WO2010121380A1 - Methods and compositions for lung cancer prognosis - Google Patents
Methods and compositions for lung cancer prognosis Download PDFInfo
- Publication number
- WO2010121380A1 WO2010121380A1 PCT/CA2010/000619 CA2010000619W WO2010121380A1 WO 2010121380 A1 WO2010121380 A1 WO 2010121380A1 CA 2010000619 W CA2010000619 W CA 2010000619W WO 2010121380 A1 WO2010121380 A1 WO 2010121380A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gain
- chemotherapy
- gene
- mcr
- listed
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- genes and genomic regions are associated with prognosis of lung cancer. A subset are associated with significant improvement when administered chemotherapy. Detecting the gains and losses are useful for determining a prognosis for a subject with lung cancer and for guiding treatment selection.
- the disclosure provides a method for determining a lung cancer prognosis in a subject, the method comprising: (a) determining a genomic profile comprising detecting the presence or absence of one or more genomic alterations in one or more of chromosomes 2, 11 , 4, 5, 7, 9, 12, 17, 19, 20, 8, 1 , 13, 16, 6 and/or 14 listed in Tables 1-11 in a biological sample from the subject; wherein the prognosis is determined to be poor when the genomic profile comprises a gain of all or part of one or more minimal common regions (MCRs) and/or genes within one or more of chromosomes 1 , 2, 11 , 4, 5, 6, 7, 9, 12, 14, 16, 17, 19 and/or 20, listed as associated with poor prognosis (e.g.
- MCRs minimal common regions
- the method comprises: (a) determining a genomic profile comprising detecting the presence or absence all or part of one or more genomic alterations in one or more of chromosomes 2, 11 , 4, 5, 7, 9, 12, , 17, 19, 20, 8, 1 , 13, 16, 6 and/or 14 and/or genes listed in Tables 1-11 in a biological sample from the subject; (b) determining the lung cancer prognosis for the subject by comparing the genomic profile with one or more controls, wherein the prognosis is determined to be poor when the genomic profile comprises a gain of all or part of one or more minimal common regions (MCRs) and/or genes within chromosomes 1 , 2, 11 , 4, 5, 6, 7, 9, 12, 14, 16, 17, 19 and/or 20, listed as associated with poor prognosis in Tables 1 , 2, 5, 9, 10, and/or 11 and/or a loss of all or part of one or more MCRs within chromosomes 1 , 5, 8, 13 and/or 16 listed as associated with poor prognosis in Tables
- MCRs minimal common
- the method comprises obtaining a biological sample for determining the genomic profile.
- the prognosis is determined to be good when the hybridization pattern indicates a gain of all or part of a MCR within chromosome 8 associated with good prognosis and/or a loss of all or part of one or more MCRs within chromosome 6 or 14 associated with good prognosis relative to a control.
- the gain comprises all or part of RAB11 FIP1 and/or the loss comprises all or part of a gene listed in Table 8.
- the disclosure includes a method for determining tumour responsiveness to a chemotherapy treatment comprising detecting a gain of all or part of one or more of the genes listed in Tables 1 , 2, 5, 9 or 11 associated with improved response to chemotherapy, wherein a gain indicates the tumour is likely responsive to treatment with chemotherapy relative to a tumour not comprising the gain.
- the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of all or part of one or more of the following genes: MFSD7, D4S234E, ACOX3, SRD5A1 , AQP2, ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, DNMT3B.
- the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of all or part of one or more of the following genes GUCA2A, PPIH, LEPRE1 , CR623026, C1orf50, DQ515898, DQ515897, MYC FGF3, KRT81 , KRT1 , FAM112B B4GALNT1 , CENTG1 , BCL11 B (e g Table 11 genes associated with improved response to chemotherapy)
- the disclosure includes a method for determining a likelihood of improved survival with chemotherapy treatment comprising detecting a loss of all or part of a MCR and/or gene listed in Tables 3, 4, 7 and/or 8 associated with improved response to chemotherapy, wherein the loss indicates the subject has a good prognosis when treated with chemotherapy relative to a subject not treated with chemotherapy
- the disclosure includes a method for determining tumour responsiveness to a chemotherapy treatment comprising detecting a loss of all or part of a MCR and/or gene listed in Tables 3, 4, 7 and/or 8 associated with improved response to chemotherapy, wherein the loss indicates the tumour is likely responsive to treatment with chemotherapy relative to a tumour not comprising the loss
- the loss is of all or part of one of the following genes RHOC, ATP2C2, ZDHHC7, COC4I1 , and/or FOXF1
- the lung cancer is non-small cell lung cancer (NSCLC), early stage NSCLC, squamous cell carcinoma or adenocarcinoma and/or metastatic lung cancer
- the method further comprises detecting the expression level of a gene listed in Table 5, 6, 7, 8 9 and/or 11
- the expression level of a gene associated with prognosis and/or response to chemotherapy can be detected for predicting a prognosis and/or for predicting tumour responsiveness
- the expression level of the gene all or partly gained or lost is increased or decreased respectively, relative to a control expression level wherein increased expression of a gene gain listed in Table 5 and/or decreased expression of a gene listed in Table 7 indicates poor prognosis without chemotherapy, and/or increased expression of a gene listed in Table 6 and/or decreased expression of a gene listed in Table 8 indicates good prognosis
- the expression level of a gene listed in Table 9 or 11 is detected
- the gain of DNA copy number is at an MCR located at approximately base-pair positions 128289292 to about 128936748 on the long arm of chromosome 8 is indicative of a good prognosis with chemotherapy
- the gain of DNA copy number is at or within an MCR located at approximately base-pair positions 68572940 to about 70388868 on the long arm of chromosome 11 is indicative of a good prognosis with chemotherapy.
- the gain of DNA copy number is at or within an MCR located at approximately base-pair positions 52696908 to about 53538441 on the long arm of chromosome 12 is indicative of a good prognosis with chemotherapy.
- the gain of DNA copy number is at or within an MCR located at approximately base-pair positions 55933813 to about 57461765 on the long arm of chromosome 12 is indicative of a good prognosis with chemotherapy.
- the gain of DNA copy number is at or within an MCR located at approximately base-pair positions 96994959 to about 99058653 on the long arm of chromosome 14 is indicative of a good prognosis with chemotherapy.
- Another aspect relates to a method of selecting a treatment regimen for a subject with lung cancer, the method comprising' (a) determining a genomic profile comprising detecting a genomic alteration of all or part of one or more MCRs and/or genes selected from MCRs and genes identified herein associated with survival with chemotherapy, for example as listed in Table 1 , 2, 3, 5, 7, 9, 10 and/or 11 ; in a biological sample from the subject; and (b) selecting chemotherapy when a gain or loss associated with improved survival with chemotherapy is detected and/or not selecting chemotherapy and/or selecting a non-chemotherapy and/or a non- platinum analog -, a vinca alkyloid- and/or combination thereof chemotherapy, when a gene associated with worse survival with chemotherapy.
- the method comprises: (a) determining a genomic profile comprising detecting a genomic alteration in one or more genes selected from Table 5 and/or 7 in a biological sample from the subject;(b) selecting chemotherapy for the subject when the genomic profile comprises a gain of all or part of one or more of the following genes: MFSD7, D4S234E, ACOX3, SRD5A1 , AQP2, ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, and/or DNMT3B; and/or a loss of all or part of one or more of the following genes: RHOC, ATP2C2, ZDHHC7, COC4I1 , and/or FOXF1 relative to a control.
- the method comprises: (a) determining a genomic profile comprising detecting a genomic alteration in one or more genes selected from Table 9 and/or 11 in a biological sample from the subject;(b) selecting chemotherapy for the subject when the genomic profile comprises a gain of all or part of one or more of the following genes: BAALC, ANGPT1 , MYC, WISP1 , KRT81 , KRT1 , NEUROD4, and/or PA2G4 (e.g. Table 9 genes associated with improved response to chemotherapy).
- the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of all or part of one or more of the following genes: GUCA2A, PPIH, LEPRE1 , CR623026, C1orf50, DQ515898, DQ515897, MYC, FGF3, KRT81 , KRT1 , FAM112B, B4GALNT1 , CENTG1 , and/or BCL11 B (e.g. Table 11 genes associated with improved response to chemotherapy).
- the method comprises not selecting chemotherapy and/or not selecting a chemotherapeutic regimen comprising a platinum analog, a vinca alkyloid and/or a combination thereof e.g.
- the biological sample is selected from the group consisting of lung tissue, lung cells, lung biopsy and sputum, including formalin fixed, paraffin embedded and fresh frozen specimens
- a method for determining a lung cancer prognosis in a subject comprising detecting the presence or absence of a genomic alteration at a locus identified in Tables 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 and/or 11 in a biological sample from the subject, wherein the prognosis is determined to be poor in the absence of chemotherapy when a gain of all or part of a MCR listed in Tables 1 and/or 2 or a gene listed in Table 5 and/or a loss of all or part of a MCR listed in Table 3 and/or gene listed in Table 7 is detected, and the prognosis is determined to be good when a gain of all or part of a MCR or gene listed in Table 6 and/or loss of all or part of a MCR or gene in Table 4 and/or 8 is detected relative to a control
- a gain of all or part of a MCR listed in Table 10 and/or a gene listed in Table 9 and/or 11 wherein the prognosis
- the presence or absence of a gain of DNA copy number is detected at an MCR at 12q at or within basepair positions 50731457 to 51457372, and/or 12q at or within basepair positions 52696908 to 53538441 , and/or 12q at or within basepair positions 55933813 to 57461765, and/or 12q at or within basepair positions 64438067 to 68503251 , and/or 14q at or within basepair positions 96994959 to 99058653
- the presence or absence of a gam of DNA copy number is detected at an MCR at 12q at or within basepair positions 50731457 to 51457372
- the presence or absence of a gain of DNA copy number is detected at an MCR at 12q at or within basepair positions 52696908 to 53538441
- the presence or absence of a gain of DNA copy number is detected at an MCR at 12q at or within basepair positions 55933813
- the presence or absence of a gain of DNA copy number is detected at an MCR at 14q at or within basepair positions 96994959 to 99058653.
- the genomic alteration comprises all or part of a MCR listed in Table 1 , 2, 3, 4 and/or 10.
- the presence or absence of a DNA copy number alteration at for example, the position of a gene located within the MCRs gained or lost, for example genes within the MCRs listed in any one of Tables 1 to 11 are detected.
- the presence or absence of a DNA copy number alteration at the position of a gene from the group consisting of KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , and/or genes within an MCR located between 50-57 Mb on chromosome arm 12q e.g. MCR IDs NRG79, NRG80, NRG81 , NRG82
- the presence or absence of a gene from the group consisting of ITGA7, CDK2, BCDO2, ERBB3, DLST, PA2G4.ZBTB39 and/or TSFM which are comprised in the MCRs at 55.2 -55.6 Mbp on chromosome arm 12q are detected.
- the gene detected is all or part of a gene listed in Table 9 and/or 11.
- Another aspect provides a method of predicting response to a chemotherapeutic treatment in a subject with lung cancer comprising detecting the presence or absence of a gain or loss of all or part of a MCR or a gene in any one of Tables 1-11 , predicting the response to the chemotherapeutic according to the presence or absence of the MCR or gene gain or loss compared to a control, wherein detecting a MCR or gene associated with improvement with chemotherapy predicts chemotherapy will be efficacious, for example will, improve survival and/or wherein detecting a MCR and/or gene not associated with improvement with chemotherapy predicts no response to chemotherapy.
- a further aspect provides a method of determining a likelihood of improved survival in a lung cancer subject who was or is receiving a chemotherapeutic treatment, comprising determining the presence or absence of a gain or loss of all or part of a MCR and/or gene associated with improvement with chemotherapy, predicting the likelihood of improved survival according to the presence or absence of the MCR and/or gene gain or loss compared to a control, wherein detecting all or part of a gain and/or loss of a MCR and/or gene associated with improvement with chemotherapy predicts likelihood of improved survival compared to a control having the same gam and/or loss who has not received and/or is not receiving chemotherapy
- the presence of a gain and/or loss associated with improvement with chemotherapy is indicative of a favourable predisposition of the subject to respond to platinum analogs, vinca alkyloids and/or a combination thereof
- the genomic alteration, MCR and/or gene gain or loss is determined by array CGH, FISH, chromagen in situ hybridization (CISH) or PCR
- Another aspect provides a method of treating lung cancer comprising determining the presence or absence of a gain and/or loss of all or part of a MCR and/or gene associated with improvement with chemotherapy in a subject with lung cancer and administering chemotherapy to the subject with at least one gain or loss associated with improvement with chemotherapy
- the chemotherapy is a platinum analog, a vinca alkaloid or a combination thereof
- the platinum analog is selected from the group consisting of cisplatin, paraplatin, carboplatin, oxaliplatin and satraplatin in either IV or oral form
- the vinca alkaloid is selected from the group vinorelbine, vincristine, vinblastine, vindesine and vinflunine in either IV or oral form
- a further aspect relates to a composition
- a composition comprising a detection agent for detecting all or part of a MCR and/or gene gam or loss associated with prognosis
- the composition comprises a probe that binds and/or hybridizes with all or part of a MCR and/or a gene described herein, and/or a primer or primer pair for amplifying a polynucleotide comprising all or part of a MCR and/or gene associated with prognosis described herein
- the probe is a BAC clone listed in Table 13 and/or the primer is a primer listed in Table 12
- kits for determining lung cancer prognosis in a subject comprises a chromosomal probe and/or a set of chromosomal probes, wherein the probe or set comprises a probe to a MCR or part thereof listed in any one of Tables 1 to 11 and/or a gene or part thereof listed in Tables 5, 6, 7, 8, 9 and/or 11
- the kit comprises one or more gene expression probes, wherein a probe is specific for a gene expression product of a gene listed in Tables 5, 6, 7, 8, 9 and/or 11
- the probes are labeled, optionally fluorescently labeled or labelled with a chromagen
- the probes are comprised in an array on a solid support
- the kit further comprising instructions that indicate prognosis is determined to be poor when a hybridization pattern of the set of chromosomal probes indicates a gain in all or part of a MCR in 12q
- the kit comprises a reagent for FISH analysis of a MCR or a gene gain or loss described herein, for example, the kit comprises a probe for a MCR or gene gain or loss described herein, for example a BAC clone comprising all or part of a target MCR or gene including for example the BAC clones listed in Table 13 and/or labeling reagents for labeling the probe.
- the kit comprises a reagent for CGH analysis of a MCR or gene gain or loss described herein, for example, the kit comprises an array with one or more probes for detecting all or part of one or more MCRs or genes gained or lost described herein and/or labeling reagents for labeling the subject sample DNA.
- the kit comprises a reagent for PCR such as quantitative or multiplex PCR, for example the kit comprises a primer set for amplifying all or part of a MCR or gene described herein associated with prognosis.
- lung cancer refers to cancers of the tissues or cells of the lung including for example non-small cell lung cancer (NSCLC), and small cell lung cancer (SCLC).
- NSCLC non-small cell lung cancer
- SCLC small cell lung cancer
- the term could also be used to refer to cancers that have arisen in the lung and have metastasized to other sites (e.g. brain, liver, adrenals),
- non-small cell lung cancer refers to primary lung cancer that is distinguished from small cell lung cancer and that is composed of multiple different types, including adenocarcinoma, squamous cell carcinoma, large cell carcinoma and other less frequent types.
- lung adenocarcinoma and/or “lung ADC” and/or “pulmonary ADC” as used herein refer to a type of lung cancer and comprises various subtypes including bronchioloalveolar carcinoma (BAC) which is non invasive and/or includes focal invasion and has good prognosis (2) and invasive ADC including mixed type, which can have areas with BAC like pattern and is referred to as invasive ADC with BAC features (AWBF).
- BAC bronchioloalveolar carcinoma
- AWBF invasive ADC with BAC features
- control refers to a specific value or dataset e.g., control expression level, control gene copy number, reference expression profile or reference genomic profile according to the context which a person skilled in the art would readily understand, derived from one or more samples of a known subject class e.g., lung cancer free class not having a MCR or a gene gain or loss described herein, that is suitable for comparison to the value or dataset derived from a subject sample.
- the control can be a value or dataset derived from tumor adjacent non-neoplastic normal tissue or tissue from a disease free subject, e.g. for comparing to a lung cancer subject gene expression profile.
- genomic alterations e.g.
- control can for example also refer to an internal control e.g. the copy number of a non-altered region of the chromosome or a different chromosome e.g. a chromosome with minimal variance in lung cancer subjects, for example a chromosome not herein or previously identified as associated with prognosis.
- an internal control e.g. the copy number of a non-altered region of the chromosome or a different chromosome e.g. a chromosome with minimal variance in lung cancer subjects, for example a chromosome not herein or previously identified as associated with prognosis.
- Such methods wherein an internal control is useful include for example quantitative polymerase chain reaction (PCR) or fluorescent in situ hybridization (FISH).
- PCR quantitative polymerase chain reaction
- FISH fluorescent in situ hybridization
- the copy number can be compared to the centromere for example when using FISH.
- a normal or control genomic profile refers to a single genomic copy on each of the two allele
- control is a normal reference genomic DNA that is assumed to have 2 copies of each gene.
- a positive control is employed, for example, a sample or standard corresponding to subject comprising the gain or loss associated with prognosis and/or response to chemotherapy, useful for example for quantitative PCR and/or FISH methods, for example included in quantitative PCR and/or FISH based kits.
- disease free subject refers to a subject that is free of lung cancer.
- microarray refers to an array of distinct polynucleotides or oligonucleotides synthesized or spotted (e.g. in the case of BAC clones) on a substrate, such as paper, nylon or other type of membrane, filter, chip, glass slide, or any other suitable solid support.
- complementarity refers to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing.
- sequence "A- G-T” binds to the complementary sequence "T-C-A”.
- Complementarity between two single-stranded molecules may be "partial”, in which only some nucleotides or portions of the nucleotide sequences of the nucleic acids bind, or it may be complete when total complementarity exists between the single stranded molecules
- the degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands
- PCR polymerase chain reaction
- MLPA multiplex PCR and multiplex ligation dependent probe amplification
- ligation amplification or hgase chain reaction LCR
- amplification methods based on the use of Q-beta replicase
- reference profile refers to a reference expression profile, a reference genomic profile, and/or a reference gene copy number profile according to the context
- a "reference expression profile” as used herein refers to the expression signature of a subset of biomarkers (e g one or more), which correspond to genes associated with a prognosis class e g poor prognosis or good prognosis +/- chemotherapy and/or a control
- expression level refers to the absolute or relative amount of the transcription and/or translation product of a gene described herein and includes RNA and polypeptide products
- a "reference gene copy number profile" as used herein refers to the gene copy number of a subset of genes (e g one or more) listed in Tables 5, 6, 7, 8, 9 and/or 11
- the reference gene copy number profile is optionally a reference number, typically 2, and/or identified using for example using normal human tissue and/or cells and/or tissue and/or cells from lung cancer Normal tissue and/or cells includes for example, tumor adjacent non- neoplastic tissue and/or cells and/or tissue and/or cells from a lung cancer disease free subject.
- the reference gene copy number profile is accordingly a reference signature of the copy number of a subset of genes in Tables 5, 6, 7, 8, 9 and/or 11 , to which the subject gene copy number of the corresponding genes in a sample of a subject are compared.
- genomic profile refers to the genomic structural signature of a subject genome.
- a number of variations and alterations referred to as copy number variations, have been characterized including amplifications and deletions, a subset of which are associated with disease.
- the alterations can comprise small and large amplifications and/or deletions which can occur through out the genome.
- determining a genomic profile refers to detecting the presence, absence, frequency, variability and/or length of one or more genomic alterations including amplifications and deletions of all or part of one or more MCRs and/or which may or may not comprise alterations in the coding nucleic acid sequence of genes e.g., can comprise alterations in the intergenic regions of the genome, such as those found for example on 12q, 8q and 11q.
- Genomic alterations comprising amplifications and deletions in all or part of one or more genes comprise those listed in Tables 5, 6, 7, 8, 9 and/or 11.
- a person skilled in the art will appreciate that a number of methods can be used to determine a genomic profile, including for example fluorescence and other non-fluorescent types of in situ hybridization (FISH, CISH or others), and quantitative PCR (qPCR), multiplex PCR including for example multiplex ligation dependent probe amplification (MLPA) and array CGH.
- FISH fluorescence and other non-fluorescent types of in situ hybridization
- qPCR quantitative PCR
- multiplex PCR including for example multiplex ligation dependent probe amplification (MLPA) and array CGH.
- reference genomic profile refers a genomic signature comprising genomic alterations, associated with prognosis with or without chemotherapy.
- the reference genomic profile is optionally a normal reference genomic DNA (e.g. a control) that is assumed to have 2 copies of each gene and/or is derived from normal human tissues and/or cells.
- the reference genomic profile is accordingly for example, normal genomic copy number to which a subject genomic profile is compared for classifying the tumor or determining or predicting clinical outcome.
- chemotherapy means treatment with anticancer drugs, including but not limited to treatment with vinca alkaloids for example vinorelbine vinblastine, vincristine, vinflunine and/or vindesine in for example IV or oral form and/or platinum analogues for example cisplatin, carboplatin, paraplatin, satraplatin and/or oxaliplatin in for example IV or oral form.
- vinca alkaloids for example vinorelbine vinblastine, vincristine, vinflunine and/or vindesine in for example IV or oral form
- platinum analogues for example cisplatin, carboplatin, paraplatin, satraplatin and/or oxaliplatin in for example IV or oral form.
- chemotherapeutic means an anticancer drug, including but not limited to treatment with mitotic inhibitors such as vinca alkaloids for example vinorelbine vinblastine, vincristine, and/or vindesine or analogs thereof and/or DNA alkylating agents such as platinum based chemotherapeutics for example cisplatin, carboplatin and oxaliplatin.
- mitotic inhibitors such as vinca alkaloids for example vinorelbine vinblastine, vincristine, and/or vindesine or analogs thereof
- DNA alkylating agents such as platinum based chemotherapeutics for example cisplatin, carboplatin and oxaliplatin.
- similar or “similarity” as used herein with respect to a reference profile refers to similarly in both the identity and quantum of change in expression level of a biomarker, genomic alteration, or gene copy number variation compared to a control where the control is for example derived from a normal cell and/or tissue or has a known outcome class such as poor survival or good survival.
- similarity in expression means that there is no or little difference, for example no statistical difference, in the level of expression of the biomarkers between the test sample and the control and/or between good and poor prognosis groups defined by biomarker expression levels.
- the term "most similar” in the context of a reference profile refers to a reference profile that is associated with a clinical outcome that shows the greatest number of identities and/or degree of changes with the subject profile.
- the term "differentially expressed” or “differential expression” as used herein refers to biomarkers described herein that are expressed at one level in a prognostic group and expressed at another level in a control The differential expression can be assayed by measuring the level of expression of the transcription and/or translation products of the biomarkers, such as the difference in level of messenger RNA transcript expressed or polypeptide expressed in a test sample and a control The difference can be statistically significant
- the term "difference in the level of expression” refers to an increase or decrease in the measurable expression level of a given biomarker expression product as measured by the amount of messenger RNA transcript and/or the amount of polypeptide in a sample as compared with the measurable expression level of a given biomarker in a control
- the differential expression can be compared using the ratio of the level of expression of a given biomarker or biomarkers as compared with the expression level of the given biomarker or biomarkers of a control, wherein the ratio is not equal to 1 0
- an RNA or polypeptide is differentially expressed if the ratio of the level of expression in a first sample as compared with a second sample is greater than or less than 1 0
- a ratio of greater than 1 1 , 1 2, 1 5, 1 7, 2, 3, 3, 5, 10, 15, 20 or more or a ratio less than 0 9, 0 8, 0 6, 0 4, 0 2, 0 1 , 0 05 0 001 or less
- prognosis refers to a clinical outcome e g a poor survival or a good survival, and includes for example survival outcome in the absence of chemotherapy and/or improved survival with administration of chemotherapy
- Good prognosis and improved survival are used herein interchangeably as are poor prognosis and poor survival
- prognosis is associated with the presence or absence of a gain or loss of specific MCRs and genes described herein, compared to a reference profile such as a reference expression profile, or a reference gene copy number profile of a suitable comparator group
- a reference profile such as a reference expression profile, or a reference gene copy number profile of a suitable comparator group
- subjects with gains in MCRs and/or genes listed in for example Tables 1 , 2, 5, 9, 10 and/or 11 or loss of MCRs and/or genes in Table 3, 4, and/or 7 have a poor prognosis or poor survival compared to subjects not having these gains or losses for regions identified Accordingly, the prognosis provides an indication of disease progression and includes an indication of likelihood of
- the term "associated with a prognosis” as used herein refers to gains and/or losses in all or part of a MCR and/or gene associated with survival identified in the Tables as associated with for example, poor survival in the absence of chemotherapy and/or listed in the Tables as associated with improved survival with chemotherapy, as well as for example MCRs and/or genes listed in the Tables as associated with good and/or prognosis
- the term "associated with a poor prognosis” identifies the subset shown to statistically or trend to poor survival with surgery alone e g in the absence of chemotherapy (and /or the presence of chemotherapy for gams at AK024870 and/or CPSF6)
- the term "tumour responsiveness” as used herein refers to the likelihood that a subject's lung cancer will or will not respond to chemotherapy treatment It has been determined that a subset gains or losses associated with prognosis are associated with benefit from chemotherapy such that a subject with these gains or losses have an improved survival when treated with chemotherapy compared to a subject not receiving chemotherapy with the same gain or loss Gains have also been associated with worse survival For example, a gain or increased expression ofANK024870 and/or CPSF6 is associated with worse survival with administration of chemotherapy [0084]
- the term "classifying” as used herein refers to assigning, to a class or kind, an unclassified item A "class” or "group” then being a grouping of items, based on one or more characteristics, attributes, properties, qualities, effects, parameters, etc , which they have in common, for the purpose of classifying them according to an established system or scheme For example, subjects having gains associated with poor prognosis, such as gains in MCRs and/or genes listed in for example Table
- loss or "gain” refers with respect to a genomic profile refers to a change in copy number, for example the loss can be on the plus strand or the minus strand and can involve loss of one or both alleles Similarly, a "gain” can for example be a gain on the plus strand or the minus strand and can involve gain on one or both alleles The gain can additionally be the gam of 1 or more copies
- high amplitude gain or “high level amplification” as used herein refers to a copy number variation of a MCR or gene amplification where the average Iog2 value, as assigned by DNAcopy analysis, in the gained samples, was greater than 0 15
- high amplification gains were identified as described in the Examples and include for example MCRs listed in Table 10 and genes listed in Table 11
- prognosing means predicting clinical outcome such as survival and/or response to chemotherapy for example by identifying the class a subject belongs to according to the presence of a gain or loss of a genomic region such as 12q, 11q, 8q, 1 p, or 14q or a region (MCR) or gene identified in any one of Tables 1to 11 Where one or more gains or losses are detected, clinical outcome can be based on a subject's similarity to a control and/or a reference profile and/or biomarker expression level associated with a prognosis. Methods of prognosis described herein can optionally be included in multivariate models incorporating known prognostic clinical factors, such as age, sex stage and grade.
