WO2010126771A1 - Systems, kits and methods of identifying ocular fungal and amoebic pathogens - Google Patents
Systems, kits and methods of identifying ocular fungal and amoebic pathogens Download PDFInfo
- Publication number
- WO2010126771A1 WO2010126771A1 PCT/US2010/032030 US2010032030W WO2010126771A1 WO 2010126771 A1 WO2010126771 A1 WO 2010126771A1 US 2010032030 W US2010032030 W US 2010032030W WO 2010126771 A1 WO2010126771 A1 WO 2010126771A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- species
- specific
- probes
- seq
- cluster
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Definitions
- the invention relates generally to the fields of medicine, genetics, and microbiology. More particularly, the invention relates to compositions, kits and methods for detecting one or more particular species of ocular fungal or amoebic pathogen in a biological sample.
- Described herein are systems, kits, and methods for identification and detection of ocular pathogens including, but not limited to, Candidas spp, Fusarium spp and Acanthamoebas species, in a sample.
- ocular pathogens including, but not limited to, Candidas spp, Fusarium spp and Acanthamoebas species
- Group- specific and species-specific probes for the detection of ocular medically important pathogenic species within the genus of Acanlhamoeba, Fusarium and Candida were tested and validated that allow discrimination of a 1 base pair mismatch.
- the systems, kits, and methods described herein include culture-based and nonculture-based ocular pathogenic fungal/protist detection systems for the detection of species in clinical specimens. The sequences in a multiplex and high-throughput format.
- LuminexTM technology was used for the detection of species in clinical specimens and in a 96 well plate, provided for detection of 1-10 conidias per sample (Fusarium) and 10 amoebas per sample.
- the systems, devices and methods described herein have a sensitivity of as few as 1-10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11) fungi per sample, and as few as 10 (e.g., 9, 10, 11) amoebas per sample.
- the systems, devices and methods described herein can be used for the design and validation of species- specific and cluster probes that can be used to identify any clinically important ocular pathogens in addition to those above, including for example, Acremonium, Colletolr ⁇ chum Curvnlar ⁇ a, Lasiodiplodia and Paecilomyces, and they provide a detection capability to identify in a fast and efficient manner the etiological agents that cause ophthalmic mycoses and keratitis. When performed in a 96 well plate format, for example, up to 100 species per well can be detected (identified).
- the methods, kits and systems described herein also include a comprehensive suspension array that can be used as standard routine screening methods in clinics.
- the systems, kits, probes and methods described herein provide for improved medical care by allowing early intervention and reducing surgical intervention and potential visual loss associated with ocular diseases.
- a precise and fast identification system will benefit the medical community and patients since it will ease diagnosis and therefore medical treatment regimens can be quickly adopted.
- nucleic acid or a “nucleic acid molecule” means a chain of two or more nucleotides such as RNA (ribonucleic acid) and DNA (deoxyribonucleic acid), and chemically-modified nucleotides.
- a "purified" nucleic acid molecule is one that is substantially separated from other nucleic acid sequences in a cell or organism in which the nucleic acid naturally occurs (e.g., 30, 40, 50, 60, 70, 80, 90, 95, 96, 97, 98, 99, 100% free of contaminants).
- the terms include, e.g., a recombinant nucleic acid molecule incorporated into a vector, a plasmid, a virus, or a genome of a prokaryote or eukaryote.
- purified nucleic acids include cDNAs, fragments of genomic nucleic acids, nucleic acids produced polymerase chain reaction (PCR), nucleic acids formed by restriction enzyme treatment of genomic nucleic acids, recombinant nucleic acids, and chemically synthesized nucleic acid molecules.
- a "recombinant" nucleic acid molecule is one made by an artificial combination of two otherwise separated segmen s o sequence, e.g., y c emica syn esis or y e manipu a ion oi isoiate ⁇ segmen ⁇ nucleic acids by genetic engineering techniques.
- protein or “polypeptide” are used synonymously to mean any peptide-linked chain of amino acids, regardless of length or post-translational modification, e.g., glycosylation or phosphorylation.
- nucleic acid molecule polypeptide, bacterium, fungus, amoeba, or virus
- native refers to a naturally-occurring (e.g., a WT) nucleic acid, polypeptide, bacterium, fungus, amoeba, or virus.
- vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors.”
- patient means a mammalian subject to be treated.
- methods, systems and devices described herein find use in experimental animals, in veterinary applications, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats and hamsters, as well as primates.
- diagnosis means identifying the presence or nature of a pathologic condition.
- sample is used herein in its broadest sense.
- a sample including polynucleotides, peptides, antibodies and the like may include a bodily fluid, a soluble fraction of a cell preparation or media in which cells were grown, genomic DNA, RNA or cDNA, a cell, a tissue, skin, hair and the like.
- samples include corneal scrapings, corneal biopsies, and anterior chamber and vitreous fluids.
- probe means a single-stranded nucleic acid molecule.
- An example of a probe as described herein is a single-stranded DNA used to detect a species-specific complementary sequence.
- array is used herein to refer to an array of distinct polynucleotides affixed to a substrate, such as microspheres, beads, or any other suitable solid support.
- the polynucleotides can be synthesized directly on the substrate, or synthesized separate from the substrate and then affixed to the substrate.
- cluster-specific probes means probes that target a specific group of phylogenetically-related organisms.
- patient "subject” and “individual” are used interchangeably herein, and mean a mammalian subject to be diagnosed or treated, with human patients being preferred.
- the methods of the invention find use in experimental animals, in veterinary applications, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters, as well as non-human primates.
- sequence identity means the percentage of identical subunits at corresponding positions in two sequences when the two sequences are aligned to maximize subunit matching, i.e., taking into account gaps and insertions. Sequence identity is present when a subunit position in both of the two sequences is occupied by the same nucleotide or amino acid, e.g., if a given position is occupied by an adenine in each of two DNA molecules, then the molecules are identical at that position. For example, if 7 positions in a sequence 10 nucleotides in length are identical to the corresponding positions in a second 10-nucleotide sequence, then the two sequences have 70% sequence identity. Sequence identity is typically measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer
- bind means that one molecule recognizes and adheres to a particular second molecule in a sample, but does not substantially recognize or adhere to other structurally unrelated molecules in the sample.
- a first molecule that "specifically binds" a second molecule has a binding affinity greater than about 10 5 to 10 6 moles/liter for that second molecule.
- labeled with regard to a probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody.
- a method of detecting at least one species of ocular fungal or amoebic pathogen in a biological sample includes the steps of: obtaining rDNA from a biological sample and amplifying and labeling the rDNA with a detectable label; providing a liquid suspension including a plurality of microspheres to which are bound a plurality of species-specific, genotype-specific, and cluster-specific oligonucleotide probes; contacting the amplified and labeled rDNA with the liquid suspension under conditions such that the rDNA hybridize to complementary sequences in the species-specific probes; detecting hybridization of the rDNA to complementary sequences in the species-specific probes; and correlating hybridization of the rDNA to complementary sequences in the species- specific probes with the presence of at least one ocular fungal or amoebic pathogen.
- the method has a sensitivity of as few as 1-10 in the sample, and as few as 10 amoebas in the sample.
- the biological sample includes any ocular sample, e.g., an ocular tear film, vitreous fluid, anterior chamber biopsy or fluid, or corneal scrape.
- the detectable label can be biotin.
- the method can further include a signal amplification step including incorporation of multiple biotin moieties in the plurality of species-specific, genotype-specific and cluster- specific probes.
- ACCTAGGGAATGTGGCTCTGC SEQ ID NO:9 and C. iropicalis probes: Pctrop(b) TAGCCTTCGTCGATACTGCCAG (SEQ ID NO: 10), Pctrop(c) , , TAGCCTTCGTCGATTCTGCCAG (SEQ ID NO: 12).
- the sample can include any ocular sample, e.g., corneal scraping, corneal biopsy, vitreous fluid, or anterior chamber biopsy or fluid, and can include DNA extracted from a culture.
- the method can further include a signal amplification step including incorporation of multiple biotin moieties in the plurality of species-specific, genotype-specific and cluster-specific probes.
- the plurality of species-specific, genotype-specific and cluster-specific probes can target at least one of a Fusari urn species, an Acanthamoeba species, a Candidas species, and an Aspergillus species, e.g., the plurality of species-specific, genotype-specific and cluster-specific probes can target Fusarium species, Acanthamoeba species, Candidas species, and Aspergillus species.
- the plurality of species-specific, genotype-specific and cluster-specific probes can include Cgl ⁇ br ⁇ t ⁇ probes: Pcglabr(b) TCTGCGCCTCGGTGTAGAGTG (SEQ ID NO:8) and Pcglabr (c) ACCTAGGGAATGTGGCTCTGC (SEQ ID NO:9) and C. tropic ⁇ lis probes: Pctrop(b) TAGCCTTCGTCGATACTGCCAG (SEQ ID NO: 10), Pctrop(c)
- an xMAPTM multiplex bead suspension array including a plurality of species-specific, genotype-specific and cluster-specific probes that target a plurality of ocular fungal and amoebic pathogen species.
- the plurality of species-specific, genotype- specific and cluster-specific probes can target at least one of a Fusarium species, an Acanthamoeba species, a Candidas species, and an Aspergillus species. e ur er escri e er in or e e i pecies ⁇ i ⁇ cuitu iuii or amoebic pathogen in a biological sample.
- the kit includes: a plurality of probe-coupled microspheres; at least one buffer; biotinylateci primer sets; and instructions for detecting a particular species of ocular fungal or amoebic pathogen in a biological sample.
- the kit can include probe-coupled microspheres, microsphere diluent, hybridization buffer, reporter solution, and biotinylated primer sets.
- the probe-coupled microspheres can include C glabrata probes: Pcglabr(b) TCTGCGCCTCGGTGTAGAGTG (SEQ ID NO:8) and Pcglabr (c) ACCTAGGGAATGTGGCTCTGC (SEQ ID NO:9) and C. tropicalis probes: Pctro ⁇ (b) TAGCCTTCGTCGATACTGCCAG (SEQ ID NO: 10), Pctrop(c)
- FIG. 6 is a diagram illustrating Minis Label IT chemistry. DETAILED DESCRIPTION OF THE INVENTION
- a method and system of detecting a particular species of ocular fungal or amoebic pathogen in a sample can be any method and apparatus or device(s) that allows simultaneous detection of different target sequences in a multiplex and high-throughput format.
- the method can include use of a flow cytometer with a dual laser system.
- LuminexTM technology was employed because compared to conventional methods and apparatuses, it has faster kinetics, is less expensive, and the working platform is flexible, as any modification involves simply mixing beads (microspheres) of interest into a single tube. Generally, when using LuminexTM technology, several steps are performed.
- hybridization of biotinylated target amplicons to t e o igonuc eo i e pro es is quan i ie y t e a i ion o e conjugate sireptavi ⁇ m- - phycoerythrin.
- oligonucleotide probes hybridize to sequences in two different loci (ITS and D 1 D2) of the rDNA gene in a particular species, ⁇ n other embodiments, however, oligonucleotide probes that hybridize to sequences in one loci, or to sequences in three or more different loci may be used.
