WO2010100437A2 - Production of protein - Google Patents

Production of protein Download PDF

Info

Publication number
WO2010100437A2
WO2010100437A2 PCT/GB2010/000401 GB2010000401W WO2010100437A2 WO 2010100437 A2 WO2010100437 A2 WO 2010100437A2 GB 2010000401 W GB2010000401 W GB 2010000401W WO 2010100437 A2 WO2010100437 A2 WO 2010100437A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
seq
nucleic acid
sirna
acid molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2010/000401
Other languages
French (fr)
Other versions
WO2010100437A9 (en
WO2010100437A3 (en
Inventor
Aidan Riley
David James
Richard Ross
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Sheffield
Original Assignee
University of Sheffield
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0903809A external-priority patent/GB0903809D0/en
Priority claimed from GB0916305A external-priority patent/GB0916305D0/en
Application filed by University of Sheffield filed Critical University of Sheffield
Publication of WO2010100437A2 publication Critical patent/WO2010100437A2/en
Publication of WO2010100437A9 publication Critical patent/WO2010100437A9/en
Publication of WO2010100437A3 publication Critical patent/WO2010100437A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]

Definitions

  • the invention relates to genetically modified cells and their use in the production of polypeptides, for example recombinant polypeptides and monoclonal antibodies.
  • Glycosylphosphatidylinositol anchors ["GPI-anchors"] are post-translational modifications to proteins that add glycosylphosphatidylinositol which enable these proteins to anchor to the extracellular side of cell membranes.
  • extracellular proteins which have a GPI anchor do not have transmembrane or cytoplasmic domains.
  • GPI anchor proteins occur in all eukaryotes and form a diverse variety of proteins. All GPI-anchor proteins are initially synthesized with a transmembrane anchor which, after translocation across the endoplasmic reticulum, is cleaved and covalently linked to a preformed GPI anchor by a specific transamidase enzyme.
  • the modification of proteins by the addition of a GPI-anchor confers important properties on the protein since the addition of the lipid moiety allows the protein to be inserted into cell membranes thereby anchoring the protein thus increasing its effective local concentration.
  • GPI anchor sequence There are some general requirements for creating a synthetic GPI anchor sequence. These are a hydrophobic region at the C-terminus of the molecule (10-20 amino acids) not followed by a cluster of basic residues, a "spacer domain" of 7-10 residues preceding the hydrophobic region and small amino acids after the spacer region, where cleavage of the precursor and attachment of the anchor occurs.
  • the GPI anchor is preassembled and added to nascent protein in the endoplasmic reticulum. Concomitant with this step, the initial C-terminal peptide is removed so that the GPI anchor is covalently attached to a new C-terminal amino acid on the protein.
  • PGAP2 Post-GPI-Attachment to Proteins 2 is a Golgi/ER-resident membrane protein thought to be involved in the remodeling of GPI anchored proteins prior to plasma membrane insertion (Tashima and Maeda 2006). Previous studies have shown that PGAP2 deficient mutants have low surface expression of GPI-anchored proteins which was shown to be due to their secretion into the culture medium. GPI-APs were modified/cleaved by two reaction steps in the mutant cells. First, the GPI-anchor was converted to lyso-GPI before exiting the trans-Golgi-network.
  • phosphatidylinositol glycan anchor class A [PIG-A].
  • This enzyme is involved in the initial step in the production of N-acetylglucosaminyl phosphatidylinositol [GlcNac-PI] in the endoplasmic reticulum and in complex with other proteins initiates the reaction that results in the production of GlcNac-PI.
  • This disclosure relates to the genetic modification of eukaryotic cells to alter patterns of GPI modification of proteins.
  • the modified cells show enhanced production of proteins that are not typically GPI modified. This has application in the production of recombinant proteins and monoclonal antibodies from hybridomas.
  • a further advantage of expression systems that use these modified cells is that cell cultures comprising these cells have reduced shedding of GPI containing proteins into culture medium which is a problem associated with the expression and purification of recombinant protein.
  • GPI glycosylphosphatidylinositol
  • HCP has to be demonstrated to be removed from the product by costly downstream purification processes and associated assays.
  • a significant reduction in HCP burden is obtained by inhibition of cellular processes involved in GPI anchor synthesis.
  • genetic inhibition of PIG-A expression would result in a significant reduction or elimination of cell surface GPI-linked proteins and thus this component of HCP.
  • a eukaryotic cell that expresses a therapeutic polypeptide wherein the cell is modified which modification inhibits the expression of a gene or translation of a messenger RNA that encodes a polypeptide that functions in the addition of a glycosylphosphatidylinositol anchor to proteins expressed by the cell characterized in that the expression of the therapeutic polypeptide is enhanced.
  • said cell is a mammalian cell.
  • said mammalian cell is a primate cell, e.g. human or monkey, a rodent cell e.g. rat, mouse or hamster.
  • said cell is an insect cell.
  • said insect cell is of the genus Spodoptera; more preferably Spodoptera frugiperda.
  • said cell is a fungal cell, for example a yeast cell.
  • said cell is a hybridoma that produces a monoclonal antibody.
  • said gene encodes or mRNA encodes a polypeptide with glycosylphosphatidylinositol activity or a polypeptide that modifies proteins with a GPI anchor.
  • said gene is represented by the nucleotide sequence as shown in Figure 9 [SEQ ID NO: 1] or a nucleic acid molecule that hybridizes under stringent hybridization conditions to a nucleic acid molecule represented by the nucleotide sequence represented in Figure 9 [SEQ ID NO: 1].
  • said gene is represented by the nucleotide sequence as shown in Figure 10 [SEQ ID NO: 2] or a nucleic acid molecule that hybridizes under stringent hybridization conditions to a nucleic acid molecule represented by the nucleotide sequence represented in Figure 10 [SEQ ID NO: 2].
  • Hybridization of a nucleic acid molecule occurs when two complementary nucleic acid molecules undergo an amount of hydrogen bonding to each other.
  • the stringency of hybridization can vary according to the environmental conditions surrounding the nucleic acids, the nature of the hybridization method, and the composition and length of the nucleic acid molecules used. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001); and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology — Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993).
  • the T m is the temperature at which 50% of a given strand of a nucleic acid molecule is hybridized to its complementary strand. The following is an exemplary set of hybridization conditions and is not limiting:
  • Hybridization 6x SSC at RT to 55°C for 16-20 hours
  • PCR polymerase chain reaction
  • Further methods include antibody based detection.
  • said gene is partially or entirely disrupted such that expression of the gene is substantially or completely inhibited.
  • said cell is modified by transfection of an antisense nucleic acid; preferably an antisense RNA comprising modified nucleotides.
  • said cell is modified by transfection of a small inhibitory RNA [siRNA] or short hairpin RNA [shRNA].
  • siRNA small inhibitory RNA
  • shRNA short hairpin RNA
  • RNA 1 also referred to as small inhibitory/interfering RNA (siRNA) or short hairpin RNA [shRNA], into a cell which results in the destruction of mRNA complementary to the sequence included in the siRNA/shRNA molecule.
  • the siRNA molecule comprises two complementary strands of RNA (a sense strand and an antisense strand) annealed to each other to form a double stranded RNA molecule.
  • the siRNA molecule is typically derived from exons of the gene which is to be ablated. The mechanism of RNA interference is being elucidated.
  • siRNA acts as a guide for the RNase complex to cleave mRNA complementary to the antisense strand of the siRNA thereby resulting in destruction of the mRNA.
  • said cell is modified by a siRNA molecule that is between 19 nucleotides [nt] and 29nt in length. More preferably still said siRNA molecule is between 21 nt and 27nt in length. Preferably said siRNA molecule is about 21 nt in length. In a preferred embodiment of the invention said siRNA consists of 21 bp.
  • said cell is modified by a siRNA molecule that is selected from the group of paired sense and antisense nucleotide sequences represented in table 5 by SEQ ID NOs: 29, 30, 32, 33, 35, 36, 38, 39, 41 , 42, 44, 45, 47, 48, 50, 51 , 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71 , 72, 74, 75, 77, 78, 80, 81 , 83, 84, 86, 87, 89, 90, 92, 93, 95, 96, 98, 99, 101 , 102, 104, 105, 107, 108, 110, 111 , 11 , 114, 116, 117, 119, 120, 122, 123, 125, 126, 128, 129, 131 , 132, 134, 135, 137, 138, 140, 141 , 143,
  • siRNA or shRNA includes modified nucleotides.
  • modified describes a nucleic acid molecule in which; i) at least two of its nucleotides are covalently linked via a synthetic internucleoside linkage (i.e., a linkage other than a phosphodiester linkage between the 5' end of one nucleotide and the 3' end of another nucleotide).
  • a synthetic internucleoside linkage i.e., a linkage other than a phosphodiester linkage between the 5' end of one nucleotide and the 3' end of another nucleotide.
  • said linkage may be the 5' end of one nucleotide linked to the 5' end of another nucleotide or the 3' end of one nucleotide with the 3' end of another nucleotide; and/or
  • a chemical group, such as cholesterol, not normally associated with nucleic acids has been covalently attached to the double stranded nucleic acid.
  • Preferred synthetic internucleoside linkages are phosphorothioates, alkylphosphonates, phosphorodithioates, phosphate esters, alkylphosphonothioates, phosphoramidates, carbamates, phosphate triesters, acetamidates, peptides, and carboxymethyl esters.
  • modified nucleotides also encompasses nucleotides with a covalently modified base and/or sugar.
  • modified nucleotides include nucleotides having sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5 1 position.
  • modified nucleotides may also include 2' substituted sugars such as 2'-O-methyl-; 2-O-alkyl; 2-O-allyl; 2'-S-alkyl; 2'-S-allyl; 2'- fluoro-; 2'-halo or 2;azido-ribose, carbocyclic sugar analogues a-anomeric sugars; epimeric, sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, and sedoheptulose.
  • 2' substituted sugars such as 2'-O-methyl-; 2-O-alkyl; 2-O-allyl; 2'-S-alkyl; 2'-S-allyl; 2'- fluoro-; 2'-halo or 2;azido-ribose, carbocyclic sugar analogues a-anomeric sugars; epimeric, sugars such as arabinose, xyloses or
  • Modified nucleotides include, by example and not by way of limitation, alkylated purines and/or pyrimidines; acylated purines and/or pyrimidines; or other heterocycles. These classes of pyrimidines and purines are known in the art and include, pseudoisocytosine; N4, N4-ethanocytosine; 8-hydroxy-N6-methyladenine; 4- acetylcytosine, 5-(carboxyhydroxylmethyl) uracil; 5-fluorouracil; 5-bromouracil;5- carboxymethylaminomethyl-2-thiouracil; 5 carboxymethylaminomethyl uracil; dihydrouracil; inosine; N6-isopentyl-adenine; l-methyladenine; 1-methylpseudouracil; 1- methylguanine; 2,2-dimethylguanine; 2-methyladenine; 2-methylguanine; 3- methylcytosine;
  • siRNA or shRNA is part of an expression vector adapted for eukaryotic expression; preferably said siRNA or shRNA is operably linked to at least one promoter sequence.
  • said cassette is provided with at least two promoters adapted to transcribe both sense and antisense strands of said nucleic acid molecule.
  • said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts thereby forming an shRNA.