- good survival refers to an increased disease free survival for example as compared to subjects in a suitable comparator "poor survival” group e.g. not having a gain or loss associated with good prognosis or improved response to chemotherapy.
- poor survival refers to an increased risk of death and/or disease occurrence as compared to subjects in a suitable comparator "good survival” group e.g. having a gain or loss associated with good prognosis or improved response to chemotherapy.
- subjects comprising a gain or loss of a MCR or gene or altered biomarker expression described herein as associated with poor prognosis such as genes and MCRs listed in Tables 1 , 2, 5, 7, and/or 9-11 , have a poor survival compared to subjects not comprising such a loss, gain or altered expression as indicated therein.
- subjects not receiving chemotherapy who comprise a gain or loss associated with improvement when treated with chemotherapy for example such as MCRS listed in Table 1 , 2, and/or 3 and/or genes listed in Tables 5, 7, 9 and/or 11 associated with improvement with chemotherapy, have poor survival when not treated with chemotherapy compared to subjects with the same gain, loss or altered expression who receive chemotherapy.
- a good survival group comprises subjects comprising a gain or loss or biomarker expression described herein associated with good prognosis, for example a gain or loss listed in Table 6 and/or 8 respectively.
- subjects receiving chemotherapy that comprise gains or losses associated with improved survival with chemotherapy such as the particular MCRs listed in Table 1 , 2 and/or 3 and/or the genes in Tables 5, 7, 9 and/or 11 identified as associated with significant improvement with chemotherapy have good survival when treated with chemotherapy compared to subjects with the similar gain, loss or expression who do not receive chemotherapy.
- Subjects in a good survival group or good survival group when treated with chemotherapy are at less risk of death 5 years after surgery.
- Subjects in a poor survival group or poor survival when not treated with chemotherapy group are at greater risk of death within 5 years from surgery.
- a poor survival group comprises subjects having a 5 year survival rate of less than 80%.
- good survival indicates good prognosis and poor survival indicates poor prognosis.
- genes associated with good survival or “genes associated with good prognosis” as used herein refers to genes listed in Table 6, for example RAB11 FIP1 and genes listed in Table 8, for example, C6orf15, CDYL, HLA-DOA, KIFC1 , MSH5/C6orf26, NCR3, RXRB, and/or TCL6.
- MCRs associated with good survival or "MCRs associated with good prognosis” as used herein refer to MCRs associated with good prognosis for example the MCRs comprising the genes listed in Tables 6 and/or 8.
- genes associated with good survival when treated with chemotherapy or “genes associated with good prognosis when treated with chemotherapy” as used herein refers to for example genes identified in Table 5 as showing significant improvement and/or trending to improvement, for example MFSD7, D4S234E, ACOX3, SRD5A1 , AQP2, ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, and/or DNMT3B; and/or genes listed in Table 7, for example RHOC, ATP2C2, ZDHHC7, COC4I1 , and/or FOXF1 ; and/or gene listed in Table 9, for example BAALC, ANGPT1 , MYC, WISP1 , KRT81 , KRT
- genes associated with poor survival or “genes associated with poor prognosis” alternatively “genes associated with poor survival/prognosis in the absence of chemotherapy” as used herein refers to for example genes so identified and listed in Table 5, for example MFSD7, D4S234E, ACOX3, SRD5A1 , ADCY2, (clone Z146), ANKH, CDH18, OXCT1 , UTRN, cDNA DKFZp434E2423, C9orf68, AQP2 ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ITGA7, CDK2/BCDO2, ERBB3, DLST/PA2G4, PRIM1 , ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, TRHDE, OR1
- genes not associated with improvement when treated with chemotherapy refers to genes for example listed in Table 5 identified as not showing significant improvement when treated with chemotherapy, for example ADCY2, (clone Z146), ANKH, CDH18, OXCT1 , UTRN, cDNA DKFZp434E2423, C9orf68, ITGA7, CDK2/BCDO2, ERBB3, DLST/PA2G4, PRIM1 , TRHDE, OR1 E1/OR1 E2, and/or RCVRN, and/or genes listed in Table 7 identified as not showing significant improvement when treated with chemotherapy, for example AHCYL1 , ATP1A1 , IGSF3, ELF1 , RGC32, ESD, TAF1C, and/or MAP1 LC3B, as well as genes listed in Table 9 and/or 11 so identified Detection of these genes for example is useful for selecting a treatment regimen For example since subjects comprising losses or gains at these loci do not demonstrate improved
- treatment is an indicated approach for obtaining beneficial or desired results, including clinical results
- an indicated approach for lung cancer Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized ( ⁇ e not worsening) state of disease, preventing spread of disease delay or slowing of disease progression, amelioration or palliation of the disease state, prolonging survival as compared to expected survival if not receiving treatment and remission (whether partial or total), whether detectable or undetectable
- surgery is indicated for Stage I lung cancers
- surgery plus adjuvant chemotherapy is indicated for subjects with more advanced stages
- the methods described herein are useful for example, for identifying subjects with lung cancer that benefit from receiving chemotherapy
- selecting a treatment refers to selecting a chemotherapeutic regimen, for example a regimen comprising a platinum based chemotherapeutic such as cisplatin, a regimen comprising a vinca alkyloid such as vinolrebine or a treatment regimen comprising a combination thereof, that is useful for obtaining beneficial results such as prolonging survival
- the treatment selected is a regimen that does not comprise a platinum based chemotherapeutic such as cisplatin, a regimen comprising a vinca alkyloid such as vinolrebine or a treatment regimen comprising a combination thereof.
- subject such as a “subject” to be diagnosed, prognosed, staged, screened, assessed for risk, subject for selection of a treatment, and/or treated by the subject methods and articles of manufacture can mean either a human or non-human animal, preferably a human being.
- sample refers to any fluid, cell or tissue sample from a subject which can be assayed for genomic alterations or biomarker expression products e.g. for determining a genomic profile or an expression profile, depending on the method and comprises without limitation lung tumor tissue and/or cells, derived from, for example, lung biopsy, for example obtained by bronchoscopy, needle aspiration, thoracentesis and/or thoracotomy, and/or derived from cells found in sputum.
- lung tumor tissue and/or cells derived from, for example, lung biopsy, for example obtained by bronchoscopy, needle aspiration, thoracentesis and/or thoracotomy, and/or derived from cells found in sputum.
- the term could also be used for example to refer to metastatic tumour tissue obtained from the brain or liver or other site.
- RNA includes mRNA transcripts, and/or specific spliced variants of mRNA.
- RNA product of the biomarker refers to RNA transcripts transcribed from the biomarkers and/or specific spliced variants.
- polypeptide it refers to polypeptides translated from the RNA transcripts transcribed from the biomarkers.
- polypeptide product of the biomarker refers to polypeptide translated from RNA products of the biomarkers.
- nucleic acid refers to a polynucleotide molecule and includes DNA and RNA and can be either double stranded or single stranded.
- the nucleic acid molecules contemplated by the present disclosure include isolated nucleotide molecules which hybridize specifically to genomic DNA, RNA product of a biomarker, polynucleotides which are complementary to a RNA product of a biomarker of the present disclosure, nucleotide molecules which act as probes, or nucleotide molecules which are specific primers for a MCR or gene gained or lost set out in Tables 1-11 , including for example the probes and primers listed in Tables 12 and 13.
- isolated nucleic acid refers to a nucleic acid substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors, or other chemicals when chemically synthesized.
- An "isolated nucleic acid” is also substantially free of nucleotides which naturally flank the nucleic acid (i.e. nucleotides located at the 5' and 3' ends of the nucleic acid) from which the nucleic acid is derived.
- hybridize refers to the sequence specific non- covalent binding interaction with a complementary nucleic acid.
- the hybridization is under high stringency conditions.
- Appropriate stringency conditions which promote hybridization are known to those skilled in the art, or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1 6.3.6.
- 6.0 x sodium chloride/sodium citrate (SSC) at about 45°C, followed by a wash of 2.0 x SSC at 50°C may be employed when hybridization is detecting expression levels, for example by northern or slot blot analysis.
- array CGH hybridization often occurs with labeled DNA for patient and reference DNA added to a solution including formamide and SSC (2.Ox).
- the DNA/hybridization buffer mixture is allowed to competitively hybridize at 45°C to the array (and its targets) for -36-40 hours, after which washes take place. Signal intensities at each arrayed element are then evaluated.
- a detailed description of array CGH hybridization protocols is provided in Buys et al., "Key Features of Bacterial Artificial Chromosome Microarray Production and Use" in DNA Microarrays (Methods Express Series) (Schena M, ed.), Scion Publishing, Ltd. Bloxham, Oxfordshire, UK, pp.115-145 (ISBN: 9781904842156) (please see section 2.5 in particular).
- primer refers to a nucleic acid sequence, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of synthesis of when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand is induced (e.g. in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH).
- the primer must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent.
- the exact length of the primer will depend upon factors, including temperature, sequences of the primer and the methods used.
- a primer typically contains 15-25 or more nucleotides, although it can contain less. The factors involved in determining the appropriate length of primer are readily known to one of ordinary skill in the art.
- primer pair refers a set of primers which can produce a double stranded nucleic acid product complementary to a portion of the RNA products of the biomarker or sequences complementary thereof.
- probe and/or “hybridization probe” as used herein refers to a nucleic acid sequence that will hybridize to a nucleic acid target sequence, for example.
- the probe hybridizes to a RNA product of the biomarker or a nucleic acid sequence complementary thereof for detecting gene expression or hybridizes a genomic region comprising a gain or loss of a genomic region described herein associated with prognosis.
- the length of probe depends on the hybridization conditions and the sequences of the probe and nucleic acid target sequence.
- the probe comprises at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, 500 or more nucleotides in length, for example complementary to at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, or 500 contiguous nucleotides of a gene listed in Table 5, 6, 7, 8, 9 and/or 11 , or a genomic region alteration such as a MCR and/or region flanking a MCR described herein, for example in Tables 1 to 11 , for example Table 1 , 2, 3, 4 and/or 10.
- the probe can further be 90%, 95, 96, 97, 98, 99, 99 5, 99 9% identical to the at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, or 500 contiguous nucleotides of a gene listed in Table 5, 6, 7, 8, 9 and/or 11 , or a genomic region alteration such as a MCR and/or region flanking a MCR described herein, for example in Table 1 , 2, 3, 4 and/or 10
- the probe can also for example comprise a MCR or a gene associated with prognosis.
- the probe can be a bacterial artificial chromosome (BAC) clones and can comprise the target sequence as well as additional sequence
- the probe can be at least 50 000, 100 000, 150 000 and/or 200 000 nucleotides, for example 150 000-200 000 base pairs
- the probe can for example comprised in an array, for example, on a solid support, for example array for CGH
- BAC clone probes on the array are usually in the 150,000-200,000 bp range
- Labelled DNA and reference DNA generated from subject and reference DNA samples are typically a few hundred bp in size (small fragments may be excluded after labeling or during washing steps)
- These subject DNA and reference DNA are generated for example, using a random priming reaction, such that their lengths will vary See for example Buys et al reference (above) and citations within (e g original citation at Feinberg & Vogelstein Anal Biochem, 132, 6-13 )
- antibody as used herein is intended to include monoclonal antibodies, polyclonal antibodies, and chimeric antibodies The antibody may be from recombinant sources and/or produced in transgenic animals
- antibody fragment as used herein is intended to include Fab, Fab 1 , F(ab')2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, and multimers thereof and bispecific antibody fragments
- Antibodies can be fragmented using conventional techniques For example, F(ab')2 fragments can be generated by treating the antibody with pepsin The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments Papain digestion can lead to the formation of Fab fragments Fab, Fab' and F(ab')2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments and
- biomarker refers to a gene that is altered in its gene copy number in a poor prognosis class and/or a good prognosis class e g with or without chemotherapy, compared to a control and/or is differentially expressed in subjects in poor and good prognosis classes
- biomarkers includes one or more of the genes listed in Table 5, 6, 7, 8, 9 and/or 11
- Lung cancer remains the leading cause of cancer death in Canada with an overall 5-yr survival rate of 16% Up to 40% of lung cancer patients are potentially curable by surgery, yet their risk of dying from the disease remains high at 50% Post-surgery chemotherapy is a toxic therapy but may improve cure rate New methods of classifying lung cancers are needed for making more informed decisions on chemotherapy, based on specific molecular markers present in each cancer Using a CGH microarray, small regions of chromosomes have been identified that when gained or lost in lung cancers, impart a worse prognosis with surgery alone, and a subset of these also show a significant benefit with current standard chemotherapy After testing individual genes within these regions by quantitative polymerase chain reaction, DNA copy number gains located on 1 p, 8q, 11q, 12q, and 14q were confirmed to impart a worse prognosis in the absence of chemotherapy, and/or an improved response to chemotherapy [00110] Accordingly in an aspect, the disclosure provides a method for determining a lung cancer prognosis in a subject, the method
- the method comprises (a) determining a genomic profile comprising detecting one or more genomic alterations in chromosomes 2, 11 , 4, 5, 7, 9, 12, 17, 19, 20, 8, 1 , 13, 16, 6 and/or 14 listed in Tables 1-11 in a biological sample from the subject, (b) determining the lung cancer prognosis for the subject by comparing the genomic profile with one or more controls, wherein the prognosis is determined to be poor when the genomic profile comprises a gain of one or more minimal common regions (MCRs) or genes within chromosomes 1 , 2, 11 , 12, 4, 5, 6, 7, 9, 12, 14, 16, 17, 19 and 20 listed as associated with poor prognosis in Tables 1 , 2,
- MCRs minimal common regions
- the prognosis is determined to be good when the genomic profile comprises a genomic gain of an MCR or gene within chromosome 8 listed as associated with good prognosis in Table 6 and/or a loss of one or more MCRs or genes within chromosome 2, 6, 9 or 14 listed as associated with good prognosis in Tables 6 and/or 8 relative to the control
- the method comprises obtaining a biological sample for determining the genomic profile
- the disclosure provides a method for determining a lung cancer prognosis in a subject, the method comprising detecting the presence of a genomic alteration at a locus identified in Tables 1-11 in a biological sample from the subject, wherein the prognosis is determined to be poor in the absence of chemotherapy when a gain of a MCR or gene listed in Tables 1 , 2, 5, 9, 10 and/or 11 and/or a loss of a MCR or gene listed in Table 3 and/or 7 is detected, and the prognosis is determined to be good when a gain of a MCR or gene listed in Table 6 and/or loss of a MCR or gene in Table 4 and/or 8 is detected relative to a control
- the genomic alteration detected comprises a gain or loss of DNA copy number at an MCR listed in Tables 1 -11 , for example Table 1 , 2, 3, 4 and/or 10
- the presence or absence of a gain of DNA copy number is detected at an MCR at 1 p at or within basepair positions 41265460 to 43221579
- the presence or absence of a gain of DNA copy number is detected at an MCR at 8q at or within basepair positions 128289292 to 128936748
- the presence or absence of a gain of DNA copy number is detected at an MCR at 11 q at or within basepair positions 68572940 to 70388868
- the presence or absence of a gain of DNA copy number is detected at an MCR at 14q at or within basepair positions 96994959 to about 99058653
- the presence or absence of a gain of DNA copy number is detected at an MCR at 12q at or within basepair positions 507314
- the genomic alteration detected comprises all or part of a MCR listed in Table 1 , 2, 3, 4 and/or 10 In an embodiment, the genomic alteration detected comprises all or part of a MCR listed in Table 10
- the method comprises determining a genomic profile comprising detecting one or more genomic alterations listed Table 1 , 2, 5, 9, 10 and/or 11 , in a biological sample from the subject, (b) determining the lung cancer prognosis for the subject by comparing the genomic profile with one or more controls, wherein the prognosis is determined to be poor in the absence of chemotherapy when the genomic profile comprises a gain of one or more minimal common regions (MCRs) or genes listed in Table 1 , 2, 5, 9, 10 and/or 11
- MCRs minimal common regions
- the method comprises determining a genomic profile comprising detecting one or more genomic alterations in chromosomes 1 , 5, 8, 13 and 16 listed in Table 3 and/or 7 wherein the prognosis is determined to be poor in the absence of chemotherapy when the genomic profile comprises a loss of one or more MCRs or genes within chromosomes 1 , 5, 8, 13 and 16 listed in Table 3 and/or 7
- all or part of genes located within the MCRs gained or lost for example the MCRs listed in any one of Tables 1 to 11 , for example, Tables 1 , 2 and/or 10 are detected Detection of an increased or decreased DNA copy number of a gene (e g a gam, amplification or loss of said gene) comprised therein can be indicative of the presence or absence of a gain, amplification, or loss at the corresponding MCR
- a gene e g a gam, amplification or loss of said gene
- Detection of an increased or decreased DNA copy number of a gene (e g a gam, amplification or loss of said gene) comprised therein can be indicative of the presence or absence of a gain, amplification, or loss at the corresponding MCR
- DQ515898, DQ515897, and MYC genes are found within the MCR at basepair positions 128289292 to 128936748 on chromosome arm 8q
- the gene detected is selected from the group, DQ515898, DQ515897, and MYC In a further embodiment, the gene detected is selected from the group consisting of AK024870, NUP107, MDM2, CPSF6, and BCL11 B In a further embodiment, the gene detected is selected from the group consisting of GUCA2A, PPIH, LEPRE1 , CR623026, and C1orf50 In a further embodiment, the gene detected is selected from the group consisting of CCND1 and FGF3 In a further embodiment the gene detected is selected from the group consisting of B4GALNT1 , OS9, CENTG1 , CDK4, and TSFM
- the method comprises detection of a gain of all or part of one or more of the genes listed in Table 9 and/or 11 for genes identified as associated significantly with poor prognosis (and/or trending to poor prognosis) including ANGPT1 , HOXC11 , ITGA7, PRIM1 , B4GALNT1 , OS9, CDK4, and TSFM (e g Table 9 genes) and/or GUCA2A, LEPRE1 , C1orf50, FGF3, FAM112B, B4GALNT1 , OS9, CENTG1 , CDK4, TSFM, AK024870, NUP107, MDM2, CPSF6, BCL11 B, ASXH1 AND C20orf112 (e g Table 11 genes)
- the MCRs described herein as associated with prognosis comprise gains or losses of genes listed in Tables 5, 6, 7, 8, 9 and/or 11 , and of the genomic regions listed in Tables 1 to 11 and particularly Tables 1 , 2, 3, 4 and/or 10
- the gain or loss can be all or part of any one of these genes
- the detected gain or loss comprises amplification and/or deletion of the entire gene
- the prognosis is determined to be poor, in the absence of chemotherapy, when the genomic profile comprises a gain of a MCR comprising all or part of a gene listed in Table 5, 9 and/or 11 associated with poor prognosis and/or comprises a loss of a MCR comprising all or part of a gene listed in Table 7 associated with poor and/or comprises a gain of an MCR in table 1 , 2 and/or 10 associated with poor prognosis, and the prognosis is determined to be good, in the absence of chemotherapy, when the genomic profile comprises a gain of a MCR comprising all or part of gene listed in Table 6 and/or a loss of a MCR comprising all or part of a gene listed in Table 8 relative to the control
- detection of one of the gains losses described herein is sufficient for association with prognosis and/or response to chemotherapy
- the method comprises hybridizing a chromosomal probe or a set of chromosomal probes to the biological sample, and detecting the presence or absence of hybridized probe
- the probe is complementary to at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, 500 contiguous nucleotides of a gene listed in Table 5, 6, 7, 8, 9 and/or 11 , or a genomic region alteration such as a MCR and/or region flanking a MCR described herein, for example in Table 1 , 2, 3, 4 and/or 11.
- the probe is at least or greater than 90, 95, 96, 97, 98, 99, 99.5 or 99.9% identical to a gene listed in Tables 5, 6, 7, 8, 9 and/or 11 , or a region in listed in any one of Tables 1-11 , for example Tables 1 , 2, 3, 4 and/or 10.
- the probe can be a bacterial artificial chromosome (BAC) clone and can comprise the target sequence.
- the probe can be at least 50,000 bp, at least 100, 000 bp, at least 150, OOObp and/or at least 200 000 bp, for example 150 000-200 000 bp
- the probe can for example comprised in an array, for example, on a solid support.
- the set of chromosomal probes is comprised in an array.
- the probes are labeled, for example the probes are fluorescently labeled.
- the subject DNA and the reference DNA is labeled.
- the method comprises: (a) determining a hybridization pattern of a chromosomal probe in a biological sample from the subject, wherein the probe hybridizes to a chromosome selected from the group 11 , 4, 5, 6, 7, 9, 12, 17, 20, 8, 1 , 13, 16, and/or 14 and (b) determining the lung cancer prognosis for the subject based on the hybridization pattern, wherein the prognosis is determined to be poor when the hybridization pattern indicates a gain of one or more MCRs or genes within chromosome for example 1 , 2, 8, 11 , 12, 14 and/or 20 listed in Table 1 , 2 and/or 10 , or for example within chromosome 1 , 2, 4, 5, 6, 7, 8, 9, 11 , 12, 14, 17, and 20 listed in Table 5, 9 and/or 11 and/or a loss of one or more MCRs or genes within chromosomes 1 , 13 and 16 listed in Table 7 and the prognosis is determined to be good when the hybridization profile indicates a gain
- the method comprises (a) determining a hybridization pattern of a chromosomal probe or set of chromosomal probes in a biological sample from the subject, wherein the set comprises one or more probes directed to one or more MCRs and/or genes in chromosomes 2, 11 , 4, 5, 6, 7, 9, 12, 14, 16, 17, 19, 20, 8, 1 , 13, 16, 6 and/or 14 listed in Tables 1-11 , and (b) determining the lung cancer prognosis for the subject based on the hybridization pattern, wherein the prognosis is determined to be poor when the hybridization pattern indicates a gain or loss of one or more MCRs or genes associated with poor prognosis and the prognosis is determined to be good when the hybridization profile indicates a gain or loss of one or more MCRs or genes associated with good prognosis relative to the control
- the prognosis is determined to be poor when the hybridization pattern indicates a gain of one or more MCRs or genes listed in Table 1 , 2, 5, 9 and/or 11 and/or a loss of one or more MCRs or genes listed in Table 3 and/or 7
- the gain comprises all or part of a gene listed in Table 5
- the gain comprises all or part of a gene listed in Table 9
- the gain comprises all or part of a gene listed in Table 11
- the loss comprises all or part of a gene listed in Table 7
- the prognosis is determined to be good when the hybridization pattern indicates a gain of a MCR or gene within chromosome 8 and/or a loss of one or more MCRs or genes within chromosome 6 or 14 relative to the control
- the gain comprises all or part of RAB11 FIP1
- the loss comprises all or part of a gene listed in Table 8
- the disclosure includes a method for determining a likelihood of improved survival or response with chemotherapy treatment comprising detecting a gain of all or part of a MCR or gene listed in Tables 1 , 2, 5, 9, 10 and/or 11 associated with improved response to chemotherapy, wherein a gain indicates the subject has a good prognosis when treated with chemotherapy relative to a subject not treated with chemotherapy.
- the disclosure includes a method for determining tumour responsiveness to a chemotherapy treatment comprising detecting a gain of all or part of one or more of the genes listed in Tables 1 , 2, 5, 9 or 11 associated with improved response to chemotherapy, wherein a gain indicates the tumour is likely responsive to treatment with chemotherapy relative to a tumour not comprising the gain.
- the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of all or part of one or more of the following genes: BAALC, ANGPT1 , MYC, WISP1 , KRT81 , KRT1 , NEUROD4, and/or PA2G4 (e.g.
- the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of of all or part of one or more of the following genes: GUCA2A, PPIH, LEPRE1 , CR623026, C1orf50, DQ515898, DQ515897, MYC FGF3, KRT81 , KRT1 , FAM112B, B4GALNT1 , CENTG1 , BCL11 B (e.g. Table 11 genes associated with improved response to chemotherapy).
- Another aspect provides a method of determining a lung cancer prognosis in a subject, the method comprising detecting the presence of a MCR and/or gene associated with improvement with chemotherapy, for example a MCR of Table 1 , 2, and/or 3, or a gene from Table 5 or 7, wherein the gain or loss of a MCR and/or gene associated with improvement with chemotherapy (as indicated in the relevant table) is indicative the subject will have good prognosis relevant to a control, for example a subject with the gain or loss not receiving chemotherapy.
- a MCR and/or gene associated with improvement with chemotherapy for example a MCR of Table 1 , 2, and/or 3, or a gene from Table 5 or 7, wherein the gain or loss of a MCR and/or gene associated with improvement with chemotherapy (as indicated in the relevant table) is indicative the subject will have good prognosis relevant to a control, for example a subject with the gain or loss not receiving chemotherapy.
- the disclosure includes a method for determining a likelihood of improved survival with chemotherapy treatment comprising detecting a loss of all or part of a MCR or gene listed in Tables 3, 4, 7 and/or 8 associated with improved response to chemotherapy, wherein the loss indicates the subject has a good prognosis when treated with chemotherapy relative to a subject not treated with chemotherapy.
- the disclosure includes a method for determining tumour responsiveness to a chemotherapy treatment comprising detecting a loss of all or part of a MCR or gene listed in Tables 3, 4, 7 and/or 8 associated with improved response to chemotherapy, wherein the loss indicates the tumour is likely responsive to treatment with chemotherapy relative to a tumour not comprising the loss.
- the chemotherapy comprises a platinum based chemotherapeutic.
- the chemotherapy comprises a vinca alkaloid.
- the chemotherapy regimen includes both a platinum based chemotherapeutic and a vinca alkyloid.
- Expression data of the genes herein identified associated with prognosis is also predicted to be useful for predicting prognosis.
- gene expression levels would be expected to increase
- gene expression levels would be expected to decrease This is for example often the case with heterozygous gene knock out in mice, and/or transgene copy number in transgenic mice
- increased expression of a gene whose gain is associated with poor outcome is expected to be indicative of poor outcome and decreased expression of a gene, loss of which is associated with poor outcome is expected to be indicative of poor outcome
- increased expression of a gene, gain of which is associated with good outcome is expected to be indicative of good outcome and decreased expression of a gene, loss of which is associated with good outcome, is expected to be indicative a good outcome
- Gene expression can be determined alone and/or in conjunction with genomic alterations
- another aspect provides a method for determining a lung cancer prognosis in a subject, the method comprising (a) determining an expression profile comprising detecting an expression level of one or more genes listed in Tables 5, 6, 7, 8, 9 and/or 11 associated with prognosis in a biological sample from the subject, wherein the prognosis is determined to be poor when the expression profile comprises a increased level of expression of one or more genes in Table 5, 9 and/or 11 associated with poor prognosis and/or a decreased expression in one or more genes listed in Table 7 and the prognosis is determined to be good when the expression profile comprises increased expression of RAB11 FIP1 and/or decreased expression of one or more genes in Table 8, relative to a control
- the method includes step (b), said step (b) comprising determining the lung cancer prognosis for the subject by comparing the expression profile with one or more controls
- the expression level is optionally determined in addition to the genomic copy number Accordingly, in addition to determining the genomic profile and/or the detecting the gain or loss of a MCR comprising all or part of one or more genes listed in Tables 5, 6, 7, 8, 9 and/or 11 , the method further comprises detecting the expression level of a gene listed in Table 5, 6, 7, 8, 9 and/or 11. In an embodiment, the expression level of the gene all or partly gained or lost, is increased or decreased respectively, relative to a control expression level.