- the steps include: providing a biological sample and a plurality of species-specific, genotype-specific and cluster-specific probes that target a plurality of ocular fungal and amoebic pathogen species; covalently coupling the probes to microspheres; subjecting the microspheres and biological sample to a hybridization assay using an xMAPTM multiplex bead suspension array resulting in hybridization between at least one nucleic acid from the biological sample and at least one probe; detecting and quantifying the hybridization using a LurainexTM analyzer; and correlating the hybridization with the presence of a particular species of ocular fungal or amoebic pathogen in the biological sample.
- a particular species of ocular fungal or amoebic pathogen e.g., Candidas spp, Fusarium spp and Acanthamoebas
- the biological sample is typically from a subject such as a mammal (any mammal e.g., human beings, rats, mice, cats, dogs, goats, sheep, horses, monkeys, apes, rabbits, cattle, etc).
- the subject e.g., mammal
- the biological sample is obtained from the eye, e.g., tear film (e.g., ocular tear film), corneal scrape, iris, lens, choroid, retina, optic nerve, sclera, aqueous and vitreous humor, conjunctival sac, ocular adnexa (lids, orbit, etc.), etc.
- one or more of the probes listed below are coupled to microspheres. Generally, the method involves one probe per microsphere set. Several of the probes listed below were designed and tested as described in the Examples section below. [0041J Candidas spp. Pcalb2: CAC GGC TTC TGC TGT GTG T C (SEQ ID NO: 1) C. albicans
- PFIESC ACATACCTACAACGTTGCCTC (SEQ ID NO:22) F. incarnatum sp. complex complex
- a rapid identification of the ocular pathogen at the species level is often important to guide therapy and aid in a positive visual outcome.
- the rapid identification of Paecilomyces lilacinus would indicate the administration of miconazole nitrate or ketoconazole rather than amphoteracin or natamycin, because of reduced susceptibility to these standard ocular antifungal drugs (Scott et al. Arch Ophthalmol. Jun;l 19:916-919, 2001).
- Paecilomyces lilacinus and P. va ⁇ otii both display a high level of resistance to amphoteracin and natamycin, which are the standard initial drugs of choice for ocular fungal infections.
- Candida spp. has shown resistance to flucytosine, fluconazole and itraconazole, while isolates of Aspergillus displayed resistance to itraconazole. Reduced susceptibility to interference of ergosterol biosynthesis is another way by which resistance to antifungal drugs has increased.
- Species identification via the systems and methods described herein will aid the clinician to select the adequate treatment based on species susceptibilities to antifungal agents but will allow and promote expansion of current guidelines for therapeutic management. Furthermore, species level identification can have epidemiological importance in tracking point- source outbreaks and can uncovered possible outbreaks of unusual species.
- kits for identifying and detecting ocular and amoebic pathogens e.g., Candidas spp, Fusarium spp and Acanthamoebas
- a kit for detecting a particular species of ocular fungal or amoebic pathogen in a biological sample can include, for example, probe-coupled microspheres, microsphere diluent (TE buffer), hybridization buffer e.g., u er , repor er so u ion e.g., s rep avi m-p ycoery-n,rin , iounyiaiea primer se s; and instructions for use.
- Probes are integrated and consolidated into a single universal platform that can be employed as a detection kit for ocular pathogens.
- a homogeneous set of stringent conditions that allows the probe testing in a multiplex universal platform is provided.
- Fusarium spp, Candida spp and Acanthoamoeba spp probes were integrated into a single platform as described in the Examples below.
- probes to any combination of fungi and/or amoebic pathogens can be constructed according to the methods described herein.
- probes to any bacteria, virus, or other pathogenic organisms can be used.
- a kit as described herein can be used to detect ocular and/or amoebic pathogens in a number of different samples, including both biological and non-biological samples.
- a kit can be used to detect contaminants in contact lens solution.
- the systems, kits and methods described herein can be used to detect and identify a number of ocular pathogens. As many as 10 5 fungal species, representing over 56 different genera, have been associated with oculomycosis. However, the most common fungal species involved with the disease are ubiquitous and saprophytic fungi such as: Fusarium, Aspergillus, Acremoniutn, Curvularia, Phialophora, followed by the yeast like fungi of the genus Candida and other hyaline and dematiaceous hyphomycetes. Dematiaceous fungi, such as Curvularia spp.
- Luminex xMapTM is a specialized flow cytometer that can detect 100 different analytes in a reaction tube/well at a rate approx 0,47min/well.
- the technique employs a 96 well format, therefore, 100 different analytes can be tested in each of the wells.
- the system uses multiple color fluorescent microspheres by varying the proportion of red and infrared fluorescent dyes within microspheres to create an array of up to 100 separate bead ass auons, eac o w c prese s ng e sp . i m . technologies are commercially available from Luminex Corporation (Austin, TX).
- FIG. IA and IB illustrate the specificity of the assay.
- the developed Candida probes were tested against closely and non-closely related species.
- Two different PCR- based methods were used to amplify target sequences: symmetric PCR to generate dsDNA PCR products and asymmetric PCR to generate ssDNA PCR products. When using both assay formats, the probes successfully hybridized their respective targets.
- This multiple labeling system allows the incorporation of multiple biotin moieties in the sample (target DNA).
- a dramatic increase in signal intensity ranging from 60 to 80% was demonstrated.
- FIG. 5 displays two labeling methods used for the detection of K. brevis and K. mikirnotoi. Note the significant enhancement of signal intensity when Mirus labeling IT system is used as opposed to the 5 'end PCR method.
- FIG.4 shows that all tested probes hybridized well with their respective targets, demonstrating the multiplex capability of the assay (note the inclusion of Comandoni spp (TIV), Tubiashi spp and Astronyxis spp).
- the tested probes showed robust signal intensities ranging from ⁇ 470 to 2550 MFI.
- An exception was PTSnew, which failed to generate a signal.
- a failure in coupling reaction or a secondary structure around the probe-binding site could explain the outcome of this result.
- a new probe PGRPl was included in the multiplex assay.
- Example 2 Design and validate species-specific and cluster probes for the identification of clinically important ocular pathogens including Acremonium, Colletotrichum, Curvularia, Lasiodiplodia and Paecilomyces.
- Probes will be designed for genera or clusters within genera. Focus on species or strain-specific probes will be developed based on results from clinical studies. The need for generic and cluster probes is due to the extensive species and strain variability exhibited by some of these fungi.
- DNA extraction from pure culture DNA extraction from pure cultures in the culture collections at BPEI, will use the boiling extraction method or the protocol described by Fell et al. (Int. J. Syst Evol. Microbiol. 50:1351-1371, 2000). Fungal species will be isolated from ocular samples taken by corneal scrapings and biopsies as well as from anterior chamber and vitreous fluids. These isolations will be undertaken at BPEI. The specimens will be streaked on Saborouds Dextrose Agar plates and incubated for 1 - 5 days. The culture plates will be examined periodically for the presence of filamentous fungi and yeasts.
- DNA extracted from isolated fungi will be tested to expand the diversity of species/strains and to validate the probes and multiplex analysis. Clinical specimens are expected to be obtained at a rate of 20-30 samples per month. The DNA from these samples will be isolated, properly stored, and amplified using the multiplex PCR assay format described herein. The amplified products will be used to validate probes in preparation for widespread clinical use.
- the amplicons are sequenced using the primer sets F63/R635 for the D 1 /D2 region and ITS 1 /ITS4 for the ITS region. Cycle sequence analysis will be undertaken with 3730 ABI Sequencer using the manufacturer protocol. Sequences will be aligned with MegAlign (DNAStar) arid visually corrected with the Aligner Program (Li-Cor). Phylogenetic analysis will be done with PAUP*4.0bl0 using Parsimony analysis, random step-wise addition and tree bisection-reconnection.
- Probe design and development based on computer analyses. Probe design at species and group/clade level will be based on sequence data generated from D1/D2 and ITS 1&2 regions. Probe selection will be facilitated employing Megalign Program (DNAStar). The quality of the probe will be assessed using the software program OHgoTM (Molecular Biology Insights Inc.). This program provides the parameters (e.g., T m values by nearest neighbor algorithm, hairpin structures, primer-dimer structures, GC content and delta G) necessary to test the quality of the capture probe. The specificity of the prospective sequence will be analyzed with sequences deposited in GeneBank using BLAST. Further probe validation will be achieved by testing the performance of the probe on a capture probe hybridization format such as that described below within Example 2. If the probe does not meet the specific requirements, another sequence will be selected. For more detail about probe development see (Diaz and Fell J. Clin. Microbiol. 42:3696-3706, 2004).
- Probe validation Validation and optimization of probes will use a capture hybridization assay format with the xMAP system. Once the probes have been designed and validated employing computer programs and public domain databases, the probes will be validated on a captured probe hybridization format as described below. The probes will be covalently coupled to the microspheres using a carbodiimide method (Fulton et al. Clin. Chem. 43:1749-1756, 1997). To optimize the assay conditions, different probe concentrations will be tested from O.lnmol to 0.5nmoles. For each color coded microsphere a specific capture probe will be assigned. [0068] The probe validation will be carried out in a single stringent condition. The probes that fail this test will be modified.
- probe fails, it will be redesigned. DNA sequence u redesign. Modified probes will be synthesized with bases sequentially removed or added from the 3' and 5' end of the original probe. Newly re-designed probes will be tested against a control panel consisting of probe variants. If the probe valiants fail, anew sequence will be selected and will be subject to the same assay protocol.
- Probe optimization and specificity Following the acceptance of a probe motif, the probe concentration will be optimized for signal intensity through a series of titrations. The specificity of each probe will be tested against the complementary target amplicon and a selective library of amplicons representing closely and non-closely related species. The selected amplicons will contain a variety of polymorphic sites.
- PCR reaction will use universal primers, which are common to all fungi.
- the primers will target the ribosomal DNA rDNA regions: 1) D1/D2 LrDNA; and2) ITS regions.
- the primer combination for the D1/D2 will employ (F63 and R635) and for the ITS I & ITS II regions: (ITS5 and 5.8S; or ITS 1 and ITS4) .
- All reverse primers will be biotinylated at the 5 'end and the reaction uses QIAGEN HotStar Taq (QIAGEN Inc.). Sequences description and detailed PCR conditions are described in Diaz and Fell (J. Clin. Microbiol.42:3696-3706, 2004).
- the first stage of the probe validation will use PCR amplicons generated with single set of primers. However, in order to analyze multiple loci in one reaction, a multiplex PCR reaction containing all primers sets will be employed and optimized. The optimization which, will be undertaken with a MJ Research PTC 100 thermocycler, require titrations of magnesium chloride, annealing temperatures and primer concentration. A set of blanks with no DNA, will be included to monitor any potential contamination of the PCR. reagents An agarose gel electrophoresis is performed to confirm the synthesis of amplicons. Following this protocol a panel of characterized amplicons are prepared from a selection of species in the probe design. The characterized amplicons will include positive, negative and cross- reactive groups.