  • said cell is further modified by transfection with a nucleic acid molecule that encodes a heterologous polypeptide.
  • a nucleic acid molecule that encodes a heterologous polypeptide Preferably said cell is transiently transfected. Alternatively said cell is stably transfected.
  • a heterologous polypeptide is a therapeutic polypeptide.
  • Therapeutic polypeptides which are "pharmaceutical polypeptides" (cytokines e.g. growth hormone; leptin; erythropoietin; prolactin; TNF 1 interleukins (IL), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-10, IL-11 ; the p35 subunit of IL-12, IL-13, IL-15; granulocyte colony stimulating factor (G-CSF); granulocyte macrophage colony stimulating factor (GM-CSF); ciliary neurotrophic factor (CNTF); cardiotrophin-1 (CT-1); leukemia inhibitory factor (LIF); oncostatin M (OSM); interferons, e.g. interferon ⁇ , interferon ⁇ , interferon ⁇ , interferon K and ⁇ interferon are included within the scope of the invention.
  • cytokines e.g. growth hormone; leptin; erythrop
  • Therapeutic polypeptides are also chemokines.
  • the term "chemokine gene” refers to a nucleotide sequence, the expression of which in a cell produces a cytokine.
  • the term chemokine refers to a group of structurally related low-molecular cytokines weight factors secreted by cells that are structurally related having mitogenic, chemotactic or inflammatory activities. They are primarily cationic proteins of 70 to 100 amino acid residues that share four conserved cysteine. These proteins can be sorted into two groups based on the spacing of the two amino-terminal cysteines. In the first group, the two cysteines are separated by a single residue (C-x-C), while in the second group; they are adjacent (C-C).
  • member of the 1 C-X-C chemokines include but are not limited to platelet factor 4 (PF4), platelet basic protein (PBP), interleukin-8 (IL-8), melanoma growth stimulatory activity protein (MGSA), macrophage inflammatory protein 2 (MIP-2), mouse Mig (m119), chicken 9E3 (or pCEF-4), pig alveolar macrophage chemotactic factors I and Il (AMCF-I and -II), pre-B cell growth stimulating factor (PBSF), and IP10.
  • PF4 platelet factor 4
  • PBP platelet basic protein
  • IL-8 interleukin-8
  • MGSA melanoma growth stimulatory activity protein
  • MIP-2 macrophage inflammatory protein 2
  • mouse Mig m119
  • chicken 9E3 or pCEF-4
  • pig alveolar macrophage chemotactic factors I and Il AMCF-I and -II
  • PBSF pre-B cell growth stimulating factor
  • Examples of members of the 'C-C group include but are not limited to monocyte chemotactic protein 1 (MCP-1), monocyte chemotactic protein 2 (MCP-2), monocyte chemotactic protein 3 (MCP-3), monocyte chemotactic protein 4 (MCP-4), macrophage inflammatory protein 1 ⁇ (MIP-1- ⁇ ), macrophage inflammatory protein 1 ⁇ (MIP-1- ⁇ ), macrophage inflammatory protein 1- ⁇ (MIP-1- ⁇ ), macrophage inflammatory protein 3 ⁇ (MIP-3- ⁇ , macrophage inflammatory protein 3 ⁇ (MIP-3- ⁇ ), chemokine (ELC), macrophage inflammatory protein-4 (MIP-4), macrophage inflammatory protein 5 (MIP-5), LD78 ⁇ , RANTES, SIS-epsilon (p500), thymus and activation-regulated chemokine (TARC), eotaxin, I-309, human protein HCC-1/NCC-2, human protein HCC- 3.
  • MIP-1
  • Therapeutic polypeptides which are "anti-angiogenic" polypeptides (e.g. angiostatin, inhibitors of vascular endothelial growth factor (VEGF) such as Tie 2 (as described in PNAS(USA)(1998) 95:8795-8800) and endostatin.
  • VEGF vascular endothelial growth factor
  • said therapeutic polypeptide is a growth factor.
  • said growth factor is insulin
  • said growth factor is insulin-like growth factor 1.
  • said therapeutic polypeptide is a peptide hormone.
  • said peptide hormone is selected from the group consisting of: GLP-1 , anti-diuretic hormone; oxytocin; gonadotropin releasing hormone, corticotrophin releasing hormone; calcitonin, glucagon, amylin, A-type natriuretic hormone, B-type natriuretic hormone, ghrelin, neuropeptide Y, neuropeptide YY 3 - 36, growth hormone releasing hormone, somatostatin; or homologues or analogues thereof.
  • said therapeutic polypeptide is selected from the group consisting of follicle stimulating hormone (FSH) ⁇ subunit, follicle stimulating hormone (FSH) ⁇ subunit, luteinizing hormone [LH] ⁇ subunit, thyroid stimulating hormone [TSH] ⁇ subunit.
  • said therapeutic polypeptide is an antigenic polypeptide for use in a vaccine.
  • subunit vaccines e.g. vaccines in which the immunogen is a purified protein
  • subunit vaccines e.g. vaccines in which the immunogen is a purified protein
  • the development of subunit vaccines has been the focus of considerable research in recent years.
  • the emergence of new pathogens and the growth of antibiotic resistance have created a need to develop new vaccines and to identify further candidate molecules useful in the development of subunit vaccines.
  • novel vaccine antigens from genomic and proteomic studies is enabling the development of new subunit vaccine candidates, particularly against bacterial pathogens and cancers.
  • therapeutic antibodies are also included within the scope of therapeutic polypeptides.
  • said antibodies are monoclonal antibodies or at least the active binding fragments thereof.
  • Therapeutic antibodies may be antibodies which bind and inhibit the activity of biological molecules, e.g. ligands or receptors.
  • Monoclonal antibodies may be humanised or chimeric antibodies.
  • a chimeric antibody is produced by recombinant methods to contain the variable region of an antibody with an invariant or constant region of a human antibody.
  • a humanised antibody is produced by recombinant methods to combine the complementarity determining regions (CDRs) of an antibody with both the constant (C) regions and the framework regions from the variable (V) regions of a human antibody.
  • said fragment is a Fab fragment.
  • said antibody is selected from the group consisting of: F(ab') 2 , Fab, Fv and Fd fragments; and antibodies comprising CDR3 regions.
  • said fragments are single chain antibody variable regions (scFV's) or domain antibodies.
  • scFV's single chain antibody variable regions
  • domain antibodies are the smallest binding part of an antibody (approximately 13kDa). Examples of this technology is disclosed in US6, 248, 516, US6, 291 , 158, US6.127, 197 and EP0368684 which are all incorporated by reference in their entirety.
  • a modified antibody, or variant antibody, and reference antibody may differ in amino acid sequence by one or more substitutions, additions, deletions, truncations which may be present in any combination.
  • preferred variants are those that vary from a reference polypeptide by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid by another amino acid of like characteristics.
  • amino acids are considered conservative replacements (similar): a) alanine, serine, and threonine; b) glutamic acid and asparatic acid; c) asparagine and glutamine d) arginine and lysine; e) isoleucine, leucine, methionine and valine and f) phenylalanine, tyrosine and tryptophan. Most highly preferred are variants which show enhanced biological activity.
  • heterologous polypeptide is an enzyme
  • said enzyme is selected from the group consisting of: tissue plasminogen actvator, activated protein C, deoxyribonuclease I , ⁇ glucocerebrosidase and ⁇ galactosidase, adenosine deaminase, arginine deiminase, urate oxidase, L asparaginase, factor Vila, factor IX, ⁇ Liduronidase, urostreptokinase , staphylokinases, ancrodkinase, acid ⁇ glucosidase, superoxide dismutase hyaluronidase, lactase, pancreatin, ⁇ galactosidase, galsulfase, idursulfase, asparaginase, lipase, uricase, methioninase, streptokinase, superoxide dismut
  • siRNA or shRNA designed with reference to a nucleotide sequence represented in Figure 9 or 10 , or a nucleic acid molecule that hybridizes under stringent hybridization conditions to a nucleic acid molecule represented by the nucleotide sequence represented in Figure 9 or 10.
  • RNA or shRNA molecule is between 19 nucleotides [nt] and 29nt in length. More preferably still said RNA molecule is between 21 nt and 27nt in length. Preferably said RNA molecule is about 21 nt in length.
  • a nucleic acid molecule comprising a transcription cassette wherein said cassette includes a nucleotide sequence designed with reference to Figure 9 [SEQ ID NO: 1] or 10 [SEQ ID NO: 2] and is adapted for expression by provision of at least one promoter operably linked to said nucleotide sequence such that both sense and antisense molecules are transcribed from said cassette.
  • said cassette is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette wherein said sense and antisense nucleic acid molecules are adapted to anneal over at least part or all of their length to form a siRNA or shRNA.
  • said cassette is provided with at least two promoters adapted to transcribe both sense and antisense strands of said nucleic acid molecule.
  • said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts thereby forming an shRNA.
  • said cassette includes one or more of the following nucleotide sequences: i) 5 1 - TGGGACTTCGGAAACAATTCTCAAGAGAAATTGTTTCCGAAGTCCCACC
  • a vector comprising a transcription cassette according to the invention.
  • Vectors may also be viral or non-viral and are available from a number of commercial sources readily available to a person -skilled in the art.
  • the vectors may be plasmids which can be episomal or integrating.
  • siRNA or shRNA designed with reference to a nucleotide sequence as represented in Figure 9 [SEQ ID NO: 1] or 10 [SEQ ID NO: 2] in the production of recombinant protein production.
  • said nucleotide sequence is selected from the from the group of paired sense and antisense nucleotide sequences represented in table 5 by SEQ ID NOs: 29, 30, 32, 33, 35, 36, 38, 39, 41 , 42, 44, 45, 47, 48, 50, 51 , 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71 , 72, 74, 75, 77, 78, 80, 81 , 83, 84, 86, 87, 89, 90, 92, 93, 95, 96, 98, 99, 101 , 102, 104, 105, 107, 108, 110, 111 , 11 , 114, 116, 117, 119, 120, 122, 123, 125, 126, 128, 129, 131 , 132, 134, 135, 137, 138, 140, 141 , 143, 144,
  • a cell culture comprising a cell according to the invention.
  • a cell culture vessel comprising a cell according to the invention.
  • a method for the recombinant production of a polypeptide comprising: i) providing a cell culture vessel comprising a cell according to the invention; ii) culturing the cell under conditions that facilitate the production of recombinant protein; and optionally iii) isolating said recombinant protein from the cell or cell culture medium.
  • Figure 1 Relative luciferase units detected 48hrs post-transfection. 5XIO 5 CHO-S cells were transiently transfected with 200ng of pMetLuc +/- 5pmols siRNA per well of a 24 well plate. Media samples were removed and filtered through a 0.45uM spin column to remove cellular debris. Error bars represent the standard deviation of the mean calculated from three transfection replicates;
  • FIG. 1 Relative levels of SEAP activity detected 48hrs post-transfection.
  • 5XIO 5 CHO-S cells were transiently transfected with 200ng of pSEAP2 +/- 5pmols siRNA per well of a 24 well plate. Media samples were removed and filtered through a 0.45uM spin column to remove cellular debris. Error bars represent the standard deviation of the mean calculated from three transfection replicates;
  • FIG. 3 Relative Fluorescence units detected 48hrs post-transfection. 5XIO 5 CHO-S cells were transiently transfected with 200ng of pTurboGFP +/- ⁇ pmols siRNA per well of a 24 well plate. Error bars represent the standard deviation of the mean calculated from three transfection replicates;
  • FIG. 6 Relative luciferase units detected 24hrs post-transfection. 5XIO 5 CHO-S cells were transiently transfected with 200ng of pMetLuc +/- 5pmols siRNA per well of a 24 well plate. Media samples were removed and filtered through a 0.45uM spin column to remove cellular debris. Error bars represent the standard deviation of the mean calculated from three transfection replicates;
