WO2010094762A1 - Heteroaryl substituted pyridazinone derivatives - Google Patents

Heteroaryl substituted pyridazinone derivatives Download PDF

Info

Publication number
WO2010094762A1
WO2010094762A1 PCT/EP2010/052116 EP2010052116W WO2010094762A1 WO 2010094762 A1 WO2010094762 A1 WO 2010094762A1 EP 2010052116 W EP2010052116 W EP 2010052116W WO 2010094762 A1 WO2010094762 A1 WO 2010094762A1
Authority
WO
WIPO (PCT)
Prior art keywords
pyridin
pyridazin
alkyl
pyrazol
phenyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2010/052116
Other languages
French (fr)
Inventor
Daniela Alberati
Matthias Koerner
Bernd Kuhn
Jens-Uwe Peters
Rosa Maria Rodriguez Sarmiento
Mark Rogers-Evans
Markus Rudolph
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
F Hoffmann La Roche AG
Original Assignee
F Hoffmann La Roche AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to MX2011008360A priority Critical patent/MX2011008360A/en
Priority to EP10711618.8A priority patent/EP2398795B1/en
Priority to ES10711618.8T priority patent/ES2526251T3/en
Priority to CA2749867A priority patent/CA2749867C/en
Priority to AU2010215428A priority patent/AU2010215428B2/en
Priority to CN201080008620.XA priority patent/CN102325766B/en
Priority to BRPI1008007A priority patent/BRPI1008007A2/en
Priority to KR1020117019449A priority patent/KR101363091B1/en
Application filed by F Hoffmann La Roche AG filed Critical F Hoffmann La Roche AG
Priority to JP2011550576A priority patent/JP5518902B2/en
Priority to SG2011058278A priority patent/SG173671A1/en
Publication of WO2010094762A1 publication Critical patent/WO2010094762A1/en
Priority to IL213983A priority patent/IL213983A/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D403/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/14Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/50Pyridazines; Hydrogenated pyridazines
    • A61K31/501Pyridazines; Hydrogenated pyridazines not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/18Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/22Anxiolytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/24Antidepressants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/30Drugs for disorders of the nervous system for treating abuse or dependence
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/30Drugs for disorders of the nervous system for treating abuse or dependence
    • A61P25/36Opioid-abuse
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system

Definitions

  • the invention is concerned with novel pyridazinone derivatives of formula (I)
  • R 1 is heteroaryl which can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, halogen, lower-alkoxy- lower-alkyl, cyano, NO 2 , morpholinyl, NH 2 -SO 2 , N(H,lower-alkyl)-SO 2 , N(lower- alkyl) 2 -SO 2 , pyrrolidinyl-SO 2 , piperidinyl-SO 2 , morpholinyl- S O 2 , hydroxy, COOH, COO-lower-alkyl, lower-alkyl-C(O)O, CO-lower-alkyl, CONH 2 , CON(H,lower-alkyl), CON(lower-alkyl) 2 , lower-
  • R 2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower- alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO 2 , COOH, CONH 2 , NH 2 -SO 2 , COO-lower-alkyl, lower-alkoxy-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl) 2 , N(H,lower-alkyl)-SO 2 , N(lower-alkyl) 2 -SO 2 , lower-alkenyl, hydroxy, NO 2 , morpholinyl, piperidinyl, piperazinyl, (N-lower-alkyl)-piperazinyl, pyrrolidinyl, lower-alkyl-C(O)O, lower-
  • R 3 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
  • R 4 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
  • the invention is concerned with a process for the manufacture of the above compounds, pharmaceutical preparations which contain such compounds as well as the use of these compounds for the production of pharmaceutical preparations.
  • Schizophrenia is a progressive and devastating neurological disease characterized by episodic positive symptoms such as delusions, hallucinations, thought disorders and psychosis and persistent negative symptoms such as flattened affect, impaired attention and social withdrawal, and cognitive impairments (Lewis DA and Lieberman JA, Neuron, , 28:325-33, 2000).
  • episodic positive symptoms such as delusions, hallucinations, thought disorders and psychosis
  • persistent negative symptoms such as flattened affect, impaired attention and social withdrawal, and cognitive impairments
  • For decades research has focused on the "dopaminergic hyperactivity" hypothesis which has led to therapeutic interventions involving blockade of the dopaminergic system (Vandenberg RJ and Aubrey KR., Exp. Opin. Ther. Targets, 5(4): 507-518, 2001; Nakazato A and Okuyama S, et al, Exp. Opin. Ther.
  • Patents, 10(1): 75-98, 2000 This pharmacological approach, besides ameliorating positive symptoms in schizophrenic patients, poorly addresses negative and cognitive symptoms which are the best predictors of functional outcome (Sharma T., BrJ. Psychiatry, 174(suppl. 28): 44-51, 1999).
  • current antipsychotic treatment is associated with adverse effects like weight gain, extrapyramidal symptoms or effects on glucose and lipid metabolism, related to their unspecific pharmacology.
  • Cyclic nucleotides cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) are ubiquitous second messengers responsible for mediating the biological response of a variety of extracellular signals, including neurotransmitters, light and hormones.
  • cAPM and cGMP regulate a variety of intracellular processes particularly in neurons of the central nervous system by activating cAMP- and cGMP-dependent kinases which then phosphorylate proteins involved in the regulation of synaptic transmission, neuronal differentiation and survival.
  • Phosphodiesterases are a family of widely expressed enzymes encoded by 21 different genes in humans, with each gene encoding several splice variants (Beavo, J., Physiol. Rev. 1995, 75, 725-748; Conti, M., Jin, S.L., Prog. Nucleic Acid Res. MoI. Biol. 1999, 63, 1-38; Soderling, S.H., Beavo, J.A., Curr. Opin. Cell Biol. 2000,12, 174-179, Manallack, D.T. et al. J. Med.Chem. 2005, 48 (10), 3449-3462).
  • the PDE families differ in their substrate specificy for the cyclic nucleotides, their mechanism of regulation and their sensitivity to inhibitors. Moreover, they are differentially localized in the organism, among the cells of an organ and even within the cells. These differences lead to a differentiated involvement of the PDE families in the various physiological functions.
  • PDElOA is a dual substrate PDE encoded by a single gene as reported in 1999 by three separate research groups (Fujishige K., et al, Eur J Biochem (1999) 266(3):1118-1127, Soderling S.H., et al., ProcNatl Acad Sci USA (1999) 96(12):7071-7076, Loughney K., et al., Gene (1999) 234(1): 109-117).
  • PDElOA is unique from other members of the multigene family with respect to amino acid sequence (779 aa), tissue-specific pattern of expression, affinity for cAMP and cGMP and the effect on PDE activity by specific and general inhibitors.
  • PDElOA has one of the most restricted distribution of any PDE family being primarily expressed in the brain particularly in the nucleus accumbens and the caudate putamen. Additionally thalamus, olfactory bulb, hippocampus and frontal cortex show moderate levels of PDElOA expression. All these brain areas have been suggested to be involved in the pathophysiology of schizophrenia and psychosis, suggesting a central role of PDElOA in this devastating mental illness. Outside the central nervous system PDElOA transcript expression is also observed in peripheral tissues like thyroid gland, pituitary gland, insulin secreting pancreatic cells and testes (Fujishige, K. et al., J. Biol. Chem. 1999, 274, 18438-18445, Sweet, L.
  • the striatal medium spiny neurons are the principal input site and first site for information integration in the basal ganglia circuit of the mammalian brain.
  • the basal ganglia are a series of interconnected subcortical nuclei that integrate widespread cortical input with dopaminergic signaling to plan and execute relevant motor and cognitive patterns while suppressing unwanted or irrelevant patterns (Graybiel, A.M. Curr. Biol. 2000, 10, R509-R511 (2000). Papaverine, a relatively specific PDElOA inhibitor, and PDElOA-knockout mice have been used to explore the physiology of this enzyme and the possible therapeutic utility of PDElOA inhibition. Inhibition of this enzyme pharmacologically or through gene disruption causes a reduction in activity and a reduced response to psychomotor stimulants.
  • Inhibition also reduces the conditioned avoidance response, a behavioural response that is predictive of clinical antipsychotic activity (Siuciak, J.A.; et al, Neuropharmacology 2006, 51 (2), 386-396; Siuciak, J.A.; et al., Neuropharmacology 2006, 57 (2), 374-385).
  • PDElOA inhibition bears the potential to improve the negative and cognitive symptoms associated to schizophrenia.
  • papaverine have been shown to attenuate the deficits in the extra-dimensional shift learning induced in rats by sub-chronic treatment with PCP, an animal paradigm of NMDA receptor hypofunction (Rodefer, J,S., et al., Eur. J. Neuroscience 2005, 2, : 1070- 1076).
  • increased social interaction in PDE10A2-deficient mice have been observed (Sano, H. J. Neurochem. 2008, 105, 546-556).
  • Diseases that can be treated with PDElOA inhibitors include, but are not limited to, diseases thought to be mediated in part by dysfunction of the basal ganglia, of other parts of the central nervous system and of other PDElOA expressing tissues.
  • diseases can be treated, where inhibition of PDElOA can have therapeutic effects.
  • These diseases include, but are not limited to, certain psychotic disorders such as schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder or substance-induced psychotic disorder, anxiety disorders such as panic disorder, obsessive-compulsive disorder, acute stress disorder or generalized anxiety disorder, obsessive/compulsive disorders, drug addictions, movement disorders such as Parkinson's disease or restless leg syndrome, cognition deficiency disorders such as Alzheimer's disease or multi-infarct dementia, mood disorders such as depression or bipolar disorders, or neuropsychiatric conditions such as psychosis, attention-deficit/hyperactivity disorder (ADHD) or related attentional disorders.
  • psychotic disorders such as schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder or substance-induced psychotic disorder, anxiety disorders such as panic disorder, obsessive-compulsive disorder, acute stress disorder or generalized anxiety disorder, obsessive/compulsive disorders, drug addictions, movement disorders such as Parkinson's disease or restless leg
  • the compounds of the present invention are also suitable for the treatment of diabetes and related disorders such as obesity by regulating the cAMP signaling system.
  • PDElOA inhibitors might also be useful in preventing neurons from undergoing apoptosis by raising cAMP and cGMP levels and, thus, might possess anti-inflammatory properties.
  • Neurodegenerative disorders treatable with PDElOA inhibitors include, but are not limited to, as
  • Alzheimer's disease Huntington's disease, Parkinson's disease, multiple sclerosis, stroke or spinal cord injury.
  • cAMP and cGMP The growth of cancer cells is inhibited by cAMP and cGMP.
  • PDElOA inhibitors can also be used for the treatment of different solid tumors and hematological malignancies such as renal cell carcinoma or breast cancer.
  • lower is used to mean a group consisting of one to seven, preferably of one to four carbon atom(s).
  • halogen refers to fluorine, chlorine, bromine and iodine, with fluorine, chlorine and bromine being preferred.
  • alkyl refers to a branched or straight-chain monovalent saturated aliphatic hydrocarbon radical of one to twenty carbon atoms, preferably one to sixteen carbon atoms, more preferably one to ten carbon atoms. Lower-alkyl groups as described below also are preferred alkyl groups.
  • lower-alkyl refers to a branched or straight-chain monovalent alkyl radical of one to seven carbon atoms, preferably one to four carbon atoms. This term is further exemplified by such radicals as methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, t-butyl and the like.
  • alkenyl stands for a straight-chain or branched hydrocarbon residue comprising an olefinic bond and up to 20, preferably up to 16 carbon atoms.
  • lower-alkenyl refers to a straight-chain or branched hydrocarbon residue comprising an olefinic bond and up to 7, preferably up to 4 carbon atoms, such as e.g. ethenyl or 2-propenyl.
  • alkinyl alone or in combination with other groups, stands for a straight-chain or branched hydrocarbon residue comprising a tripple bond and up to 20, preferably up to 16 carbon atoms.
  • lower-alkinyl refers to a straight-chain or branched hydrocarbon residue comprising a tripple bond and up to 7, preferably up to 4 carbon atoms, such as e.g. ethinyl or 2-propinyl.
  • lower-alkylene refers to a branched or straight chain divalent lower-alkyl radical. This term is further exemplified by such radicals as methylene, ethylene, propylene and the like.
  • dioxo- lower-alkylene refers to the group -O-lower-alkylene-0-.
  • fluoro-lower-alkylene refers to a branched or straight chain divalent fluoro-lower-alkyl radical. This term is further exemplified by such radicals as -CF 2 - and the like.
  • dioxo-fluoro-lower-alkylene refers to the group -O-fluoro-lower-alkylene-O-.
  • cycloalkyl refers to a monovalent carbocyclic radical of 3 to 10 carbon atoms, preferably 3 to 6 carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.
  • fluoro-lower-alkyl refers to lower-alkyl groups which are mono- or multiply substituted with fluorine.
  • fluoro-lower-alkyl groups are e.g. CFH 2 , CF 2 H, CF 3 , CF 3 CH 2 , CF 3 (CH 2 ) 2 , (CF 3 ) 2 CH and CF 2 H-CF 2. .
  • alkoxy refers to the group R'-O-, wherein R' is an alkyl.
  • lower- alkoxy refers to the group R'-O-, wherein R' is a lower-alkyl.
  • fluoro-lower-alkoxy refers to the group R"-O-, wherein R" is fluoro-lower- alkyl.
  • fluoro-lower-alkoxy groups are e.g. CFH 2 -O, CF 2 H-O, CF 3 -O, CF 3 CH 2 -O, CF 3 (CH 2 ) 2 -O, (CF 3 ) 2 CH-O, and CF 2 H-CF 2 -O.
  • aryl alone or in combination, relates to the phenyl or naphthyl group, preferably the phenyl group, which can optionally be substituted, unless specifically stated otherwise, by 1 to 5 , preferably 1 to 3, substituents, independently selected from the group consisting of halogen, hydroxy, amino, NO 2 , lower-alkyl, hydroxy-lower-alkyl, lower-alkoxy, carboxy, carboxy-lower-alkyl, H 2 NC(O), (H,lower-alkyl)NC(O), (lower-alkyl) 2 NC(O), fiuoro- lower-alkyl, lower-alkyl-SO 2 , lower-alkyl-SO 2 O, lower-alkyl-SO 2 -NH, lower-alkyl-SO 2 - N(lower-alkyl), H 2 NSO 2 , (H,lower-alkyl)NSO 2 , (lower-alkyl) 2 NSO 2 , cyano
  • Preferred substituents can be halogen, lower-alkyl and lower- alkoxy.
  • aryl groups can preferably be substituted as described in the description and claims below. Examples of aryl, wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo- lower-alkylene, dioxo-fluoro-lower-alyklene, NH-Io was-alkylene, N(Io was alkyl)-lower-alkylene, lower-alkylene-NH-lower-alkylene, lower-alkylene-N(lower alkyl)-lower-alkylene, NH-C(O)- lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower-alkylene-NH-C(O)-lower-alkylene, lower-alkylene-N(lower alkyl)-C(O)
  • heteroaryl refers to an aromatic 5 to 6 membered monocyclic ring or 9 to 10 membered bicyclic ring which can comprise 1, 2 or 3 atoms selected from nitrogen, oxygen and/or sulphur, such as furyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, thienyl, isoxazolyl, oxazolyl, oxadiazolyl, imidazolyl, pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, thiadiazolyl, benzo imidazolyl, indolyl, indazolyl, benzothiazolyl, benzo isothiazolyl, benzoxazolyl, benzoisoxazolyl, quinolinyl and isoquinolinyl.