- the expression level is detected using a probe that binds a gene listed in Tables 5, 6, 7, 8, 9 and/or 11.
- the probe comprises at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, 500 contiguous nucleotides complementary to a gene listed in Table 5, 6, 7, 8, 9 and/or 11 , or a gene with at least 90, 95, 98, 99, 99.5 or 99.9% identity to a gene in Table 5, 6, 7, 8, 9 and/or 11.
- the probe can for example be comprised in an array, for example, on a solid support, for example array.
- the expression level is detected by detecting the presence or absence of hybridized probe.
- the probes are comprised in an array, for example on a solid support.
- the probes are labeled or for example fluorescently labeled.
- MCRs of gain located on 12q and 14q e.g. Table 1 or 10
- MCR gains were found by array-CGH and qPCR studies to be significantly associated with poor survival in the absence of chemotherapy.
- Predictive associations have been found for MCRs of gain located on 1 p, 8q, 11q, 12q, and 14q. Subjects with these MCRs were found to have improved survival when treated with chemotherapy.
- another aspect provides a method for determining a lung cancer prognosis in a subject, the method comprising: (a) determining a hybridization pattern of a chromosomal probe in a biological sample from the subject, wherein the set comprises a probe to the 6Mb region of chromosome 12q, 8q or 11q; and (b) determining the lung cancer prognosis for the subject based on the hybridization pattern, wherein the prognosis is determined to be poor without chemotherapy when the hybridization pattern indicates a gain of a MCR within the 6Mb region of chromosome 12q relative to a control and/or the prognosis is determined to be good when treated with chemotherapy when the hybridization pattern indicates a gain of a MCR within 8q and/or 11 q
- gain of DNA copy number at an MCR located on 1 p within basepair positions 41265460 to 43221579 is indicative of a good prognosis with chemotherapy
- gain of DNA copy number at an MCR within basepair positions 128289292 to about 128936748 on the long arm of chromosome 8 is indicative of a good prognosis with chemotherapy
- gain of DNA copy number at an MCR within basepair positions 68572940 to about 70388868 on the long arm of chromosome 11 is indicative of a good prognosis with chemotherapy
- gain of DNA copy number at an MCR within basepair positions 50731457 to about 51457372 on the long arm of chromosome 12 is indicative of a good prognosis with chemotherapy
- gain of DNA copy number at an MCR within basepair positions 52696908 to about 53538441 on the long arm of chromosome 12 is indicative of a good prognosis with chemotherapy
- gain of DNA copy number at an MCR within basepair positions 55933813 to about 57461765 on the long arm of chromosome 12 is indicative of a good prognosis with chemotherapy
- gain of DNA copy number at an MCR within basepair positions 96994959 to about 99058653 on the long arm of chromosome 14 is indicative of a good prognosis with chemotherapy
- the method comprises detection of DNA copy number of a gene in Tables 5-11 that falls within a MCR listed in Table 1 , 2, 3, 4 and/or 10.
- the disclosure provides methods for selecting a treatment for subjects with lung cancer.
- the disclosure provides a method of selecting a treatment regimen for a subject with lung cancer, the method comprising: (a) determining a genomic profile comprising detecting a genomic alteration in one or more genes selected from Table 5 and/or 7 in a biological sample from the subject; (b) selecting a treatment for the subject optionally by comparing the genomic profile with one or more controls, wherein the treatment selected comprises chemotherapy when the genomic profile comprises a gain of all or part of one or more of the following genes: MFSD7, D4S234E, ACOX3, SRD5A1 , AQP2, ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, DNMT3B; and/or a loss of all or part of one or more of
- the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of all or part of one or more of the following genes: BAALC, ANGPT1 , MYC, WISP1 , KRT81 , KRT1 , NEUROD4, and/or PA2G4 (e.g.
- the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of of all or part of one or more of the following genes: GUCA2A, PPIH, LEPRE1 , CR623026, C1orf50, DQ515898, DQ515897, MYC FGF3, KRT81 , KRT1 , FAM112B, B4GALNT1 , CENTG1 , BCL11 B (e.g. Table 11 genes associated with improved response to chemotherapy).
- the gain comprises a gain in all or part of one or more of FGF3, FAM112B, TSFM, NUP107 and/or MDM2
- the subject has been treated by surgical resection
- the method for selecting a treatment comprises (a) determining a genomic profile comprising detecting a genomic alteration in one or more genes selected from AK024870 and CPSF6, wherein the treatment selected comprises non-chemotherapy and/or a non-platinum analog-, vinca alkaloid or combination thereof chemotherapy treatment when the genomic profile comprises a gain of all or part of one or more of AK024870 and CPSF6
- the disclosure also provides a method of prognosis of likelihood of improved survival in a lung cancer subject who was and/or is receiving a chemotherapeutic treatment, comprising determining the presence or absence of a gain or loss of a MCR associated with improvement with chemotherapy, predicting the likelihood of improved survival according to the presence or absence of the MCR or gene gain or loss compared to a control, wherein detecting a MCR or gene associated with improvement with chemotherapy predicts likelihood of improved survival compared to a control having the same gain or loss who has not received or is not receiving chemotherapy
- the presence of a gain or loss associated with improvement with chemotherapy is indicative of a favourable predisposition of the subject to respond to platinum analogs, vinca alkyloids and/or a combination thereof
- Another aspect provides a method of treating lung cancer comprising determining the presence or absence of a gain or loss of a MCR or gene associated with improvement with chemotherapy in a subject with lung cancer and administering chemotherapy to a subject with at least one gain or loss associated with improvement with chemotherapy
- the chemotherapy administered is a platinum analog, a vinca alkyloid or a combination thereof
- the platinum analog is selected from the group consisting of cisplatin, paraplatin, carboplatin, oxaliplatin and satraplatin in either IV or oral form
- the vinca alkyloid is selected from the group vinorelbine, vincristine, vinblastine, vindesine and vinflunine in either IV or oral form
- the lung cancer is non-small cell lung cancer (NSCLC), early stage NSCLC, squamous cell carcinoma, adenocarcinoma, or large cell carcinoma
- NSCLC non-small cell lung cancer
- squamous cell carcinoma adenocarcinoma
- large cell carcinoma adenocarcinoma
- the biological sample can be any sample that comprises a polynucleotide or biomarker expression product to be assayed
- the biological sample is selected from the group consisting of lung tissue, lung cells, lung biopsy and sputum including formalin fixed, paraffin embedded and fresh frozen specimens
- the methods described herein compare a subject profile, genomic or expression with a control
- the control with respect to genomic alterations is for example the copy number of gene or region in a subject in a different class e g good prognosis when treated with chemotherapy versus poor prognosis when not treated with chemotherapy, or alternatively can be an internal control, e g the copy number at a region with no gain or loss, for example centromere copy number
- centromere copy number can be used
- centromere cannot be used, and instead a "control" gene would be used, a gene on the same or different chromosome that is infrequently gained or lost
- a reference genomic DNA sample from a "normal" individual without cancer would be used
- the control is the centromere copy number
- the copy number of a gene or region is 2, one copy per allele Accordingly, in another embodiment the control is such
- the gene detected is not EGFR, MET, MYC, CCND1 KRAS, and/or TITF1
- compositions and kits which are useful for example in the methods described herein
- An aspect provides a composition comprising a detection agent for detecting the presence or absence of a MCR or gene gain or loss associated with prognosis
- the detection reagent is a hybridization probe, for example a chromosomal probe or a gene expression probe
- the probe comprises at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, or 500 contiguous nucleotides complementary to a gene listed in Table 5, 6, 7, 8, 9 and/or 11 , or a genomic region alteration such as a MCR and/or region flanking a MCR described herein, for example in Tables 1 to 11 , or for example in Table 1 , 2, 3, 4 and/or 11.
- the probe can further be 90, 95, 96, 97, 98, 99, 99 5, 99 9% identical to the at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, or 500 contiguous nucleotides of a gene listed in Table 5, 6, 7, 8, 9 and/or 11 , and/or a MCR and/or region flanking a MCR described herein, for example in Table 1 , 2, 3, 4 and/or 10
- the nucleotide length of the probe can vary, and in the case of a BAC clone can include sequence in addition to the gene or MCR associated
- the probe is a BAC clone.
- the BAC clone is at least 50 000, 100 000, 150 000 or 200 000 nucleotides. In an embodiment the BAC clone is about 150 000-200 000 nucleotides.
- BAC clones can be used for example as probes in FISH and some array CGH platforms.
- the probe is complementary to a MCR described herein.
- the probe comprises a BAC clone that overlaps the MCR or gene gained or lost.
- the probe comprises the nucleotide sequence of a BAC clone of an Affymetrix U133A chip comprising a MCR or gene gain or loss described herein as associated with prognosis.
- a person skilled in the art on the basis on the teachings herein, such as the teachings in the Examples, would be able to identify the probes that correspond to the particular MCRs and genes.
- the composition comprises a primer or a primer pair for amplifying a biomarker expression polynucleotide, or a genomic region described herein.
- the primer is in an embodiment, 15-20, 21-30, 31-40, 41-50 or more than 50 nucleotides in length.
- composition further comprises a carrier.
- the disclosure provides a kit for determining lung cancer prognosis in a subject comprising for example a detection agent or composition described herein.
- the kit comprises a chromosomal probe wherein the probe hybridizes all or part of a MCR listed in Tables 1 to 11 , for example in Table 1 , 2, 3, 4 and/or 10 and/or all or part of a gene listed in Tables 5, 6, 7, 8, 9 and/or 11.
- the disclosure provides a kit for determining lung cancer prognosis in a subject, the kit comprising one or more gene expression probes, wherein the set comprises a probe specific for a gene expression product of a gene listed in Tables 5, 6, 7, 8, 9 and/or 11.
- the probes are labeled, for example, the probes are fluorescently labeled.
- the kit comprises labeling reagents for example for labeling subject sample, e.g. subject DNA.
- the probes are comprised in an array on a solid support.
- the kit comprises reagents for FISH analysis of a MCR or gene gain or loss described herein, and a control region such as a centromere or gene on the same or different chromosome.
- the kit comprises a probe for a MCR or gene gain or loss described herein, and a reference probe to the centromere or a gene on the same or different chromosome, and labeling reagents for labeling the probe.
- the kit comprises reagents for CGH analysis of a MCR or gene gain or loss described herein, for example, the kit comprises an array with one or more probes for one or more MCRs or genes gained or lost described herein and labeling reagents for labeling the subject sample DNA.
- the kit comprises reagents for PCR such as quantitative or multiplex PCR.
- the kit comprises a primer set for amplifying all or part of a MCR or gene, or multiple MCRs or genes, described herein associated with prognosis, as well as one or more primer sets for identifying one or more control genes on the same or different chromosomes.
- the kit comprises a primer set and probe for detecting an amplification product.
- the kit comprises a positive and/or a negative control.
- the control in an embodiment comprises normal reference DNA for CGH or FISH based kits.
- a positive control comprises a tumour that is known to have a gain or loss at the particular target being assayed.
- the kit further comprising instructions that indicate prognosis is determined to be poor in the absence of chemotherapy when a hybridization pattern of the chromosomal probe or set of chromosomal probes indicates a gain in a MCR in for example, chromosome 11 or 12 listed in Table 1 , 2 and/or 10, or a gain in a MCR comprising all or part of a gene listed in Table 5, 9 and/or 11 and/or a loss of the a MCR comprising all or part of a gene listed in Table 7, relative to control; good when a hybridization pattern of one or more chromosomal probes indicates a gain in a MCR comprising all or part of a gene listed in Table 6 and/or a loss of the MCR comprising all or part of a gene listed in Table 8.
- the kit comprises instructions that indicate prognosis is determined to good when treated with chemotherapy when a hybridization pattern of the chromosomal probe or set of chromosomal probes indicates a gain in a MCR comprising for example, all or part of MFSD7, D4S234E, ACOX3, SRD5A1 , AQP2, ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, and/or DNMT3B, and/or a loss in a MCR comprising all or part of RHOC, ATP2C2, ZDHHC7, COC4I1 , FOXF1 , relative to a control.
- the kit comprises instructions that indicate prognosis is determined to be good when treated with chemotherapy, when a hybridization pattern of a chromosomal probe or set of chromosomal probes indicates a gain in a MCR comprising for example a gain listed in Table 9 and/or 11 to be associated with poor prognosis.
- the instructions include direction for comparing to a control.
- the instructions include direction and/or reagents for using a centromere copy number or other chromosome as a control.
- the chromosomal pattern of observed gains and losses by array-CGH are in concordance with previous array-CGH and CGH studies in NSCLC, including frequent gains at chromosome 1q, 3q, 5p, and 8q, and frequent losses at 3p, 5q, 6q, 8p, 9p, 13q, and 17p
- MCRs of DNA copy number alteration encompass multiple genes known to be important in NSCLC, including MYC, hTERT, and cyclin D1 , as well as many potentially important novel genes
- DNA was extracted from 134 formalin-fixed, paraffin-embedded (FFPE) and 16 fresh frozen NSCLC specimens, from 142 patients.
- FFPE formalin-fixed, paraffin-embedded
- the FFPE samples were cored from tissue blocks in areas of > 60% tumour cells, as marked by a pathologist on hematoxylin and eosin (H&E) slides.
- tumour samples 176 fresh frozen tumour samples and 10 fresh frozen corresponding normal lung samples were used. 133 of these tumour samples were from patients in the JBR10 cohort, 81 of which also had array-CGH data analyzed in this study. 38 of the tumour samples were from a non-JBR10 cohort.
- Array comparative genomic hybridization was performed using a custom whole genome tiling path bacterial artificial chromosome array with 26,363 overlapping clones, each spotted in duplicate (BC Cancer Research Centre, Vancouver, BC) (Watson SK et al., 2007). This platform enables us to measure alterations in DNA copy number at high resolution across the entire genome in each tumour sample, with a minimal amount (as little as 50ng) of DNA.
- Array-CGH data preprocessing and normalization [00205] Array image capture and data normalization was performed as previously described (Watson SK et al , 2007) Briefly, post-hybrid ization arrays were scanned using a CCD-based imaging system, and quantitated using Soft-Worx Tracker spot analysis software (Applied Precision, Issaquah, WA)
- MCRs whose frequency of alteration amongst the samples multiplied by their average Iog2 of altered samples was less than 0.02 were removed from further analysis. These MCRs are referred to as “narrow MCRs of gain” and “narrow MCRs of loss” herein.
- RNA expression levels within MCRs of gain were determined by integrating data from gene expression microarray experiments. Gene expression for 133 NSCLC samples was assessed using an Affymetrix U133A microarray chip. The data was normalized using RMAexpress software followed by distance-weighted discrimination (DWD) to minimize "batch" differences among samples, and then Iog2 transformed.
- DWD distance-weighted discrimination
- the MCRs of gain and loss as defined above were cross-referenced with the locations of genes on the Affymetrix U133A chip ( ⁇ 22,000 probesets in total) that were found to have prognostic value by univariate Cox proportional hazards analysis on the observation arm only.
- p ⁇ 0.05 the locations of genes on the Affymetrix U133A chip ( ⁇ 22,000 probesets in total) that were found to have prognostic value by univariate Cox proportional hazards analysis on the observation arm only.
- 398 probesets (364 genes) fell within MCRs of gain
- 426 probesets (391 genes) fell within MCRs of loss.
- Standard curves were derived using pooled DNA from 20 formalin-fixed paraffin-embedded lung tissue from resection specimens, taken from blocks unmvolved by tumour In addition, 23 normal FFPE lung samples were run along with the tumour samples in each reaction
- RNA expression data showing the same survival effect for the RNA transcript quantity as for the DNA copy number, gene ontology relating to oncogenicity, average Iog2 ("raw" Iog2 values as well as Iog2 values assigned by DNAcopy) among gained samples, STAC analysis frequency p-value ⁇ 0 05, overexpression of RNA transcripts in NSCLC, location within an amplicon reported previously in the literature, p-values of prognostic and predictive survival associations for DNA copy number at that location (both univariate and multivariate), and p-values for prognostic and predictive survival associations of RNA transcript levels (univariate)
- the array-CGH dataset described in Example 1 is unique and powerful in that it uses tumour samples from a randomized controlled trial of the effectiveness of chemotherapy in early-stage NSCLC, providing an unprecedented opportunity to study genomic aberrations at high-resolution and correlating them with patient outcome in the presence or absence of chemotherapy
- the sample size (113) is more than double the majority of previous array-CGH studies, allowing for a greater power in determining prognostic and predictive effects of gains and losses
- the resolution of our platform is superior to most previous array-CGH studies in NSCLC, allowing us to more precisely define the breakpoints of amplifications and deletions
- An additional 180 samples from the same trial will be processed to further validate the survival associations found in the array-CGH study described herein.
- the sample of lung tumour is obtained during surgery or a minimally invasive procedure.
- the tissue is processed in the lab to identify the tumour content.
- a portion of the tumour is frozen, or fixed in formalin and embedded in paraffin as per standard laboratory protocol.
- the DNA is extracted from the tumour tissue, and subjected to a laboratory test to examine for specific genomic alterations, such as array-CGH or multiplex qPCR.
- sections are cut from a paraffin block containing tumour, and processed for FISH analysis using probes hybridizing to one or more of our targets, and the tumour nuclei are scored for gains and losses.
- BAC clones span the recurring alteration
- Human BAC Resource http://www.ncbi.nlm.nih.gov/qenome/cyto/hbrc.shtml
- SMRT array mapping information - specific to individual BAC clones - is available online (http://www.bccrc.ca/cg/ArrayCGH_Group.html, http://bacpac.chori.org/order.php).
- BACPAC Resources Center http://bacpac.chori.org/order.php BACPAC Resources Center http://bacpac.chori.org/order.php. Labeled probes from this DNA could then be made and applied using a standard FISH protocol. Alternatively, labeled probes for FISH from a given clone could also be ordered directly from a variety of sources, including the BC Cancer Research Centre (http://arraycgh.ca/services.php).
- a HR of 0 indicates that no subjects in the chemotherapy-treated group died due to disease
- a HR of 0 1 means that the risk of dying due to disease was 10 times greater in the non-chemotherapy-treated group compared to the chemotherapy-treated group
- a gene identified as "continuous” refers to a gene that shows an increasing survival effect with increasing amplitude of DNA copy gam or amplification, by cox proportional hazards statistical analysis on continuous copy number data
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Oncology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Hospice & Palliative Care (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Disclosed herein are methods and materials for prognosing survival of lung cancer patients, the methods comprising the detection of gains and losses of minimal common regions and/or genes associated with prognosis and benefit of chemotherapy.
Description
Title: METHODS AND COMPOSITIONS FOR LUNG CANCER PROGNOSIS
Family Information
[0001] This application claims the benefit of 35 U S C 119 based on the priority of co-pending U S provisional patent applications 61/171 ,356, filed April 21 , 2009 and 61/171 ,687 filed April 22, 2009, each of which are herein incorporated by reference in their entirety
Field of the Disclosure
[0002] The disclosure relates to methods and compositions for prognosing and selecting treatment for lung cancer, particularly non-small cell lung carcinomas (NSCLC)
Background of the Disclosure
[0003] Lung cancer is the leading cause of cancer death in Canada (Canadian Cancer Society, 2008) Even after complete surgical resection of stage l-lll non-small-cell lung cancer (NSCLC), approximately half of patients will recur and die within 5 years (Azzoli et al, 2008) Current NSCLC clinicopathologic staging is not adequate to accurately predict which patients will be cured by surgery alone, and which patients with high risk of disease recurrence and mortality need adjuvant therapies
[0004] Many studies have examined gene and protein expression patterns in NSCLC for refining the prognostication and treatment of the disease, with some success However, the impact on patient survival and response to therapy for gene copy number alterations (amplifications and deletions) is an area that has not been well studied in this regard
[0005] Gene copy number changes are worthy of close examination in NSCLC, because they have been shown to provide important information in other malignancies HER2/neu amplification in breast cancer is the best- known example, where it has been shown to impart a much worse survival (Slamon DJ et al, 1987) as well as predict the response to systemic chemotherapies (Dhesy-Thind et al, 2007) B-cell chronic lymphocytic
leukemia / lymphoma is another well-studied example, deletions at 13q14 have been shown to be associated with prolonged survival, whereas deletions at 11q22-23 and at the TP53 locus on chromosome 17p have both been associated with a poor prognosis (Jaffe, 2003) Many similar discoveries of associations of gene copy number gains and losses with patient outcome are rapidly being discovered in many different malignancies Detailed mechanistic studies may help further our understanding of the pathobiology and ultimately provide better treatments for patients
[0006] Microarray comparative genomic hybridization (array-CGH) is a relatively new technique, capable of detecting gains and losses of genomic material at high-resolution across the genome, that has begun to revolutionize this body of knowledge Recent studies have demonstrated the ability of array-CGH to subtype breast carcinomas (Chment et al, 2007a), DLBCL (Tagawa et al, 2005), CLL (Patel et al, 2008), and gliomas (Idbaih et al, 2008) into distinct groups based on their pattern of gams and losses Many studies have shown an impact of specific gains or losses on patient survival, including colorectal carcinoma (Kim et al, 2006), gastric adenocarcinoma (Weiss et al, 2004), breast carcinoma (Han et al, 2006), mantle cell lymphoma (Rubio-Moscardo et al, 2005), diffuse large B cell lymphoma (Chen et al , 2006, Tagawa et al, 2005), neuroblastoma (Tomioka et al, 2008), and gliomas (Idbaih et al, 2008) In one study of breast carcinomas from patients enrolled in a clinical trial, the loss of a specific region of chromosome 11q was shown to be associated with a good response to anthracychne-based chemotherapy (Chment et al, 2007b) Two previous studies have shown that reliable array-CGH profiles can be obtained using archival formalin-fixed, paraffin-embedded (FFPE) tissues (Fenesterer et al, 2007, Mayr et al, 2006) This is very important, as it allows this powerful technique to be performed on the vast quantity of routinely handled and archived surgical specimens of diagnostic laboratories
[0007] Similar to other epithelial malignancies, the karyotypes of NSCLC show multiple and complex chromosomal aberrations, resulting in
net gain or loss of genetic material, indicative of genomic instability (Balsara et al, 2002) The imbalance profiles of the histologic subtypes of NSCLC (adenocarcinoma, squamous carcinoma, and large cell carcinoma) are similar, with frequent gains involving 5p, 8q, 3q, and 1q, frequent losses at 3p, 8p, 9p, 13q, and 17p, and often showing polyploidy (in the range of 58- 102 chromosomes per cell) (Hoglund et al, 2004) Amplifications are commonly observed in the form of double minutes Knowledge of the order or progression of these aberrations is scarce, but some have speculated that early events include trisomy 7, loss at 3p, and trisomy 12 Gains at both 7q and 8q have been associated with higher stage tumours with positive nodal involvement and higher tumour grade, and 20q13 gains have been linked with invasiveness in adenocarcinoma (AC)
[0008] Genes reported to be amplified have included MYC TERT, cyclin D1 , and EGFR Increased epidermal growth factor (EGFR) copy number are seen in 8-30% of patients by FISH and qPCR, and are often seen in conjunction with mutations in the EGFR tyrosine kinase domain (Thomas et al, 2006) Both amplification and mutations are associated with a specific demographic East Asian, female, never smokers, with adenocarcinomas often showing a bronchioloalveolar histologic pattern (Sequist et al, 2007) Studies have shown that these patients tend to have a rapid, dramatic, and durable response to gefitinib, a drug specifically designed to inhibit the tyrosine kinase signaling activity of EGFR (Cappuzo et al, 2005, Takano et al, 2005, Hirsch et al, 2007) This finding is an exciting example of how the identification of genetic events such as amplification and mutation can lead to effective targeted therapies Strategies such as this could eventually lead to effective individualized chemotherapy designed against many other altered pathways
[0009] P63 amplification has also been shown to have a prognostic utility in NSCLC Massion et al (2003) applied FISH and immunohistochemistry to detect P63 gene amplification and protein expression in tissue microarrays containing 217 NSCLC samples They
found that P63 copy number >= 3 and increased immunostaining intensity were both significantly associated with a better survival
[0010] Array-CGH has allowed researchers to study gene copy number aberrations in even greater detail (Dehan et al, 2007, Choi et al, 2007, Zhao et al, 2005, Jiang et al, 2004) The high resolution of this technique is clarifying genomic amplification and deletion to regions often containing only a few genes, as well as identifying small, previously undetected aberrations As a result, the list of genes implicated in NSCLC pathobiology is growing rapidly Tonon et al (2005) identified 93 minimal common regions (MCRs) of aberration in NSCLC tumours and cell lines, 21 of which spanned less than 0 5Mb with a median of 5 genes in each, with virtually all genes previously implicated in NSCLC pathogenesis present within these regions, as well as many novel candidate genes Patterns of aberrations were similar between adenocarcinoma (AC) and squamous carcinoma (SqC), supervised or unsupervised clustering was unable to differentiate the two Only the amplification on 3q26-29 has been targeted significantly in SqC, similar to previous findings by Massion et al (2002)
[0011] In a large study of 371 adenocarcinomas using SNP array-CGH, Weir et al (2007) identified 26 recurrent large-scale events involving gain or loss of at least half of a chromosome, together comprising more than half of the human genome In addition, 31 focal amplifications and homozygous deletions were identified, including multiple novel candidate genes One of the homozygously deleted genes was PTPRD, a tyrosine phosphatase Upon sequencing of this gene, somatic mutations were found in 11 of 188 samples, indicating a role in PTPRD dysregulation in a subset of ACs The most common focal amplification, at 14q13 3, contained no known proto- oncogene Biological studies using RNAi knockout of the 2 genes found within this region identified that NKX2-1 as a key factor in the growth of cell lines with 14q amplifications
[0012] Findings such as these highlight the power and utility of array- CGH for finding specific molecular aberrations in subsets of NSCLC
However, lacking in the literature are studies correlating these genomic events with patient outcome. Shibata et al (2005) studied 55 ACs and were able to split the tumours into 3 groups by unsupervised hierarchical clustering. These clusters were associated with distinct genetic alterations and showed an association with smoking history and gender, but no association with stage or disease-free survival. However, two specific alterations did show an association with disease-free survival on multivariate analysis: loss on 13q14.1 and gain of 8q24.2 were both associated with a poor outcome.
[0013] Materials and methods for prognosing lung cancer and selecting effective treatment for subjects with lung cancer, particularly non-small cell lung carcinomas (NSCLC) would be useful.
Summary of the Disclosure
[0014] Disclosed herein are genes and genomic regions, the gain or loss of which are associated with prognosis of lung cancer. A subset are associated with significant improvement when administered chemotherapy. Detecting the gains and losses are useful for determining a prognosis for a subject with lung cancer and for guiding treatment selection.
