WO2010102380A1 - Potent vegf antagonists - Google Patents
Potent vegf antagonists Download PDFInfo
- Publication number
- WO2010102380A1 WO2010102380A1 PCT/CA2010/000275 CA2010000275W WO2010102380A1 WO 2010102380 A1 WO2010102380 A1 WO 2010102380A1 CA 2010000275 W CA2010000275 W CA 2010000275W WO 2010102380 A1 WO2010102380 A1 WO 2010102380A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- vegf
- seq
- residue
- amino acid
- xaa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention relates to vascular endothelial growth factor (VEGF) antagonists More specifically, the present invention relates to VEGF antagonists that reduce signal transduction by VEGF receptors
- VEGFs Vascular endothelial growth factors
- VEGF-A has been identified as playing a central role in angiogenesis
- Numerous naturally-occurring isoforms of this glycoprotein have been identified, including predominant isoforms comprising 121 , 145, 165, 189, and 206 amino acids
- the isoforms share a common N-termtnus, but differ at the C-terminus
- the VEGF-A isoforms share the same basic effects on vascular endothelium, however they may differ in their physical properties and abilities to bind VEGFR co-receptors Consequently, the different VEGF-A isoforms can vary in their in vivo bioactivities
- VEGF-A 105 has been extensively studied and has been identified in playing a central role in vascular development accompanying cancers, chronic inflammatory diseases, and other human pathologies This type of endothelial cell proliferation and angiogenesis is referred to as pathological angiogenesis ' It has been shown that VEGF-A 105 alone can induce the proliferation of endothelial cells and formation of new blood vessels in pathological angiogenesis
- VEGF-A 165 b Due to the role of VEGFs and VEGFRs in human pathologies, antagonism of VEGFR signal transduction and/or homeostatic abilities has been an area of intense research Different approaches have been used to inhibit or modulate the interaction of VEGF with VEGFR, one being production of VEGF mutants that bind the VEGFR without allowing its activation
- VEGF-A 165 b has such properties (Bates et al (2002), Harper & Bates (2008), Bates et al, US Patent Application Publication No 2005/0054036)
- VEGF-A 165 b differs from VEGF-Ai 6S by its C-terminal 6 amino acids, specifically, the VEGF- A 165 C-terminus comprises CDKPRR (residues 160-165, SEQ ID NO 1 ), while VEGF-A 165 b comprises SLTRKD (SEQ ID NO 2)
- CDKPRR deoxyribonucleic acid
- VEGF-A 165 b comprises SLTRKD (SEQ ID NO 2)
- the loss of Cys160 impairs the formation of an intra- chain disulfide bond between residues 146 and 160 present in the wild-type molecule
- the DKPRR motif of VEGF-A shown to bind to neurop ⁇ l ⁇ n-1 (Cebe-Suarez et al (2008)), is not present in VEGF-A 165 b Cebe-Suarez et al (2006, 2008), Harper and Bates (2008), and Jia et al (2006) indicate that Cys160 is
- VEGF-A 165 b may show promise in anti-angiogenesis therapies, protein stability could be affected and aggregation of the VEGF-A 165 b following disulfide bond formation (at Cys 146) with itself or other proteins could result Additionally, it was recently shown that this variant still partially activate the VEGFR2 receptor (Kawamura et al (2008))
- the present invention provides an improved VEGF antagonist
- the present VEGF are surprising in that they retain Cys160 while exhibiting antagonistic activity
- the present invention provides a VEGF antagonist based on the sequence of VEGF-A 165 and comprising a mutation at residue 159, 161 , 162, 163, 164, 165, or a combination thereof and wherein the Cys at residue 160 is retained
- the wild-type sequence of VEGF-A 165 upon which the mutant is based may comprise the sequence shown in SEQ ID NO 3
- the VEGF antagonist of the present invention shows improved anti-angiogenic activity compared to VEGF-A 165 D
- the mutant shows improved protein stability and lower aggregation compared to VEGF-A 165 b
- the intact disulfide bond also allows the mutant to retain a more wild-type structural conformation, thus minimizing an immunogenic response Additionally, it is also presently shown that the VEGF mutant of the present invention shows less activation of VEGFR2
- FIGURE 1 shows the sequence alignment of VEGF-A 165 (SEQ ID NO 3), VEGF-A 165 b (SEQ ID NO 4), VEGF-A 165 BRI (SEQ ID NO 5), VEGF-A 165 C (SEQ ID NO 6), VEGF-A 165 d (SEQ ID NO 7), VEGF-A 165 e (SEQ ID NO 8),VEGF-A 165 f (SEQ ID NO 9) and VEGF-A 165 g (SEQ ID NO 10) Amino acid differences compared to the VEGF-A 165 are shown in bold and underlined
- FIGURE 2 is a SDS-PAGE gel showing purified fractions of VEGF165 mutants Lanes 1- VEGF-A 165 b, 2- VEGF-A 165 BRI, 3- VEGF-A 165 C, 4- VEGF-A 165 d, 5- VEGF-A 165 e, and 6- VEGF-A 165 f
- FIGURE 3 shows the effect of VEGF-A 165 and VEGF-A 165 BRI on VEGFR2 (Flk-1 ) phosphorylation and ERK activation As shown, VEGF-A 165 BRI does not activate VEGFR2, but does activate ERK phosphorylation in HUVEC cells
- FIGURE 4 is a bar graph showing results of VEGFR2 phosphorylation quantification by scanning densitometry
- VEGF-A 165 BRI appears to antagonize VEGF-A 165 with potency similar to VEGF-A 165 b in HUVEC cells
- VEGF-A 165 b * and VEGF-A 165 BRI were produced by transfection of HEK293 cells and purified as described in the Examples, while VEGF-A 165 b ** was obtained from R & D Systems
- FIGURE 5 is a Western blot showing the inhibition of endogenous ERK activity in HBEC AB from microcapillary fraction (20 ⁇ m) by VEGF-A 165 BRI (FIGURE 5A) and VEGF-Ai 65 b
- FIGURE 5A lanes 1 - Control, 2- VEGF- A 165 BRI 5 ng/mL, 3- VEGF-A 165 BRI 25 ng/mL, 4- VEGF-A 165 BRI 100 ng/mL 5- VEGF- A 165 BRI 200 ng/mL, 6- VEGF-A 160 BRI 400 ng/mL
- FIGURE 5B lanes 1- Control, 2- VEGF- A 165 b 5 ng/mL, 3- VEGF-A 165 D 25 ng/mL, 4- VEGF-A 165 D 100 ng/mL, 5- VEGF-A 165 D 200 ng/mL, 6- VEGF-A 165 D 400 ng/mL
- FIGURE 6 is a Western blot showing the inhibition of VEGF-A 165 -mduced ERK activation in HBEC AB from microcapillary fraction (20 ⁇ m) by VEGF-A 165 BRI and VEGF-A 165 b
- VEGF-A 165 BRI is more potent than VEGF-A 165 b at blocking ERK activation by VEGF 165
- FIGURE 7 is a Western blot showing the inhibition of endogenous or VEGF-A 16 s-st ⁇ mulated ERK activity in mouse astrocytes by VEGF-A 165 mutants
- Results show that all mutants prepared inhibits VEGF-induced ERK activation in mouse astrocytes, but mutants 'c' and "d" have the least agonistic activity
- Lanes 1- Control (medium alone), 2- VEGF-A 165 25 ng/ml, 3- VEGF-A 165 C 200 ng/mL, 4- VEGF-A 165 d 200 ng/mL, 5- VEGF-A 165 e 200 ng/mL, 6- VEGF- A 165 f 200 ng/mL, 7- VEGF-A 165 b + VEGF-A 165 25 ng/ml, 8- VEGF-A 165 C + VEGF-A 165 25 ng/ml, 9- VEGF-A 165 d +
- FIGURE 8 shows the elution profile of VEGF-A 165 (FIGURE 8A) and VEGF-A 165 b (FIGURE 8B) from a gel filtration column VEGF-A 16 sb shows formation of oligomers
- FIGURE 9 is an image of a 4-14% Bis-T ⁇ s gels under reducing (FIGURE 9A) and non- reducing (FIGURE 9B) conditions
- Lanes 1 are VEGF-A 165 and lanes 2 are VEGF-A 165 b
- VEGF-A 165 b shows formation of oligomers
- the present invention relates to vascular endothelial growth factor (VEGF) antagonists More specifically, the present invention relates to VEGF antagonists that reduce signal transduction by VEGF receptors
- a VEGF antagonist based on the sequence of VEGF-A 16S comprising a mutation at residue 159, 161 , 162, 163, 164, 165, or a combination thereof, and wherein the Cys at residue 160 is retained.
- the wild-type sequence of VEGF-A 165 upon which the mutant is based may comprise the sequence shown in SEQ ID NO:3.
- the present invention is directed to a VEGF antagonist.
- VEGF antagonist or "vascular endothelial growth factor antagonist” it is meant a polypeptide that shows anti- angiogenic activity.
- the anti-angiogenic activity may be achieved by modulation or inhibition of the action of VEGF and/or VEGFR by the VEGF antagonist; this may be accomplished in any manner of mechanisms.
- the VEGF antagonist may hinder, prevent or block interaction of VEGF to VEGFR; may prevent phosphorylation of the VEGFR; may also prevent binding to/recruitment of neuropilin or HSPGs; or by any other method of action.
- the VEGF antagonist of the present invention is based on the sequence of VEGF-A 16S -
- the sequence of VEGF-A 165 is well-known in the art and may comprise the sequence shown in
- the VEGF antagonist may also include an additional N- or C-terminal sequence to, for example, target protein expression or provide ease of purification; for example, but without wishing to be limiting, the sequence may comprise the VEGF signal peptide MNFLLSWVHWSLALLLYLHHAKWSQA (SEQ ID NO:1 1 ) at the N-terminus of the VEGF antagonist.