  • heteroaryl groups are pyridinyl, quinolinyl and isoquinolinyl. Unless specifically stated otherwise, a heteroaryl group may optionally have a substitution pattern as described earlier in connection with the term "aryl". Furthermore, heteroaryl groups can preferably be substituted as described in the description and claims below. Preferred examples of heteroaryl, wherein two substituents at adjacent positions of the heteroaryl are bound together to form a ring are those wherein said two bound substituents are lower-alkylene, dioxo-lower-alkylene or dioxo-fluoro-lower-alyklene, e.g.
  • Compounds of formula (I) can form pharmaceutically acceptable acid addition salts.
  • pharmaceutically acceptable salts are salts of compounds of formula (I) with physiologically compatible mineral acids, such as hydrochloric acid, sulphuric acid, sulphurous acid or phosphoric acid; or with organic acids, such as methanesulphonic acid, p- toluenesulphonic acid, acetic acid, lactic acid, trifluoro acetic acid, citric acid, fumaric acid, maleic acid, tartaric acid, succinic acid or salicylic acid.
  • physiologically compatible mineral acids such as hydrochloric acid, sulphuric acid, sulphurous acid or phosphoric acid
  • organic acids such as methanesulphonic acid, p- toluenesulphonic acid, acetic acid, lactic acid, trifluoro acetic acid, citric acid, fumaric acid, maleic acid, tartaric acid, succinic acid or salicylic acid.
  • a COOH group can further form salts with bases.
  • salts examples of such salts are alkaline, earth- alkaline and ammonium salts such as e.g. Na-, K-, Ca- and trimethylammoniumsalt.
  • pharmaceutically acceptable salts also refers to such salts. Salts obtained by the addition of an acid are preferred.
  • esters embraces derivatives of the compounds of formula (I), in which a carboxy group has been converted to an ester.
  • esters are preferred esters.
  • pharmaceutically acceptable esters furthermore embraces compounds of formula (I) in which hydroxy groups have been converted to the corresponding esters with inorganic or organic acids such as, nitric acid, sulphuric acid, phosphoric acid, citric acid, formic acid, maleic acid, acetic acid, succinic acid, tartaric acid, methanesulphonic acid, p-toluenesulphonic acid and the like, which are non toxic to living organisms.
  • the present invention relates to compounds of formula (I)
  • R 1 is heteroaryl which can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, halogen, lower-alkoxy- lower-alkyl, cyano, NO 2 , morpholinyl, NH 2 -SO 2 , N(H,lower-alkyl)-SO 2 , N(lower- alkyl) 2 -SO 2 , pyrrolidinyl-SO 2 , piperidinyl-SO 2 , morpholinyl- S O 2 , hydroxy, COOH,
  • R 2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower- alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO 2 , COOH, CONH 2 ,
  • R is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
  • R 4 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
  • the compounds of formula (I) can have one or more asymmetric C atoms and can therefore exist as an enantiomeric mixture, mixture of stereoisomers or as optically pure compounds.
  • R 2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO2, COOH, CONH 2 , NH 2 -SO 2 , COO-lower-alkyl, lower-alkoxy-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl) 2 , N(H,lower-alkyl)-SO 2 , N(lower-alkyl) 2 -SO 2 , lower-alkenyl, hydroxy, NO 2 , morpholinyl, piperidinyl, piperazinyl, (N-lower-alkyl)-piperazinyl, pyrroli
  • a preferred embodiment of the present invention relates to compounds of formula (I) as described above, wherein R 1 is heteroaryl selected from the group consisting of pyridinyl, isoquinolinyl and quinolinyl, which heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, halogen, cyano, morpholinyl and hydroxy.
  • R 1 is heteroaryl selected from the group consisting of pyridinyl and quinolinyl, which heteroaryl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of lower-alkyl, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, halogen, morpholinyl and hydroxy.
  • R 1 is pyridin-4-yl, 2- chloro-pyridin-4-yl, 2-methansulfonyl-pyridin-4-yl, pyridin-3-yl, 5-methyl-pyridin-3-yl, 2- morpholin-4-yl-pyridin-4-yl, 2-hydroxy-pyridin-4-yl, 5-chloro-pyridin-3-yl, 5-trifluoromethyl- pyridin-3-yl, 5-difluoromethoxy-pyridin-3-yl, 6-trifluoromethyl-pyridin-3-yl, quinolin-3-yl or 2- methyl-pyridin-4-yl.
  • R 2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of pyridinyl, quinolinyl and isoquinolinyl, which aryl or heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, fluoro-lower-alkyl, COOH, NH2-SO2, COO-lower-alkyl, N(lower-alkyl) 2 - SO 2 , piperazinyl, (N-lower-alkyl)-piperazinyl, lower-alkinyl and tri(lower-alkyl)silyl- loweralkinyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene.
  • R 2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of pyridinyl, quinolinyl and isoquinolinyl, which aryl or heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, fiuoro-lower-alkyl, COOH, NH 2 -SO 2 , COO-lower-alkyl, N(lower-alkyl) 2 -SO 2 , piperazinyl, (N-lower-alkyl)-piperazinyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo- lower-alkylene.
  • R 2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of quinolinyl and isoquinolinyl, which aryl or heteroaryl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of halogen and lower-alkinyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo- lower-alkylene.
  • R 2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of quinolinyl and isoquinolinyl, which aryl or heteroaryl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of halogen, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene.
  • R 2 is napthalen-1-yl, quinolin-4-yl, phenyl, benzo[l,3]dioxol-5-yl, 3-fluoro-phenyl, 2,3-dihydro-benzo[l,4]dioxin-6-yl, 3-chloro-phenyl, 2- fluoro -phenyl, 3 -bromo -phenyl, 3-ethynyl-phenyl or isoquinolin-5-yl, particularly those, wherein R 2 is napthalen-1-yl, quinolin-4-yl, phenyl, benzo[l,3]dioxol-5-yl, 3-fluoro-phenyl, 2,3-dihydro- benzo[l,4]dioxin-6-yl, 3-chloro-phenyl, 2-fluoro-phenyl or isoquinolin-5-yl.
  • Another preferred embodiment of the present invention refers to compounds as defined above, wherein R 3 is hydrogen.
  • Other preferred compounds of the present invention are those, wherein R 4 is hydrogen.
  • preferred compounds are the compounds of formula (I) described in the examples as individual compounds as well as pharmaceutically acceptable salts as well as pharmaceutically acceptable esters thereof. Furthermore, the substituents as found in the specific examples described below, individually constitute separate preferred embodiments of the present invention.
  • Preferred compounds of formula (I) are those selected from the group consisting of: 3-[2-(6-Chloro-pyridin-2-yl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, l-Pyridin-4-yl-3-(2-pyridin-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-[5-(4-Oxo- 1 -pyridin-4-yl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl]-benzonitrile, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 3-[5-(4-Oxo- 1 -pyridin-4-yl- 1 ,4-dihydr
  • Particularly preferred compounds of formula (I) are those selected from the group consisting of:
  • the compounds of general formula (I) in this invention may be derivatised at functional groups to provide derivatives which are capable of conversion back to the parent compound in vivo.
  • the invention further relates to a process for the manufacture of compounds of formula (I) as defined above, which process comprises reacting a compound of formula (II)
  • reaction of a compound of formula (II) with a compound of the formula R 2 -NH-NH 2 can be carried out under conditions as described in the examples or under conditions well known to the person skilled in the art.
  • the reaction can be performed in solvents like DMF, acetic acid, ethanol, water, a mixture of ethanol with hydrochloric acid and the like at elevated temperatures e.g. at 100-200 0 C, at atmospheric pressure or elevated pressure.
  • the reaction can be performed at the reflux temperature of the respective solvent, or it can be performed at temperatures above boiling point by applying sealed tubes and using microwave irradiation conditions.
  • the present invention also relates to compounds of formula (I) as defined above, when prepared by a process as described above.
  • R 1 , R 2 , R 3 , and R 4 are as described above.
  • the pyridazinones of the general formula (I) can be prepared starting from anilines of formula 2 (see scheme 1 below).
  • Anilines 2 are either commercially available or can be prepared from commercial precursors as e.g. from their corresponding nitro compounds by reductive methods.
  • Another option is to convert commercial anilines into the desired anilines 2 by standard methods known in the art.
  • Conversion of anilines 2 into their corresponding diazonium salts of general formula 3 can be done using standard methods known to those skilled in the art as e.g. treatment of the aniline in a mineral acid as e.g. hydrochloric acid, sulfuric acid or phosphoric acid with sodium nitrite.
  • the formed diazonium salts 3 can be used without any further purification for the condensation with suitable 1,3-diketones 4 resulting in diazo compounds of general formula 5.
  • This reaction is preferentially performed in an alcohol/water mixture at low temperatures (0-5 0 C) at almost neutral pH value (pH 5-6) which can be achieved by adding suitable basic salts like e.g. ammonium acetate.
  • suitable basic salts like e.g. ammonium acetate.
  • the diazo compounds of formula 5 can tautomerize to the corresponding hydrazones.
  • the pyridazin-4-one ring can be formed by reacting the intermediate diazo compounds of formula 5 with Cl -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N ,N- dimethylformamide dimethyl acetal.
  • Cl -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N ,N- dimethylformamide dimethyl acetal.
  • the reaction with N,N-dimethylformamide dimethyl acetal affords the pyridazinone intermediates of general formula 6 bearing a 1,3-diketone equivalent as side chain.
  • the side chain 1,3-diketone equivalent of pyridazinones 6 is used to form the final products of general formula (I) by condensing pyridazinones 6 with suitable hydrazines of general formula 7.
  • This reaction is usually performed in solvents like DMF, acetic acid, ethanol, water, a mixture of ethanol with hydrochloric acid and the like at elevated temperatures.
  • the reaction can be performed at the reflux temperature of the respective solvent, or it can be performed at temperatures above boiling point by applying sealed tubes and using microwave irradiation conditions.
  • Hydrazines of general formula 7 are commercially available or can be prepared by methods known to those skilled in the art. Straightforward synthetic methods starting from commercial precursors include the conversion of the corresponding anilines with sodium nitrite and tin-(II)-chloride and the treatment of hydrazine hydrate with aromatic/hetero aromatic halides.
  • the pyridazinones of the general formula (I) can also be prepared starting from anilines of formula 2 according to scheme 2 (see below).
  • Conversion of anilines 2 into their corresponding diazonium salts of general formula 3 can be done as described above.
  • the formed diazonium salts 3 can be used without any further purification for the condensation with suitable ketoesters 8 resulting in diazo compounds of general formula 9.
  • This reaction is preferentially performed in an alcohol/water mixture at low temperatures (0-5 0 C) at almost neutral pH value (pH 5-6) which can be achieved by adding suitable basic salts like e.g. ammonium acetate.
  • the diazo compounds of formula 9 can tautomerize to the corresponding hydrazones.
  • the pyridazin-4-one ring can be formed by reacting the intermediate diazo compounds of formula 9 with Ci -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N 5 N- dimethylformamide dimethyl acetal.
  • Ci -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N 5 N- dimethylformamide dimethyl acetal.
  • the reaction with N,N-dimethylformamide dimethyl acetal affords the pyridazinone intermediates of general formula 10 bearing an ester equivalent as side chain.
  • the ester side chain equivalent of pyridazinones 10 can be converted into a ketone most conveniently by functionalisation into a suitable activated species such as a Weinreb amide 11 therefore disposed towards displacement with an organometalic species, most commonly a Grignard reagent of general formula 12 in e.g.
  • Hydrazines of general formula 7 are commercially available or can be prepared by methods known to those skilled in the art. Straightforward synthetic methods starting from commercial precursors include the conversion of the corresponding anilines with sodium nitrite and tin-(II)-chloride and the treatment of hydrazine hydrate with aromatic/hetero aromatic halides.
  • Certain substituents on the groups R 1 , R 2 , R 3 , and R 4 may not be inert to the conditions of the synthesis sequences described above and may require protection by standard protecting groups known in the art. For instance, an amino or hydroxyl group may be protected as an acetyl or tert- butoxycarbonyl derivative. Alternatively, some substituents may be derived from others at the end of the reaction sequence.
  • a compound of formula I may be synthesized bearing a nitro-, an ethoxycarbonyl, an ether, a sulfonic acid substituent on the groups R 1 , R 2 , R 3 , and R 4 , which substituents are finally converted to an amino- (e.g. by reduction of a nitro group or cleavage of a suitable amino protective group (e.g. removal of a Boc group with TFA)), alkylamino- (e.g. by reductive amination of an amino group), dialkylamino- (e.g.
  • acylamino- by amide formation from an amino group e.g. with appropriate acyl halides or with appropriate carboxylic acids after their activation with CDI, EDC etc.
  • alkylsulfonylamino e.g. by reaction of an amino group with sulfonyl chlorides
  • arylsulfonylamino substituent e.g. by reaction of an amino group with sulfonyl chlorides
  • hydroxyl- by cleavage of a suitable hydroxy protective group (e.g.
  • hydro geno lytic removal of a benzyl ether or oxidative cleavage of a p-methoxy benzyl ether ether- (e.g. by Williamson's ether synthesis from a hydroxyl group) or to a carboxamide substituent (e.g. by amide formation from a carboxylic acid group with appropriate amines after activation of the carboxylic acid group with CDI, EDC etc. or conversion to an acyl chloride), or to a sulfonamide substituent by standard procedures.
  • the corresponding salts with acids can be obtained by standard methods known to the person skilled in the art, e.g. by dissolving the compound of formula (I) in a suitable solvent such as e.g. dioxan or THF and adding an appropriate amount of the corresponding acid.
  • a suitable solvent such as e.g. dioxan or THF
  • the products can usually be isolated by filtration or by chromatography.
  • the conversion of a compound of formula (I) into a pharmaceutically acceptable salt with a base can be carried out by treatment of such a compound with such a base.
  • One possible method to form such a salt is e.g. by addition of 1/n equivalents of a basic salt such as e.g.
  • a suitable solvent e.g. ethanol, ethanol- water mixture, tetrahydrofuran- water mixture
  • the conversion of compounds of formula (I) into pharmaceutically acceptable esters can be carried out e.g. by treatment of a suitable carboxy group present in the molecule with a suitable alcohol using e.g. a condensating reagent such as benzotriazol-1- yloxytris(dimethylamino)phosphonium hexafluorophosphate (BOP), N 5 N- dicylohexylcarbodiimide (DCC), N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDCI) or O-(l,2-dihydro-2-oxo-l-pyridyl)-N,N,N,N-tetra-methyluronium- tetrafluoroborate (TPTU), or by direct reaction with a suitable alcohol under acidic conditions, as for example in the presence of a strong mineral acid like hydrochloric acid, sulfuric acid and the like.
  • the compounds of formula (I) as well as all intermediate products can be prepared according to analogous methods or according to the methods set forth above. Starting materials are commercially available, known in the art or can be prepared by methods known in the art or in analogy thereto.
