WO2010123784A2 - Conversion of chitin into n-acetylglucosamine, glucosamine and bioethanol - Google Patents

Conversion of chitin into n-acetylglucosamine, glucosamine and bioethanol Download PDF

Info

Publication number
WO2010123784A2
WO2010123784A2 PCT/US2010/031504 US2010031504W WO2010123784A2 WO 2010123784 A2 WO2010123784 A2 WO 2010123784A2 US 2010031504 W US2010031504 W US 2010031504W WO 2010123784 A2 WO2010123784 A2 WO 2010123784A2
Authority
WO
WIPO (PCT)
Prior art keywords
mutant
chitin
acetylglucosamine
bacterium
gicnac
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2010/031504
Other languages
French (fr)
Other versions
WO2010123784A3 (en
Inventor
Saul Roseman
Xibing Li
Donald Comb
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
New England Biolabs Inc
Johns Hopkins University
Original Assignee
New England Biolabs Inc
Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by New England Biolabs Inc, Johns Hopkins University filed Critical New England Biolabs Inc
Priority to US13/264,273 priority Critical patent/US9267141B2/en
Publication of WO2010123784A2 publication Critical patent/WO2010123784A2/en
Publication of WO2010123784A3 publication Critical patent/WO2010123784A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P39/00Processes involving microorganisms of different genera in the same process, simultaneously
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06Ethanol, i.e. non-beverage
    • C12P7/08Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00Technologies for the production of fuel of non-fossil origin
    • Y02E50/10Biofuels, e.g. bio-diesel