- the additional sequence may be, for example and without wishing to be limiting, a His tag (His 5 /His 6 /His 8 /His 10 ). Such additional sequences may be cleaved during synthesis in the cell or may be cleaved after secretion/isolation of the VEGF antagonist.
- the VEGF antagonist while based on the sequence of VEGF-A 165 , comprises a mutation at residue 159, 161 , 162, 163, 164, 165, or a combination thereof.
- Such “mutation” may comprise an amino acid substitution, deletion or addition.
- the newly added or substituent amino acid may be a basic, neutral, hydrophobic, or acidic amino acid.
- basic amino acid it is meant hydrophilic amino acids having a side chain pK value of greater than 7, which are typically positively charged at physiological pH.
- Basic amino acids include histidine (His or H), arginine (Arg or R), and lysine (Lys or K).
- neutral amino acid also “polar amino acid”
- hydrophilic amino acids having a side chain that is uncharged at physiological pH, but which has at least one bond in which the pair of electrons shared in common by two atoms is held more closely by one of the atoms.
- Polar amino acids include serine (Ser or S), threonine (Thr or T), cysteine (Cys or C), tyrosine (Tyr or Y), asparagine (Asn or N), and glutamine (GIn or Q).
- hydrophobic amino acid (also “non-polar amino acid”) is meant to include amino acids exhibiting a hydrophobicity of greater than zero according to the normalized consensus hydrophobicity scale of Eisenberg (1984) Hydrophobic amino acids include proline (Pro or P), isoleucine (lie or I), phenylalanine (Phe or F), valine (VaI or V), leucine (Leu or L), tryptophan (T rp or W), methionine (Met or M) alanine (Ala or A), and glycine (GIy or G) "Acidic amino acid” refers to hydrophilic amino acids having a side chain pK value of less than 7, which are typically negatively charged at physiological pH Acidic amino acids include glutamate (GIu or E), and aspartate (Asp or D)
- VEGF antagonist based on the sequence of VEGF-A 165 and comprising
- the substitution at residue 159 may be, for example, for a isoleucine, glutamate, aspartate, alanine, or glycine, in a non-limiting example, the substitution at residue 159 is for a isoleucine or glutamate
- the substitution at residue 161 may be for a glycine, alanine, lysine or arginine, in a specific, non-limiting example, the substitution at residue 161 is for lysine (SEQ ID NO 8)
- the substitution at residue 162 may be for a glutamate, aspartate, or alanine, for example, but not wishing to be limiting, residue 162 may be mutated to glutamate (SEQ ID NO 6) or alanine (SEQ ID NO 9)
- the substitution at residue 163 may be for a glycine or alanine, in a non-limiting example, residue 163 may be mutated to glycine
- the substitution at residue 164 may be for
- the VEGF antagonist as described above may also comprise a combination of two or more of the mutations listed above
- the VEGF antagonist comprises two mutations at residues 162 and 163, in a further example, the residue at position 162 may be mutated to GIu and the residue at position 163 to GIy (SEQ ID NO 5)
- the VEGF antagonist comprises two mutations at residues 161 and 162, in a further example, the residue at position 161 may be mutated to GIy and the residue at position 162 to Ala (SEQ ID NO 7)
- the VEGF antagonist comprises two mutations at residues 159 and 162, in a further example, the residue at position 159 may be mutated to lie and the residue at position 162 to GIu (SEQ ID NO 10)
- the VEGF antagonist may comprise a glutamate residue at positions 159 and 162
- the VEGF antagonist of the present invention also includes polypeptides that are substantially identical to the VEGF antagonist described herein
- the substantially identical polypeptide may comprise one or more conservative amino acid mutation, provided the C-terminal 6 amino acids remain unchanged ( ⁇ e , none of the conservative amino acid mutations are found in the 6 C-terminal amino acids)
- one or more conservative amino acid mutation to a reference protein may yield a mutant protein with no substantial change in physiological, chemical, or functional properties compared to the reference protein, in such a case, the reference and mutant proteins would be considered "substantially identical" polypeptides
- Conservative amino acid mutation may include addition, deletion or substitution of an amino acid, a conservative amino acid substitution is defined herein as the substitution of an amino acid residue for another amino acid residue with similar chemical properties (e g size, charge, or polarity)
- the VEGF antagonist of the present invention also encompasses substantially identical proteins comprising one or more conservative amino acid mutation, provided these mutations are not within the 6 C-terminal amino acids, provided the Cys at position
- Sequence identity is used to evaluate the similarity of two sequences, it is determined by calculating the percent of residues that are the same when the two sequences are aligned for maximum correspondence between residue positions Any known method may be used to calculate sequence identity, for example, computer software is available to calculate sequence identity Without wishing to be limiting, one can use NCBI BLAST2 service maintained by the Swiss Institute of Bioinformatics, and as found at http Ilea expasy orq/tools/blast/
- the substantially identical sequences of the present invention may be at least 85% identical, in another example, the substantially identical sequences may be at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous at the amino acid level to sequences described herein
- the VEGF antagonists of the present invention shows equal or improved anti-angiogenic activity compared to VEGF-A 165 D Additionally, because the Cys146-Cys160 disulfide bridge is intact in the present VEGF
- VEGF-A 166 BRI polypeptide is a more potent antagonist than VEGF-A-
- This agonist-to-antagonist conversion is not due to the disappearance of C160, nor to the R164K and R165D mutations, as proposed by Cebe-Suarez et al (2008) and Harper and Bates (2008), but rather is due to the mutation at position 162 (to T or E in the case of VEGF-A 165 b and VEGF-A 165 BRI, respectively)
- the residue at position 162 may play a role in interaction of VEGF with neurop ⁇ l ⁇ n-1 , or for bringing VEGFR2 together with neurop ⁇ l ⁇ n-1 in a proper orientation for full activation of the signalling pathway, other residues may also play a role in these interactions, such as D161 and R159
- VEGF-A 16 sb the natural splice variant which has 6 mutations at the C-terminus, including a C160S mutation
- VEGF-A 16 sb the natural splice variant which has 6 mutations at the C-terminus, including a C160S mutation
- the present is a more systematic approach to conferring antagonist activity, leading to a better and more stable antagonist
- the VEGF antagonist of the present invention may retain a wild-type like structure at its C-terminus
- the present invention also encompasses nucleic acid sequences encoding the VEGF antagonists as described above
- the nucleic acid sequence may be codon-optimized
- the present invention also encompasses vectors comprising the nucleic acids as just described
- the invention encompasses cells comprising the nucleic acid and/or vector as described
- the present invention also provides a method of providing the VEGF antagonist of the present invention to a person in need thereof
- a nucleic acid encoding the VEGF antagonist of the present invention may be administered by injection or through the use of viral delivery systems such as adenovirus, adeno-associated virus, retrovirus, alternatively, the purified VEGF antagonist could be delivered by injection into the person in need thereof
- local implantation of encapsulated cells stably expressing the VEGF antagonist of the present invention can be performed.
- VEGF-A 16S cDNA Codon-optimized (human codon basis) was synthesized by GeneArt and cloned into the pTT5 vector (Shi et al, 2005). All mutants were created by cloning annealed oligonucleotides sequences comprising the mutated sequence between the Sbfl and BamHI sites (underlined) of the VEGF-A 165 cDNA in pTT5 vector as shown below (VEGF-A 165 stop codon is shown in bold):
- VEGF 165 C sense oligo: ⁇ '-GGTGCGACGAGCCCAGGAGGTGAG-S' (SEQ ID NO: 13)
- Antisense oligo ⁇ '-TGCAGGTGCGACGAGCCCAGGAGGTGAGGATC-S' (SEQ ID NO:14)
- VEGF 165 D sense oligo: 5'- GGTGCGGAGCCCCCAGGAGGTGAG-3' (SEQ ID NO:15)
- Antisense oligo 5'- TGCAGGTGCGGAGCCCCCAGGAGGTGAGGATC-3' (SEQ ID NO:16)
- VEGF 165 E sense oligo: 5'- GGTGCAAGAAGCCCAGGAGGTGAG-3' (SEQ ID NO: 17)
- Antisense oligo ⁇ '- TGCAGGTGCAAGAAGCCCAGGAGGTGAGGATC-S' (SEQ ID NO:18)
- VEGF 165 F sense oligo: 5'- GGTGCGACGCCCCCAGGAGGTGAG-3' (SEQ ID NO: 19)
- Antisense oligo 5'- TGCAGGTGCGACGCCCCCAGGAGGTGAGGATC-3' (SEQ ID NO:20)
- the VEGF 165 g mutant is cloned using an annealed oligonucleotide sequence comprising the mutated sequence between the Sbfl and BamHI sites of the VEGF-A 165 cDNA in pTT5 vector as shown below:
- VEGF 165 G sense oligo: 5'- TCTGCGACGAGCCCAGGAGGTGAG-3' (SEQ ID NO:21 )
- Antisense oligo 5'- TGCATCTGCGACGAGCCCAGGAGGTGAGGATC-3' (SEQ ID NO:22)
- SEQ ID NO:22 Example 2 Expression and Purification of VEGF proteins
- VEGF mutants constructs described in Example 1 were expressed and purified for further experimentation
- Human recombinant VEGF (isoform 165b) was from R&D Systems
- Human recombinant VEGF (isoform 165) was produced and purified as described (Labrecque et al , 2004)
- the VEGF mutants (shown in Figure 1 ) were expressed using methods known in the art Briefly, 293-6E cells were cultured in Erlenmeyer flasks using 25% of their nominal volume at 110 rpm under standard humidified conditions (37°C and 5% CO 2 ) in F17 medium (Invitrogen, Grand Island NY) supplemented with 4 mM glutamine, 25 ⁇ g/ml Geneticin 418, and 0 1% Pluronic F-68 Cells were seeded two days prior to transfection at 2 5x10 5 cells/ml in fresh medium at 90% of the final volume Cells were transfected with the pTT5 vectors of Example 1 at a density of 0 8 to 1 2 x10 6 cells/ml The transfection mixture was prepared in 10% of the final volume using F17 medium, 1 mg/L plasmid and 2 mg/L 25 kDa linear polyethylenimine (Polysciences, Wamngton PA) as the transfection vehicle (Durocher et al, 2002
- VEGF mutants were purified by chromatographic techniques All chromatographic operations were performed using an AKTA Explorer 100 (GE Healthcare) controlled by UNICORN software version 5 01 (GE Healthcare)
- AKTA Explorer 100 GE Healthcare
- UNICORN software version 5 01 GE Healthcare
- the clarified supernatant was acidified to pH 4 0 by dropwise addition of 12 N HCI Acid precipitate was removed by cent ⁇ fugation followed by filtration under vacuum using a 0 45 ⁇ m filter (Millipore)
- the supernatant was loaded onto Fractogel EMD SO3 650 (M) (EMD) packed in an XK16/20 column (GE Healthcare) equilibrated with wash buffer (100 mM sodium acetate / acetic acid, 80 mM NaCI, pH 4 0)
- wash buffer 100 mM sodium acetate / acetic acid, 80 mM NaCI, pH 4 0
- the column was washed with 5 column volumes (CV) of wash buffer followed by 10 CV of 600
- Human umbilical vein endothelial cells were exposed to either VEGF-Ai 65 or VEGF-A 165BR i to evaluate their effects on VEGFR2 phosphorylation and ERK activation
- HUVECs were purchased from Clonetics (San Diego, CA) and maintained in EC basal med ⁇ um-2 (EBM-2) supplemented with EGM-2 Mv growth factor mixture (Clonetics) The cells were cultured at 37 0 C under a humidified 95%/5% (v/v) mixture of air and CO 2 For experimental purposes, cells were plated in 100 mm plastic dishes at 5000 cells/cm 2 and were grown to confluence before overnight serum starvation without supplements Cells were treated with VEGF-A 165 or VEGF-A 165B RI
- HUVEC cells were treated with VEGF-A 165 (50 ng/ml) or 50-200 ng/ml of VEGF-A 165B RI using previously described methods (Gingras et al, 2000) Cells were then washed once with ice- cold PBS (pH 7 4) containing 1 mM Na 3 VO 4 and were incubated in the same medium for 1 h at 4°C The cells were solubiiised on ice in lysis buffer (150 mM NaCI, 10 mM Tris-HCI (pH 7 4), 1 mM EDTA, 1 mM EGTA, 0 5% (v/v) Nonidet P-40 and 1 % (v/v) Triton X-100) containing 1 mM Na 3 VO 4 Lysates were clarified by centrifugation at 10 000 g for 10 mm, and the resulting supernatants were used for VEGFR-2 immunoprecipitation overnight with 1 mg/ml of ant
- the immunoreactive phospho-VEGFR2 bands obtained as described above were quantified by scanning densitometry (Molecular Dynamics, Sunnyvale, CA). PTK (ACC Corp, San Diego CA) was used at 1 ⁇ M as a positive control to inhibit VEGFR2 activation.
