WO2010121533A1

WO2010121533A1 - Rape heat shock protein gene hsp17.8 and uses thereof

Info

Publication number: WO2010121533A1
Application number: PCT/CN2010/071877
Authority: WO
Inventors: 王汉中; 华玮; 刘静; 刘贵华; 王新发; 杨庆
Original assignee: 中国农业科学院油料作物研究所
Priority date: 2009-04-24
Filing date: 2010-04-19
Publication date: 2010-10-28
Also published as: CA2759847A1; CA2759847C; CN101544983A; CN101544983B

Abstract

A rape heat shock protein gene HSP17.8 and uses thereof are provided. Also provided are nucleotide sequence and amino acid sequence of the gene, gene sequences which have at least 70% homology with the DNA sequence as shown in SEQ ID NO:1 in other crops, and mutant alleles or derivatives thereof produced by adding, substituting, inserting or deleting one or more nucleotides. At the same time, it is proved that over expression of the heat shock protein strengthens the heat-tolerances of arabidopsis thaliana at high temperature by means of model plant, namely the arabidopsis thaliana, through transgenic technology, increases the yield of seeds at high temperature, and improves the yield of the arabidopsis thaliana under high temperature stress, so the heat shock protein gene has good application prospect in heat-tolerance breeding of crops.

Description

Brassica napus heat shock protein gene HSP17.8 and its application

The invention belongs to the field of molecular biology. In particular, the present invention relates to a rapeseed heat shock protein gene HSP17.8, which provides the nucleic acid sequence and protein sequence of this gene, as well as the use of the gene in heat-tolerant breeding of crops. Overexpression of the rapeseed heat shock gene HSP17.8 in Arabidopsis indicates that this gene can significantly enhance the heat tolerance of plants and provide a guarantee for increasing crop yield under high temperature adverse conditions. Background technique

Plants are often stressed by various abiotic factors during growth and development, and temperature is the main factor affecting plant growth. As the industrialization process accelerates, the global ecological environment deteriorates, and the greenhouse effect causes global temperatures to rise. The global average temperature in the 20th century has risen by 0.6, and global temperatures are expected to rise by 1.4-5.8 tons by the end of the century. At the same time, extreme weather phenomena (such as high temperatures in summer) will occur more frequently in many regions of the world and last longer. In many areas, high temperatures have become a major contributor to crop growth, and crop damage is not only reflected in reduced yields, but also severely affects quality.

Analytical studies on plant physiological changes at high temperatures have shown that: photosynthesis ability of plants is inhibited, cell membrane system stability is impaired, cell aging and death; cell proteins are extensively degraded and aggregated, resulting in misfolded proteins and existing proteins At the same time, studies have shown that under high temperature stress, all organisms will produce a heat shock response. Exceeding the appropriate growth temperature of 10 ~ 15*C (sublethal range), the plant heat shock reaction is induced, the gene expression is globally transformed, and the expression of most genes is decreased or weakened, while the heat shock gene is rapidly expressed at high levels, making heat Heat Shock Proteins (HSP) synthesis rapidly increases to restore normal cellular and physiological activities, protecting cells and organisms from serious damage. The role of heat shock proteins makes it easy for humans to recognize the relationship between the acquisition of plant heat tolerance and the accumulation of heat shock protein expression. Therefore, research on heat shock protein genes has been carried out in many laboratories and has made important progress. HSP is widely distributed in plant cell membrane, cytoplasm, chloroplast, mitochondria and other tissues. It is a group of structurally conserved proteins. According to the degree of homology and molecular weight, HSP can be divided into HSP100, HSP90, HSP70, HSP60, HSP40, small molecule HSP and ubiquitin. A subfamily (Papp E, Nardai G, Soti C, Csermely P. Molecular chaperones, stress proteins and redox homeostasis. Biofactors, 2003, 17: 249-257). HSP reduces the harmful effects of heat stress on cells by molecular chaperones through two pathways: (1) assisting protein transmembrane transport, preventing protein precursor accumulation, and forming complexes with unfolded proteins to maintain their metastatic ability; 2) Maintaining the normal folding state of the protein, promoting the degradation of the misfolded protein; and stabilizing the polypeptide chain and preventing the protein from deactivating under the conditions of protein folding and stress. It is involved in target protein activity and function regulation, but is not a component of the target protein. The mechanism of action of different HSPs on target proteins may be different.