Definitions

  • chitin fibrils embedded in a matrix of highly cross-linked, insoluble protein(s) make up a significant fraction of the cuticles of arthropoda, annalida, mollusca, and the cell walls of many fungi and yeasts.
  • Each chitin fibril molecule consists of a straight chain of over a thousand N-acetylglucosamine (GIcNAc) monomers linked by ⁇ ,l-4 bonds similar to beads on a string. These fibril molecules are cross-linked via hydrogen bonds to each other, giving enormous strength to the fibers.
  • Native chitin also contains a small percentage of glucosamine (GIcN). Harsh chemical methods (acid and alkali) are used to isolate chitin, thus yielding an increased quantity of glucosamine in the polymer.
  • chitin is purified from invertebrate cuticles by a process that includes using dilute acid to remove the calcium from the cuticles, followed by repetitive hot strong alkali treatment, and acid extraction to remove the highly insoluble protein matrix that surrounds the chitin in the cuticles. Chitin can then be completely hydrolyzed to GIcN by refluxing it with 4N-6N HCI for 16 hours or more. The GIcN, HCI salt must then be purified, which is accomplished by fractional crystallization or ion-exchange chromatography. Thus, the chemical isolation of GIcN as an HCI or sulfate salt is expensive and is a high energy-consuming chemical procedure presenting ecological problems associated with the disposal of large volumes of waste products.
  • a new method of fermentation that could convert chitin into GIcNAc or GIcN on an industrial scale would facilitate the preparation of medicines and would also provide an alternative bioavailable source of sugars. Additionally, it would be valuable if these sugars could be converted to ethanol.
  • a composition in an embodiment of the invention, includes a genetically engineered mutant bacterium in which one or more genes have been deleted or inactivated or their expression product rendered inactive, such that the mutant bacterium is capable of converting chitin to products including N-acetylglucosamine but is not capable of substantially degrading glucosamine and N-acetylglucosamine. These products are preferably released into the extracellular growth medium.
  • one or a combination of the following genes or their equivalents are deleted or inactivated.
  • operon or combination of operons selected from NagACE operon, chitin operon including the periplasmic (GIcNAc) 2 binding protein, and chitibiose operon; or NagB.
  • chitin catabolic sensor ChiS is not inactivated. Rather, it preferably becomes constitutively activated.
  • An example of a mutant bacterium includes a mutant gram negative bacterium for example a mutant Vibrionaceae for example a mutant Vibrio species for example a mutant of Vibrio alginolyticus (V. alginolyticus), Vibrio cholerae (V. cholerae) and Vibrio furnissii (V. furnissii) .
  • a mutant gram negative bacterium for example a mutant Vibrionaceae for example a mutant Vibrio species for example a mutant of Vibrio alginolyticus (V. alginolyticus), Vibrio cholerae (V. cholerae) and Vibrio furnissii (V. furnissii) .
  • the chiti ⁇ referred to throughout may be environmental chitin such as is found in invertebrates such as arthropods, mollusks and annelids; fungi; and algae.
  • chitin can be found in the cuticles or exoskeletons of invertebrates and in the mycelium and cell walls of fungi.
  • the chitin may be obtained from a purified or semi-purified source.
  • a method in which the mutant bacterium described above is used to obtain products that comprise at least one of N-acetylglucosamine and glucosamine.
  • the method includes (a) adding the mutant Vibrio species to an extracellular medium comprising chitin; (b) converting the chitin into products comprising N-acetylglucosamine by means of the mutant Vibrio species; and (c) obtaining at least one of N-acetylglucosamine and glucosamine in the extracellular medium.
  • the N-acetylglucosamine in the extracellular medium can be purified on an activated charcoal column.
  • N-acetylglucosamine can be converted to glucosamine by acid hydrolysis or by means of a deacetylase.
  • a method for forming a mutant bacterium exemplified by a mutant gram negative bacterium exemplified by a mutant Vibrionaceae exemplified by a mutant Vibrio species such as mutants of V. alginolyticus, V. cholerae, or V. furnissii.
  • the method includes (a) obtaining a bacterium from a source; (b) knocking out or inactivating one or more genes for expressing at least one protein from one or both of a signal transduction system and a chitin degradative pathway in the bacterium, exemplified by part or all of an operon or a combination of operons selected from NagACE operon, chitin operon including the periplasmic BP, but not ChiS which is preferably constitutively activated and chitobiose operon (ChB) or NagB; and (c) forming a mutant bacterium as described above.
  • the source of the bacterium may be the environment such as a terrestrial environment, an aqueous environment such as a marine environment; a hospital patient; or a culture collection such as provided by the ATCC.
  • the product of the method of forming a mutant bacterium is an organism that is capable of hydrolyzing chitin contained in a growth medium and producing N-acetylglucosamine and/or glucosamine.
  • a method in which a mutant bacterium such as described above is used in a process to make ethanol .
  • the method includes: (a) adding the mutant bacterium to a medium that comprises chitin; (b) converting the chitin into a product that comprises comprising extracellular N-acetylglucosamine by means of the bacterium; and (c) converting the N-acetylglucosamine into ethanol by additional fermentation, for example, using genetically engineered yeast cells.
  • the extracellular N-acetylglucosamine can be harvested and then added to a culture of genetically engineered yeast cells so as to convert the N-acetylglucosamine into ethanol.
  • genetically engineered yeast may be added to the mutant bacterium in growth medium at the end of the fermentation of chitin to products comprising N-acetylglucosamine.
  • the mutant bacterium and the genetically engineered yeast can be co-cultivated to produce ethanol from chitin in a single fermentation.
  • the mutant bacterium is V. alginolyticus.
  • the genetically engineered yeast is a genetically engineered Saccharomyces.
  • Figure 1 shows three electron micrographs (a) a section of a single Vibrio cell, (b) Vibrios digesting a crab shell, and (c) marine snow, which resembles a huge bacterial colony as the bacteria grow on the agglutinated copepod skeletons.
  • Figure 2 provides an overview of the conversion of chitin containing waste products into GIcNAc, GIcN or a biofuel. Vibrionaceae mutants break down the chitin to predominantly GIcNAc. The GIcNAc may then be treated by a deacetylase to produce GIcN (Roseman, J. Biol. Chem. 226: 115-124 (1957) or by acid or heat. Alternatively, the GIcNAc may be further metabolized to ethanol preferably using an engineered yeast.
  • Figure 3 provides the catabolic pathway in Escherichia coli (E coif) for the conversion of GIcNAc and GIcN to fructose-6-phosphate in the cytoplasm. In E.
  • GIcNAc traverses the periplasmic space, and is taken up by the phosphoenolpyruvate: glycose phosphotransferase system(PEP) (Kundig et al. Proc. Natl. Acad. ScI., U. S. A. 52: 1067-1074 (1964)) at the cytoplasmic membrane.
  • PEP glycose phosphotransferase system
  • the transport product in the cytoplasm is GlcNAc-6-P.
  • the acetyl group is then removed, giving GIcN- 6-P (Distler et al. J. Biol. Chem. 230: 497-509 (1958); Roseman J. Biol. Chem. 226: 115-124 (1957)).
  • fructose-6-P and NH 4 + This is further converted to fructose-6-P and NH 4 + (Comb and Roseman Biochim. et Biophys. Acta 21 : 193-194 (1956); Comb and Roseman J. Biol. Chem. 232: 807-827 (1958)).
  • Figure 4 shows the cascade of reactions that converts chitin to fructose-6-P in Vibrionaceae as the pathway extends from the extracellular space, through the periplasm and into the cytoplasm.
  • A extracellular protease(s);
  • BP periplasmic (GIcNAc) 2 binding protein
  • E ⁇ -N-acetylglucosaminidase (EC 3.2.1.52);
  • F 2-component signal transduction system
  • G ABSC type transporter
  • H phosphoenolpyruvate: glycose phosphotransferase system (PTS system) for GIcNAc (NagE gene product);
  • I ⁇ /, ⁇ /'-diacetylchitobiose phosphorylase (EC: 2.4.1.-); Park et al. (2000)
  • Figures 5A-5E show extracellular chitinase expression in V. furnissii, which is characteristic of Vibrio species capable of hydrolyzing chitin. Intact cells of V. furnissii were streaked out on agar medium overlayed with colloidal chitin to produce colonies. The secreted bacterial chitinases yielded clear areas resulting from hydrolysis of the chitin.
  • the agar contained rich broth resulting in rapid growth of the bacteria, but only small quantities of chitinase(s) were produced.
  • a minimal synthetic medium was used with lactate as the carbon source. Wild type cells grew better in the presence of 0.5% lactate compared with 0.05% lactate, but produced less chitinase.
  • Figure 5E the clearing of a substantial area of the chitin plate was evidence that a large amount of chitinase(s) were secreted in labeled minimal medium with no carbon source except for colloidal chitin. The colonies can barely be seen in this figure.
  • Figure 6 shows a cartoon of the two component ChiS located partly in the periplasm and partly in the cytoplasm. Maximal expression of the chitinases and other proteins critical to chitin catabolism are obtained only when ChiS is activated. ChiS forms a chitin signal transduction system across the inner membrane (IM) of Vibrio.
  • the BP binds to the sensor in the periplasmic space. This results in the sensor being inactive or "OFF”.
  • the figure also contains graphic representations of (i) BP (ii) ABC transporter and (iii) chitoporin and other porins as shown in the key.
  • Figure 7 shows how environmental chitin turns the sensor to the "ON" mode.
  • a low level of chitinase(s) is secreted by the cells, reaches the chitin, and hydrolyzes it primarily to the disaccharide, (GIcNAc) 2 , which enters the periplasmic space.
  • GIcNAc disaccharide
  • Figure 8 shows the construction of Vibrio alginolyticus 12G01 mutants VAXB55 and also the mutants VAXB77 which lack the chitin oligosaccharide deacetylase. The same approach was used to construct VAXB56 and VAXB78, but the antibiotic markers were removed from VAXB55 and VAXB77, respectively, as shown in Figure 10.
  • Figure 9 shows the gene knockout strategy outlined in Figure 8 in more detail. Note that the chitin catabolic operon is deleted, including BP, the first gene in the operon, but ChiS is not deleted, and is therefore always ON.
  • FIG 10 shows the general experimental approach taken to complete the knockout strategy described in Figure 9 in more detail.
  • Figure 11 is a summary of the knockout for Vibrio alginolyticus 12G01.
  • Figure 12 shows GIcNAc production from wild type V. alginolyticus and the mutant strain (VAXB55) incubated with colloidal chitin or lobster waste. Over a period of days virtually no GIcNAc was observed with wild type cells because they consumed it as rapidly as it was formed. On the other hand, the mutant produced GIcNAc from both substrates. These results were obtained in flask cultures.
  • Figure 13 shows the yields of both GIcNAc and GIcN from lobster waste.
  • the yield of GIcNAc was about 93%.
  • a small amount of GIcN was also obtained.
  • the GIcN yield was about 10% of the GIcNAc yield.
  • Figure 14 shows the results of fermentation of shrimp shell waste by the mutant VAXB77 in jar type fermentors.
  • the actual yield of GIcNAc was consistent with the theoretical value.
  • the GIcN yield was 5-6% compared to the GIcNAc.
  • Figure 15 shows the product of desorption of the GIcNAc fermentation product from a charcoal column; 20Og of activated charcoal was used. All GIcNAc was adsorbed by the charcoal. One liter of 50% ethanol was used for desorption at a flow rate of 2 ml/min.
  • the y axis is GIcNAc concentration in effluent (g/l) and the X axis is the desorption time (minutes).
  • Figures 16A and B show how purity of GIcNAc was assessed by electrospray-mass spectroscopy (ESI-MS).
  • Figure 16A shows the results for GIcN.
  • Figure 16B shows the results for GIcNAc.
  • Figures 17A and B show that the major component of the fermentation of the shrimp waste is GIcNAc.
  • Figure 17A shows that the components of the fermentation supernatant are closely similar to that of the GIcNAc standard ( Figure 17B).
  • Figures 18A and B show the amount of GIcNAc isolated from fermentation supernatant and purified on a charcoal column.
  • Figure 18A shows ESI-MS of the fermentation broth supernatant fluid placed on the column, and
  • Figure 18B shows the 50% alcohol eluate of the column. A single step is sufficient to give a high yield of nearly pure GIcNAc.
  • Figure 19 shows that the results of co-fermentation of V. alginolyticus mutant (VAXB77) and S. cerevisiae (mutant S9) in a fermentor where the initial GIcNAc concentration as chitin was about 22 mM. After 5 days of co-fermentation, the final ethanol concentration was about 9.6 mM.
  • Embodiments of the invention include methods for (a) metabolizing environmental chitin into GIcNAc; (b) converting N-acetylglucosamine to glucosamine; and (c) converting GIcNAc to ethanol.
  • Chitin in chitin-containing waste products which include fungi and invertebrate exoskeletons, for example seafood waste, such as crab, lobster, or shrimp, can be converted to GIcNAc by engineering the appropriate genes in bacteria (such as Vibrionaceae) that actively consume chitin.
  • Large amounts of chitin waste are also generated from fungal cell walls.
  • waste fungi from fermentation of Aspergillus strains which have a large amount of chitin in their cell walls and are used for industrial processes is a chitin source for generating GIcNAc and GIcN. Algae are also a rich source of chitin.
  • Bacteria capable of converting chitin to GIcNAc includes gram negative bacteria such as Vibrionaceae for example V. furnissii, V. cholera and V. alginolyticus (Yu and Roseman, "Bacterial adhesion to immobilized carbohydrates", In Lectins and Glvcobiolo ⁇ v, Gabius, ed. Springer-Verlag) (1993)).
  • Vibrionaceae for example V. furnissii, V. cholera and V. alginolyticus (Yu and Roseman, "Bacterial adhesion to immobilized carbohydrates", In Lectins and Glvcobiolo ⁇ v, Gabius, ed. Springer-Verlag) (1993)).