  • the novel compounds of the present invention have been found to inhibit PDElOA activity.
  • the compounds of the present invention can therefore be used, either alone or in combination with other drugs, for the treatment and/or prophylaxis of diseases which are modulated by PDElOA inhibitors.
  • These diseases include, but are not limited to, certain psychotic disorders such as schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder or substance-induced psychotic disorder, anxiety disorders such as panic disorder, obsessive/compulsive disorders, acute stress disorder or generalized anxiety disorder, drug addictions, movement disorders such as Parkinson's disease or restless leg syndrome, cognition deficiency disorders such as Alzheimer's disease or multi- infarct dementia, mood disorders such as depression or bipolar disorders, or neuropsychiatric conditions such as psychosis, attention-def ⁇ cit/hyperactivity disorder (ADHD) or related attentional disorders.
  • psychotic disorders such as schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder or substance-induced psychotic disorder, anxiety disorders such as panic disorder, obsessive/compulsive disorders, acute stress disorder or generalized anxiety disorder, drug addictions, movement disorders such as Parkinson's disease or restless leg syndrome, cognition deficiency disorders such as Alzheimer's disease or multi- infarc
  • diabetes and related disorders such as type 2 diabetes mellitus, neurodegenerative disorders such as Alzheimer's disease, Huntington's disease, Parkinson's disease, multiple sclerosis, stroke or spinal cord injury, solid tumors and hematological malignancies such as renal cell carcinoma or breast cancer.
  • the invention therefore also relates to pharmaceutical compositions comprising a compound as defined above and a pharmaceutically acceptable carrier and/or adjuvant.
  • the invention likewise embraces compounds as described above for use as therapeutically active substances, especially as therapeutically active substances for the treatment and/or prophylaxis of diseases which are modulated by PDElOA inhibitors, particularly as therapeutically active substances for the treatment and/or prophylaxis of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-def ⁇ cit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer.
  • the invention relates to a method for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-def ⁇ cit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer, which method comprises administering a compound as defined above to a human being or animal.
  • the invention also embraces the use of compounds as defined above for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-def ⁇ cit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer.
  • psychotic disorders schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, de
  • the invention also relates to the use of compounds as described above for the preparation of medicaments for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention- deficit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer.
  • Such medicaments comprise a compound as described above.
  • Prevention and/or treatment of schizophrenia is a preferred indication. Furthermore, prevention and/or treatment of positive, negative and/or cognitive symptoms associated with schizophrenia is preferred.
  • PDElO activity of the compounds of the present invention is determined using a Scintillation Proximity Assay (SPA) -based method similar to the one previously described (Fawcett, L. et al., ProcNatl Acad Sci USA (2000) 97(7):3702-3707).
  • SPA Scintillation Proximity Assay
  • PDElOAl and PDE10A2 are two splice variants of PDElOA. There are these 2 splice variants known, which differ in the N-terminal part of the protein. The catalytic domains of PDElOAl and PDE10A2 are identical. The assay for PDE10A2 described below is therefore also representative for PDElOAl and also for PDElOA in general.
  • the PDE10A2 assay was performed in a two step procedure in 96-well micro titer plates.
  • the reaction mixture of 80 ⁇ l contained 20 mM HEPES/ 10 mM MgCl 2 /0.05 mg/ml buffer (pH 7.5), 50 nM cGMP (Sigma) and 50 nM [ 3 H] -cGMP (GE Healthcare), 0.25 nM PDE10A2 with or without a specific test compound.
  • a range of concentrations of the potential inhibitor was used to generate data for calculating the concentration of inhibitor resulting in 50% of the effect (e.g. IC 5 O, the concentration of the competitor inhibiting PDE10A2 activity 50%). Non-specific activity was tested without the enzyme.
  • the reaction was initiated by addition of the substrate solution (cGMP and [ 3 H] -cGMP) and allowed to progress for 30 minutes at room temperature.
  • the reaction was terminated by transferring 50 ⁇ l of the reaction mixture into an OptiPlate (Perkin Elmer) containing 25 ⁇ l of YSi-SPA scintillation beads (GE Healthcare) in 18 mM zinc sulphate solution (stop reagent). After 1 h under shaking, the plate was centrifuged one minute at 1000 rpm to allow beads to settle. Afterwards, radioactive counts were measured on a Perkin Elmer TopCount Scintillation plate reader.
  • the PCR product was used in a BP recombination reaction with pDONR221 to generate pENTR Thm-PDE10A2(S449-D789) which was DNA sequence verified and then used in an LR recombination reaction with a Gateway modified version of pETl la.
  • the resulting expression vector, placT7.2 H6-(gwl)-Thm-PDE10A2(S449-D789) was DNA sequence confirmed and transformed into E. coli strain BL21(DE3) pLysS and recombinant protein was produced in TB medium at 20 0 C by induction to a final IPTG concentration of 0.5mM at an optical density of 1.0 at 600nm for 20 hours.
  • the protein was purified using sequential chromatography on Ni-NTA and HiTrapQ/HiTrapS. After thrombin digest at room temperature a HiTrapChelating/HiTrap Benzamindin chromatography removed impurities, uncleaved protein and thrombin. Final purification of PDE10A2(S449-D789) was performed on a Superdex 75 size exclusion chromatography equilibrated with 25 mM HEPES pH 8.4, 0.15 M NaCl. The yield of pure protein was 2 mg/liter of culture volume is relatively low. The purity of the protein was >95%, monomeric and monodisperse as shown by SDS-PAGE, HPLC and analytical ultracentrifugation.
  • the compounds according to formula (I) preferably have an IC 50 value below 10 ⁇ M, preferably below 5 ⁇ M, more preferably below 1 ⁇ M.
  • the IC50 values are above 0.0 InM, more preferable above 0.1 nM, more preferably above 1 nM.
  • the following table shows data for some examples.
  • the compounds of formula (I) and/or their pharmaceutically acceptable salts can be used as medicaments, e.g. in the form of pharmaceutical preparations for enteral, parenteral or topical administration. They can be administered, for example, pero rally, e.g. in the form of tablets, coated tablets, dragees, hard and soft gelatine capsules, solutions, emulsions or suspensions, rectally, e.g. in the form of suppositories, parenterally, e.g. in the form of injection solutions or suspensions or infusion solutions, or topically, e.g. in the form of ointments, creams or oils. Oral administration is preferred.
  • the production of the pharmaceutical preparations can be effected in a manner which will be familiar to any person skilled in the art by bringing the described compounds of formula (I) and/or their pharmaceutically acceptable salts, optionally in combination with other therapeutically valuable substances, into a galenical administration form together with suitable, non-toxic, inert, therapeutically compatible solid or liquid carrier materials and, if desired, usual pharmaceutical adjuvants.
  • Suitable carrier materials are not only inorganic carrier materials, but also organic carrier materials.
  • lactose, corn starch or derivatives thereof, talc, stearic acid or its salts can be used as carrier materials for tablets, coated tablets, dragees and hard gelatine capsules.
  • Suitable carrier materials for soft gelatine capsules are, for example, vegetable oils, waxes, fats and semi-solid and liquid polyols (depending on the nature of the active ingredient no carriers might, however, be required in the case of soft gelatine capsules).
  • Suitable carrier materials for the production of solutions and syrups are, for example, water, polyols, sucrose, invert sugar and the like.
  • Suitable carrier materials for injection solutions are, for example, water, alcohols, polyols, glycerol and vegetable oils.
  • Suitable carrier materials for suppositories are, for example, natural or hardened oils, waxes, fats and semi-liquid or liquid polyols.
  • Suitable carrier materials for topical preparations are glycerides, semi- synthetic and synthetic glycerides, hydrogenated oils, liquid waxes, liquid paraffins, liquid fatty alcohols, sterols, polyethylene glycols and cellulose derivatives.
  • Usual stabilizers, preservatives, wetting and emulsifying agents, consistency- improving agents, flavour-improving agents, salts for varying the osmotic pressure, buffer substances, solubilizers, colorants and masking agents and antioxidants come into consideration as pharmaceutical adjuvants.
  • the dosage of the compounds of formula (I) can vary within wide limits depending on the disease to be controlled, the age and the individual condition of the patient and the mode of administration, and will, of course, be fitted to the individual requirements in each particular case. For adult patients a daily dosage of about 0.1 to 2000 mg, especially about 1 to 500 mg, comes into consideration. Depending on severity of the disease and the precise pharmacokinetic profile the compound could be administered with one or several daily dosage units, e.g. in 1 to 3 dosage units.
  • the pharmaceutical preparations conveniently contain about 0.1-500 mg, preferably 1- 200 mg, of a compound of formula (I).
  • Example 8 4- ⁇ 5-( 4-Oxo- l-pyridin-4-yl- 1 ,4-dihvdro-pyridazin-3-yl)-pyrazol- 1-yll - benzenesulfonamide
  • Example 13 l- ⁇ -Chloro-pyridin-4-yl)-3- ⁇ -naphthalen-l-yl-2H-pyrazol-3-yl)-lH- pyridazin-4-one
  • Examplel 5 3- r2-(2,3-Dihydro-benzo ⁇ 1 ,41 dioxin-6-yl)-2H-pyrazol-3-yll - l-pyridin-4-yl- IH- pyridazin-4-one
  • Example 16 l-f2-Methanesulfonyl-pyridin-4-yl)-3-f2-naphthalen-l-yl-2H-pyrazol-3-yl)- lH-pyridazin-4-one
  • Example 17 3- r2-(2,3-Dihydro-benzo r 1 ,41 dioxin-6-yl)-2H-pyrazol-3-yll - 1-(2- methanesulfonyl-pyridin-4-yl)-lH-pyridazin-4-one
  • Example 20 l-Pyridin-4-yl-3-f2- ⁇ uinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
  • Example 22 l-Pyridin-4-yl-3-f2- ⁇ uinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
  • Example 25 3-[2-f2-Piperazin-l-yl-pyridin-4-yl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH- pyridazin-4-one
  • Example 38 3- r2-(2,3-Dihydro-benzo ⁇ 1 ,41 dioxin-6-yl)-2H-pyrazol-3-yll - l-(2-methyl- pyridin-4-yl)-lH-pyridazin-4-one
  • Example 41 3- [2-(2,3-Dihvdro-benzo [ 1 ,41 dioxin-6-vD-2H-pyrazol-3-yll - l-(2-morpholin-4- yl-Pyridin-4-yl)-lH-pyridazin-4-one
  • Example 43 4- ⁇ 3- ⁇ 2-( 2,3-Dihydro-benzo [ 1 ,41 dioxin-6-yl)-2H-pyrazol-3-yll -4-oxo-4H- Pyridazin-l-yl ⁇ -pyridine-2-carbonitrile
  • Example 46 3- [2-(2,3-Dihvdro-benzo [ 1 ,41 dioxin-6-vD-2H-pyrazol-3-yll - l-(2-hydroxy- pyridin-4-yl)-lH-pyridazin-4-one
  • Example 48 3-[2-f6-Fluoro- ⁇ uinolin-4-yl)-2H-pyrazol-3-yll-l-f5-methyl-pyridin-3-yl)-lH- pyridazin-4-one
  • Example 50 3-[2-f6-Fluoro- ⁇ uinolin-4-yl)-2H-pyrazol-3-yll-l-pyridin-3-yl-lH-pyridazin-4- one
  • Example 51 l-(5-Chloro-pyridin-3-yl)-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4- one
  • Example 52 l-(5-Chloro-pyridin-3-yl)-3-r2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
  • Example 54 l-f2-Chloro-pyridin-4-yl)-3-f2- ⁇ uinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4- one
  • Example 55 l-(2-Chloro-pyridin-4-yl)-3-r2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
  • Example 60 l-f5-Chloro-pyridin-3-yl)-3-f2- ⁇ uinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4- one
  • Example 62 l-(2-Chloro-pyridin-4-yl)-3-r2-(6-chloro-quinolin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
  • Example 64 l-( ⁇ -Chloro-pyridin-3-yl)-3-r2-a-fluoro-phenyl)-2H-pyrazol-3-yll-lH- Pyridazin-4-one
  • Example 65 3-[2-f2-Fluoro-phenyl)-2H-pyrazol-3-yll-l-iso ⁇ uinolin-4-yl-lH-pyridazin-4- one
  • Example 70 l-(5-Chloro-pyridin-3-yl)-3-r2-(7-chloro-quinolin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
  • Example 72 3-r2-(6-Chloro-quinolin-4-yl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH-pyridazin-4- one
  • Example 74 l-(5-Difluoromethoxy-pyridin-3-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yll- lH-pyridazin-4-one
  • Example 75 3-[2-f2-Fluoro-phenyl)-2H-pyrazol-3-yll-l-f6-trifluoromethyl-pyridin-3-yl)- lH-pyridazin-4-one
  • Example 77 l-(6-Chloro-pyridin-3-yl)-3-r2- ⁇ -fluoro-phenyl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
  • Example 80 3-f2-Ouinolin-5-yl-2H-pyrazol-3-yl)-l-f6-trifluoromethyl-pyridin-3-yl)-lH- pyridazin-4-one
  • Example 83 l-(2-Methyl-pyridin-4-yl)-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4- one
  • Example 84 l-Pyridin-3-yl-3-f2- ⁇ uinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
  • Example 88 l-(6-Chloro-pyridin-3-yl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
  • Example 90 3-r2- ⁇ -Fluoro-phenyl)-2H-pyrazol-3-yll-l-(5-methyl-pyridin-3-yl)-lH- pyridazin-4-one
  • Example 96 4- ⁇ 3-[2-f2-Fluoro-phenyl)-2H-pyrazol-3-yll-4-oxo-4H-pyridazin-l-yl ⁇ - pyridine-2-carbonitrile
  • Example 98 l-Pyridin-4-yl-3-r2-(3-trimethylsilanylethvnyl-phenyl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
  • Example 100 3- ⁇ 2-( 2-Fluoro-phenyl)-2H-pyrazol-3-yll - 1-isoq uinolin-6-yl- lH-pyridazin-4- one
  • Example 101 3- ⁇ 2-( 3-Fluoro-phenyl)-2H-pyrazol-3-yll - 1-isoq uinolin-6-yl- lH-pyridazin-4- one
  • Example 102 3- ⁇ 2-( 2-Fluoro-phenyl)-2H-pyrazol-3-yll - 1-q uinolin-6-yl- lH-pyridazin-4-one
  • Film coated tablets containing the following ingredients can be manufactured in a conventional manner:
  • the active ingredient is sieved and mixed with micro cristalline cellulose and the mixture is granulated with a solution of polyvinylpyrrolidon in water.
  • the granulate is mixed with sodium starch glycolate and magesiumstearate and compressed to yield kernels of 120 or 350 mg respectively.
  • the kernels are lacquered with an aqueous solution / suspension of the above mentioned film coat.
  • Capsules containing the following ingredients can be manufactured in a conventional manner:
  • the components are sieved and mixed and filled into capsules of size 2.
  • Injection solutions can have the following composition:
  • the active ingredient is dissolved in a mixture of Polyethylene Glycol 400 and water for injection (part).
  • the pH is adjusted to 5.0 by Acetic Acid.