  • Figure 7 Relative luciferase units detected 24hrs post-transfection. 5XIO 5 CHO-S cells were transiently transfected with 200ng of pMetLuc +/- 20pmol AS per well of a 24 well plate. Media samples were removed and filtered through a 0.45uM spin column to remove cellular debris. Error bars represent the standard deviation of the mean calculated from three transfection replicates;
  • Figure 8 Mean relative luminescence units detected 48hrs post-transfection. 5X10 5 CHO- S cells were transiently transfected with 200ng of pMetLuc +/- ⁇ pmols siRNA per well of a 24 well plate. Media samples were removed and filtered through a 0.45uM spin column to remove cellular debris; and
  • Figure 9 Chinese Hamster Ovary PGAP2 full length cDNA sequence showing ORF underlined and in upper case
  • Figure 10 Human PIG A full length cDNA sequence;
  • Figure 11 illustrates GFP fluoresence of cells transfected with PIG-A siRNA;
  • Figure 12 shows cell associated fluorescently labelled pDNA 48hrs post-transfection as measured by flow-cytometry.
  • E.coli Strains E.coli Strains; DH5alpha (Invitrogen, UK) and XLI Blue chemically competent cells.
  • pSecTag ⁇ nk- A mammalian expression vector containing the CMV immediate early promoter. This vector allows the selection of isogenic stable clones owing to the presence of a FIp recombinase site in the vector backbone. • pGHSecGH+/-Thy1
  • p0G44- Plasmid contains the FIp recombinase gene for production of stable clones using the FIp-In system. No selectable markers present in order to mitigate against sequence excision.
  • CHO- S cells (Invitrogen) were maintained in CD-CHO (serum free media) and incubated at 37°C in a 5% CO 2 shaker. All media were supplemented with 2mM L-glutamine (Invitrogen).
  • Adherant CHO Flp-in Cells were passaged by mild trypsin treatment at 70- 90% confluency.
  • the medium was removed, and the cells were washed in PBS (0.137M NaCI, 2.7mM KCI, 12mM NaHPO 4 , and 1.76mM KH 2 PO 4 ).
  • the cells were incubated with Trypsin-EDTA (Gibco) for 2-5 minutes at 37°C and dislodged by gently tapping the side of the flask.
  • the cells were then resuspended in 10 % (v/v) FCS- containing medium.
  • the cells were resuspended in the appropriate medium; cells were then counted using a Viability analyzer (Vi-CeII) and plated out at the required cell density.
  • CHO-S cells were grown to around 5X10 6 /ml before passaging.
  • the required number of cells were then transferred to a 15 ml falcon tube (Nunc) and centrifuged at IOOOrpm for 5 minutes.
  • the cells were then resuspended in fresh CD-CHO media at a concentration of 1X10 7 VmI. 1 ml or 0.5ml of the resuspended cells were then transferred to 24mls or 12mls of CD-CHO media respectively in an Erlen-Meyer shake flask (Corning).
  • CHO cells were cryopreserved at low passage number. Briefly, CHO-FIp In cells were trypsinised, spun down and resuspended in 90% FCS (v/v) and 10% (v/v) DMSO. Cells were frozen in cryogenic tubes at -80 0 C for 24-72 hours prior to final transfer to liquid nitrogen (-196 0 C). In order to recover the frozen cells, cells were thawed rapidly by holding the cryogenic tube for a few minutes in a 37°C water bath, washed twice in pre- warmed 10% (v/v) FCS containing medium and plated out at the same density as prior to freezing.
  • CHO-S cells were frozen at a concentration of 1X10 7 cells per ml in freezing solution (CD-CHO, 10% v/v DMSO). CHO-S cells were recovered in the same way as CHO-FIp In cells. Bacterial cell growth and storage
  • E.coli Escherichia coli
  • All Escherichia coli (E.coli) strains were grown in LB medium, 2YT medium or SB medium containing the appropriate antibiotic(s) in an orbital shaker at 37°C.
  • E.coli cells When plated, E.coli cells were allowed to grow on agar plates (LB+1.5% agar) at 37°C.
  • glycerol stocks of appropriate strains were made by mixing 250 ⁇ l of neat sterile glycerol with 750 ⁇ l of the bacterial culture in a 1.5ml eppendorf tube and subsequently the cells were frozen at -80 0 C.
  • RNA sequences which are able to direct GPI anchoring of the protein of interest.
  • the technique used here utilises polymerase chain reaction (PCR) amplification to prepare the PAS sequence and the sequence of the protein of interest sequentially.
  • the PAS and protein sequences are subsequently fused by using oligos that overlap with the 5' end of the PAS and the 3' end of the protein of interest.
  • oligos are used to create restriction sites that allow the fused protein to be readily subcloned into a eukaryotic expression vector.
  • the PAS sequence clones were obtained from a previously created GHBP_Thy1 containing plasmid.
  • Primer 1 Contains 15-20 bp at its 3' end that is homologous to the 5' end of the gene encoding the protein of interest.
  • the 5' end of the primer contains a restriction site (e.g., H/ndlll).
  • Primer 2 Contains 15-20 bp at its 3' end that will hybridize with the 3 1 end of the gene encoding the protein of interest.
  • the 5' end of the primer contains a 15-20 bp hybridizing to the 5 1 end of the PAS.
  • Primer 3. Contains 15-20 bp at its 3' end that is homologous to the 5' end of the PAS.
  • the 3' end of the primer contains 15-20 bp homologous to the 3' end of the gene encoding the protein of interest.
  • Primer 4. Contains 15-20 bp at its 3' end that will hybridize with the 3' end of the PAS.
  • the 5' end of the primer contains a restriction site (e.g., BamH ⁇ ).
  • Vectors constructed using this method were GPI linked variants of a GH-GHR chimera (1 B7) molecule, GH, and Luciferase ⁇ Metrida Longa). The correct fusion constructs were then confirmed by DNA sequencing.
  • CHO-S cells (Invitrogen) were then transfected with the modified vector using Lipofectamine 2000 based protocol. Stable transfectants are isolated by their resistance to the antibiotic Hygromycin B, and expression was verified clones by flow cytometry, western blotting and ELISA methodologies. The selected cells can then be grown up to high density and the protein assayed for.
  • Protein samples were fractioned by sodium dodecyl sulphate/polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions and both resolving and stacking gel were prepared as in Shambrook et al. The concentration of the resolving gel was determined based on the size of the proteins to be detected. A 4% stacking gel was used to concentrate the samples. Bio-Rad prestained markers were run alongside the samples for protein size determination. The samples were denatured by heat at 80 ° C in laemmli sample buffer for 5 minutes and loaded on the gel.
  • SDS-PAGE sodium dodecyl sulphate/polyacrylamide gel electrophoresis
  • the gel cassette was set up in the electrophoresis tank with the running buffer (25mM Tris Base, 19OmM glycine, and 17mM SDS) acting as a conductor between the gel and both the anode and cathode. Electrophoresis was performed at 35mA per gel with constant current until the dye-front reached the base of the gel.
  • running buffer 25mM Tris Base, 19OmM glycine, and 17mM SDS
  • the migrated proteins on the SDS-PAGE gel were transferred to a PVDF membrane (Invitrogen) preactivated with methanol (Sigma Aldrich) by loading the gel back into the electrophoresis tank and carrying out electrophoresis for a further 1 hour at 100 volts (constant) in transfer buffer (48mM Tris Base, 39mM glycine, 0.037% SDS v/v, 20% methanol v/v).
  • the membrane was then extensively washed in Phosphate buffer saline- 0.2% v/v Tween, pH 8.0 (PBS-T) and incubated overnight at 4 ° C in PBS-T with 5% BSA (w/v) or skimmed milk powder to avoid non-specific binding of proteins.
  • the blocked membrane was washed three times in 25mls of PBS-T and subjected to incubation with primary antibody (1 :15000 mouse anti-human GH) in PBS-T+1% (w/v) milk powder for 1 hour on a rotating table. After three washes of 10 minutes with PBS-T, the membrane was incubated in PBS-T containing 1% milk powder (w/v) and the appropriate species specific secondary antibody linked to horseradish peroxidase (HRP) (1 :20000 rabbit anti-mouse IgG conjugated with HRP). The membrane was then washed in large volume of PBS-T three times for 15 minutes prior to detection of chemiluminescence.
  • primary antibody 1 :15000 mouse anti-human GH
  • HRP horseradish peroxidase
  • the membrane was placed on an acetate sheet and band detection carried out via a digital gel imaging device.
  • the optimal exposure time was dependent on the antibodies used and the amount of antigen on the membrane, and varied between experiments. Thus exposure times were determined empirically by setting the imager to take a range of different exposures. The image with the greatest signal to noise ratio was then selected for image capture.
  • the protein content of a sample was quantified by Bradford protein assay (BioRad, UK).
  • CHO-S cells (Invitrogen) were cultured in CD-CHO supplemented with 6 mM L- glutamine (Invitrogen) for no more than 15 passages.
  • siRNA targeting sequences previously described were mixed with Lipofectamine 2000 reagent (Invitrogen) was delivered to 100,000 cells in a 24-well plate format. Culture media were changed 24 hours after transfection. After 48 hours, total RNA was extracted using the Qiagen RNAeasy Total RNA Isolation Kit with gDNA cleanup by TURBO DNaseTM (Ambion).
  • Real-Time RT-PCR cDNA was synthesized from total RNA using the High CapacityTM First Strand cDNA Synthesis Kit (Applied Biosystems. Real-time PCR was performed using SYBR Green qPCR Master Mixes on the Applied Biosystems Fast-7500 real-time PCR system. GAPDH was chosen as the housekeeping gene for normalization. Threshold cycle values (Ct) were collected and used. For realative qRT-PCR analysis. Gene knockdown efficiency was calculated in the multi-step process described in the text below. Steps for Data Analysis
  • Step 1 Calculate the mean C ⁇ of the technical replicates.
  • Step 2 Calculate the ⁇ C T for both Experimental (anti-PGAP2 siRNA treated) and C ⁇
  • Step 3 Calculate the mean ⁇ C T for the negative controls (NC ⁇ C T ).
  • CHO-S cells (Invitrogen) were co-transfected with either 10 or 20 pmols per 10 ⁇ 6 cells of chemically synthesised siRNA and 500ng/well of pTGFP (Evrogen) using Lipofectamine 2000 as described by the manufactures protocol.
  • Anti-PIGA siRNA was used at 10 and 20 pmol per 10 ⁇ 6 cells.
  • IOpmols per 10 ⁇ 6 cells of anti-PGAP2 SiRNAI was used as a comparison.
  • IOpmols per 10 ⁇ 6 cells of Negative control siRNA (scrambled sequence) was also co-transfected in order to control for any non-specific effects. 24hrs after transfection RFU values were obtained by plate reader to access overall fluorescence from the cells. Background fluorescence values obtained from triplicate wells of untransfected CHO cells were then subtracted from the transfected values of each well. The error bars represent the standard deviation from the mean of triplicate transfection values; see Figure 11. Summary of PIG A siRNA constructs
  • Fluorescently labelled-DNA analysis shows enhanced DNA uptake in the prescience of SiRNA against PGAP2
  • anti_PGAP2 siRNA The effect of anti_PGAP2 siRNA on cellular DNA uptake was assessed using fluorescently labelled DNA. This allows the quantification of cell associated DNA complexes i.e. those complexes which have been or are in the process of being transfected into the cell. Furthermore this change in plasmid quantity associated with the cells may be correlated with the product titre since the plasmid remains expression competent after being labelled.
  • DNA labelling was carried out using the Mirus Bio (Madison) Label IT Nucleic Acid Labelling Kit.
  • the DNA labelling reaction was set up as described in the manufacturers protocol using pSEAP2 as the substrate DNA. This mixture was then incubated at 37 0 C for 1 hour before being ethanol precipitated as per manufactures protocol.
  • the resulting labelled pSEAP2 DNA was subsequently quantified on a spectrophotometer.
  • results appear to show a very significant increase in DNA uptake when fluorescently labelled plasmid DNA is co-transfected in the presence of SiRNA against PGAP2. This is consistent with the increase in product titre accompanying anti-PGAP2 siRNA co- transfection.