- Hybridization Assay The captured probe hybridization assay will be based upon detection of 5'biotin labeled PCR amplicons by hybridization to specific capture probes, which are covalently bound to the carboxylate surface of the microspheres. The addition of a fiuorochrome group coupled to a reporter molecule allows quantification of the hybridized target.
- the assay involves the addition of denatured biotinylated amplicon into a stringent hybridization buffer containing the microsphere mix.
- Assay detection limits The limits of detection of the assay will be determined by serial dilutions of genomic DNA or cell counts. Statistical analysis such as median and standard deviations will be calculated. Blanks will be substracted from the actual readings.
- Multiplexed assay The multiplexed assay will contain all the probes that followed the assay criteria when tested individually. Initially, the multiplex tests will include mixes of different microspheres in multiples of five, which will then be combined to a maximum of 100 different probes per well. The goal is to mix as many different species- specific and group specific probes in a multiplex reaction after the specificity of the probes and the optimal conditions for the captured probe hybridization assay have been determined separately in a non-multiplexed format.
- Example 3 Adapt and modify the culture-based method into a direct detection method, which can be readily employed with ocular clinical specimens
- the working specimens will be available as freshly collected samples and frozen archived samples from the BPEI collection.
- the samples will be de- identified, with new, unknown codes obtained from patients of the Cornea Service of Bascom Palmer Eye Institute, Samples will be divided for molecular testing and for confirmation with standard culture techniques.
- Clinical eye conditions will include corneal scrapings, corneal and conjunctival tissue , uua, ⁇ uu UVCIUWB, addition, samples will be obtained from individuals with healthy eyes including patients that wear contact lenses.
- DNA extraction The first step will involve DNA extraction of the clinical specimens. Optimization of DNA extraction methods have been already undertaken. For example, using a boiling method or the lysing enzyme method (Trichoderma harzianum and QIAamp Tissue kit extraction (Qiagen), we successfully isolated yeast and filamentous fungal DNA from culture and non-cultured based clinical material. Both methods will be tested with the new fungal species. If needed, the methods will be further optimized.
- a boiling method or the lysing enzyme method Trichoderma harzianum and QIAamp Tissue kit extraction (Qiagen)
- PCR Reaction (clinical specimens). PCR reaction will use a similar protocol as described in Example 2. However, certain modifications to PCR conditions and reagents may be necessary to achieve maximum sensitivity and reproducibility. To alleviate some inhibitory effects of clinical specimens to PCR reactions, 0.5% BSA will be added to DNA extracts. [0079] Hybridization Assay. Clinical derived ampiicons will be tested using the hybridization protocol described in Example 2. Depending on the hybridization efficiency, the assay protocol will be modified accordingly. Assay reproducibility and multiplex capability will use the approach as described in Example 2.
- Luminex system is designed to target specific DNA in a mixed community of ampiicons. This feature is employed in our environmental research where we target specific harmful algal blooms and sewage indicators in seawater with communities of hundreds of different species of prokaryotes; b) low concentrations of target DNA can become a critical factor with some clinical specimens.
- FIG. 5 illustrates that Mirus Label IT, as opposed to 5 'end incorporated on any reactive heteroatom in the polynucleotide. Based on these results, we are confident this technology can be merged to our current assay to create a powerful method for the detection of ocular pathogens in clinical specimens.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Described herein are systems, kits, probes and methods for identification and detection of ocular pathogens including, but not limited to, Candidas spp, Fusarium spp and Acanthamoebas species, in a sample. Group-specific and species-specific probes for the detection of ocular medically important pathogenic species within the genus of Acanthamaeba, Fusarium and Candida were tested and validated; ocular pathogenic fungal/protist Luminex detection systems for the detection of species in clinical specimens. The systems, kits, probes and methods can be used for the design and validation of species-specific and cluster probes useful for identifying any clinically important ocular pathogens. The methods, kits, probes and systems also include a comprehensive suspension array that can be used as standard routine screening methods in clinics.
Description
AMOEBIC PATHOGENS
FIELD OF THE INVENTION
[0Θ01] The invention relates generally to the fields of medicine, genetics, and microbiology. More particularly, the invention relates to compositions, kits and methods for detecting one or more particular species of ocular fungal or amoebic pathogen in a biological sample.
BACKGROUND OF THE INVENTION
[0002] Ocular fungal infections are being increasingly recognized as an important cause of morbidity and blindness. The diagnosis of these eye infections remains a clinical and therapeutic challenge. The majority of these ocular infections are often diagnosed as bacterial keratitis since the clinical features often resemble infections of bacterial etiology. The incidence of ocular mycosis, which is a prominent cause of vision loss in subtropical and tropical regions, has increased in recent decades due to the frequent use of topical corticosteroids, antibacterial agents, surgical procedures, inappropriate maintenance of contact lenses and the rise in immunocompromised patients. If not treated in time, eye infections can have devastating and irreversible effects. The management of ocular infections depends on rapid identification of the causal agent. However diagnosis of the disease typically occurs late, when therapeutic failure is at higher risk. The clinical challenge is to rapidly diagnose the presence of the etiological agent to reduce ocular morbidity and blindness by early initiation of appropriated antifungal treatment. The delay in diagnosis is mostly due to the lack of sensitive techniques and the continued dependence on traditional methods, which are often slow and complex.
SUMMARY OF THE INVENTION
[0003] Described herein are systems, kits, and methods for identification and detection of ocular pathogens including, but not limited to, Candidas spp, Fusarium spp and Acanthamoebas species, in a sample. Group- specific and species-specific probes for the detection of ocular medically important pathogenic species within the genus of Acanlhamoeba, Fusarium and Candida were tested and validated that allow discrimination of a 1 base pair mismatch. The systems, kits, and methods described herein include culture-based and nonculture-based ocular pathogenic fungal/protist detection systems for the detection of species in clinical specimens. The
sequences in a multiplex and high-throughput format. In the experiments described below, Luminex™ technology was used for the detection of species in clinical specimens and in a 96 well plate, provided for detection of 1-10 conidias per sample (Fusarium) and 10 amoebas per sample. Thus, the systems, devices and methods described herein have a sensitivity of as few as 1-10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11) fungi per sample, and as few as 10 (e.g., 9, 10, 11) amoebas per sample. The systems, devices and methods described herein can be used for the design and validation of species- specific and cluster probes that can be used to identify any clinically important ocular pathogens in addition to those above, including for example, Acremonium, Colletolrϊchum Curvnlarϊa, Lasiodiplodia and Paecilomyces, and they provide a detection capability to identify in a fast and efficient manner the etiological agents that cause ophthalmic mycoses and keratitis. When performed in a 96 well plate format, for example, up to 100 species per well can be detected (identified). The methods, kits and systems described herein also include a comprehensive suspension array that can be used as standard routine screening methods in clinics. The systems, kits, probes and methods described herein provide for improved medical care by allowing early intervention and reducing surgical intervention and potential visual loss associated with ocular diseases. A precise and fast identification system will benefit the medical community and patients since it will ease diagnosis and therefore medical treatment regimens can be quickly adopted.
[0004] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinaiy skill in the art to which this invention belongs. [0005] As used herein, a "nucleic acid" or a "nucleic acid molecule" means a chain of two or more nucleotides such as RNA (ribonucleic acid) and DNA (deoxyribonucleic acid), and chemically-modified nucleotides. A "purified" nucleic acid molecule is one that is substantially separated from other nucleic acid sequences in a cell or organism in which the nucleic acid naturally occurs (e.g., 30, 40, 50, 60, 70, 80, 90, 95, 96, 97, 98, 99, 100% free of contaminants). The terms include, e.g., a recombinant nucleic acid molecule incorporated into a vector, a plasmid, a virus, or a genome of a prokaryote or eukaryote. Examples of purified nucleic acids include cDNAs, fragments of genomic nucleic acids, nucleic acids produced polymerase chain reaction (PCR), nucleic acids formed by restriction enzyme treatment of genomic nucleic acids, recombinant nucleic acids, and chemically synthesized nucleic acid molecules. A "recombinant" nucleic acid molecule is one made by an artificial combination of two otherwise separated
segmen s o sequence, e.g., y c emica syn esis or y e manipu a ion oi isoiateα segmenτ nucleic acids by genetic engineering techniques.
[0006] As used herein, "protein" or "polypeptide" are used synonymously to mean any peptide-linked chain of amino acids, regardless of length or post-translational modification, e.g., glycosylation or phosphorylation.
[0007] When referring to a nucleic acid molecule, polypeptide, bacterium, fungus, amoeba, or virus, the term "native" refers to a naturally-occurring (e.g., a WT) nucleic acid, polypeptide, bacterium, fungus, amoeba, or virus.
[0008] As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors."
[0009] The terms "patient," "subject" and "individual" are used interchangeably herein, and mean a mammalian subject to be treated. In some cases, the methods, systems and devices described herein find use in experimental animals, in veterinary applications, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats and hamsters, as well as primates.
[0010] As used herein, the terms "diagnostic," "diagnose" and "diagnosed" mean identifying the presence or nature of a pathologic condition.
[0011] The term "sample" is used herein in its broadest sense. A sample including polynucleotides, peptides, antibodies and the like may include a bodily fluid, a soluble fraction of a cell preparation or media in which cells were grown, genomic DNA, RNA or cDNA, a cell, a tissue, skin, hair and the like. Examples of samples include corneal scrapings, corneal biopsies, and anterior chamber and vitreous fluids.
[0012] The phrases "isolated" or biologically pure" refer to material which is substantially or essentially free from components which normally accompany it as found in its native state.
[0013] As used herein, the term "probe" means a single-stranded nucleic acid molecule. An example of a probe as described herein is a single-stranded DNA used to detect a species-specific complementary sequence.
[O014J By the term "array" is meant a plurality of nucleic acid probes immobilized on a surface.
, sample.
[0016] As used herein, the term "high- throughput" means simultaneous screening of multiple samples (e.g., a large number or plurality of samples).
[0017] The term "array" is used herein to refer to an array of distinct polynucleotides affixed to a substrate, such as microspheres, beads, or any other suitable solid support. The polynucleotides can be synthesized directly on the substrate, or synthesized separate from the substrate and then affixed to the substrate.
[0018] As used herein, the phrase "cluster-specific probes" means probes that target a specific group of phylogenetically-related organisms.
[0019] When referring to hybridization of one nucleic acid to another, "high stringency conditions" means conditions under which only those nucleic acid sequences that are highly complementary to one another will anneal to one another.
[0020] The terms "patient" "subject" and "individual" are used interchangeably herein, and mean a mammalian subject to be diagnosed or treated, with human patients being preferred. In some cases, the methods of the invention find use in experimental animals, in veterinary applications, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters, as well as non-human primates.
[0021] As used herein, "sequence identity" means the percentage of identical subunits at corresponding positions in two sequences when the two sequences are aligned to maximize subunit matching, i.e., taking into account gaps and insertions. Sequence identity is present when a subunit position in both of the two sequences is occupied by the same nucleotide or amino acid, e.g., if a given position is occupied by an adenine in each of two DNA molecules, then the molecules are identical at that position. For example, if 7 positions in a sequence 10 nucleotides in length are identical to the corresponding positions in a second 10-nucleotide sequence, then the two sequences have 70% sequence identity. Sequence identity is typically measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer
Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis.