  • the volume is adjusted to 1.0 mL by addition of the residual amount of water.
  • the solution is filtered, filled into vials using an appropriate overage and sterilized.
  • Soft gelatin capsules containing the following ingredients can be manufactured in a conventional manner:
  • Soya bean oil HO.O mg
  • the active ingredient is dissolved in a warm melting of the other ingredients and the mixture is filled into soft gelatin capsules of appropriate size.
  • the filled soft gelatin capsules are treated according to the usual procedures.
  • Sachets containing the following ingredients can be manufactured in a conventional manner:
  • Microcristalline cellulose (AVICEL PH 102) 1400.0 mg
  • Flavoring additives 1.0 mg
  • the active ingredient is mixed with lactose, microcristalline cellulose and sodium carboxymethyl cellulose and granulated with a mixture of po lyvinylpyrro lidon in water.
  • the granulate is mixed with magnesiumstearate and the flavouring additives and filled into sachets.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Psychiatry (AREA)
  • Diabetes (AREA)
  • Addiction (AREA)
  • Hematology (AREA)
  • Psychology (AREA)
  • Obesity (AREA)
  • Emergency Medicine (AREA)
  • Cardiology (AREA)
  • Oncology (AREA)
  • Pain & Pain Management (AREA)
  • Endocrinology (AREA)
  • Hospice & Palliative Care (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)

Abstract

The present invention is concerned with novel pyridazinone derivatives of formula (I) wherein R1, R2, R3 and R4 are as defined in the description and in the claims, as well as physiologically acceptable salts and esters thereof. These compounds inhibit PDE10A and can be used as medicaments.

Description

HETEROARYL SUBSTITUTED PYRIDAZINONE DERIVATIVES
The invention is concerned with novel pyridazinone derivatives of formula (I)
Figure imgf000003_0001
wherein
R1 is heteroaryl which can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, halogen, lower-alkoxy- lower-alkyl, cyano, NO2, morpholinyl, NH2-SO2, N(H,lower-alkyl)-SO2, N(lower- alkyl)2-SO2, pyrrolidinyl-SO2, piperidinyl-SO2, morpholinyl- S O2, hydroxy, COOH, COO-lower-alkyl, lower-alkyl-C(O)O, CO-lower-alkyl, CONH2, CON(H,lower-alkyl), CON(lower-alkyl)2, lower-alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl), NH2-CO- lower-alkyl, NH(lower-alkyl)-CO-lower-alkyl, N(lower-alkyl)2-CO-lower-alkyl, NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower-alkyl)-lower-alkyl,
N(lower-alkyl)2-lower-alkyl, cycloalkyl, piperidinyl, piperazinyl and (N-lower-alkyl)- piperazinyl;
R2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower- alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO2, COOH, CONH2, NH2-SO2, COO-lower-alkyl, lower-alkoxy-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl)2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, lower-alkenyl, hydroxy, NO2, morpholinyl, piperidinyl, piperazinyl, (N-lower-alkyl)-piperazinyl, pyrrolidinyl, lower-alkyl-C(O)O, lower-alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl), NH2-CO- lower-alkyl, NH(lower-alkyl)-CO-lower-alkyl, N(lower-alkyl)2-CO-lower-alkyl, CO- lower-alkyl, NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower- alkyl)-lower-alkyl, N(lower-alkyl)2-lower-alkyl, tri(lower-alkyl)silyl-loweralkinyl and cycloalkyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower- alkylene, dioxo-fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower- alkylene, lower-alkylene-NH-lower-alkylene, lower-alkylene-N(lower alkyl)-lower- alkylene, NH-C(O)-Io wer-alkylene, N(Io wer alkyl)-C(O)-lower-alkylene, lower- alkylene-NH-C(O)-lower-alkylene, lower-alkylene -N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)-N(lower-alkyl)-lower-alkylene;
R3 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
R4 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
and pharmaceutically acceptable salts and esters thereof.
Further, the invention is concerned with a process for the manufacture of the above compounds, pharmaceutical preparations which contain such compounds as well as the use of these compounds for the production of pharmaceutical preparations.
Schizophrenia is a progressive and devastating neurological disease characterized by episodic positive symptoms such as delusions, hallucinations, thought disorders and psychosis and persistent negative symptoms such as flattened affect, impaired attention and social withdrawal, and cognitive impairments (Lewis DA and Lieberman JA, Neuron, , 28:325-33, 2000). For decades research has focused on the "dopaminergic hyperactivity" hypothesis which has led to therapeutic interventions involving blockade of the dopaminergic system (Vandenberg RJ and Aubrey KR., Exp. Opin. Ther. Targets, 5(4): 507-518, 2001; Nakazato A and Okuyama S, et al, Exp. Opin. Ther. Patents, 10(1): 75-98, 2000). This pharmacological approach, besides ameliorating positive symptoms in schizophrenic patients, poorly addresses negative and cognitive symptoms which are the best predictors of functional outcome (Sharma T., BrJ. Psychiatry, 174(suppl. 28): 44-51, 1999). In addition, current antipsychotic treatment is associated with adverse effects like weight gain, extrapyramidal symptoms or effects on glucose and lipid metabolism, related to their unspecific pharmacology.
In conclusion there is still a need for developing new antipsychotics with improved efficacy and safety profile. A complementary model of schizophrenia was proposed in the mid- 1960' based upon the psychotomimetic action caused by the blockade of the glutamate system by compounds like phencyclidine (PCP) and related agents (ketamine) which are non- competitive NMDA receptor antagonists. Interestingly, in healthy volunteers PCP-induced psychotomimetic action incorporates positive and negative symptoms as well as cognitive dysfunction, thus closely resembling schizophrenia in patients (Javitt DC et al, Biol. Psychiatry, 45: 668-679, 1999).
Cyclic nucleotides cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) are ubiquitous second messengers responsible for mediating the biological response of a variety of extracellular signals, including neurotransmitters, light and hormones. cAPM and cGMP regulate a variety of intracellular processes particularly in neurons of the central nervous system by activating cAMP- and cGMP-dependent kinases which then phosphorylate proteins involved in the regulation of synaptic transmission, neuronal differentiation and survival.
A crucial mechanism for controlling intracellular cyclic nucleotide levels and therefore cyclic nucleotide signaling is via hydrolysis of the 3',5'-phosphodiester bond by phosphodiesterases. Phosphodiesterases (PDEs) are a family of widely expressed enzymes encoded by 21 different genes in humans, with each gene encoding several splice variants (Beavo, J., Physiol. Rev. 1995, 75, 725-748; Conti, M., Jin, S.L., Prog. Nucleic Acid Res. MoI. Biol. 1999, 63, 1-38; Soderling, S.H., Beavo, J.A., Curr. Opin. Cell Biol. 2000,12, 174-179, Manallack, D.T. et al. J. Med.Chem. 2005, 48 (10), 3449-3462).
The PDE families differ in their substrate specificy for the cyclic nucleotides, their mechanism of regulation and their sensitivity to inhibitors. Moreover, they are differentially localized in the organism, among the cells of an organ and even within the cells. These differences lead to a differentiated involvement of the PDE families in the various physiological functions.
PDElOA is a dual substrate PDE encoded by a single gene as reported in 1999 by three separate research groups (Fujishige K., et al, Eur J Biochem (1999) 266(3):1118-1127, Soderling S.H., et al., ProcNatl Acad Sci USA (1999) 96(12):7071-7076, Loughney K., et al., Gene (1999) 234(1): 109-117). PDElOA is unique from other members of the multigene family with respect to amino acid sequence (779 aa), tissue-specific pattern of expression, affinity for cAMP and cGMP and the effect on PDE activity by specific and general inhibitors.
PDElOA has one of the most restricted distribution of any PDE family being primarily expressed in the brain particularly in the nucleus accumbens and the caudate putamen. Additionally thalamus, olfactory bulb, hippocampus and frontal cortex show moderate levels of PDElOA expression. All these brain areas have been suggested to be involved in the pathophysiology of schizophrenia and psychosis, suggesting a central role of PDElOA in this devastating mental illness. Outside the central nervous system PDElOA transcript expression is also observed in peripheral tissues like thyroid gland, pituitary gland, insulin secreting pancreatic cells and testes (Fujishige, K. et al., J. Biol. Chem. 1999, 274, 18438-18445, Sweet, L. (2005) WO 2005/012485). On the other hand expression of PDElOA protein has been observed only in enteric ganglia, in testis and epididdimal sperm (Coskran T. M, et al., J. Histochem. Cytochem. 2006, 54 (11), 1205-1213).
In the striatum both mRNA and protein are expressed only in the GABA (γ-aminobutyric acid)-containing medium spiny projection neurons making it an intriguing target for the treatment of diseases of the central nervous system (Fujishige, K. et al., Eur. J. Biochem. 1999, 266, 1118-1127; Seeger, T.F. et al., Brain Res. 2003, 985, 113-126). The striatal medium spiny neurons are the principal input site and first site for information integration in the basal ganglia circuit of the mammalian brain. The basal ganglia are a series of interconnected subcortical nuclei that integrate widespread cortical input with dopaminergic signaling to plan and execute relevant motor and cognitive patterns while suppressing unwanted or irrelevant patterns (Graybiel, A.M. Curr. Biol. 2000, 10, R509-R511 (2000). Papaverine, a relatively specific PDElOA inhibitor, and PDElOA-knockout mice have been used to explore the physiology of this enzyme and the possible therapeutic utility of PDElOA inhibition. Inhibition of this enzyme pharmacologically or through gene disruption causes a reduction in activity and a reduced response to psychomotor stimulants. Inhibition also reduces the conditioned avoidance response, a behavioural response that is predictive of clinical antipsychotic activity (Siuciak, J.A.; et al, Neuropharmacology 2006, 51 (2), 386-396; Siuciak, J.A.; et al., Neuropharmacology 2006, 57 (2), 374-385).
In addition PDElOA inhibition bears the potential to improve the negative and cognitive symptoms associated to schizophrenia. Indeed papaverine have been shown to attenuate the deficits in the extra-dimensional shift learning induced in rats by sub-chronic treatment with PCP, an animal paradigm of NMDA receptor hypofunction (Rodefer, J,S., et al., Eur. J. Neuroscience 2005, 2, : 1070- 1076). In addition increased social interaction in PDE10A2-deficient mice have been observed (Sano, H. J. Neurochem. 2008, 105, 546-556).
Diseases that can be treated with PDElOA inhibitors include, but are not limited to, diseases thought to be mediated in part by dysfunction of the basal ganglia, of other parts of the central nervous system and of other PDElOA expressing tissues. In particular, diseases can be treated, where inhibition of PDElOA can have therapeutic effects.
These diseases include, but are not limited to, certain psychotic disorders such as schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder or substance-induced psychotic disorder, anxiety disorders such as panic disorder, obsessive-compulsive disorder, acute stress disorder or generalized anxiety disorder, obsessive/compulsive disorders, drug addictions, movement disorders such as Parkinson's disease or restless leg syndrome, cognition deficiency disorders such as Alzheimer's disease or multi-infarct dementia, mood disorders such as depression or bipolar disorders, or neuropsychiatric conditions such as psychosis, attention-deficit/hyperactivity disorder (ADHD) or related attentional disorders.
The compounds of the present invention are also suitable for the treatment of diabetes and related disorders such as obesity by regulating the cAMP signaling system. PDElOA inhibitors might also be useful in preventing neurons from undergoing apoptosis by raising cAMP and cGMP levels and, thus, might possess anti-inflammatory properties.
Neurodegenerative disorders treatable with PDElOA inhibitors include, but are not limited to, as
Alzheimer's disease, Huntington's disease, Parkinson's disease, multiple sclerosis, stroke or spinal cord injury.
The growth of cancer cells is inhibited by cAMP and cGMP. Thus by raising cAMP and cGMP, PDElOA inhibitors can also be used for the treatment of different solid tumors and hematological malignancies such as renal cell carcinoma or breast cancer.
Unless otherwise indicated, the following definitions are set forth to illustrate and define the meaning and scope of the various terms used to describe the invention herein.
In this specification the term "lower" is used to mean a group consisting of one to seven, preferably of one to four carbon atom(s).
The term "halogen" refers to fluorine, chlorine, bromine and iodine, with fluorine, chlorine and bromine being preferred.
The term "alkyl", alone or in combination with other groups, refers to a branched or straight-chain monovalent saturated aliphatic hydrocarbon radical of one to twenty carbon atoms, preferably one to sixteen carbon atoms, more preferably one to ten carbon atoms. Lower-alkyl groups as described below also are preferred alkyl groups.
The term "lower-alkyl", alone or in combination with other groups, refers to a branched or straight-chain monovalent alkyl radical of one to seven carbon atoms, preferably one to four carbon atoms. This term is further exemplified by such radicals as methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, t-butyl and the like.
The term "alkenyl", alone or in combination with other groups, stands for a straight-chain or branched hydrocarbon residue comprising an olefinic bond and up to 20, preferably up to 16 carbon atoms. The term "lower-alkenyl" refers to a straight-chain or branched hydrocarbon residue comprising an olefinic bond and up to 7, preferably up to 4 carbon atoms, such as e.g. ethenyl or 2-propenyl. The term "alkinyl", alone or in combination with other groups, stands for a straight-chain or branched hydrocarbon residue comprising a tripple bond and up to 20, preferably up to 16 carbon atoms. The term "lower-alkinyl" refers to a straight-chain or branched hydrocarbon residue comprising a tripple bond and up to 7, preferably up to 4 carbon atoms, such as e.g. ethinyl or 2-propinyl.
The term "lower-alkylene", alone or in combination with other groups, refers to a branched or straight chain divalent lower-alkyl radical. This term is further exemplified by such radicals as methylene, ethylene, propylene and the like. The term "dioxo- lower-alkylene" refers to the group -O-lower-alkylene-0-.
The term "fluoro-lower-alkylene", alone or in combination with other groups, refers to a branched or straight chain divalent fluoro-lower-alkyl radical. This term is further exemplified by such radicals as -CF2- and the like. The term "dioxo-fluoro-lower-alkylene" refers to the group -O-fluoro-lower-alkylene-O-.
The term "cycloalkyl" refers to a monovalent carbocyclic radical of 3 to 10 carbon atoms, preferably 3 to 6 carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.
The term "fluoro-lower-alkyl" refers to lower-alkyl groups which are mono- or multiply substituted with fluorine. Examples of fluoro-lower-alkyl groups are e.g. CFH2, CF2H, CF3, CF3CH2, CF3(CH2)2, (CF3)2CH and CF2H-CF2..
The term "alkoxy" refers to the group R'-O-, wherein R' is an alkyl. The term "lower- alkoxy" refers to the group R'-O-, wherein R' is a lower-alkyl.
The term "fluoro-lower-alkoxy" refers to the group R"-O-, wherein R" is fluoro-lower- alkyl. Examples of fluoro-lower-alkoxy groups are e.g. CFH2-O, CF2H-O, CF3-O, CF3CH2-O, CF3(CH2)2-O, (CF3)2CH-O, and CF2H-CF2-O.
