

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060246484A1 (en) * 2005-03-10 2006-11-02 Hare Joshua M Identification of gene expression by heart failure etiology
WO2008102906A1 (en) * 2007-02-20 2008-08-28 Oncotherapy Science, Inc. Hspc-hrpc transition genes
US20090087436A1 (en) * 2001-07-13 2009-04-02 Myriad Genetics, Incorporated Compositions and methods for treating diseases

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090087436A1 (en) * 2001-07-13 2009-04-02 Myriad Genetics, Incorporated Compositions and methods for treating diseases
US20060246484A1 (en) * 2005-03-10 2006-11-02 Hare Joshua M Identification of gene expression by heart failure etiology
WO2008102906A1 (en) * 2007-02-20 2008-08-28 Oncotherapy Science, Inc. Hspc-hrpc transition genes

Non-Patent Citations (73)

* Cited by examiner, † Cited by third party
Title
ALEXANDER ET AL., J. AM. MED. ASSOC., vol. 294, 2005, pages 2446 - 2454
BAKER ET AL., J. BIOL. CHEM., vol. 272, 1997, pages 11994 - 12000
BEEN ET AL., CELL, vol. 47, 1986, pages 207 - 216
BERNSTEIN ET AL., NATURE, vol. 409, 2001, pages 363 - 366
BREAKER; JOYCE, CHEM. BIOL., vol. 1, 1994, pages 223 - 229
CHARLET, MOL. CELL, vol. 10, 2002, pages 45 - 53
CROOKE, METHODS ENZYMOL., vol. 313, 2000, pages 3 - 45
CULLEN, NAT. IMMUNOL., vol. 3, 2002, pages 597 - 599
DOUDNA ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 92, 1995, pages 2355 - 2359
ECKSTEIN, ANTISENSE NUCLEIC ACID DRUG DEV., vol. 10, 2000, pages 117 - 121
EIS ET AL., NATURE BIOTECHNOL., vol. 19, 2001, pages 673 - 676
ELBASHIR ET AL., GENES DEV., vol. 15, 2001, pages 188 - 200
ELLINGTON; SZOSTAK, NATURE, vol. 346, 1990, pages 818 - 822
FIRE ET AL., NATURE, vol. 391, 1998, pages 806 - 811
FRANCOIS ET AL., NUCLEIC ACIDS RES., vol. 16, 1988, pages 11431 - 11440
GAO GE ET AL: "A Possible Mechanism of Reduced Sodium Current in Human Heart Failure", CIRCULATION, vol. 120, no. 18, Suppl. 2, ABS.2812, November 2009 (2009-11-01), & 82ND SCIENTIFIC SESSION OF THE AMERICAN-HEART-ASSOCIATION; ORLANDO, FL, USA; NOVEMBER 14 -18, 2009, XP002594090, ISSN: 0009-7322 *
GELLENS ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 89, 1992, pages 554 - 558
GEORGE ET AL., CYTOGENET. CELL GENET., vol. 68, 1995, pages 67 - 70
GILMORE ET AL., J. DRUG TARGET., vol. 12, 2004, pages 315 - 340
GLEAVE; MONIA, NAT. REV. CANCER, vol. 5, 2005, pages 468 - 479
GLEMBOTSKI ET AL: "The role of the unfolded protein response in the heart", JOURNAL OF MOLECULAR AND CELLULAR CARDIOLOGY, ACADEMIC PRESS, GB LNKD- DOI:10.1016/J.YJMCC.2007.10.017, vol. 44, no. 3, 3 December 2007 (2007-12-03), pages 453 - 459, XP022524889, ISSN: 0022-2828 *
GRAGOUDAS ET AL., N. ENGL. J. MED., vol. 351, 2004, pages 3805 - 2816
GUVAKOVA ET AL., J. BIOL. CHEM., vol. 270, 1995, pages 2620 - 2627
HANNON, NATURE, vol. 418, 2002, pages 244 - 251
HELENE ET AL., ANN. N.Y. ACAD. SCI., vol. 660, 1992, pages 27 - 36
HELENE, C., ANTICANCER DRUG DES., vol. 6, 1991, pages 569 - 84
KEHLENBACK ET AL., J. CELL BIOL., vol. 141, 1998, pages 863 - 74
KHACHIGIAN, BIOCHEM. PHARMACOI., vol. 68, 2004, pages 1023 - 1025
KHACHIGIAN, CURR. PHARM. BIOTECHNOL., vol. 5, 2004, pages 337 - 339
KOURLAS; SCHILLER ET AL., CLIN. THER., vol. 28, 2006, pages 36 - 44
KRUGER ET AL., TETRAHYMENA. CELL, vol. 31, 1982, pages 147 - 157
KUMAR ET AL., GENE THER., vol. 12, 2005, pages 1486 - 1493