The sHSP protein family is a heat shock protein with a molecular weight of 12-40 kDa belonging to the molecular chaperone superfamily. It is also the most complex and important class of HSP in plants. It is extremely abundant in higher plants and is encoded by nuclear genes. It belongs to 7 multi-gene families based on different amino acid sequence structures. Among them, class I and class II sHSP are present in cytosol, class III is located in nucleus, and the other four classes are located. They are found in chloroplasts, endoplasmic reticulum, mitochondria and peroxisomes, respectively. In in vitro experiments, sHSP binds to partially unfolded proteins in an ATP-independent manner, preventing them from irreversibly degrading. With the help of sHSP, ATP-dependent large molecular weight heat shock proteins help unfolded proteins refold and function (Studer S and Narberhaus F. Chaperone activity and homo- and hetero-oligomer formation of bacterial small heat shock proteins. J Biol Chem, 2000, 275:37212 - 37218). In the current proposed sHSP functional model, the sHSP multimer is broken down into dimers and binds proteins through conserved regions and non-conserved regions. In addition to its function as a "molecular chaperone", sHSP is also thought to regulate membrane lipid composition and fluidity. The function of defining sHSP in plants is still very difficult, because almost all sHSPs are expressed in a large amount under heat shock conditions. At the same time, Arabidopsis thaliana sHSP mutants are very limited, which limits the study of sHSP to some extent. Despite this, the research of sHSP is still carried out like a fire like tea.

(Sachin Kotak, Jane Larkindale, Ung Lee, Pascal von Koskull-Do ring, Complexity of the heat stress response in plants. Curt Op in Plant Biol, 2007, 10: 310 - 316). Studies have shown that many plant sHSPs are not only expressed during heat shock, but may also be expressed under other stresses. Tomato sHSP, tom66 and tomlll were induced by low temperature, HSP21 was found to be involved in the antioxidant pathway, and type I AtHSP17.6A was induced by osmotic pressure. Transgenic studies revealed overexpression of class II SHSP17.7 in rice. It not only improves the heat resistance of transgenic lines, but also enhances its UV resistance. Overexpression of the mitochondrial sHSP increases the heat tolerance of the tobacco. Overexpression of chloroplast sHSP provides evidence that can protect photosynthetic system II in tomato and tobacco, and mutants of class I SHSP17.5 lose their acquired heat-resistant phenotype. In addition, sHSP accumulation during heat shock can protect cells from damage, but overexpression of sHSP that can be induced at room temperature does not necessarily increase heat tolerance at high temperatures. Transgenic lines overexpressing HSP21 are only under strong light conditions. In order to improve its heat resistance, Sun et al found that the overexpression of AtHSP17.6A only increased the penetration ability of Arabidopsis under drought and salt stress. So far, no reports have been found on the overexpression of class I sHSP to improve plant heat tolerance. Summary of the invention

The object of the present invention is to provide a rapeseed heat shock protein gene HSP17.8, which provides the nucleotide sequence and amino acid sequence of the gene, such as the DNA sequence shown in SEQ ID NO: 1, including SEQ ID NO: A gene sequence having a DNA sequence of at least 70% homology; a mutant allele or derivative produced by adding, substituting, inserting or deleting one or more nucleotides. The protein represented by SEQ ID NO: 2 in the present invention belongs to a small molecule heat shock protein in which a functional analog can be obtained by performing one, several amino acid substitution, insertion or deletion of an amino acid. Accordingly, the present invention also encompasses sequences having at least 70% homology to the amino acid sequence set forth in SEQ ID NO: 2.