53705).
[0022] When referring to mutations in a nucleic acid molecule, "silent" changes are those that substitute of one or more base pairs in the nucleotide sequence, but do not change the amino acid sequence of the polypeptide encoded by the sequence. "Conservative" changes are those in which at least one codon in the protein-coding region of the nucleic acid has been changed such
χ substituted with a another amino acid having similar characteristics.
[0023] As used herein, "bind," "binds," or "interacts with" means that one molecule recognizes and adheres to a particular second molecule in a sample, but does not substantially recognize or adhere to other structurally unrelated molecules in the sample. Generally, a first molecule that "specifically binds" a second molecule has a binding affinity greater than about 105 to 106 moles/liter for that second molecule.
[0024] The term "labeled," with regard to a probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody.
[0025] Accordingly, described herein is a method of detecting at least one species of ocular fungal or amoebic pathogen in a biological sample. The method includes the steps of: obtaining rDNA from a biological sample and amplifying and labeling the rDNA with a detectable label; providing a liquid suspension including a plurality of microspheres to which are bound a plurality of species-specific, genotype-specific, and cluster-specific oligonucleotide probes; contacting the amplified and labeled rDNA with the liquid suspension under conditions such that the rDNA hybridize to complementary sequences in the species-specific probes; detecting hybridization of the rDNA to complementary sequences in the species-specific probes; and correlating hybridization of the rDNA to complementary sequences in the species- specific probes with the presence of at least one ocular fungal or amoebic pathogen. The method has a sensitivity of as few as 1-10 in the sample, and as few as 10 amoebas in the sample. The biological sample includes any ocular sample, e.g., an ocular tear film, vitreous fluid, anterior chamber biopsy or fluid, or corneal scrape. The detectable label can be biotin. The method can further include a signal amplification step including incorporation of multiple biotin moieties in the plurality of species-specific, genotype-specific and cluster- specific probes. The plurality of species-specific, genotype-specific and cluster- specific probes can target at least one of a Fusarium species, an Acanlhamoeba species, a Candidas species, and an Aspergillus species, e.g., the plurality of species-specific, genotype-specific and cluster-specific probes can target Fusarium species, Acanthamoeba species, Candidas species, and Aspergillus species. The plurality of species- specific, genotype-specific and cluster-specific probes can include Cglabrata probes: Pcglabr(b) TCTGCGCCTCGGTGTAGAGTG (SEQ ID NO:8) and Pcglabr (c)
ACCTAGGGAATGTGGCTCTGC (SEQ ID NO:9) and C. iropicalis probes: Pctrop(b) TAGCCTTCGTCGATACTGCCAG (SEQ ID NO: 10), Pctrop(c)
, , TAGCCTTCGTCGATTCTGCCAG (SEQ ID NO: 12).
[0026] Also described herein is a method of detecting a particular species of ocular fungal or amoebic pathogen in a biological sample. The method includes the steps of: providing a biological sample and a plurality of species-specific, genotype-specific and cluster-specific probes that target a plurality of ocular fungal and amoebic pathogen species; covalently coupling the probes to microspheres; subjecting the microspheres and biological sample to a hybridization assay using an xMAP™ multiplex bead suspension array resulting in hybridization between at least one nucleic acid from the biological sample and at least one probe; detecting and quantifying the hybridization using a Luminex™ analyzer; and correlating the hybridization with the presence of a particular species of ocular fungal or amoebic pathogen in the biological sample. The sample can include any ocular sample, e.g., corneal scraping, corneal biopsy, vitreous fluid, or anterior chamber biopsy or fluid, and can include DNA extracted from a culture. The method can further include a signal amplification step including incorporation of multiple biotin moieties in the plurality of species-specific, genotype-specific and cluster-specific probes. The plurality of species-specific, genotype-specific and cluster-specific probes can target at least one of a Fusari urn species, an Acanthamoeba species, a Candidas species, and an Aspergillus species, e.g., the plurality of species-specific, genotype-specific and cluster-specific probes can target Fusarium species, Acanthamoeba species, Candidas species, and Aspergillus species. The plurality of species-specific, genotype-specific and cluster-specific probes can include Cglαbrαtα probes: Pcglabr(b) TCTGCGCCTCGGTGTAGAGTG (SEQ ID NO:8) and Pcglabr (c) ACCTAGGGAATGTGGCTCTGC (SEQ ID NO:9) and C. tropicαlis probes: Pctrop(b) TAGCCTTCGTCGATACTGCCAG (SEQ ID NO: 10), Pctrop(c)
ATGATCCAGGCCTATGTAAAG (SEQ ID NO: 11), and Ptrop(c)
TAGCCTTCGTCGATTCTGCCAG (SEQ ID NO: 12). In the method, the plurality of species- specific, genotype-specific and cluster- specific probes can include probes that target Fusarium species, Acanthamoeba species, and Candidas species.
[0027] Further described herein is an xMAP™ multiplex bead suspension array including a plurality of species-specific, genotype-specific and cluster-specific probes that target a plurality of ocular fungal and amoebic pathogen species. The plurality of species-specific, genotype- specific and cluster-specific probes can target at least one of a Fusarium species, an Acanthamoeba species, a Candidas species, and an Aspergillus species.
e ur er escri e er in or e e i pecies υi υcuitu iuii or amoebic pathogen in a biological sample. The kit includes: a plurality of probe-coupled microspheres; at least one buffer; biotinylateci primer sets; and instructions for detecting a particular species of ocular fungal or amoebic pathogen in a biological sample. The kit can include probe-coupled microspheres, microsphere diluent, hybridization buffer, reporter solution, and biotinylated primer sets. The probe-coupled microspheres can include C glabrata probes: Pcglabr(b) TCTGCGCCTCGGTGTAGAGTG (SEQ ID NO:8) and Pcglabr (c) ACCTAGGGAATGTGGCTCTGC (SEQ ID NO:9) and C. tropicalis probes: Pctroρ(b) TAGCCTTCGTCGATACTGCCAG (SEQ ID NO: 10), Pctrop(c)
ATGATCCAGGCCTATGTAAAG (SEQ ID NO: 11), and Ptrop(c)
TAGCCTTCGTCGATTCTGCCAG (SEQ ID NO: 12). In the kit, the probe-coupled microspheres can include probes that target Fusarium species, Acanthamoeba species, and Candidas species.
[0029] Although compositions, methods, probes, systems and kits similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods, kits and systems are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. In the case of conflict, the present specification, including definitions will control. The particular embodiments discussed below are illustrative only and not intended to be limiting.
BRIEF DESCRIPTION OF THE DRAWFNGS
[0030] FIG. 1 is a pair of graphs Illustrating specificity of an assay as described herein. [0031] FIG. 2 is a pair of graphs illustrating results from hybridization assay optimization [0032] FIG. 3 is a pair of graphs illustrating detection limits of an assay using multiplex PCR assay format. A) detection limits of Fusarium conidias. The PCR reactions used 105to 10° conidias/rx. B) detection limits of cyst cells. The PCR reaction was undertaken with 102 to 10"3 cells/rx.
[0033] FIG. 4 is a graph illustrating results from multiplex PCR. The Y axis indicates median fluorescence intensity, and the X axis indicates the probes. The inset legend lists the tested strains.
[0Θ34] FIG. 5 is a graph illustrating results from two labeling methods used for the detection of K. brevis and K. mikimoto.
[0035] FIG. 6 is a diagram illustrating Minis Label IT chemistry.
DETAILED DESCRIPTION OF THE INVENTION
[0036] Described herein are compositions, methods, systems, probes and kits for detecting one or more particular species of ocular fungal or amoebic pathogen in a biological sample. The below described preferred embodiments illustrate adaptations of these methods, systems and kits. Nonetheless, from the description of these embodiments, other aspects of the invention can be made and/or practiced based on the description provided below.
Biological Methods
[0037] Methods involving conventional molecular biology techniques are described herein. Such techniques are generally known in the art and are described in detail in methodology treatises such as Molecular Cloning: A Laboratory Manual, 3rd ed., vol. 1 -3, ed. Sambrook et al,3 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. , 2001 ; and Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992 (with periodic updates). Methods for using Luminex™'s xMAP™ liquid bead array technology and bead-based hybridization arrays are described, for example, in U.S. Patents Nos. 5,736,330, 5,981,180, 6,939,720 and 7,445,844, and Lu et al., Nature vol. 435, 2005.
Methods of Identifying and Detecting Ocular Fungal and Amoebic Pathogen
Species In A Sample
[ΘΘ38] A method and system of detecting a particular species of ocular fungal or amoebic pathogen in a sample (biological or nonbiological sample) can be any method and apparatus or device(s) that allows simultaneous detection of different target sequences in a multiplex and high-throughput format. For example, the method can include use of a flow cytometer with a dual laser system. In the experiments described below, Luminex™ technology was employed because compared to conventional methods and apparatuses, it has faster kinetics, is less expensive, and the working platform is flexible, as any modification involves simply mixing beads (microspheres) of interest into a single tube. Generally, when using Luminex™ technology, several steps are performed. First, in a liquid suspension, specific (e.g., species- specific) oligonucleotide probes are covalently bound to the surface of fluorescent color-coded microspheres (also referred to herein as beads). Biotinylated (or other suitably labeled) target amplicons are added to the liquid suspension under conditions in which the target amplicons hybridize to their complementary probe sequences (if such complementary probe sequences are present in the liquid suspension). In this example, hybridization of biotinylated target amplicons
to t e o igonuc eo i e pro es is quan i ie y t e a i ion o e conjugate sireptaviαm- - phycoerythrin. In the experiments described herein, oligonucleotide probes hybridize to sequences in two different loci (ITS and D 1 D2) of the rDNA gene in a particular species, ϊn other embodiments, however, oligonucleotide probes that hybridize to sequences in one loci, or to sequences in three or more different loci may be used.