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

We describe genetically modified cells which have been modified to inhibit the addition of glycosylphosphatidylinositol and their use in the production of therapeutic polypeptides, for example recombinant polypeptides or monoclonal antibodies.

Description

Production of Protein
The invention relates to genetically modified cells and their use in the production of polypeptides, for example recombinant polypeptides and monoclonal antibodies.
Introduction
The large scale production of proteins, for example enzymes, polypeptide hormones and monoclonal antibodies, requires a high standard of quality control since many of these proteins are administered to humans. Moreover, the development of vaccines, particularly subunit vaccines, requires the production of large amounts of pure protein free from contaminating antigens which may provoke anaphylaxis. The production of recombinant protein in cell expression systems is based either on prokaryotic cell expression or eukaryotic cell expression. The latter is preferred when post-translation modifications to the protein are required. The addition of glycosylphosphatidylinositol is one example of a post-translational modification.
Background
Glycosylphosphatidylinositol anchors ["GPI-anchors"] are post-translational modifications to proteins that add glycosylphosphatidylinositol which enable these proteins to anchor to the extracellular side of cell membranes. Typically, extracellular proteins which have a GPI anchor do not have transmembrane or cytoplasmic domains. GPI anchor proteins occur in all eukaryotes and form a diverse variety of proteins. All GPI-anchor proteins are initially synthesized with a transmembrane anchor which, after translocation across the endoplasmic reticulum, is cleaved and covalently linked to a preformed GPI anchor by a specific transamidase enzyme. The modification of proteins by the addition of a GPI-anchor confers important properties on the protein since the addition of the lipid moiety allows the protein to be inserted into cell membranes thereby anchoring the protein thus increasing its effective local concentration.
There are some general requirements for creating a synthetic GPI anchor sequence. These are a hydrophobic region at the C-terminus of the molecule (10-20 amino acids) not followed by a cluster of basic residues, a "spacer domain" of 7-10 residues preceding the hydrophobic region and small amino acids after the spacer region, where cleavage of the precursor and attachment of the anchor occurs. The GPI anchor is preassembled and added to nascent protein in the endoplasmic reticulum. Concomitant with this step, the initial C-terminal peptide is removed so that the GPI anchor is covalently attached to a new C-terminal amino acid on the protein.
PGAP2 (Post-GPI-Attachment to Proteins 2) is a Golgi/ER-resident membrane protein thought to be involved in the remodeling of GPI anchored proteins prior to plasma membrane insertion (Tashima and Maeda 2006). Previous studies have shown that PGAP2 deficient mutants have low surface expression of GPI-anchored proteins which was shown to be due to their secretion into the culture medium. GPI-APs were modified/cleaved by two reaction steps in the mutant cells. First, the GPI-anchor was converted to lyso-GPI before exiting the trans-Golgi-network. Second, lyso-GPI-APs were cleaved by a phospholipase D after transport to the plasma membrane (Tashima and Maeda 2006). Therefore, PGAP2 deficiency caused transport to the cell surface of lyso-GPI-APs that were sensitive to a phospholipase D. These results demonstrate that PGAP2 is involved in the processing of GPI-APs required for their stable expression at the cell surface. During experiments aimed at increasing GPI- anchored protein harvest we have surprisingly found that inhibition of PGAP2 gene expression resulted in increase in the expression levels of non GPI-anchored proteins. A further example of a protein involved in GPI anchor biosynthesis is phosphatidylinositol glycan anchor class A [PIG-A]. This enzyme is involved in the initial step in the production of N-acetylglucosaminyl phosphatidylinositol [GlcNac-PI] in the endoplasmic reticulum and in complex with other proteins initiates the reaction that results in the production of GlcNac-PI.
This disclosure relates to the genetic modification of eukaryotic cells to alter patterns of GPI modification of proteins. The modified cells show enhanced production of proteins that are not typically GPI modified. This has application in the production of recombinant proteins and monoclonal antibodies from hybridomas. A further advantage of expression systems that use these modified cells is that cell cultures comprising these cells have reduced shedding of GPI containing proteins into culture medium which is a problem associated with the expression and purification of recombinant protein. Approximately 1% of all proteins encoded by eukaryotic genomes, or -10-20% of all membrane- associated proteins are post-translationally modified at their C-terminus by glycosylphosphatidylinositol (GPI) anchors, a modification which tethers the extracellular protein to the cell surface. However, this anchor is known to be highly susceptible to cleavage by cellular phospholipases, which sheds the protein into the extracellular space (unlike integral transmembrane proteins for example). Thus, for cultures of mammalian cells (such as CHO cells) a substantial proportion of extracellular host cell derived protein (HCP) is derived from GPI-anchored proteins. In commercial manufacturing processes utilising mammalian cells as production vehicles, HCP has to be demonstrated to be removed from the product by costly downstream purification processes and associated assays. A significant reduction in HCP burden is obtained by inhibition of cellular processes involved in GPI anchor synthesis. For example, genetic inhibition of PIG-A expression would result in a significant reduction or elimination of cell surface GPI-linked proteins and thus this component of HCP.
Statements of Invention
According to an aspect of the invention there is provided a eukaryotic cell that expresses a therapeutic polypeptide wherein the cell is modified which modification inhibits the expression of a gene or translation of a messenger RNA that encodes a polypeptide that functions in the addition of a glycosylphosphatidylinositol anchor to proteins expressed by the cell characterized in that the expression of the therapeutic polypeptide is enhanced.
In a preferred embodiment of the invention said cell is a mammalian cell.
Preferably said mammalian cell is a primate cell, e.g. human or monkey, a rodent cell e.g. rat, mouse or hamster.
In an alternative preferred embodiment of the invention said cell is an insect cell.
Preferably said insect cell is of the genus Spodoptera; more preferably Spodoptera frugiperda.
In a still further alternative embodiment of the invention said cell is a fungal cell, for example a yeast cell.
In a further preferred embodiment of the invention said cell is a hybridoma that produces a monoclonal antibody.
The production of monoclonal antibodies using hybridoma cells is well-known in the art. The methods used to produce monoclonal antibodies are disclosed by Kohler and Milstein in Nature 256, 495-497 (1975) and also by Donillard and Hoffman, "Basic Facts about Hybridomas" in Compendium of Immunology V.ll ed. by Schwartz, 1981 , which are incorporated by reference.
In a preferred embodiment of the invention said gene encodes or mRNA encodes a polypeptide with glycosylphosphatidylinositol activity or a polypeptide that modifies proteins with a GPI anchor.
Preferably said gene is represented by the nucleotide sequence as shown in Figure 9 [SEQ ID NO: 1] or a nucleic acid molecule that hybridizes under stringent hybridization conditions to a nucleic acid molecule represented by the nucleotide sequence represented in Figure 9 [SEQ ID NO: 1].
Alternatively said gene is represented by the nucleotide sequence as shown in Figure 10 [SEQ ID NO: 2] or a nucleic acid molecule that hybridizes under stringent hybridization conditions to a nucleic acid molecule represented by the nucleotide sequence represented in Figure 10 [SEQ ID NO: 2].
Hybridization of a nucleic acid molecule occurs when two complementary nucleic acid molecules undergo an amount of hydrogen bonding to each other. The stringency of hybridization can vary according to the environmental conditions surrounding the nucleic acids, the nature of the hybridization method, and the composition and length of the nucleic acid molecules used. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001); and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology — Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993). The Tm is the temperature at which 50% of a given strand of a nucleic acid molecule is hybridized to its complementary strand. The following is an exemplary set of hybridization conditions and is not limiting:
Very High Stringency (allows sequences that share at least 90% identity to hybridize)
Hybridization: 5x SSC at 65°C for 16 hours Wash twice: 2x SSC at room temperature (RT) for 15 minutes each
Wash twice: 0.5x SSC at 65°C for 20 minutes each High Stringency (allows sequences that share at least 80% identity to hybridize) Hybridization: 5x-6x SSC at 65°C-70°C for 16-20 hours
Wash twice: 2x SSC at RT for 5-20 minutes each Wash twice: 1x SSC at 55°C-70°C for 30 minutes each
Low Stringency (allows seguences that share at least 50% identity to hybridize) Hybridization: 6x SSC at RT to 55°C for 16-20 hours
Wash at least twice: 2x-3x SSC at RT to 55°C for 20-30 minutes each.
Means to monitor expression are known in the art. For example, polymerase chain reaction [PCR] methods such as quantitative PCR. Further methods include antibody based detection.
In a preferred embodiment of the invention said gene is partially or entirely disrupted such that expression of the gene is substantially or completely inhibited.
In an alternative preferred embodiment of the invention said cell is modified by transfection of an antisense nucleic acid; preferably an antisense RNA comprising modified nucleotides.
In an alternative preferred embodiment of the invention said cell is modified by transfection of a small inhibitory RNA [siRNA] or short hairpin RNA [shRNA].
A technique to specifically ablate gene function is through the introduction of double stranded RNA1 also referred to as small inhibitory/interfering RNA (siRNA) or short hairpin RNA [shRNA], into a cell which results in the destruction of mRNA complementary to the sequence included in the siRNA/shRNA molecule. The siRNA molecule comprises two complementary strands of RNA (a sense strand and an antisense strand) annealed to each other to form a double stranded RNA molecule. The siRNA molecule is typically derived from exons of the gene which is to be ablated. The mechanism of RNA interference is being elucidated. Many organisms respond to the presence of double stranded RNA by activating a cascade that leads to the formation of siRNA. The presence of double stranded RNA activates a protein complex comprising RNase III which processes the double stranded RNA into smaller fragments (siRNAs, approximately 21-29 nucleotides in length) which become part of a ribonucleoprotein complex. The siRNA acts as a guide for the RNase complex to cleave mRNA complementary to the antisense strand of the siRNA thereby resulting in destruction of the mRNA.
In a preferred embodiment of the invention said cell is modified by a siRNA molecule that is between 19 nucleotides [nt] and 29nt in length. More preferably still said siRNA molecule is between 21 nt and 27nt in length. Preferably said siRNA molecule is about 21 nt in length. In a preferred embodiment of the invention said siRNA consists of 21 bp.