- the results, shown in Figure 4, indicate that VEGF-A 165BR ⁇ has higher antagonistic activity (VEGFR2 activation) compared to that of VEGF-A 165b .
- HBECs Human brain endothelial cells
- HBECs were obtained from small intracortical microvessels and capillaries (1 12-20 ⁇ m) harvested from temporal cortex surgically excised from patients treated for idiopathic epilepsy. Tissues were obtained with approval from the Institutional Research Ethics Committee.
- HBECs were separated from smooth muscle cells with cloning rings and grown at 37 0 C in HBEC media containing Earle's salts, 25 mM 4-(2-hydroxyethyl)-1- piperazineetahanesulfonic acid (HEPES), 4.35 g/L sodium bicarbonate, and 3 mM L- glutamine, 10% FBS, 5% human serum, 20% of media conditioned by murine melanoma cells (mouse melanoma, Cloudman S91 , clone M-3, melanin-producing cells), 5 ⁇ g/ml insulin, 5 ⁇ g/ml transferrin, 5 ng/ml selenium and 10 ⁇ g/ml endothelial cell growth supplement.
- EPES 4-(2-hydroxyethyl)-1- piperazineetahanesulfonic acid
- HBEC cultures were routinely characterized morphologically and biochemically. More than 95% of cells in culture stained immunopositive for the selective endothelial markers, angiotensin ll-converting enzyme and Factor Vlll-related antigen, incorporated fluorescently labeled Ac-LDL, and exhibited high activities of the blood-brain barrier-specific enzymes, ⁇ -glutamyltranspeptidase and alkaline phosphatase.
- HBECs were rinsed three time with DME before applying different concentrations (5-400 ng/ml) of either VEGF-AI 65B RI or VEGF-A 165b for 10 min.
- ristocetin-induced platelet agglutination lysis buffer 1%NP-40 (IGEPAL, lysis buffer, Sigma-Aldrich), 0.5% deoxycholate, 0.1% sodium dodecyl sulfate and protease inhibitor 100 ⁇ L/10 mL ristocetin- induced platelet agglutination in PBS), (Sigma-Aldrich) for 30 min at 4 0 C.
- the cell lysates were centrifuged at 700 g for 30 min at 4°C, and the supematants were collected.
- Protein concentration was measured in each of the ceil lysates by Bicinchoninic Acid Protein Assay Reagent Kit (Pierce Biotechnology, Rockford, IL, USA), and 15 ⁇ g of protein was denatured in protein loading buffer for 5 min at 100 0 C, and then separated on a 10% sodium dodecyl sulfate-polyacrylamide gel. Separated proteins were then transferred to polyvinylidene difluoride membranes.
- Blocking was performed by incubating membranes in Tris-buffered saline with Tween 20 (TBST) (20 mM Tris-buffer (pH 8.0) and 150 mM NaCI with 0.1 % Tween 20) containing 5% BSA (Sigma-Aldrich) for 1 h at 21 0 C. Membranes were then incubated overnight at 4 0 C with primary antibodies against p44/42 MAPK (Cell Signaling Technology, Beverly, MA, USA) diluted 1/1000 in TBST containing 5% BSA.
- Tween 20 Tween 20
- BSA Sigma-Aldrich
- the membranes were washed with TBST and incubated for 1 h with anti-rabbit IgG (whole molecule)-peroxidase antibody (Sigma-Aldrich) diluted 1/5000 in TBST containing 5% skimmed milk. Immunoreactive proteins were visualized by Amersham enhanced chemiluminescence plus western blotting detection reagents (GE Healthcare, Buckinghamshire, UK).
- VEGF-A- I65BRI (left panel), while Figure 5B (right) shows increasing concentrations of VEGF- A 165b ; ERK phosphorylation was revealed by western lot as described above.
- VEGF-Ai 6S 25 ng/ml was added to the cells following their pre-incubation for 15 minutes in the absence or presence of 200 ng/mi of VEGF-A 165B RI or VEGF-A 16Sb - ERK phosphorylation was revealed by western blot, as described above, 10 minutes after VEGF- A 165 addition. Results are shown in Figure 6. VEGF-A 165B R I appears more potent than VEGF- A 165b at blocking ERK activation by VEGF-A 165 .
- Example 5 Effect of VEGF-A 165 , VEGF-A 165b and VEGF-A 165 mutants on ERK Activation in Mouse Astrocytes
- Mouse astrocytes were exposed to VEGF-A 165 , VEGF-A 165 b, or one of the mutants described in Example 2 to evaluate their effects on ERK activation.
- the cerebellum, and the olfactory bulbs were removed and brain cortices (four brains per isolation) were homogenized by passing through sequentially smaller gauge needles (18G 1 1/2, 23G 3/4, and 25G 5/8).
- Dispase (12 img/mL, Sigma-AIdrich) in DMEM was added to the homogenate, and incubated at 37°C for 15 min. After incubation, the homogenate was filtered through a 53 mm Nitex filter (Sefar Canada Inc., Scarborough, ON, Canada) and then centrifuged at 4°C for 10 min at 700 g.
- the peilet was resuspended in astrocyte media containing 10% heat-inactivated fetal bovine serum (FBS; Hycione, Logan, UT, USA), 1X antibiotic- antimycotic, and DMEM, and the cells were plated on poly-L-lysine (Sigma-AIdrich) coated 75 cm 2 culture flasks. After 3 days, cells were rinsed 3X with warm Hank's buffered salt solution (HBSS) (Sigma-AIdrich) and fed every 3-4 days thereafter. Cells were kept in culture in an atmosphere of 5% CO 2 /95% air at 37°C. Experiments were performed using astrocytes from the first passage only. The purity of astrocyte cultures (> 99%) was confirmed by positive immunostaining with a rabbit anti-glial fibrillary acidic protein (GFAP) polyclonal antibody (Dako, Hamburg, Germany).
- GFAP rabbit anti-glial fibrillary acidic protein
- VEGF-A 1 6 5 Ceils were incubated for 10 minutes in the presence of 200 ng/ml of VEGF-A 1 6 5 , VEGF- A 165 C, VEGF-A 165 d, VEGF-A 165 e, or VEGF-A 165 f; other cells were pre-incubated with VEGF- A 165 b, VEGF-A 165 C, VEGF-A 165 d, VEGF-A 165 e, or VEGF-A 165 f, then challenged for 10 minutes with 25 ng/ml of VEGF-A 165 .
- ERK phosphorylation was revealed by western blot as described in Example 4. This experiment was done in duplicate, and results are show in Figure 7 (upper and lower panels). Results indicate that mutants VEGF-A 16 sC and VEGF- A 16S d have the least agonistic activity.
- the degree of aggregation of the purified VEGF-A 165 and VEGF-A 165b proteins was analysed by gel filtration chromatography.
- VEGF 165b shows significantly higher amounts of oligomers migrating with an apparent Mr of -1 13 kDa ( Figure 8B) compared to VEGF 165 ( Figure 8A).
- VEGF-A 165 and VEGF-A 165b were further analyzed by SDS-PAGE.