KURRECK, EUR. J. BIOCHEM., vol. 270, 2003, pages 1628 - 1644
LOPEZ, ANN. REV. GENET., vol. 32, 1998, pages 279 - 305
MAHER, L. J., BIOASSAYS, vol. 14, 1992, pages 807 - 15
MANN; DZAU, J. CLIN. INVEST., vol. 106, 2000, pages 1071 - 1075
MANOHARAN, BIOCHIM. BIOPHYS. ACTA, vol. 1489, 1999, pages 117 - 130
MARWICK, J. AM. MED. ASSOC., vol. 280, 1998, pages 871
MILLER ET AL., NUCLEIC ACIDS RES., vol. 32, 2004, pages 661 - 668
MONTGOMERY ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 95, 1998, pages 15502 - 15507
MONTIE ET AL: "PERK is activated differentially in peripheral organs following cardiac arrest and resuscitation", RESUSCITATION, ELSEVIER, IE LNKD- DOI:10.1016/J.RESUSCITATION.2005.03.014, vol. 66, no. 3, 30 August 2005 (2005-08-30), pages 379 - 389, XP022231795, ISSN: 0300-9572 *
MORISHITA ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 92, 1995, pages 5855 - 5859
MOSER; DERVAN, SCIENCE, vol. 238, 1987, pages 645 - 650
NIMJEE ET AL., ANNU. REV. MED., vol. 56, 2005, pages 555 - 583
NIMJEE ET AL., MOL. THER., vol. 14, 2006, pages 408 - 415
NYKANEN ET AL., CELL, vol. 107, 2001, pages 309 - 321
PADDISON ET AL., METHODS MOL. BIOL., vol. 265, 2004, pages 85 - 100
PATIL, AAPS J., vol. 7, 2005, pages E61 - E77
RALPH ET AL., NAT. MED., vol. 11, 2005, pages 429 - 433
REYNOLDS ET AL., NAT. BIOTECHNOL., vol. 22, 2004, pages 326 - 330
ROSSI, CURRENT BIOLOGY, vol. 4, 1994, pages 469 - 471
RUSCONI ET AL., NATURE, vol. 419, 2002, pages 90 - 94
SCHOTT ET AL., NAT. GENET., vol. 23, 1999, pages 20 - 21
SHANG ET AL., AM. J. PHYSIOL. CELL. PHYSIOL., vol. 292, 2007, pages C886 - 95
SHANG ET AL., CIRC. RES., vol. 101, 2007, pages 1146 - 1154
SIERAKOWSKA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 12840 - 12844
SIGURDSSON; ECKSTEIN, TRENDS BIOTECHNOL., vol. 13, 1995, pages 286 - 289
SOUTSCHEK ET AL., NATURE, 2004, pages 432173 - 178
THOMAS JEFF D ET AL: "Translational repression during chronic hypoxia is dependent on glucose levels.", RNA (NEW YORK, N.Y.) APR 2008 LNKD- PUBMED:18268023, vol. 14, no. 4, April 2008 (2008-04-01), pages 771 - 781, XP002594092, ISSN: 1469-9001 *
TOMITA; MORISHITA, CURR. PHARM. DES., vol. 10, 2004, pages 797 - 803
TRULZSCH; WOOD, J. NEUROCHEM., vol. 88, 2004, pages 257 - 265
TUERK; GOLD, SCIENCE, vol. 249, 1990, pages 505 - 510
UHLENBECK, NATURE, vol. 328, 1987, pages 596 - 600
USUI SOICHIRO ET AL: "Mst1 Promotes Cardiac Myocyte Apoptosis through PERK-Mediated Stimulation of the Unfolded Protein Response", CIRCULATION, vol. 118, no. 18, Suppl. 2, October 2008 (2008-10-01), & 81ST ANNUAL SCIENTIFIC SESSION OF THE AMERICAN-HEART-ASSOCIATION; NEW ORLEANS, LA, USA; NOVEMBER 08 -12, 2008, pages S273, XP002594093, ISSN: 0009-7322 *
VINORES, CURR. OPIN. MOL. THER., 2003, pages 5673 - 679
WANG ET AL., GENOMICS, vol. 34, 1996, pages 9 - 16
WHITE ET AL., MOL. 1HER., vol. 4, 2001, pages 567 - 573
XIA ET AL., NAT. MED., 2004, pages 10816 - 820
ZAUG ET AL., NATURE, vol. 324, 1986, pages 429 - 433
ZAUG ET AL., SCIENCE, vol. 224, 1984, pages 574 - 578
ZAUG ET AL., SCIENCE, vol. 231, 1986, pages 470 - 475
ZHOU ANYU ET AL: "Novel splicing factor RBM25 modulates Bcl-x pre-mRNA 5 ' splice site selection", MOLECULAR AND CELLULAR BIOLOGY, vol. 28, no. 19, October 2008 (2008-10-01), pages 5924 - 5936, XP002594091, ISSN: 0270-7306 *
ZHOU ET AL., MOL. CELL. BIOL., vol. 28, 2008, pages 5924 - 5936