[0015] Accordingly in an aspect, the disclosure provides a method for determining a lung cancer prognosis in a subject, the method comprising: (a) determining a genomic profile comprising detecting the presence or absence of one or more genomic alterations in one or more of chromosomes 2, 11 , 4, 5, 7, 9, 12, 17, 19, 20, 8, 1 , 13, 16, 6 and/or 14 listed in Tables 1-11 in a biological sample from the subject; wherein the prognosis is determined to be poor when the genomic profile comprises a gain of all or part of one or more minimal common regions (MCRs) and/or genes within one or more of chromosomes 1 , 2, 11 , 4, 5, 6, 7, 9, 12, 14, 16, 17, 19 and/or 20, listed as associated with poor prognosis (e.g. associated with survival) in Tables 1 , 2, 5, 9, 10, and/or 11 and/or a loss of all or part of one or more MCRs and/or genes within one or more chromosomes 1 , 5, 8, 13 and/or 16 listed as associated with poor prognosis in Table 3 and/or 7 and the prognosis is
determined to be good when the genomic profile comprises a genomic gain of all or part of a MCR and/or gne within chromosome 8 listed as associated with good prognosis in Table 6 and/or a loss of all or part of one or more MCRs and/or genes within chromosome 2, 6, 9 and/or 14 listed as associated with good prognosis in Tables 8 relative to a control.
[0016] In an embodiment, the method comprises: (a) determining a genomic profile comprising detecting the presence or absence all or part of one or more genomic alterations in one or more of chromosomes 2, 11 , 4, 5, 7, 9, 12, , 17, 19, 20, 8, 1 , 13, 16, 6 and/or 14 and/or genes listed in Tables 1-11 in a biological sample from the subject; (b) determining the lung cancer prognosis for the subject by comparing the genomic profile with one or more controls, wherein the prognosis is determined to be poor when the genomic profile comprises a gain of all or part of one or more minimal common regions (MCRs) and/or genes within chromosomes 1 , 2, 11 , 4, 5, 6, 7, 9, 12, 14, 16, 17, 19 and/or 20, listed as associated with poor prognosis in Tables 1 , 2, 5, 9, 10, and/or 11 and/or a loss of all or part of one or more MCRs within chromosomes 1 , 5, 8, 13 and/or 16 listed as associated with poor prognosis in Tables 3 and/or 7; and the prognosis is determined to be good when the genomic profile comprises a genomic gain of all or part of a MCR and/or gene within chromosome 8 listed as associated with good prognosis in Table 6 and/or a loss of all or part of one or more MCRs and/or genes within chromosome 2, 6, 9 and/or 14 listed as associated with good prognosis in Table 6 and/or 8 relative to the control.
[0017] In an embodiment, the method comprises obtaining a biological sample for determining the genomic profile.
[0018] In an embodiment, the prognosis is determined to be poor when the genomic profile comprises a gain of all or part of a gene listed in Table 5, and/or comprises a loss of all or part of a gene listed in Table 7, and the prognosis is determined to be good when the genomic profile comprises a gain of all or part of a gene listed in Table 6 and/or a loss of all or part of a gene listed in Table 8 relative to the control. In an embodiment, the
prognosis is determined to be poor when the genomic profile comprises a gain of all or part of a gene listed in Table 9, and/or 11 identified as associated significantly and/or trending to significance with poor prognosis. In an embodiment, the gene associated with prognosis is a gene that shows a trend to significance. In another embodiment, the gene associated with prognosis is a gene with a significant association.
[0019] In an embodiment, the presence or absence of a genomic alteration is determined using a chromosomal probe and detecting a hybridization pattern.
[0020] In another embodiment, the prognosis is determined to be poor when the hybridization pattern indicates a gain of all or part of a MCR or a gene listed in Table 1 , 2, 5 and/or 9-11 (for genes identified as associated with poor prognosis) and/or loss of all or part a MCR or gene listed in Table 3 and/or 7. In a further embodiment, the gain comprises all or part of a gene listed in Table 5 and/or the loss comprises all or part of a gene listed in Table 7. In yet another embodiment, the gain comprises all or part of one or more of genes listed in Tables 9 and/or 11.
[0021] In another embodiment, the method comprises detection of a gain of all or part of one or more of the genes listed in Table 9 and/or 11 for genes identified as associated significantly with poor prognosis (and/or trending to poor prognosis) including ANGPT1 , HOXC11 , ITGA7, PRIM1 , B4GALNT1 , OS9, CDK4, and/or TSFM (e.g. Table 9 genes) and/or GUCA2A, LEPRE1 , C1orf50, FGF3, FAM112B, B4GALNT1 , OS9, CENTG1 , CDK4, TSFM, AK024870, NUP107, MDM2, CPSF6, BCL11 B, ASXH1 and/or C20orf112 (e.g. Table 11 genes).
[0022] In another embodiment, the prognosis is determined to be good when the hybridization pattern indicates a gain of all or part of a MCR within chromosome 8 associated with good prognosis and/or a loss of all or part of one or more MCRs within chromosome 6 or 14 associated with good prognosis relative to a control. In an embodiment, the gain comprises all or
part of RAB11 FIP1 and/or the loss comprises all or part of a gene listed in Table 8.
[0023] In an embodiment, the presence or absence of a genomic alteration is determined using a chromosomal probe. In another embodiment, the control is a control copy number, centromere copy number or a control gene on the same or different chromosome.
[0024] In another aspect, the disclosure includes a method for determining a likelihood of improved survival or response with chemotherapy treatment comprising detecting a gain of all or part of a MCR or gene listed in Tables 1 , 2, 5, 9, 10 and/or 11 associated with improved response to chemotherapy, wherein a gain indicates the subject has a good prognosis when treated with chemotherapy relative to a subject not treated with chemotherapy.
[0025] In another aspect, the disclosure includes a method for determining tumour responsiveness to a chemotherapy treatment comprising detecting a gain of all or part of one or more of the genes listed in Tables 1 , 2, 5, 9 or 11 associated with improved response to chemotherapy, wherein a gain indicates the tumour is likely responsive to treatment with chemotherapy relative to a tumour not comprising the gain.
[0026] In an embodiment, the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of all or part of one or more of the following genes: MFSD7, D4S234E, ACOX3, SRD5A1 , AQP2, ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, DNMT3B.
[0027] In another embodiment, the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of all or part of one or more of the following genes: BAALC, ANGPT1 , MYC, WISP1 , KRT81 , KRT1 , NEUROD4, and/or PA2G4 (e.g. Table 9 genes associated with improved response to chemotherapy), In a further
embodiment, the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of all or part of one or more of the following genes GUCA2A, PPIH, LEPRE1 , CR623026, C1orf50, DQ515898, DQ515897, MYC FGF3, KRT81 , KRT1 , FAM112B B4GALNT1 , CENTG1 , BCL11 B (e g Table 11 genes associated with improved response to chemotherapy)
[0028] In another aspect, the disclosure includes a method for determining a likelihood of improved survival with chemotherapy treatment comprising detecting a loss of all or part of a MCR and/or gene listed in Tables 3, 4, 7 and/or 8 associated with improved response to chemotherapy, wherein the loss indicates the subject has a good prognosis when treated with chemotherapy relative to a subject not treated with chemotherapy
[0029] In another aspect, the disclosure includes a method for determining tumour responsiveness to a chemotherapy treatment comprising detecting a loss of all or part of a MCR and/or gene listed in Tables 3, 4, 7 and/or 8 associated with improved response to chemotherapy, wherein the loss indicates the tumour is likely responsive to treatment with chemotherapy relative to a tumour not comprising the loss
[0030] In an embodiment, the loss is of all or part of one of the following genes RHOC, ATP2C2, ZDHHC7, COC4I1 , and/or FOXF1
[0031] In another embodiment, the lung cancer is non-small cell lung cancer (NSCLC), early stage NSCLC, squamous cell carcinoma or adenocarcinoma and/or metastatic lung cancer
[0032] In another aspect, the method further comprises detecting the expression level of a gene listed in Table 5, 6, 7, 8 9 and/or 11 For example, the expression level of a gene associated with prognosis and/or response to chemotherapy can be detected for predicting a prognosis and/or for predicting tumour responsiveness In an embodiment, the expression level of the gene all or partly gained or lost is increased or decreased respectively, relative to a control expression level wherein increased
expression of a gene gain listed in Table 5 and/or decreased expression of a gene listed in Table 7 indicates poor prognosis without chemotherapy, and/or increased expression of a gene listed in Table 6 and/or decreased expression of a gene listed in Table 8 indicates good prognosis In a further embodiment, the expression level of a gene listed in Table 9 or 11 is detected
[0033] Another aspect comprises a method for determining a lung cancer prognosis in a subject, the method comprising (a) determining a hybridization pattern of a chromosomal probe or a set of chromosomal probes in a biological sample from the subject, wherein the probe or probeset is targeted to all or part of one or more MCRs listed in the provided tables, including but not limited to NRG4 on the short arm of chromosome 1 (1 p), NRG58 on 8q, NRG74 on 11q, NRG79 on 12q, NRG80 on 12q, NRG81 on 12q, NRG82 on 12q, and/or NRG89 on 14q, (b) determining the prognosis and/or predicting the response to chemotherapy for a patient with lung cancer based on the hybridization pattern, wherein the prognosis is determined to be poor without chemotherapy when the hybridization pattern indicates a gain of DNA copy number at an MCR on 11q and/or a gain at an MCR on 12q and/or a gain at an MCR on 14q relative to a control, and/or the prognosis is determined to be good when treated with chemotherapy when the hybridization pattern indicates a gain of DNA copy number within an MCR on 1 p and/or 8q and/or 11q and/or 12q and/or 14q.
[0034] In an embodiment, the gain of DNA copy number is at or within an MCR located at approximately base-pair positions 41265460 to about 43221579 on the short arm of chromosome 1 , and is indicative of a good prognosis with chemotherapy
[0035] In another embodiment, the gain of DNA copy number is at an MCR located at approximately base-pair positions 128289292 to about 128936748 on the long arm of chromosome 8 is indicative of a good prognosis with chemotherapy
[0036] In another embodiment, the gain of DNA copy number is at or within an MCR located at approximately base-pair positions 68572940 to about 70388868 on the long arm of chromosome 11 is indicative of a good prognosis with chemotherapy.
[0037] In another embodiment, the gain of DNA copy number is at or within an MCR located at approximately base-pair positions 50731457 to about 51457372 on the long arm of chromosome 12 is indicative of a good prognosis with chemotherapy.
[0038] In another embodiment, the gain of DNA copy number is at or within an MCR located at approximately base-pair positions 52696908 to about 53538441 on the long arm of chromosome 12 is indicative of a good prognosis with chemotherapy.
[0039] In another embodiment, the gain of DNA copy number is at or within an MCR located at approximately base-pair positions 55933813 to about 57461765 on the long arm of chromosome 12 is indicative of a good prognosis with chemotherapy.
[0040] In another embodiment, the gain of DNA copy number is at or within an MCR located at approximately base-pair positions 96994959 to about 99058653 on the long arm of chromosome 14 is indicative of a good prognosis with chemotherapy.
[0041] Another aspect relates to a method of selecting a treatment regimen for a subject with lung cancer, the method comprising' (a) determining a genomic profile comprising detecting a genomic alteration of all or part of one or more MCRs and/or genes selected from MCRs and genes identified herein associated with survival with chemotherapy, for example as listed in Table 1 , 2, 3, 5, 7, 9, 10 and/or 11 ; in a biological sample from the subject; and (b) selecting chemotherapy when a gain or loss associated with improved survival with chemotherapy is detected and/or not selecting chemotherapy and/or selecting a non-chemotherapy and/or a non- platinum analog -, a vinca alkyloid- and/or combination thereof
chemotherapy, when a gene associated with worse survival with chemotherapy.
[0042] In an embodiment, the method comprises: (a) determining a genomic profile comprising detecting a genomic alteration in one or more genes selected from Table 5 and/or 7 in a biological sample from the subject;(b) selecting chemotherapy for the subject when the genomic profile comprises a gain of all or part of one or more of the following genes: MFSD7, D4S234E, ACOX3, SRD5A1 , AQP2, ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, and/or DNMT3B; and/or a loss of all or part of one or more of the following genes: RHOC, ATP2C2, ZDHHC7, COC4I1 , and/or FOXF1 relative to a control.
[0043] In another embodiment, the method comprises: (a) determining a genomic profile comprising detecting a genomic alteration in one or more genes selected from Table 9 and/or 11 in a biological sample from the subject;(b) selecting chemotherapy for the subject when the genomic profile comprises a gain of all or part of one or more of the following genes: BAALC, ANGPT1 , MYC, WISP1 , KRT81 , KRT1 , NEUROD4, and/or PA2G4 (e.g. Table 9 genes associated with improved response to chemotherapy). In a further embodiment, the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of all or part of one or more of the following genes: GUCA2A, PPIH, LEPRE1 , CR623026, C1orf50, DQ515898, DQ515897, MYC, FGF3, KRT81 , KRT1 , FAM112B, B4GALNT1 , CENTG1 , and/or BCL11 B (e.g. Table 11 genes associated with improved response to chemotherapy). In an embodiment, the method comprises not selecting chemotherapy and/or not selecting a chemotherapeutic regimen comprising a platinum analog, a vinca alkyloid and/or a combination thereof e.g. selecting a non-chemotherapy and/or a non- platinum analog-, vinca alkyloid- or combination thereof chemotherapy, when a gain at AK024870, CPSF6 is detected.
[0044] In certain embodiments, the biological sample is selected from the group consisting of lung tissue, lung cells, lung biopsy and sputum, including formalin fixed, paraffin embedded and fresh frozen specimens
[0045] Also provided is a method for determining a lung cancer prognosis in a subject, the method comprising detecting the presence or absence of a genomic alteration at a locus identified in Tables 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 and/or 11 in a biological sample from the subject, wherein the prognosis is determined to be poor in the absence of chemotherapy when a gain of all or part of a MCR listed in Tables 1 and/or 2 or a gene listed in Table 5 and/or a loss of all or part of a MCR listed in Table 3 and/or gene listed in Table 7 is detected, and the prognosis is determined to be good when a gain of all or part of a MCR or gene listed in Table 6 and/or loss of all or part of a MCR or gene in Table 4 and/or 8 is detected relative to a control In another embodiment, a gain of all or part of a MCR listed in Table 10 and/or a gene listed in Table 9 and/or 11 , wherein the prognosis is determined to be poor in the absence of chemotherapy when a gain associated with poor prognosis (including trending to poor prognosis) is detected
[0046] In an embodiment, the presence or absence of a gain of DNA copy number is detected at an MCR at 12q at or within basepair positions 50731457 to 51457372, and/or 12q at or within basepair positions 52696908 to 53538441 , and/or 12q at or within basepair positions 55933813 to 57461765, and/or 12q at or within basepair positions 64438067 to 68503251 , and/or 14q at or within basepair positions 96994959 to 99058653 In another embodiment, the presence or absence of a gam of DNA copy number is detected at an MCR at 12q at or within basepair positions 50731457 to 51457372 In another embodiment, the presence or absence of a gain of DNA copy number is detected at an MCR at 12q at or within basepair positions 52696908 to 53538441 In another embodiment, the presence or absence of a gain of DNA copy number is detected at an MCR at 12q at or within basepair positions 55933813 to 57461765 In another embodiment,
the presence or absence of a gain of DNA copy number is detected at an MCR at 12q at or within basepair positions 64438067 to 68503251. In another embodiment, the presence or absence of a gain of DNA copy number is detected at an MCR at 14q at or within basepair positions 96994959 to 99058653. In yet a further embodiment the genomic alteration comprises all or part of a MCR listed in Table 1 , 2, 3, 4 and/or 10.
[0047] In an embodiment, the presence or absence of a DNA copy number alteration at for example, the position of a gene located within the MCRs gained or lost, for example genes within the MCRs listed in any one of Tables 1 to 11 are detected. In an embodiment, the presence or absence of a DNA copy number alteration at the position of a gene from the group consisting of KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , and/or genes within an MCR located between 50-57 Mb on chromosome arm 12q (e.g. MCR IDs NRG79, NRG80, NRG81 , NRG82) is detected. In another embodiment, the presence or absence of a gene from the group consisting of ITGA7, CDK2, BCDO2, ERBB3, DLST, PA2G4.ZBTB39 and/or TSFM which are comprised in the MCRs at 55.2 -55.6 Mbp on chromosome arm 12q are detected. In another embodiment, the gene detected is all or part of a gene listed in Table 9 and/or 11.
[0048] Another aspect provides a method of predicting response to a chemotherapeutic treatment in a subject with lung cancer comprising detecting the presence or absence of a gain or loss of all or part of a MCR or a gene in any one of Tables 1-11 , predicting the response to the chemotherapeutic according to the presence or absence of the MCR or gene gain or loss compared to a control, wherein detecting a MCR or gene associated with improvement with chemotherapy predicts chemotherapy will be efficacious, for example will, improve survival and/or wherein detecting a MCR and/or gene not associated with improvement with chemotherapy predicts no response to chemotherapy.
[0049] A further aspect provides a method of determining a likelihood of improved survival in a lung cancer subject who was or is receiving a
chemotherapeutic treatment, comprising determining the presence or absence of a gain or loss of all or part of a MCR and/or gene associated with improvement with chemotherapy, predicting the likelihood of improved survival according to the presence or absence of the MCR and/or gene gain or loss compared to a control, wherein detecting all or part of a gain and/or loss of a MCR and/or gene associated with improvement with chemotherapy predicts likelihood of improved survival compared to a control having the same gam and/or loss who has not received and/or is not receiving chemotherapy In an embodiment, the presence of a gain and/or loss associated with improvement with chemotherapy is indicative of a favourable predisposition of the subject to respond to platinum analogs, vinca alkyloids and/or a combination thereof
[0050] In certain embodiments, the genomic alteration, MCR and/or gene gain or loss is determined by array CGH, FISH, chromagen in situ hybridization (CISH) or PCR
[0051] Another aspect provides a method of treating lung cancer comprising determining the presence or absence of a gain and/or loss of all or part of a MCR and/or gene associated with improvement with chemotherapy in a subject with lung cancer and administering chemotherapy to the subject with at least one gain or loss associated with improvement with chemotherapy
[0052] In an embodiment, the chemotherapy is a platinum analog, a vinca alkaloid or a combination thereof In a further embodiment, the platinum analog is selected from the group consisting of cisplatin, paraplatin, carboplatin, oxaliplatin and satraplatin in either IV or oral form In another embodiment, the vinca alkaloid is selected from the group vinorelbine, vincristine, vinblastine, vindesine and vinflunine in either IV or oral form
[0053] A further aspect relates to a composition comprising a detection agent for detecting all or part of a MCR and/or gene gam or loss associated
with prognosis In an embodiment, the composition comprises a probe that binds and/or hybridizes with all or part of a MCR and/or a gene described herein, and/or a primer or primer pair for amplifying a polynucleotide comprising all or part of a MCR and/or gene associated with prognosis described herein In an embodiment, the probe is a BAC clone listed in Table 13 and/or the primer is a primer listed in Table 12
[0054] Yet a further aspect provided is a kit for determining lung cancer prognosis in a subject In and embodiment, the kit comprises a chromosomal probe and/or a set of chromosomal probes, wherein the probe or set comprises a probe to a MCR or part thereof listed in any one of Tables 1 to 11 and/or a gene or part thereof listed in Tables 5, 6, 7, 8, 9 and/or 11 In another embodiment the kit comprises one or more gene expression probes, wherein a probe is specific for a gene expression product of a gene listed in Tables 5, 6, 7, 8, 9 and/or 11 In an embodiment, the probes are labeled, optionally fluorescently labeled or labelled with a chromagen In another embodiment, the probes are comprised in an array on a solid support In yet a further embodiment, the kit further comprising instructions that indicate prognosis is determined to be poor when a hybridization pattern of the set of chromosomal probes indicates a gain in all or part of a MCR in 12q, and/or a gain in all or part of a MCR comprising all or part of a gene listed in Table 5, 9 and/or 11 and/or a loss of all or part of a MCR comprising all or part of a gene listed in Table 7, relative to control, and/or to be good when a hybridization pattern of chromosomal probes indicates a gain in all or part of a MCR comprising all or part of a gene listed in Table 6 and/or a loss of all or part of a MCR comprising all or part of a gene listed in Table 8, optionally wherein the control is centromere copy number
[0055] In an embodiment, the kit comprises a reagent for FISH analysis of a MCR or a gene gain or loss described herein, for example, the kit comprises a probe for a MCR or gene gain or loss described herein, for example a BAC clone comprising all or part of a target MCR or gene including for example the BAC clones listed in Table 13 and/or labeling
reagents for labeling the probe. In a further embodiment, the kit comprises a reagent for CGH analysis of a MCR or gene gain or loss described herein, for example, the kit comprises an array with one or more probes for detecting all or part of one or more MCRs or genes gained or lost described herein and/or labeling reagents for labeling the subject sample DNA. In a further embodiment, the kit comprises a reagent for PCR such as quantitative or multiplex PCR, for example the kit comprises a primer set for amplifying all or part of a MCR or gene described herein associated with prognosis.
[0056] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of methods and compositions described herein, a few selected suitable methods and materials are described in more details below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety, including nucleic acid sequences identified by Entrez Gene ID, unigene ID or other gene identifier number referred to herein and particularly as provided in the Tables . In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting in any respect.
[0057] All embodiments of the disclosure, including those described under different aspects of the disclosure, are contemplated to be combined with other embodiments whenever applicable.
[0058] Other features and advantages of the present disclosure will become apparent from the following detailed description and claims. It should be understood, however, that the detailed description and the specific examples while indicating preferred embodiments of the disclosure are given by way of illustration only, since various changes and modifications within
the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.
Detailed description of the Disclosure I. DEFINITIONS
[0059] The term "lung cancer" as used herein refers to cancers of the tissues or cells of the lung including for example non-small cell lung cancer (NSCLC), and small cell lung cancer (SCLC). The term could also be used to refer to cancers that have arisen in the lung and have metastasized to other sites (e.g. brain, liver, adrenals),
[0060] The term "non-small cell lung cancer" as used herein refers to primary lung cancer that is distinguished from small cell lung cancer and that is composed of multiple different types, including adenocarcinoma, squamous cell carcinoma, large cell carcinoma and other less frequent types.
[0061] The term "lung adenocarcinoma" and/or "lung ADC" and/or "pulmonary ADC" as used herein refer to a type of lung cancer and comprises various subtypes including bronchioloalveolar carcinoma (BAC) which is non invasive and/or includes focal invasion and has good prognosis (2) and invasive ADC including mixed type, which can have areas with BAC like pattern and is referred to as invasive ADC with BAC features (AWBF).
[0062] The term "control" as used herein refers to a specific value or dataset e.g., control expression level, control gene copy number, reference expression profile or reference genomic profile according to the context which a person skilled in the art would readily understand, derived from one or more samples of a known subject class e.g., lung cancer free class not having a MCR or a gene gain or loss described herein, that is suitable for comparison to the value or dataset derived from a subject sample. For example, the control can be a value or dataset derived from tumor adjacent non-neoplastic normal tissue or tissue from a disease free subject, e.g. for
comparing to a lung cancer subject gene expression profile. With respect to genomic alterations e.g. gains and losses, the control can for example also refer to an internal control e.g. the copy number of a non-altered region of the chromosome or a different chromosome e.g. a chromosome with minimal variance in lung cancer subjects, for example a chromosome not herein or previously identified as associated with prognosis. Such methods wherein an internal control is useful include for example quantitative polymerase chain reaction (PCR) or fluorescent in situ hybridization (FISH). Optionally, the copy number can be compared to the centromere for example when using FISH. Typically a normal or control genomic profile refers to a single genomic copy on each of the two alleles. For example in the array-CGH, the control is a normal reference genomic DNA that is assumed to have 2 copies of each gene. In other examples, a positive control is employed, for example, a sample or standard corresponding to subject comprising the gain or loss associated with prognosis and/or response to chemotherapy, useful for example for quantitative PCR and/or FISH methods, for example included in quantitative PCR and/or FISH based kits. Based on the teachings herein and knowledge in the field, a person skilled in the art would readily be able to identify suitable controls for the methods described herein.
[0063] The term "disease free subject" refers to a subject that is free of lung cancer.
[0064] The term "microarray" as used herein, refers to an array of distinct polynucleotides or oligonucleotides synthesized or spotted (e.g. in the case of BAC clones) on a substrate, such as paper, nylon or other type of membrane, filter, chip, glass slide, or any other suitable solid support.
[0065] The terms "complementary" or "complementarity", as used herein, refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing. For example, the sequence "A- G-T" binds to the complementary sequence "T-C-A". Complementarity between two single-stranded molecules may be "partial", in which only some nucleotides or portions of the nucleotide sequences of the nucleic acids bind,
or it may be complete when total complementarity exists between the single stranded molecules The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands
[0066] "Amplification of polynucleotides" can be achieved by utilization of s methods such as the polymerase chain reaction (PCR), including for example quantitative PCR, multiplex PCR and multiplex ligation dependent probe amplification (MLPA), ligation amplification (or hgase chain reaction LCR) and amplification methods based on the use of Q-beta replicase These methods are well known and widely practiced in the art Reagents and hardware for conducting PCR are commercially available Primers useful to amplify specific sequences from selected genomic regions are preferably complementary to, and hybridize specifically to sequences flanking the target genomic regions
[0067] The term "reference profile" as used herein refers to a reference expression profile, a reference genomic profile, and/or a reference gene copy number profile according to the context
[0068] A "reference expression profile" as used herein refers to the expression signature of a subset of biomarkers (e g one or more), which correspond to genes associated with a prognosis class e g poor prognosis or good prognosis +/- chemotherapy and/or a control
[0069] The term "expression level" as used herein refers to the absolute or relative amount of the transcription and/or translation product of a gene described herein and includes RNA and polypeptide products
[0070] A "reference gene copy number profile" as used herein refers to the gene copy number of a subset of genes (e g one or more) listed in Tables 5, 6, 7, 8, 9 and/or 11 The reference gene copy number profile is optionally a reference number, typically 2, and/or identified using for example using normal human tissue and/or cells and/or tissue and/or cells from lung cancer Normal tissue and/or cells includes for example, tumor adjacent non-
neoplastic tissue and/or cells and/or tissue and/or cells from a lung cancer disease free subject. The reference gene copy number profile is accordingly a reference signature of the copy number of a subset of genes in Tables 5, 6, 7, 8, 9 and/or 11 , to which the subject gene copy number of the corresponding genes in a sample of a subject are compared.
[0071] The term "genomic profile" as used herein refers to the genomic structural signature of a subject genome. A number of variations and alterations referred to as copy number variations, have been characterized including amplifications and deletions, a subset of which are associated with disease. The alterations can comprise small and large amplifications and/or deletions which can occur through out the genome.