- Samples of VEGF-A 165 (lanes 1 ) and VEGF-A 165b (lanes 2) were resolved on 4-14% Bis-Tris gels under reducing ( Figure 9A) or non-reducing ( Figure 9B) conditions and stained with Coomassie blue R-250 using known methods; 10 ⁇ g of protein was loaded in each lane. The presence of oligomers is represented by the brace.
- VEGF-A 165b shows significantly higher amounts of SDS- resistant oligomers migrating with an apparent Mr of 67-200 kDa ( Figure 9B, lane 2) compared to VEGF-A 165 ( Figure 9B, lane 1 ) These oligomers appear to be DTT-sensitive
- VEGFR-2 vascular endothelial- growth-factor receptor-2
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention is directed to a VEGF antagonist based on the sequence of VEGF- A165, and comprising a mutation at residue 159, 161, 162, 163, 164, 165, or a combination thereof. The Cys at residue 160 of VEGF-A165 is retained.
Description
POTENT VEGF ANTAGONISTS
Cross-reference to Related Applications
This application claims the benefit of United States Provisional Patent Application USSN 61/202,568 filed March 12, 2009, the entire contents of which his herein incorporated by reference
Field of the Invention
The present invention relates to vascular endothelial growth factor (VEGF) antagonists More specifically, the present invention relates to VEGF antagonists that reduce signal transduction by VEGF receptors
Background of the Invention
Vascular endothelial growth factors (VEGFs) are key regulators of angiogenesis and vascular homeostasis In mammals, various VEGFs have been identified, including VEGF- A, -B, -C, and -D, isoforms of each have also been discovered The VEGFs bind various combinations of VEGF receptors (VEGFR-1 , VEGFR-2, and/or VEGFR-3) and co-receptors (including neuropilins and heparan sulphate proteoglycans) These interactions initiate VEGFR signal transduction, leading to normal vascular development
Among the VEGF family VEGF-A has been identified as playing a central role in angiogenesis Numerous naturally-occurring isoforms of this glycoprotein have been identified, including predominant isoforms comprising 121 , 145, 165, 189, and 206 amino acids The isoforms share a common N-termtnus, but differ at the C-terminus, the VEGF-A isoforms share the same basic effects on vascular endothelium, however they may differ in their physical properties and abilities to bind VEGFR co-receptors Consequently, the different VEGF-A isoforms can vary in their in vivo bioactivities
VEGF-A105 has been extensively studied and has been identified in playing a central role in vascular development accompanying cancers, chronic inflammatory diseases, and other human pathologies This type of endothelial cell proliferation and angiogenesis is referred to as pathological angiogenesis ' It has been shown that VEGF-A105 alone can induce the proliferation of endothelial cells and formation of new blood vessels in pathological angiogenesis
Due to the role of VEGFs and VEGFRs in human pathologies, antagonism of VEGFR signal transduction and/or homeostatic abilities has been an area of intense research Different approaches have been used to inhibit or modulate the interaction of VEGF with VEGFR, one
being production of VEGF mutants that bind the VEGFR without allowing its activation A recently discovered VEGF-A splice variant, VEGF-A165b, has such properties (Bates et al (2002), Harper & Bates (2008), Bates et al, US Patent Application Publication No 2005/0054036)
VEGF-A165b differs from VEGF-Ai6S by its C-terminal 6 amino acids, specifically, the VEGF- A165 C-terminus comprises CDKPRR (residues 160-165, SEQ ID NO 1 ), while VEGF-A165b comprises SLTRKD (SEQ ID NO 2) The loss of Cys160 impairs the formation of an intra- chain disulfide bond between residues 146 and 160 present in the wild-type molecule Additionally, the DKPRR motif of VEGF-A, shown to bind to neuropιlιn-1 (Cebe-Suarez et al (2008)), is not present in VEGF-A165b Cebe-Suarez et al (2006, 2008), Harper and Bates (2008), and Jia et al (2006) indicate that Cys160 is essential for presenting the DKPRR motif in the proper context for binding to neuropιlιn-1 Thus, the loss of CDKPRR in VEGF-A16sb prevents its binding to neuropιlιn-1 and subsequent formation of stable co-receptor complex Furthermore, Harper and Bates (2008) indicate that the neutral residues at the C-terminus of VEGF-A165b, coupled with the absence of Cys160 to keep the C-terminus in proximity of the neuropilm binding site, prevent phosphorylation of key tyrosine residues in the VEGFR
While VEGF-A165b may show promise in anti-angiogenesis therapies, protein stability could be affected and aggregation of the VEGF-A165b following disulfide bond formation (at Cys 146) with itself or other proteins could result Additionally, it was recently shown that this variant still partially activate the VEGFR2 receptor (Kawamura et al (2008))
Better VEGF and/or VEGFR antagonists are needed to provide a therapeutic effect while avoiding the disadvantages of the prior art
Summary of the Invention
The present invention provides an improved VEGF antagonist In view of the prior art findings that removal of Cys160 results in antagonistic VEGF molecules, the present VEGF are surprising in that they retain Cys160 while exhibiting antagonistic activity
Accordingly, the present invention provides a VEGF antagonist based on the sequence of VEGF-A165 and comprising a mutation at residue 159, 161 , 162, 163, 164, 165, or a combination thereof and wherein the Cys at residue 160 is retained The wild-type sequence of VEGF-A165 upon which the mutant is based may comprise the sequence shown in SEQ ID NO 3
The VEGF antagonist of the present invention shows improved anti-angiogenic activity compared to VEGF-A165D Additionally, because the Cys146-Cys160 disulfide bridge is intact in the present VEGF mutant, the mutant shows improved protein stability and lower aggregation compared to VEGF-A165b The intact disulfide bond also allows the mutant to retain a more wild-type structural conformation, thus minimizing an immunogenic response Additionally, it is also presently shown that the VEGF mutant of the present invention shows less activation of VEGFR2
This summary of the invention does not necessarily describe all features of the invention The invention may also reside in a sub-combination of the described features
Brief Description of the Drawings
These and other features of the invention will now be described by way of example, with reference to the appended drawings, wherein
FIGURE 1 shows the sequence alignment of VEGF-A165 (SEQ ID NO 3), VEGF-A165b (SEQ ID NO 4), VEGF-A165BRI (SEQ ID NO 5), VEGF-A165C (SEQ ID NO 6), VEGF-A165d (SEQ ID NO 7), VEGF-A165e (SEQ ID NO 8),VEGF-A165f (SEQ ID NO 9) and VEGF-A165g (SEQ ID NO 10) Amino acid differences compared to the VEGF-A165 are shown in bold and underlined
FIGURE 2 is a SDS-PAGE gel showing purified fractions of VEGF165 mutants Lanes 1- VEGF-A165b, 2- VEGF-A165BRI, 3- VEGF-A165C, 4- VEGF-A165d, 5- VEGF-A165e, and 6- VEGF-A165f
FIGURE 3 shows the effect of VEGF-A165 and VEGF-A165BRI on VEGFR2 (Flk-1 ) phosphorylation and ERK activation As shown, VEGF-A165BRI does not activate VEGFR2, but does activate ERK phosphorylation in HUVEC cells
FIGURE 4 is a bar graph showing results of VEGFR2 phosphorylation quantification by scanning densitometry VEGF-A165BRI appears to antagonize VEGF-A165 with potency similar to VEGF-A165b in HUVEC cells VEGF-A165b* and VEGF-A165BRI were produced by transfection of HEK293 cells and purified as described in the Examples, while VEGF-A165b** was obtained from R & D Systems
FIGURE 5 is a Western blot showing the inhibition of endogenous ERK activity in HBEC AB from microcapillary fraction (20 μm) by VEGF-A165BRI (FIGURE 5A) and VEGF-Ai65b
(FIGURE 5B) These results show that VEGF-A165BRI is more potent than VEGF-A165b at inhibiting endogenous ERK activity in HBEC FIGURE 5A lanes 1 - Control, 2- VEGF-
A165BRI 5 ng/mL, 3- VEGF-A165BRI 25 ng/mL, 4- VEGF-A165BRI 100 ng/mL 5- VEGF- A165BRI 200 ng/mL, 6- VEGF-A160BRI 400 ng/mL FIGURE 5B lanes 1- Control, 2- VEGF- A165b 5 ng/mL, 3- VEGF-A165D 25 ng/mL, 4- VEGF-A165D 100 ng/mL, 5- VEGF-A165D 200 ng/mL, 6- VEGF-A165D 400 ng/mL
FIGURE 6 is a Western blot showing the inhibition of VEGF-A165-mduced ERK activation in HBEC AB from microcapillary fraction (20 μm) by VEGF-A165BRI and VEGF-A165b These results show that VEGF-A165BRI is more potent than VEGF-A165b at blocking ERK activation by VEGF165 Lanes 1 - Control (DME) 2- VEGF-A165 25 ng/mL, 3- VEGF-A165b 200 ng/mL, 4- VEGF-A165b 200 ng/mL (different batch), 5- VEGF-A165BRI 200 ng/mL, 6- VEGF-A165 25 ng/mL + VEGF-A165b 200 ng/mL, 7- VEGF-A165 25 ng/mL + VEGF-A165b 200 ng/mL (different batch), 8- VEGF-A165 25 ng/mL + VEGF-A165BRI 200 ng/mL
FIGURE 7 is a Western blot showing the inhibition of endogenous or VEGF-A16s-stιmulated ERK activity in mouse astrocytes by VEGF-A165 mutants Results show that all mutants prepared inhibits VEGF-induced ERK activation in mouse astrocytes, but mutants 'c' and "d" have the least agonistic activity Lanes 1- Control (medium alone), 2- VEGF-A165 25 ng/ml, 3- VEGF-A165C 200 ng/mL, 4- VEGF-A165d 200 ng/mL, 5- VEGF-A165e 200 ng/mL, 6- VEGF- A165f 200 ng/mL, 7- VEGF-A165b + VEGF-A165 25 ng/ml, 8- VEGF-A165C + VEGF-A165 25 ng/ml, 9- VEGF-A165d + VEGF-A165 25 ng/ml, 10- VEGF-A165e + VEGF-A165 25 ng/ml, 11- VEGF-A165f + VEGF-A165 25 ng/ml Experiments were run in duplicate as shown by the upper and lower panels
FIGURE 8 shows the elution profile of VEGF-A165 (FIGURE 8A) and VEGF-A165b (FIGURE 8B) from a gel filtration column VEGF-A16sb shows formation of oligomers
FIGURE 9 is an image of a 4-14% Bis-Tπs gels under reducing (FIGURE 9A) and non- reducing (FIGURE 9B) conditions Lanes 1 are VEGF-A165 and lanes 2 are VEGF-A165b VEGF-A165b shows formation of oligomers
Detailed Description of the Invention
The present invention relates to vascular endothelial growth factor (VEGF) antagonists More specifically, the present invention relates to VEGF antagonists that reduce signal transduction by VEGF receptors
The following description is of a preferred embodiment by way of example only and without limitation to the combination of features necessary for carrying the invention into effect
In one embodiment of the present invention, there is provided a VEGF antagonist based on the sequence of VEGF-A16S comprising a mutation at residue 159, 161 , 162, 163, 164, 165, or a combination thereof, and wherein the Cys at residue 160 is retained. The wild-type sequence of VEGF-A165 upon which the mutant is based may comprise the sequence shown in SEQ ID NO:3.