Another object of the present invention is to provide a use of a Brassica napus heat shock gene HSP17.8 for improving plant heat resistance.

In order to achieve the above object, the present invention adopts the following technical measures:

Rape heat shock protein gene HSP17.8 and Arabidopsis thaliana HSP 17.8 homologous to rapeseed Obtained:

1) The EST sequence of the gene was subtracted from a pair of heat resistant lines with different heat tolerance, and the published Arabidopsis HSP17.8 gene sequence (ATlg07400) was searched in the NCBI database, and the coding region sequence BLAST NCBI was used. EST database, search for the EST sequence of the homologous rapeseed HSP17.8 gene, and design the two-side primers of the gene coding sequence (forward primer: [5,-ATGTCGTTGATTCCAAGCTTC-3,]; reverse primer: [5,- TCAGCCAGAGATCTGGATAG -3,] ). The Arabidopsis thaliana HSP17.8 gene was designed based on the sequence in the database: (forward primer: [5'-ATGTCGCTTATTCCAAGCTTC-3,]; reverse primer: [5,-TTAGCCAGAGATATCAATAG -3'] ).

2) RT-PCR amplification of the first strand of rapeseed and Arabidopsis cDNA as a template, and sequencing the amplified fragment to obtain the HSP17.8 gene sequence of Brassica napus and Arabidopsis thaliana, a DNA molecule, Brassica napus The sequence is the nucleotide sequence shown in SEQ ID NO: 1, and the Arabidopsis gene sequence is identical to that published in the database.

The heat shock protein gene HSP17.8 of Brassica napus L. and Arabidopsis thaliana was obtained by the above method, and a transgenic Arabidopsis thaliana with enhanced HSP17.8 expression activity was characterized, in which the transgenic plants showed an increase in HSP17.8 content, compared with the receptor. The heat resistance of non-transgenic plants has increased.

The specific technical measures are:

A PCR8/GW/TOPO Shield granule (invitrogen, commercially available) is provided, and a gene expression plasmid can be constructed recombinantly with an expression vector plasmid.

A plasmid expression vector, PearleygatelOO (invitrogen, commercially available), is provided which contains the 35S promoter and translational controls.

Provides a host strain that can be expressed in plants, Agrobacterium (Agrobacterium tumefaciens GV3101, invitrogen, commercially available).

The present invention provides a method of transgenic Arabidopsis thaliana capable of overexpressing HSP17.8, characterized by an increase in HSP17.8 content in Arabidopsis. The application process includes the following steps:

1) The cloned rapeseed and Arabidopsis thaliana heat shock protein gene HSP17.8 were ligated to the PCR8/GW/TOPO plasmid, respectively, and named as topo-Bnhspl7.8 and topo-Ahsp l7.8. Using the PCR8/GW/TOPO plasmid and the plasmid expression vector PearleygatelOO to recombine in vitro, the heat shock protein gene HSP17.8 was transferred to the expression vector, named PearleygatelOO-Bnhsp 17.8 and Pear leygatelOO-Ahsp 17.8;

2) Transfer the vectors PearleygatelOO-Bnhsp 17.8 and Pear leygatelOO-Ahsp 17.8 prepared in step 1) into Agrobacterium tumefaciens GV3101, and then into Arabidopsis plants;

3) Screen positive colonies.

The seeds harvested from the Arabidopsis thaliana were planted, and the herbicides (Liberty, Invitrogen) were sprayed for about 10 days to screen positive plants. The DNA of the leaves was extracted and identified by PCR, and finally the positive plants were confirmed.

The term "transgenic plant" as used in the present invention refers to a plant containing the introduced gene and capable of stably enhancing or inhibiting the expression of the introduced gene and producing a specific biological trait, including the rice, wheat, and the like. Grain crops, such as corn, soybeans, cotton, etc., which also have high impact on high temperature stress, include vegetable crops such as cucumbers and tomatoes grown in summer.