[0039] In one example of a method of detecting a particular species of ocular fungal or amoebic pathogen (e.g., Candidas spp, Fusarium spp and Acanthamoebas) in a biological sample, the steps include: providing a biological sample and a plurality of species-specific, genotype-specific and cluster-specific probes that target a plurality of ocular fungal and amoebic pathogen species; covalently coupling the probes to microspheres; subjecting the microspheres and biological sample to a hybridization assay using an xMAP™ multiplex bead suspension array resulting in hybridization between at least one nucleic acid from the biological sample and at least one probe; detecting and quantifying the hybridization using a Lurainex™ analyzer; and correlating the hybridization with the presence of a particular species of ocular fungal or amoebic pathogen in the biological sample. The biological sample is typically from a subject such as a mammal (any mammal e.g., human beings, rats, mice, cats, dogs, goats, sheep, horses, monkeys, apes, rabbits, cattle, etc). The subject (e.g., mammal) can be in any stage of development including adults, and juveniles. The biological sample is obtained from the eye, e.g., tear film (e.g., ocular tear film), corneal scrape, iris, lens, choroid, retina, optic nerve, sclera, aqueous and vitreous humor, conjunctival sac, ocular adnexa (lids, orbit, etc.), etc. [0040] Species-specific oligonucleotide probes as described herein can be designed and prepared using any suitable methods. Generally, probe design can be performed as described in, for example, Diaz, M. R., and J.W. Fell ( J. Clin. Microbiol 42:3696-3706, 2004). High throughput detection of pathogenic yeasts in the genus Trichosporon is described, for example, in also described in Diaz, M.R. and J.W. Fell (J. Clin. Microbiol. 42:3696-3706). Commercially synthesized probes can be obtained by IDT technologies, and probes can be synthesized using phosphoramidite chemistry. These probes bear a 5'end amino C12 linker arm. In atypical method or kit, one or more of the probes listed below are coupled to microspheres. Generally, the method involves one probe per microsphere set. Several of the probes listed below were designed and tested as described in the Examples section below. [0041J Candidas spp. Pcalb2: CAC GGC TTC TGC TGT GTG T C (SEQ ID NO: 1) C. albicans
Pcalb7: TAT TTT GCA TGC TGC TCT CTC (SEQ ID NO:2) C. albicans
. Pctrop: GGA GAA TTG CGT TGG AA T GTG (SEQ ID NO:4) C. tropicalis Pparap: GGA TAAGTGCAAAGAAATG (SEQ ΪD N0:5) C. parapsilopsis
Pgui 11 : ATA TTT TGT GAG CCT TGC CTT (SEQ ID N0:6) C. guilliermondii Pglabr: CCT CTC GTG GGC TTG GGA CTC (SEQ ID NO:7) C. glabrata Pcglabrφ) TCT GCG CCT CGG TGT AGA GTG (SEQ ID NO: 8) C glabrata
Pcglabr(c) ACC TAG GGA ATG TGG CTC TGC (SEQ ID NO :9) C glabrata Pctrop(b) TAGCCTTCGTCGATACTGCCAG (SEQ ID NO: 10) C. tropicalis Pctrop(c) ATGATCCAGGCCTATGTAAAG (SEQ ID NO: 11) C tropicalis Ptrop(c) TAG CCT TCG TCG ATT CTG CCA G (SEQ ID NO: 12) C. tropicalis Pcalb(c) ATA ATG GCG GAG GAA TGT GGC (SEQ ID NO : 13) C. albicans
[0042] Acanthamoeba spp
PT3 A ACA CCA AAG ACG ACC GCA AT (SEQ ID NO: 14) Acanthamoeba
T3
PT4D GCC AAG GAY GAC CGC RCC GA (SEQ ID NO: 15) Acanthamoeba
T4
PT5, T AA TCC CCG AAA GGA TTA AC (SEQ ID NO: 16) Acanthamoeba
T5
PGRPI CCG TGT GAA ACG TCT CCC AA (SEQ ID NO: 17) Acanthamoeba
(T8, T7, T9)
PGemis GRPI GGT GTT TTG TAT TCA ACG TC (SEQ ID NO : 18)
Acanthamoeba genus (minus PGRPl)
[0043] Fusarium spp.
PFSSC CAACTCATCAACCCTGTGAAC (SEQ ID NO: 19) Fusarium solani sp. complex
PFOSC GAACATACCACTTGTTGCCTC (SEQ ID NO:20) F. oxysporum sp. complex
PFNSSC TCAGCCCGCGCCCCGTAAAAC (SEQ ID NO:21) F. non solani sp. complex
PFIESC ACATACCTACAACGTTGCCTC (SEQ ID NO:22) F. incarnatum sp. complex
complex
[0044J A rapid identification of the ocular pathogen at the species level is often important to guide therapy and aid in a positive visual outcome. For example, the rapid identification of Paecilomyces lilacinus would indicate the administration of miconazole nitrate or ketoconazole rather than amphoteracin or natamycin, because of reduced susceptibility to these standard ocular antifungal drugs (Scott et al. Arch Ophthalmol. Jun;l 19:916-919, 2001). Paecilomyces lilacinus and P. vaήotii both display a high level of resistance to amphoteracin and natamycin, which are the standard initial drugs of choice for ocular fungal infections. Because of the delay in appropriate treatment regimens for species of Paecilomyces, the visual outcome for affected patients is usually poor (Pettit et al. Arch Ophthalmol 98:1025-1039, 1980; Levin et a!. Ophthalmic Surg 18:217-219, 1987; Scott et al. Arch Ophthalmol. Jun;l 19:916-919, 2001). A number of Candida spp. has shown resistance to flucytosine, fluconazole and itraconazole, while isolates of Aspergillus displayed resistance to itraconazole. Reduced susceptibility to interference of ergosterol biosynthesis is another way by which resistance to antifungal drugs has increased. In a study of fungal susceptibility to antifungal drugs, Marangon et al. (Am J Ophthalmol. 137:820-825, 2004) found resistance levels ofup to 30% when testing a variety of ocular fungal pathogens including Fusarium spp., Colletotrichum spp. Paecilomyces spp., Phialophora spp. and Candida spp. isolates. The least effective antifungal drug was itraconazole followed by amphoteracin, ketoconazole and voriconazole. Based on these studies, identification of the fungi at species level is imperative as different species present different profiles regarding to antimycotics. Species identification via the systems and methods described herein will aid the clinician to select the adequate treatment based on species susceptibilities to antifungal agents but will allow and promote expansion of current guidelines for therapeutic management. Furthermore, species level identification can have epidemiological importance in tracking point- source outbreaks and can uncovered possible outbreaks of unusual species.
Kits
[0045] Described herein are kits for identifying and detecting ocular and amoebic pathogens (e.g., Candidas spp, Fusarium spp and Acanthamoebas) in a sample. A kit for detecting a particular species of ocular fungal or amoebic pathogen in a biological sample can include, for example, probe-coupled microspheres, microsphere diluent (TE buffer), hybridization buffer
e.g., u er , repor er so u ion e.g., s rep avi m-p ycoery-n,rin , iounyiaiea primer se s; and instructions for use. In a typical embodiment, a kit for use in the xMAP™ platform system includes an ocular tissue (e.g., a corneal scraping, a corneal biopsy) test for the rapid identification of ocular fungal and amoebic pathogens. Generally, a kit as described herein includes packaging and instructions for use. In some embodiments, the kit includes a sterile container which contains one or more probes as described herein; such containers can be boxes, ampules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments.
[θ§46] Probes are integrated and consolidated into a single universal platform that can be employed as a detection kit for ocular pathogens. A homogeneous set of stringent conditions that allows the probe testing in a multiplex universal platform is provided. Fusarium spp, Candida spp and Acanthoamoeba spp probes were integrated into a single platform as described in the Examples below. However, probes to any combination of fungi and/or amoebic pathogens can be constructed according to the methods described herein. In addition, probes to any bacteria, virus, or other pathogenic organisms can be used. A kit as described herein can be used to detect ocular and/or amoebic pathogens in a number of different samples, including both biological and non-biological samples. For example, a kit can be used to detect contaminants in contact lens solution.
Species Identified by Systems and Methods for Identifying Ocular Pathogens [0047] The systems, kits and methods described herein can be used to detect and identify a number of ocular pathogens. As many as 105 fungal species, representing over 56 different genera, have been associated with oculomycosis. However, the most common fungal species involved with the disease are ubiquitous and saprophytic fungi such as: Fusarium, Aspergillus, Acremoniutn, Curvularia, Phialophora, followed by the yeast like fungi of the genus Candida and other hyaline and dematiaceous hyphomycetes. Dematiaceous fungi, such as Curvularia spp. and Bipoiaris spp., have been reported as the third most important cause of keratitis in a number of studies (Garget al. Ophthalmology 107:574-580, 2000;.Gopinathanetal. Cornea 21 :555-559, 2002). Some yeasts species such as Candida, Rhodolυrula and Cryplococcus have also been linked with the disease (Li et al. Ya Ke Xue Bao: 1998:14:229-231 , 1998; Dorko et al. Folia Microbiol. (Praha) 46: 147-150, 2001; Garelick et al. Cornea. 23:730-731, 2004). Other organisms that also have been associated with ocular infections are Acanthamoeba, free-living
. . , air, fresh and brackish water. Despite their wide cosmopolitan distribution, they are known to act as opportunistic etiological agents in humans and animals. This protist can produce fatal brain infection in immunocompromised patients and can also induce Acanthamoeba keratitis (AK), a serious sight-threatening infection of the cornea (Seal D.V., AJ Brown and J Hay. Ocular infection. Investigation and treatment in practice. Martin Dunitz Ltd. London, United Kingdom, 1998). The latter infection is more common with contact lens wearers who practice poor sanitation procedures. Also, exposition to contaminated water sources can promote AK. It has been estimated that -90% of Acanthamoeba keratitis has been associated with contact lens wearers. The disease has also been reported in non contact lens wearers (Sharma et al. Arch Ophthalmol: 108:676-78, 1990). Acanthamoeba keratitis poses a diagnostic challenge because of its similarity to fungal and viral keratitis. The disease is often misdiagnosed as herpes simplex keratitis. If left untreated, the amoebae can penetrate the cornea, and subsequently, perforate the eye.
[0Θ48] There is ample evidence in the literature about new species emerging as new mycotic ocular agents (Guarro et al. J- Clin. Microbiol. 37:4170-4173, 1999, Guarro et al. J. Clin. Microbiol. 38:2434-2437, 2000; Guarro, etal. J. Clin. Microbiol.40:3071-3075, 2002; Guarro et al. JCM 41:5823-5826, 2003). The emergence of less common pathogens is an issue since clinicians are often unfamiliar with these mycotic agents. To address this problem, the systems and methods described herein include probes that cover different taxonomic levels. By using a hierarchical approach, in which group-specific probes (genera or clusters within genera) are used in conjunction with species-specific probes, the new emergent pathogens can be identified.
Luminex™ Devices, Systems, and Methods of Use
[0049] The methods and systems described herein for identifying an ocular pathogen in a sample involving a multiplex bead suspension array approach, which employs Luminex™ instrumentation and xMAP™ technology, can significantly improve and provide a positive impact in the diagnosis of ocular diseases. Luminex xMap™ is a specialized flow cytometer that can detect 100 different analytes in a reaction tube/well at a rate approx 0,47min/well. The technique employs a 96 well format, therefore, 100 different analytes can be tested in each of the wells. The system uses multiple color fluorescent microspheres by varying the proportion of red and infrared fluorescent dyes within microspheres to create an array of up to 100 separate bead
ass auons, eac o w c prese s ng e sp . i m . technologies are commercially available from Luminex Corporation (Austin, TX).
EXAMPLES
[0050] The present invention is further illustrated by the following specific examples. The examples are provided for illustration only and should not be construed as limiting the scope of the invention in any way.