[0072] The phrase "determining a genomic profile" as used herein refers to detecting the presence, absence, frequency, variability and/or length of one or more genomic alterations including amplifications and deletions of all or part of one or more MCRs and/or which may or may not comprise alterations in the coding nucleic acid sequence of genes e.g., can comprise alterations in the intergenic regions of the genome, such as those found for example on 12q, 8q and 11q. Genomic alterations comprising amplifications and deletions in all or part of one or more genes comprise those listed in Tables 5, 6, 7, 8, 9 and/or 11. A person skilled in the art will appreciate that a number of methods can be used to determine a genomic profile, including for example fluorescence and other non-fluorescent types of in situ hybridization (FISH, CISH or others), and quantitative PCR (qPCR), multiplex PCR including for example multiplex ligation dependent probe amplification (MLPA) and array CGH.
[0073] The term "reference genomic profile" as used herein refers a genomic signature comprising genomic alterations, associated with prognosis with or without chemotherapy. The reference genomic profile is optionally a normal reference genomic DNA (e.g. a control) that is assumed to have 2 copies of each gene and/or is derived from normal human tissues and/or cells. The reference genomic profile is accordingly for example,
normal genomic copy number to which a subject genomic profile is compared for classifying the tumor or determining or predicting clinical outcome.
[0074] The term "chemotherapy" as used herein means treatment with anticancer drugs, including but not limited to treatment with vinca alkaloids for example vinorelbine vinblastine, vincristine, vinflunine and/or vindesine in for example IV or oral form and/or platinum analogues for example cisplatin, carboplatin, paraplatin, satraplatin and/or oxaliplatin in for example IV or oral form.
[0075] The term "chemotherapeutic" as used herein means an anticancer drug, including but not limited to treatment with mitotic inhibitors such as vinca alkaloids for example vinorelbine vinblastine, vincristine, and/or vindesine or analogs thereof and/or DNA alkylating agents such as platinum based chemotherapeutics for example cisplatin, carboplatin and oxaliplatin.
[0076] The term "similar" or "similarity" as used herein with respect to a reference profile refers to similarly in both the identity and quantum of change in expression level of a biomarker, genomic alteration, or gene copy number variation compared to a control where the control is for example derived from a normal cell and/or tissue or has a known outcome class such as poor survival or good survival.
[0077] The term "similarity in expression" as used herein means that there is no or little difference, for example no statistical difference, in the level of expression of the biomarkers between the test sample and the control and/or between good and poor prognosis groups defined by biomarker expression levels.
[0078] The term "most similar" in the context of a reference profile refers to a reference profile that is associated with a clinical outcome that shows the greatest number of identities and/or degree of changes with the subject profile.
[0079] The term "differentially expressed" or "differential expression" as used herein refers to biomarkers described herein that are expressed at one level in a prognostic group and expressed at another level in a control The differential expression can be assayed by measuring the level of expression of the transcription and/or translation products of the biomarkers, such as the difference in level of messenger RNA transcript expressed or polypeptide expressed in a test sample and a control The difference can be statistically significant
[0080] The term "difference in the level of expression" refers to an increase or decrease in the measurable expression level of a given biomarker expression product as measured by the amount of messenger RNA transcript and/or the amount of polypeptide in a sample as compared with the measurable expression level of a given biomarker in a control In one embodiment, the differential expression can be compared using the ratio of the level of expression of a given biomarker or biomarkers as compared with the expression level of the given biomarker or biomarkers of a control, wherein the ratio is not equal to 1 0 For example, an RNA or polypeptide is differentially expressed if the ratio of the level of expression in a first sample as compared with a second sample is greater than or less than 1 0 For example, a ratio of greater than 1 1 , 1 2, 1 5, 1 7, 2, 3, 3, 5, 10, 15, 20 or more, or a ratio less than 0 9, 0 8, 0 6, 0 4, 0 2, 0 1 , 0 05 0 001 or less A sample can be compared to a group to identify differential expression For example, one could compare a sample of interest to a group of control samples and use a p-value to demonstrate statistically that the sample of interest is for example overexpressing the RNA product of a gene or has an increased DNA copy number at that gene compared to control samples.
[0081] The term "prognosis" as used herein refers to a clinical outcome e g a poor survival or a good survival, and includes for example survival outcome in the absence of chemotherapy and/or improved survival with administration of chemotherapy Good prognosis and improved survival are used herein interchangeably as are poor prognosis and poor survival As
demonstrated herein, prognosis is associated with the presence or absence of a gain or loss of specific MCRs and genes described herein, compared to a reference profile such as a reference expression profile, or a reference gene copy number profile of a suitable comparator group For example, subjects with gains in MCRs and/or genes listed in for example Tables 1 , 2, 5, 9, 10 and/or 11 or loss of MCRs and/or genes in Table 3, 4, and/or 7 have a poor prognosis or poor survival compared to subjects not having these gains or losses for regions identified Accordingly, the prognosis provides an indication of disease progression and includes an indication of likelihood of recurrence, metastasis, death due to disease e g survival, tumor subtype or tumor type
[0082] The term "associated with a prognosis" as used herein refers to gains and/or losses in all or part of a MCR and/or gene associated with survival identified in the Tables as associated with for example, poor survival in the absence of chemotherapy and/or listed in the Tables as associated with improved survival with chemotherapy, as well as for example MCRs and/or genes listed in the Tables as associated with good and/or prognosis The term "associated with a poor prognosis" identifies the subset shown to statistically or trend to poor survival with surgery alone e g in the absence of chemotherapy (and /or the presence of chemotherapy for gams at AK024870 and/or CPSF6)
[0083] The term "tumour responsiveness" as used herein refers to the likelihood that a subject's lung cancer will or will not respond to chemotherapy treatment It has been determined that a subset gains or losses associated with prognosis are associated with benefit from chemotherapy such that a subject with these gains or losses have an improved survival when treated with chemotherapy compared to a subject not receiving chemotherapy with the same gain or loss Gains have also been associated with worse survival For example, a gain or increased expression ofANK024870 and/or CPSF6 is associated with worse survival with administration of chemotherapy
[0084] The term "classifying" as used herein refers to assigning, to a class or kind, an unclassified item A "class" or "group" then being a grouping of items, based on one or more characteristics, attributes, properties, qualities, effects, parameters, etc , which they have in common, for the purpose of classifying them according to an established system or scheme For example, subjects having gains associated with poor prognosis, such as gains in MCRs and/or genes listed in for example Tables 1 , 2, 5, 9, 10 and/or 11 , or losses of MCRs and/or genes listed in Table 3, 4 and/or 7, define a class with poor prognosis Also for example, subjects having a gain in a Table 5, 9 or 11 gene or loss in a Table 7 gene identified as showing benefit from receiving chemotherapy, define a class that benefit from receiving chemotherapy Similarly, subjects for example with a gain in a Table 6 gene or a loss of a Table 8 gene define a class with good prognosis
[0085] The term "loss" or "gain" refers with respect to a genomic profile refers to a change in copy number, for example the loss can be on the plus strand or the minus strand and can involve loss of one or both alleles Similarly, a "gain" can for example be a gain on the plus strand or the minus strand and can involve gain on one or both alleles The gain can additionally be the gam of 1 or more copies
[0086] The term "high amplitude gain" or "high level amplification" as used herein refers to a copy number variation of a MCR or gene amplification where the average Iog2 value, as assigned by DNAcopy analysis, in the gained samples, was greater than 0 15 For example, high amplification gains were identified as described in the Examples and include for example MCRs listed in Table 10 and genes listed in Table 11
[0087] The term "prognosing" as used herein means predicting clinical outcome such as survival and/or response to chemotherapy for example by identifying the class a subject belongs to according to the presence of a gain or loss of a genomic region such as 12q, 11q, 8q, 1 p, or 14q or a region (MCR) or gene identified in any one of Tables 1to 11 Where one or more gains or losses are detected, clinical outcome can be based on a subject's
similarity to a control and/or a reference profile and/or biomarker expression level associated with a prognosis. Methods of prognosis described herein can optionally be included in multivariate models incorporating known prognostic clinical factors, such as age, sex stage and grade.
[0088] The term "good survival" as used herein refers to an increased disease free survival for example as compared to subjects in a suitable comparator "poor survival" group e.g. not having a gain or loss associated with good prognosis or improved response to chemotherapy. The term "poor survival" as used herein refers to an increased risk of death and/or disease occurrence as compared to subjects in a suitable comparator "good survival" group e.g. having a gain or loss associated with good prognosis or improved response to chemotherapy. For example, subjects comprising a gain or loss of a MCR or gene or altered biomarker expression described herein as associated with poor prognosis, such as genes and MCRs listed in Tables 1 , 2, 5, 7, and/or 9-11 , have a poor survival compared to subjects not comprising such a loss, gain or altered expression as indicated therein. As another example, subjects not receiving chemotherapy who comprise a gain or loss associated with improvement when treated with chemotherapy, for example such as MCRS listed in Table 1 , 2, and/or 3 and/or genes listed in Tables 5, 7, 9 and/or 11 associated with improvement with chemotherapy, have poor survival when not treated with chemotherapy compared to subjects with the same gain, loss or altered expression who receive chemotherapy. As a further example, subjects who comprise a gain or loss not associated with improvement when treated with chemotherapy have a poor prognosis compared to individuals without the gain, or loss. Similarly, for example, a good survival group comprises subjects comprising a gain or loss or biomarker expression described herein associated with good prognosis, for example a gain or loss listed in Table 6 and/or 8 respectively. As another example, subjects receiving chemotherapy that comprise gains or losses associated with improved survival with chemotherapy, such as the particular MCRs listed in Table 1 , 2 and/or 3 and/or the genes in Tables 5, 7, 9 and/or 11 identified as associated with significant improvement with
chemotherapy have good survival when treated with chemotherapy compared to subjects with the similar gain, loss or expression who do not receive chemotherapy. Subjects in a good survival group or good survival group when treated with chemotherapy are at less risk of death 5 years after surgery. Subjects in a poor survival group or poor survival when not treated with chemotherapy group are at greater risk of death within 5 years from surgery. For example a poor survival group comprises subjects having a 5 year survival rate of less than 80%. As used herein, good survival indicates good prognosis and poor survival indicates poor prognosis.
[0089] The term "genes associated with good survival" or "genes associated with good prognosis" as used herein refers to genes listed in Table 6, for example RAB11 FIP1 and genes listed in Table 8, for example, C6orf15, CDYL, HLA-DOA, KIFC1 , MSH5/C6orf26, NCR3, RXRB, and/or TCL6.
[0090] The term "MCRs associated with good survival" or "MCRs associated with good prognosis" as used herein refer to MCRs associated with good prognosis for example the MCRs comprising the genes listed in Tables 6 and/or 8.
[0091] The term "genes associated with good survival when treated with chemotherapy" or "genes associated with good prognosis when treated with chemotherapy" as used herein refers to for example genes identified in Table 5 as showing significant improvement and/or trending to improvement, for example MFSD7, D4S234E, ACOX3, SRD5A1 , AQP2, ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, and/or DNMT3B; and/or genes listed in Table 7, for example RHOC, ATP2C2, ZDHHC7, COC4I1 , and/or FOXF1 ; and/or gene listed in Table 9, for example BAALC, ANGPT1 , MYC, WISP1 , KRT81 , KRT1 , NEUROD4, and/or PA2G4; and/or genes listed in Table 11 , for example, GUCA2A, PPIH, LEPRE1 , CR623026, C1orf50, DQ515898, DQ515897, MYC FGF3, KRT81 , KRT1 , FAM112B, B4GALNT1 , CENTG1 , and/or BCL11 B.
[0092] The term "genes associated with poor survival" or "genes associated with poor prognosis" alternatively "genes associated with poor survival/prognosis in the absence of chemotherapy" as used herein refers to for example genes so identified and listed in Table 5, for example MFSD7, D4S234E, ACOX3, SRD5A1 , ADCY2, (clone Z146), ANKH, CDH18, OXCT1 , UTRN, cDNA DKFZp434E2423, C9orf68, AQP2 ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ITGA7, CDK2/BCDO2, ERBB3, DLST/PA2G4, PRIM1 , ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, TRHDE, OR1 E1/OR1 E2, RCVRN, and/or DNMT3B, and genes listed in Table 7, for example AHCYL1 , RHOC, ATP1A1 , IGSF3, ELF1 , RGC32, ESD, TAF1C, ATP2C2, ZDHHC7, COC4I1 , FOXF1 , and/or MAP1 LC3B, and/or genes Table 9, including ANGPT1 , HOXC11 , ITGA7, PRIM1 , B4GALNT1 , OS9, CDK4, and TSFM, and/or genes in Table 11 , including GUCA2A, LEPRE1 , C1orf50, FGF3, FAM112B, B4GALNT1 , OS9, CENTG1 , CDK4, TSFM, AK024870, NUP107, MDM2, CPSF6, BCL11 B, ASXH1 and/or C20orf112
[0093] The term "genes not associated with improvement when treated with chemotherapy" as used herein refers to genes for example listed in Table 5 identified as not showing significant improvement when treated with chemotherapy, for example ADCY2, (clone Z146), ANKH, CDH18, OXCT1 , UTRN, cDNA DKFZp434E2423, C9orf68, ITGA7, CDK2/BCDO2, ERBB3, DLST/PA2G4, PRIM1 , TRHDE, OR1 E1/OR1 E2, and/or RCVRN, and/or genes listed in Table 7 identified as not showing significant improvement when treated with chemotherapy, for example AHCYL1 , ATP1A1 , IGSF3, ELF1 , RGC32, ESD, TAF1C, and/or MAP1 LC3B, as well as genes listed in Table 9 and/or 11 so identified Detection of these genes for example is useful for selecting a treatment regimen For example since subjects comprising losses or gains at these loci do not demonstrate improved prognosis with cisplatin, and/or venolrebine, chemotherapeutics that are not related to cisplatin and/or venolrebine e g a different class of drug, may be indicated
[0094] The term "minimal common region" or "MCR" refers to the a region determined to be commonly gained or lost in subjects belonging to a particular class such as good prognosis when treated chemotherapy A subject may have a gain or loss that comprises the MCR and/or comprises a portion of the MCR For example the minimal common regions associated with poor prognosis in the absence of chemotherapy, and/or improved prognosis upon treatment with chemotherapy, are listed in Tables 1-11 The MCR start and stop positions refer to positions in NCBI human genome build 36 3 which corresponds to hg18
[0095] As used herein, "treatment" or "treating" is an indicated approach for obtaining beneficial or desired results, including clinical results, for example an indicated approach for lung cancer Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (ι e not worsening) state of disease, preventing spread of disease delay or slowing of disease progression, amelioration or palliation of the disease state, prolonging survival as compared to expected survival if not receiving treatment and remission (whether partial or total), whether detectable or undetectable For example surgery is indicated for Stage I lung cancers, and surgery plus adjuvant chemotherapy is indicated for subjects with more advanced stages The methods described herein are useful for example, for identifying subjects with lung cancer that benefit from receiving chemotherapy
[0096] The phrase "selecting a treatment" as used herein refers to selecting a chemotherapeutic regimen, for example a regimen comprising a platinum based chemotherapeutic such as cisplatin, a regimen comprising a vinca alkyloid such as vinolrebine or a treatment regimen comprising a combination thereof, that is useful for obtaining beneficial results such as prolonging survival Alternatively for example, where MCRs or genes that are not associated with improvement with chemotherapy or good prognosis, the treatment selected is a regimen that does not comprise a platinum based
chemotherapeutic such as cisplatin, a regimen comprising a vinca alkyloid such as vinolrebine or a treatment regimen comprising a combination thereof.
[0097] The term "subject" such as a "subject" to be diagnosed, prognosed, staged, screened, assessed for risk, subject for selection of a treatment, and/or treated by the subject methods and articles of manufacture can mean either a human or non-human animal, preferably a human being.
[0098] The term "sample", "test sample" or "biological sample" as used herein refers to any fluid, cell or tissue sample from a subject which can be assayed for genomic alterations or biomarker expression products e.g. for determining a genomic profile or an expression profile, depending on the method and comprises without limitation lung tumor tissue and/or cells, derived from, for example, lung biopsy, for example obtained by bronchoscopy, needle aspiration, thoracentesis and/or thoracotomy, and/or derived from cells found in sputum. The term could also be used for example to refer to metastatic tumour tissue obtained from the brain or liver or other site.
[0099] The phrase "determining the expression level of biomarkers" as used herein refers to determining or quantifying RNA and/or polypeptides expressed by the biomarkers. The term "RNA" includes mRNA transcripts, and/or specific spliced variants of mRNA. The term "RNA product of the biomarker" as used herein refers to RNA transcripts transcribed from the biomarkers and/or specific spliced variants. In the case of "polypeptide", it refers to polypeptides translated from the RNA transcripts transcribed from the biomarkers. The term "polypeptide product of the biomarker" refers to polypeptide translated from RNA products of the biomarkers.
[00100] The term "nucleic acid" as used herein refers to a polynucleotide molecule and includes DNA and RNA and can be either double stranded or single stranded. The nucleic acid molecules contemplated by the present
disclosure include isolated nucleotide molecules which hybridize specifically to genomic DNA, RNA product of a biomarker, polynucleotides which are complementary to a RNA product of a biomarker of the present disclosure, nucleotide molecules which act as probes, or nucleotide molecules which are specific primers for a MCR or gene gained or lost set out in Tables 1-11 , including for example the probes and primers listed in Tables 12 and 13.
[00101] The term "isolated nucleic acid" as used herein refers to a nucleic acid substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors, or other chemicals when chemically synthesized. An "isolated nucleic acid" is also substantially free of nucleotides which naturally flank the nucleic acid (i.e. nucleotides located at the 5' and 3' ends of the nucleic acid) from which the nucleic acid is derived.
[00102] The term "hybridize" refers to the sequence specific non- covalent binding interaction with a complementary nucleic acid. In a preferred embodiment, the hybridization is under high stringency conditions. Appropriate stringency conditions which promote hybridization are known to those skilled in the art, or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1 6.3.6. For example, 6.0 x sodium chloride/sodium citrate (SSC) at about 45°C, followed by a wash of 2.0 x SSC at 50°C may be employed when hybridization is detecting expression levels, for example by northern or slot blot analysis. For array CGH, hybridization often occurs with labeled DNA for patient and reference DNA added to a solution including formamide and SSC (2.Ox). The DNA/hybridization buffer mixture is allowed to competitively hybridize at 45°C to the array (and its targets) for -36-40 hours, after which washes take place. Signal intensities at each arrayed element are then evaluated. A detailed description of array CGH hybridization protocols is provided in Buys et al., "Key Features of Bacterial Artificial Chromosome Microarray Production and Use" in DNA Microarrays (Methods Express Series) (Schena
M, ed.), Scion Publishing, Ltd. Bloxham, Oxfordshire, UK, pp.115-145 (ISBN: 9781904842156) (please see section 2.5 in particular).
[00103] The term "primer" as used herein refers to a nucleic acid sequence, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of synthesis of when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand is induced (e.g. in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH). The primer must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer will depend upon factors, including temperature, sequences of the primer and the methods used. A primer typically contains 15-25 or more nucleotides, although it can contain less. The factors involved in determining the appropriate length of primer are readily known to one of ordinary skill in the art.
[00104] The term "primer pair" as used herein refers a set of primers which can produce a double stranded nucleic acid product complementary to a portion of the RNA products of the biomarker or sequences complementary thereof.
[00105] The term "probe" and/or "hybridization probe" as used herein refers to a nucleic acid sequence that will hybridize to a nucleic acid target sequence, for example. For example, the probe hybridizes to a RNA product of the biomarker or a nucleic acid sequence complementary thereof for detecting gene expression or hybridizes a genomic region comprising a gain or loss of a genomic region described herein associated with prognosis. The length of probe depends on the hybridization conditions and the sequences of the probe and nucleic acid target sequence. For example, the probe comprises at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, 500 or more nucleotides in length, for example complementary to at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, or 500 contiguous nucleotides of a
gene listed in Table 5, 6, 7, 8, 9 and/or 11 , or a genomic region alteration such as a MCR and/or region flanking a MCR described herein, for example in Tables 1 to 11 , for example Table 1 , 2, 3, 4 and/or 10. The probe can further be 90%, 95, 96, 97, 98, 99, 99 5, 99 9% identical to the at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, or 500 contiguous nucleotides of a gene listed in Table 5, 6, 7, 8, 9 and/or 11 , or a genomic region alteration such as a MCR and/or region flanking a MCR described herein, for example in Table 1 , 2, 3, 4 and/or 10 The probe can also for example comprise a MCR or a gene associated with prognosis. For example the probe can be a bacterial artificial chromosome (BAC) clones and can comprise the target sequence as well as additional sequence In this case, the probe can be at least 50 000, 100 000, 150 000 and/or 200 000 nucleotides, for example 150 000-200 000 base pairs The probe can for example comprised in an array, for example, on a solid support, for example array for CGH For example, BAC clone probes on the array are usually in the 150,000-200,000 bp range Labelled DNA and reference DNA generated from subject and reference DNA samples are typically a few hundred bp in size (small fragments may be excluded after labeling or during washing steps) These subject DNA and reference DNA are generated for example, using a random priming reaction, such that their lengths will vary See for example Buys et al reference (above) and citations within (e g original citation at Feinberg & Vogelstein Anal Biochem, 132, 6-13 )
[00106] The term "antibody" as used herein is intended to include monoclonal antibodies, polyclonal antibodies, and chimeric antibodies The antibody may be from recombinant sources and/or produced in transgenic animals The term "antibody fragment" as used herein is intended to include Fab, Fab1, F(ab')2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, and multimers thereof and bispecific antibody fragments Antibodies can be fragmented using conventional techniques For example, F(ab')2 fragments can be generated by treating the antibody with pepsin The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab'
fragments Papain digestion can lead to the formation of Fab fragments Fab, Fab' and F(ab')2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments and other fragments can also be synthesized by recombinant techniques
[00107] The term "biomarker" as used herein refers to a gene that is altered in its gene copy number in a poor prognosis class and/or a good prognosis class e g with or without chemotherapy, compared to a control and/or is differentially expressed in subjects in poor and good prognosis classes For example the term "biomarkers" includes one or more of the genes listed in Table 5, 6, 7, 8, 9 and/or 11
[00108] The definitions and embodiments described in particular sections are intended to be applicable to other embodiments herein described for which they are suitable as would be understood by a person skilled in the art
I. METHODS
[00109] Lung cancer remains the leading cause of cancer death in Canada with an overall 5-yr survival rate of 16% Up to 40% of lung cancer patients are potentially curable by surgery, yet their risk of dying from the disease remains high at 50% Post-surgery chemotherapy is a toxic therapy but may improve cure rate New methods of classifying lung cancers are needed for making more informed decisions on chemotherapy, based on specific molecular markers present in each cancer Using a CGH microarray, small regions of chromosomes have been identified that when gained or lost in lung cancers, impart a worse prognosis with surgery alone, and a subset of these also show a significant benefit with current standard chemotherapy After testing individual genes within these regions by quantitative polymerase chain reaction, DNA copy number gains located on 1 p, 8q, 11q, 12q, and 14q were confirmed to impart a worse prognosis in the absence of chemotherapy, and/or an improved response to chemotherapy
[00110] Accordingly in an aspect, the disclosure provides a method for determining a lung cancer prognosis in a subject, the method comprising determining a genomic profile comprising detecting one or more genomic alterations in chromosomes 2, 11 , 4, 5, 7, 9, 12, 17, 19, 20, 8, 1 , 13, 16, 6 and/or 14 listed in Tables 1-11 in a biological sample from the subject, wherein the prognosis is determined to be poor in the absence of chemotherapy when the genomic profile comprises a gain of one or more minimal common regions (MCRs) or genes within chromosomes 1 , 2, 11 , 12,
4, 5, 6, 7, 9, 12, 14, 16, 17, 19 and 20 listed as associated with poor prognosis in Tables 1 , 2, 5, 9, 10, and 11 , and/or a loss of one or more MCRs or genes within chromosomes 1 , 5, 8, 13 and/or 16 listed as associated with poor prognosis in Tables 3 and/or 7 and the prognosis is determined to be good in the absence of chemotherapy when the genomic profile comprises a genomic gain of an MCR or gene within chromosome 8 listed as associated with good prognosis in Table 6 and/or a loss of one or more MCRs or genes within chromosome 2, 6, 9 or 14 listed as associated with good prognosis in Table 8 relative to the control
[00111] In an embodiment, the method comprises (a) determining a genomic profile comprising detecting one or more genomic alterations in chromosomes 2, 11 , 4, 5, 7, 9, 12, 17, 19, 20, 8, 1 , 13, 16, 6 and/or 14 listed in Tables 1-11 in a biological sample from the subject, (b) determining the lung cancer prognosis for the subject by comparing the genomic profile with one or more controls, wherein the prognosis is determined to be poor when the genomic profile comprises a gain of one or more minimal common regions (MCRs) or genes within chromosomes 1 , 2, 11 , 12, 4, 5, 6, 7, 9, 12, 14, 16, 17, 19 and 20 listed as associated with poor prognosis in Tables 1 , 2,
5, 9, 10, and 11 , and/or a loss of one or more MCRs or genes within chromosomes 1 , 5, 8, 13 and/or 16 listed as associated with poor prognosis in Tables 3 and/or 7 and the prognosis is determined to be good when the genomic profile comprises a genomic gain of an MCR or gene within chromosome 8 listed as associated with good prognosis in Table 6 and/or a loss of one or more MCRs or genes within chromosome 2, 6, 9 or 14 listed
as associated with good prognosis in Tables 6 and/or 8 relative to the control
[00112] In an embodiment, the method comprises obtaining a biological sample for determining the genomic profile
[00113] In another embodiment, the disclosure provides a method for determining a lung cancer prognosis in a subject, the method comprising detecting the presence of a genomic alteration at a locus identified in Tables 1-11 in a biological sample from the subject, wherein the prognosis is determined to be poor in the absence of chemotherapy when a gain of a MCR or gene listed in Tables 1 , 2, 5, 9, 10 and/or 11 and/or a loss of a MCR or gene listed in Table 3 and/or 7 is detected, and the prognosis is determined to be good when a gain of a MCR or gene listed in Table 6 and/or loss of a MCR or gene in Table 4 and/or 8 is detected relative to a control
[00114] In an embodiment, the genomic alteration detected comprises a gain or loss of DNA copy number at an MCR listed in Tables 1 -11 , for example Table 1 , 2, 3, 4 and/or 10 In another embodiment, the presence or absence of a gain of DNA copy number is detected at an MCR at 1 p at or within basepair positions 41265460 to 43221579 In another embodiment, the presence or absence of a gain of DNA copy number is detected at an MCR at 8q at or within basepair positions 128289292 to 128936748 In another embodiment, the presence or absence of a gain of DNA copy number is detected at an MCR at 11 q at or within basepair positions 68572940 to 70388868 In another embodiment, the presence or absence of a gain of DNA copy number is detected at an MCR at 14q at or within basepair positions 96994959 to about 99058653 In another embodiment, the presence or absence of a gain of DNA copy number is detected at an MCR at 12q at or within basepair positions 50731457 to 51457372 In another embodiment, the presence or absence of a gain of DNA copy number is detected at an MCR at 12q at or within basepair positions 52696908 to 53538441 In another embodiment, the presence or absence of
a gain of DNA copy number is detected at an MCR at 12q at or within basepair positions 55933813 to 57461765 In another embodiment, the presence or absence of a gain of DNA copy number is detected at an MCR at 12q at or within basepair positions 64438067 to 68503251 In another embodiment, the presence or absence of a gain of DNA copy number is detected at an MCR at 14q at or within basepair positions 96994959 to 99058653
[00115] In another embodiment, the genomic alteration detected comprises all or part of a MCR listed in Table 1 , 2, 3, 4 and/or 10 In an embodiment, the genomic alteration detected comprises all or part of a MCR listed in Table 10
[00116] In an embodiment, the method comprises determining a genomic profile comprising detecting one or more genomic alterations listed Table 1 , 2, 5, 9, 10 and/or 11 , in a biological sample from the subject, (b) determining the lung cancer prognosis for the subject by comparing the genomic profile with one or more controls, wherein the prognosis is determined to be poor in the absence of chemotherapy when the genomic profile comprises a gain of one or more minimal common regions (MCRs) or genes listed in Table 1 , 2, 5, 9, 10 and/or 11
[00117] In another embodiment, the method comprises determining a genomic profile comprising detecting one or more genomic alterations in chromosomes 1 , 5, 8, 13 and 16 listed in Table 3 and/or 7 wherein the prognosis is determined to be poor in the absence of chemotherapy when the genomic profile comprises a loss of one or more MCRs or genes within chromosomes 1 , 5, 8, 13 and 16 listed in Table 3 and/or 7
[00118] In a further embodiment, the method comprises determining a genomic profile comprising detecting a genomic alteration or gene gain in chromosome 8 listed as associated with good prognosis in Table 6, wherein the prognosis is determined to be good when the genomic profile comprises a gain of the MCR or the gene within chromosome 8 listed as associated with good prognosis
[00119] In another embodiment, the method comprises determining a genomic profile comprising detecting one or more genomic alterations in chromosomes 6 and/or 14, wherein the prognosis is determined to be good when the genomic profile comprises a loss of one or more MCRs within chromosomes 6 and/or 14 listed in Table 8
[00120] In another aspect, all or part of genes located within the MCRs gained or lost, for example the MCRs listed in any one of Tables 1 to 11 , for example, Tables 1 , 2 and/or 10 are detected Detection of an increased or decreased DNA copy number of a gene (e g a gam, amplification or loss of said gene) comprised therein can be indicative of the presence or absence of a gain, amplification, or loss at the corresponding MCR For example, DQ515898, DQ515897, and MYC genes are found within the MCR at basepair positions 128289292 to 128936748 on chromosome arm 8q, CCND1 and FGF3 genes are found within the MCR at basepair positions 68572940 to 70388868 on chromosome arm 11q, and B4GALNT1 , OS9, CENTG1 , CDK4, and TSFM are genes found within the MCR at basepair positions 55933813 to 57461765 on chromosome arm 12q
[00121] In an embodiment, the gene detected is selected from the group, DQ515898, DQ515897, and MYC In a further embodiment, the gene detected is selected from the group consisting of AK024870, NUP107, MDM2, CPSF6, and BCL11 B In a further embodiment, the gene detected is selected from the group consisting of GUCA2A, PPIH, LEPRE1 , CR623026, and C1orf50 In a further embodiment, the gene detected is selected from the group consisting of CCND1 and FGF3 In a further embodiment the gene detected is selected from the group consisting of B4GALNT1 , OS9, CENTG1 , CDK4, and TSFM
[00122] In another embodiment, the method comprises detection of a gain of all or part of one or more of the genes listed in Table 9 and/or 11 for genes identified as associated significantly with poor prognosis (and/or trending to poor prognosis) including ANGPT1 , HOXC11 , ITGA7, PRIM1 , B4GALNT1 , OS9, CDK4, and TSFM (e g Table 9 genes) and/or GUCA2A,
LEPRE1 , C1orf50, FGF3, FAM112B, B4GALNT1 , OS9, CENTG1 , CDK4, TSFM, AK024870, NUP107, MDM2, CPSF6, BCL11 B, ASXH1 AND C20orf112 (e g Table 11 genes)
[00123] The MCRs described herein as associated with prognosis comprise gains or losses of genes listed in Tables 5, 6, 7, 8, 9 and/or 11 , and of the genomic regions listed in Tables 1 to 11 and particularly Tables 1 , 2, 3, 4 and/or 10 The gain or loss can be all or part of any one of these genes In an embodiment, the detected gain or loss comprises amplification and/or deletion of the entire gene
[00124] Accordingly, in a further embodiment, the prognosis is determined to be poor, in the absence of chemotherapy, when the genomic profile comprises a gain of a MCR comprising all or part of a gene listed in Table 5, 9 and/or 11 associated with poor prognosis and/or comprises a loss of a MCR comprising all or part of a gene listed in Table 7 associated with poor and/or comprises a gain of an MCR in table 1 , 2 and/or 10 associated with poor prognosis, and the prognosis is determined to be good, in the absence of chemotherapy, when the genomic profile comprises a gain of a MCR comprising all or part of gene listed in Table 6 and/or a loss of a MCR comprising all or part of a gene listed in Table 8 relative to the control
[00125] The genomic profile can be determined by various methods for example by determining a hybridization pattern using a probe that hybridizes to a region described herein as associated with a prognosis or outcome In an embodiment, a set of probes are used In another embodiment the probe is a chromosomal probe
[00126] In an embodiment, detection of one of the gains losses described herein is sufficient for association with prognosis and/or response to chemotherapy
[00127] In an embodiment, the method comprises hybridizing a chromosomal probe or a set of chromosomal probes to the biological sample, and detecting the presence or absence of hybridized probe
[00128] In an embodiment, the probe is complementary to at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, 500 contiguous nucleotides of a gene listed in Table 5, 6, 7, 8, 9 and/or 11 , or a genomic region alteration such as a MCR and/or region flanking a MCR described herein, for example in Table 1 , 2, 3, 4 and/or 11. In another embodiment, the probe is at least or greater than 90, 95, 96, 97, 98, 99, 99.5 or 99.9% identical to a gene listed in Tables 5, 6, 7, 8, 9 and/or 11 , or a region in listed in any one of Tables 1-11 , for example Tables 1 , 2, 3, 4 and/or 10.] Alternatively, for example the probe can be a bacterial artificial chromosome (BAC) clone and can comprise the target sequence. In this case, the probe can be at least 50,000 bp, at least 100, 000 bp, at least 150, OOObp and/or at least 200 000 bp, for example 150 000-200 000 bp The probe can for example comprised in an array, for example, on a solid support. Accordingly, in another embodiment, the set of chromosomal probes is comprised in an array.