The method of cloning the heat shock protein gene HSP 17.8 described in the present invention is a method commonly employed in the art. Extraction of plant leaf DNA is a commonly used molecular biology technique. There are also many mature techniques for extracting mRNA. The kit (TRIzol Reagent) is commercially available (Invitrogen), and the construction of cDNA library is also a commonly used molecular biology technique. . Methods of constructing the vectors described in the present invention and enzymatic cleavage, ligation, inflorescence infection, and the like used in transfecting vectors into plants are also common techniques in the art. The plasmid involved (starter vector PCR8/GW/TOPO, plasmid expression vector PearleygatelOO), transfection medium (e.g., Agrobacterium tumefaciens GV3101 and reagent components used such as sucrose, 6-BA, etc.) are commercially available.

Hspl7.8 gene acts as a small molecule heat shock protein to play its molecular chaperone role: assists protein transmembrane transport, prevents protein precursor accumulation, forms complex with unfolded protein to maintain its metastatic ability; maintains normal folding of protein , promotes the degradation of misfolded proteins; stabilizes the polypeptide chain and prevents proteins under protein folding and stress conditions The role of inactivation. They bind to partially unfolded proteins in an ATP-independent manner, preventing them from irreversibly degrading. With the help of sHSP, large molecular weight heat shock proteins that rely on ATP help unfolded proteins to refold and function. In the current proposed sHSP functional model, the sHSP multimer is broken down into dimers and binds proteins through conserved regions and non-conserved regions. In addition to its function as a "molecular chaperone", sHSP is also thought to regulate membrane lipid composition and fluidity.

The invention has the advantages that: the invention discloses the HSP17.8 sequence of the small heat shock protein gene of Brassica napus for the first time at home and abroad, which belongs to the cytoplasmic class I small molecule heat shock protein, and the function of overexpression thereof to improve the heat resistance of the plant is not related. Report. The experimental results of the present invention showed that the content of transgenic Arabidopsis thaliana HSP17.8 was greatly improved compared with the recipient control (non-transgenic plants), and the heat resistance was also enhanced. Therefore, the present invention proposes that the overexpression of HSP17.8 can be utilized to enhance the heat resistance of plants for the breeding of heat-resistant varieties of crops and vegetables, thereby alleviating the damage caused by high temperature on the yield and quality of economic crops. DRAWINGS

Figure 1 Schematic diagram of plant expression vector. The HSP17.8 gene coding region sequence was ligated with the PCR8/GW/TOPO plasmid, and the forward vector was selected to obtain PCR8/GW/TOPO-hsp l7.8, and then the PCR8/GW/TOPO-hspl7.8 plasmid was expressed with the expression vector PearleygatelOO. Recombination, and screening positive clones to obtain PearleygatelOO-hsp 17.8.

Figure 2 Schematic diagram of transgenic plants after herbicide screening. Plants harvested from Arabidopsis inflorescences were harvested from the TO generation. After 2 weeks of sowing, the herbicides were sprayed to screen positive plants.

Figure 3 Schematic diagram of PCR identification of transgenic H117.8 Arabidopsis thaliana T 1 generation. 123 is the heat shock protein gene of turnip rape, ABC is the heat shock gene of Arabidopsis thaliana, and WT is the control wild plant.

Fig. 4 is a schematic diagram showing the comparison between the transgenic plantation and the control plantation at 45 Ό high temperature treatment. The transgenic plants and the control plants were treated with high temperature for 45 hours in a 24 solid medium for one hour, and then placed for 24 months to recover the phenotype after two weeks. It can be seen that the wild type control WT has no survival. Transgenic lines exhibit varying degrees of heat tolerance.

Fig. 5 is a schematic diagram of the comparison between the transgenic plants and the control plants at the maturity stage after high temperature treatment. After the HSP17.8 gene line was grown in the pod ripening stage for 36 days, the wild type plant rapidly turned yellow and withered, while the transgenic plants showed almost no growth and showed good heat resistance.

It is usually prepared according to the conditions described in conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or Draper et al. (Blackwell Science Press, 1988), or according to the reagents used. The conditions recommended by the manufacturer.