Example 1 - Development and testing of Fusar iutn spp, Acanthoemaba and Candidas spp probes [0051] Genotyping. Clinical isolates from 39 confirmed Acanlhamoeba keratitis and 58 confirmed Fusarium keratitis cases were genotyped to assess the prevalent isolates causing infections. All but one of the Acanthamoeba isolates were genotyped to the T4 clade, the sole outlier belonged to the T5 clade. For the Fυsariums, 44 isolates genotyped to the F. solani spp complex, 9 to the F. oxysporum spp complex, 3 to the F. incamatum-Qqmsetl spp and 2 to the F. dimerum spp complex. Of interest, is the correlation observed between the taxonomic groups and antifungal sensitivity data observed in a separate study conducted at BPEI validating the urgent need for a high-throughput detection method capable of identifying the etiological agent at species level. The sequence data was used to develop a database on which probes were generated. [0052] The relationship between the taxonomic groups, antifungal sensitivity data, and clinical outcomes was explored. It was found that F. solani isolates are more resistant to the available antifungal medications than F, non-solani isolates. (Table 1) Furthermore, this study validated the urgent need for a high-throughput detection method capable of identifying the ethiological agent at species level by demonstrating that infections caused by F. solani isolates result in significantly worse visual acuity, a longer time to cure, and are more prone to require corneal transplant than corneal infections from F. non-solani isolates (Table 2). In summary, these observations emphasize the clinically important differences between F. solani and F. non- solani infections and suggest that rapid and accurate differentiation of these two organisms (which is very difficult and unreliable using standard microbiologic techniques) will impact treatment decisions and will likely improve clinical outcomes in patients harboring such infections. By providing accurate and rapid species identification of the organisms responsible for corneal infections, physicians will be able to treat these infections sooner, more effectively and appropriately.
a e - orre a ion o ug m o oricon ,
o a
Natamycin between F, solani and F. non-solani isolates.
Voriconazole Amphotericin B Natamycin
F. solani 16* 2 4.8
F. non-solani 2 4.8
*P<0.01 (Fischer's exact test) MIG>o values after 48 hours
[0054] Table 2 - Comparison of clinical outcomes between F. solani and F. non-solani infection cases.
Species Initial VA Final VA Time to cure Need of urgency
(days) Penetrating keratoplasty LogMAR (Snellen) LogMAR (Snellen)
F. solani 0.91 (« 20/160) 0.89 (« 20/160) * 79* 7 cases
F. non-solani 0.84 (^ 20/140) 0.27 (~ 20/40) * 46* *ρ<0.01 (T-test)
[0055] Development and testing of Fusarium spp, Λcanthoemaba and Candidas spp probes. A total of 5 probes were tested and validated for the detection of ' Acanthamoeba spp, 5 for the Fusarium spp. and 7 for Candidas spp. (Table 3). In view of intraspecies sequence variability within some C. albicans strains, three probes ie, Pcalb7; Pcalb7b; Pcalb2 were developed to target various C. albicans populations. Pcalb2 is a generic probe that targets all variants of C. albicans strains. The developed probes were successfully tested with Type strains from various culture collections as well as with archives strains from BP culture collections. Medically important species within the genus Aspergillus can be included in the array format.
[0056] Table 3. List of probes designed for the identification and detection of ocular pathogens using Luminex technology.
Pcalb2 C. albicans
Pcalb7 C. albicans
Pcalb7b C. albicans
Pctrop C. tropicalis
Pcguill C. guillermondii
Pcglab C, glabrata
Pcparap C. parapsilopsis
PT3A Acanthoamoeba spp Clade 3
PT4D Acanthoamoeba spp Clade 4
PT5 Acanthoamoeba spp Clade 5
PGRPl Acanthamoeba group 1 (Tubiashi spp, ,Astronixis spp., Comandoni spp.)
PGenus GRPl Acanthoamoeba genus probe (excluding Type 1 )
PFSSC Fusarivm solani species complex
PFOSC F. oxysporum species complex
PFNSSC F. non solani species complex
PFΪESC F. incarnatum-equiseti species complex
PFDSC F. dimerum species complex
[0057] Specificity of the assay. Each species-specific, genotype-specific and cluster- specific probe was blasted against GenBank. Once the universal specificity of the probe was established, validation and optimization of the probes was tested with a capture hybridization format using xMAP. Each probe was tested against the complementary target amplicon and negative controls. FIG. IA and IB illustrate the specificity of the assay. In this particular assay, the developed Candida probes were tested against closely and non-closely related species. Two different PCR- based methods were used to amplify target sequences: symmetric PCR to generate dsDNA PCR products and asymmetric PCR to generate ssDNA PCR products. When using both assay formats, the probes successfully hybridized their respective targets. No significant cross reactivity was found with non-target species. However, a slight cross reactivity was found when ATCC 90028 and CaIb str# 1 were challenged with Pcalb7b. Both strains differed from the probe sequence by a single bp. This slight cross reactivity could be attributed to allelic variations within tandem repeats copies of rRNA gene. In contrast, species like C. sojoae (Yl 7909) and A. niger, which
. ι , , reactivity with any of the probes.
[Θ058] Hybridization Assay Optimization. Different PCR formats and PCR conditions were explored in order to optimize assay conditions. Toward this end, the performance of Pctrop, Pcparap, Pcgmller and Pcglabr were tested with amplicon targets that were generated using two different PCR methods: symmetric versus asymmetric (FIG. 2A and 2B). The results consistently showed higher median fluorescence intensity (MFI) values for probes that were challenged with asymmetric PCR products. For instance, assay conditions that used asymmetric PCR products and a total of 45 cycles, produced a significant enhancement in signal intensity. The enhancement in signal intensity ranged from 50 to 70%. Similar results were documented for Pcalb2 and Pcalb7b (FIG. 2B). The results appear to suggest that asymmetric PCR preferentially generated single-stranded DNA products through the extension of the higher-concentration biotinylated reverse primer. This in turn, appeared to increase the binding efficiency of the target to the complementary probe-labeled microsphere, thus, generating high fluorescent intensity. [0059] Detection Limits of the assay. The detection limits of the assay were assessed for Acanthoamoeba and Fusarium. Preliminary data showed a repeatable detection limit of 100 amoebas and conidia per sample. However, after optimization of assay conditions, the analytical sensitivity levels were improved and ranged from 1 to 10 conidias/sample {Fusarium) and 10 amoebas/sample {Acanlhoamoebas). If clinical specimens do not provide the expected level of detection, a signal amplification method can be incorporated that has been successfully developed for the detection of harmful algal blooms in pre-blooming conditions (Diaz et al 2010 "Molecular detection of harmful algal blooms (HABs) using locked nucleic acids and bead array technology." Limnol. Oceanogr. Methods (In Print)). See FIG. 3
|0060] This multiple labeling system (Mirus Label IT) allows the incorporation of multiple biotin moieties in the sample (target DNA). Using this signal amplification system, a dramatic increase in signal intensity ranging from 60 to 80% was demonstrated. For example, FIG. 5 displays two labeling methods used for the detection of K. brevis and K. mikirnotoi. Note the significant enhancement of signal intensity when Mirus labeling IT system is used as opposed to the 5 'end PCR method.
[Θ061] Multiplex Assay. To test the multiplex capability of Luminex technology, the developed sets of probes were mixed and tested using different multiplex formats consisting of 7- plex or lβplex (7 plex = 7 probes in a single reaction; 16plex = 16 probes in a single reaction).
The signal intensities of probes tested in various plex formats were not significantly different,
mons ra e e p i probes without compromising the fluorescent signal.
[0062] Multiplex PCR. Because probes were developed in two different loci of the rDNA gene (ITS and D 1 D2) and in order to avoid the preparation of various PCR reactions for a given set of samples, major efforts were given to design a multiplex PCR format that would accommodate all primer sets. The main goal was to allow the simultaneous amplification of all loci in a single reaction. After a myriad of optimization steps, which involved the testing of relative concentration of primers, concentration of PCR buffer and PCR parameters such as: number of cycles, cycling temperatures and time intervals (annealing and extension), successful amplification of all regions of interest using three primer sets was achieved. Because higher MFI values were attained when primer sets were used in unequal concentrations (asymmetric PCR), the developed assay used non-equimolar concentrations of each of the primer sets. FIG.4 shows that all tested probes hybridized well with their respective targets, demonstrating the multiplex capability of the assay (note the inclusion of Comandoni spp (TIV), Tubiashi spp and Astronyxis spp). The tested probes showed robust signal intensities ranging from ~ 470 to 2550 MFI. An exception was PTSnew, which failed to generate a signal. A failure in coupling reaction or a secondary structure around the probe-binding site could explain the outcome of this result. A new probe PGRPl was included in the multiplex assay. This particular probe was designed to target species within the clade Acanthamoeba group 1: Tubiashi spp., Astronixis spp., Comandoni spp.T. The documented MFI values for the species were: Comandoni spp: 241-266; Tubiashi spp: 699-789 and Aslronyxis spp 826-1280. have been tested.
Example 2 - Design and validate species-specific and cluster probes for the identification of clinically important ocular pathogens including Acremonium, Colletotrichum, Curvularia, Lasiodiplodia and Paecilomyces.
[0063] Probes will be designed for genera or clusters within genera. Focus on species or strain-specific probes will be developed based on results from clinical studies. The need for generic and cluster probes is due to the extensive species and strain variability exhibited by some of these fungi.
[0064] DNA extraction from pure culture: DNA extraction from pure cultures in the culture collections at BPEI, will use the boiling extraction method or the protocol described by Fell et al. (Int. J. Syst Evol. Microbiol. 50:1351-1371, 2000). Fungal species will be isolated from ocular samples taken by corneal scrapings and biopsies as well as from anterior chamber and vitreous fluids. These isolations will be undertaken at BPEI. The specimens will be streaked on Saborouds Dextrose Agar plates and incubated for 1 - 5 days. The culture plates will be examined periodically for the presence of filamentous fungi and yeasts. DNA extracted from isolated fungi will be tested to expand the diversity of species/strains and to validate the probes and multiplex analysis. Clinical specimens are expected to be obtained at a rate of 20-30 samples per month. The DNA from these samples will be isolated, properly stored, and amplified using the multiplex PCR assay format described herein. The amplified products will be used to validate probes in preparation for widespread clinical use.
[0Θ65] Cycle Sequence Analyses. Amplification and cycle sequences of different genes e.g., D1/D2, and ITS will use primers combinations as described in the literature (Fell et al. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000; Diaz, M. R., J. W. Fell, T. Boekhout, and B. Theelen. Syst and Appl. Microbiol. 23: 535-545, 2000; , 2000 Peterson 2000a, b; Peterson SW. Phylogenetic relationship in Aspergillus based on rDNA sequence analysis, pp: 323-355, 2000, in: Robert A, Samson and John I Pitt (eds), Integration of Modern Taxonomic Methods of
. . , , .; 2000b; Phylogenetic analysis of P enicillium species based on ITS and LSU-rDNA nucleotide sequences, pp. 163-178 in: Robert A. Samson and John ϊ Pitt (eds), Integration of Modern Taxonomic Methods of P enicillium and Aspergillus Classification, Harwood Acad. Publishers, UK; Kurtzman, CP, Fell JW, The Yeasts, A Taxonomic Study, 1998, 4th Edition, 1055 pgs Elsevier, Amsterdam). After purification with a Qiagen kit, the amplicons are sequenced using the primer sets F63/R635 for the D 1 /D2 region and ITS 1 /ITS4 for the ITS region. Cycle sequence analysis will be undertaken with 3730 ABI Sequencer using the manufacturer protocol. Sequences will be aligned with MegAlign (DNAStar) arid visually corrected with the Aligner Program (Li-Cor). Phylogenetic analysis will be done with PAUP*4.0bl0 using Parsimony analysis, random step-wise addition and tree bisection-reconnection.