[00129] In a further embodiment, the probes are labeled, for example the probes are fluorescently labeled. In another embodiment, the subject DNA and the reference DNA is labeled.
[00130] Accordingly in another embodiment, the method comprises: (a) determining a hybridization pattern of a chromosomal probe in a biological sample from the subject, wherein the probe hybridizes to a chromosome selected from the group 11 , 4, 5, 6, 7, 9, 12, 17, 20, 8, 1 , 13, 16, and/or 14 and (b) determining the lung cancer prognosis for the subject based on the hybridization pattern, wherein the prognosis is determined to be poor when the hybridization pattern indicates a gain of one or more MCRs or genes within chromosome for example 1 , 2, 8, 11 , 12, 14 and/or 20 listed in Table 1 , 2 and/or 10 , or for example within chromosome 1 , 2, 4, 5, 6, 7, 8, 9, 11 , 12, 14, 17, and 20 listed in Table 5, 9 and/or 11 and/or a loss of one or more MCRs or genes within chromosomes 1 , 13 and 16 listed in Table 7 and the prognosis is determined to be good when the hybridization profile indicates a gain of a MCR or gene within chromosome 8 in Table 6 and/or a loss of one
or more MCRs or genes within chromosome 6 or 14 in Table 8, relative to the control
[00131] Accordingly in another embodiment, the method comprises (a) determining a hybridization pattern of a chromosomal probe or set of chromosomal probes in a biological sample from the subject, wherein the set comprises one or more probes directed to one or more MCRs and/or genes in chromosomes 2, 11 , 4, 5, 6, 7, 9, 12, 14, 16, 17, 19, 20, 8, 1 , 13, 16, 6 and/or 14 listed in Tables 1-11 , and (b) determining the lung cancer prognosis for the subject based on the hybridization pattern, wherein the prognosis is determined to be poor when the hybridization pattern indicates a gain or loss of one or more MCRs or genes associated with poor prognosis and the prognosis is determined to be good when the hybridization profile indicates a gain or loss of one or more MCRs or genes associated with good prognosis relative to the control
[00132] In an embodiment, the prognosis is determined to be poor when the hybridization pattern indicates a gain of one or more MCRs or genes listed in Table 1 , 2, 5, 9 and/or 11 and/or a loss of one or more MCRs or genes listed in Table 3 and/or 7 In an embodiment, the gain comprises all or part of a gene listed in Table 5 In another embodiment, the gain comprises all or part of a gene listed in Table 9 In yet another embodiment, the gain comprises all or part of a gene listed in Table 11 In another embodiment, the loss comprises all or part of a gene listed in Table 7
[00133] In yet a further embodiment, the prognosis is determined to be good when the hybridization pattern indicates a gain of a MCR or gene within chromosome 8 and/or a loss of one or more MCRs or genes within chromosome 6 or 14 relative to the control In an embodiment, the gain comprises all or part of RAB11 FIP1 In another embodiment, the loss comprises all or part of a gene listed in Table 8
[00134] It has also been determined that subjects with a gam or loss of a subset of MCRs or genes are associated with significant improvement in
survival and/or have improved tumor responsiveness with chemotherapy compared to subjects with the gain or loss not treated with chemotherapy.
[00135] In another aspect, the disclosure includes a method for determining a likelihood of improved survival or response with chemotherapy treatment comprising detecting a gain of all or part of a MCR or gene listed in Tables 1 , 2, 5, 9, 10 and/or 11 associated with improved response to chemotherapy, wherein a gain indicates the subject has a good prognosis when treated with chemotherapy relative to a subject not treated with chemotherapy.
[00136] In another aspect, the disclosure includes a method for determining tumour responsiveness to a chemotherapy treatment comprising detecting a gain of all or part of one or more of the genes listed in Tables 1 , 2, 5, 9 or 11 associated with improved response to chemotherapy, wherein a gain indicates the tumour is likely responsive to treatment with chemotherapy relative to a tumour not comprising the gain.
[00137] Accordingly in an embodiment, a gain detected of all or part of one or more of the following genes: MFSD7, D4S234E, ACOX3, SRD5A1 , AQP2, ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, DNMT3B and/or the loss of all or part of one of the following genes: RHOC, ATP2C2, ZDHHC7, COC4I1 , FOXF1 , indicates the subject has a good prognosis when treated with chemotherapy relative to a subject not treated with chemotherapy.
[00138] In another embodiment, the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of all or part of one or more of the following genes: BAALC, ANGPT1 , MYC, WISP1 , KRT81 , KRT1 , NEUROD4, and/or PA2G4 (e.g. Table 9 genes associated with improved response to chemotherapy), In a further embodiment, the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of of all or part of one or more of the following genes: GUCA2A, PPIH, LEPRE1 , CR623026, C1orf50,
DQ515898, DQ515897, MYC FGF3, KRT81 , KRT1 , FAM112B, B4GALNT1 , CENTG1 , BCL11 B (e.g. Table 11 genes associated with improved response to chemotherapy).
[00139] Another aspect provides a method of determining a lung cancer prognosis in a subject, the method comprising detecting the presence of a MCR and/or gene associated with improvement with chemotherapy, for example a MCR of Table 1 , 2, and/or 3, or a gene from Table 5 or 7, wherein the gain or loss of a MCR and/or gene associated with improvement with chemotherapy (as indicated in the relevant table) is indicative the subject will have good prognosis relevant to a control, for example a subject with the gain or loss not receiving chemotherapy.
[00140] In another aspect, the disclosure includes a method for determining a likelihood of improved survival with chemotherapy treatment comprising detecting a loss of all or part of a MCR or gene listed in Tables 3, 4, 7 and/or 8 associated with improved response to chemotherapy, wherein the loss indicates the subject has a good prognosis when treated with chemotherapy relative to a subject not treated with chemotherapy.
[00141] In another aspect, the disclosure includes a method for determining tumour responsiveness to a chemotherapy treatment comprising detecting a loss of all or part of a MCR or gene listed in Tables 3, 4, 7 and/or 8 associated with improved response to chemotherapy, wherein the loss indicates the tumour is likely responsive to treatment with chemotherapy relative to a tumour not comprising the loss.
[00142] In an embodiment, the chemotherapy comprises a platinum based chemotherapeutic. In another embodiment, the chemotherapy comprises a vinca alkaloid. In a further embodiment, the chemotherapy regimen includes both a platinum based chemotherapeutic and a vinca alkyloid.
[00143] Expression data of the genes herein identified associated with prognosis is also predicted to be useful for predicting prognosis. Generally,
with increasing gene dosage, gene expression levels would be expected to increase Similarly, with decreasing gene dosage, gene expression would be expected to decrease This is for example often the case with heterozygous gene knock out in mice, and/or transgene copy number in transgenic mice For example, increased expression of a gene whose gain is associated with poor outcome is expected to be indicative of poor outcome and decreased expression of a gene, loss of which is associated with poor outcome is expected to be indicative of poor outcome Similarly, increased expression of a gene, gain of which is associated with good outcome is expected to be indicative of good outcome and decreased expression of a gene, loss of which is associated with good outcome, is expected to be indicative a good outcome Gene expression can be determined alone and/or in conjunction with genomic alterations
[00144] Accordingly, another aspect provides a method for determining a lung cancer prognosis in a subject, the method comprising (a) determining an expression profile comprising detecting an expression level of one or more genes listed in Tables 5, 6, 7, 8, 9 and/or 11 associated with prognosis in a biological sample from the subject, wherein the prognosis is determined to be poor when the expression profile comprises a increased level of expression of one or more genes in Table 5, 9 and/or 11 associated with poor prognosis and/or a decreased expression in one or more genes listed in Table 7 and the prognosis is determined to be good when the expression profile comprises increased expression of RAB11 FIP1 and/or decreased expression of one or more genes in Table 8, relative to a control
[00145] In an embodiment, the method includes step (b), said step (b) comprising determining the lung cancer prognosis for the subject by comparing the expression profile with one or more controls
[00146] The expression level is optionally determined in addition to the genomic copy number Accordingly, in addition to determining the genomic profile and/or the detecting the gain or loss of a MCR comprising all or part of one or more genes listed in Tables 5, 6, 7, 8, 9 and/or 11 , the method further
comprises detecting the expression level of a gene listed in Table 5, 6, 7, 8, 9 and/or 11. In an embodiment, the expression level of the gene all or partly gained or lost, is increased or decreased respectively, relative to a control expression level.
[00147] In an embodiment, the expression level is detected using a probe that binds a gene listed in Tables 5, 6, 7, 8, 9 and/or 11. In an embodiment, the probe comprises at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, 500 contiguous nucleotides complementary to a gene listed in Table 5, 6, 7, 8, 9 and/or 11 , or a gene with at least 90, 95, 98, 99, 99.5 or 99.9% identity to a gene in Table 5, 6, 7, 8, 9 and/or 11. The probe can for example be comprised in an array, for example, on a solid support, for example array. In another embodiment, the expression level is detected by detecting the presence or absence of hybridized probe.
[00148] In a further embodiment, the probes are comprised in an array, for example on a solid support. In another embodiment, the probes are labeled or for example fluorescently labeled.
[00149] As described herein and mentioned above, prognostic associations have been found for MCRs of gain located on 12q and 14q (e.g. Table 1 or 10). Such MCR gains were found by array-CGH and qPCR studies to be significantly associated with poor survival in the absence of chemotherapy. Predictive associations have been found for MCRs of gain located on 1 p, 8q, 11q, 12q, and 14q. Subjects with these MCRs were found to have improved survival when treated with chemotherapy.
[00150] Accordingly, another aspect provides a method for determining a lung cancer prognosis in a subject, the method comprising: (a) determining a hybridization pattern of a chromosomal probe in a biological sample from the subject, wherein the set comprises a probe to the 6Mb region of chromosome 12q, 8q or 11q; and (b) determining the lung cancer prognosis for the subject based on the hybridization pattern, wherein the prognosis is determined to be poor without chemotherapy when the hybridization pattern indicates a gain of a MCR within the 6Mb region of chromosome 12q relative
to a control and/or the prognosis is determined to be good when treated with chemotherapy when the hybridization pattern indicates a gain of a MCR within 8q and/or 11 q
[00151]
[00152] In an embodiment, gain of DNA copy number at an MCR located on 1 p within basepair positions 41265460 to 43221579 is indicative of a good prognosis with chemotherapy
[00153] In another embodiment, gain of DNA copy number at an MCR within basepair positions 128289292 to about 128936748 on the long arm of chromosome 8 is indicative of a good prognosis with chemotherapy
[00154] In another embodiment, gain of DNA copy number at an MCR within basepair positions 68572940 to about 70388868 on the long arm of chromosome 11 is indicative of a good prognosis with chemotherapy
[00155] In another embodiment, gain of DNA copy number at an MCR within basepair positions 50731457 to about 51457372 on the long arm of chromosome 12 is indicative of a good prognosis with chemotherapy
[00156] In another embodiment, gain of DNA copy number at an MCR within basepair positions 52696908 to about 53538441 on the long arm of chromosome 12 is indicative of a good prognosis with chemotherapy
[00157] In another embodiment, gain of DNA copy number at an MCR within basepair positions 55933813 to about 57461765 on the long arm of chromosome 12 is indicative of a good prognosis with chemotherapy
[00158] In another embodiment, gain of DNA copy number at an MCR within basepair positions 96994959 to about 99058653 on the long arm of chromosome 14 is indicative of a good prognosis with chemotherapy
[00159] Several genes comprised within the 1 p, 8q, 11q, 12q, and 14q MCRs were also detected in a separate gene analysis Accordingly, in an embodiment, the method comprises detection of DNA copy number of a
gene in Tables 5-11 that falls within a MCR listed in Table 1 , 2, 3, 4 and/or 10.
[00160] As a number of genome gains and losses are associated with tumour responsiveness and/or better survival when subjects are treated with chemotherapy, the disclosure provides methods for selecting a treatment for subjects with lung cancer.
[00161] Accordingly, in another aspect, the disclosure provides a method of selecting a treatment regimen for a subject with lung cancer, the method comprising: (a) determining a genomic profile comprising detecting a genomic alteration in one or more genes selected from Table 5 and/or 7 in a biological sample from the subject; (b) selecting a treatment for the subject optionally by comparing the genomic profile with one or more controls, wherein the treatment selected comprises chemotherapy when the genomic profile comprises a gain of all or part of one or more of the following genes: MFSD7, D4S234E, ACOX3, SRD5A1 , AQP2, ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, DNMT3B; and/or a loss of all or part of one or more of the following genes: RHOC, ATP2C2, ZDHHC7, COC4I1 , and/or FOXF1 relative to the control.
[00162] In another embodiment, the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of all or part of one or more of the following genes: BAALC, ANGPT1 , MYC, WISP1 , KRT81 , KRT1 , NEUROD4, and/or PA2G4 (e.g. Table 9 genes associated with improved response to chemotherapy), In a further embodiment, the gain associated with improved survival with chemotherapy or improved tumor responsiveness is a gain of of all or part of one or more of the following genes: GUCA2A, PPIH, LEPRE1 , CR623026, C1orf50, DQ515898, DQ515897, MYC FGF3, KRT81 , KRT1 , FAM112B, B4GALNT1 , CENTG1 , BCL11 B (e.g. Table 11 genes associated with improved response to chemotherapy).
[00163] In an embodiment, the gain comprises a gain in all or part of one or more of FGF3, FAM112B, TSFM, NUP107 and/or MDM2
[00164] In an embodiment, the subject has been treated by surgical resection
[00165] Two genes were identified as trending to worse survival with administration of chemotherapy
[00166] Accordingly, in an embodiment the method for selecting a treatment comprises (a) determining a genomic profile comprising detecting a genomic alteration in one or more genes selected from AK024870 and CPSF6, wherein the treatment selected comprises non-chemotherapy and/or a non-platinum analog-, vinca alkaloid or combination thereof chemotherapy treatment when the genomic profile comprises a gain of all or part of one or more of AK024870 and CPSF6
[00167] The disclosure also provides a method of prognosis of likelihood of improved survival in a lung cancer subject who was and/or is receiving a chemotherapeutic treatment, comprising determining the presence or absence of a gain or loss of a MCR associated with improvement with chemotherapy, predicting the likelihood of improved survival according to the presence or absence of the MCR or gene gain or loss compared to a control, wherein detecting a MCR or gene associated with improvement with chemotherapy predicts likelihood of improved survival compared to a control having the same gain or loss who has not received or is not receiving chemotherapy
[00168] In an embodiment, the presence of a gain or loss associated with improvement with chemotherapy is indicative of a favourable predisposition of the subject to respond to platinum analogs, vinca alkyloids and/or a combination thereof
[00169] Another aspect provides a method of treating lung cancer comprising determining the presence or absence of a gain or loss of a MCR or gene associated with improvement with chemotherapy in a subject with
lung cancer and administering chemotherapy to a subject with at least one gain or loss associated with improvement with chemotherapy
[00170] In an embodiment the chemotherapy administered is a platinum analog, a vinca alkyloid or a combination thereof In a further embodiment, the platinum analog is selected from the group consisting of cisplatin, paraplatin, carboplatin, oxaliplatin and satraplatin in either IV or oral form In another embodiment the vinca alkyloid is selected from the group vinorelbine, vincristine, vinblastine, vindesine and vinflunine in either IV or oral form
[00171] The methods described herein are useful for different lung cancers In an embodiment, the lung cancer is non-small cell lung cancer (NSCLC), early stage NSCLC, squamous cell carcinoma, adenocarcinoma, or large cell carcinoma
[00172] The biological sample can be any sample that comprises a polynucleotide or biomarker expression product to be assayed In an embodiment, the biological sample is selected from the group consisting of lung tissue, lung cells, lung biopsy and sputum including formalin fixed, paraffin embedded and fresh frozen specimens
[00173] The methods described herein compare a subject profile, genomic or expression with a control The control with respect to genomic alterations is for example the copy number of gene or region in a subject in a different class e g good prognosis when treated with chemotherapy versus poor prognosis when not treated with chemotherapy, or alternatively can be an internal control, e g the copy number at a region with no gain or loss, for example centromere copy number For example, For the FISH method, the centromere copy number can be used For the qPCR method, centromere cannot be used, and instead a "control" gene would be used, a gene on the same or different chromosome that is infrequently gained or lost For array- CGH, a reference genomic DNA sample from a "normal" individual without cancer would be used A person skilled in the art would be able to select an
appropriate control Accordingly, in an embodiment the control is the centromere copy number Typically, the copy number of a gene or region is 2, one copy per allele Accordingly, in another embodiment the control is such that a copy number greater than 2 is a gain, and a copy number less than 2 is a loss Myc and CCDN 1 have for example, previously been shown to be amplified in lung cancer, however it is not believed that they have been identified in association with improved response to chemotherapy
[00174] In an embodiment, for example pertaining to prognosis without chemotherapy, the gene detected is not EGFR, MET, MYC, CCND1 KRAS, and/or TITF1
I. COMPOSITIONS AND KITS
[00175] The disclosure also provides compositions and kits which are useful for example in the methods described herein
[00176] An aspect provides a composition comprising a detection agent for detecting the presence or absence of a MCR or gene gain or loss associated with prognosis In an embodiment the detection reagent is a hybridization probe, for example a chromosomal probe or a gene expression probe In an embodiment, the probe comprises at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, or 500 contiguous nucleotides complementary to a gene listed in Table 5, 6, 7, 8, 9 and/or 11 , or a genomic region alteration such as a MCR and/or region flanking a MCR described herein, for example in Tables 1 to 11 , or for example in Table 1 , 2, 3, 4 and/or 11. The probe can further be 90, 95, 96, 97, 98, 99, 99 5, 99 9% identical to the at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, or 500 contiguous nucleotides of a gene listed in Table 5, 6, 7, 8, 9 and/or 11 , and/or a MCR and/or region flanking a MCR described herein, for example in Table 1 , 2, 3, 4 and/or 10 Depending on the probe type (e g oligonucleotide or BAC clone), the nucleotide length of the probe can vary, and in the case of a BAC clone can include sequence in addition to the gene or MCR associated In an
embodiment, the probe is a BAC clone. In an embodiment, the BAC clone is at least 50 000, 100 000, 150 000 or 200 000 nucleotides. In an embodiment the BAC clone is about 150 000-200 000 nucleotides. BAC clones can be used for example as probes in FISH and some array CGH platforms. In an embodiment, the probe is complementary to a MCR described herein. In a further embodiment the probe comprises a BAC clone that overlaps the MCR or gene gained or lost. In an embodiment the probe comprises the nucleotide sequence of a BAC clone of an Affymetrix U133A chip comprising a MCR or gene gain or loss described herein as associated with prognosis. A person skilled in the art on the basis on the teachings herein, such as the teachings in the Examples, would be able to identify the probes that correspond to the particular MCRs and genes.
[00177] In another embodiment, the composition comprises a primer or a primer pair for amplifying a biomarker expression polynucleotide, or a genomic region described herein. The primer is in an embodiment, 15-20, 21-30, 31-40, 41-50 or more than 50 nucleotides in length.
[00178] In an embodiment the composition further comprises a carrier.
[00179] In another aspect, the disclosure provides a kit for determining lung cancer prognosis in a subject comprising for example a detection agent or composition described herein. In an embodiment, the kit comprises a chromosomal probe wherein the probe hybridizes all or part of a MCR listed in Tables 1 to 11 , for example in Table 1 , 2, 3, 4 and/or 10 and/or all or part of a gene listed in Tables 5, 6, 7, 8, 9 and/or 11.
[00180] In another aspect, the disclosure provides a kit for determining lung cancer prognosis in a subject, the kit comprising one or more gene expression probes, wherein the set comprises a probe specific for a gene expression product of a gene listed in Tables 5, 6, 7, 8, 9 and/or 11.
[00181] In an embodiment, the probes are labeled, for example, the probes are fluorescently labeled. In other embodiment, the kit comprises labeling reagents for example for labeling subject sample, e.g. subject DNA.
[00182] In another embodiment, the probes are comprised in an array on a solid support.
[00183] In an embodiment, the kit comprises reagents for FISH analysis of a MCR or gene gain or loss described herein, and a control region such as a centromere or gene on the same or different chromosome. For example, the kit comprises a probe for a MCR or gene gain or loss described herein, and a reference probe to the centromere or a gene on the same or different chromosome, and labeling reagents for labeling the probe.
[00184] In another embodiment, the kit comprises reagents for CGH analysis of a MCR or gene gain or loss described herein, for example, the kit comprises an array with one or more probes for one or more MCRs or genes gained or lost described herein and labeling reagents for labeling the subject sample DNA.
[00185] In a further embodiment the kit comprises reagents for PCR such as quantitative or multiplex PCR. For example the kit comprises a primer set for amplifying all or part of a MCR or gene, or multiple MCRs or genes, described herein associated with prognosis, as well as one or more primer sets for identifying one or more control genes on the same or different chromosomes.