1. Acquisition of a heat shock protein gene HSP17.8 from Brassica napus L.

The published Arabidopsis thaliana HSP17.8 gene sequence was searched in the NCBI database, BLAST was transferred to the rape EST sequence and the full length of the HSP17.8 coding region was spliced. Design two-way primers for the coding sequence of the gene (forward primer: [5,- ATGTCGTTGATTCCAAGCTTC-3']; reverse primer: [5'-TCAGCCAGAGATCTGGATAG -3']), Arabidopsis HSP17.8 gene according to the sequence in the database Primers were designed: (forward primer: [5'-ATGTCGCTTATTCCAAGCTTC-3,]; reverse primer: [5,-TTAGCCAGAGATATCAATAG -3,]), for the corresponding sequence of HSP amplification from Brassica napus and Arabidopsis thaliana.

(1) Extraction of Brassica napus and Arabidopsis thaliana mRNA.

RNA extraction (TRIZOL TM Kit for RNA extraction)

Liquid nitrogen grinding lOOmg material

A. Add lmlTRIZOL and leave it at room temperature (20-25, the same below) for 5 min.

B. Add 200 ul of chloroform, shake vigorously for 30 s, and let stand for 2 min at room temperature.

C. 12000g, 15min, 4"C, take the supernatant into a new tube, add 500ul of isopropanol, mix and let stand for 15min at room temperature.

D. 12000g, 15min, 4*C, remove the supernatant, add lml70% (anhydrous alcohol and H ₂ 0 Volume ratio) ethanol.

E. 7500g, 7min, 4"C, go to the supernatant, air dry.

F. DEPC - H ₂ 0 dissolved.

(2) The reverse transcription of the first strand of cDNA was carried out using RevertAid H Minus First Strand cDNA Synthesis Kit (Fermentas), and the procedure was carried out with reference to the kit instructions used.

(3) PCR amplification using cDNA as a template, and a heat shock protein gene HSP17.8 having a nucleotide sequence of SEQ ID NO: 1 was obtained. An isolated protein having the sequence of the amino acid sequence shown in SEQ ID NO: 2.

2. Application of Brassica napus and Arabidopsis thaliana HSP17.8 in improving heat tolerance of Arabidopsis thaliana

2.1 Construction of HSP expression vector and transformation of Arabidopsis thaliana

The gene sequence amplified by PCR was ligated into the TOPO entry vector (invitrogen) and transformed into competent cell DH5 ct (invitrogen), Spectral Enzyme Screening, Plant Primer (T7 Primer) and Gene Primer (Gene Upstream) Primers were amplified and identified as positive insert clones. The plasmid was miniprep and recombined with PearleygatelOO (invitrogen) and transformed into competent cells DH5 o, kanamycin screened, and the insert was primed by vector primer (35S) The word sequence primer) and the gene primer (gene downstream primer) were identified by PCR, and the schematic diagram is shown in Figure A.

Arabidopsis conversion process:

Reagent preparation

Osmotic medium (1L): l/2xMurashige-Skoog; 5% (mass ratio) sucrose; 0.5 g MES; adjusted to pH 5.7 with KOH; plus: 10 μl of 1 mg/ml mother liquor of 6-BA; Lil Silwet L-77

Conversion step

(1) Prepare 10 ml of Agrobacterium tumefaciens (Agrobacterium tumefaciens GV3101), which has been transformed with the corresponding plasmid, and transfer to a large bottle overnight before the conversion, and take the next day when the Agrobacterium liquid O.D600 is used. Between 1.2 and 1.6.

(2) Centrifuge at room temperature 5000 rpm for 15 minutes. (3) Discard the supernatant and suspend the Agrobacterium pellet in the corresponding volume of osmotic medium so that the O.D600 is around 0.8.

(4) Soak the whole plant directly to the Agrobacterium suspension for 30 s.

(5) Incubate overnight in the dark, and then culture until the knot is normal.