  • Knockouts of selected genes in bacteria yielded mutants that converted chitin-containing waste products to GIcNAc and small amounts of GIcN. Vibrionaceae mutants were created in which the catabolic pathway in the cytoplasm for converting GIcNAc to fructose-6-P was disrupted by knocking out specific genes resulting in accumulation of GIcNAc in the extracellular fluid (see Figures 8-10).
  • Gram negative bacterial cells which include Vibrionaceae have 3 compartments: the extracellular compartment, the periplasmic space, and the cytoplasm.
  • the extracellular and periplasmic compartments are separated by the cell wall/outer membrane complex. This complex contains pores which permit low molecular weight solutes to penetrate into the periplasm.
  • the periplasm (from 20-30% of the cell volume) and cytoplasm are separated by the cytoplasmic membrane, which contains the various transporters or permeases and many other proteins.
  • Wild type Vibrionaceae produce proteases for digesting insoluble proteins that enmesh chitin thereby releasing chitin substrate.
  • the cells secrete extracellular chitinases and proteases (see Figures 1 and 5) which attack the cuticle and hydrolyze the chitin to chitin oligosaccharides, (GIcNAc) n .
  • GIcNAc chitin oligosaccharides
  • the examples provided herein describe the use of several different Vibrionaceae.
  • V. alginolyticus is described and is convenient for use in generating GIcNAc as it is non-pathogenic. It is obtained from a marine environment . Its genome sequence is described in Genebank (accession number AAPSOOOOOOOO, see below).
  • Extracellular chitin is digested by chitinases to soluble oligosaccharides. These are taken up by the wild type bacteria through pores in the membranes identified as porins (Keyhani J. Biol. Chem. 275: 33068-33076 (2000)) and some of them are hydrolyzed to GIcNAc by an outer membrane bound ⁇ -N-acetylglucosaminidase (EC 3.2.1.52).
  • the oligosaccharides are hydrolytically cleaved by two enzymes, a chitodextrinase (D in Figure) and a specific ⁇ -N- acetylglucosaminidase (E in Figure 4) (Keyhani and Roseman J. Biol. Chem. 271, 33414-33424 (1996); Keyhani and Roseman J. Biol. Chem. 271 : 33425-33432 (1996)).
  • the combined action of the two enzymes yield as final products, the monosaccharide, GIcNAc, and the disaccharide, (GIcNAc) 2 .
  • the periplasmic ⁇ -N-acetylglucosaminidase (E) is an exoenzyme that has significantly greater activity with the chitooligosaccharides (GIcNAc) n , where n ⁇ 3 at the pH of sea water. But, (GIcNAc) 2 is not significantly hydrolyzed by this enzyme and can thus serve as the signal for the sensor. GIcNAc uptake and catabolism in Vibrio is essentially the same as in E. coli ( Figure 3).
  • GIcNAc monosaccharides may be translocated from the periplasmic space into the cytoplasm by means of the phosphoenolpyruvate: glycose phosphotransferase system (PTS in Figure 3).
  • PTS glycose phosphotransferase system
  • This system catalyzes the vectorial transport of sugars such as GIcNAc across the membrane, with the energy supplied by phosphoenolpyruvate (PEP) (Bouma and Roseman J. Biol. Chem. 271 : 33457-33467 (1996); (Bouma and Roseman, 1996a; Heidelberg et al. Nature 406(6795) : 477-483 (2000)).
  • GIcNAc disaccharides may be translocated from the periplasmic space into the cytoplasm by an ABC transporter ( Figures 4 and 6), driven by ATP hydrolysis (Keyhani et al. J. Biol. Chem. 271 : 33409-33413 (1996)).
  • the first step takes place in the periplasm, where the disaccharide binds to a BP.
  • BP binds to the disaccharide and delivers it to the ABC transporter (G in Figure 4).
  • the disaccharide can then be translocated into the cytoplasm without modification.
  • the sum of the next 3 steps, I + J + K, is to convert (GIcNAc) 2 to GlcNAc-6-P.
  • I is a phosphorylase that converts (GIcNAc) 2 to GIcNAc-I-P + GIcNAc (Park et al. J. Biol. Chem. 275 : 33077-33083 (2000); Enzyme J is an ATP kinase specific for GIcNAc.
  • the GIcNAc-I-P is converted to GlcNAc-6-P by Enzyme K, an N-acetylglucosamine-phosphate mutase (EC: 5.4.2.3) specific for interconverting GlcNAc-6-P and GIcNAc-I-P.
  • Figure 5 shows wild type cells growing on the surface of Petri dishes.
  • the cells were streaked on agar plates containing the indicated carbon sources.
  • the agar was overlaid with colloidal chitin, which appeared white in Figure 5A-5E.
  • Expression of extracellular chitinases by the colonies was evident as clear zones around the colonies.
  • the medium in the agar was a rich broth, there was heavy growth of the Vibrio species, but no clear zones. A somewhat less rich carbon source, again gave good growth, with little evidence of chitinases.
  • the mutant Vibrionaceae described herein have been engineered to produce chitinases continuously under substantially all growth conditions.
  • Transport systems for GIcNAc and chitooligosaccharide have been knocked out without preventing the mutant Vibrionaceae from metabolizing an alternative food source or interfering with other machinery in the cell.
  • These cells are expected to grow well on waste products since these products contain protein, etc., similar to the broth medium, which supports rapid growth of the cells.
  • chitinase production and secretion is preferably turned on all the time, independent of the other substances in the medium. This has been accomplished by knocking out BP, which means that ChiS is permanently turned ON as in Figure 7.
  • the conversion of chitin to GIcNAc by these knockout mutants is shown in Figures 12-15, 16A-B, 17A-B, 18A-B and 19.
  • GIcNAc can be converted to GIcN by a deacetylase (Roseman J. Biol. Chem. 226: 115-124 (1957)). Provided here is an alternative procedure that utilizes mild acid hydrolysis (see Example 3). It is also contemplated that conversion of GIcNAc to GIcN may be achieved during microbial fermentation.
  • chitin An important use of chitin is its conversion to ethanol via GIcNAc. While common yeasts, such as Saccharomyces cerevisiae (S. cerevisiae) cannot utilize GIcNAc (or GIcN), an engineered S. cerevisiae is used here that metabolizes GIcNAc to produce ethanol (see, for example PCT/US09/064511). We have shown that this engineered S. cerevisiae produced ethanol from GIcNAc almost as rapidly as from glucose (see Table 4 and Figure 19). Ethanol production proceeded both aerobically and under O 2 limiting conditions and similar yields of ethanol were obtained with GIcNAc and with GIc.
  • V. alginolyticus mutants utilize metabolites of S. cerevisiae including acetate, a byproduct of the alcoholic fermentation; (b) V. alginolyticus mutants can survive in ethanol medium generated by the yeast; and (c) growth and fermentations for both Vibrio and yeast can occur at a common temperature and pH.
  • GIcNAc Uses of GIcNAc include its conversion into ethanol for use as a biofuel, its conversion into GIcN for use as a nutraceutical, or as a cosmetic.
  • cosmetics may include skin whitening and anti- wrinkle GIcN formlations where the formulations may be topical creams or ingestible products.
  • V. alginolyticus 12G01 wild type strain was isolated from the surface water at Plum Island Ecosystem- LTER, USA, by Dr. Martin PoIz (Stocker et al . Proc. Natl. Acad. Sci. U. S. A 105: 4209-4214 (2008); Hunt et al. Appl. Environ. Microbiol. 74: 44-51 (2008)). This strain is naturally resistant to 100 ⁇ g/ml ampicillin, but sensitive to other antibiotics. This organism consumes chitin from waste products.
  • the genome sequence is provided in the Gordon and Betty Moore Foundation Marine Microbial Genome Sequencing Project and deposited under Accession No. AAPS00000000. No genome annotation was provided in the public database or published papers.
  • VAL is used to indicate V. alginolyticus in the Table and Figures.
  • V. alginolyticus 12G01 was transformed by transconjugation.
  • the target genes are listed in Figures 8 and 9, and the general procedures for deleting a target gene are outlined in Figure 10.
  • the primers used are listed in Table 1. Table I
  • VAL-NagAE-KO-MF SEQ ID N0:3
  • VAL-NagE-KO-R CTAGCTTCACAACTCCCATAG (SEQ ID NO: 4)
  • VAL-NagB-KO-F (SEQ ID N0: 5)
  • the suicide vector and transconjugation methods were used to construct the required deletions and knockout mutants.
  • a deletion construct with or without an antibiotic marker, was prepared as outlined in Figures 8-11.
  • the desired DNA fragment was then transferred to a general suicide vector pRE113 (Edwards, et al. Gene 207: 149-157 (1998)).
  • pRE113 was developed from plasmid pRE112 (ATCC 87692).
  • pRE113 is a plasmid with a BgIII restriction site inserted into the Smal site of pRE112.
  • These vectors contained a conditional origin of replication, R6K.
  • a host cell such as E. coli S17-1, was used which expressed the pi protein in trans.
  • E. coli S17-1 containing the desired vector was mixed with virtually any Gram negative cell such as a Vibrionaceae, the cells mated and the vector was transferred to the recipient Vibrionaceae cell.
  • a Vibrionaceae cell In the Vibrionacea cells used here, no pi protein was generated, and the vector DNA could not replicate (therefore called a suicide vector), unless it was integrated into the chromosome by allelic exchange of the homologous DNA.
  • the general strategy for making the constructs is outlined in Figure 10. It included a two-step PCR to get the knockout construct with wild type genomic DNA as the template. Then the construct was subcloned into pGEM-T vector (Promega, Madison WI). Depending on the construct, an antibiotic cartridge ending with the Sail site was inserted into the Xhol site. The BgIII fragments from the above constructs were inserted into the BgIII site in pRE113 giving the final suicide knocking out constructs.
  • the construct retained only the N-end 39bp/1680bp of BP and C-end 310bp/1410bp of phosphomutase with a 6 bp addition of Xhol site in the middle.
  • First round PCR was performed with primers VAL-NagB-KO-F/VAL- NagB-KO-MR and VAL-NagB-KO-MF/VAL-NagB-KO-R.
  • the second round PCR was with primers VAL-NagB-KO-F/VAL-NagB-KO-R.
  • 383bp 376-758
  • a 1137 bp Sail ended erythromycin resistance gene within 2 loxP sites was inserted into the Xhol site of the above construct.
  • First round PCR was performed with primers VAL-Chb-KO-F/VAL- Chb-KO-MR and VAL-Chb-KO-MF/VAL-Chb-KO-R.
  • the second round PCR was with primers VAL-Chb-KO-F/VAL-Chb-KO-R.
  • the resulting construct inactivated and eliminated 7 genes of divergent chb operon (chitooligosaccharide deacetylase-COD, 3 genes for PTS type chitobiose transport system, annotated 6-phosphate-beta-glucosidase, annotated conserved hypothetical protein and chitobiose repressor).
  • the construct retained only the C-end 359bp/1281bp of chitooligosaccharide deacetylase and C-end 389bp/996bp of chitobiose repressor with a 6 bp addition of Xhol site in the middle.
  • Vibrionacea mutants contained the following genetic markers as shown in Figures 8-11 :
  • VAXB56 was derived from VAXB55 with the introduction of suicide plasmid pRE112-lac-Cre. pRE112-lac-Cre was created by inserting blunted Asel-EcoRI fragment from pCM157 plasmid (Marx et al. Biotechniques 33(5) : 1062-1067 (2002)) into the Smal site of pRE112 plasmid. The pRE112-lac-Cre plasmid expressd Cre enzyme in target cells and removed antibiotic marker enclosed by two loxP site leaving one loxP site instead. VAXB56 had the same properties as VAXB55 except the antibiotic markers were removed.
  • VAXB78 was derived from VAXB56 with additional chb operon deletion and antibiotic marker being removed. This knockout reduced the GIcN content in the final product and blocked the utilization of chitobiose (GIcN) 2 by the mutant.
  • Table 2 lists the phenotypic properties of the final strains.
  • the parental strain was naturally resistant to ampicillin, while the mutant, VAXB55 was also resistant to 50 ⁇ g/ml kanamycin and 75 ⁇ g/ml erythromycin, the genes having been introduced during genetic manipulation.
  • the mutant strain On agar plates the mutant strain swarmed very strongly, and spread even more extensively in a high salt medium, and at 37 0 C than at room temperature. To isolate single colonies, an LB plate at 42 0 C gave good results. In some cases, a MacConkey plate with 2% NaCI was used, although this method resulted in a greatly decreased cell number.
  • the 50 ml minimal medium (50% ASW/HEPES, pH 7.5/K + /NH4 + ) with 1% DL-lactate, and either colloidal chitin or lobster waste as carbon source was inoculated with 200 ⁇ l LB overnight culture of wild type or VAXB55 mutant cells.
  • the incubation was conducted at 37 0 C.
  • a 500 ⁇ l aliquot was centrifuged, and the supernatant was assayed for GIcNAc concentration by the Morgan-Elson method (Morgan and Elson Biochem. J. 28: 988 (1934)) with known concentrations of GIcNAc as standard.
  • the result is shown in Figure 12.
  • the wild type strain an active chitin and GIcNAc consumer, maintained a sub millimolar concentration of GIcNAc during the incubation.
  • the target mutant on the other hand, accumulated 11.6 mM (colloidal chitin) and 8.6 mM GIcNAc in the lobster waste culture.
  • GIcNAc GIcNAc
  • the concentration of GIcNAc reached 8.6 mM at 24 hours for colloidal chitin or 10.2 mM at 55 hours for lobster waste.
  • GIcN was also produced in these incubations.
  • VAXB78 generated the exact percentage of GIcN depending on the original glucosamine content of the chitin source, while VAXB55 and VAXB56 generated an additional 20% more GIcN from the lobster waste because of activation of chb operon including the chitooligosaccharide deacetylase (COD).
  • Example 2 Degradation of lobster and shrimp meal (finely ground shells ' ) Jar fermentor conditions are listed for both lobster and shrimp shell waste.
  • the "theoretical GIcNAc" content of the waste products was determined by 2 methods: (a) The chitin content was assayed by standard methods, isolation from the raw material. (b)The glucosamine content of the waste was also assayed by standard methods (4 N HCI hydrolysis, 100°C, 16 hr, followed by drying, and Morgan-Elson method for glucosamine). The two methods gave excellent agreement.
  • GIcNAc hydrolysis proceeds quantitatively in 0.1 N HCI at 100°C for 2 hr. Spray drying or concentrating the solution removes excess HCI and the acetic acid, giving GIcN. HCI.
  • Example 4 Ethanol production from degradation products of chitin wastes bv S. cerevisiae (mutant S9)
  • Example 5 Co-fermentation of V. alginolvticus (mutant 77 " ) and S. cerevisiae (engineered veast S91