[0066] Probe design and development based on computer analyses. Probe design at species and group/clade level will be based on sequence data generated from D1/D2 and ITS 1&2 regions. Probe selection will be facilitated employing Megalign Program (DNAStar). The quality of the probe will be assessed using the software program OHgoTM (Molecular Biology Insights Inc.). This program provides the parameters (e.g., Tm values by nearest neighbor algorithm, hairpin structures, primer-dimer structures, GC content and delta G) necessary to test the quality of the capture probe. The specificity of the prospective sequence will be analyzed with sequences deposited in GeneBank using BLAST. Further probe validation will be achieved by testing the performance of the probe on a capture probe hybridization format such as that described below within Example 2. If the probe does not meet the specific requirements, another sequence will be selected. For more detail about probe development see (Diaz and Fell J. Clin. Microbiol. 42:3696-3706, 2004).
[0067] Probe validation. Validation and optimization of probes will use a capture hybridization assay format with the xMAP system. Once the probes have been designed and validated employing computer programs and public domain databases, the probes will be validated on a captured probe hybridization format as described below. The probes will be covalently coupled to the microspheres using a carbodiimide method (Fulton et al. Clin. Chem. 43:1749-1756, 1997). To optimize the assay conditions, different probe concentrations will be tested from O.lnmol to 0.5nmoles. For each color coded microsphere a specific capture probe will be assigned. [0068] The probe validation will be carried out in a single stringent condition. The probes that fail this test will be modified. If the probe fails, it will be redesigned. DNA sequence
u redesign. Modified probes will be synthesized with bases sequentially removed or added from the 3' and 5' end of the original probe. Newly re-designed probes will be tested against a control panel consisting of probe variants. If the probe valiants fail, anew sequence will be selected and will be subject to the same assay protocol.
[0069] Probe optimization and specificity. Following the acceptance of a probe motif, the probe concentration will be optimized for signal intensity through a series of titrations. The specificity of each probe will be tested against the complementary target amplicon and a selective library of amplicons representing closely and non-closely related species. The selected amplicons will contain a variety of polymorphic sites.
[0070] PCR reaction. PCR reaction will use universal primers, which are common to all fungi. The primers will target the ribosomal DNA rDNA regions: 1) D1/D2 LrDNA; and2) ITS regions. The primer combination for the D1/D2 will employ (F63 and R635) and for the ITS I & ITS II regions: (ITS5 and 5.8S; or ITS 1 and ITS4) . All reverse primers will be biotinylated at the 5 'end and the reaction uses QIAGEN HotStar Taq (QIAGEN Inc.). Sequences description and detailed PCR conditions are described in Diaz and Fell (J. Clin. Microbiol.42:3696-3706, 2004). The first stage of the probe validation will use PCR amplicons generated with single set of primers. However, in order to analyze multiple loci in one reaction, a multiplex PCR reaction containing all primers sets will be employed and optimized. The optimization which, will be undertaken with a MJ Research PTC 100 thermocycler, require titrations of magnesium chloride, annealing temperatures and primer concentration. A set of blanks with no DNA, will be included to monitor any potential contamination of the PCR. reagents An agarose gel electrophoresis is performed to confirm the synthesis of amplicons. Following this protocol a panel of characterized amplicons are prepared from a selection of species in the probe design. The characterized amplicons will include positive, negative and cross- reactive groups. This step is followed by a capture-probe hybridization assay, which is described below and for more details see Diaz and Fell (J. Clin. Microbiol 43:3662-3672, 2005; J. Clin. Microbiol. 42:3696-3706, 2004). [0071] Hybridization Assay. The captured probe hybridization assay will be based upon detection of 5'biotin labeled PCR amplicons by hybridization to specific capture probes, which are covalently bound to the carboxylate surface of the microspheres. The addition of a fiuorochrome group coupled to a reporter molecule allows quantification of the hybridized target. The assay involves the addition of denatured biotinylated amplicon into a stringent hybridization buffer containing the microsphere mix. Approximately 2500 microspheres of each set of probes
p r i . , amplicoiis are labeled and incubated for 5 min with streptavidin Rphycoerythrin. Afterwards, the sample is washed with the hybridization buffer and analyzed on the Luminex 100, This system quantifies and determines the MFI of the counted microspheres, which corresponds to the number of targets bound. At least, 100 microspheres of each set will be analyzed by the system. This will result in 100 replicate measurements. Categorization of the microspheres is achieved by their unique internal fluorescent spectra.
[0072] Modification on hybridization conditions will be performed as needed. The aim is to create a homogeneous set of stringent conditions that will allow the probe testing in a multiplex format.
[0073] Assay detection limits. The limits of detection of the assay will be determined by serial dilutions of genomic DNA or cell counts. Statistical analysis such as median and standard deviations will be calculated. Blanks will be substracted from the actual readings. [0074J Multiplexed assay. The multiplexed assay will contain all the probes that followed the assay criteria when tested individually. Initially, the multiplex tests will include mixes of different microspheres in multiples of five, which will then be combined to a maximum of 100 different probes per well. The goal is to mix as many different species- specific and group specific probes in a multiplex reaction after the specificity of the probes and the optimal conditions for the captured probe hybridization assay have been determined separately in a non-multiplexed format. [0075] Data collection and analysis. The data acquired by Luminex 100 flow cytometer, which is interfaced to a PC computer, performs real data processing, allowing multiple reactions to be analyzed simultaneously. Individual sets of microspheres are analyzed by a dual laser system. For each probe, one hundred microspheres, will be counted and the MFI value is calculated and reported in the Median mode of the Acquisition Detail Tab of the Luminex IS Software. Data will be presented as the average of the median.
Example 3 - Adapt and modify the culture-based method into a direct detection method, which can be readily employed with ocular clinical specimens
[0076] The working specimens will be available as freshly collected samples and frozen archived samples from the BPEI collection. The samples will be de- identified, with new, unknown codes obtained from patients of the Cornea Service of Bascom Palmer Eye Institute, Samples will be divided for molecular testing and for confirmation with standard culture techniques. Clinical eye conditions will include corneal scrapings, corneal and conjunctival tissue
, uua, αuu UVCIUWB, addition, samples will be obtained from individuals with healthy eyes including patients that wear contact lenses.
[0077] DNA extraction. The first step will involve DNA extraction of the clinical specimens. Optimization of DNA extraction methods have been already undertaken. For example, using a boiling method or the lysing enzyme method (Trichoderma harzianum and QIAamp Tissue kit extraction (Qiagen), we successfully isolated yeast and filamentous fungal DNA from culture and non-cultured based clinical material. Both methods will be tested with the new fungal species. If needed, the methods will be further optimized.
[0078] PCR Reaction (clinical specimens). PCR reaction will use a similar protocol as described in Example 2. However, certain modifications to PCR conditions and reagents may be necessary to achieve maximum sensitivity and reproducibility. To alleviate some inhibitory effects of clinical specimens to PCR reactions, 0.5% BSA will be added to DNA extracts. [0079] Hybridization Assay. Clinical derived ampiicons will be tested using the hybridization protocol described in Example 2. Depending on the hybridization efficiency, the assay protocol will be modified accordingly. Assay reproducibility and multiplex capability will use the approach as described in Example 2.
[0080] In the event that some of the selected primers do amplify, two factors assist the assay: 1) human rDNA is larger than fungal rDNA and smaller DNA fragments are preferentially amplified during PCR5 2) the Luminex system is designed to target specific DNA in a mixed community of ampiicons. This feature is employed in our environmental research where we target specific harmful algal blooms and sewage indicators in seawater with communities of hundreds of different species of prokaryotes; b) low concentrations of target DNA can become a critical factor with some clinical specimens.
[Θ081] To increase sensitivity without loss of multiplexing, sensitivity will be increased by enhancing the fluorescent signal. The approach involves the incorporation of multiple biotin labeled moieties in the target DNA. As opposed to 5 'end labeling, which incorporate only one biotin molecule in the target DNA, Mirus label IT technique allows the covalent attachment of biotin molecules to N7 guanine, N3 of adenine and N3 of cytosine. This non-enzymatic direct chemical labeling system (FIG. 6) is currently used in our laboratory for the detection and identification of harmful algal blooms and it has a labeling efficiency of one marker molecule for eveiy 20 to 60 nucleotides. Using this promising application, a remarkable signal enhancement ranging from 70-80% was observed. FIG. 5 illustrates that Mirus Label IT, as opposed to 5 'end
incorporated on any reactive heteroatom in the polynucleotide. Based on these results, we are confident this technology can be merged to our current assay to create a powerful method for the detection of ocular pathogens in clinical specimens.
Other Embodiments
[0082] Any improvement may be made in part or all of the compositions, kits, and method steps. All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended to illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. For example, although the experiments described herein involve detection of ocular etiological agents (pathogens), the compositions, kits and methods described herein can find use in a number of other diagnostic applications, including detection of pathogens associated with food safety, agriculture, sick building syndrome, homeland security, etc. Any statement herein as to the nature or benefits of the invention or of the preferred embodiments is not intended to be limiting, and the appended claims should not be deemed to be limited by such statements. More generally, no language in the specification should be construed as indicating any non-claimed element as being essential to the practice of the invention. This invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly coniraindicaied by context.
Claims
.
1. A method of detecting at least one species of ocular fungal or amoebic pathogen in a biological sample comprising the steps of:
(a) obtaining rDNA from a biological sample and amplifying and labeling the rDNA with a detectable label;
(b) providing a liquid suspension comprising a plurality of microspheres to which are bound a plurality of species-specific, genotype-specific, and cluster-specific oligonucleotide probes;
(c) contacting the amplified and labeled rDNA with the liquid suspension under conditions such that the rDNA hybridize to complementary sequences in the species- specific probes;
(d) detecting hybridization of the rDNA to complementary sequences in the species-specific probes; and
(e) correlating hybridization of the rDNA to complementary sequences in the species-specific probes with the presence of at least one ocular fungal or amoebic pathogen.
2. The method of claim 1 , wherein as few as 1-10 can be detected in the sample.
3. The method of claim 1, wherein as few as 10 amoebas can be detected in the sample.
4. The method of claim 1, wherein the biological sample comprises an ocular tear film, vitreous fluid, anterior chamber biopsy or fluid, or corneal scrape.
5. The method of claim 1, wherein the detectable label is biolin.
6. The method of claim 5, further comprising a signal amplification step comprising incorporation of multiple biotin moieties in lhe plurality of species-specific, genotype-specific and cluster-specific probes.
7. The method of claim 1 , wherein the plurality of species-specific, genotype- specific and cluster-specific probes target at least one of a Fusarium species, an Acanthamoeba species, a Candidas species, and an Aspergillus species.