In a preferred embodiment of the invention said cell is modified by a siRNA molecule that is selected from the group of paired sense and antisense nucleotide sequences represented in table 5 by SEQ ID NOs: 29, 30, 32, 33, 35, 36, 38, 39, 41 , 42, 44, 45, 47, 48, 50, 51 , 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71 , 72, 74, 75, 77, 78, 80, 81 , 83, 84, 86, 87, 89, 90, 92, 93, 95, 96, 98, 99, 101 , 102, 104, 105, 107, 108, 110, 111 , 11 , 114, 116, 117, 119, 120, 122, 123, 125, 126, 128, 129, 131 , 132, 134, 135, 137, 138, 140, 141 , 143, 144, 146, 147, 149, 150, 152, 153, 155, 156, 158, 159, 161 , 162, 164, 165, 167, 168, 170, 171 , 173, 174, 176, 177, 179, 180, 182, 183, 185, 186, 188, 189, 191 , 192, 194, 195, 197, 198, 200, 202, 203, 205, 206, 208, 209, 211 , 212, 214, 215, 217, 218, 220, 221 , 223, 224, 226, 227, 229, 230, 232, 233.
In a preferred embodiment of the invention said RNA comprise or consists of the nucleotide sequences:
i) GGUGGGACUUCGGAAACAA [SEQ ID NO: 3]
ii) UCGCGGCAUCCCUCAGUUA [SEQ ID NO: 4]
iii) GUCUCAACGUGGUGGAGAA [SEQ ID NO: 5]
In an alternative preferred embodiment of the invention said RNA comprises or consists of the nucleotide sequences:
i) AGCCACAUUUACCAGCUCU [SEQ ID NO: 6] ii) AGAGCUGGUAAAUGUGGCU [SEQ ID NO: 7] iii) GACAAUGGGGCUUCAGACA [SEQ ID NO:8] iv) UGUCUGAAGCCCCAUUGUC [SEQ ID NO: 9] In a preferred embodiment of the invention said siRNA or shRNA includes modified nucleotides.
The term "modified" as used herein describes a nucleic acid molecule in which; i) at least two of its nucleotides are covalently linked via a synthetic internucleoside linkage (i.e., a linkage other than a phosphodiester linkage between the 5' end of one nucleotide and the 3' end of another nucleotide). Alternatively or preferably said linkage may be the 5' end of one nucleotide linked to the 5' end of another nucleotide or the 3' end of one nucleotide with the 3' end of another nucleotide; and/or
ii) a chemical group, such as cholesterol, not normally associated with nucleic acids has been covalently attached to the double stranded nucleic acid.
iii) Preferred synthetic internucleoside linkages are phosphorothioates, alkylphosphonates, phosphorodithioates, phosphate esters, alkylphosphonothioates, phosphoramidates, carbamates, phosphate triesters, acetamidates, peptides, and carboxymethyl esters.
The term "modified" also encompasses nucleotides with a covalently modified base and/or sugar. For example, modified nucleotides include nucleotides having sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 51 position. Thus modified nucleotides may also include 2' substituted sugars such as 2'-O-methyl-; 2-O-alkyl; 2-O-allyl; 2'-S-alkyl; 2'-S-allyl; 2'- fluoro-; 2'-halo or 2;azido-ribose, carbocyclic sugar analogues a-anomeric sugars; epimeric, sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, and sedoheptulose.
Modified nucleotides are known in the art and include, by example and not by way of limitation, alkylated purines and/or pyrimidines; acylated purines and/or pyrimidines; or other heterocycles. These classes of pyrimidines and purines are known in the art and include, pseudoisocytosine; N4, N4-ethanocytosine; 8-hydroxy-N6-methyladenine; 4- acetylcytosine, 5-(carboxyhydroxylmethyl) uracil; 5-fluorouracil; 5-bromouracil;5- carboxymethylaminomethyl-2-thiouracil; 5 carboxymethylaminomethyl uracil; dihydrouracil; inosine; N6-isopentyl-adenine; l-methyladenine; 1-methylpseudouracil; 1- methylguanine; 2,2-dimethylguanine; 2-methyladenine; 2-methylguanine; 3- methylcytosine; 5-methylcytosine; N6-methyladenine; 7-methylguanine; 5- methylaminomethyl uracil; 5-methoxy amino methyl-2-thiouracil; β-D-mannosylqueosine; 5-methoxycarbonylmethyluracil; 5-methoxyuracil; 2 methylthio-N6-isopentenyladenine; uracil-5-oxyacetic acid methyl ester; psueouracil; 2-thiocytosine; 5-methyl-2 thiouracil, 2- thiouracil; 4-thiouracil; 5-methyluracil; N-uracil-5-oxyacetic acid methylester; uracil 5 — oxyacetic acid; queosine; 2-thiocytosine; 5-propyluracil; 5-propylcytosine; 5-ethyluracil; 5-ethylcytosine; 5-butyluracil; 5-pentyluracil; 5-pentylcytosine; and 2,6,-diaminopurine; methylpsuedouracil; 1 -methylguanine; 1-methylcytosine. Modified double stranded nucleic acids also can include base analogs such as C-5 propyne modified bases (see Wagner et al., Nature Biotechnology 14:840-844, 1996).
In an alternative preferred embodiment of the invention said siRNA or shRNA is part of an expression vector adapted for eukaryotic expression; preferably said siRNA or shRNA is operably linked to at least one promoter sequence.
In a preferred embodiment of the invention said vector is adapted by inclusion of a transcription cassette comprising a nucleic acid molecule wherein said cassette comprises a nucleotide sequence selected from the group consisting of:
i) 5'- TGGGACTTCGGAAACAATTCTCAAGAGAAATTGTTTCCGAAGTCCCACC
I I I I I I -3' [SEQ ID NO: 10] ii) 5'-GCGGCATCCCTCAGTTATT CTCAAGAGA AATAACTGAGGGATGCCGCGA
I I I I I I -31 [SEQ ID NO: 11] iii) 5'- CTCAACGTGGTGGAGAATTCTCAAGAGAAATTCTCCACCACGTTGAGAC
TTTTTT-31 [SEQ ID NO: 12]
which is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette wherein said sense and antisense nucleic acid molecules are adapted to anneal over at least part of their length to form an shRNA.
In a preferred embodiment of the invention said cassette is provided with at least two promoters adapted to transcribe both sense and antisense strands of said nucleic acid molecule. In a further preferred embodiment of the invention said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts thereby forming an shRNA.
In a preferred embodiment of the invention said cell is further modified by transfection with a nucleic acid molecule that encodes a heterologous polypeptide. Preferably said cell is transiently transfected. Alternatively said cell is stably transfected.
In a preferred embodiment of the invention said a heterologous polypeptide is a therapeutic polypeptide.
Therapeutic polypeptides which are "pharmaceutical polypeptides" (cytokines e.g. growth hormone; leptin; erythropoietin; prolactin; TNF1 interleukins (IL), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-10, IL-11 ; the p35 subunit of IL-12, IL-13, IL-15; granulocyte colony stimulating factor (G-CSF); granulocyte macrophage colony stimulating factor (GM-CSF); ciliary neurotrophic factor (CNTF); cardiotrophin-1 (CT-1); leukemia inhibitory factor (LIF); oncostatin M (OSM); interferons, e.g. interferon α, interferon β, interferon ε, interferon K and ω interferon are included within the scope of the invention.
Therapeutic polypeptides are also chemokines. The term "chemokine gene" refers to a nucleotide sequence, the expression of which in a cell produces a cytokine. The term chemokine refers to a group of structurally related low-molecular cytokines weight factors secreted by cells that are structurally related having mitogenic, chemotactic or inflammatory activities. They are primarily cationic proteins of 70 to 100 amino acid residues that share four conserved cysteine. These proteins can be sorted into two groups based on the spacing of the two amino-terminal cysteines. In the first group, the two cysteines are separated by a single residue (C-x-C), while in the second group; they are adjacent (C-C). Examples of member of the 1C-X-C chemokines include but are not limited to platelet factor 4 (PF4), platelet basic protein (PBP), interleukin-8 (IL-8), melanoma growth stimulatory activity protein (MGSA), macrophage inflammatory protein 2 (MIP-2), mouse Mig (m119), chicken 9E3 (or pCEF-4), pig alveolar macrophage chemotactic factors I and Il (AMCF-I and -II), pre-B cell growth stimulating factor (PBSF), and IP10. Examples of members of the 'C-C group include but are not limited to monocyte chemotactic protein 1 (MCP-1), monocyte chemotactic protein 2 (MCP-2), monocyte chemotactic protein 3 (MCP-3), monocyte chemotactic protein 4 (MCP-4), macrophage inflammatory protein 1 α (MIP-1-α), macrophage inflammatory protein 1 β (MIP-1-β), macrophage inflammatory protein 1-γ (MIP-1-γ), macrophage inflammatory protein 3 α (MIP-3-α, macrophage inflammatory protein 3 β (MIP-3-β), chemokine (ELC), macrophage inflammatory protein-4 (MIP-4), macrophage inflammatory protein 5 (MIP-5), LD78 β, RANTES, SIS-epsilon (p500), thymus and activation-regulated chemokine (TARC), eotaxin, I-309, human protein HCC-1/NCC-2, human protein HCC- 3.
Therapeutic polypeptides which are "anti-angiogenic" polypeptides (e.g. angiostatin, inhibitors of vascular endothelial growth factor (VEGF) such as Tie 2 (as described in PNAS(USA)(1998) 95:8795-8800) and endostatin.
In a further preferred embodiment of the invention said therapeutic polypeptide is a growth factor.
In an alternative embodiment of the invention said growth factor is insulin.
In a preferred embodiment of the invention said growth factor is insulin-like growth factor 1.
In a preferred embodiment of the invention said therapeutic polypeptide is a peptide hormone.
In a preferred embodiment of the invention said peptide hormone is selected from the group consisting of: GLP-1 , anti-diuretic hormone; oxytocin; gonadotropin releasing hormone, corticotrophin releasing hormone; calcitonin, glucagon, amylin, A-type natriuretic hormone, B-type natriuretic hormone, ghrelin, neuropeptide Y, neuropeptide YY3-36, growth hormone releasing hormone, somatostatin; or homologues or analogues thereof.
In an alternative preferred embodiment of the invention said therapeutic polypeptide is selected from the group consisting of follicle stimulating hormone (FSH) α subunit, follicle stimulating hormone (FSH) β subunit, luteinizing hormone [LH] β subunit, thyroid stimulating hormone [TSH] β subunit. In a yet further preferred embodiment of the invention said therapeutic polypeptide is an antigenic polypeptide for use in a vaccine.
Many modern vaccines are made from protective antigens of the pathogen or disease that are separated by purification or molecular cloning. These vaccines are known as
'subunit vaccines'. The development of subunit vaccines (e.g. vaccines in which the immunogen is a purified protein) has been the focus of considerable research in recent years. The emergence of new pathogens and the growth of antibiotic resistance have created a need to develop new vaccines and to identify further candidate molecules useful in the development of subunit vaccines. Likewise the discovery of novel vaccine antigens from genomic and proteomic studies is enabling the development of new subunit vaccine candidates, particularly against bacterial pathogens and cancers.
Also included within the scope of therapeutic polypeptides are therapeutic antibodies. Preferably said antibodies are monoclonal antibodies or at least the active binding fragments thereof. Therapeutic antibodies may be antibodies which bind and inhibit the activity of biological molecules, e.g. ligands or receptors. Monoclonal antibodies may be humanised or chimeric antibodies.
A chimeric antibody is produced by recombinant methods to contain the variable region of an antibody with an invariant or constant region of a human antibody. A humanised antibody is produced by recombinant methods to combine the complementarity determining regions (CDRs) of an antibody with both the constant (C) regions and the framework regions from the variable (V) regions of a human antibody.
In a preferred embodiment of the invention said fragment is a Fab fragment.
In a further preferred embodiment of the invention said antibody is selected from the group consisting of: F(ab')2, Fab, Fv and Fd fragments; and antibodies comprising CDR3 regions.