The term "aryl", alone or in combination, relates to the phenyl or naphthyl group, preferably the phenyl group, which can optionally be substituted, unless specifically stated otherwise, by 1 to 5 , preferably 1 to 3, substituents, independently selected from the group consisting of halogen, hydroxy, amino, NO2, lower-alkyl, hydroxy-lower-alkyl, lower-alkoxy, carboxy, carboxy-lower-alkyl, H2NC(O), (H,lower-alkyl)NC(O), (lower-alkyl)2NC(O), fiuoro- lower-alkyl, lower-alkyl-SO2, lower-alkyl-SO2O, lower-alkyl-SO2-NH, lower-alkyl-SO2- N(lower-alkyl), H2NSO2, (H,lower-alkyl)NSO2, (lower-alkyl)2NSO2, cyano, heteroaryl, cycloalkyl, phenyl and phenyloxy. Preferred substituents can be halogen, lower-alkyl and lower- alkoxy. Furthermore, aryl groups can preferably be substituted as described in the description and claims below. Examples of aryl, wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo- lower-alkylene, dioxo-fluoro-lower-alyklene, NH-Io wer-alkylene, N(Io wer alkyl)-lower-alkylene, lower-alkylene-NH-lower-alkylene, lower-alkylene-N(lower alkyl)-lower-alkylene, NH-C(O)- lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower-alkylene-NH-C(O)-lower-alkylene, lower-alkylene-N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)- N(lower-alkyl)-lower-alkylene are e.g. tetrahydronaphthaline, indane, benzocycloheptene, benzo[l,3]dioxole, 2,3-dihydro-benzo[l,4]dioxine, 3,4-dihydro-2H-benzo[b][l,4]dioxepine, 2,2- difluoro-benzo[l,3]dioxole, 2,3-dihydro-lH-indole, 2,3-dihydro-lH-isoindole, 1,3-dihydro- indol-2-one, l,3-dihydro-isoindol-2-one, 1,2,3,4-tetrahydroquinoline or 1,2,3,4- tetrahydroisoquinoline, preferably benzo[l,3]dioxole, 2,2-difluoro-benzo[l,3]dioxole or 2,3- dihydro-benzo[l,4]dioxine.
The term "heteroaryl" refers to an aromatic 5 to 6 membered monocyclic ring or 9 to 10 membered bicyclic ring which can comprise 1, 2 or 3 atoms selected from nitrogen, oxygen and/or sulphur, such as furyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, thienyl, isoxazolyl, oxazolyl, oxadiazolyl, imidazolyl, pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, thiadiazolyl, benzo imidazolyl, indolyl, indazolyl, benzothiazolyl, benzo isothiazolyl, benzoxazolyl, benzoisoxazolyl, quinolinyl and isoquinolinyl. Preferred heteroaryl groups are pyridinyl, quinolinyl and isoquinolinyl. Unless specifically stated otherwise, a heteroaryl group may optionally have a substitution pattern as described earlier in connection with the term "aryl". Furthermore, heteroaryl groups can preferably be substituted as described in the description and claims below. Preferred examples of heteroaryl, wherein two substituents at adjacent positions of the heteroaryl are bound together to form a ring are those wherein said two bound substituents are lower-alkylene, dioxo-lower-alkylene or dioxo-fluoro-lower-alyklene, e.g. 6,7-dihydro-5H- [2]pyrindine, 5,6,7,8-tetrahydroisoquinoline, 5,6,7,8-tetrahydroquinoline, [l,3]dioxolo[4,5- c]pyridine, 2,2-difluoro-[l,3]dioxolo[4,5-c]pyridine, 2,3-dihydro-[l,4]dioxino[2,3-c]pyridine, preferably 5,6,7,8-tetrahydroisoquinoline.
Compounds of formula (I) can form pharmaceutically acceptable acid addition salts. Examples of such pharmaceutically acceptable salts are salts of compounds of formula (I) with physiologically compatible mineral acids, such as hydrochloric acid, sulphuric acid, sulphurous acid or phosphoric acid; or with organic acids, such as methanesulphonic acid, p- toluenesulphonic acid, acetic acid, lactic acid, trifluoro acetic acid, citric acid, fumaric acid, maleic acid, tartaric acid, succinic acid or salicylic acid. The term "pharmaceutically acceptable salts" refers to such salts. Compounds of formula (I) which comprise an acidic group, such as e.g. a COOH group, can further form salts with bases. Examples of such salts are alkaline, earth- alkaline and ammonium salts such as e.g. Na-, K-, Ca- and trimethylammoniumsalt. The term "pharmaceutically acceptable salts" also refers to such salts. Salts obtained by the addition of an acid are preferred.
The term "pharmaceutically acceptable esters" embraces derivatives of the compounds of formula (I), in which a carboxy group has been converted to an ester. Lower-alkyl, hydroxy- lower-alkyl, lower-alkoxy-lower-alkyl, amino-lower-alkyl, mono- or di-lower-alkyl-amino- lower-alkyl, morpholino-lower-alkyl, pyrrolidino-lower-alkyl, piperidino-lower-alkyl, piperazino-lower-alkyl, lower-alkyl-piperazino-lower-alkyl and aralkyl esters are examples of suitable esters. The methyl, ethyl, propyl, butyl and benzyl esters are preferred esters. The term "pharmaceutically acceptable esters" furthermore embraces compounds of formula (I) in which hydroxy groups have been converted to the corresponding esters with inorganic or organic acids such as, nitric acid, sulphuric acid, phosphoric acid, citric acid, formic acid, maleic acid, acetic acid, succinic acid, tartaric acid, methanesulphonic acid, p-toluenesulphonic acid and the like, which are non toxic to living organisms. In detail, the present invention relates to compounds of formula (I)
Figure imgf000012_0001
wherein
R1 is heteroaryl which can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, halogen, lower-alkoxy- lower-alkyl, cyano, NO2, morpholinyl, NH2-SO2, N(H,lower-alkyl)-SO2, N(lower- alkyl)2-SO2, pyrrolidinyl-SO2, piperidinyl-SO2, morpholinyl- S O2, hydroxy, COOH,
COO-lower-alkyl, lower-alkyl-C(O)O, CO-lower-alkyl, CONH2, CON(H,lower-alkyl), CON(lower-alkyl)2, lower-alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl), NH2-CO- lower-alkyl, NH(lower-alkyl)-CO-lower-alkyl, N(lower-alkyl)2-CO-lower-alkyl, NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower-alkyl)-lower-alkyl, N(lower-alkyl)2-lower-alkyl, cycloalkyl, piperidinyl, piperazinyl and (N-lower-alkyl)- piperazinyl;
R2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower- alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO2, COOH, CONH2,
NH2-SO2, COO-lower-alkyl, lower-alkoxy-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl)2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, lower-alkenyl, hydroxy, NO2, morpholinyl, piperidinyl, piperazinyl, (N-lower-alkyl)-piperazinyl, pyrrolidinyl, lower-alkyl-C(O)O, lower-alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl), NH2-CO- lower-alkyl, NH(lower-alkyl)-CO-lower-alkyl, N(lower-alkyl)2-CO-lower-alkyl, CO- lower-alkyl, NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower- alkyl)-lower-alkyl, N(lower-alkyl)2-lower-alkyl, tri(lower-alkyl)silyl-loweralkinyl and cycloalkyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower- alkylene, dioxo-fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower- alkylene, lower-alkylene-NH-lower-alkylene, lower-alkylene-N(lower alkyl)-lower- alkylene, NH-C(O)-lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower- alkylene-NH-C(O)-lower-alkylene, lower-alkylene -N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)-N(lower-alkyl)-lower-alkylene;
R is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
R4 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
and pharmaceutically acceptable salts and esters thereof.
Compounds of formula (I) are individually preferred and physiologically acceptable salts thereof are individually preferred and pharmaceutically acceptable esters thereof are individually preferred, with the compounds of formula (I) being particularly preferred.
The compounds of formula (I) can have one or more asymmetric C atoms and can therefore exist as an enantiomeric mixture, mixture of stereoisomers or as optically pure compounds.
One embodiment of the present invention is related to compounds of formula (I) as defined above, wherein R2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO2, COOH, CONH2, NH2-SO2, COO-lower-alkyl, lower-alkoxy-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl)2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, lower-alkenyl, hydroxy, NO2, morpholinyl, piperidinyl, piperazinyl, (N-lower-alkyl)-piperazinyl, pyrrolidinyl, lower-alkyl- C(O)O, lower-alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl), NH2-CO-lower-alkyl, NH(lower- alkyl)-CO-lower-alkyl, N(lower-alkyl)2-CO-lower-alkyl, CO-lower-alkyl, NH2, N(H,lower- alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower-alkyl)-lower-alkyl, N(lower-alkyl)2-lower- alkyl and cycloalkyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower-alkylene, dioxo- fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower-alkylene, lower-alkylene-NH- lower-alkylene, lower-alkylene-N(lower alkyl)-lower-alkylene, NH-C(O)-lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower-alkylene-NH-C(O)-lower-alkylene, lower-alkylene- N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)-N(lower-alkyl)-lower- alkylene.
A preferred embodiment of the present invention relates to compounds of formula (I) as described above, wherein R1 is heteroaryl selected from the group consisting of pyridinyl, isoquinolinyl and quinolinyl, which heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, halogen, cyano, morpholinyl and hydroxy. Preferably, R1 is heteroaryl selected from the group consisting of pyridinyl and quinolinyl, which heteroaryl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of lower-alkyl, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, halogen, morpholinyl and hydroxy. More preferably, R1 is pyridin-4-yl, 2- chloro-pyridin-4-yl, 2-methansulfonyl-pyridin-4-yl, pyridin-3-yl, 5-methyl-pyridin-3-yl, 2- morpholin-4-yl-pyridin-4-yl, 2-hydroxy-pyridin-4-yl, 5-chloro-pyridin-3-yl, 5-trifluoromethyl- pyridin-3-yl, 5-difluoromethoxy-pyridin-3-yl, 6-trifluoromethyl-pyridin-3-yl, quinolin-3-yl or 2- methyl-pyridin-4-yl.
Other preferred compounds of the present invention are those, wherein R2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of pyridinyl, quinolinyl and isoquinolinyl, which aryl or heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, fluoro-lower-alkyl, COOH, NH2-SO2, COO-lower-alkyl, N(lower-alkyl)2- SO2, piperazinyl, (N-lower-alkyl)-piperazinyl, lower-alkinyl and tri(lower-alkyl)silyl- loweralkinyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene. Other preferred compounds of the present invention are those, wherein R2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of pyridinyl, quinolinyl and isoquinolinyl, which aryl or heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, fiuoro-lower-alkyl, COOH, NH2-SO2, COO-lower-alkyl, N(lower-alkyl)2-SO2, piperazinyl, (N-lower-alkyl)-piperazinyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo- lower-alkylene.
Preferably, R2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of quinolinyl and isoquinolinyl, which aryl or heteroaryl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of halogen and lower-alkinyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo- lower-alkylene. It is furthermore preferred that R2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of quinolinyl and isoquinolinyl, which aryl or heteroaryl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of halogen, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene.
Other preferred compounds are those, wherein R2 is napthalen-1-yl, quinolin-4-yl, phenyl, benzo[l,3]dioxol-5-yl, 3-fluoro-phenyl, 2,3-dihydro-benzo[l,4]dioxin-6-yl, 3-chloro-phenyl, 2- fluoro -phenyl, 3 -bromo -phenyl, 3-ethynyl-phenyl or isoquinolin-5-yl, particularly those, wherein R2 is napthalen-1-yl, quinolin-4-yl, phenyl, benzo[l,3]dioxol-5-yl, 3-fluoro-phenyl, 2,3-dihydro- benzo[l,4]dioxin-6-yl, 3-chloro-phenyl, 2-fluoro-phenyl or isoquinolin-5-yl.
Another preferred embodiment of the present invention refers to compounds as defined above, wherein R3 is hydrogen. Other preferred compounds of the present invention are those, wherein R4 is hydrogen.
In particular, preferred compounds are the compounds of formula (I) described in the examples as individual compounds as well as pharmaceutically acceptable salts as well as pharmaceutically acceptable esters thereof. Furthermore, the substituents as found in the specific examples described below, individually constitute separate preferred embodiments of the present invention.