[00186] In yet a further embodiment, the kit comprises a primer set and probe for detecting an amplification product.
[00187] In a further embodiment, the kit comprises a positive and/or a negative control. The control in an embodiment comprises normal reference DNA for CGH or FISH based kits. A positive control comprises a tumour that is known to have a gain or loss at the particular target being assayed.
[00188] In yet a further embodiment, the kit further comprising instructions that indicate prognosis is determined to be poor in the absence of chemotherapy when a hybridization pattern of the chromosomal probe or set of chromosomal probes indicates a gain in a MCR in for example, chromosome 11 or 12 listed in Table 1 , 2 and/or 10, or a gain in a MCR
comprising all or part of a gene listed in Table 5, 9 and/or 11 and/or a loss of the a MCR comprising all or part of a gene listed in Table 7, relative to control; good when a hybridization pattern of one or more chromosomal probes indicates a gain in a MCR comprising all or part of a gene listed in Table 6 and/or a loss of the MCR comprising all or part of a gene listed in Table 8. In another embodiment, the kit comprises instructions that indicate prognosis is determined to good when treated with chemotherapy when a hybridization pattern of the chromosomal probe or set of chromosomal probes indicates a gain in a MCR comprising for example, all or part of MFSD7, D4S234E, ACOX3, SRD5A1 , AQP2, ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, and/or DNMT3B, and/or a loss in a MCR comprising all or part of RHOC, ATP2C2, ZDHHC7, COC4I1 , FOXF1 , relative to a control. In another embodiment, the kit comprises instructions that indicate prognosis is determined to be good when treated with chemotherapy, when a hybridization pattern of a chromosomal probe or set of chromosomal probes indicates a gain in a MCR comprising for example a gain listed in Table 9 and/or 11 to be associated with poor prognosis. In an embodiment, the instructions include direction for comparing to a control. In an embodiment, the instructions include direction and/or reagents for using a centromere copy number or other chromosome as a control.
[00189] The following non-limiting examples are illustrative of the present disclosure:
EXAMPLES Example 1
Results Array-CGH and RNA microarray:
[00190] The chromosomal pattern of observed gains and losses by array-CGH are in concordance with previous array-CGH and CGH studies in
NSCLC, including frequent gains at chromosome 1q, 3q, 5p, and 8q, and frequent losses at 3p, 5q, 6q, 8p, 9p, 13q, and 17p MCRs of DNA copy number alteration encompass multiple genes known to be important in NSCLC, including MYC, hTERT, and cyclin D1 , as well as many potentially important novel genes
[00191] Upon integration of wide MCRs of gain with RNA expression microarray data, there are 38 genes that, when gained in copy number, were found to impart a significantly worse survival in the absence of chemotherapy (p < 0 05) (Table 5) These genes are found mostly on chromosomes 12q and 5p Of these 38 genes 22 were found to show a significant improvement with chemotherapy by the interaction terms analysis on the array-CGH dataset Only one gene (RAB11 FIP1) was found to have a favourable effect on prognosis when gained (Table 6)
[00192] Within the wide MCRs of loss, 13 genes had a significant deleterious effect on survival in the absence of chemotherapy, predominantly found on chromosomes 1 p, 13q, and 16q (Table 7) Of these, 6 genes were found to show a significant improvement with chemotherapy by the interaction terms analysis Eight genes, mostly on chromosome 6p, showed an improved prognosis with loss of DNA material in one of the 3 analyses
[00193] After removing known human copy number variations, 27 narrow MCRs of gain and 19 narrow MCRs of loss across the genome were identified for statistical analysis After correcting for multiple testing, MCRs of gain within a 6Mb region of 12q were found to be significantly associated with poor survival in the absence of chemotherapy (p < 0 001 , q < 0 05) When this region was examined for benefit of chemotherapy, a significant improvement of survival was identified at one of these 12q MCRs (interaction p < 0 01), while the other 12q MCRs showed a trend towards improved response to chemotherapy (Table 1) These associations remained significant (p < 0 05) in a multivariate model incorporating known prognostic clinical factors (ι e , age, sex, stage, grade) Approximately 25% of samples showed gains at these MCRs on 12q, which were more common in
squamous cell carcinomas (40%) than adenocarcinomas (20%), and tended to be seen in older patients
[00194] Other potential predictive associations arising from this analysis that were not significant after multiple testing corrections included an improved survival with chemotherapy for patients with gains at MCRs on 8q (interaction p = 0 02) and 11q (interaction p = 0 08) The 11 q gain showed significant predictive ability in the multivariate model (interaction p = 0 02), whereas the MCR on 8q lost its predictive ability in the multivariate model in this analysis
[00195] One hundred and twenty-three focal high-amplitude MCRs were identified from the 113 NSCLC samples interrogated by array-CGH These amplicons were found on all 22 chromosomes examined, and included well- known amplified genes in NSCLC including EGFR, MET, MYC, CCND1 , KRAS, and TITF1 Twenty-six of these high-amplitude MCRs were found to be well known copy number variations (CNVs) contained within the Database of Genomic Variants (DGV) Eleven of these MCRs were selected for further validation studies based on significant survival associations (Table 10)
Quantitative Polymerase Chain Reaction (qPCR):
[00196] There were 40 genes on chromosomes 5, 8, and 12 from the wide MCRs analysis, that were tested by qPCR on the same samples Of these, 6 genes showed a significant (p < 0 05) poor survival in the observation arm associated with DNA copy number gains as detected by qPCR (Table 9) Five of the genes showed a significant (p < 0 05) improved outcome with chemotherapy by interaction terms analysis (Table 9) These survival associations were in agreement with the array-CGH analysis However, the remainder of the genes tested did not show the same survival association by qPCR as by array-CGH, on DNA from the same samples
[00197] Upon examination of the minority of genes that were validated by qPCR, it was noted that these genes tended to fall in regions that showed
high-level amplifications. As a result of this finding, an array-CGH analysis designed to focus on high-level amplifications was performed, resulting in the list of high-amplitude MCRs listed in Table 10.
[00198] From the 11 prognostic / predictive high-amplitude MCRs, 38 genes have been tested by qPCR on the same samples. Of these, 16 have shown significant (p < 0.05) survival associations (prognostic in the absence of chemotherapy, and/or predictive of improved response to chemotherapy) in agreement with the array-CGH analysis. An additional 9 of these genes show a trend to significant survival associations (p < 0.2). Many of the genes with significant survival associations were found within the four 12q amplicons, showing a poor prognosis in the observation arm, and an improved response to chemotherapy.
Discussion
[00199] High-resolution array-CGH analyses on a subset of the BR.10 patients have identified regions of recurrent copy number gain that may be predictive of benefit from adjuvant chemotherapy. This information would be very useful for selecting those lung cancer patients who should receive current adjuvant chemotherapy, those who do not require chemotherapy, and those patients who will require more experimental treatments in hopes of curing their disease. Further experiments are underway to validate these results in additional samples from the same study, as well as to identify critical genes in these areas. (Supported by grants from the Canadian Cancer Society, Ontario Institute of Cancer Research and Genome Canada)
Materials and Methods Study materials:
[00200] All NSCLC samples used in this study were excised from patients who were enrolled in a prospective, randomized controlled trial (JBR10) which studied the efficacy of adjuvant venorelbine plus cisplatin to improve survival in early stage (stage IB or II) NSCLC patients who had been treated by complete surgical resection (Winton et al., 2006). Half of the patients were randomly assigned to receive adjuvant chemotherapy, and half
were assigned to no adjuvant chemotherapy. The samples examined were excised prior to any adjuvant therapy being administered. The study concluded that adjuvant chemotherapy prolongs disease free survival and overall survival in patients with completely resected early-stage NSCLC.
[00201] For array-comparative genomic hybridization (CGH) analysis, DNA was extracted from 134 formalin-fixed, paraffin-embedded (FFPE) and 16 fresh frozen NSCLC specimens, from 142 patients. The FFPE samples were cored from tissue blocks in areas of > 60% tumour cells, as marked by a pathologist on hematoxylin and eosin (H&E) slides.
[00202] For gene expression microarray experiments, 176 fresh frozen tumour samples and 10 fresh frozen corresponding normal lung samples were used. 133 of these tumour samples were from patients in the JBR10 cohort, 81 of which also had array-CGH data analyzed in this study. 38 of the tumour samples were from a non-JBR10 cohort.
Array-CGH hybridization:
[00203] Array comparative genomic hybridization (CGH) was performed using a custom whole genome tiling path bacterial artificial chromosome array with 26,363 overlapping clones, each spotted in duplicate (BC Cancer Research Centre, Vancouver, BC) (Watson SK et al., 2007). This platform enables us to measure alterations in DNA copy number at high resolution across the entire genome in each tumour sample, with a minimal amount (as little as 50ng) of DNA.
[00204] Comparative genomic hybridization experiments were undertaken as previously described (Coe & Lockwood et al., 2006). Briefly, each tumour DNA sample was labeled with Cyanine-3, mixed with a Cyanine-5-labeled individual male reference DNA sample, and hybridized to the array.
Array-CGH data preprocessing and normalization:
[00205] Array image capture and data normalization was performed as previously described (Watson SK et al , 2007) Briefly, post-hybrid ization arrays were scanned using a CCD-based imaging system, and quantitated using Soft-Worx Tracker spot analysis software (Applied Precision, Issaquah, WA)
[00206] Data was Iog2 transformed, and replicate clones having standard deviations > 0 075 or signal-to-noise ratios in each dye channel of < 3 were filtered out A multi-step normalization was then carried out to control for biases caused by the array (ex spatial biases or differences in background signal), the dyes used for labeling, or the DNA sample quality (Khojasteh et al 2005, Chi et al 2007) The amount of "copycat" correction required for each sample was plotted in a histogram of all samples, those that required too much correction and did not lie within a normal distribution were deemed to be poor quality DNA, and were eliminated from analysis By this criteria, 35 samples were eliminated, leaving 115 samples from 113 patients (56 received adjuvant chemotherapy, 57 had no adjuvant chemotherapy) for further analysis Log2 ratios were plotted and data was visualized using SeeGH software (Chi et al 2004)
Array-CGH data analysis:
[00207] In order to define genomic regions that were frequently gained in terms of DNA copy number in NSCLC, three algorithms were employed in parallel analyses to define the segmental DNA gains and losses in each tumour genome for the 113 patient samples circular binary segmentation (DNAcopy) (Venkatraman & Olshen, 2007), a hidden markov model (HMMeR) (Shah et al , 2006), and aCGH Smooth (Jong et al 2004) For DNAcopy analysis, a Iog2 threshold of 0 05 for gams and -0 05 for losses was used to define whether a segment was gained/lost or not For each algorithm, minimal common regions (MCRs) of DNA gam and loss were then identified for the entire tumor panel with STAC software (Diskm et al 2006) (using 100 permutations at a resolution of 100,000 bp, and a p-value cut-off of 0 05 by either footprint or frequency calculation by the software) These
regions are referred to herein and accompanying tables as "wide MCRs of gain" and "wide MCRs of loss."
[00208] To attempt to focus further the genomic regions of DNA copy number gain in NSCLC, circular binary segmentation (DNAcopy) (Venkatraman & Olshen, 2007) was used to define the segmental DNA gains and losses in each tumour genome for the 113 patient samples. A Iog2 threshold of 0.05 for gains and -0.05 for losses was used to define whether a segment was gained/lost or not. Minimal common regions (MCRs) of DNA gain and loss were then identified for the entire tumor panel with STAC software (Diskin et al. 2006) (using 100 permutations at a resolution of 100,000 bp) with a p-value cut-off of 0.05 by frequency calculation. MCRs corresponding to known copy number variations as described by Wong et al. 2007 were eliminated. As well, MCRs whose frequency of alteration amongst the samples multiplied by their average Iog2 of altered samples was less than 0.02 were removed from further analysis. These MCRs are referred to as "narrow MCRs of gain" and "narrow MCRs of loss" herein.
[00209] In order to focus the array-CGH analysis on high-level amplification events in NSCLC, circular binary segmentation (DNAcopy) (Venkatraman & Olshen, 2007 was used to define the segmental DNA gains and losses in each tumour genome for the 113 patient samples. A Iog2 threshold of 0.05 was used to define whether a segment was gained or not. High-amplitude regions of gain (referred to as "high-amplitude MCRs" herein) were defined as genomic regions where the average Iog2 value, as assigned by DNAcopy analysis, in the gained samples, was greater than 0.15.
[00210] Prognostic and predictive genes by RNA expression levels within MCRs of gain were determined by integrating data from gene expression microarray experiments. Gene expression for 133 NSCLC samples was assessed using an Affymetrix U133A microarray chip. The data was normalized using RMAexpress software followed by distance-weighted discrimination (DWD) to minimize "batch" differences among samples, and then Iog2 transformed.
Statistical Analysis:
[00211] In order to identify prognostic genes, the MCRs of gain and loss as defined above (p-value 0.05 by frequency or footprint calculation) were cross-referenced with the locations of genes on the Affymetrix U133A chip (~22,000 probesets in total) that were found to have prognostic value by univariate Cox proportional hazards analysis on the observation arm only. Out of 1584 probesets that had a significant prognostic effect (p < 0.05) by gene expression, 398 probesets (364 genes) fell within MCRs of gain, and 426 probesets (391 genes) fell within MCRs of loss. These genes were selected for further analysis.
[00212] To evaluate the prognostic significance of genomic gain or loss at each of the genes in the absence of adjuvant therapy, a univariate Cox proportional hazards model using disease-specific survival (DSS) was applied to determine any statistically significant (p < 0.05) prognostic effect for the patients who did not receive chemotherapy (57 patients) Hazard ratios were compared to ensure agreement between the gene expression and array-CGH data in terms of the effect on patient survival, and 4 lists of genes were arrived at: genes imparting a worse prognosis when gained (39 genes), genes imparting a better prognosis when gained (1 gene), genes imparting a worse prognosis when lost (13 genes), and genes imparting a better prognosis when lost (8 genes).
[00213] In addition, a univariate Cox proportional hazards model was employed on the entire cohort (observation and chemotherapy arm, 113 patients in total) with the use of interaction terms to identify effects of chemotherapy on the survival associated with gain or loss at each gene.
[00214] Genes within MCRs that were differentially expressed between tumours and normal lung samples were identified through significance analysis of microarray (SAM) analysis of the Affymetrix U133A expression microarray data from 176 NSCLC samples and 10 corresponding normal lung samples. The SAM parameters were as follows: FDR 5%, fold-change required 0.
[00215] To examine any clinicopathological associations between genomic gains and losses at each MCR, a Fisher's exact test was employed, using sex, nodal status, and histologic cell type as variables
Quantitative Polymerase Chain Reaction (qPCR):
[00216] Quantitative PCR was performed using the SYBR Green method and the Roche Lightcycler 480 instrument Five ng of genomic DNA were used per well in triplicate in 384 well plates Primers were designed and tested for specificity using the online Primer Blast software (NCBI) Primers were designed to target one exon region of each gene, with a bias towards 3' exon location As a reference, primers were designed for 3 genes on different chromosomes that are infrequently altered numerically in NSCLC, as guided by our array-CGH results Dissociation curves (melting curves) for each primer pair were determined to test for contamination, mispriming, and primer-dimer artifact, only primers producing a single peak in the dissociation curve were used in the assays
[00217] Standard curves were derived using pooled DNA from 20 formalin-fixed paraffin-embedded lung tissue from resection specimens, taken from blocks unmvolved by tumour In addition, 23 normal FFPE lung samples were run along with the tumour samples in each reaction
[00218] Initial processing of data was carried out using the Roche Lightcycler 480 software, which calculates using the 2nd derivative max point to determine crossing-point (CP) values for each well CP values were mapped to the standard curve for each gene to obtain DNA concentration values for each well The gene copy number was normalized against the copy number of the reference genes A normal range of gene copy number for each gene was established with the 23 samples of non-neoplastic lung DNA, and samples with copy number 2sd above the mean were identified as gained in copy number Samples with copy numbers, as calculated by advanced relative quantification, of greater than 4, were identified as having an amplification (in addition to a gain) at that gene, by qPCR analysis
Example 2 [00219] Selection of genes for quantitative PCR validation:
[00220] Genes within wide MCRs of gain on chromosomes 5, 8, and 12 that showed concordant survival effect by transcript level and DNA copy number were chosen for the first round of quantitative PCR validation
[00221] For the second round of quantitative PCR validation, 5 genes within each prognostic / predictive high-amplitude MCR were selected by ranking them using the following criteria RNA expression data showing the same survival effect for the RNA transcript quantity as for the DNA copy number, gene ontology relating to oncogenicity, average Iog2 ("raw" Iog2 values as well as Iog2 values assigned by DNAcopy) among gained samples, STAC analysis frequency p-value < 0 05, overexpression of RNA transcripts in NSCLC, location within an amplicon reported previously in the literature, p-values of prognostic and predictive survival associations for DNA copy number at that location (both univariate and multivariate), and p-values for prognostic and predictive survival associations of RNA transcript levels (univariate)
Example 3
[00222] The array-CGH dataset described in Example 1 is unique and powerful in that it uses tumour samples from a randomized controlled trial of the effectiveness of chemotherapy in early-stage NSCLC, providing an unprecedented opportunity to study genomic aberrations at high-resolution and correlating them with patient outcome in the presence or absence of chemotherapy The sample size (113) is more than double the majority of previous array-CGH studies, allowing for a greater power in determining prognostic and predictive effects of gains and losses Furthermore, the resolution of our platform is superior to most previous array-CGH studies in NSCLC, allowing us to more precisely define the breakpoints of amplifications and deletions An additional 180 samples from the same trial
will be processed to further validate the survival associations found in the array-CGH study described herein.
Example 4 Optimization of the prognostic and predictive gene copy number model:
[00223] The gains and losses outlined herein could be tested for associations amongst one another using methods of multivariate statistics including but not limited to, cluster analysis, principal component analysis, and logistic regression. In this way, copy number alterations that tend to occur together could be identified, and key alterations that could serve as surrogate biomarkers for the co-occurring events could be identified. These key copy number alterations could be incorporated into a weighted model or that could be used to identify one or more "copy number signatures" that could molecularly classify non-small cell lung carcinomas. Such a signature would be useful for predicting prognosis and response to chemotherapy.
Example 5
[00224] The sample of lung tumour is obtained during surgery or a minimally invasive procedure. The tissue is processed in the lab to identify the tumour content. A portion of the tumour is frozen, or fixed in formalin and embedded in paraffin as per standard laboratory protocol. The DNA is extracted from the tumour tissue, and subjected to a laboratory test to examine for specific genomic alterations, such as array-CGH or multiplex qPCR. Alternatively, sections are cut from a paraffin block containing tumour, and processed for FISH analysis using probes hybridizing to one or more of our targets, and the tumour nuclei are scored for gains and losses. The presence as determined by these tests of a gain or loss in copy number, compared to a control (internal or external, depending on the test), indicates a poor prognosis for the patient if not treated with chemotherapy, but a significantly improved prognosis if treated with chemotherapy.
Example 6
How to identify probes used herein useful for detecting gains and losses associated with prognosis.
An individual could take the known genomic location of the MCR and then apply online resources to determine which BAC clones span the recurring alteration (e.g. Human BAC Resource http://www.ncbi.nlm.nih.gov/qenome/cyto/hbrc.shtml). SMRT array mapping information - specific to individual BAC clones - is available online (http://www.bccrc.ca/cg/ArrayCGH_Group.html, http://bacpac.chori.org/order.php).
Individuals can take the known genomic location, open the mapping file, and determine which BAC clones span the MCR region they are interested in. Individuals could then order clone(s) for their own use from an online resource (e.g. BACPAC Resources Center http://bacpac.chori.org/order.php). Labeled probes from this DNA could then be made and applied using a standard FISH protocol. Alternatively, labeled probes for FISH from a given clone could also be ordered directly from a variety of sources, including the BC Cancer Research Centre (http://arraycgh.ca/services.php).
Tables
TABLE 1 : Narrow Minimal Common Regions (MCRs) of Gain Associated with Prognosis by array-CGH analysis
TABLE 2: Wide MCRs of gain associated with prognosis by array-CGH analysis
TABLE 3: Wide MCRs of loss associated with poor prognosis and / or significant response to chemotherapy by array-CGH analysis
TABLE 7: Poor prognosis genes when lost as determined by aCGH and RNA microarray analysis
TABLE 8: Good prognosis genes when lost as determined by aCGH and RNA microarray analysis
All basepair positions in the tables refer to positions on the NCBI human genome build 36.3.
HR refers to Hazard ratio
In the column relating to improvement with chemotherapy, a HR of 0 indicates that no subjects in the chemotherapy-treated group died due to disease A HR of 0 1 means that the risk of dying due to disease was 10 times greater in the non-chemotherapy-treated group compared to the chemotherapy-treated group
A gene identified as "amp" is a higher threshold gam than a gene identified as a "gain" (e g an "amp" gene comprises a gam of greater than 4 copies by qPCR analysis
A gene identified as "continuous" refers to a gene that shows an increasing survival effect with increasing amplitude of DNA copy gam or amplification, by cox proportional hazards statistical analysis on continuous copy number data
TABLE 10: High-amplitude MCRs with survival associations by array-CGH data analysis
"Survival effect significant using amplitude of gain as a continuous variable
TABLE 11 : Survival associations of genes within high-amplitude MCRs, by qPCR analysis
'Survival effect significant using amplitude of gain as a continuous variable **Trend to worse survival with administration of chemotherapy
TABLE 12: qPCR primers
ZBTB39 I CCCCAAATAGTAGATGTCTAAAATCA I ACAATGGAATATAAAAGAATCAGATGT I 1 1 1
TABLE 13: BAC clones that lie within high-amplitude MCRs
[00225] While the present disclosure has been described with reference to what are presently considered to be the preferred examples, it is to be
understood that the disclosure is not limited to the disclosed examples. To the contrary, the disclosure is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.
[00226] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.
FULL CITATIONS FOR REFERENCES REFERRED TO IN THE SPECIFICATION
1 Azzoli CG, Park BJ, Pao W Molecularly tailored adjuvant chemotherapy for resected non- small cell lung cancer a time for excitement and equipoise J Thorac Oncol (2008), 3 84- 93
2 Balsara BR, Testa JR Chromosomal imbalances in human lung cancer Oncogene (2002), 21 6877-83
3 Blaven E, Brewer JL, Roydasgupta R, et al Bladder cancer stage and outcome by array- based comparative genomic hybridization CIm Cancer Res 2005 11 (19 Pt 1 ) 7012-22
4 Cappuzzo F, Hirsch FR, Rossi E, et al Epidermal growth factor receptor gene and protein and gefitinib sensitivity in non-small-cell lung cancer J Natl Cancer Inst 2005,97(9) 643- 55
5 Climent J, Garcia JL, Mao JH, Arsuaga J, Perez-Losada J Characterization of breast cancer by array comparative genomic hybridization Biochem Cell Biol (2007a),85(4) 497-508
6 Climent J et al Deletion of chromosome 11q predicts response to anthracycline-based chemotherapy in early breast cancer Cancer Res (2007b), 67 (2) 818-26
7 Canadian Cancer Society / National Cancer Institute of Canada Canadian Cancer Statistics 2008, Toronto, Canada, 2008
8 Chen W et al Array comparative genomic hybridization reveals genomic copy number changes associated with outcome in diffuse large B-cell lymphomas Blood (2006) 107 2477-85
9 Chi B, DeLeeuw RJ, Coe BP, MacAulay C, Lam WL (2004) SeeGH - a software tool for visualization of whole genome array comparative genomic hybridization data SMC Bioinformat 5(1) 13
10 Chi et al "MD-SeeGH a platform for integrative analysis of multi-dimensional genomic data", BMC Bioinformatics 2008 May 20, 9 243 [
11 Choi et al Comparative genomic hybridization array analysis and real time PCR reveals genomic alterations in squamous cell carcinomas of the lung Lung Cancer (2007), 55 43-51
12 Coe BP, Lockwood WW, Girard L, et al Differential disruption of cell cycle pathways in small cell and non-small cell lung cancer Br J Cancer 2006,94(12) 1927-35
13 Dehan E, Ben-Dor A, Liao W, et al Chromosomal aberrations and gene expression profiles in non-small cell lung cancer Lung Cancer 2007,56(2) 175-84
14 Dhesy-Thind B et al HER2/neu in systemic therapy for women with breast cancer a systematic review Breast Cancer Res Treat (2007), DOI 10 1007/s10549-007-9656-y (published online)
15 Diskin et al (2006) STAC A method for testing the significance of DNA copy number aberrations across multiple array-CGH experiments Genome Research 16 1149-58
16 Fensterer H, Radlwimmer B, Strater J, et al Matrix-comparative genomic hybridization from multicenter formalin-fixed paraffin-embedded colorectal cancer tissue blocks SMC Cancer 2007,7 58
17 Han W, Han M, Kang JJ, et al Genomic alterations identified by array comparative genomic hybridization as prognostic markers in tamoxifen-treated estrogen receptor- positive breast cancer BMC Cancer 2006,6 92
18 Hirsch FR, Varella-Garcia M Cappuzzo F et al Combination of EGFR gene copy number and protein expression predicts outcome for advanced non-small-cell lung cancer patients treated with gefitinib Ann Oncol 2007 18(4) 752-60
19 Hoglund M, Gisselsson D, Hansen GB, Mitelman F Statistical dissection of cytogenetic patterns in lung cancer reveals multiple modes of karyotypic evolution independent of histological classification Cancer Genet Cytogenet 2004 154(2) 99-109
20 ldbaih A, Marie Y, Lucchesi C, et al BAC array CGH distinguishes mutually exclusive alterations that define clinicogenetic subtypes of gliomas lnt J Cancer 2008,122(8) 1778-86
Jaffe ES Pathology and Genetics Tumours of Haematopoietic and Lymphoid Tissues lntl Agency for Research on Cancer, 2003 Jiang et al Genomic profiles in stage I primary non small cell lung cancer using comparative genomic hybridization analysis of cDNA microarrays Neoplasia (2004) 6(5) 623-35 Jong et al (2004) Breakpoint identification and smoothing of array comparative genomic hybridization data Bioinformatics 20(18) 3636-7 Khojasteh M et al A stepwise framework for the normalization of array CGH data BMC Bioinformatics 2005, 18(6) 274 Kim M, Yim S, Kwon M, et al Recurrent genomic alterations with impact on survival in colorectal cancer identified by genome-wide array comparative genomic hybridization Gastroenterology 2006,131 (6) 1913-24 Massion PP et al Genomic copy number analysis of non-small cell lung cancer using array comparative genomic hybridization implications of the phosphatidylinositol 3-kιnase pathway Cancer Res (2002), 62 3636-40 Massion PP, Taflan PM, Jamshedur Rahman SM, et al Significance of p63 amplification and overexpression in lung cancer development and prognosis Cancer Res 2003,63(21 ) 7113-21 Mayr D, Kanitz V, Anderegg B, et al Analysis of gene amplification and prognostic markers in ovarian cancer using comparative genomic hybridization for microarrays and immunohistochemical analysis for tissue microarrays Am J CIm Pathol 2006,126(1) 101-9 Patel A, Kang S, Lennon PA, et al Validation of a targeted DNA microarray for the clinical evaluation of recurrent abnormalities in chronic lymphocytic leukemia Am J Hematol 2008,83(7) 540-6 Rubio-Moscardo F et al Mantle-cell lymphoma genotypes identified with CGH to BAC microarrays define a leukemic subgroup of disease and predict patient outcome Neoplasia (2005), 105(11 ) 4445-54 Shah et al (2006) Integrating copy number polymorphisms into array CGH analysis using a robust HMM Bioinformatics 22(14) e431-9 Shibata et al Genetic classification of lung adenocarcinoma based on array-based comparative genomic hybridization analysis its association with clinicopathologic features CIm Cancer Res (2005), 11 (17) 6177-85 Slamon DJ, Clark GM, Wong SG, Levin WJ, Ulrich A, McGuire WL Human breast cancer correlation of relapse and survival with amplification of HER-2/neu oncogene Science (1987), 235 177-82 Takano T, One Y, Sakamoto H, et al Epidermal growth factor receptor gene mutations and increased copy numbers predict gefitinib sensitivity in patients with recurrent non- small-cell lung cancer J CIm Oncol 2005,23(28) 6829-37 Tagawa H, Suguro M, Tsuzuki S, et al Comparison of genome profiles for identification of distinct subgroups of diffuse large B-cell lymphoma Blood 2005 106(5) 1770-7 Thomas RK, Weir B, Meyerson M Genomic approaches to lung cancer CIm Cancer Res (2006), 12(14 Suppl) 4384s-91s Tomioka N, Oba S, Ohira M, et al Novel risk stratification of patients with neuroblastoma by genomic signature, which is independent of molecular signature Oncogene 2008,27(4) 441-9 Tonon G et al High-resolution genomic profiles of human lung cancer PNAS (2005), 102(27) 9625-30 Weir BA et al Characterizing the cancer genome in lung adenocarcinoma Nature (2007), 450(7171) 893-8 Weiss MM et al Genomic alterations in primary gastric adenocarcinomas correlate with clinicopathological characteristics and survival Cellular Oncology (2004) 26 307-17 Venkatraman ES, Olshen AB (2007) A faster circular binary segmentation algorithm for the analysis of array CGH data Bioinformatics 23(6) 657-63 Watson SK, deLeeuw RL, Horsman DE, Squire JA, Lam WL (2007) Cytogenetically balanced translocations are associated with focal copy number alterations Hum Genet 120 795-805
Winton et al (2005) Vinorelbine plus cisplatin vs observation in resected non-small-cell lung cancer New Eng J Med 352 2589-97 Zhao et al Homozygous deletions and chromosome amplifications in human lung carcinomas revealed by single nucleotide polymorphism array analysis Cancer Res (2005), 65 5561-70
Claims
Claims:
1 A method for determining a lung cancer prognosis in a subject, the method comprising (a) determining a genomic profile comprising detecting one or more genomic alterations in one or more of chromosomes 2, 11 , 4, 5, 7, 9, 12, 17, 19, 20, 8, 1 , 13, 16, 6 and/or 14 listed in Tables 1 to 11 , in a biological sample from the subject, wherein the prognosis is determined to be poor when the genomic profile comprises a gain of all or part of one or more minimal common regions (MCRs) and/or genes within chromosomes 1 , 2, 11 , 4, 5, 6, 7, 9, 12, 14, 16, 17, 19 and 20, listed as associated with poor prognosis in Tables 1 , 2, 5, 9, 10, and 11 , and/or a loss of all or part of one or more MCRs and/or genes within chromosomes 1 , 5, 8, 13 and 16 listed as associated with poor prognosis in Tables 3 and 7, and the prognosis is determined to be good when the genomic profile comprises a genomic gam of all or part of a MCR and/or gene within chromosome 8 listed as associated with good prognosis in Table 6, and/or a loss of one or more MCRs and/or genes within chromosome 6 or 14 listed as associated with good prognosis in Table 8 relative to a control
2 The method of claim 1 wherein the gain comprises a gain all or part of one or more genes listed in Table 11 associated with prognosis
3 The method of claim 2, wherein the gain comprises a gain in all or part of one or more of FGF3, FAM112B, TSFM, NUP107 and/or MDM2
4 The method of claim 1 comprising after step (a) the step (b) comparing the genomic profile with one or more controls
5 The method of claim 1 or 2 wherein the MCR listed as associated with poor prognosis is selected from a MCR listed in Table 10
6 The method of claim 1 or 2, wherein the prognosis is determined to be poor when the genomic profile comprises a gain of all or part of a gene listed in Table 5, 9, and/or 11 associated with poor prognosis and/or comprises a loss of all or part of a gene listed in Table 7, and the prognosis is determined to be good when the genomic profile comprises a gain of all or part of gene listed in Table 6 or a loss of all or part of a gene listed in Table 8 relative to the control.