Preferably said fragments are single chain antibody variable regions (scFV's) or domain antibodies. If a hybridoma exists for a specific monoclonal antibody it is well within the knowledge of the skilled person to isolate scFv's from mRNA extracted from said hybridoma via RT PCR. Alternatively, phage display screening can be undertaken to identify clones expressing scFv's. Domain antibodies are the smallest binding part of an antibody (approximately 13kDa). Examples of this technology is disclosed in US6, 248, 516, US6, 291 , 158, US6.127, 197 and EP0368684 which are all incorporated by reference in their entirety. A modified antibody, or variant antibody, and reference antibody, may differ in amino acid sequence by one or more substitutions, additions, deletions, truncations which may be present in any combination. Among preferred variants are those that vary from a reference polypeptide by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid by another amino acid of like characteristics. The following non-limiting list of amino acids are considered conservative replacements (similar): a) alanine, serine, and threonine; b) glutamic acid and asparatic acid; c) asparagine and glutamine d) arginine and lysine; e) isoleucine, leucine, methionine and valine and f) phenylalanine, tyrosine and tryptophan. Most highly preferred are variants which show enhanced biological activity.
In a further alternative preferred embodiment of the invention said heterologous polypeptide is an enzyme.
In a preferred embodiment of the invention said enzyme is selected from the group consisting of: tissue plasminogen actvator, activated protein C, deoxyribonuclease I , β glucocerebrosidase and α galactosidase, adenosine deaminase, arginine deiminase, urate oxidase, L asparaginase, factor Vila, factor IX, α Liduronidase, urostreptokinase , staphylokinases, ancrodkinase, acid α glucosidase, superoxide dismutase hyaluronidase, lactase, pancreatin, α galactosidase, galsulfase, idursulfase, asparaginase, lipase, uricase, methioninase, streptokinase, superoxide dismutase and α-chymotrypsin.
According to an aspect of the invention there is provided a siRNA or shRNA designed with reference to a nucleotide sequence represented in Figure 9 or 10 , or a nucleic acid molecule that hybridizes under stringent hybridization conditions to a nucleic acid molecule represented by the nucleotide sequence represented in Figure 9 or 10.
In a preferred embodiment of the invention said siRNA or shRNA comprises a nucleic acid sequence selected from the group consisting of:
i) GGUGGGACUUCGGAAACAA [SEQ ID NO: 3] ϋ) UCGCGGCAUCCCUCAGUUA [SEQ ID NO: 4] iϋ) GUCUCAACGUGGUGGAGAA [SEQ ID NO: 5]
In a preferred embodiment of the invention said RNA or shRNA molecule is between 19 nucleotides [nt] and 29nt in length. More preferably still said RNA molecule is between 21 nt and 27nt in length. Preferably said RNA molecule is about 21 nt in length.
According to a further aspect of the invention there is provided a nucleic acid molecule comprising a transcription cassette wherein said cassette includes a nucleotide sequence designed with reference to Figure 9 [SEQ ID NO: 1] or 10 [SEQ ID NO: 2] and is adapted for expression by provision of at least one promoter operably linked to said nucleotide sequence such that both sense and antisense molecules are transcribed from said cassette.
In a preferred embodiment of the invention said cassette is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette wherein said sense and antisense nucleic acid molecules are adapted to anneal over at least part or all of their length to form a siRNA or shRNA.
In a preferred embodiment of the invention said cassette is provided with at least two promoters adapted to transcribe both sense and antisense strands of said nucleic acid molecule.
In an alternative preferred embodiment of the invention said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts thereby forming an shRNA.
In a preferred embodiment of the invention said cassette includes one or more of the following nucleotide sequences: i) 51- TGGGACTTCGGAAACAATTCTCAAGAGAAATTGTTTCCGAAGTCCCACC
I I I I I I -3' [SEQ ID NO: 10] ii) 51- GCGGCATCCCTCAGTTATTCTCAAGAGAAATAACTGAGGGATGCCGCGA
I I I I I I -3' [SEQ ID NO: 11] Hi) 51- CTCAACGTGGTGGAGAATTCTCAAGAGAAATTCTCCACCACGTTGAGAC I I I I I I -3' SEQ ID NO: 12]
According to a further aspect of the invention there is provided a vector comprising a transcription cassette according to the invention.
Vectors may also be viral or non-viral and are available from a number of commercial sources readily available to a person -skilled in the art. For example, the vectors may be plasmids which can be episomal or integrating.
According to a further aspect of the invention there is provided the use of a siRNA or shRNA designed with reference to a nucleotide sequence as represented in Figure 9 [SEQ ID NO: 1] or 10 [SEQ ID NO: 2] in the production of recombinant protein production.
In an alternative preferred embodiment of the invention said nucleotide sequence is selected from the from the group of paired sense and antisense nucleotide sequences represented in table 5 by SEQ ID NOs: 29, 30, 32, 33, 35, 36, 38, 39, 41 , 42, 44, 45, 47, 48, 50, 51 , 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71 , 72, 74, 75, 77, 78, 80, 81 , 83, 84, 86, 87, 89, 90, 92, 93, 95, 96, 98, 99, 101 , 102, 104, 105, 107, 108, 110, 111 , 11 , 114, 116, 117, 119, 120, 122, 123, 125, 126, 128, 129, 131 , 132, 134, 135, 137, 138, 140, 141 , 143, 144, 146, 147, 149, 150, 152, 153, 155, 156, 158, 159, 161 , 162, 164, 165, 167, 168, 170, 171 , 173, 174, 176, 177, 179, 180, 182, 183, 185, 186, 188, 189, 191 , 192, 194, 195, 197, 198, 200, 202, 203, 205, 206, 208, 209, 211 , 212, 214, 215, 217, 218, 220, 221 , 223, 224, 226, 227, 229, 230, 232, 233.
According to a further aspect of the invention there is provided a cell culture comprising a cell according to the invention.
According to a further aspect of the invention there is provided a cell culture vessel comprising a cell according to the invention.
According to a further aspect of the invention there is provided a method for the recombinant production of a polypeptide comprising: i) providing a cell culture vessel comprising a cell according to the invention; ii) culturing the cell under conditions that facilitate the production of recombinant protein; and optionally iii) isolating said recombinant protein from the cell or cell culture medium.
Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of the words, for example "comprising" and "comprises", means "including but not limited to", and is not intended to (and does not) exclude other moieties, additives, components, integers or steps.
Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.
Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.
An embodiment of the invention will now be described by example only and with reference to the following figures:
Figure 1 Relative luciferase units detected 48hrs post-transfection. 5XIO5CHO-S cells were transiently transfected with 200ng of pMetLuc +/- 5pmols siRNA per well of a 24 well plate. Media samples were removed and filtered through a 0.45uM spin column to remove cellular debris. Error bars represent the standard deviation of the mean calculated from three transfection replicates;
Figure 2 Relative levels of SEAP activity detected 48hrs post-transfection. 5XIO5CHO-S cells were transiently transfected with 200ng of pSEAP2 +/- 5pmols siRNA per well of a 24 well plate. Media samples were removed and filtered through a 0.45uM spin column to remove cellular debris. Error bars represent the standard deviation of the mean calculated from three transfection replicates;
Figure 3 Relative Fluorescence units detected 48hrs post-transfection. 5XIO5CHO-S cells were transiently transfected with 200ng of pTurboGFP +/- δpmols siRNA per well of a 24 well plate. Error bars represent the standard deviation of the mean calculated from three transfection replicates;
Figure 4 GH levels detected 24hrs post-transfection. 5XIO5CHO-S cells were transiently transfected with 200ng of pSecGH +/- δpmols siRNA per well of a 24 well plate. Media samples were removed and filtered through a 0.45uM spin column to remove cellular debris. Error bars represent the standard deviation of the mean calculated from three separate transfection replicates;
Figure 5. Relative levels of SEAP activity detected 24hrs post-transfection. 5XIO5CHO-S cells were transiently transfected with 200ng of pSEAP2 +/- varying siRNA. Lane 1 Media samples were removed and filtered through a 0.45uM spin column to remove cellular debris. Error bars represent the standard deviation of the mean calculated from three transfection replicates;
Figure 6 Relative luciferase units detected 24hrs post-transfection. 5XIO5CHO-S cells were transiently transfected with 200ng of pMetLuc +/- 5pmols siRNA per well of a 24 well plate. Media samples were removed and filtered through a 0.45uM spin column to remove cellular debris. Error bars represent the standard deviation of the mean calculated from three transfection replicates;
Figure 7 Relative luciferase units detected 24hrs post-transfection. 5XIO5CHO-S cells were transiently transfected with 200ng of pMetLuc +/- 20pmol AS per well of a 24 well plate. Media samples were removed and filtered through a 0.45uM spin column to remove cellular debris. Error bars represent the standard deviation of the mean calculated from three transfection replicates;
Figure 8 Mean relative luminescence units detected 48hrs post-transfection. 5X105CHO- S cells were transiently transfected with 200ng of pMetLuc +/- δpmols siRNA per well of a 24 well plate. Media samples were removed and filtered through a 0.45uM spin column to remove cellular debris; and
Figure 9 Chinese Hamster Ovary PGAP2 full length cDNA sequence showing ORF underlined and in upper case;
Figure 10 Human PIG A full length cDNA sequence; Figure 11 illustrates GFP fluoresence of cells transfected with PIG-A siRNA;
Figure 12 shows cell associated fluorescently labelled pDNA 48hrs post-transfection as measured by flow-cytometry.
Cell lines Mammalian cell lines
CHO-FIp In Adherent cells (Invitrogen, UK) CHO-Suspension adapted cells (Invitrogen, UK)
Bacterial cell strains
Two types of bacterial strains were routinely used during molecular cloning of vector constructs:
E.coli Strains; DH5alpha (Invitrogen, UK) and XLI Blue chemically competent cells.
Cell culture
Media used in bacterial culture Table 1
Figure imgf000018_0001
Table 2
Antibiotics used in bacterial cell culture
Figure imgf000019_0001
Gene transfection of mammalian cells
Lipofectamine 2000 Transfection Reagent Invitrogen
Plasmid DNA pCR3-GHBP_GPI; original source of the Thy-1 pre anchor sequence (PAS)
pSecTagϋnk- A mammalian expression vector containing the CMV immediate early promoter. This vector allows the selection of isogenic stable clones owing to the presence of a FIp recombinase site in the vector backbone. • pGHSecGH+/-Thy1
p0G44- Plasmid contains the FIp recombinase gene for production of stable clones using the FIp-In system. No selectable markers present in order to mitigate against sequence excision.
pSEAP2 plasmids-Used as a positive control for transfection efficiency.
pMetl_uc+/-Thy1
pTurboGFP- Used as a positive control for transfection efficiency
Oligonucleotides
The following oligonucleotides were used during the construction of the above vectors; Table 3
Figure imgf000020_0001
Cell growth and storage
Mammalian cell Culture and maintenance Chinese hamster ovary Flp-in cells (Invitrogen) were maintained in HAM's F12 media (Gibco) supplemented with 10% FCS at 37°C in a 5% CO2 humidified atmosphere. CHO- S cells (Invitrogen) were maintained in CD-CHO (serum free media) and incubated at 37°C in a 5% CO2 shaker. All media were supplemented with 2mM L-glutamine (Invitrogen). Adherant CHO Flp-in Cells were passaged by mild trypsin treatment at 70- 90% confluency. First, the medium was removed, and the cells were washed in PBS (0.137M NaCI, 2.7mM KCI, 12mM NaHPO4, and 1.76mM KH2PO4). The cells were incubated with Trypsin-EDTA (Gibco) for 2-5 minutes at 37°C and dislodged by gently tapping the side of the flask. The cells were then resuspended in 10 % (v/v) FCS- containing medium. The cells were resuspended in the appropriate medium; cells were then counted using a Viability analyzer (Vi-CeII) and plated out at the required cell density. CHO-S cells were grown to around 5X106/ml before passaging. The required number of cells were then transferred to a 15 ml falcon tube (Nunc) and centrifuged at IOOOrpm for 5 minutes. The cells were then resuspended in fresh CD-CHO media at a concentration of 1X107VmI. 1 ml or 0.5ml of the resuspended cells were then transferred to 24mls or 12mls of CD-CHO media respectively in an Erlen-Meyer shake flask (Corning).