2.2 Screening and validation of transgenic Arabidopsis thaliana

Transformant screening

The vernalized Arabidopsis seeds are planted in artificial soil that has been saturated with a PNS nutrient solution and covered with a plastic wrap. Two days later, artificially simulated natural conditions (lighting for 16 hours, dark for 8 hours), and peeling off the film after three days.

Artificial culture room conditions: relative humidity 80%, constant temperature 20-240C, light intensity 80-200umol/M2/S, light cycle 8 h dark, 16 h light culture. A week or so, spray herbicides to screen positive plants.

PCR identification

(1) Extraction of total DNA from transformed plants for PCR

A. 70% (by volume) ethanol scrubbing the leaves, weigh about 100 mg

B. Add 600 ul of extraction buffer (0.2 M Tris-C1, 0.25 NaCl, 25 mM EDTA, 0.5% SDS, pH 7.5) and rapidly grind at room temperature.

C. 1.5ml Ependorff tube vortex mixing 5-10s

D. 12000 rpm, 25 min, room temperature. The supernatant was taken and an equal volume of isopropanol was added and precipitated at -20 ° C overnight.

E. 12000 rpm, 15 min, room temperature. DNA precipitation was carried out by adding 200 ul of 200% ethanol.

F. 12000 rpm, 15 min, room temperature. Go to ethanol. Pour it on a paper towel and let the alcohol evaporate clean.

G. Add sterile water lOOul to dissolve the crude DNA precipitate. The concentration is estimated by spectrophotometry or electrophoresis.

H. Perform PCR using total DNA as a template.

(2) PCR program

The ratio of the PCR reaction mixture was identified by PCR with the plasmid, according to the plant expression vector Gene and its upstream 35S promoter sequence and gene downstream primer

[5,-TCAGCCAGAGATCTGGATAG -3,], the reaction time and temperature are as follows:

94^ 3min

94 X: 45s,

59"C 45s

2m in 30s, 30 cycles

72"C 5min

The results showed that most of the transformed plants were able to amplify the expected size of the electrophoresis band, while the negative control did not, indicating that the transgenic Arabidopsis genome already contained the foreign gene DNA fragment, and the results are shown in Figure C.

2.3 Arabidopsis heat shock test

Transgenic T1 plants were planted in MS solid medium at 23"C/21"C, heat shocked for 1 hour after 16/8 hours of growth, and the plant survival status was observed after two weeks. The experimental results showed that the transgenic plants had higher survival rate and higher heat tolerance than wild-type Arabidopsis thaliana after high temperature treatment (Fig. 4). When the transgenic T2 plants were grown to the pod ripening stage, they were placed in 36 high-temperature growth for 2 days, and the wild-type plants rapidly turned yellow and withered compared with the transgenic plants (Fig. 5).

The results of high-temperature growth experiments of transgenic lines showed that there was no significant difference in the yield of transgenic and wild-type Arabidopsis thaliana seeds in the environment, but in the 321C/30TC environment, there was a significant difference in the yield between transgenic plants and control plants. In the 30 _32" environment, the yield of wild-type forests was reduced by more than 30% compared to normal conditions, while the transgenic lines were reduced by less than 10% compared to normal conditions (Table 1).

Table 1 Changes in yield of transgenic Arabidopsis thaliana at different temperatures

Claims

Rights request

1. A rapeseed heat shock protein gene HSP17.8 having a nucleotide sequence of SEQ ID ΝΟ: 1 and comprising at least 70 of the other crops having the DNA sequence set forth in SEQ ID NO: 1. % homologous gene sequence; also includes mutant alleles or derivatives produced by addition, substitution, insertion or deletion of one or more nucleotides.

2. An isolated protein having the sequence of the amino acid sequence set forth in SEQ ID NO: 2, and comprising a protein sequence of at least 70% homology to the amino acid sequence set forth in SEQ ID NO: 1 in other crops; A mutant sequence or derivative produced by the addition, substitution, insertion or deletion of one or more amino acids is included.

3. The use of a rapeseed heat shock protein gene HSP17.8 according to claim 1 for improving plant heat resistance.