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Polysaccharides And Polysaccharide Derivatives (AREA)

Abstract

Compositions and methods are provided for converting chitin into N-acetylglucosamine, glucosamine and ethanol. The chitin may be used directly from the environment, for example, as occurs in invertebrate cuticles, fungal cells and/or algae. Mutant bacteria were created by knocking out or inactivating one or more genes preferably resulting in the chitin catabolic sensor maintaining an activated state. Methods are further provided for converting the N-acetylglucosamine into ethanol by means of a genetically engineered yeast strain which can be optionally co-cultivated with the Vibrionaceae to produce significant yields of ethanol.

Description

Conversion of Chitin into N-Acetylglucosamine, Glucosamine and Bioethanol
BACKGROUND
About 1011 metric tons of chitin are produced annually in the ocean waters, 109 tons from copepods alone, the most abundant animals on earth. Chitin fibrils embedded in a matrix of highly cross-linked, insoluble protein(s) make up a significant fraction of the cuticles of arthropoda, annalida, mollusca, and the cell walls of many fungi and yeasts.
Each chitin fibril molecule consists of a straight chain of over a thousand N-acetylglucosamine (GIcNAc) monomers linked by β,l-4 bonds similar to beads on a string. These fibril molecules are cross-linked via hydrogen bonds to each other, giving enormous strength to the fibers. Native chitin also contains a small percentage of glucosamine (GIcN). Harsh chemical methods (acid and alkali) are used to isolate chitin, thus yielding an increased quantity of glucosamine in the polymer.
The ecological significance of chitin degradation has been recognized for over a century. The carbon and nitrogen cycles would cease if this highly insoluble polysaccharide was not recycled in a biologically useful form. The commercial significance of chitin breakdown has also been recognized in the context of production of bioavailable sugars and in medicine for the treatment of arthritis, and other joint problems. Although a constant rain of chitin falls to the ocean floors (marine snow), marine sediments contain only traces of the polymer. Zobell and Rittenberg (J. Bacteriol. 35: 275-287 (1937)) demonstrated the existence of chitinivorous bacteria that cause degradation of chitin and are ubiqui- tous in the marine environment.
Historically, it was thought that only two steps were required to convert chitin to GIcNAc. The first step relied on a chitinase (EC: 3.2.1.14) that would yield primarily the disaccharide, (GlcNAc-β,l-4-GlcNAc, or (GIcNAc)2 or N,N'-diacetylchitobiose). The second step was thought to utilize a β-N-acetylglucosaminidase (EC: 3.2.1.52) to hydrolyze the disaccharide to GIcNAc. Further investigation revealed that the chitin catabolic cascade was much more complex involving a minimum of three signaling pathways that rely on many gene products. For instance, using DNA microarray analyses (Meibom et al. Proc. Natl. Acad. Sci. U. S. A 101 : 2524-2529 (2004)), some 200 genes have been shown to be involved in the growth of Vibrio cholerae on living copepods.
Traditionally, chitin is purified from invertebrate cuticles by a process that includes using dilute acid to remove the calcium from the cuticles, followed by repetitive hot strong alkali treatment, and acid extraction to remove the highly insoluble protein matrix that surrounds the chitin in the cuticles. Chitin can then be completely hydrolyzed to GIcN by refluxing it with 4N-6N HCI for 16 hours or more. The GIcN, HCI salt must then be purified, which is accomplished by fractional crystallization or ion-exchange chromatography. Thus, the chemical isolation of GIcN as an HCI or sulfate salt is expensive and is a high energy-consuming chemical procedure presenting ecological problems associated with the disposal of large volumes of waste products. A new method of fermentation that could convert chitin into GIcNAc or GIcN on an industrial scale would facilitate the preparation of medicines and would also provide an alternative bioavailable source of sugars. Additionally, it would be valuable if these sugars could be converted to ethanol.
SUMMARY
In an embodiment of the invention, a composition is provided that includes a genetically engineered mutant bacterium in which one or more genes have been deleted or inactivated or their expression product rendered inactive, such that the mutant bacterium is capable of converting chitin to products including N-acetylglucosamine but is not capable of substantially degrading glucosamine and N-acetylglucosamine. These products are preferably released into the extracellular growth medium. In an embodiment of the invention, one or a combination of the following genes or their equivalents are deleted or inactivated. These include part or all of an : operon or combination of operons selected from NagACE operon, chitin operon including the periplasmic (GIcNAc)2 binding protein, and chitibiose operon; or NagB. However, the chitin catabolic sensor (ChiS) is not inactivated. Rather, it preferably becomes constitutively activated.
An example of a mutant bacterium includes a mutant gram negative bacterium for example a mutant Vibrionaceae for example a mutant Vibrio species for example a mutant of Vibrio alginolyticus (V. alginolyticus), Vibrio cholerae (V. cholerae) and Vibrio furnissii (V. furnissii) .
The chitiπ referred to throughout may be environmental chitin such as is found in invertebrates such as arthropods, mollusks and annelids; fungi; and algae. For example, chitin can be found in the cuticles or exoskeletons of invertebrates and in the mycelium and cell walls of fungi. Alternatively, the chitin may be obtained from a purified or semi-purified source.
In another embodiment of the invention, a method is provided in which the mutant bacterium described above is used to obtain products that comprise at least one of N-acetylglucosamine and glucosamine. The method includes (a) adding the mutant Vibrio species to an extracellular medium comprising chitin; (b) converting the chitin into products comprising N-acetylglucosamine by means of the mutant Vibrio species; and (c) obtaining at least one of N-acetylglucosamine and glucosamine in the extracellular medium. The N-acetylglucosamine in the extracellular medium can be purified on an activated charcoal column.
Any of the N-acetylglucosamine can be converted to glucosamine by acid hydrolysis or by means of a deacetylase.
In an additional embodiment of the invention, a method is provided for forming a mutant bacterium exemplified by a mutant gram negative bacterium exemplified by a mutant Vibrionaceae exemplified by a mutant Vibrio species such as mutants of V. alginolyticus, V. cholerae, or V. furnissii. The method includes (a) obtaining a bacterium from a source; (b) knocking out or inactivating one or more genes for expressing at least one protein from one or both of a signal transduction system and a chitin degradative pathway in the bacterium, exemplified by part or all of an operon or a combination of operons selected from NagACE operon, chitin operon including the periplasmic BP, but not ChiS which is preferably constitutively activated and chitobiose operon (ChB) or NagB; and (c) forming a mutant bacterium as described above.
The source of the bacterium may be the environment such as a terrestrial environment, an aqueous environment such as a marine environment; a hospital patient; or a culture collection such as provided by the ATCC.
The product of the method of forming a mutant bacterium is an organism that is capable of hydrolyzing chitin contained in a growth medium and producing N-acetylglucosamine and/or glucosamine.
In an embodiment of the invention, the glucosamine obtained by the described methods involving fermentation using chitin and mutant bacteria may be used in production of nutraceutical glucosamine for the treatment of arthritis in humans and non-human mammals.
In an additional embodiment of the invention, a method is provided in which a mutant bacterium such as described above is used in a process to make ethanol . The method includes: (a) adding the mutant bacterium to a medium that comprises chitin; (b) converting the chitin into a product that comprises comprising extracellular N-acetylglucosamine by means of the bacterium; and (c) converting the N-acetylglucosamine into ethanol by additional fermentation, for example, using genetically engineered yeast cells.
The extracellular N-acetylglucosamine can be harvested and then added to a culture of genetically engineered yeast cells so as to convert the N-acetylglucosamine into ethanol. Alternatively, genetically engineered yeast may be added to the mutant bacterium in growth medium at the end of the fermentation of chitin to products comprising N-acetylglucosamine. Alternatively, the mutant bacterium and the genetically engineered yeast can be co-cultivated to produce ethanol from chitin in a single fermentation. In one example, the mutant bacterium is V. alginolyticus. In another example, the genetically engineered yeast is a genetically engineered Saccharomyces.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows three electron micrographs (a) a section of a single Vibrio cell, (b) Vibrios digesting a crab shell, and (c) marine snow, which resembles a huge bacterial colony as the bacteria grow on the agglutinated copepod skeletons.
Figure 2 provides an overview of the conversion of chitin containing waste products into GIcNAc, GIcN or a biofuel. Vibrionaceae mutants break down the chitin to predominantly GIcNAc. The GIcNAc may then be treated by a deacetylase to produce GIcN (Roseman, J. Biol. Chem. 226: 115-124 (1957) or by acid or heat. Alternatively, the GIcNAc may be further metabolized to ethanol preferably using an engineered yeast. Figure 3 provides the catabolic pathway in Escherichia coli (E coif) for the conversion of GIcNAc and GIcN to fructose-6-phosphate in the cytoplasm. In E. coli, GIcNAc traverses the periplasmic space, and is taken up by the phosphoenolpyruvate: glycose phosphotransferase system(PEP) (Kundig et al. Proc. Natl. Acad. ScI., U. S. A. 52: 1067-1074 (1964)) at the cytoplasmic membrane. The transport product in the cytoplasm is GlcNAc-6-P. The acetyl group is then removed, giving GIcN- 6-P (Distler et al. J. Biol. Chem. 230: 497-509 (1958); Roseman J. Biol. Chem. 226: 115-124 (1957)). This is further converted to fructose-6-P and NH4 + (Comb and Roseman Biochim. et Biophys. Acta 21 : 193-194 (1956); Comb and Roseman J. Biol. Chem. 232: 807-827 (1958)).
Figure 4 shows the cascade of reactions that converts chitin to fructose-6-P in Vibrionaceae as the pathway extends from the extracellular space, through the periplasm and into the cytoplasm.
A=extracellular protease(s);