Preferred compounds of formula (I) are those selected from the group consisting of: 3-[2-(6-Chloro-pyridin-2-yl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, l-Pyridin-4-yl-3-(2-pyridin-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-[5-(4-Oxo- 1 -pyridin-4-yl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl]-benzonitrile, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 3-[5-(4-Oxo- 1 -pyridin-4-yl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl]-benzoic acid, 3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yl]- 1 -pyridin-4-yl- lH-pyridazin-4-one, 3 -[2-(4-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -pyridin-4-yl- lH-pyridazin-4-one, 4-[5-(4-Oxo- 1 -pyridin-4-yl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl]-benzenesulfonamide, 3 - [2-(3 ,5 -Dichloro-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -pyridin-4-yl- 1 H-pyridazin-4-one, 3-[5-(4-Oxo-l -pyridin-4-yl- l,4-dihydro-pyridazin-3-yl)-pyrazol-l-yl]-benzoic acid methyl ester, l-Pyridin-4-yl-3-(2-p-tolyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-[2-(2-Chloro-phenyl)-2H-pyrazol-3-yl]-l -pyridin-4-yl- 1 H-pyridazin-4-one,
1 -(2-Chloro-pyridin-4-yl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one,
3 - [2-(2, 8-Bis-trifluoromethyl-quino lin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -pyridin-4-yl- 1 H-pyridazin-4- one, 3-[2-(2,3-Dihydro-benzo[ 1 ,4]dioxin-6-yl)-2H-pyrazol-3-yl]- 1 -pyridin-4-yl- 1 H-pyridazin-4-one, 1 -(2-Methanesulfonyl-pyridin-4-yl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one, 3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-methanesulfonyl-pyridin-4-yl)- 1 H-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 3 -[2-(2-Methyl-pyridin-4-yl)-2H-pyrazo 1-3 -yl]-l -pyridin-4-yl- 1 H-pyridazin-4-one, l-Pyridin-4-yl-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)-l -pyridin-4-yl- 1 H-pyridazin-4-one, l-Pyridin-4-yl-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-[2-(2-Chloro-pyridin-4-yl)-2H-pyrazol-3-yl]-l -pyridin-4-yl- 1 H-pyridazin-4-one, 3- {2-[2-(4-Methyl-piperazin- 1 -yl)-pyridin-4-yl]-2H-pyrazol-3-yl} - 1 -pyridin-4-yl- 1 H-pyridazin- 4-one,
3-[2-(2-Piperazin- 1 -yl-pyridin-4-yl)-2H-pyrazol-3-yl]- 1 -pyridin-4-yl- 1 H-pyridazin-4-one, l-Pyridin-4-yl-3-(2-quinolin-8-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-(2-Isoquinolin-8-yl-2H-pyrazol-3-yl)-l-pyridin-4-yl-lH-pyridazin-4-one, N,N-Dimethyl-3-[5-(4-oxo- l-pyridin-4-yl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl]- benzenesulfonamide,
3-[2-(2,3-Difluoro-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 3-(2-Phenyl-2H-pyrazol-3-yl)- 1 -pyridin-4-yl- 1 H-pyridazin-4-one, l-Pyridin-4-yl-3-(2-pyridin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-(2-Benzo[l,3]dioxol-5-yl-2H-pyrazol-3-yl)-l-pyridin-3-yl-lH-pyridazin-4-one, l-Pyridin-3-yl-3-(2-pyridin-2-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, 3-[2-(2,3-Dihydro-benzo[ 1 ,4]dioxin-6-yl)-2H-pyrazol-3-yl]- 1 -pyridin-3-yl- 1 H-pyridazin-4-one, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -pyridin-3-yl- 1 H-pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(5-methyl-pyridin-3-yl)-lH- pyridazin-4-one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(5-methyl-pyridin-3-yl)-lH-pyridazin-4-one, 3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-methyl-pyridin-4-yl)-lH- pyridazin-4-one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(2-methyl-pyridin-4-yl)-lH-pyridazin-4-one, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(2-methoxy-pyridin-4-yl)-lH-pyridazin-4-one, 3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-morpholin-4-yl-pyridin-4-yl)- 1 H-pyridazin-4-one, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(2-morpholin-4-yl-pyridin-4-yl)-lH-pyridazin-4-one, 4- {3-[2-(2,3-Dihydro-benzo[ 1 ,4]dioxin-6-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} - pyridine-2-carbonitrile,
4- {3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -pyridine-2-carbonitrile, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(5-methanesulfonyl-pyridin-3-yl)-lH-pyridazin-4- one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-hydroxy-pyridin-4-yl)-lH- pyridazin-4-one,
3 - [2-(2,5 -Difluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -pyridin-3-yl- 1 H-pyridazin-4-one,
3 -[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazo 1-3 -yl]-l -(5 -methyl-pyridin-3-yl)-l H-pyridazin-4-one, l-(5-Fluoro-pyridin-3-yl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3 -[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazo 1-3 -yl]-l -pyridin-3-yl- 1 H-pyridazin-4-one, 1 -(5 -Chloro-pyridin-3-yl)-3-(2-quinolin-4-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, l-(5-Chloro-pyridin-3-yl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(5-chloro-pyridin-3-yl)-lH-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(2-chloro-pyridin-4-yl)-lH-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-[2-(2-chloro-pyridin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-(2-isoquinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, l-(5-Chloro-pyridin-3-yl)-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, l-(5-Chloro-pyridin-3-yl)-3-[2-(6-chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-[2-(6-chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(5-Chloro-pyridin-3-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-isoquinolin-4-yl-lH-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-isoquinolin-4-yl-lH-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(5-trifluoromethyl-pyridin-3-yl)-lH-pyridazin-4-one, 3 - [2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(5 -trifluoromethyl-pyridin-3 -yl)- 1 H-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-[2-(7-chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(5-Chloro-pyridin-3-yl)-3-[2-(7-chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3 -(2-Quino lin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(5 -trifluoromethyl-pyridin-3 -yl)- 1 H-pyridazin-4-one, 3-[2-(6-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 3-(2-Isoquinolin-4-yl-2H-pyrazol-3-yl)-l-pyridin-4-yl-lH-pyridazin-4-one, l-(5-Difluoromethoxy-pyridin-3-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4- one, 3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l-(6-trifluoromethyl-pyridin-3-yl)-l H-pyridazin-4-one, 5- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -pyridine-2-carbonitrile, l-(6-Chloro-pyridin-3-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l H-pyridazin-4-one, 3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l-quinolin-3-yl-l H-pyridazin-4-one, l-(2-Methyl-pyridin-4-yl)-3-(2-quinolin-4-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, 3 -(2-Quino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 -(6-trifluoromethyl-pyridin-3 -yl)- 1 H-pyridazin-4-one, 3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)-l-(6-trifluoromethyl-pyridin-3-yl)-lH-pyridazin-4-one, 3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-(5-methyl-pyridin-3-yl)-lH-pyridazin-4-one, l-(2-Methyl-pyridin-4-yl)-3-(2-quino lin-5 -yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, l-Pyridin-3-yl-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)-l-(2-methyl-pyridin-4-yl)-lH-pyridazin-4-one, 3 -(2-Isoquino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 -pyridin-3 -yl- 1 H-pyridazin-4-one, 5- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -nicotinonitrile, and l-(6-Chloro-pyridin-3-yl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, and pharmaceutically acceptable salts and esters thereof.
Particularly preferred compounds of formula (I) are those selected from the group consisting of:
1 -(2-Chloro-pyridin-4-yl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one, 1 -(2-Methanesulfonyl-pyridin-4-yl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one, l-Pyridin-4-yl-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-(2-Phenyl-2H-pyrazol-3-yl)- 1 -pyridin-4-yl- 1 H-pyridazin-4-one,
3-(2-Benzo[l,3]dioxol-5-yl-2H-pyrazol-3-yl)-l-pyridin-3-yl-lH-pyridazin-4-one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(5-methyl-pyridin-3-yl)-lH-pyridazin-4-one, 3-[2-(2,3-Dihydro-benzo[ 1 ,4]dioxin-6-yl)-2H-pyrazol-3-yl]- 1 -(2-morpholin-4-yl-pyridin-4-yl)-
1 H-pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-hydroxy-pyridin-4-yl)-lH- pyridazin-4-one,
1 -(5 -Chloro-pyridin-3-yl)-3-(2-quinolin-4-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(2-chloro-pyridin-4-yl)-lH-pyridazin-4-one,
3 - [2-(3-Chloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(5 -trifluoromethyl-pyridin-3 -yl)- 1 H-pyridazin-4-one, l-(5-Difluoromethoxy-pyridin-3-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4- one,
3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l-(6-trifluoromethyl-pyridin-3-yl)-l H-pyridazin-4-one, 3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l-quinolin-3-yl-l H-pyridazin-4-one, l-(2-Methyl-pyridin-4-yl)-3-(2-quinolin-4-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, and
3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)-l-(2-methyl-pyridin-4-yl)-lH-pyridazin-4-one, and pharmaceutically acceptable salts and esters thereof.
Other preferred compounds of formula (I) are those selected from the group consisting of:
1 -(5 -Difluoromethoxy-pyridin-3 -yl)-3 -(2-quino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one, 3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(5 -methyl-pyridin-3-yl)-l H-pyridazin-4-one, 3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-l -pyridin-4-yl- 1 H-pyridazin-4-one, 3-[2-(3-Methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(2-methyl-pyridin-4-yl)-lH-pyridazin-4-one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(2-trifluoromethyl-pyridin-4-yl)-lH-pyridazin-4-one, 3 - [2-(3-Chloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(2-trifluoromethyl-pyridin-4-yl)- 1 H-pyridazin-4-one, 4- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -pyridine-2-carbonitrile, 3-[2-(3-Bromo-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 1 -Pyridin-4-yl-3 - [2-(3 -trimethylsilanylethynyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 H-pyridazin-4-one, 3-[2-(3-Ethynyl-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-isoquinolin-6-yl-lH-pyridazin-4-one, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -isoquinolin-6-yl- 1 H-pyridazin-4-one, 3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l-quinolin-6-yl-l H-pyridazin-4-one, and 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-quinolin-6-yl-lH-pyridazin-4-one and pharmaceutically acceptable salts and esters thereof.
Other particularly preferred compounds of formula (I) are those selected from the group consisting of:
3-[2-(3-Bromo-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, and
3-[2-(3-Ethynyl-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one and pharmaceutically acceptable salts and esters thereof.
It will be appreciated that the compounds of general formula (I) in this invention may be derivatised at functional groups to provide derivatives which are capable of conversion back to the parent compound in vivo.
The invention further relates to a process for the manufacture of compounds of formula (I) as defined above, which process comprises reacting a compound of formula (II)
Figure imgf000021_0001
with a compound of the formula R2 -NH-NH2, wherein R1, R2, R3 and R4 are as defined above.
The reaction of a compound of formula (II) with a compound of the formula R2 -NH-NH2 can be carried out under conditions as described in the examples or under conditions well known to the person skilled in the art. For example, the reaction can be performed in solvents like DMF, acetic acid, ethanol, water, a mixture of ethanol with hydrochloric acid and the like at elevated temperatures e.g. at 100-2000C, at atmospheric pressure or elevated pressure. The reaction can be performed at the reflux temperature of the respective solvent, or it can be performed at temperatures above boiling point by applying sealed tubes and using microwave irradiation conditions.
The present invention also relates to compounds of formula (I) as defined above, when prepared by a process as described above.
The compounds of formula (II) and R2 -NH-NH2, can be prepared by methods known in the art or as described below or in analogy thereto. Unless otherwise indicated, R1, R2, R3, and R4 are as described above.
The pyridazinones of the general formula (I) can be prepared starting from anilines of formula 2 (see scheme 1 below). Anilines 2 are either commercially available or can be prepared from commercial precursors as e.g. from their corresponding nitro compounds by reductive methods. Another option is to convert commercial anilines into the desired anilines 2 by standard methods known in the art. Conversion of anilines 2 into their corresponding diazonium salts of general formula 3 can be done using standard methods known to those skilled in the art as e.g. treatment of the aniline in a mineral acid as e.g. hydrochloric acid, sulfuric acid or phosphoric acid with sodium nitrite. The formed diazonium salts 3 can be used without any further purification for the condensation with suitable 1,3-diketones 4 resulting in diazo compounds of general formula 5. This reaction is preferentially performed in an alcohol/water mixture at low temperatures (0-5 0C) at almost neutral pH value (pH 5-6) which can be achieved by adding suitable basic salts like e.g. ammonium acetate. The diazo compounds of formula 5 can tautomerize to the corresponding hydrazones.
The pyridazin-4-one ring can be formed by reacting the intermediate diazo compounds of formula 5 with Cl -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N ,N- dimethylformamide dimethyl acetal. The reaction with N,N-dimethylformamide dimethyl acetal affords the pyridazinone intermediates of general formula 6 bearing a 1,3-diketone equivalent as side chain.
The side chain 1,3-diketone equivalent of pyridazinones 6 is used to form the final products of general formula (I) by condensing pyridazinones 6 with suitable hydrazines of general formula 7. This reaction is usually performed in solvents like DMF, acetic acid, ethanol, water, a mixture of ethanol with hydrochloric acid and the like at elevated temperatures. The reaction can be performed at the reflux temperature of the respective solvent, or it can be performed at temperatures above boiling point by applying sealed tubes and using microwave irradiation conditions.
Hydrazines of general formula 7 are commercially available or can be prepared by methods known to those skilled in the art. Straightforward synthetic methods starting from commercial precursors include the conversion of the corresponding anilines with sodium nitrite and tin-(II)-chloride and the treatment of hydrazine hydrate with aromatic/hetero aromatic halides.
Figure imgf000023_0001
Scheme 1
The pyridazinones of the general formula (I) can also be prepared starting from anilines of formula 2 according to scheme 2 (see below).
Figure imgf000023_0002
Conversion of anilines 2 into their corresponding diazonium salts of general formula 3 can be done as described above. The formed diazonium salts 3 can be used without any further purification for the condensation with suitable ketoesters 8 resulting in diazo compounds of general formula 9. This reaction is preferentially performed in an alcohol/water mixture at low temperatures (0-5 0C) at almost neutral pH value (pH 5-6) which can be achieved by adding suitable basic salts like e.g. ammonium acetate. The diazo compounds of formula 9 can tautomerize to the corresponding hydrazones.
The pyridazin-4-one ring can be formed by reacting the intermediate diazo compounds of formula 9 with Ci -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N5N- dimethylformamide dimethyl acetal. The reaction with N,N-dimethylformamide dimethyl acetal affords the pyridazinone intermediates of general formula 10 bearing an ester equivalent as side chain. The ester side chain equivalent of pyridazinones 10 can be converted into a ketone most conveniently by functionalisation into a suitable activated species such as a Weinreb amide 11 therefore disposed towards displacement with an organometalic species, most commonly a Grignard reagent of general formula 12 in e.g. a non protic solvent such as THF or hexane to give the corresponding ketone 13. This can be again reacted with Ci -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N,N-dimethylformamide dimethyl acetal. The reaction with N,N-dimethylformamide dimethyl acetal affords the diketone equivalent of general formula 14 which is used to form the final products of general formula (I) by condensing with suitable hydrazines of general formula 7. This reaction is usually performed in solvents like DMF, acetic acid, ethanol, water, a mixture of ethanol with hydrochloric acid and the like at elevated temperatures. The reaction can be performed at the reflux temperature of the respective solvent, or it can be performed at temperatures above boiling point by applying sealed tubes and using microwave irradiation conditions.
Hydrazines of general formula 7 are commercially available or can be prepared by methods known to those skilled in the art. Straightforward synthetic methods starting from commercial precursors include the conversion of the corresponding anilines with sodium nitrite and tin-(II)-chloride and the treatment of hydrazine hydrate with aromatic/hetero aromatic halides. Certain substituents on the groups R1, R2, R3, and R4 may not be inert to the conditions of the synthesis sequences described above and may require protection by standard protecting groups known in the art. For instance, an amino or hydroxyl group may be protected as an acetyl or tert- butoxycarbonyl derivative. Alternatively, some substituents may be derived from others at the end of the reaction sequence. For instance, a compound of formula I may be synthesized bearing a nitro-, an ethoxycarbonyl, an ether, a sulfonic acid substituent on the groups R1, R2, R3, and R4, which substituents are finally converted to an amino- (e.g. by reduction of a nitro group or cleavage of a suitable amino protective group (e.g. removal of a Boc group with TFA)), alkylamino- (e.g. by reductive amination of an amino group), dialkylamino- (e.g. by alkylation of an amino group, reduction of an appropriate acylamino group with lithium aluminum hydride or Eschweiler-Clarke reaction with an appropriate amino or alkylamino group), acylamino- (by amide formation from an amino group e.g. with appropriate acyl halides or with appropriate carboxylic acids after their activation with CDI, EDC etc.), alkylsulfonylamino (e.g. by reaction of an amino group with sulfonyl chlorides), arylsulfonylamino substituent (e.g. by reaction of an amino group with sulfonyl chlorides), hydroxyl- (by cleavage of a suitable hydroxy protective group (e.g. hydro geno lytic removal of a benzyl ether or oxidative cleavage of a p-methoxy benzyl ether), ether- (e.g. by Williamson's ether synthesis from a hydroxyl group) or to a carboxamide substituent (e.g. by amide formation from a carboxylic acid group with appropriate amines after activation of the carboxylic acid group with CDI, EDC etc. or conversion to an acyl chloride), or to a sulfonamide substituent by standard procedures.
The corresponding salts with acids can be obtained by standard methods known to the person skilled in the art, e.g. by dissolving the compound of formula (I) in a suitable solvent such as e.g. dioxan or THF and adding an appropriate amount of the corresponding acid. The products can usually be isolated by filtration or by chromatography. The conversion of a compound of formula (I) into a pharmaceutically acceptable salt with a base can be carried out by treatment of such a compound with such a base. One possible method to form such a salt is e.g. by addition of 1/n equivalents of a basic salt such as e.g. M(OH)n, wherein M = metal or ammonium cation and n = number of hydroxide anions, to a solution of the compound in a suitable solvent (e.g. ethanol, ethanol- water mixture, tetrahydrofuran- water mixture) and to remove the solvent by evaporation or lyophilisation.