The present invention is directed to a VEGF antagonist. By the term "VEGF antagonist" or "vascular endothelial growth factor antagonist" it is meant a polypeptide that shows anti- angiogenic activity. The anti-angiogenic activity may be achieved by modulation or inhibition of the action of VEGF and/or VEGFR by the VEGF antagonist; this may be accomplished in any manner of mechanisms. For example but without wishing to be limiting, the VEGF antagonist may hinder, prevent or block interaction of VEGF to VEGFR; may prevent phosphorylation of the VEGFR; may also prevent binding to/recruitment of neuropilin or HSPGs; or by any other method of action.
The VEGF antagonist of the present invention is based on the sequence of VEGF-A16S- The sequence of VEGF-A165 is well-known in the art and may comprise the sequence shown in
SEQ ID NO:3. The VEGF antagonist may also include an additional N- or C-terminal sequence to, for example, target protein expression or provide ease of purification; for example, but without wishing to be limiting, the sequence may comprise the VEGF signal peptide MNFLLSWVHWSLALLLYLHHAKWSQA (SEQ ID NO:1 1 ) at the N-terminus of the VEGF antagonist. The additional sequence may be, for example and without wishing to be limiting, a His tag (His5/His6/His8/His10). Such additional sequences may be cleaved during synthesis in the cell or may be cleaved after secretion/isolation of the VEGF antagonist.
The VEGF antagonist, while based on the sequence of VEGF-A165, comprises a mutation at residue 159, 161 , 162, 163, 164, 165, or a combination thereof. Such "mutation" may comprise an amino acid substitution, deletion or addition. The newly added or substituent amino acid may be a basic, neutral, hydrophobic, or acidic amino acid. By the term "basic amino acid" it is meant hydrophilic amino acids having a side chain pK value of greater than 7, which are typically positively charged at physiological pH. Basic amino acids include histidine (His or H), arginine (Arg or R), and lysine (Lys or K). By the term "neutral amino acid" (also "polar amino acid"), it is meant hydrophilic amino acids having a side chain that is uncharged at physiological pH, but which has at least one bond in which the pair of electrons shared in common by two atoms is held more closely by one of the atoms. Polar amino acids include serine (Ser or S), threonine (Thr or T), cysteine (Cys or C), tyrosine (Tyr or Y), asparagine (Asn or N), and glutamine (GIn or Q). The term "hydrophobic amino acid" (also "non-polar amino acid") is meant to include amino acids exhibiting a hydrophobicity of
greater than zero according to the normalized consensus hydrophobicity scale of Eisenberg (1984) Hydrophobic amino acids include proline (Pro or P), isoleucine (lie or I), phenylalanine (Phe or F), valine (VaI or V), leucine (Leu or L), tryptophan (T rp or W), methionine (Met or M) alanine (Ala or A), and glycine (GIy or G) "Acidic amino acid" refers to hydrophilic amino acids having a side chain pK value of less than 7, which are typically negatively charged at physiological pH Acidic amino acids include glutamate (GIu or E), and aspartate (Asp or D)
In one embodiment of the present invention, there is provided a VEGF antagonist based on the sequence of VEGF-A165 and comprising
a) a substitution at residue 159 for an acidic or neutral amino acid,
b) a substitution at residue 161 for a basic or neutral ammo acid,
c) a substitution at residue 162 for an acidic or neutral amino acid,
d) a substitution at residue 163 for a hydrophobic amino acid,
e) a substitution at residue 164 for an acidic or neutral amino acid,
f ) a substitution at residue 165 for an acidic or neutral amino acid, or
g) a combination of a) to f)
The substitution at residue 159 may be, for example, for a isoleucine, glutamate, aspartate, alanine, or glycine, in a non-limiting example, the substitution at residue 159 is for a isoleucine or glutamate The substitution at residue 161 may be for a glycine, alanine, lysine or arginine, in a specific, non-limiting example, the substitution at residue 161 is for lysine (SEQ ID NO 8) The substitution at residue 162 may be for a glutamate, aspartate, or alanine, for example, but not wishing to be limiting, residue 162 may be mutated to glutamate (SEQ ID NO 6) or alanine (SEQ ID NO 9) The substitution at residue 163 may be for a glycine or alanine, in a non-limiting example, residue 163 may be mutated to glycine Without wishing to be limiting, the substitution at residue 164 may be for a glutamate, aspartate, alanine, or glycine The substitution at residue 165 may be for a glutamate, aspartate, alanine, or glycine
The VEGF antagonist as described above may also comprise a combination of two or more of the mutations listed above In a specific non-limiting example, the VEGF antagonist comprises two mutations at residues 162 and 163, in a further example, the residue at
position 162 may be mutated to GIu and the residue at position 163 to GIy (SEQ ID NO 5) In an alternative, non-limiting, example, the VEGF antagonist comprises two mutations at residues 161 and 162, in a further example, the residue at position 161 may be mutated to GIy and the residue at position 162 to Ala (SEQ ID NO 7) In yet another alternative example, and without wishing to be limiting, the VEGF antagonist comprises two mutations at residues 159 and 162, in a further example, the residue at position 159 may be mutated to lie and the residue at position 162 to GIu (SEQ ID NO 10) Alternatively, the VEGF antagonist may comprise a glutamate residue at positions 159 and 162
Additionally, the VEGF antagonist of the present invention also includes polypeptides that are substantially identical to the VEGF antagonist described herein The substantially identical polypeptide may comprise one or more conservative amino acid mutation, provided the C-terminal 6 amino acids remain unchanged (ι e , none of the conservative amino acid mutations are found in the 6 C-terminal amino acids) It is known in the art that one or more conservative amino acid mutation to a reference protein may yield a mutant protein with no substantial change in physiological, chemical, or functional properties compared to the reference protein, in such a case, the reference and mutant proteins would be considered "substantially identical" polypeptides Conservative amino acid mutation may include addition, deletion or substitution of an amino acid, a conservative amino acid substitution is defined herein as the substitution of an amino acid residue for another amino acid residue with similar chemical properties (e g size, charge, or polarity) The VEGF antagonist of the present invention also encompasses substantially identical proteins comprising one or more conservative amino acid mutation, provided these mutations are not within the 6 C-terminal amino acids, provided the Cys at position 160 is retained, and provided the anti-angiogenic activity is retained
Sequence identity is used to evaluate the similarity of two sequences, it is determined by calculating the percent of residues that are the same when the two sequences are aligned for maximum correspondence between residue positions Any known method may be used to calculate sequence identity, for example, computer software is available to calculate sequence identity Without wishing to be limiting, one can use NCBI BLAST2 service maintained by the Swiss Institute of Bioinformatics, and as found at http Ilea expasy orq/tools/blast/ The substantially identical sequences of the present invention may be at least 85% identical, in another example, the substantially identical sequences may be at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous at the amino acid level to sequences described herein
The VEGF antagonists of the present invention shows equal or improved anti-angiogenic activity compared to VEGF-A165D Additionally, because the Cys146-Cys160 disulfide bridge is intact in the present VEGF mutant, the mutants may exhibit improved protein stability and lower incidence of aggregation compared to VEGF-A165b The intact disulfide bond may also allow the mutants to retain a more wild-type structural conformation, thus minimizing an immunogenic response Additionally, it is also presently shown that the VEGF mutant of the present invention shows less activation of VEGFR2
The present results show that the VEGF-A166BRI polypeptide is a more potent antagonist than VEGF-A-|65b This agonist-to-antagonist conversion is not due to the disappearance of C160, nor to the R164K and R165D mutations, as proposed by Cebe-Suarez et al (2008) and Harper and Bates (2008), but rather is due to the mutation at position 162 (to T or E in the case of VEGF-A165b and VEGF-A165BRI, respectively) Without wishing to be bound by theory, the residue at position 162 may play a role in interaction of VEGF with neuropιlιn-1 , or for bringing VEGFR2 together with neuropιlιn-1 in a proper orientation for full activation of the signalling pathway, other residues may also play a role in these interactions, such as D161 and R159
The present results also show that a single mutation (K162E) or two mutations (K162E and P163G) may be sufficient to convert VEGF-A165 into an antagonist This is in contrast with the natural splice variant (VEGF-A16sb) which has 6 mutations at the C-terminus, including a C160S mutation The present is a more systematic approach to conferring antagonist activity, leading to a better and more stable antagonist Furthermore, as the disulfide bridge between cysteines at positions 146 and 160 is conserved, the VEGF antagonist of the present invention may retain a wild-type like structure at its C-terminus
The present invention also encompasses nucleic acid sequences encoding the VEGF antagonists as described above The nucleic acid sequence may be codon-optimized The present invention also encompasses vectors comprising the nucleic acids as just described Furthermore, the invention encompasses cells comprising the nucleic acid and/or vector as described
The present invention also provides a method of providing the VEGF antagonist of the present invention to a person in need thereof For example, and without wishing to be limiting, a nucleic acid encoding the VEGF antagonist of the present invention may be administered by injection or through the use of viral delivery systems such as adenovirus, adeno-associated virus, retrovirus, alternatively, the purified VEGF antagonist could be delivered by injection into the person in need thereof In yet another non-limiting example,
local implantation of encapsulated cells stably expressing the VEGF antagonist of the present invention can be performed.