8. The method of claim 7, wherein the plurality of species-specific, genotype- specific and cluster-specific probes target Fusarium species, Acanthamoeba species, Candidas species, and Aspergillus species.
9. The method of claim I5 wherein the plurality of species-specific, genotype- specific and cluster- specific probes comprise C gϊabrata probes: Pcgiabr(b) TCTGCGCCTCGGTGTAGAGTG (SEQ ID NO:8) and Pcglabr (c) ACCTAGGGAATGTGGCTCTGC (SEQ ID NO:9) and C. tropicalis probes: Pctrop(b) TAGCCTTCGTCGATACTGCCAG (SEQ ID NO: 10), Pctrop(c) ATGATCCAGGCCTATGTAAAG (SEQ ID NO: 11), and Ptrop(c) TAGCCTTCGTCGATTCTGCCAG (SEQ ID NO: 12).
10. A method of detecting a particular species of ocular fungal or amoebic pathogen in a biological sample, the method comprising the steps of:
specific and cluster- specific probes that target a plurality of ocular fungal and amoebic pathogen species;
(b) covalently coupling the probes to microspheres;
(c) subjecting the microspheres and biological sample to a hybridization assay using an xMAP™ multiplex bead suspension array resulting in hybridization between at least one nucleic acid from the biological sample and at least one probe;
(d) detecting and quantifying the hybridization using a Luminex™ analyzer; and
(e) correlating the hybridization with the presence of a particular species of ocular fungal or amoebic pathogen in the biological sample.
11. The method of claim 10, wherein the sample comprises corneal scraping, corneal biopsy, vitreous fluid, or anterior chamber biopsy or fluid.
12. The method of claim 10, wherein the sample comprises DNA extracted from a culture.
13. The method of claim 10, further comprising a signal amplification step comprising incorporation of multiple biotin moieties in the plurality of species-specific, genotype-specific and cluster-specific probes.
14. The method of claim 10, wherein the plurality of species- specific, genotype- specific and cluster-specific probes target at least one of a Fusarium species, an Acanlhamoeba species, a Candidas species, and an Aspergillus species.
specific and cluster-specific probes target Fusαrium species, Acαnthαmoebα species, Candidas species, and Aspergillus species.
16. The method of claim 10, wherein the plurality of species-specific, genotype- specific and cluster-specific probes comprise C glabrata probes: Pcglabr(b) TCTGCGCCTCGGTGTAGAGTG (SEQ ID N0:8) and Pcglabr (c) ACCTAGGGAATGTGGCTCTGC (SEQ ID N0:9) and C lropicalis probes: Pctrop(b) TAGCCTTCGTCGATACTGCCAG (SEQ ID NO: 10), Pctrop(c) ATGATCCAGGCCTATGTAAAG (SEQ ID NO: 11), and Ptrop(c) TAGCCTTCGTCGATTCTGCCAG (SEQ ID NO: 12).
17. The method of claim 10, wherein the plurality of species-specific, genotype- specific and c luster- specific probes comprise probes that target Fusarium species, Acanthamoeba species, and Candidas species.
18. An xMAP™ multiplex bead suspension array comprising a plurality of species- specific, genotype-specific and cluster-specific probes that target a plurality of ocular fungal and amoebic pathogen species.
19. The xMAP™ multiplex bead suspension array of claim 18, wherein the plurality of species-specific, genotype- specific and cluster- specific probes target at least one of a Fusarium species, an Acanthamoeba species, a Candidas species, and din. Aspergillus species.
. i or e ec ng a par cu spec es o iueuiu pαuiugcu biological sample, the kit comprising:
(a) a plurality of probe-coupled microspheres;
(b) at least one buffer;
(c) biotinylated primer sets; and
(d) instructions for detecting a particular species of ocular fungal or amoebic pathogen in a biological sample.
21. The kit of claim 20, wherein the kit comprises probe-coupled microspheres, microsphere diluent, hybridization buffer, reporter solution, and biotinylated primer sets.
22. The kit of claim 20, wherein the probe-coupled microspheres comprise C glabrata probes: Pcglabr(b) TCTGCGCCTCGGTGTAGAGTG (SEQ ID NO:8) and Pcglabr (c) ACCTAGGGAATGTGGCTCTGC (SEQ ID NO:9) and C. tropicalis probes: Pctrop(b) TAGCCTTCGTCGATACTGCCAG (SEQ ID NO: 10), Pctrop(c) ATGATCCAGGCCTATGTAAAG (SEQ ID NO: 1 1), and Ptrop(c) TAGCCTTCGTCGATTCTGCCAG (SEQ ID NO: 12).
23. The kit of claim 20, wherein the probe-coupled microspheres comprise probes that target Fusarϊum species, Acanthamoeba species, and Candidas species.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17298109P | 2009-04-27 | 2009-04-27 | |
| US61/172,981 | 2009-04-27 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010126771A1 true WO2010126771A1 (en) | 2010-11-04 |
Family
ID=43032498
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/032030 Ceased WO2010126771A1 (en) | 2009-04-27 | 2010-04-22 | Systems, kits and methods of identifying ocular fungal and amoebic pathogens |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2010126771A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102943128A (en) * | 2012-10-29 | 2013-02-27 | 中国检验检疫科学研究院 | Suspension array multiple non-diagnostic detection method for mosquito vector virus |
| CN103173567A (en) * | 2013-03-27 | 2013-06-26 | 中国检验检疫科学研究院 | Suspension-array multiple non-diagnostic detection method for tick-borne pathogens |
| ES2932995A1 (en) * | 2021-07-22 | 2023-01-30 | Ocupharm Diagnostics Sl | Eye parasite detection system |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5707802A (en) * | 1995-01-13 | 1998-01-13 | Ciba Corning Diagnostics Corp. | Nucleic acid probes for the detection and identification of fungi |
| US20050260584A1 (en) * | 2001-09-26 | 2005-11-24 | Lindsley Mark D | Nucleic acids for the identification of fungi and methods for using the same |
| US20060129327A1 (en) * | 2004-07-29 | 2006-06-15 | Kim Myung L | Ultrasensitive sensor and rapid detection of analytes |
| US20060216723A1 (en) * | 2004-05-21 | 2006-09-28 | University Of Miami | High through-put detection of pathogenic yeasts in the genus trichosporon |
| US20060275809A1 (en) * | 2005-05-17 | 2006-12-07 | University Of Miami | Rapid identification of the varieties and genotypes of cryptococcus neoformans species complex using a high-throughput flow cytometer |
| WO2008135931A2 (en) * | 2007-05-04 | 2008-11-13 | STAB VIDA, Investigação e Serviços em Ciências Biológicas, Lda | Kit and method for the detection and identification of clinically relevant yeasts, using an isothermal dna amplification followed by the hybridisation to species- specific oligonucleotide probes, and respective applications |
-
2010
- 2010-04-22 WO PCT/US2010/032030 patent/WO2010126771A1/en not_active Ceased
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5707802A (en) * | 1995-01-13 | 1998-01-13 | Ciba Corning Diagnostics Corp. | Nucleic acid probes for the detection and identification of fungi |
| US20050260584A1 (en) * | 2001-09-26 | 2005-11-24 | Lindsley Mark D | Nucleic acids for the identification of fungi and methods for using the same |
| US20060216723A1 (en) * | 2004-05-21 | 2006-09-28 | University Of Miami | High through-put detection of pathogenic yeasts in the genus trichosporon |
| US20060129327A1 (en) * | 2004-07-29 | 2006-06-15 | Kim Myung L | Ultrasensitive sensor and rapid detection of analytes |
| US20060275809A1 (en) * | 2005-05-17 | 2006-12-07 | University Of Miami | Rapid identification of the varieties and genotypes of cryptococcus neoformans species complex using a high-throughput flow cytometer |
| WO2008135931A2 (en) * | 2007-05-04 | 2008-11-13 | STAB VIDA, Investigação e Serviços em Ciências Biológicas, Lda | Kit and method for the detection and identification of clinically relevant yeasts, using an isothermal dna amplification followed by the hybridisation to species- specific oligonucleotide probes, and respective applications |
Non-Patent Citations (1)
| Title |
|---|
| JAEGER ET AL.: "Rapid Detection and Identification of Candida, Aspergillus, and Fusarium Species in Ocular Samples Using Nested PCR.", J OF CLINICAL MICROBIOLOGY, vol. 38, 2000, pages 2902 - 2908 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102943128A (en) * | 2012-10-29 | 2013-02-27 | 中国检验检疫科学研究院 | Suspension array multiple non-diagnostic detection method for mosquito vector virus |
| CN103173567A (en) * | 2013-03-27 | 2013-06-26 | 中国检验检疫科学研究院 | Suspension-array multiple non-diagnostic detection method for tick-borne pathogens |
| ES2932995A1 (en) * | 2021-07-22 | 2023-01-30 | Ocupharm Diagnostics Sl | Eye parasite detection system |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2008256216B2 (en) | A novel method for simultaneous detection and discrimination of bacterial, fungal, parasitic and viral infections of eye and central nervous system | |
| US7906286B2 (en) | Probe set, probe carrier, and method for determining and identifying fungus | |
| US20190284618A1 (en) | Polynucleotides for the amplification and detection of neisseria gonorrhoeae | |
| US20090246767A1 (en) | Compositions and methods for detecting Cryptococcus neoformans | |
| WO2020114998A1 (en) | Compositions and methods for detection of candida auris | |
| WO2010126771A1 (en) | Systems, kits and methods of identifying ocular fungal and amoebic pathogens | |
| US9745636B2 (en) | SWI5 gene as a diagnostic target for the identification of fungal and yeast species | |
| US20050064451A1 (en) | Methods and compositions for the detection of bacterial species | |
| US9944996B2 (en) | eIF2γ gene as a diagnostic target for the identification of fungal and yeast species | |
| Man et al. | Candida Identification and Genotyping-A Challenge for the Medical Laboratory | |
| EP2294220B1 (en) | P2/p2a/p2b gene sequences as diagnostic targets for the identification of fungal and yeast species | |
| JP2011522555A (en) | Ace2 as a target gene for molecular identification of fungal and yeast species | |
| Baranov et al. | POSSIBILITIES OF PHYTOPHTHORA IDENTIFICATION AS A GROUP OF NEW AND ECONOMICALLY IMPORTANT PATHOGENS IN FORESTRY | |
| HK1206396B (en) | A novel method for simultaneous detection and discrimination of bacterial, fungal, parasitic and viral infections of eye and central nervous system | |
| IES85514Y1 (en) | Ace2 as a target gene for the molecular identification of yeast and fungal species. | |
| HK1133282A (en) | A novel method for simultaneous detection and discrimination of bacterial, fungal, parasitic and viral infections of eye and central nervous system | |
| IES85506Y1 (en) | P2/P2A/P2B gene sequences as diagnostic targets for the identification of fungal and yeast species. | |
| IES85505Y1 (en) | SWI5 gene as a diagnostic target for the identification of fungal and yeast species | |
| IE20090466U1 (en) | P2/P2A/P2B gene sequences as diagnostic targets for the identification of fungal and yeast species. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10770144 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10770144 Country of ref document: EP Kind code of ref document: A1 |