The conversion of compounds of formula (I) into pharmaceutically acceptable esters can be carried out e.g. by treatment of a suitable carboxy group present in the molecule with a suitable alcohol using e.g. a condensating reagent such as benzotriazol-1- yloxytris(dimethylamino)phosphonium hexafluorophosphate (BOP), N5N- dicylohexylcarbodiimide (DCC), N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDCI) or O-(l,2-dihydro-2-oxo-l-pyridyl)-N,N,N,N-tetra-methyluronium- tetrafluoroborate (TPTU), or by direct reaction with a suitable alcohol under acidic conditions, as for example in the presence of a strong mineral acid like hydrochloric acid, sulfuric acid and the like. Compounds having a hydroxyl group can be converted to esters with suitable acids by analogous methods.
Insofar as their preparation is not described in the examples, the compounds of formula (I) as well as all intermediate products can be prepared according to analogous methods or according to the methods set forth above. Starting materials are commercially available, known in the art or can be prepared by methods known in the art or in analogy thereto. As described above, the novel compounds of the present invention have been found to inhibit PDElOA activity. The compounds of the present invention can therefore be used, either alone or in combination with other drugs, for the treatment and/or prophylaxis of diseases which are modulated by PDElOA inhibitors. These diseases include, but are not limited to, certain psychotic disorders such as schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder or substance-induced psychotic disorder, anxiety disorders such as panic disorder, obsessive/compulsive disorders, acute stress disorder or generalized anxiety disorder, drug addictions, movement disorders such as Parkinson's disease or restless leg syndrome, cognition deficiency disorders such as Alzheimer's disease or multi- infarct dementia, mood disorders such as depression or bipolar disorders, or neuropsychiatric conditions such as psychosis, attention-defϊcit/hyperactivity disorder (ADHD) or related attentional disorders. Other disorders are diabetes and related disorders, such as type 2 diabetes mellitus, neurodegenerative disorders such as Alzheimer's disease, Huntington's disease, Parkinson's disease, multiple sclerosis, stroke or spinal cord injury, solid tumors and hematological malignancies such as renal cell carcinoma or breast cancer.
The invention therefore also relates to pharmaceutical compositions comprising a compound as defined above and a pharmaceutically acceptable carrier and/or adjuvant.
The invention likewise embraces compounds as described above for use as therapeutically active substances, especially as therapeutically active substances for the treatment and/or prophylaxis of diseases which are modulated by PDElOA inhibitors, particularly as therapeutically active substances for the treatment and/or prophylaxis of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-defϊcit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer. In another preferred embodiment, the invention relates to a method for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-defϊcit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer, which method comprises administering a compound as defined above to a human being or animal.
The invention also embraces the use of compounds as defined above for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-defϊcit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer.
The invention also relates to the use of compounds as described above for the preparation of medicaments for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention- deficit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer. Such medicaments comprise a compound as described above.
Prevention and/or treatment of schizophrenia is a preferred indication. Furthermore, prevention and/or treatment of positive, negative and/or cognitive symptoms associated with schizophrenia is preferred.
The following tests were carried out in order to determine the activity of the compounds of the present invention. PDElO activity of the compounds of the present invention is determined using a Scintillation Proximity Assay (SPA) -based method similar to the one previously described (Fawcett, L. et al., ProcNatl Acad Sci USA (2000) 97(7):3702-3707).
PDElOAl and PDE10A2 are two splice variants of PDElOA. There are these 2 splice variants known, which differ in the N-terminal part of the protein. The catalytic domains of PDElOAl and PDE10A2 are identical. The assay for PDE10A2 described below is therefore also representative for PDElOAl and also for PDElOA in general.
The PDE10A2 assay was performed in a two step procedure in 96-well micro titer plates. The reaction mixture of 80 μl contained 20 mM HEPES/ 10 mM MgCl2/0.05 mg/ml buffer (pH 7.5), 50 nM cGMP (Sigma) and 50 nM [3H] -cGMP (GE Healthcare), 0.25 nM PDE10A2 with or without a specific test compound. A range of concentrations of the potential inhibitor was used to generate data for calculating the concentration of inhibitor resulting in 50% of the effect (e.g. IC5O, the concentration of the competitor inhibiting PDE10A2 activity 50%). Non-specific activity was tested without the enzyme. The reaction was initiated by addition of the substrate solution (cGMP and [3H] -cGMP) and allowed to progress for 30 minutes at room temperature. The reaction was terminated by transferring 50 μl of the reaction mixture into an OptiPlate (Perkin Elmer) containing 25 μl of YSi-SPA scintillation beads (GE Healthcare) in 18 mM zinc sulphate solution (stop reagent). After 1 h under shaking, the plate was centrifuged one minute at 1000 rpm to allow beads to settle. Afterwards, radioactive counts were measured on a Perkin Elmer TopCount Scintillation plate reader.
The catalytic domain of human PDE10A2, residues serine 449 to aspartate 789, was amplified by PCR using cDNA (Origene) and the oligonucleotides 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGTΛCCTΛGΛGGΛTCΛAGCATTTGTACTT CAGAAG-3' (with AttBl recombination site in bold and thrombin protease cleavage site in italics) and 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCAATCTTCAGATGCAGCTG- 3' (with AttBl recombination site in bold) which conferred Gateway recombination sites. The PCR product was used in a BP recombination reaction with pDONR221 to generate pENTR Thm-PDE10A2(S449-D789) which was DNA sequence verified and then used in an LR recombination reaction with a Gateway modified version of pETl la. The resulting expression vector, placT7.2 H6-(gwl)-Thm-PDE10A2(S449-D789) was DNA sequence confirmed and transformed into E. coli strain BL21(DE3) pLysS and recombinant protein was produced in TB medium at 200C by induction to a final IPTG concentration of 0.5mM at an optical density of 1.0 at 600nm for 20 hours. About 30% of the protein was in the soluble fraction of the cell homogenate. The protein was purified using sequential chromatography on Ni-NTA and HiTrapQ/HiTrapS. After thrombin digest at room temperature a HiTrapChelating/HiTrap Benzamindin chromatography removed impurities, uncleaved protein and thrombin. Final purification of PDE10A2(S449-D789) was performed on a Superdex 75 size exclusion chromatography equilibrated with 25 mM HEPES pH 8.4, 0.15 M NaCl. The yield of pure protein was 2 mg/liter of culture volume is relatively low. The purity of the protein was >95%, monomeric and monodisperse as shown by SDS-PAGE, HPLC and analytical ultracentrifugation.
The compounds according to formula (I) preferably have an IC50 value below 10 μM, preferably below 5 μM, more preferably below 1 μM. Preferably, the IC50 values are above 0.0 InM, more preferable above 0.1 nM, more preferably above 1 nM. The following table shows data for some examples.
Figure imgf000030_0001
Figure imgf000031_0001
Figure imgf000032_0001
The compounds of formula (I) and/or their pharmaceutically acceptable salts can be used as medicaments, e.g. in the form of pharmaceutical preparations for enteral, parenteral or topical administration. They can be administered, for example, pero rally, e.g. in the form of tablets, coated tablets, dragees, hard and soft gelatine capsules, solutions, emulsions or suspensions, rectally, e.g. in the form of suppositories, parenterally, e.g. in the form of injection solutions or suspensions or infusion solutions, or topically, e.g. in the form of ointments, creams or oils. Oral administration is preferred.
The production of the pharmaceutical preparations can be effected in a manner which will be familiar to any person skilled in the art by bringing the described compounds of formula (I) and/or their pharmaceutically acceptable salts, optionally in combination with other therapeutically valuable substances, into a galenical administration form together with suitable, non-toxic, inert, therapeutically compatible solid or liquid carrier materials and, if desired, usual pharmaceutical adjuvants.
Suitable carrier materials are not only inorganic carrier materials, but also organic carrier materials. Thus, for example, lactose, corn starch or derivatives thereof, talc, stearic acid or its salts can be used as carrier materials for tablets, coated tablets, dragees and hard gelatine capsules. Suitable carrier materials for soft gelatine capsules are, for example, vegetable oils, waxes, fats and semi-solid and liquid polyols (depending on the nature of the active ingredient no carriers might, however, be required in the case of soft gelatine capsules). Suitable carrier materials for the production of solutions and syrups are, for example, water, polyols, sucrose, invert sugar and the like. Suitable carrier materials for injection solutions are, for example, water, alcohols, polyols, glycerol and vegetable oils. Suitable carrier materials for suppositories are, for example, natural or hardened oils, waxes, fats and semi-liquid or liquid polyols. Suitable carrier materials for topical preparations are glycerides, semi- synthetic and synthetic glycerides, hydrogenated oils, liquid waxes, liquid paraffins, liquid fatty alcohols, sterols, polyethylene glycols and cellulose derivatives.
Usual stabilizers, preservatives, wetting and emulsifying agents, consistency- improving agents, flavour-improving agents, salts for varying the osmotic pressure, buffer substances, solubilizers, colorants and masking agents and antioxidants come into consideration as pharmaceutical adjuvants. The dosage of the compounds of formula (I) can vary within wide limits depending on the disease to be controlled, the age and the individual condition of the patient and the mode of administration, and will, of course, be fitted to the individual requirements in each particular case. For adult patients a daily dosage of about 0.1 to 2000 mg, especially about 1 to 500 mg, comes into consideration. Depending on severity of the disease and the precise pharmacokinetic profile the compound could be administered with one or several daily dosage units, e.g. in 1 to 3 dosage units.
The pharmaceutical preparations conveniently contain about 0.1-500 mg, preferably 1- 200 mg, of a compound of formula (I).
The following examples serve to illustrate the present invention in more detail. They are, however, not intended to limit its scope in any manner.
Examples A. Starting materials and intermediates:
A-I. Preparation of 3-(YE)-3-Dimethylamino-acπioyl)-l-pyridin-4-yl-lH-pyridazin-4-one
a) 3-fPyridin-4-ylazo)-pentane-2,4-dione
A solution of pyridine-4-ylamine (4.5 g, 47.81 mmol) in 85% phosphoric acid (30 ml) and 65% nitric acid (20ml) was cooled to -10 0C and treated with solid sodium nitrite (3.3 g, 47.8 mmol) over 20 mins. Ice (5Og) was added and the mixture added at 00C to a suspension of 2,4- pentadione (4.79 g ; 47.8 mmol) and potassium acetate (4Og) in EtOH (280 ml). After completion, 20% aq. Na2CO3 (300ml) was added at 0 0C until pH reached 7 and the solution extracted with dichloromethane (3 X 400ml), dried, concentrated and chromato graphed on silica gel with dichloromethane/methanol to give the product as a yellow solid (5.3g, 54%). MS: M = 206.1 (M+H)+
b) 3-(YE)-3-Dimethylamino-acryloyl)-l-pyridin-4-yl-lH-pyridazin-4-one 3-(Pyridin-4-ylazo)-pentane-2,4-dione (2.3 g; 11.2 mmol) was dissolved in N5N- dimethylformamide dimethyl acetal (16 ml) and heated at 100 0C for 60 min. After concentration, the oily crude product was purified by flash chromatography on silica gel (eluent: dichloromethane / methanol) yielding 1.68 g (55 %) of A-I as an orange solid. MS: M = 271.2 (M+H)+
In analogy to the method described above for the synthesis of A-I, the following intermediates were prepared:
Figure imgf000035_0001
Figure imgf000036_0001
Figure imgf000037_0002
B. Final Products:
Example 1: 3-[2-f6-Chloro-pyridin-2-yl)-2Η-pyrazol-3-yll-l-pyridin-4-yl-lΗ-pyridazin-4- one
Figure imgf000037_0001
A solution of 3-((E)-3-dimethylamino-acryloyl)-l-pyridin-4-yl-lH-pyridazin-4-one (A-I; 0.075 g; 0.3 mmol) in EtOH (2ml) was treated with (6-chloropyridin-2-yl)-hydrazine (0.048 g; 0.3 mmol) in a sealed tube and irradiated at 1000C for 30 min. Acetic acid (0.5ml) was added and the mixture again irradiated at 1000C for 15 min. The solvent of the reaction mixture was removed and the crude product purified by preparative HPLC yielding 0.0122 g (12 %) of the final product.
MS: M = 351.1 (M+H)+
Example 2: l-Pyridin-4-yl-3-(2-pyridin-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
Figure imgf000038_0001
l-Pyridin-4-yl-3-(2-pyridin-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and pyridin-2-yl- hydrazine. MS: M = 371.1 (M+Η)+
Example 3: 3- \5-( 4-Oxo- l-pyridin-4-yl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1-yll - benzonitrile
Figure imgf000038_0002
3-[5-(4-Oxo- 1 -pyridin-4-yl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl] -benzonitrile was obtained in analogy to the method of example 1 from intermediate A-I and 3 -hydrazino -benzonitrile. MS: M = 341.1 (M+H)+
Example 4: 3- \2-( 2-Fluoro-phenyl)-2H-pyrazol-3-yll - l-pyridin-4-yl- lH-pyridazin-4-one
Figure imgf000039_0001
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and 2-fluoro-phenylhydrazine. MS: M = 334.0 (M+Η)+
Examples : 3- \5-( 4-Oxo- l-pyridin-4-yl- 1 ,4-dihvdro-pyridazin-3-yl)-pyrazol- 1-yll -benzoic acid
Figure imgf000039_0002
3-[5-(4-Oxo-l-pyridin-4-yl-l,4-dihydro-pyridazin-3-yl)-pyrazol-l-yl]-benzoic acid was obtained in analogy to the method of example 1 from intermediate A-I and 3 -hydrazino -benzoic acid. MS: M = 359.8 (M+H)+
Example 6: 3-[2-f4-Chloro-phenyl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH-pyridazin-4-one
Figure imgf000039_0003
3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yl]- 1 -pyridin-4-yl- lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and 4-chloro-phenylhydrazine. MS: M = 349.9 (M+Η)+ Example 7: 3-[2-f4-Fluoro-phenyl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH-pyridazin-4-one
Figure imgf000040_0001
3-[2-(4-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and 4-fluoro-phenylhydrazine. MS: M = 334.0 (M+Η)+
Example 8 : 4- \5-( 4-Oxo- l-pyridin-4-yl- 1 ,4-dihvdro-pyridazin-3-yl)-pyrazol- 1-yll - benzenesulfonamide
Figure imgf000040_0002
4-[5-(4-Oxo- 1 -pyridin-4-yl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl] -benzenesulfonamide was obtained in analogy to the method of example 1 from intermediate A-I and 4-hydrazino- benzenesulfonamide. MS: M = 395.0 (M+H)+
Example 9: 3-[2-f3.,5-Dichloro-pyridin-4-yl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH-pyridazin- 4-one
Figure imgf000040_0003
3-[2-(3,5-Dichloro-pyridin-4-yl)-2H-pyrazol-3-yl]- 1 -pyridin-4-yl- lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and (3,5-dichloropyridin-
4-yl)-hydrazine.