The present invention will be further illustrated in the following examples. However, it is to be understood that these examples are for illustrative purposes only and should not be used to limit the scope of the present invention in any manner.
Example 1: Construction of VEGF-Ai65 mutants
Codon-optimized (human codon basis) VEGF-A16S cDNA was synthesized by GeneArt and cloned into the pTT5 vector (Shi et al, 2005). All mutants were created by cloning annealed oligonucleotides sequences comprising the mutated sequence between the Sbfl and BamHI sites (underlined) of the VEGF-A165 cDNA in pTT5 vector as shown below (VEGF-A165 stop codon is shown in bold):
GAGGACCTGCAGGTGCGACGAGCCCAGGAGGTGAGGATCC (SEQ ID NO: 12)
VEGF165C: sense oligo: δ'-GGTGCGACGAGCCCAGGAGGTGAG-S' (SEQ ID NO: 13) Antisense oligo: δ'-TGCAGGTGCGACGAGCCCAGGAGGTGAGGATC-S' (SEQ ID NO:14)
VEGF165D: sense oligo: 5'- GGTGCGGAGCCCCCAGGAGGTGAG-3' (SEQ ID NO:15)
Antisense oligo: 5'- TGCAGGTGCGGAGCCCCCAGGAGGTGAGGATC-3' (SEQ ID NO:16)
VEGF165E: sense oligo: 5'- GGTGCAAGAAGCCCAGGAGGTGAG-3' (SEQ ID NO: 17)
Antisense oligo: δ'- TGCAGGTGCAAGAAGCCCAGGAGGTGAGGATC-S' (SEQ ID NO:18)
VEGF165F: sense oligo: 5'- GGTGCGACGCCCCCAGGAGGTGAG-3' (SEQ ID NO: 19) Antisense oligo: 5'- TGCAGGTGCGACGCCCCCAGGAGGTGAGGATC-3' (SEQ ID NO:20)
The VEGF165g mutant is cloned using an annealed oligonucleotide sequence comprising the mutated sequence between the Sbfl and BamHI sites of the VEGF-A165 cDNA in pTT5 vector as shown below:
VEGF165G: sense oligo: 5'- TCTGCGACGAGCCCAGGAGGTGAG-3' (SEQ ID NO:21 )
Antisense oligo: 5'- TGCATCTGCGACGAGCCCAGGAGGTGAGGATC-3' (SEQ ID NO:22)
Example 2 Expression and Purification of VEGF proteins
The VEGF mutants constructs described in Example 1 were expressed and purified for further experimentation Human recombinant VEGF (isoform 165b) was from R&D Systems Human recombinant VEGF (isoform 165) was produced and purified as described (Labrecque et al , 2004)
The VEGF mutants (shown in Figure 1 ) were expressed using methods known in the art Briefly, 293-6E cells were cultured in Erlenmeyer flasks using 25% of their nominal volume at 110 rpm under standard humidified conditions (37°C and 5% CO2) in F17 medium (Invitrogen, Grand Island NY) supplemented with 4 mM glutamine, 25 μg/ml Geneticin 418, and 0 1% Pluronic F-68 Cells were seeded two days prior to transfection at 2 5x105 cells/ml in fresh medium at 90% of the final volume Cells were transfected with the pTT5 vectors of Example 1 at a density of 0 8 to 1 2 x106 cells/ml The transfection mixture was prepared in 10% of the final volume using F17 medium, 1 mg/L plasmid and 2 mg/L 25 kDa linear polyethylenimine (Polysciences, Wamngton PA) as the transfection vehicle (Durocher et al, 2002, Tom et al, 2007) Cells were fed with 20% w/v TN1 peptone in F17 medium 24 hours after transfection, to give 0 5% w/v TN 1 in the culture (Pham et al, 2005) VEGF was produced in 500 mL culture and harvested 5 days post-transfection At harvest, cells were eliminated by centπfugation followed by 0 45 μm filtration Clarified supernatant was either processed immediately, or stored frozen at -8O0C until processing
VEGF mutants were purified by chromatographic techniques All chromatographic operations were performed using an AKTA Explorer 100 (GE Healthcare) controlled by UNICORN software version 5 01 (GE Healthcare) For purification by cation exchange, the clarified supernatant was acidified to pH 4 0 by dropwise addition of 12 N HCI Acid precipitate was removed by centπfugation followed by filtration under vacuum using a 0 45 μm filter (Millipore) The supernatant was loaded onto Fractogel EMD SO3 650 (M) (EMD) packed in an XK16/20 column (GE Healthcare) equilibrated with wash buffer (100 mM sodium acetate / acetic acid, 80 mM NaCI, pH 4 0) The column was washed with 5 column volumes (CV) of wash buffer followed by 10 CV of 600 mM NaCI buffer to remove impurities, and the VEGF was eluted with 10 CV of 1 5 M NaCI and collected in 5 mL fractions The VEGF fractions were pooled and loaded onto a HiPrep 26/10 Desalting column (GE Healthcare) equilibrated with PBS, the desalted VEGF fraction was then passed through Fractogel EMD DEAE 650 (M) (EMD) packed in a XK16/20 column (GE Healthcare) connected in series with the desalting column to remove impurities The VEGF was sterile filtered at 0 22 μm and frozen in 1 ml aliquots
The VEGF-A165 mutants were analyzed by SDS-PAGE electrophoresis (Figure 2) Approximately 7 5 μg of each purified mutant was resolved by reducing SDS-PAGE and the gel stained with Coomassie blue using methods well-known in the art
Example 3 Effect of VEGF-A165 and VEGF-A165BRι on VEGFR2 (Fik-1) Phosphorylation and ERK Activation in HUVEC
Human umbilical vein endothelial cells (HUVECs) were exposed to either VEGF-Ai65 or VEGF-A165BRi to evaluate their effects on VEGFR2 phosphorylation and ERK activation
HUVECs were purchased from Clonetics (San Diego, CA) and maintained in EC basal medιum-2 (EBM-2) supplemented with EGM-2 Mv growth factor mixture (Clonetics) The cells were cultured at 370C under a humidified 95%/5% (v/v) mixture of air and CO2 For experimental purposes, cells were plated in 100 mm plastic dishes at 5000 cells/cm2 and were grown to confluence before overnight serum starvation without supplements Cells were treated with VEGF-A165 or VEGF-A165BRI
HUVEC cells were treated with VEGF-A165 (50 ng/ml) or 50-200 ng/ml of VEGF-A165BRI using previously described methods (Gingras et al, 2000) Cells were then washed once with ice- cold PBS (pH 7 4) containing 1 mM Na3VO4 and were incubated in the same medium for 1 h at 4°C The cells were solubiiised on ice in lysis buffer (150 mM NaCI, 10 mM Tris-HCI (pH 7 4), 1 mM EDTA, 1 mM EGTA, 0 5% (v/v) Nonidet P-40 and 1 % (v/v) Triton X-100) containing 1 mM Na3VO4 Lysates were clarified by centrifugation at 10 000 g for 10 mm, and the resulting supernatants were used for VEGFR-2 immunoprecipitation overnight with 1 mg/ml of antι-VEGFR-2 antibody (C-1158, Santa Cruz Biotechnologies, Santa Cruz, CA) at 4°C followed by the addition of rabbit primary antibody pre-bound to protein A-Sepharose beads at 40C for 2 h, as described previously (Labrecque et al, 2004) Non-specifically bound proteins were removed by washing the beads three times with lysis buffer and once with PBS containing 1 mM Na3VO4 The proteins were extracted with 2-fold concentrated Laemmli sample buffer, boiled 4 mm, and resolved by SDS-PAGE (7 5% gel) The proteins were transferred onto polyvinyhdene difluoπde (PVDF) membranes, blocked overnight at 40C in Tπs-buffered salιne/Tween-20 (147 mM NaCI, 20 mM Tris-HCI (pH 7 5) and 0 1 % Tween- 20) containing 2% (w/v) bovine serum albumin (BSA), and probed with primary antibodies (PY99 or VEGFR-2) for 2 h at room temperature Immunoreactive bands were revealed after 1 h incubation with HRP-conjugated anti-mouse IgG (Jackson ImmunoResearch Laboratories (West Grove, PA)), and the signals were visualized by enhanced chemiluminescence, ECL reagents were obtained from PerkinElmer Life Sciences (Boston,
MA). Figure 3 shows the results of these experiments. As can be seen in the figure, VEGF- AI65BRI does not activate VEGFR2, but does activate ERK phosphorylation in HUVEC cells.
The immunoreactive phospho-VEGFR2 bands obtained as described above were quantified by scanning densitometry (Molecular Dynamics, Sunnyvale, CA). PTK (ACC Corp, San Diego CA) was used at 1 μM as a positive control to inhibit VEGFR2 activation. The results, shown in Figure 4, indicate that VEGF-A165BRι has higher antagonistic activity (VEGFR2 activation) compared to that of VEGF-A165b.
Example 4: Effect of VEGF-A165 and VEGF-A165BRI on ERK Activation in HBEC
Human brain endothelial cells (HBECs) were exposed to either VEGF-A16S or VEGF-A165BRI to evaluate their effects on ERK activation.