B=chitinases (EC: 3.2.1.14);
BP= periplasmic (GIcNAc)2 binding protein
C= general porins and a chitoporin; D=chitodextrinase (EC: 3.2.1.14);
E=β-N-acetylglucosaminidase (EC 3.2.1.52);
F= 2-component signal transduction system;
G=ABC type transporter;
H=phosphoenolpyruvate: glycose phosphotransferase system (PTS system) for GIcNAc (NagE gene product);
I=Λ/,Λ/'-diacetylchitobiose phosphorylase (EC: 2.4.1.-); Park et al. (2000)
J. Biol. Chem. 275 p 33077-33083
J = N-acetylglucosamine ATP kinase (EC: 2.7.1.59); K=N-acetylglucosamine-phosphate mutase (EC:5.4.2.3); L=N-acetylglucosamine-6-phosphate deacetylase (EC:3.5.1.25); and M=Glucosamine-6-phosphate deaminase (EC: 3.5.99.6).
Figures 5A-5E show extracellular chitinase expression in V. furnissii, which is characteristic of Vibrio species capable of hydrolyzing chitin. Intact cells of V. furnissii were streaked out on agar medium overlayed with colloidal chitin to produce colonies. The secreted bacterial chitinases yielded clear areas resulting from hydrolysis of the chitin.
In Figures 5A and 5B, the agar contained rich broth resulting in rapid growth of the bacteria, but only small quantities of chitinase(s) were produced. In Figures 5C and 5D, a minimal synthetic medium was used with lactate as the carbon source. Wild type cells grew better in the presence of 0.5% lactate compared with 0.05% lactate, but produced less chitinase. In Figure 5E, the clearing of a substantial area of the chitin plate was evidence that a large amount of chitinase(s) were secreted in labeled minimal medium with no carbon source except for colloidal chitin. The colonies can barely be seen in this figure.
Figure 6 shows a cartoon of the two component ChiS located partly in the periplasm and partly in the cytoplasm. Maximal expression of the chitinases and other proteins critical to chitin catabolism are obtained only when ChiS is activated. ChiS forms a chitin signal transduction system across the inner membrane (IM) of Vibrio. In the cartoon, the BP binds to the sensor in the periplasmic space. This results in the sensor being inactive or "OFF". The figure also contains graphic representations of (i) BP (ii) ABC transporter and (iii) chitoporin and other porins as shown in the key.
Figure 7 shows how environmental chitin turns the sensor to the "ON" mode. A low level of chitinase(s) is secreted by the cells, reaches the chitin, and hydrolyzes it primarily to the disaccharide, (GIcNAc)2, which enters the periplasmic space. Here, it competes with ChiS for the BP When BP is released from the BP/ChiS complex, ChiS assumes a different conformation, and is turned on, or active. Maximal expression of the chitinases and other critical proteins is attained in the "ON".
Figure 8 shows the construction of Vibrio alginolyticus 12G01 mutants VAXB55 and also the mutants VAXB77 which lack the chitin oligosaccharide deacetylase. The same approach was used to construct VAXB56 and VAXB78, but the antibiotic markers were removed from VAXB55 and VAXB77, respectively, as shown in Figure 10.
(1) Turn off GIcNAc utilization at least 90% by deleting the NagA,C,E operon
(2) Turn on chitin utilization constitutively by deleting the chitin operon, including the periplasmic (GIcNAc)2 binding protein
BP, but not the sensor ChiS. Turn off GIcNAc utilization completely by deleting NagB, GlcN-6-P deaminase
(3) Remove disaccharide utilization, [(GIcNAc)2 and (GIcN)2], and chitooligosaccharide deacetylase, thereby minimizing GIcN production.
Figure 9 shows the gene knockout strategy outlined in Figure 8 in more detail. Note that the chitin catabolic operon is deleted, including BP, the first gene in the operon, but ChiS is not deleted, and is therefore always ON. The Figure schematically illustrates the genes in 3 operons: GIcNAc, chitin, and Chb (acronym for chitobiose ((GIcN)2)). The genes in these operons express proteins involved in the transport and degradation of GIcNAc, and the disaccharides (GIcNAc)2 and (GIcN)2. The two disaccharide transporters were deleted to avoid loss of (GIcNAc)2. (X= knockout)
Figure 10 shows the general experimental approach taken to complete the knockout strategy described in Figure 9 in more detail.
Figure 11 is a summary of the knockout for Vibrio alginolyticus 12G01.
Figure 12 shows GIcNAc production from wild type V. alginolyticus and the mutant strain (VAXB55) incubated with colloidal chitin or lobster waste. Over a period of days virtually no GIcNAc was observed with wild type cells because they consumed it as rapidly as it was formed. On the other hand, the mutant produced GIcNAc from both substrates. These results were obtained in flask cultures.
Figure 13 shows the yields of both GIcNAc and GIcN from lobster waste. The yield of GIcNAc was about 93%. A small amount of GIcN was also obtained. With VAXB77, the GIcN yield was about 10% of the GIcNAc yield.
Figure 14 shows the results of fermentation of shrimp shell waste by the mutant VAXB77 in jar type fermentors. The actual yield of GIcNAc was consistent with the theoretical value. The GIcN yield was 5-6% compared to the GIcNAc.
Figure 15 shows the product of desorption of the GIcNAc fermentation product from a charcoal column; 20Og of activated charcoal was used. All GIcNAc was adsorbed by the charcoal. One liter of 50% ethanol was used for desorption at a flow rate of 2 ml/min. The y axis is GIcNAc concentration in effluent (g/l) and the X axis is the desorption time (minutes).
Figures 16A and B show how purity of GIcNAc was assessed by electrospray-mass spectroscopy (ESI-MS). Figure 16A shows the results for GIcN. Figure 16B shows the results for GIcNAc.
Figures 17A and B show that the major component of the fermentation of the shrimp waste is GIcNAc. The concentration of GIcN, if present, was too low to be detected. Figure 17A shows that the components of the fermentation supernatant are closely similar to that of the GIcNAc standard (Figure 17B).
Figures 18A and B show the amount of GIcNAc isolated from fermentation supernatant and purified on a charcoal column. Figure 18A shows ESI-MS of the fermentation broth supernatant fluid placed on the column, and Figure 18B shows the 50% alcohol eluate of the column. A single step is sufficient to give a high yield of nearly pure GIcNAc. Figure 19 shows that the results of co-fermentation of V. alginolyticus mutant (VAXB77) and S. cerevisiae (mutant S9) in a fermentor where the initial GIcNAc concentration as chitin was about 22 mM. After 5 days of co-fermentation, the final ethanol concentration was about 9.6 mM.
DETAILED DESCRIPTION OF THE EMBODIMENTS
Embodiments of the invention include methods for (a) metabolizing environmental chitin into GIcNAc; (b) converting N-acetylglucosamine to glucosamine; and (c) converting GIcNAc to ethanol.
(a) Conversion of chitin in chitin-containinq waste products into N-acetylαlucosamine
Chitin in chitin-containing waste products, which include fungi and invertebrate exoskeletons, for example seafood waste, such as crab, lobster, or shrimp, can be converted to GIcNAc by engineering the appropriate genes in bacteria (such as Vibrionaceae) that actively consume chitin. Large amounts of chitin waste are also generated from fungal cell walls. For example, waste fungi from fermentation of Aspergillus strains which have a large amount of chitin in their cell walls and are used for industrial processes is a chitin source for generating GIcNAc and GIcN. Algae are also a rich source of chitin.
Bacteria capable of converting chitin to GIcNAc includes gram negative bacteria such as Vibrionaceae for example V. furnissii, V. cholera and V. alginolyticus (Yu and Roseman, "Bacterial adhesion to immobilized carbohydrates", In Lectins and Glvcobioloαv, Gabius, ed. Springer-Verlag) (1993)).
Knockouts of selected genes in bacteria yielded mutants that converted chitin-containing waste products to GIcNAc and small amounts of GIcN. Vibrionaceae mutants were created in which the catabolic pathway in the cytoplasm for converting GIcNAc to fructose-6-P was disrupted by knocking out specific genes resulting in accumulation of GIcNAc in the extracellular fluid (see Figures 8-10).
Gram negative bacterial cells which include Vibrionaceae have 3 compartments: the extracellular compartment, the periplasmic space, and the cytoplasm. The extracellular and periplasmic compartments are separated by the cell wall/outer membrane complex. This complex contains pores which permit low molecular weight solutes to penetrate into the periplasm. The periplasm (from 20-30% of the cell volume) and cytoplasm are separated by the cytoplasmic membrane, which contains the various transporters or permeases and many other proteins.
Wild type Vibrionaceae produce proteases for digesting insoluble proteins that enmesh chitin thereby releasing chitin substrate. The cells secrete extracellular chitinases and proteases (see Figures 1 and 5) which attack the cuticle and hydrolyze the chitin to chitin oligosaccharides, (GIcNAc)n. Expression of the extracellular enzymes is under stringent cellular control. The examples provided herein describe the use of several different Vibrionaceae. In one embodiment, V. alginolyticus is described and is convenient for use in generating GIcNAc as it is non-pathogenic. It is obtained from a marine environment . Its genome sequence is described in Genebank (accession number AAPSOOOOOOOO, see below).
Extracellular chitin is digested by chitinases to soluble oligosaccharides. These are taken up by the wild type bacteria through pores in the membranes identified as porins (Keyhani J. Biol. Chem. 275: 33068-33076 (2000)) and some of them are hydrolyzed to GIcNAc by an outer membrane bound β-N-acetylglucosaminidase (EC 3.2.1.52). Once in the periplasmic space, the oligosaccharides are hydrolytically cleaved by two enzymes, a chitodextrinase (D in Figure) and a specific β-N- acetylglucosaminidase (E in Figure 4) (Keyhani and Roseman J. Biol. Chem. 271, 33414-33424 (1996); Keyhani and Roseman J. Biol. Chem. 271 : 33425-33432 (1996)). The combined action of the two enzymes yield as final products, the monosaccharide, GIcNAc, and the disaccharide, (GIcNAc)2. The periplasmic β-N-acetylglucosaminidase (E) is an exoenzyme that has significantly greater activity with the chitooligosaccharides (GIcNAc)n, where n ≥ 3 at the pH of sea water. But, (GIcNAc)2 is not significantly hydrolyzed by this enzyme and can thus serve as the signal for the sensor. GIcNAc uptake and catabolism in Vibrio is essentially the same as in E. coli (Figure 3).
In wild type organisms, GIcNAc monosaccharides may be translocated from the periplasmic space into the cytoplasm by means of the phosphoenolpyruvate: glycose phosphotransferase system (PTS in Figure 3). This system, (H in Figure 4), catalyzes the vectorial transport of sugars such as GIcNAc across the membrane, with the energy supplied by phosphoenolpyruvate (PEP) (Bouma and Roseman J. Biol. Chem. 271 : 33457-33467 (1996); (Bouma and Roseman, 1996a; Heidelberg et al. Nature 406(6795) : 477-483 (2000)).