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9211301B2 (en) 2007-10-18 2015-12-15 U.S. Department Of Veterans Affairs Method for ameliorating or preventing arrhythmic risk associated with cardiomyopathy by improving conduction velocity
US8003324B2 (en) 2007-10-18 2011-08-23 U.S. Department Of Veterans Affairs Modulation of sodium channels by nicotinamide adenine dinucleotide
US9220720B2 (en) 2007-10-18 2015-12-29 U.S. Department Of Veterans Affairs Method for ameliorating or preventing arrhythmic risk associated with cardiomyopathy
US9050350B2 (en) 2007-10-18 2015-06-09 U.S. Department Of Veterans Affairs Method for modulating or controlling connexin 43(Cx43) level of a cell and reducing arrhythmic risk
US9114151B2 (en) 2007-10-18 2015-08-25 The United States Of America Dept. Of Veterans Affairs Method for modulating or controlling sodium channel current by reactive oxygen species (ROS) originating from mitochondria
US8598156B2 (en) 2010-03-25 2013-12-03 Glaxosmithkline Llc Chemical compounds
WO2012158123A1 (en) * 2011-05-13 2012-11-22 Agency For Science, Technology And Research Compounds and methods for treating insulin resistance syndrome
WO2014152364A2 (en) 2013-03-15 2014-09-25 The Board Of Trustees Of The University Of Illinois Methods for detecting brugada syndrome
WO2015021376A1 (en) 2013-08-08 2015-02-12 Onyx Therapeutics, Inc. Immunoglobulin expression levels as biomarker for proteasome inhibitor response
US11016099B2 (en) 2015-09-17 2021-05-25 Amgen Inc. Prediction of clinical response to IL23-antagonists using IL23 pathway biomarkers
WO2017077391A2 (en) 2015-11-04 2017-05-11 Astrazeneca Ab Dipeptidyl peptidase-4 and periostin as predictors of clinical response to eosinophil-targeted therapeutic agents in eosinophilic diseases
WO2017112536A1 (en) 2015-12-22 2017-06-29 Amgen Inc. Ccl20 as a predictor of clinical response to il23-antagonists
US11220541B2 (en) 2015-12-22 2022-01-11 Amgen Inc. CCL20 as a predictor of clinical response to IL23-antagonists

Similar Documents

Publication Publication Date Title
Hu et al. Knockdown of lncRNA MALAT1 attenuates acute myocardial infarction through miR-320-Pten axis
Miyauchi et al. Upregulated IL-18 expression in type 2 diabetic subjects with nephropathy: TGF-β1 enhanced IL-18 expression in human renal proximal tubular epithelial cells
US20160025745A1 (en) Methods of diagnosing and treating fibrosis
AU2014336070B2 (en) Dynamin 2 inhibitor for the treatment of centronuclear myopathies
US20080014191A1 (en) Treatment of Protein Misfolding
Deng et al. DNA methyltransferase 1 (DNMT1) suppresses mitophagy and aggravates heart failure via the microRNA-152-3p/ETS1/RhoH axis
US10280422B2 (en) MiR-92 inhibitors and uses thereof
US8877188B2 (en) Detection and treatment of non-dermal fibrosis
EP2566967B1 (en) Cadherin-11 antagonist for the treatment of fibrosis
JP2025023319A (en) Compositions and methods for treating and preventing amyotrophic lateral sclerosis
US20120129179A1 (en) Scn5a splicing factors and splice variants for use in diagnostic and prognostic methods
Huang et al. MiR-520h inhibits viability and facilitates apoptosis of KGN cells through modulating IL6R and the JAK/STAT pathway
KR20160130986A (en) Asymmetric interfering rna compositions that silence k-ras and methods of uses thereof
EP3030657B1 (en) Ligase e3 rnf185 inhibitors and uses thereof
US8580758B2 (en) Method of inhibiting cancer cell proliferation, proliferation inhibitor and screening method
WO2014082993A2 (en) Molecular targets and compounds, and methods to identify the same, useful in the down-regulation of the th2 response
EP2502069B1 (en) Compounds inhibiting cd95 signaling for the treatment of pancreatic cancer
US20240299347A1 (en) Methods and compositions to treat huntington&#39;s disease by targeting alox5- mediated ferroptosis
WO2020002691A1 (en) TREATMENT OF CARDIOMYOPATHY THROUGH MODULATION OF HYPOXIA-INDUCED eRNA ACTIVITY
WO2024033467A2 (en) Allele specific sirna therapy for dynamin 2-related diseases
WO2014095916A1 (en) Ninjurin-1 as therapeutic target for brain tumor
Moester et al. SOST and Rank expression
WO2019138237A1 (en) A micro rna as a marker of a disease that may be associated with ageing
HK1183322B (en) Cadherin-11 antagonist for the treatment of fibrosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10718814

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10718814

Country of ref document: EP

Kind code of ref document: A1