7. The method of any one of claims 1 to 6, wherein the method of determining a genomic profile comprises: determining a hybridization pattern using one or more chromosomal probes in the biological sample from the subject, wherein the one or more probes hybridze specifically to one or more MCRs and/or genes listed in Tables 1 to 11.
8. The method of claim 7, wherein the gain associated with poor prognosis comprises all or part of a gene listed in Table 5, 9 and/or 11 and/or the loss comprises all or part of a gene listed in Table 7.
9. The method of claim 6 or 7, wherein the gain associated with good prognosis comprises all or part of RAB11 FIP1 and/or the loss associated with good prognosis comprises all or part of a gene listed in Table 8.
10. The method of any one of claims 1 to 9, wherein the control is a control copy number such as centromere copy number or a control gene on the same or different chromosome.
11. The method of claim 1 for predicting tumour responsiveness and/or likelihood of improved survival with chemotherapy comprising: detecting a gain of all or part of a MCR or gene listed in Tables 1 , 2, 5, 9, 10 and/or 11 associated with improved response to chemotherapy, wherein a gain predicts the tumour is responsive to chemotherapy and/or that the subject has improved survival when treated with chemotherapy relative to a subject not treated with chemotherapy.
12. The method of claim 11 , wherein the gain of all or part of one or more of the following genes: MFSD7, D4S234E, ACOX3, SRD5A1 , AQP2, ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, DNMT3B and/or the loss of all or part of one of the following genes: RHOC, ATP2C2, ZDHHC7, COC4I1 , FOXF1 , predicts the tumour is responsive to chemotherapy and/or that the subject has improved survival when treated with chemotherapy relative to a subject not treated with chemotherapy.
13. The method of claim 11 , wherein the gain associated with improved survival with chemotherapy or tumor responsiveness is a gain of all or part of one or more of the genes listed in Table 9 as associated with improved survival with chemotherapy including: BAALC, ANGPT1 , MYC, WISP1 , KRT81 , KRT1 , NEUROD4, and/or PA2G4; and/or a gain of of all or part of one or more of the genes listed in Table 11 as associated with improved survival with chemotherapy including: GUCA2A, PPIH, LEPRE1 , CR623026, C1orf50, DQ515898, DQ515897, MYC FGF3, KRT81 , KRT1 , FAM112B, B4GALNT1 , CENTG1 , BCL11 B.
14. The method of any one of claims 1 to 13, wherein the lung cancer is non-small cell lung cancer (NSCLC), early stage NSCLC, squamous cell carcinoma or adenocarcinoma.
15. The method of claim 1 , comprising detecting the expression level of a gene listed in Table 5, 6, 7, 8, 9 and/or 11 , wherein the expression level of the gene all or partly gained or lost is increased or decreased respectively, relative to a control expression level.
16. The method of claim 1 for determining a lung cancer prognosis in a subject, the method comprising: (a) determining a hybridization pattern of one or more chromosomal probes in a biological sample from the subject, wherein the one or more probes each specific to a region of one or more of chromosomes 1p, 12q, 8q, 11q, 12 q and/or 14q specified in tables 1-11 ; and (b) determining the lung cancer prognosis for the subject based on the hybridization pattern, wherein the prognosis is determined to be poor without chemotherapy when the hybridization pattern indicates a gain of a MCR within the regions of chromosome 12q listed in Tables 1 , 2, 5, 9, 10, and/or 11 relative to a control and/or the prognosis is determined to be good when treated with chemotherapy when the hybridization pattern indicates a gain of a MCR within 1 p, 8q,11q, 12q, and/or 14q listed in Tables 6 and/or 8 and/or 10
17. The method of claim 1 for selecting a treatment regimen for a subject with lung cancer, the method comprising: (a) determining a genomic profile comprising detecting a genomic alteration in one or more genes selected from Table 5, 9 and/or 11 and/or 7 in a biological sample from the subject; (b) selecting a treatment for the subject by comparing the genomic profile with one or more controls, wherein the treatment selected comprises chemotherapy when the genomic profile comprises a gain of all or part of one or more genes associated with improved survival with chemotherapy including the following genes: MFSD7, D4S234E, ACOX3, SRD5A1 , AQP2, ACCN2, SLC11A2, SCN8A, KRT81 , KRT1 , ESPL1 , NPFF, ATP5G2, HOXC11 , NEUROD4, ZBTB39, KIAA0286, INHBE, MARS, B4GALNT1 , TSFM, DNMT3B, BAALC, ANGPT1 , MYC, WISP1 , KRT81 , KRT1 , NEUROD4, PA2G4, GUCA2A, PPIH, LEPRE1 , CR623026, C1orf50, DQ515898, DQ515897, MYC FGF3, KRT81 , KRT1 , FAM112B, B4GALNT1 , CENTG1 , and/or BCL11 B; and/or a loss of all or part of one or more genes associated with improved survival with chemotherapy including the following genes: RHOC, ATP2C2, ZDHHC7, COC4I1 , FOXF1 relative to the control and/or wherein the treatment comprises a non-chemotherapy treatment and/or a non-platinum analog, a vinca alkyloid or a combination thereof chemotherapy treatment, when the genomic profile comprises a gain of all or part of one or more of AK024870 and CPSF6.
18. The method of claim 1 or 17, wherein the biological sample is selected from the group consisting of lung tissue, lung cells, lung biopsy and sputum, including formalin fixed, paraffin embedded and fresh frozen specimens.
19. The method of claim 7, wherein determining the hybridization pattern comprises hybridizing one or more chromosomal probes to the biological sample, and detecting the presence or absence of hybridized probe.
20. The method of claim 19, wherein the set of chromosomal probes is comprised in an array and/or the probes are labeled, optionally wherein the probes are fluorescently labeled.
21. The method of claim 1 for determining a lung cancer prognosis in a subject, the method comprising: detecting the presence of a genomic alteration at a locus identified in Tables 1 to 11 in a biological sample from the subject, wherein the prognosis is determined to be poor in the absence of chemotherapy when a gain of a MCR and/or gene listed in Tables 1 , 2, 5, 9, 10 or 11 and/or a loss of a MCR and/or gene listed in Table 3 and/or 7 is detected; and the prognosis is determined to be good when a gain of a MCR and/or gene listed in Table 6 and/or loss of a MCR and/or gene in Table 8 is detected relative to a control.
22. The method of claim 1 or 19, wherein the genomic alteration detected comprises all or part of a MCR and/or gene listed in Table 11.
23. The method of claim 20 wherein the MCR detected is comprised in the one or more regions of chromosome 12q specified in Tables 1-11.
24. The method of claim 19 wherein all or part of one or more genes from Table 11 signficnalty associated with survival with or without survival is detected
25. The method of claim 1 for predicting response to a chemotherapeutic treatment in a subject with lung cancer comprising determining the presence or absence of a gain or loss of all or part of a MCR land/or gene isted in Tables 1 to 11 , predicting the response to the chemotherapeutic according to the presence or absence of the MCR and/or gene gain or loss compared to a control, wherein detecting a MCR and/or gene associated with improvement with chemotherapy predicts chemotherapy will be efficacious, for example will improve survival and wherein detecting a MCR and/or gene not associated with improvement with chemotherapy predicts no response to chemotherapy.
26. The method of any one of claims 1 to 25, wherein the genomic alteration, MCR and/or gene gain or loss is determined by array CGH, FISH, chromagen in situ hybridization (CISH) or PCR.
27. The method of claim 1 for determining a likelihood of improved survival in a lung cancer subject who was or is receiving a chemotherapeutic treatment, comprising determining the presence or absence of a gain or loss of all or part of a MCR and/or gene associated with improvement with chemotherapy, predicting the likelihood of improved survival according to the presence or absence of the MCR or gene gain or loss compared to a control, wherein detecting a MCR and/or gene associated with improvement with chemotherapy predicts likelihood of improved survival compared to a control having the same gain or loss who has not received and/or is not receiving chemotherapy.
28. The method of claim 27 wherein the presence of a gain or loss associated with improvement with chemotherapy is indicative of a favourable predisposition of the subject to respond to platinum analogs, vinca alkaloids and/or a combination thereof.
29. The method of claim 1 , 17 or 27 for treating a subject with lung cancer comprising determining the presence or absence of a gain or loss of a MCR or gene associated with improvement with chemotherapy in a subject with lung cancer and administering chemotherapy to a subject with at least one gain or loss associated with improvement with chemotherapy.
30. The method of claim 17 or 29 wherein the chemotherapy is a platinum analog, a vinca alkaloid or a combination thereof.
31. The method of claim 30 wherein the platinum analog is selected from cisplatin, paraplatin, carboplatin, oxaliplatin and satraplatin in either IV or oral form.
32 The method of claim 30 wherein the vinca alkyloid is selected from vinorelbine, vincristine, vinblastine, vindesine and vinflunine in either IV or oral form
33 A composition comprising a detection agent for detecting the presence or absence of a MCR and/or gene gain or loss associated with prognosis.wherein the detection agent comprises a hybridization probe, or a primer and/or a primer pair for amplifying one or more genomic alterations listed in Tables 1 to 11 for use in the method of any one of claims 1 to 32
34 The composition of claim 33 comprising a chromosomal probe or a gene expression probe, an oligonucleotide probe or a BAC clone
35 The composition of claim 34 wherein the probe comprises at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, or 500 contiguous nucleotides hybπdizable and/or complementary to a gene listed in Table 5, 6 7, 8, 9 and/or 11 , or a genomic region alteration such as a MCR and/or region flanking a MCR described herein, for example in Tables 1 , 2, 3, 4 and/or 10 and/or comprises at least 90, 95, 96, 97, 98, 99, 99 5, 99 9% identityl to at least 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 400, or 500 contiguous nucleotides of a gene listed in Table 5, 6, 7, 8, 9 and/or 11 , and/or a MCR and/or region flanking a MCR described herein, for example in Table 1 , 2, 3 4 and/or 10
36 The composition of claim 35 wherein the BAC clone comprises all or part of one or more MCRs or genes listed in Tables 1 to 11 and optionally is selected from Table 13
37 The composition of claim 33 wherein the probe is useful for array CGH, FISH, and/or CISH
38 The composition of claim 33 wherein the primer or primer pair of claim wherein the primer or primer pair is selected from Table 12 for amplifying all or part of a MCR and/or a gene and/or gene expression product listed in Tables 1-11
39.A kit for determining lung cancer prognosis and/or tumour responsiveness according to any one of claims 1 to 32 in a subject, the kit comprising a detection agent optionally a of chromosomal probe, wherein the one or more probes comprises a probe to a MCR and/or gene listed in Tables
I to 11.
40. The kit of claim 39, wherein the detection agent comprises one or more gene expression probes, or a set of probes specific for a gene expression product of a gene listed in Tables 5, 6, 7, 8, 9 and/or 11.
41. The kit of claim 39 or 40, wherein the probes are labeled, optionally wherein the probes are fluorescently labeled.
42. The kit of any one of claims 39 to 41 , wherein the probes are comprised in an array on a solid support.
43. The kit of claim 39 comprising a reagent for FISH analysis of a MCR or gene gain or loss described herein, for example, the kit comprises a probe for a MCR or gene gain or loss listed in any one of Tables 1 to 11 and labeling reagents for labeling the probe.
44. The kit of claim 39 comprising a reagent for CGH analysis of a MCR or gene gain or loss listed in any one of Tables 1 to 11 , for example, the kit comprises an array with one or more probes for one or more MCRs or genes gained or lost described herein and labeling reagents for labeling the subject sample DNA.
45. The kit of claim 39 comprising a reagent for PCR such as quantitative or multiplex PCR, for example the kit comprises a primer set for amplifying all or part of a MCR or gene listed in any one of Tables 1 to
I I associated with prognosis, optionally comprising one or more of the primers listed in Table 12.
46. The method of claim 1 wherein the method comprises (a) determining a hybridization pattern of a chromosomal probe or a set of chromosomal probes in a biological sample from the subject, wherein the probe or probeset is targeted to all or part of one or more MCRs listed in the provided tables, including but not limited to NRG4 on the short arm of chromosome 1 (1 p), NRG58 on 8q, NRG74 on 11q, NRG79 on 12q, NRG80 on 12q, NRG81 on 12q, NRG82 on 12q, and/or NRG89 on 14q; (b) determining the prognosis and/or predicting the response to chemotherapy for a patient with lung cancer based on the hybridization pattern, wherein the prognosis is determined to be poor without chemotherapy when the hybridization pattern indicates a gain of DNA copy number at an MCR on 11q and/or a gain at an MCR on 12q and/or a gain at an MCR on 14q relative to a control; and/or the prognosis is determined to be good when treated with chemotherapy when the hybridization pattern indicates a gain of DNA copy number within an MCR on 1p and/or 8q and/or 11q and/or 12q and/or 14q.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/265,583 US20120141603A1 (en) | 2009-04-21 | 2010-04-21 | Methods and compositions for lung cancer prognosis |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17135609P | 2009-04-21 | 2009-04-21 | |
| US61/171,356 | 2009-04-21 | ||
| US17168709P | 2009-04-22 | 2009-04-22 | |
| US61/171,687 | 2009-04-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010121380A1 true WO2010121380A1 (en) | 2010-10-28 |
Family
ID=43010639
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CA2010/000619 Ceased WO2010121380A1 (en) | 2009-04-21 | 2010-04-21 | Methods and compositions for lung cancer prognosis |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20120141603A1 (en) |
| WO (1) | WO2010121380A1 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2494076A4 (en) * | 2009-10-26 | 2013-04-24 | Abbott Lab | Detection of chromosomal abnormalities associated with prognosis of non small cell lung cancer |
| WO2013183964A1 (en) * | 2012-06-07 | 2013-12-12 | 한양대학교 산학협력단 | Target protein for diagnosing and treating lung cancer |
| WO2016153434A1 (en) * | 2015-03-24 | 2016-09-29 | Agency For Science, Technology And Research (A*Star) | Normalization methods for measuring gene copy number and expression |
| CN106282347A (en) * | 2016-08-17 | 2017-01-04 | 中南大学 | HoxC11 as biomarker preparation adenocarcinoma of lung pre-diagnostic reagent in application |
| CN107723354A (en) * | 2017-08-23 | 2018-02-23 | 广州永诺健康科技有限公司 | A kind of multiple PCR primer, kit and method based on high-flux sequence detection non-small cell lung cancer oncogenic mutation |
| CN109680063A (en) * | 2019-01-04 | 2019-04-26 | 宋现让 | A kind of kit for early stage of lung cancer diagnosis and First-line chemotherapy reaction assessment early warning |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TWI449791B (en) * | 2011-07-05 | 2014-08-21 | Univ Nat Taiwan | Method for predicting response or prognosis of lung adenocarcinoma with egfr-activating mutations |
| US11408887B2 (en) | 2017-05-22 | 2022-08-09 | The National Institute for Biotechnology in the Negev Ltd. | Biomarkers for diagnosis of lung cancer |
| CN109837340B (en) * | 2017-11-24 | 2023-01-10 | 顾万君 | Peripheral blood gene marker for noninvasive diagnosis of lung cancer |
| CN111269983A (en) * | 2020-02-21 | 2020-06-12 | 深圳市众循精准医学研究院 | FISH detection method, probe and kit for bladder cancer gene amplification |
| CA3201466A1 (en) | 2020-12-14 | 2022-06-23 | Regeneron Pharmaceuticals, Inc. | Methods of treating metabolic disorders and cardiovascular disease with inhibin subunit beta e (inhbe) inhibitors |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2402320A1 (en) * | 2000-03-31 | 2001-10-11 | Abbott Molecular Inc. | Patient stratification for cancer therapy based on genomic dna microarray analysis |
| US20050112141A1 (en) * | 2000-08-30 | 2005-05-26 | Terman David S. | Compositions and methods for treatment of neoplastic disease |
| WO2006128195A2 (en) * | 2005-05-27 | 2006-11-30 | Dana-Farber Cancer Institute | Methods of diagnosing and treating cancer by detection of chromosomal abnormalities |
| EP2093566A1 (en) * | 2008-02-21 | 2009-08-26 | Pangaea Biotech, S.A. | Method for the prognosis of non-small cell lung cancer |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB9805918D0 (en) * | 1998-03-19 | 1998-05-13 | Nycomed Amersham Plc | Sequencing by hybridisation |
-
2010
- 2010-04-21 US US13/265,583 patent/US20120141603A1/en not_active Abandoned
- 2010-04-21 WO PCT/CA2010/000619 patent/WO2010121380A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2402320A1 (en) * | 2000-03-31 | 2001-10-11 | Abbott Molecular Inc. | Patient stratification for cancer therapy based on genomic dna microarray analysis |
| US20050112141A1 (en) * | 2000-08-30 | 2005-05-26 | Terman David S. | Compositions and methods for treatment of neoplastic disease |
| WO2006128195A2 (en) * | 2005-05-27 | 2006-11-30 | Dana-Farber Cancer Institute | Methods of diagnosing and treating cancer by detection of chromosomal abnormalities |
| EP2093566A1 (en) * | 2008-02-21 | 2009-08-26 | Pangaea Biotech, S.A. | Method for the prognosis of non-small cell lung cancer |
Non-Patent Citations (3)
| Title |
|---|
| COATE, L.E. ET AL.: "Molecular predictive and prognostic markers in non-small-cell lung cancer.", THE LANCET ONCOLOGY., vol. 10, no. 10, 2009, pages 1001 - 1010 * |
| DEHAN, E. ET AL.: "Chromosomal aberrations and gene expression profiles in non-small cell lung cancer.", LUNG CANCER., vol. 56, no. 2, 2007, pages 175 - 184 * |
| TAI, A.L.S. ET AL.: "Co-overexpression of Fibroblast Growth Factor 3 and Epidermal Growth Factor Receptor is correlated with the development of nonsmall cell lung carcinoma.", CANCER., vol. 106, no. 1, 2006, pages 146 - 155 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2494076A4 (en) * | 2009-10-26 | 2013-04-24 | Abbott Lab | Detection of chromosomal abnormalities associated with prognosis of non small cell lung cancer |
| US9752196B2 (en) | 2009-10-26 | 2017-09-05 | Abbott Molecular Inc. | Detection of chromosomal abnormalities associated with prognosis of non small cell lung cancer |
| WO2013183964A1 (en) * | 2012-06-07 | 2013-12-12 | 한양대학교 산학협력단 | Target protein for diagnosing and treating lung cancer |
| WO2016153434A1 (en) * | 2015-03-24 | 2016-09-29 | Agency For Science, Technology And Research (A*Star) | Normalization methods for measuring gene copy number and expression |
| CN106282347A (en) * | 2016-08-17 | 2017-01-04 | 中南大学 | HoxC11 as biomarker preparation adenocarcinoma of lung pre-diagnostic reagent in application |
| CN107723354A (en) * | 2017-08-23 | 2018-02-23 | 广州永诺健康科技有限公司 | A kind of multiple PCR primer, kit and method based on high-flux sequence detection non-small cell lung cancer oncogenic mutation |
| CN107723354B (en) * | 2017-08-23 | 2021-09-07 | 广州永诺健康科技有限公司 | A multiplex PCR primer, kit and method for detecting oncogene mutations in non-small cell lung cancer based on high-throughput sequencing |
| CN109680063A (en) * | 2019-01-04 | 2019-04-26 | 宋现让 | A kind of kit for early stage of lung cancer diagnosis and First-line chemotherapy reaction assessment early warning |
Also Published As
| Publication number | Publication date |
|---|---|
| US20120141603A1 (en) | 2012-06-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20120141603A1 (en) | Methods and compositions for lung cancer prognosis | |
| US10597729B2 (en) | Use of gene expression profiling to predict survival in cancer patient | |
| JP4938672B2 (en) | Methods, systems, and arrays for classifying cancer, predicting prognosis, and diagnosing based on association between p53 status and gene expression profile | |
| Sircoulomb et al. | Genome profiling of ERBB2-amplified breast cancers | |
| Piscuoglio et al. | Integrative genomic and transcriptomic characterization of papillary carcinomas of the breast | |
| Fabris et al. | Molecular and transcriptional characterization of 17p loss in B‐cell chronic lymphocytic leukemia | |
| Kim et al. | Recurrent genomic alterations with impact on survival in colorectal cancer identified by genome-wide array comparative genomic hybridization | |
| US20100316629A1 (en) | Use of gene expression profiling to predict survival in cancer patient | |
| US20160024591A1 (en) | Methods and compositions for correlating genetic markers with risk of aggressive prostate cancer | |
| CN105431738A (en) | Method for manufacturing gastric cancer prognosis prediction model | |
| KR20180108820A (en) | Genetic profiling of cancer | |
| US7741035B2 (en) | Use of gene expression profiling to predict survival in cancer patient | |
| WO2016014941A1 (en) | Method to diagnose malignant melanoma in the domestic dog | |
| WO2014173905A2 (en) | Methods and kits for prognosis of stage i nsclc by determining the methylation pattern of cpg dinucleotides | |
| CN111194356A (en) | Methods for the detection of plasma cell cachexia | |
| US7939255B2 (en) | Diagnostic methods for colorectal cancer | |
| EP4619544A1 (en) | Method for determining microsatellite instability status, kits and uses thereof | |
| JP2014501496A (en) | Signature of clinical outcome in gastrointestinal stromal tumor and method of treatment of gastrointestinal stromal tumor | |
| KR100759288B1 (en) | Diagnosis of Lung Cancer and Subtypes of Lung Cancer Using Comparative Genetic Technique | |
| Nakagomi et al. | Genome-wide DNA methylation profiling of pleomorphic carcinoma of the lung | |
| WO2017061953A1 (en) | Invasive ductal carcinoma aggressiveness classification | |
| JPWO2006112483A1 (en) | Method for diagnosing disease type and prognosis of diffuse large B-cell lymphoma | |
| Pariyar et al. | Gene expression, copy number variation and DNA methylation associated with disease outcome in triple negative breast cancer | |
| Isidori | Addressing tumor heterogeneity in esophageal adenocarcinoma through different molecular approaches | |
| Ruosaari | Microarrays in Lung Cancer Research: From Comparative Analyses to Verified Findings |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10766566 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13265583 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10766566 Country of ref document: EP Kind code of ref document: A1 |



