GIcNAc disaccharides may be translocated from the periplasmic space into the cytoplasm by an ABC transporter (Figures 4 and 6), driven by ATP hydrolysis (Keyhani et al. J. Biol. Chem. 271 : 33409-33413 (1996)). The first step takes place in the periplasm, where the disaccharide binds to a BP. BP binds to the disaccharide and delivers it to the ABC transporter (G in Figure 4). The disaccharide can then be translocated into the cytoplasm without modification. The sum of the next 3 steps, I + J + K, is to convert (GIcNAc)2 to GlcNAc-6-P. Briefly: I is a phosphorylase that converts (GIcNAc)2 to GIcNAc-I-P + GIcNAc (Park et al. J. Biol. Chem. 275 : 33077-33083 (2000); Enzyme J is an ATP kinase specific for GIcNAc. The GIcNAc-I-P is converted to GlcNAc-6-P by Enzyme K, an N-acetylglucosamine-phosphate mutase (EC: 5.4.2.3) specific for interconverting GlcNAc-6-P and GIcNAc-I-P.
The expression of the chitin metabolism genes briefly outlined above is stringently regulated in Vibrionaceae. For example, Figure 5 shows wild type cells growing on the surface of Petri dishes. In this experiment, the cells were streaked on agar plates containing the indicated carbon sources. The agar was overlaid with colloidal chitin, which appeared white in Figure 5A-5E. Expression of extracellular chitinases by the colonies was evident as clear zones around the colonies. When the medium in the agar was a rich broth, there was heavy growth of the Vibrio species, but no clear zones. A somewhat less rich carbon source, again gave good growth, with little evidence of chitinases. On a synthetic medium containing 0.5% lactate as a carbon source, there was again good growth with little chitinase production. When the carbon source was dropped to 0.1% lactate, growth was reduced, and clear zones were now evident indicating expression of chitinases. Finally, when the cells were exposed only to the chitin (no other carbon source), there were large clear zones, and it was in fact, difficult to see the tiny colonies. In other words, a combination of starvation and exposure to chitin lead to high expression of the chitinases.
This regulation is largely controlled by a two-component His kinase system. In fact, according to results obtained by DNA microarray analysis (Meibom et al. Proc. Natl. Acad. Sci. U. S. A 101 : 2524-2529 (2004)), the expression of about 200 genes is controlled by this sensor when the cells grow on chitin. Figure 6 illustrates the structural units in ChiS, and how ChiS functions. An important component of the signal transmission is BP specific for chitooligosaccharides, but not GIcNAc. BP binds to the periplasmic loop of ChiS, and under these circumstances, ChiS is in the negative mode, i.e., no signaling (Figure 6). However, when extracellular chitinases hydrolyze chitin in the environment, the major product (GIcNAc)2 enters the periplasmic space, and competes with ChiS for BP. When BP is released from ChiS, the latter is turned "ON" (Figure 7), which means that ChiS signals the 200 or so genes to be expressed or repressed including the chitinases and N-acetylglucosaminidases. Thus, it is the environmental signal, (GIcNAc)2, that gives this dramatic response.
The mutant Vibrionaceae described herein have been engineered to produce chitinases continuously under substantially all growth conditions. Transport systems for GIcNAc and chitooligosaccharide have been knocked out without preventing the mutant Vibrionaceae from metabolizing an alternative food source or interfering with other machinery in the cell. These cells are expected to grow well on waste products since these products contain protein, etc., similar to the broth medium, which supports rapid growth of the cells. In embodiments of the invention, chitinase production and secretion is preferably turned on all the time, independent of the other substances in the medium. This has been accomplished by knocking out BP, which means that ChiS is permanently turned ON as in Figure 7. The conversion of chitin to GIcNAc by these knockout mutants is shown in Figures 12-15, 16A-B, 17A-B, 18A-B and 19.
(b) Conversion of N-acetylαlucosamine into glucosamine, HCI
GIcNAc can be converted to GIcN by a deacetylase (Roseman J. Biol. Chem. 226: 115-124 (1957)). Provided here is an alternative procedure that utilizes mild acid hydrolysis (see Example 3). It is also contemplated that conversion of GIcNAc to GIcN may be achieved during microbial fermentation.
(c) Conversion of N-acetylαlucosamine into ethanol
An important use of chitin is its conversion to ethanol via GIcNAc. While common yeasts, such as Saccharomyces cerevisiae (S. cerevisiae) cannot utilize GIcNAc (or GIcN), an engineered S. cerevisiae is used here that metabolizes GIcNAc to produce ethanol (see, for example PCT/US09/064511). We have shown that this engineered S. cerevisiae produced ethanol from GIcNAc almost as rapidly as from glucose (see Table 4 and Figure 19). Ethanol production proceeded both aerobically and under O2 limiting conditions and similar yields of ethanol were obtained with GIcNAc and with GIc. This can be achieved in either a separate or a combined fermentation by: (a) Isolating the GIcNAc and adding it to yeast growth medium as in Table 4; (b) Following the first fermentation with the V. alginolyticus mutant and then adjusting the supernatant with yeast growth medium as in Table 3; or (c) Co-culturing the yeast and Vibrio mutants with chitin as in Figure 19.
We found that: (a) V. alginolyticus mutants utilize metabolites of S. cerevisiae including acetate, a byproduct of the alcoholic fermentation; (b) V. alginolyticus mutants can survive in ethanol medium generated by the yeast; and (c) growth and fermentations for both Vibrio and yeast can occur at a common temperature and pH.
It was demonstrated here that a charcoal column is very effective in providing an efficient simple and effective purification of GIcNAc from fermentation media. This does not preclude however, the use of other methods of purification not described here but known in the art.
Uses of GIcNAc include its conversion into ethanol for use as a biofuel, its conversion into GIcN for use as a nutraceutical, or as a cosmetic. For example, cosmetics may include skin whitening and anti- wrinkle GIcN formlations where the formulations may be topical creams or ingestible products.
All references cited herein, including U.S. Provisional Application No.
61/172,251 filed April 24, 2009, are incorporated by reference. EXAMPLES
Example 1 : Production of extracellular GIcNAc
Mutants from V. alginolyticus were constructed that catabolized waste products, and hydrolyzed the chitin to produce GIcNAc. These mutants could not utilize GIcNAc as a nutrient. V. alginolyticus 12G01 wild type strain was isolated from the surface water at Plum Island Ecosystem- LTER, USA, by Dr. Martin PoIz (Stocker et al . Proc. Natl. Acad. Sci. U. S. A 105: 4209-4214 (2008); Hunt et al. Appl. Environ. Microbiol. 74: 44-51 (2008)). This strain is naturally resistant to 100 μg/ml ampicillin, but sensitive to other antibiotics. This organism consumes chitin from waste products. The genome sequence is provided in the Gordon and Betty Moore Foundation Marine Microbial Genome Sequencing Project and deposited under Accession No. AAPS00000000. No genome annotation was provided in the public database or published papers.
Genetic manipulation
Standard molecular biological methods and techniques were used unless otherwise indicated. The acronym VAL is used to indicate V. alginolyticus in the Table and Figures.
V. alginolyticus 12G01 was transformed by transconjugation. The target genes are listed in Figures 8 and 9, and the general procedures for deleting a target gene are outlined in Figure 10. The primers used are listed in Table 1. Table I
VAL-NagAE-KO-F GCAGATCTCGTTGGCTGCTTATCA (SEQ ID NO: 1)
AGTAGCTCGAGATGTCAGCACGCAATGA VAL-NagAE-KO-MR (SEQ ID N0:2)
GACATCTCGAGCTACTTCGTGTTCCGTA
VAL-NagAE-KO-MF (SEQ ID N0:3) VAL-NagE-KO-R CTAGCTTCACAACTCCCATAG (SEQ ID NO: 4)
GCGAGATCTAGCAGCACAAGTAGGTA
VAL-NagB-KO-F (SEQ ID N0: 5)
ATGGCTCGAGGATGCCAATGTACTCA
VAL-NagB-KO-MR (SEQ ID N0:6)
GCATCCTCGAGCCATAACAAAGCTCAG
VAL-NagB-KO-MF (SEQ ID N0:7)
GCGGAGATCTGCCTTTGATGTTTTCTGC
VAL-NagB-KO-R (SEQ ID N0:8)
GGAGATCTACAGCACTAGCAACAGCA
VAL-BP-KO-F (SEQ ID N0:9)
CAGACCTCGAGCGAAATACAGGCGTGT
VAL-Chitin-KO-MR (SEQ ID NO: 10)
ATTTCGCTCGAGGTCTGAGTTGCTGGAT
VAL-Chitin-KO-MF (SEQ ID NO: 11)
VAL-Chitin-KO-R AGATCTGAAGAACACGTTCCGCAG (SEQ ID NO: 12)
VAL-Chb-KO-F AAGATCTGAGTGTTCGGAGTCCAG (SEQ ID NO: 13)
CATCCTCTCGAGTACCTAAGCTCGCTAA
VAL-Chb-KO-MR (SEQ ID NO: 14)
AGGTACTCGAGAGGATGCTGGTATAGA VAL-Chb-KO-MF (SEQ ID NO: 15) GGAGATCTAAGGAGCGATCTGCTTTG VAL-Chb-KO-R (SEQ ID NO: 16)
Construction of knockout vectors
The suicide vector and transconjugation methods were used to construct the required deletions and knockout mutants. In this procedure, a deletion construct, with or without an antibiotic marker, was prepared as outlined in Figures 8-11. The desired DNA fragment was then transferred to a general suicide vector pRE113 (Edwards, et al. Gene 207: 149-157 (1998)). pRE113 was developed from plasmid pRE112 (ATCC 87692). pRE113 is a plasmid with a BgIII restriction site inserted into the Smal site of pRE112. These vectors contained a conditional origin of replication, R6K. For the vectors to be replicated, a host cell, such as E. coli S17-1, was used which expressed the pi protein in trans.
When E. coli S17-1 containing the desired vector was mixed with virtually any Gram negative cell such as a Vibrionaceae, the cells mated and the vector was transferred to the recipient Vibrionaceae cell. In the Vibrionacea cells used here, no pi protein was generated, and the vector DNA could not replicate (therefore called a suicide vector), unless it was integrated into the chromosome by allelic exchange of the homologous DNA.
In the final selection, only the Vibrionacea cells with the desired deletions in the chromosome survived. A two-step selection method was also used. In the first step, using the antibiotic markers, only the Vibrionacea cells were selected that contained the entire plasmid integrated into the chromosome. In the second step, the sacBl gene, which was carried by the suicide plasmid, was used. This gene expressed a periplasmic sucrase that was lethal to the cell in the presence of sucrose (Blomfield et al. MoI. Microbiol. 5: 1447-1457 (1991)) and was used as a positive selection marker.