HBECs were obtained from small intracortical microvessels and capillaries (1 12-20 μm) harvested from temporal cortex surgically excised from patients treated for idiopathic epilepsy. Tissues were obtained with approval from the Institutional Research Ethics Committee. HBECs were separated from smooth muscle cells with cloning rings and grown at 370C in HBEC media containing Earle's salts, 25 mM 4-(2-hydroxyethyl)-1- piperazineetahanesulfonic acid (HEPES), 4.35 g/L sodium bicarbonate, and 3 mM L- glutamine, 10% FBS, 5% human serum, 20% of media conditioned by murine melanoma cells (mouse melanoma, Cloudman S91 , clone M-3, melanin-producing cells), 5 μg/ml insulin, 5 μg/ml transferrin, 5 ng/ml selenium and 10 μg/ml endothelial cell growth supplement. HBEC cultures were routinely characterized morphologically and biochemically. More than 95% of cells in culture stained immunopositive for the selective endothelial markers, angiotensin ll-converting enzyme and Factor Vlll-related antigen, incorporated fluorescently labeled Ac-LDL, and exhibited high activities of the blood-brain barrier-specific enzymes, γ-glutamyltranspeptidase and alkaline phosphatase.
HBECs were rinsed three time with DME before applying different concentrations (5-400 ng/ml) of either VEGF-AI65BRI or VEGF-A165b for 10 min.
Cells were then rinsed with ice-cold HBSS and exposed to 250 μL ristocetin-induced platelet agglutination lysis buffer (1%NP-40 (IGEPAL, lysis buffer, Sigma-Aldrich), 0.5% deoxycholate, 0.1% sodium dodecyl sulfate and protease inhibitor 100 μL/10 mL ristocetin- induced platelet agglutination in PBS), (Sigma-Aldrich) for 30 min at 4 0C. The cell lysates were centrifuged at 700 g for 30 min at 4°C, and the supematants were collected. Protein concentration was measured in each of the ceil lysates by Bicinchoninic Acid Protein Assay Reagent Kit (Pierce Biotechnology, Rockford, IL, USA), and 15 μg of protein was denatured
in protein loading buffer for 5 min at 1000C, and then separated on a 10% sodium dodecyl sulfate-polyacrylamide gel. Separated proteins were then transferred to polyvinylidene difluoride membranes. Blocking was performed by incubating membranes in Tris-buffered saline with Tween 20 (TBST) (20 mM Tris-buffer (pH 8.0) and 150 mM NaCI with 0.1 % Tween 20) containing 5% BSA (Sigma-Aldrich) for 1 h at 210C. Membranes were then incubated overnight at 40C with primary antibodies against p44/42 MAPK (Cell Signaling Technology, Beverly, MA, USA) diluted 1/1000 in TBST containing 5% BSA. The membranes were washed with TBST and incubated for 1 h with anti-rabbit IgG (whole molecule)-peroxidase antibody (Sigma-Aldrich) diluted 1/5000 in TBST containing 5% skimmed milk. Immunoreactive proteins were visualized by Amersham enhanced chemiluminescence plus western blotting detection reagents (GE Healthcare, Buckinghamshire, UK).
The results are shown in Figure 5. Figure 5A (left) shows increasing concentrations of
VEGF-A-I65BRI (left panel), while Figure 5B (right) shows increasing concentrations of VEGF- A165b; ERK phosphorylation was revealed by western lot as described above. These results show that VEGF-A-I65BRI has less agonistic activity (ERK activation) compared to VEGF-A16Sb-
Alternatively, VEGF-Ai6S (25 ng/ml) was added to the cells following their pre-incubation for 15 minutes in the absence or presence of 200 ng/mi of VEGF-A165BRI or VEGF-A16Sb- ERK phosphorylation was revealed by western blot, as described above, 10 minutes after VEGF- A165 addition. Results are shown in Figure 6. VEGF-A165BRI appears more potent than VEGF- A165b at blocking ERK activation by VEGF-A165.
Example 5: Effect of VEGF-A165, VEGF-A165b and VEGF-A165 mutants on ERK Activation in Mouse Astrocytes
Mouse astrocytes were exposed to VEGF-A165, VEGF-A165b, or one of the mutants described in Example 2 to evaluate their effects on ERK activation.
Astrocytes were isolated from 8-day-old C57BL6/J (B6) mice, bred at the National Research Council of Canada (NRCC) Institute for Biological Sciences Animal Facility (Ottawa, ON, Canada). Mice were deeply anesthetized with 4% halothane B. P. (MTC Pharmaceuticals, Cambridge, ON, Canada) under the oxygen flow rate of 2 L/min and then killed by guillotine. All procedures used in these studies were approved by the NRCC Animal Care Committee. Brains were removed and placed into ice-cold Dulbecco's modified Eagle's medium (DMEM) with antibiotic-antimycotic solution (Sigma-Aldrich, Oakville, ON, Canada). The cerebellum, and the olfactory bulbs were removed and brain cortices (four brains per isolation) were homogenized by passing through sequentially smaller gauge needles (18G 1 1/2, 23G 3/4,
and 25G 5/8). Dispase (12 img/mL, Sigma-AIdrich) in DMEM was added to the homogenate, and incubated at 37°C for 15 min. After incubation, the homogenate was filtered through a 53 mm Nitex filter (Sefar Canada Inc., Scarborough, ON, Canada) and then centrifuged at 4°C for 10 min at 700 g. The peilet was resuspended in astrocyte media containing 10% heat-inactivated fetal bovine serum (FBS; Hycione, Logan, UT, USA), 1X antibiotic- antimycotic, and DMEM, and the cells were plated on poly-L-lysine (Sigma-AIdrich) coated 75 cm2 culture flasks. After 3 days, cells were rinsed 3X with warm Hank's buffered salt solution (HBSS) (Sigma-AIdrich) and fed every 3-4 days thereafter. Cells were kept in culture in an atmosphere of 5% CO2/95% air at 37°C. Experiments were performed using astrocytes from the first passage only. The purity of astrocyte cultures (> 99%) was confirmed by positive immunostaining with a rabbit anti-glial fibrillary acidic protein (GFAP) polyclonal antibody (Dako, Hamburg, Germany).
Ceils were incubated for 10 minutes in the presence of 200 ng/ml of VEGF-A165, VEGF- A165C, VEGF-A165d, VEGF-A165e, or VEGF-A165f; other cells were pre-incubated with VEGF- A165b, VEGF-A165C, VEGF-A165d, VEGF-A165e, or VEGF-A165f, then challenged for 10 minutes with 25 ng/ml of VEGF-A165. ERK phosphorylation was revealed by western blot as described in Example 4. This experiment was done in duplicate, and results are show in Figure 7 (upper and lower panels). Results indicate that mutants VEGF-A16sC and VEGF- A16Sd have the least agonistic activity.
Example 6: Analysis of VEGF-A165 and VEGF-A165b
The degree of aggregation of the purified VEGF-A165 and VEGF-A165b proteins was analysed by gel filtration chromatography.
Briefly, gel filtration was performed on a HiLoad Superdex 75 16/60 prep grade column (GE Healthcare) equilibrated with 50 mM MES, 150 mM NaCI pH 6.0. A 2 ml sample loop was filled with sample and injected into the column. Elution was performed with 1 CV of running buffer. Molecular weights were determined using Bio-Rad gel filtration standards. Elution profiles are shown in Figure 8. VEGF165b shows significantly higher amounts of oligomers migrating with an apparent Mr of -1 13 kDa (Figure 8B) compared to VEGF165 (Figure 8A).