Storage of mammalian cells
CHO cells were cryopreserved at low passage number. Briefly, CHO-FIp In cells were trypsinised, spun down and resuspended in 90% FCS (v/v) and 10% (v/v) DMSO. Cells were frozen in cryogenic tubes at -800C for 24-72 hours prior to final transfer to liquid nitrogen (-1960C). In order to recover the frozen cells, cells were thawed rapidly by holding the cryogenic tube for a few minutes in a 37°C water bath, washed twice in pre- warmed 10% (v/v) FCS containing medium and plated out at the same density as prior to freezing. CHO-S cells were frozen at a concentration of 1X107 cells per ml in freezing solution (CD-CHO, 10% v/v DMSO). CHO-S cells were recovered in the same way as CHO-FIp In cells. Bacterial cell growth and storage
All Escherichia coli (E.coli) strains were grown in LB medium, 2YT medium or SB medium containing the appropriate antibiotic(s) in an orbital shaker at 37°C. When plated, E.coli cells were allowed to grow on agar plates (LB+1.5% agar) at 37°C. To store the bacterial cells, glycerol stocks of appropriate strains were made by mixing 250μl of neat sterile glycerol with 750μl of the bacterial culture in a 1.5ml eppendorf tube and subsequently the cells were frozen at -800C.
Construction of GPI-Anchored Fusion Proteins
Different methods have been used for preparing chimeric DNA sequences, which are able to direct GPI anchoring of the protein of interest. The technique used here utilises polymerase chain reaction (PCR) amplification to prepare the PAS sequence and the sequence of the protein of interest sequentially. The PAS and protein sequences are subsequently fused by using oligos that overlap with the 5' end of the PAS and the 3' end of the protein of interest. At the extreme 5' end of the protein of interest and the 3' end of the PAS, oligos are used to create restriction sites that allow the fused protein to be readily subcloned into a eukaryotic expression vector. The PAS sequence clones were obtained from a previously created GHBP_Thy1 containing plasmid.
Primer Design
The overlapping PCR method outlines above requires the creation of four oligonucleotide primers (Fig. 7):
Primer 1. Contains 15-20 bp at its 3' end that is homologous to the 5' end of the gene encoding the protein of interest. The 5' end of the primer contains a restriction site (e.g., H/ndlll).
Primer 2. Contains 15-20 bp at its 3' end that will hybridize with the 31 end of the gene encoding the protein of interest. The 5' end of the primer contains a 15-20 bp hybridizing to the 51 end of the PAS.
Primer 3. Contains 15-20 bp at its 3' end that is homologous to the 5' end of the PAS. The 3' end of the primer contains 15-20 bp homologous to the 3' end of the gene encoding the protein of interest. Primer 4. Contains 15-20 bp at its 3' end that will hybridize with the 3' end of the PAS. The 5' end of the primer contains a restriction site (e.g., BamHλ).
Vectors constructed using this method were GPI linked variants of a GH-GHR chimera (1 B7) molecule, GH, and Luciferase {Metrida Longa). The correct fusion constructs were then confirmed by DNA sequencing. CHO-S cells (Invitrogen) were then transfected with the modified vector using Lipofectamine 2000 based protocol. Stable transfectants are isolated by their resistance to the antibiotic Hygromycin B, and expression was verified clones by flow cytometry, western blotting and ELISA methodologies. The selected cells can then be grown up to high density and the protein assayed for.
SDS-PAGE electrophoresis
Protein samples were fractioned by sodium dodecyl sulphate/polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions and both resolving and stacking gel were prepared as in Shambrook et al. The concentration of the resolving gel was determined based on the size of the proteins to be detected. A 4% stacking gel was used to concentrate the samples. Bio-Rad prestained markers were run alongside the samples for protein size determination. The samples were denatured by heat at 80°C in laemmli sample buffer for 5 minutes and loaded on the gel. The gel cassette was set up in the electrophoresis tank with the running buffer (25mM Tris Base, 19OmM glycine, and 17mM SDS) acting as a conductor between the gel and both the anode and cathode. Electrophoresis was performed at 35mA per gel with constant current until the dye-front reached the base of the gel.
Western blotting
The migrated proteins on the SDS-PAGE gel were transferred to a PVDF membrane (Invitrogen) preactivated with methanol (Sigma Aldrich) by loading the gel back into the electrophoresis tank and carrying out electrophoresis for a further 1 hour at 100 volts (constant) in transfer buffer (48mM Tris Base, 39mM glycine, 0.037% SDS v/v, 20% methanol v/v). The membrane was then extensively washed in Phosphate buffer saline- 0.2% v/v Tween, pH 8.0 (PBS-T) and incubated overnight at 4°C in PBS-T with 5% BSA (w/v) or skimmed milk powder to avoid non-specific binding of proteins.
The blocked membrane was washed three times in 25mls of PBS-T and subjected to incubation with primary antibody (1 :15000 mouse anti-human GH) in PBS-T+1% (w/v) milk powder for 1 hour on a rotating table. After three washes of 10 minutes with PBS-T, the membrane was incubated in PBS-T containing 1% milk powder (w/v) and the appropriate species specific secondary antibody linked to horseradish peroxidase (HRP) (1 :20000 rabbit anti-mouse IgG conjugated with HRP). The membrane was then washed in large volume of PBS-T three times for 15 minutes prior to detection of chemiluminescence. After 1 minutes incubation with freshly mixed ECL detection reagents (Amersham) the membrane was placed on an acetate sheet and band detection carried out via a digital gel imaging device. The optimal exposure time was dependent on the antibodies used and the amount of antigen on the membrane, and varied between experiments. Thus exposure times were determined empirically by setting the imager to take a range of different exposures. The image with the greatest signal to noise ratio was then selected for image capture.
Determination of protein concentration of cell-lvsate by Bradford assay
The protein content of a sample was quantified by Bradford protein assay (BioRad, UK).
In order to determine the protein concentration in a given sample, a BSA standard curve was prepared and the values plotted. The protein concentration in each sample was calculated by direct comparison of the
Figure imgf000024_0001
against the standard curve values.
Cell Culture and siRNA Delivery
CHO-S cells (Invitrogen) were cultured in CD-CHO supplemented with 6 mM L- glutamine (Invitrogen) for no more than 15 passages. siRNA targeting sequences previously described were mixed with Lipofectamine 2000 reagent (Invitrogen) was delivered to 100,000 cells in a 24-well plate format. Culture media were changed 24 hours after transfection. After 48 hours, total RNA was extracted using the Qiagen RNAeasy Total RNA Isolation Kit with gDNA cleanup by TURBO DNase™ (Ambion).
Real-Time RT-PCR: cDNA was synthesized from total RNA using the High Capacity™ First Strand cDNA Synthesis Kit (Applied Biosystems. Real-time PCR was performed using SYBR Green qPCR Master Mixes on the Applied Biosystems Fast-7500 real-time PCR system. GAPDH was chosen as the housekeeping gene for normalization. Threshold cycle values (Ct) were collected and used. For realative qRT-PCR analysis. Gene knockdown efficiency was calculated in the multi-step process described in the text below. Steps for Data Analysis
Step 1. Calculate the mean Cτ of the technical replicates.
Step 2. Calculate the ΔCT for both Experimental (anti-PGAP2 siRNA treated) and Cτ
Control siRNA Transfections: ΔCT = Experimental Cτ - Endogenous control Cτ
Step 3. Calculate the mean ΔCT for the negative controls (NC ΔCT).
Step 4. Calculate the ΔΔCT: ΔΔCT = (Experimental ΔCT - NC ΔCT)
Step 5. Calculate percent knockdown:
(%KD) = ([1 -2"^0 T] x 100) Table 4
Anti-PGAP2 siRNA SiRNAI SiRNA2 SiRNA3
Mean ΔΔCT 4.48645 2.40585 2.0962
Figure imgf000025_0001
The results from this validation experiment suggest that the SiRNA sequences are effective at eliciting specific knockdown against PGAP2. Moreover the apparent knockdown of each siRNA appears to correlate with the level of recombinant protein enhancement demonstrated in previous experiments
Co-transfection of anti PIG-A siRNA with pGFP into CHO cells using Lipofectamine 2000
CHO-S cells (Invitrogen) were co-transfected with either 10 or 20 pmols per 10Λ6 cells of chemically synthesised siRNA and 500ng/well of pTGFP (Evrogen) using Lipofectamine 2000 as described by the manufactures protocol. Anti-PIGA siRNA was used at 10 and 20 pmol per 10Λ6 cells. Additionally IOpmols per 10Λ6 cells of anti-PGAP2 SiRNAI was used as a comparison. IOpmols per 10Λ6 cells of Negative control siRNA (scrambled sequence) was also co-transfected in order to control for any non-specific effects. 24hrs after transfection RFU values were obtained by plate reader to access overall fluorescence from the cells. Background fluorescence values obtained from triplicate wells of untransfected CHO cells were then subtracted from the transfected values of each well. The error bars represent the standard deviation from the mean of triplicate transfection values; see Figure 11. Summary of PIG A siRNA constructs
PIG-A1_sense AGCCACAUUUACCAGCUCU [SEQ ID NO: 24]
PIG-A1_antisense AGAGCUGGUAAAUGUGGCU SEQ ID NO: 25]
PIG-A2_sense GACAAUGGGGCUUCAGACA [SEQ ID NO: 26]
PIG-A2_antisense UGUCUGAAGCCCCAUUGUC [SEQ ID NO: 27]
Fluorescently labelled-DNA analysis shows enhanced DNA uptake in the prescience of SiRNA against PGAP2
The effect of anti_PGAP2 siRNA on cellular DNA uptake was assessed using fluorescently labelled DNA. This allows the quantification of cell associated DNA complexes i.e. those complexes which have been or are in the process of being transfected into the cell. Furthermore this change in plasmid quantity associated with the cells may be correlated with the product titre since the plasmid remains expression competent after being labelled.
DNA Labelling
DNA labelling was carried out using the Mirus Bio (Madison) Label IT Nucleic Acid Labelling Kit. The DNA labelling reaction was set up as described in the manufacturers protocol using pSEAP2 as the substrate DNA. This mixture was then incubated at 370C for 1 hour before being ethanol precipitated as per manufactures protocol. The resulting labelled pSEAP2 DNA was subsequently quantified on a spectrophotometer.
Transfection of Fluorescein labelled DNA
1.5ug of Fluorescein labelled pSEAP2 DNA per well of a 24-well plate into 0.5X10Λ6 CHO-S cells suspended in 50OuI of CD_CHO. Following transfection cells were incubated in a static incubator at 37 DegC overnight. The following day the cells were washed in PBS supplemented with 0.5% w/v BSA. The cells were then analysed on a Quanta-Flow cytometer and mean FL1 intensity values obtained from each triplicate transfection sample. The background (cells only) FL1 signal was then subtracted from the observed values before being plotted (Fig1.)
The results appear to show a very significant increase in DNA uptake when fluorescently labelled plasmid DNA is co-transfected in the presence of SiRNA against PGAP2. This is consistent with the increase in product titre accompanying anti-PGAP2 siRNA co- transfection.