The general strategy for making the constructs is outlined in Figure 10. It included a two-step PCR to get the knockout construct with wild type genomic DNA as the template. Then the construct was subcloned into pGEM-T vector (Promega, Madison WI). Depending on the construct, an antibiotic cartridge ending with the Sail site was inserted into the Xhol site. The BgIII fragments from the above constructs were inserted into the BgIII site in pRE113 giving the final suicide knocking out constructs.
1. pRE113-VAL-Nag OperonΔ:
First round PCR was with primer pairs VAL-NagAE-KO-F/VAL-NagAE- KO-MR and VAL-NagAE-KO-MF/VAL-NagE-KO-R. The second round bridge PCR was with primers VAL-NagAE-KO-F/ VAL-NagE-KO-R. The resulting construct had a 6bp Xhol insertion at the middle: 910bp out of 1212 bp had been removed from the nagC (Repressor), the complete nagA (GlcNAc-6-P deacetylase) and 1079 bp out of 1491 bp of nagE (GIcNAc permease).
2. pRE113-VAL-chitinΔloxP-KmRD: First round PCR was with primers VAL-BP-KO-F/VAL-Chitiπ-KO-MR and VAL-Chitin-KO-MF/VAL-Chitin-KO-R. The second PCR was with VAL- BP-KO-F/VAL-Chitin-KO-R as primers. The resulting construct inactivated and eliminated 10 genes (5 genes for (GIcNAc)2 transport, GIcN kinase, β-endoglucosidase, exol hexosaminidase, (GIcNAc)2 phosphorylase and GIcNAc phosphomutase). The construct retained only the N-end 39bp/1680bp of BP and C-end 310bp/1410bp of phosphomutase with a 6 bp addition of Xhol site in the middle. A 1333 bp Sail ended kanamycin resistance gene within 2 loxP site was inserted into the Xhol site of the above construct.
3. pRE113-VAL-NagBΔIoxP-EryR :
First round PCR was performed with primers VAL-NagB-KO-F/VAL- NagB-KO-MR and VAL-NagB-KO-MF/VAL-NagB-KO-R. The second round PCR was with primers VAL-NagB-KO-F/VAL-NagB-KO-R. In the final PCR construct, 383bp (376-758) have been deleted out of 798 bp from the middle of NagB gene with a 6 bp Xhol site replacement. A 1137 bp Sail ended erythromycin resistance gene within 2 loxP sites was inserted into the Xhol site of the above construct.
4. pRE113-VAL-ChbΔloxP-EryR :
First round PCR was performed with primers VAL-Chb-KO-F/VAL- Chb-KO-MR and VAL-Chb-KO-MF/VAL-Chb-KO-R. The second round PCR was with primers VAL-Chb-KO-F/VAL-Chb-KO-R. The resulting construct inactivated and eliminated 7 genes of divergent chb operon (chitooligosaccharide deacetylase-COD, 3 genes for PTS type chitobiose transport system, annotated 6-phosphate-beta-glucosidase, annotated conserved hypothetical protein and chitobiose repressor). The construct retained only the C-end 359bp/1281bp of chitooligosaccharide deacetylase and C-end 389bp/996bp of chitobiose repressor with a 6 bp addition of Xhol site in the middle. A 1137 bp Sail ended erythromycin resistance gene within 2 loxP sites was inserted into the Xhol site of the above construct.
Genetic properties
Vibrionacea mutants contained the following genetic markers as shown in Figures 8-11 :
1. No marker knockout of Nag operon (permease, deacetylase and repressor).
2. Knockout NagB-deaminase with a loxP-Erythromycin resistance gene-loxP. The combined effect was to totally shut down the GIcNAc utilization system. This was proven by growth experiments in the presence of 20 mM GIcNAc, essentially no growth.
3. Knockout chitin operon which turned on the chitin utilization system with loxP-kanamycin resistance gene-loxP. The sensor, chiS, was not deleted, but since BP was deleted, chiS was permanently activated. It degraded chitin constitutively even in rich medium. 4. VAXB56 was derived from VAXB55 with the introduction of suicide plasmid pRE112-lac-Cre. pRE112-lac-Cre was created by inserting blunted Asel-EcoRI fragment from pCM157 plasmid (Marx et al. Biotechniques 33(5) : 1062-1067 (2002)) into the Smal site of pRE112 plasmid. The pRE112-lac-Cre plasmid expressd Cre enzyme in target cells and removed antibiotic marker enclosed by two loxP site leaving one loxP site instead. VAXB56 had the same properties as VAXB55 except the antibiotic markers were removed.
5. VAXB78 was derived from VAXB56 with additional chb operon deletion and antibiotic marker being removed. This knockout reduced the GIcN content in the final product and blocked the utilization of chitobiose (GIcN)2 by the mutant.
6. Table 2 lists the phenotypic properties of the final strains.
Table 2
Figure imgf000027_0001
Results
Growth of the mutant was tested on colloidal chitin and finely ground seafood waste (lobster, crab, and shrimp shells). V. alginolyticus mutants were grown in rich medium (usually LB), or in minimal medium: 50% ASW (artificial sea water) buffered with 50 mM HEPES pH 7.5, 0.005% K2HPO4, 0.1% NH4CI and 0.5% DL-lactate as the carbon source. The cells tolerated NaCI, at least up to 5% in the medium. Good growth was evident in the range of room temperature to 420C. The parental strain was naturally resistant to ampicillin, while the mutant, VAXB55 was also resistant to 50 μg/ml kanamycin and 75 μg/ml erythromycin, the genes having been introduced during genetic manipulation. On agar plates the mutant strain swarmed very strongly, and spread even more extensively in a high salt medium, and at 370C than at room temperature. To isolate single colonies, an LB plate at 420C gave good results. In some cases, a MacConkey plate with 2% NaCI was used, although this method resulted in a greatly decreased cell number.
The 50 ml minimal medium (50% ASW/HEPES, pH 7.5/K+/NH4+) with 1% DL-lactate, and either colloidal chitin or lobster waste as carbon source was inoculated with 200 μl LB overnight culture of wild type or VAXB55 mutant cells. The incubation was conducted at 370C. At 0, 24h, 48h, 122h, 144h, 287h time intervals, a 500 μl aliquot was centrifuged, and the supernatant was assayed for GIcNAc concentration by the Morgan-Elson method (Morgan and Elson Biochem. J. 28: 988 (1934)) with known concentrations of GIcNAc as standard. The result is shown in Figure 12. The wild type strain, an active chitin and GIcNAc consumer, maintained a sub millimolar concentration of GIcNAc during the incubation. The target mutant, on the other hand, accumulated 11.6 mM (colloidal chitin) and 8.6 mM GIcNAc in the lobster waste culture. There was no GIcNAc positive utilization reversion or other mutations in VAXB55 during this long incubation period. Removal of GIcNAc from this static system ensured production of GIcNAc at minimal cost compared with the chemical methods.
The procedure is generally applicable to seafood waste, i.e., crab and shrimp waste products and gave the same results as obtained with lobster waste (Figure 13 and 14). Other sources of environmental chitin include fungal cell walls (Blumenthal and Roseman J. Bacteriol. 74: 222- 224 (1957)). In the second set of experiments, 200 μl overnight culture of VAXB56 in LB medium was inoculated into 50 ml minimal medium containing 100 μg/ml ampicillin, and 50% ASW/HEPES, pH 7.5/K+/NH4 + with 1% DL-lactate. After incubation at 37°C overnight, the cultures were then fed with excess colloidal chitin or lobster shell. At different time points, a 500 μl culture was withdrawn from the incubations, centrifuged, and the supernatants assayed for GIcNAc concentration by the Morgan- Elson method. The concentration of GIcNAc reached 8.6 mM at 24 hours for colloidal chitin or 10.2 mM at 55 hours for lobster waste. GIcN was also produced in these incubations. VAXB78 generated the exact percentage of GIcN depending on the original glucosamine content of the chitin source, while VAXB55 and VAXB56 generated an additional 20% more GIcN from the lobster waste because of activation of chb operon including the chitooligosaccharide deacetylase (COD).
In an additional experiment, a 2-liter jar fermentor was used (Figure 14). At a constant pH of 7.0 and temperature of 37°C, with VAXB77 in LB rich medium and finely ground shrimp shell as the chitin source, the GIcNAc theoretical yield was attained and maintained at around 55mM for 40 hours with only a residual GIcN content from the natural chitin.
Example 2: Degradation of lobster and shrimp meal (finely ground shells') Jar fermentor conditions are listed for both lobster and shrimp shell waste.
1.1 Biomass Contents of lobster meal (total 2 L) : 110 g («45mM theoretical GIcNAc). HCI treatment to remove Ca2+: 600 ml of 0.25 M HCI, 10 min x3 times, room temperature. Wash with water.
1.2 Cell concentration LB medium ODeoo of strain VAXB77 in fermentor: 4.2
1.3 Fermentor parameters Cultivation conditions: pH=7.0, 370C
Total working volume: 2 L
Harvesting GIcNAc from the fermentation
The fermentation media contained many substances, as was expected. However, the following procedure gave essentially pure GIcNAc. The fermentation broths were centrifuged to remove all particulate matter, and transferred to an activated charcoal column as follows:
• 200 g activated charcoal (Norit RO 0.8, pellet)
• 500ml products from shrimp shells (8.13 g/l) used for adsorption
• Column washed extensively with water
• 50% ethanol used for desorption twice • Flow rate: 2ml/min
• Collect samples every 25 minutes Virtually all of the GIcNAc was adsorbed; the column was washed to remove other components of the medium with water, and eluted with 50% ethanol. (see Figures 15-18). The yields of highly purified GIcNAc from the raw material were better than 85-95%. The "theoretical GIcNAc" content of the waste products was determined by 2 methods: (a) The chitin content was assayed by standard methods, isolation from the raw material. (b)The glucosamine content of the waste was also assayed by standard methods (4 N HCI hydrolysis, 100°C, 16 hr, followed by drying, and Morgan-Elson method for glucosamine). The two methods gave excellent agreement.
Example 3 : Conversion of N-acetylαlucosamine to glucosamine
GIcNAc hydrolysis proceeds quantitatively in 0.1 N HCI at 100°C for 2 hr. Spray drying or concentrating the solution removes excess HCI and the acetic acid, giving GIcN. HCI.
Example 4: Ethanol production from degradation products of chitin wastes bv S. cerevisiae (mutant S9)
Medium YL3 for growing S. cerevisiae (mutant S9)
Yeast extract 5 g/l
KH 2 PO 4 3 g/l
Na HPO
2 4 4.5 g/l
(NH4)2SO4 2 g/l
MgSO4-7H2O 0.5 g/l
Methionine 20 mg/l Cultivation conditions
Batch cultivation mode;
Working volume: 9 ml
Initial pH : 6.0
Anaerobic, 300C, 200 rpm
Initial inoculum density: OD6oo=0.04
Total cultivation time: 4 days
Table 3 - Ethanol production from environmental chitin
Figure imgf000032_0001
Table 4 - Ethanol production by the yeast mutant S. cerevisiae (mutant S9) from GIcNAc and Glucose
Figure imgf000033_0001
Example 5: Co-fermentation of V. alginolvticus (mutant 77") and S. cerevisiae (engineered veast S91
Colloidal chitin 1Og
Yeast extract 5 g/l
KH 2 PO 4 3 g/l
Na HPO
2 4 4.5 g/l
(NH4)2SO4 2 g/l
MgSO -7H O
4 2 0.5 g/l
Methionine 20 mg/l
• Batch cultivation mode;
• Working volume: 5 ml
• pH 6.5
• Aerobic, 30 0C, 200 rpm • Initial separate inoculum density of two strains: OD6oo=0.04
• Total cultivation time: 5 days
As shown in Figure 19, co-culture effectively produced ethanol from chitin waste.