VEGF-A165 and VEGF-A165b were further analyzed by SDS-PAGE. Samples of VEGF-A165 (lanes 1 ) and VEGF-A165b (lanes 2) were resolved on 4-14% Bis-Tris gels under reducing (Figure 9A) or non-reducing (Figure 9B) conditions and stained with Coomassie blue R-250 using known methods; 10 μg of protein was loaded in each lane. The presence of oligomers is represented by the brace. VEGF-A165b shows significantly higher amounts of SDS-
resistant oligomers migrating with an apparent Mr of 67-200 kDa (Figure 9B, lane 2) compared to VEGF-A165 (Figure 9B, lane 1 ) These oligomers appear to be DTT-sensitive
Materials
Cell culture media were obtained from Life Technologies (Burlington, ON, Canada) and serum was purchased from Hyclone Laboratories (Logan, UT) Protein A-Sepharose was obtained from Amersham Pharmacia Biotech (Baie d'Urfe, Qc, Canada) Antι-VEGFR-2 (C- 1158) and antι-ERK-1/2 (K-23) polyclonal antibodies and the anti-phosphotyrosine (PY99) monoclonal antibody were from Santa Cruz Biotechnologies (Santa Cruz, CA) Antiphospho- p44/42 MAPK (Thr 202/Tyr 204) polyclonal antibodies were from Cell Signaling Technology (Beverly, MA) Anti-mouse and anti-rabbit horseradish peroxidase (HRP)-lιnked secondary antibodies were purchased from Jackson IrnmunoResearch Laboratories (West Grove, PA) and enhanced chemiluminescence (ECL) reagents were from PerkinElmer Life Sciences (Boston, MA) Human recombinant VEGF-A (isoform 165b) was from R&D Systems All other reagents were from Sigma-Aldπch (Oakville, ON, Canada)
The embodiments and examples described herein are illustrative and are not meant to limit the scope of the invention as claimed Variations of the foregoing embodiments will be readily apparent to those of skill in the art in light of the teachings of this invention, and are intended by the inventor to be encompassed by the claims Furthermore, the discussed combination of features might not be necessary for the inventive solution
References
All patents, patent applications and publications referred to herein are hereby incorporated by reference
Bates, D O , Cui, T G , Doughty, J M , Winkler, M , Sugiono, M , Shields, J D , Peat, D , Gillatt, D , and Harper, S J (2002) Cancer Res 62, 4123-4131
Cebe-Suarez, S , Pieren, M , Caπolato, L , Am, S , Hoffmann, U , Bogucki, A , Manlius, C , Wood, J , and Ballmer-Hofer, K (2006) Cell MoI Life Sci 63, 2067-2077
Cebe-Suarez, S , Grunewald, F S , Jaussi, R , Li, X , Claeson-Welsh, L , Spillmann, D , Mercer, A A , Prota, A E , and Ballmer-Hofer, K (2008) FASEB J 22, 1-9
Durocher, Y , S Perret, and A Kamen, High-level and high-throughput recombinant protein production by transient transfection of suspension-growing human 293-EBNA1 cells Nucleic Acids Res , 2002 30(2) p E9
Eisenberg, D , Schwarz, E , Komaromy M , and Wall, R (1984) J MoI Biol 179 125-142
Gingras, D , S Lamy, and R Beliveau, Tyrosine phosphorylation of the vascular endothelial- growth-factor receptor-2 (VEGFR-2) is modulated by Rho proteins Biochem J, 2000 348 Pt 2 p 273-80
Harper, S J and Bates, D O (2008) Nat Rev Cancer 8, 880-887
Jia, H , Bagherzadeh, A , Hartzoulakis, B , Jarvis, A , Lohr, M , Shaikh, S , Aqil, R , Cheng, L , Tickner, M , Esposito , D , Harris , R , Dπscoll P C , Selwood, D L , and Zachary, I C (2006) J Biol Chem 281 , 13493-13502
Kawamura, H , Li, X , Harper, S J , Bates, D O , and Claesson-Welsh, L (2008) Cancer Res 68, 4683-4692
Labrecque, L , et al , Src-mediated tyrosine phosphorylation of caveolιn-1 induces its association with membrane type 1 matrix metalloproteinase J Biol Chem , 2004 279(50) p 52132-52140
Pham, P L , et al , Transient gene expression in HEK293 cells peptone addition posttransfection improves recombinant protein synthesis Biotechnol Bioeng , 2005 90(3) p 332-344
Shi, C , et al , Purification and characterization of a recombinant G-protein-coupled receptor, Saccharomyces cerevisiae Ste2p, transiently expressed in HEK293 EBNA1 cells Biochemistry, 2005 44(48) p 15705-15714
Tom, R , L Bisson, and Y Durocher, Transient expression in HEK293-EBNA1 cells, in Methods Express Expression Systems, M R Dyson and Y Durocher, Editors 2007, Scion Publishing Limited Bloxham, Oxfordshire, UK p 203-223
Claims
Claims
1 A VEGF antagonist based on the sequence of VEGF-A165 (SEQ ID NO 3) and comprising a mutation at residue 159, 161 , 162, 163, 164, 165, or a combination thereof, wherein the Cys at residue 160 is retained
2 The antagonist according to claim 1 comprising SEQ ID NO 23 or a conservative amino acid mutation thereof in other than the six C-terminal amino acids, and wherein
a) Xaa at residue 159 is an acidic or neutral amino acid,
b) Xaa at residue 161 is a basic or neutral amino acid,
c) Xaa at residue 162 is an acidic or neutral ammo acid,
d) Xaa at residue 163 is a hydrophobic amino acid,
e) Xaa at residue 164 is an acidic or neutral amino acid,
f) Xaa at residue 165 is an acidic or neutral amino acid, or
g) a combination of a) to f)
3 The antagonist according to claim 1 , comprising SEQ ID NO 23 or a conservative amino acid mutation thereof in other than the six C-terminal amino acids, and wherein
a) Xaa at residue 159 is isoleucine, glutamate, aspartate, alanine or glycine,
b) Xaa at residue 161 is glycine, alanine, lysine or arginme,
c) Xaa at residue 162 is glutamate, aspartate or alanine,
d) Xaa at residue 163 is glycine or alanine,
e) Xaa at residue 164 is glutamate, aspartate, alanine or glycine, and,
f) Xaa at residue 165 is glutamate, aspartate, alanine or glycine
4 The antagonist according to claim 1 comprising the amino acid sequence as set forth in SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9 or SEQ ID NO 10, or a conservative amino acid mutation thereof in other than the six C-terminal amino acids
5 The antagonist according to claim 1 comprising the amino acid sequence as set forth in SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9 or SEQ ID NO 10
6 The antagonist according to any one of claims 1 to 5, further comprising an additional N- or C-terminal sequence to target protein expression or provide ease of purification
7 The antagonist according to claim 6 wherein the additional sequence comprises a VEGF signal peptide at the N-terminus or a His tag
8 The antagonist according to claim 7, wherein the VEGF signal peptide comprises SEQ ID NO 1 1
9 A nucleic acid encoding the VEGF antagonist as defined in any one of claims 1 to 8
10 A vector comprising the nucleic acid of claim 9
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US20256809P | 2009-03-12 | 2009-03-12 | |
| US61/202,568 | 2009-03-12 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010102380A1 true WO2010102380A1 (en) | 2010-09-16 |
Family
ID=42727733
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CA2010/000275 Ceased WO2010102380A1 (en) | 2009-03-12 | 2010-02-26 | Potent vegf antagonists |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2010102380A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104311662A (en) * | 2013-03-08 | 2015-01-28 | 上海赛伦生物技术有限公司 | High-stability human-derived anti-VEGF (vascular endothelial growth factor) antibody and application thereof |
| EP3216458A1 (en) | 2016-03-07 | 2017-09-13 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Modified vascular endothelial growth factor a (vegf-a) and its medical use |
| US12121573B2 (en) | 2019-07-14 | 2024-10-22 | Tianxin Wang | Methods and agents including STING agonist to treat tumor |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1996020403A1 (en) * | 1994-12-23 | 1996-07-04 | Ludwig Institute For Cancer Research | Assay, receptor proteins and ligands |
| WO2007044534A2 (en) * | 2005-10-06 | 2007-04-19 | Trophogen, Inc. | Vegf analogs and methods of use |
| US7414027B2 (en) * | 1997-12-09 | 2008-08-19 | Childen's Medical Center Corporation | Peptide antagonists of vascular endothelial growth factor |
-
2010
- 2010-02-26 WO PCT/CA2010/000275 patent/WO2010102380A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1996020403A1 (en) * | 1994-12-23 | 1996-07-04 | Ludwig Institute For Cancer Research | Assay, receptor proteins and ligands |
| US7414027B2 (en) * | 1997-12-09 | 2008-08-19 | Childen's Medical Center Corporation | Peptide antagonists of vascular endothelial growth factor |
| WO2007044534A2 (en) * | 2005-10-06 | 2007-04-19 | Trophogen, Inc. | Vegf analogs and methods of use |
Non-Patent Citations (2)
| Title |
|---|
| BATES, D.O. ET AL.: "VEGF165b, an Inhibitory Splice Variant of Vascular Endothelial Growth Factor", IS DOWN-REGULATED IN RENAL CELL CARCINOMA. CANCER RES., vol. 62, no. 14, 2002, pages 4123 - 4131 * |
| JIA, H. ET AL.: "Characterization of a Bicyclic Peptide Neuropilin-1 (NP-1) Antagonist (EG3287) Reveals Importance of Vascular Endothelial Growth Factor Exon 8 for NP-1 Binding and Role of NP-1 in KDR Signaling.", J. BIOL. CHEM., vol. 281, no. 19, 2006, pages 13493 - 13502 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104311662A (en) * | 2013-03-08 | 2015-01-28 | 上海赛伦生物技术有限公司 | High-stability human-derived anti-VEGF (vascular endothelial growth factor) antibody and application thereof |
| CN104311662B (en) * | 2013-03-08 | 2017-06-23 | 上海赛伦生物技术股份有限公司 | A kind of stability human anti-VEGF antibody high and its application |
| EP3216458A1 (en) | 2016-03-07 | 2017-09-13 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Modified vascular endothelial growth factor a (vegf-a) and its medical use |
| US12121573B2 (en) | 2019-07-14 | 2024-10-22 | Tianxin Wang | Methods and agents including STING agonist to treat tumor |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2381014T3 (en) | Chimeric protein inhibitor of angiogenesis and use | |
| US10689637B2 (en) | Complement factor B analogs and their uses | |
| KR20120137270A (en) | A fusion protein for inhibiting both angiogenesis and tumor cell proliferation, and composition comprising the same | |
| KR20080082608A (en) | VEGF analogues and how to use | |
| JP2017533201A (en) | Methods of using interleukin-10 for the treatment of diseases and disorders | |
| TW201412770A (en) | Modified fibronectin fragments or variants and uses thereof | |
| WO2014000042A1 (en) | COMPOSITIONS AND METHODS FOR MODIFYING TGF-β FAMILY LIGANDS | |
| HK1251001A1 (en) | Il-37 variants | |
| CN101175768B (en) | Erythropoietin variants | |
| CN106714818B (en) | Disintegrated protein variants and their medicinal uses | |
| ES2422879T3 (en) | Modified human thymic stromal lymphopoietin | |
| WO2012169822A2 (en) | Fusion protein for suppressing cancer cell growth and suppressing vasculogenesis, and anticancer composition comprising same | |
| CN113747912B (en) | Recombinant CCN domain proteins and fusion proteins | |
| JP2025512062A (en) | Complement Inhibitory Hybrid Protein | |
| US8188039B2 (en) | VEGF-D mutants and their use | |
| WO2017032216A1 (en) | Acvr1-fc fusion protein, preparation method therefor, and application thereof | |
| US20110092427A1 (en) | Polypeptide and pharmaceutical composition containing the polypeptide | |
| JP2013545440A (en) | Macaca fascicularis CCL17 | |
| WO2025002113A1 (en) | Fusion protein of human thrombopoietin receptor agonist | |
| US20200347116A1 (en) | Von willebrand factor proteins for treating bleeding disorders | |
| JPH07304796A (en) | Hepatocyte growth factor derivative |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10750266 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10750266 Country of ref document: EP Kind code of ref document: A1 |