Claims

Claims
1 A eukaryotic cell that expresses a therapeutic polypeptide wherein the cell is modified which modification inhibits the expression of a gene or translation of a messenger RNA that encodes a polypeptide that functions in the addition of a glycosylphosphatidylinositol anchor to proteins expressed by the cell characterized in that the expression of the therapeutic polypeptide is enhanced.
2. A cell according to claim 1 wherein said cell is a mammalian cell.
3. A cell according to claim 2 wherein said mammalian cell is a primate cell or rodent cell.
4. A cell according to claim 1 wherein said cell is an insect cell.
5. A cell according to claim 1 wherein said cell is a fungal cell.
6. A cell according to claim 1 wherein said cell is a hybridoma that produces a monoclonal antibody.
7. A cell according to any of claims 1-6 wherein said gene encodes or mRNA encodes a polypeptide with glycosylphosphatidylinositol activity or a polypeptide that modifies proteins with a GPI anchor.
8. A cell according to claim 7 wherein said gene is represented by the nucleotide sequence as shown in Figure 9 [SEQ ID NO: 1] or a nucleic acid molecule that hybridizes under stringent hybridization conditions to a nucleic acid molecule represented by the nucleotide sequence represented in Figure 9 [SEQ ID NO: 1].
9. A cell according to claim 7 wherein said gene is represented by the nucleotide sequence as shown in Figure 10 [SEQ ID NO: 2] or a nucleic acid molecule that hybridizes under stringent hybridization conditions to a nucleic acid molecule represented by the nucleotide sequence represented in Figure 10 [SEQ ID NO: 2].
10. A cell according to any of claims 1-9 wherein said gene is partially or entirely disrupted such that expression of the gene is substantially or completely inhibited.
11. A cell according to any of claims 1-9 wherein said cell is modified by transfection of an antisense nucleic acid.
12. A cell according to any of claims 1-9 wherein said cell is modified by transfection of a small inhibitory RNA [siRNA] or short hairpin RNA [shRNA] molecule.
13 A cell according to claim 12 wherein said RNA molecule is between 19 nucleotides [nt] and 29nt in length.
14. A cell according to claim 13 wherein said RNA molecule is between 21 nt and 27nt in length.
15 A cell according to claim 14 wherein said RNA molecule is about 21 nt in length.
16. A cell according to any of claims 12-15 wherein said siRNA or shRNA molecule is selected from the group of paired sense and antisense nucleotide sequences represented in table 5 by SEQ ID NOs: 29, 30, 32, 33, 35, 36, 38, 39, 41 , 42, 44, 45, 47, 48, 50, 51 , 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71 , 72, 74, 75, 77, 78, 80, 81 , 83, 84, 86, 87, 89, 90, 92, 93, 95, 96, 98, 99, 101 , 102, 104, 105, 107, 108, 110, 111 , 11 , 114, 116, 117, 119, 120, 122, 123, 125, 126, 128, 129, 131 , 132, 134, 135, 137, 138, 140, 141 , 143, 144, 146, 147, 149, 150, 152, 153, 155, 156, 158, 159, 161 , 162, 164, 165, 167, 168, 170, 171 , 173, 174, 176, 177, 179, 180, 182, 183, 185, 186, 188, 189, 191 , 192, 194, 195, 197, 198, 200, 202, 203, 205, 206, 208, 209, 211 , 212, 214, 215, 217, 218, 220, 221 , 223, 224, 226, 227, 229, 230, 232, 233.
17. A cell according to claim 12 or 13 wherein said RNA comprises or consists of the nucleotide sequences:
i) GGUGGGACUUCGGAAACAA [SEQ ID NO: 3]
ii) UCGCGGCAUCCCUCAGUUA SEQ ID NO: 4]
iii) GUCUCAACGUGGUGGAGAA.[SEQ ID NO: 5].
18. A cell according to claim 12 or 13 wherein said RNA comprises or consists of the nucleotide sequences:
i) AGCCACAUUUACCAGCUCU [SEQ ID NO: 6] ii) AGAGCUGGUAAAUGUGGCU [SEQ ID NO: 7] iii) GACAAUGGGGCUUCAGACA [SEQ ID NO: 8] iv) UGUCUGAAGCCCCAUUGUC [SEQ ID NO: 9].
19. A cell according to any of claims 12-18 wherein said siRNA or shRNA includes modified nucleotides.
20. A cell according to any of claims 12-18 wherein said siRNA or shRNA is part of an expression vector adapted for eukaryotic expression.
21. A cell according to claim 20 wherein said vector is adapted by inclusion of a transcription cassette comprising a nucleic acid molecule wherein said cassette comprises a nucleotide sequence selected from the group consisting of:
i) 5'- TGGGACTTCGGAAACAATTCTCAAGAGAAATTGTTTCCGAAGTCCCACC
I I I I I I -3' [SEQ ID NO: 10] ii) 5'- GCGGCATCCCTCAGTTATTCTCAAGAGAAATAACTGAGGGATGCCGCGA
I I I I I I -3' [SEQ ID NO: 11] iii) 5'- CTCAACGTGGTGGAGAATTCTCAAGAGAAATTCTCCACCACGTTGAGAC
I I I I I I -3' [SEQ ID NO: 12] which is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette wherein said sense and antisense nucleic acid molecules are adapted to anneal over at least part of their length to form an siRNA or shRNA.
22. A cell according to claim 21 wherein said cassette is provided with at least two promoters adapted to transcribe both sense and antisense strands of said nucleic acid molecule.
23. A cell according to claim 21 wherein said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts thereby forming an shRNA.
24. A cell according to any of claims 1-23 wherein said cell is further modified by transfection with a nucleic acid molecule that encodes a heterologous polypeptide.
25. A cell according to claim 24 wherein said cell is transiently transfected.
26. A cell according to claim 24 wherein said cell is stably transfected.
27. A cell according to any of claims 24-26 wherein said therapeutic polypeptide is a recombinant polypeptide.
28. A cell according to any of claims 24-27 wherein said therapeutic polypeptide is an antigenic polypeptide for use in a vaccine.
29. A cell according to claim 27 wherein said therapeutic polypeptide is a monoclonal antibody or active binding fragment thereof.
30. A cell according to claim 29 wherein said monoclonal antibody is a humanised or chimeric antibody.
31. A cell according to claim 29 or 30 wherein said fragment is a Fab fragment.
32. A cell according to claim 31 wherein said antibody fragment is selected from the group consisting of: single chain antibody fragments, F(ab')2, Fab, Fv and Fd fragments; and antibodies comprising CDR3 regions.
33. A cell according to any of claims 24-26 wherein said heterologous polypeptide is an enzyme.
34 The use of a siRNA as represented in: SEQ ID NOs: 29, 30, 32, 33, 35, 36, 38, 39, 41 , 42, 44, 45, 47, 48, 50, 51 , 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71 , 72, 74, 75, 77, 78, 80, 81 , 83, 84, 86, 87, 89, 90, 92, 93, 95, 96, 98, 99, 101 , 102, 104, 105, 107, 108, 110, 111 , 11 , 114, 116, 117, 119, 120, 122, 123, 125, 126, 128, 129, 131 , 132, 134, 135, 137, 138, 140, 141 , 143, 144, 146, 147, 149, 150, 152, 153, 155, 156, 158, 159, 161 , 162, 164, 165, 167, 168, 170, 171 , 173, 174, 176, 177, 179, 180, 182, 183, 185, 186, 188, 189, 191 , 192, 194, 195, 197, 198, 200, 202, 203, 205, 206, 208, 209, 211 , 212, 214, 215, 217, 218, 220, 221 , 223, 224, 226, 227, 229, 230, 232, 233.. in the production of therapeutic polypeptides.
35. The use of a siRNA or shRNA designed with reference to a nucleotide sequence as represented in Figure 9 [SEQ ID NO: 1] in the production of therapeutic polypeptides.
36. A siRNA or shRNA designed with reference to a nucleotide sequence represented in Figure 9 [SEQ ID NO: 1], or a nucleic acid molecule that hybridizes under stringent hybridization conditions to a nucleic acid molecule represented by the nucleotide sequence represented in Figure 9 [SEQ ID NO: 1].
37. The use of a siRNA or shRNA designed with reference to a nucleotide sequence as represented in Figure 10 [SEQ ID NO: 2] in the production of therapeutic polypeptides.
38. A siRNA or shRNA designed with reference to a nucleotide sequence represented in Figure 10 [SEQ ID NO: 2], or a nucleic acid molecule that hybridizes under stringent hybridization conditions to a nucleic acid molecule represented by the nucleotide sequence represented in Figure 10 [SEQ ID NO: 2].
39. A siRNA or shRNA according to claim 36 or 37 wherein said siRNA or shRNA comprises a nucleotide sequence selected from the group consisting of:
i) GGUGGGACUUCGGAAACAA [SEQ ID NO: 3] ϋ) UCGCGGCAUCCCUCAGUUA [SEQ ID NO: 4] iϋ) GUCUCAACGUGGUGGAGAA [SEQ ID NO: 5]
41. A siRNA or shRNA according to claim 38 or 39 wherein said siRNA or shRNA comprises a nucleotide sequence selected from the group consisting of:
i) AGCCACAUUUACCAGCUCU [SEQ ID NO: 6] ii) AGAGCUGGUAAAUGUGGCU [SEQ ID NO: 7] iii) GACAAUGGGGCUUCAGACA [SEQ ID NO: 8] iv) UGUCUGAAGCCCCAUUGUC [SEQ ID NO: 9]
42. A siRNA or shRNA selected from the group of paired sense and antisense nucleotide sequences represented in table 5 by SEQ ID NOs: 29, 30, 32, 33, 35, 36, 38, 39, 41 , 42, 44, 45, 47, 48, 50, 51 , 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71 , 72, 74, 75, 77, 78, 80, 81 , 83, 84, 86, 87, 89, 90, 92, 93, 95, 96, 98, 99, 101 , 102, 104, 105, 107, 108, 110, 111 , 11 , 114, 116, 117, 119, 120, 122, 123, 125, 126, 128, 129, 131 , 132, 134, 135, 137, 138, 140, 141 , 143, 144, 146, 147, 149, 150, 152, 153, 155, 156, 158, 159, 161 , 162, 164, 165, 167, 168, 170, 171, 173, 174, 176, 177, 179, 180, 182, 183, 185, 186, 188, 189, 191 , 192, 194, 195, 197, 198, 200, 202, 203, 205, 206, 208, 209, 211 , 212, 214, 215, 217, 218, 220, 221 , 223, 224, 226, 227, 229, 230, 232, 233.
43. A siRNA or shRNA according to any of claims 36-42 RNA or shRNA molecule is between 19 nucleotides [nt] and 29nt in length.
44. A nucleic acid molecule comprising a transcription cassette wherein said cassette includes a nucleotide sequence designed with reference to Figure 9 [SEQ ID NO: 1] or 10 [SEQ ID NO: 2] and is adapted for expression by provision of at least one promoter operably linked to said nucleic acid sequence such that both sense and antisense molecules are transcribed from said cassette.
45. A nucleic acid molecule according to claim 44 wherein said cassette is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette wherein said sense and antisense nucleic acid molecules are adapted to anneal over at least part or all of their length to form a siRNA or shRNA.
46. A nucleic acid molecule according to claim 44 or 44 wherein said cassette is provided with at least two promoters adapted to transcribe both sense and antisense strands of said nucleic acid molecule.
47. A nucleic acid molecule according to any of claims 44-46 wherein said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts thereby forming an shRNA.
48. A nucleic acid molecule according to claim 47 wherein said cassette includes one or more of the following nucleotide sequences: i) 5TGGGACTTCGGAAACAATTCTCAAGAGAAATTGTTTCCGAAGTCCC
ACC I I I I I I -3' [SEQ ID NO: 10] ii) 51GCGGCATCCCTCAGTTATTCTCAAGAGAAATAACTGAGGGATGCC
GCGA I I I I I I -3' [SEQ ID NO: 11] iii) 51CTCAACGTGGTGGAGAATTCTCAAGAGAAATTCTCCACCACGTTGA GAC I I I I I I -3'. [SEQ ID NO: 12]
49. A vector comprising a transcription cassette according to any of claims 44-48.
50. A cell culture comprising a cell according to any of claims 1-33.
51. A cell culture vessel comprising a cell culture according to claim 50.
52. A method for the recombinant production of a polypeptide comprising: i) providing a cell culture according to claim 49; ii) culturing the cell under conditions that facilitate the production of recombinant protein; and optionally iii) isolating said recombinant protein from the cell or cell culture medium.
53. The use of a siRNA or nucleic acid molecule according to any of claims 37-48 as a transfection agent to enhance the transfection of eukaryotic cells by vector nucleic acid.
54. A kit comprising a one or more siRNA or shRNA molecules according to any of claims 37-48.
55. A method to enhance the transfection of nucleic acid into a eukaryotic cell comprising the steps: i) forming a preparation comprising a eukaryotic cell and a siRNAor nucleic acid molecule according to any of claims 38-48; ii) contacting said cell with a vector that encodes a heterologous polypeptide; and iii)culturing said cell in cell culture conditions that express said heterlogous polypeptide.
56. A method according to claim 55 wherein said cell is a mammalian cell.
57. A method according to claim 55 or 56 wherein said heterologous polypeptide is a therapeutic polypeptide as hereindisclosed.
PCT/GB2010/000401 2009-03-05 2010-03-05 Production of protein Ceased WO2010100437A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB0903809A GB0903809D0 (en) 2009-03-05 2009-03-05 Production of protein
GB0903809.2 2009-03-05
GB0916305A GB0916305D0 (en) 2009-09-17 2009-09-17 Production of protein
GB0916305.6 2009-09-17

Publications (3)

Publication Number Publication Date
WO2010100437A2 true WO2010100437A2 (en) 2010-09-10
WO2010100437A9 WO2010100437A9 (en) 2010-10-07
WO2010100437A3 WO2010100437A3 (en) 2011-01-13

Family

ID=42263402

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2010/000401 Ceased WO2010100437A2 (en) 2009-03-05 2010-03-05 Production of protein

Country Status (1)

Country Link
WO (1) WO2010100437A2 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US1A (en) 1836-07-13 John Ruggles Locomotive steam-engine for rail and other roads
US6127A (en) 1849-02-20 Bxick-fbess
EP0368684A1 (en) 1988-11-11 1990-05-16 Medical Research Council Cloning immunoglobulin variable domain sequences.
US6291158B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertoire

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7217807B2 (en) * 2002-11-26 2007-05-15 Rosetta Genomics Ltd Bioinformatically detectable group of novel HIV regulatory genes and uses thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US1A (en) 1836-07-13 John Ruggles Locomotive steam-engine for rail and other roads
US6127A (en) 1849-02-20 Bxick-fbess
EP0368684A1 (en) 1988-11-11 1990-05-16 Medical Research Council Cloning immunoglobulin variable domain sequences.
US6248516B1 (en) 1988-11-11 2001-06-19 Medical Research Council Single domain ligands, receptors comprising said ligands methods for their production, and use of said ligands and receptors
US6291158B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertoire

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DONILLARD; HOFFMAN: "Compendium of Immunology V.II", 1981, article "Basic Facts about Hybridomas"
KOHLER; MILSTEIN, NATURE, vol. 256, 1975, pages 495 - 497
PNAS(USA), vol. 95, 1998, pages 8795 - 8800
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes Part", 1993, ELSEVIER
WAGNER ET AL., NATURE BIOTECHNOLOGY, vol. 14, 1996, pages 840 - 844

Also Published As

Publication number Publication date
WO2010100437A9 (en) 2010-10-07
WO2010100437A3 (en) 2011-01-13

Similar Documents

Publication Publication Date Title
AU2020227020B2 (en) Modified stem cell memory T cells, methods of making and methods of using same
JP7418470B2 (en) Integration of nucleic acid constructs into eukaryotic cells using transposase derived from Orydias
JP5735927B2 (en) Re-engineering the primary structure of mRNA to enhance protein production
KR102594051B1 (en) Single guide RNA, CRISPR/Cas9 system, and methods of use thereof
AU2008335723B2 (en) Compositions and methods related to mRNA translational enhancer elements
CN101896616B (en) Compositions and methods for improved glycoprotein sialylation
KR20210076082A (en) Methods and compositions for editing RNA
US20220325310A1 (en) Novel eukaryotic cells and methods for recombinantly expressing a product of interest
RU2720525C2 (en) Novel eukaryotic cells and methods for preparing them for recombinant expression of a product of interest
JP2022527016A (en) Transfer of nucleic acid constructs to the eukaryotic genome using transposases derived from Amielois
JP7852942B2 (en) Activated DNA transposon system and method of use thereof
CN113801881B (en) The use of super enhancer gene sequences in promoting human B2M gene expression
KR20220004649A (en) Polynucleotides, compositions and methods for polypeptide expression
KR102553990B1 (en) Promoter of the Hspa5 gene
KR102937659B1 (en) Enhanced expression system and method of use thereof
WO2010100437A2 (en) Production of protein
JP2012504392A (en) Production of products of pharmaceutical interest in plant cell culture
US10273487B2 (en) Transfection vector for pathogenic amoebae and uses thereof
JP2015180203A (en) REENGINEERING mRNA PRIMARY STRUCTURE FOR ENHANCED PROTEIN PRODUCTION
US20250320258A1 (en) Rna recognition complex and uses thereof
EP1783219A1 (en) Method of searching for novel drug discovery targets
WO2025212826A1 (en) Optimization of yeast mrna structure and sequence for expression in human cells
CN103589723B (en) A kind of Newborn recombinant promoter and application thereof
WO2008069122A1 (en) Marker for differentiation of mesenchymal stem cell into chondrocyte
TW201035312A (en) Gene amplification method for enhancing gene expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10712094

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10712094

Country of ref document: EP

Kind code of ref document: A2