Claims

What is claimed is:
1. A genetically engineered mutant bacterium in which one or more genes have been deleted or inactivated or their expression product rendered inactive, such that the mutant bacterium is capable of converting chitin to products comprising at least one of N- acetylglucosamine and glucosamine but is not capable of substantially degrading N-acetylglucosamine.
2. The mutant bacterium according to claim 1, wherein the mutant is capable of releasing N-acetylglucosamine into a growth medium containing chitin.
3. The mutant bacterium according to any of claims 1 and 2, wherein the one or more genes are a part or all of a Nag ACE operon.
4. The mutant bacterium according to any of claims 1 through 3, wherein the one or more genes are a part or all of a chitin operon.
5. The mutant bacterium according to any of claims 1 through 4, wherein the one or more genes comprise a Nag B.
6. The mutant bacterium according to any of the claims 1 through 5, wherein the one or more genes comprise a periplasmic (GIcNAc)2 binding protein (BP).
7. The mutant bacterium according to any of claims 1 through 6, wherein the one or more genes are a part or all of a chitobiose operon.
8. The mutant bacterium according to any of claims 1 through 7 wherein the one or more genes do not include a chitin catabolic sensor (chiS).
9. The mutant bacterium according to any of claims 1 through 8, consisting of a mutant of a gram negative bacterium.
10. The mutant bacterium according to any of claims 1 through 9, consisting of a mutant of a Vibrionacaea.
11. The mutant bacterium according to any of claims 1 through 10, consisting of a mutant of a Vibrio species.
12. The mutant bacterium according to any of claims 1 through 11, consisting of a mutant ofVibrio alginolyticus, Vibrio cholerae or Vibrio furnissii.
13. A method of using the mutant bacterium according to any of claims 1 through 12 to obtain at least one of N-acetylglucosamine and glucosamine, comprising :
(a) adding the mutant bacterium to an extracellular medium comprising chitin;
(b) converting the chitin into products comprising N- acetylglucosamine by means of the mutant bacterium; and
(c) obtaining at least one of N-acetylglucosamine and glucosamine in the extracellular medium.
14. The method according to claim 13, wherein the N-acetylglucosamine can be purified from the extracellular medium by means of an activated charcoal column.
15. The method according to any of claims 13 through 14, wherein the chitin is environmental chitin capable of being obtained from a source selected from the group consisting of algae, fungi and invertebrates.
16. The method according to any of claims 13 through 15, wherein the invertebrate chitin is obtained from a source selected from the group consisting of arthropod cuticles, annelida, and mollusca, or where the fungal chitin is obtained from fungal cell walls.
17. The method according to any of claims 13 through 16, further comprising converting N-acetylglucosamine to glucosamine by acid hydrolysis or by means of a deacetylase.
18. A method for forming a mutant bacterium according to any of claims 1 through 12, comprising :
(a) obtaining a bacterium from a source;
(b) knocking out or inactivating one or more genes for expressing at least one protein from one or both of a signal transduction system and a chitin degradative pathway in the Vibrio species; and
(c) forming a mutant bacterium according to any of claims 1 through 12.
19. The method according to claim 18, wherein the mutant bacterium is capable of hydrolyzing chitin contained in a growth medium and producing products comprising N-acetylglucosamine.
20. A method according to any of claims 18 or 19, wherein the one or more genes are a part or all of: an operon selected from one or a combination of Nag ACE operon, chitin operon including a periplasmic (GlcNAc)2 binding protein (BP), and chitobiose operon; or Nag B.
21. A method according to any of the claims 18-20, further comprising causing ChiS in the mutant bacterium to be constitutively activated.
22. A method according to any of claims 18-21, wherein the mutant bacterium is a mutant of a gram negative bacteria for example a mutant of a Vibrionaceae, for example a mutant of a Vibrio species for example, selected from a mutant of Vibrio alginolyticus, a mutant of Vibrio cholerae, and a mutant of Vibrio furnissii.
23. A method for using the mutant bacterium according to any claims 1- 12 to make ethanol; comprising :
(a) adding the mutant bacterium to a medium comprising chitin;
(b) converting the chitin into a degradation product comprising N-acetylglucosamine by the bacterium; and
(c) converting the N-acetylglucosamine into ethanol using genetically engineered yeast cells.
24. The method of claim 23, wherein (b) further comprises harvesting the extracellular N-acetylglucosamine for adding to a culture of genetically engineered yeast cells so as to convert the N-acetylglucosamine into ethanol.
25. The method according to claim 23 wherein (c) comprises co- cultivating a mixture of genetically engineered yeast cells to the medium containing the mutant bacterium and extracellular N-acetylglucosamine.
26. The method according to claim 23, wherein (a) further co-cultivation of a mixture of genetically engineered yeast cells and the mutant bacterium in the medium.
27. A method according to any of claims 23 through 26 wherein the mutant bacterium is Vibrio alginolyticus.
28. A method according to any of claims 23 through 27, wherein the genetically engineered yeast is a genetically engineered Saccharomγces cerevisiae.
PCT/US2010/031504 2009-04-24 2010-04-16 Conversion of chitin into n-acetylglucosamine, glucosamine and bioethanol Ceased WO2010123784A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/264,273 US9267141B2 (en) 2009-04-24 2010-04-16 Conversion of chitin into N-acetylglucosamine, glucosamine and bioethanol

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US17225109P 2009-04-24 2009-04-24
US61/172,251 2009-04-24

Publications (2)

Publication Number Publication Date
WO2010123784A2 true WO2010123784A2 (en) 2010-10-28
WO2010123784A3 WO2010123784A3 (en) 2011-03-31

Family

ID=43011697

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/031504 Ceased WO2010123784A2 (en) 2009-04-24 2010-04-16 Conversion of chitin into n-acetylglucosamine, glucosamine and bioethanol

Country Status (2)

Country Link
US (1) US9267141B2 (en)
WO (1) WO2010123784A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013128274A3 (en) * 2012-03-02 2014-02-20 Asis Datta Recombinant microorganisms and uses thereof
CN110951708A (en) * 2018-09-27 2020-04-03 华东理工大学 N-acetylglucosamine deacetylase, and coding gene and application thereof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180194794A1 (en) * 2015-06-15 2018-07-12 Zuchem, Inc. Activated N-Acetylated Sugars and Oligosaccharides
CN112553123B (en) * 2020-12-25 2021-10-15 湖北工业大学 Bacterial agent combination with high yield of chitin deacetylase and its application
CN118702173B (en) * 2024-07-19 2026-03-24 西南大学 Application of glucosamine in the degradation of tetracycline antibiotics in water

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6372457B1 (en) * 1997-01-14 2002-04-16 Arkion Life Sciences Llc Process and materials for production of glucosamine
US8734814B2 (en) * 2012-03-02 2014-05-27 Asis Datta Recombinant microorganisms and uses thereof

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013128274A3 (en) * 2012-03-02 2014-02-20 Asis Datta Recombinant microorganisms and uses thereof
CN110951708A (en) * 2018-09-27 2020-04-03 华东理工大学 N-acetylglucosamine deacetylase, and coding gene and application thereof
CN110951708B (en) * 2018-09-27 2021-05-14 华东理工大学 N-acetylglucosamine deacetylase, and coding gene and application thereof

Also Published As

Publication number Publication date
US9267141B2 (en) 2016-02-23
WO2010123784A3 (en) 2011-03-31
US20120142058A1 (en) 2012-06-07

Similar Documents

Publication Publication Date Title
ES2424240T3 (en) Recombinant microorganism with the ability to use sucrose as a carbon source
CN112322565B (en) Method for improving 2’-fucosyllactose production in recombinant Escherichia coli
US9938549B2 (en) Process for producing monosaccharides
CN101883861A (en) Process for the production of ethanol from a medium comprising xylose, employing a recombinant zymomonas strain having a reduced HIMA expression
CN101970671A (en) Zymomonas with improved ethanol production in medium containing concentrated sugars and acetate
US9267141B2 (en) Conversion of chitin into N-acetylglucosamine, glucosamine and bioethanol
CN103261400A (en) Xylose utilizing Zymomonas mobilis with improved ethanol production in biomass hydrolysate medium
CN114480465B (en) Bacillus subtilis producing 2’-fucosyllactose and its application
BRPI1010130B1 (en) Yeast CEPA AND USE OF YEAST CEPA
US9206445B2 (en) Biocatalysts with enhanced inhibitor tolerance
CN118931811B (en) An engineered bacterium with high fucose production, and its construction method and application
CN114410596B (en) Schizolysis type polysaccharide monooxygenase and application thereof
Xiong et al. Engineering Komagataella phaffii cell factories for the production of chondroitin sulfate A with high sulfation degree
JP7742399B2 (en) N-acetylglucosamine-producing strains and methods for their construction and use
CN108884120A (en) For the novel method by using microorganism purifying 3,6- dehydration-L- galactolipin
KR20120085364A (en) A noble 3,6-anhydro-L-galactose dehydrogenase to convert 3,6-anhydro-L-galactose into 3,6-anhydrogalactonic acid
DE60118401T2 (en) GEN FOR THE RUBBER POLYPEPTIDE FROM METHYLOMONAS SP. CODED AND THAT IS INVOLVED IN THE MANUFACTURE OF EXOPOLYSACCHARIDES
CN101130799A (en) Method for producing bioenergy material using chitin
CN103352031A (en) Glycosyltransferase gene and application thereof
Xu et al. Isolation of salt-tolerant Vibrio alginolyticus X511 for efficient co-production of 2, 3-butanediol and alginate lyase from Laminaria japonica
CN116042549B (en) Lytic polysaccharide monooxygenase EbLPMO A and application thereof
Ojima et al. Production of value-added materials from alginate using alginate lyases and 4-deoxy-l-erythro-5-hexoseulose uronic acid–metabolic enzymes from alginolytic bacteria and marine gastropods
Fatima et al. Xylose isomerases from thermotogales.
CN113862165A (en) A kind of method that utilizes co-culture fermentation to directly produce low molecular weight xanthan gum
EP2995684B1 (en) Recombinant microorganism metabolizing 3,6-anhydride-l-galactose and a use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10767562

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 13264273

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 10767562

Country of ref document: EP

Kind code of ref document: A2