MS: M = 386.7 (M+Η)+
Example 10: 3- \5-( 4-Oxo- l-pyridin-4-yl- 1 ,4-dihvdro-pyridazin-3-yl)-pyrazol- 1-yll -benzoic acid methyl ester
Figure imgf000041_0001
3-[5-(4-Oxo-l -pyridin-4-yl- l,4-dihydro-pyridazin-3-yl)-pyrazol-l-yl]-benzoic acid methyl ester was obtained in analogy to the method of example 1 from intermediate A-I and 3-dydrazino- benzoic acid methyl ester. MS: M = 374.0 (M+H)+
Example 11 : l-Pyridin-4-yl-3-f2-p-tolyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
Figure imgf000041_0002
l-Pyridin-4-yl-3-(2-/?-tolyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and 4-methyl-phenylhydrazine. MS: M = 330.1 (M+Η)+
Example 12: 3-r2-(2-Chloro-phenyl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH-pyridazin-4-one
Figure imgf000042_0001
3-[2-(2-Chloro-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and 2-chloro-phenylhydrazine. MS: M = 349.9 (M+Η)+
Example 13: l-α-Chloro-pyridin-4-yl)-3-α-naphthalen-l-yl-2H-pyrazol-3-yl)-lH- pyridazin-4-one
Figure imgf000042_0002
1 -(2-Chloro-pyridin-4-yl)-3-(2-naphthalen- 1 -yl-2H-pyrazol-3-yl)- lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-2 and naphthalen-1-yl- hydrazine. MS: M = 400.1 (M+Η)+
Example 14: 3-[2-f2,8-Bis-trifluoromethyl-αuinolin-4-yl)-2H-pyrazol-3-yll-l-pyridin-4-yl- lH-pyridazin-4-one
Figure imgf000042_0003
3-[2-(2,8-Bis-trifluoromethyl-quinolin-4-yl)-2H-pyrazol-3-yl]- 1 -pyridin-4-yl- lH-pyridazin-4- one was obtained in analogy to the method of example 1 from intermediate A-I and (2,8-bis- trifluoromethyl-quinolin-4-yl)-hydrazine. MS: M = 502.8 (M+Η)+
Examplel 5 : 3- r2-(2,3-Dihydro-benzo \ 1 ,41 dioxin-6-yl)-2H-pyrazol-3-yll - l-pyridin-4-yl- IH- pyridazin-4-one
Figure imgf000043_0001
3-[2-(2,3-Dihydro-benzo[ 1 ,4]dioxin-6-yl)-2H-pyrazol-3-yl]- 1 -pyridin-4-yl- lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and (2,3-dihydro- benzo[l,4]dioxin-6-yl)-hydrazine. MS: M = 374.0 (M+Η)+
Example 16: l-f2-Methanesulfonyl-pyridin-4-yl)-3-f2-naphthalen-l-yl-2H-pyrazol-3-yl)- lH-pyridazin-4-one
Figure imgf000043_0002
1 -(2-Methanesulfonyl-pyridin-4-yl)-3-(2-naphthalen- 1 -yl-2H-pyrazol-3-yl)- lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-3 and naphthalen-1-yl- hydrazine. MS: M = 443.9 (M+Η)+
Example 17: 3- r2-(2,3-Dihydro-benzo r 1 ,41 dioxin-6-yl)-2H-pyrazol-3-yll - 1-(2- methanesulfonyl-pyridin-4-yl)-lH-pyridazin-4-one
Figure imgf000044_0001
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-methanesulfonyl-pyridin-4-yl)- lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-3 and (2,3-dihydro-benzo[l,4]dioxin-6-yl)-hydrazine. MS: M = 451.8 (M+Η)+
Example 18: 3-[2-f3-Chloro-phenyl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH-pyridazin-4-one
Figure imgf000044_0002
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and 3-chloro-phenylhydrazine. MS: M = 350.1 (M+Η)+
Example 19: 3- \2-( 2-Methyl-pyridin-4-yl)-2H-pyrazol-3-yll - l-pyridin-4-yl- lH-pyridazin-4- one
Figure imgf000044_0003
3-[2-(2-Methyl-pyridin-4-yl)-2H-pyrazol-3-yl]- 1 -pyridin-4-yl- lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and (2-methylpyridin-4-yl)- hydrazine. MS: M = 331.1 (M+H)4
Example 20: l-Pyridin-4-yl-3-f2-αuinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
Figure imgf000045_0001
l-Pyridin-4-yl-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and quinolin-4-yl-hydrazine. MS: M = 367.1 (M+Η)+
Example 21: 3-f2-Isoαuinolin-5-yl-2H-pyrazol-3-yl)-l-pyridin-4-yl-lH-pyridazin-4-one
Figure imgf000045_0002
3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and isoquinolin-5-yl-hydrazine. MS: M = 367.1 (M+H)+
Example 22: l-Pyridin-4-yl-3-f2-αuinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
Figure imgf000045_0003
l-Pyridin-4-yl-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and quinolin-5-yl-hydrazine. MS: M = 367.1 (M+H)4
Example 23: 3-[2-f2-Chloro-pyridin-4-yl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH-pyridazin-4- one
Figure imgf000046_0001
3-[2-(2-Chloro-pyridin-4-yl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and (2-chloro-pyridin-4-yl)- hydrazine.
MS: M = 351.1 (M+H)+
Example 24: 3-{2-[2-f4-Methyl-piperazin-l-yl)-pyridin-4-yll-2H-pyrazol-3-yl}-l-pyridin-4- yl-lH-pyridazin-4-one
Figure imgf000046_0002
3- {2-[2-(4-Methyl-piperazin- 1 -yl)-pyridin-4-yl]-2H-pyrazol-3-yl} - 1 -pyridin-4-yl- lH-pyridazin- 4-one was obtained in analogy to the method of example 1 from intermediate A-I and 2-(4- methyl-piperazin- 1 -yl)-pyridin-4-yl- hydrazine. MS: M = 415.2 (M+H)+
Example 25: 3-[2-f2-Piperazin-l-yl-pyridin-4-yl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH- pyridazin-4-one
Figure imgf000047_0001
3-[2-(2-Piperazin- 1 -yl-pyridin-4-yl)-2H-pyrazol-3-yl]- 1 -pyridin-4-yl- lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and 2-piperazin-l-yl- pyridin-4-yl-hydrazine. MS: M = 401.2 (M+H)+
Example 26: l-Pyridin-4-yl-3-f2-αuinolin-8-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
Figure imgf000047_0002
l-Pyridin-4-yl-3-(2-quinolin-8-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and quinolin-8-yl-hydrazine. MS: M = 367.1 (M+H)+
Example 27: 3-f2-Isoαuinolin-8-yl-2H-pyrazol-3-yl)-l-pyridin-4-yl-lH-pyridazin-4-one
Figure imgf000047_0003
3-(2-Isoquinolin-8-yl-2H-pyrazol-3-yl)-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and isoquinolin-8-yl-hydrazine. MS: M = 367.1 (M+H)+ Example 28 : N,N-Dimethyl-3- \5-( 4-oxo- l-pyridin-4-yl- 1 ,4-dihvdro-pyridazin-3-yl)-pyrazol- 1-yll-benzenesulfonamide
Figure imgf000048_0001
N,N-Dimethyl-3-[5-(4-o xo- l-pyridin-4-yl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl]- benzenesulfonamide was obtained in analogy to the method of example 1 from intermediate A-I and 3-hydrazino-N,N-dimethyl-benzenesulfonamide. MS: M = 423.1 (M+H)+
Example 29: 3-[2-f2,3-Difluoro-phenyl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH-pyridazin-4- one
Figure imgf000048_0002
3-[2-(2,3-Difluoro-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and 2,3-difluoro-phenylhydrazine. MS: M = 352.1 (M+H)+
Example 30: 3-(2-Phenyl-2H-pyrazol-3-yl)-l-pyridin-4-yl-lH-pyridazin-4-one
Figure imgf000048_0003
3-(2-Phenyl-2H-pyrazol-3-yl)-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and phenylhydrazine. MS: M = 316.1 (M+H)+
Example 31: l-Pyridin-4-yl-3-(2-pyridin-4-yl-2H-pyrazol-3-vD-lH-pyridazin-4-one
Figure imgf000049_0001
l-Pyridin-4-yl-3-(2-pyridin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and pyridin-4-yl- hydrazine. MS: M = 317.1 (M+H)+
Example 32: 3-(2-Benzori,31dioxol-5-yl-2H-pyrazol-3-yl)-l-pyridin-3-yl-lH-pyridazin-4- one
Figure imgf000049_0002
3-(2-Benzo[l,3]dioxol-5-yl-2H-pyrazol-3-yl)-l-pyridin-3-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-4 and benzo[l,3]dioxol-5-yl-hydrazine. MS: M = 360.2 (M+H)+
Example 33: l-Pyridin-3-yl-3-(2-pyridin-2-yl-2H-pyrazol-3-vD-lH-pyridazin-4-one
Figure imgf000050_0001
l-Pyridin-3-yl-3-(2-pyridin-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-4 and pyridin-2-yl- hydrazine. MS: M = 317.2 (M+H)+
Example 34: 3- r2-(2,3-Dihydro-benzo r 1 ,41 dioxin-6-yl)-2H-pyrazol-3-yll - l-pyridin-3-yl- IH- pyridazin-4-one
Figure imgf000050_0002
3-[2-(2,3-Dihydro-benzo[ 1 ,4]dioxin-6-yl)-2H-pyrazol-3-yl]- 1 -pyridin-3-yl- 1 H-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-4 and (2,3-dihydro- benzo[l,4]dioxin-6-yl)-hydrazine. MS: M = 374.1 (M+H)+
Example 35: 3-[2-f3-Fluoro-phenyl)-2H-pyrazol-3-yll-l-pyridin-3-yl-lH-pyridazin-4-one
Figure imgf000050_0003
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-pyridin-3-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-4 and 3-fluoro-phenylhydrazine. MS: M = 334.3 (M+H)+ Example 36: 3- \2-( 2,3-Dihydro-benzo [ 1 ,41 dioxin-6-yl)-2H-pyrazol-3-yll - 1-( 5-methyl- Pyridin-3-yl)-lH-pyridazin-4-one
Figure imgf000051_0001
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(5-methyl-pyridin-3-yl)-lH- pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-5 and
(2,3-dihydro-benzo[l,4]dioxin-6-yl)-hydrazine.
MS: M = 388.2 (M+H)+
Example 37: 3-r2-(3-Fluoro-phenyl)-2H-pyrazol-3-yll-l-(^-methyl-pyridin-3-yl)-lH- pyridazin-4-one
Figure imgf000051_0002
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(5-methyl-pyridin-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-5 and 3-fluoro- pheny lhydrazine .
MS: M = 348.2 (M+H)+
Example 38: 3- r2-(2,3-Dihydro-benzo \ 1 ,41 dioxin-6-yl)-2H-pyrazol-3-yll - l-(2-methyl- pyridin-4-yl)-lH-pyridazin-4-one
Figure imgf000052_0001
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-methyl-pyridin-4-yl)-lH- pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-6 and (2,3-dihydro-benzo[l,4]dioxin-6-yl)-hydrazine. MS: M = 388.1 (M+H)+
Example 39: 3-r2-(3-Fluoro-phenyl)-2H-pyrazol-3-yll-l-(2-methyl-pyridin-4-yl)-lH- pyridazin-4-one
Figure imgf000052_0002
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -(2-methyl-pyridin-4-yl)- lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-6 and 3-fluoro- pheny lhydrazine . MS: M = 348.2 (M+H)+
Example 40: 3-[2-f3-Fluoro-phenyl)-2H-pyrazol-3-yll-l-f2-methoxy-pyridin-4-yl)-lH- pyridazin-4-one
Figure imgf000052_0003
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(2-methoxy-pyridin-4-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-7 and 3-fluoro- pheny lhydrazine . MS: M = 364.0 (M+H)+
Example 41: 3- [2-(2,3-Dihvdro-benzo [ 1 ,41 dioxin-6-vD-2H-pyrazol-3-yll - l-(2-morpholin-4- yl-Pyridin-4-yl)-lH-pyridazin-4-one
Figure imgf000053_0001
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-morpholin-4-yl-pyridin-4-yl)- lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-Σ and (2,3-dihydro-benzo[l,4]dioxin-6-yl)-hydrazine. MS: M = 459.3 (M+H)+
Example 42: 3-[2-f3-Fluoro-phenyl)-2H-pyrazol-3-yll-l-f2-morpholin-4-yl-pyridin-4-yl)- lH-pyridazin-4-one
Figure imgf000053_0002
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(2-morpholin-4-yl-pyridin-4-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 8 and 3-fluoro- pheny lhydrazine . MS: M = 419.1 (M+H)+
Example 43 : 4- {3- \2-( 2,3-Dihydro-benzo [ 1 ,41 dioxin-6-yl)-2H-pyrazol-3-yll -4-oxo-4H- Pyridazin-l-yl}-pyridine-2-carbonitrile
Figure imgf000054_0001
4- {3-[2-(2,3-Dihydro-benzo[ 1 ,4]dioxin-6-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} - pyridine-2-carbonitrile was obtained in analogy to the method of example 1 from intermediate A-9 and (2,3-dihydro-benzo[l,4]dioxin-6-yl)-hydrazine. MS: M = 399.2 (M+H)+
Example 44: 4-{3-[2-f3-Fluoro-phenyl)-2H-pyrazol-3-yll-4-oxo-4H-pyridazin-l-yl}- pyridine-2-carbonitrile
Figure imgf000054_0002
4- {3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -pyridine-2-carbonitrile was obtained in analogy to the method of example 1 from intermediate A-9 and 3-fluoro- pheny lhydrazine . MS: M = 359.0 (M+H)+
Example 45: 3-[2-f3-Fluoro-phenyl)-2H-pyrazol-3-yll-l-f5-methanesulfonyl-pyridin-3-yl)- lH-pyridazin-4-one
Figure imgf000054_0003
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(5-methanesulfonyl-pyridin-3-yl)-lH-pyridazin-4- one was obtained in analogy to the method of example 1 from intermediate A-IO and 3-fluoro- pheny lhydrazine . MS: M = 412.3 (M+H)+
Example 46: 3- [2-(2,3-Dihvdro-benzo [ 1 ,41 dioxin-6-vD-2H-pyrazol-3-yll - l-(2-hydroxy- pyridin-4-yl)-lH-pyridazin-4-one
Figure imgf000055_0001
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-hydroxy-pyridin-4-yl)-lH- pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-7 and (2,3-dihydro-benzo[l,4]dioxin-6-yl)-hydrazine. MS: M = 390.0 (M+H)+
Example 47: 3-r2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yll-l-pyridin-3-yl-lH-pyridazin-4- one
Figure imgf000055_0002
3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]-l-pyridin-3-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-4 and 2,5-difluoro-phenylhydrazine. MS: M = 352.3 (M+H)+
Example 48: 3-[2-f6-Fluoro-αuinolin-4-yl)-2H-pyrazol-3-yll-l-f5-methyl-pyridin-3-yl)-lH- pyridazin-4-one
Figure imgf000056_0001
3-[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-(5-methyl-pyridin-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-5 and 6-fluoro- quinolin-4-yl-hydrazine. MS: M = 399.1 (M+H)+
Example 49: l-f5-Fluoro-pyridin-3-yl)-3-[2-f6-fluoro-αuinolin-4-yl)-2H-pyrazol-3-yll-lH- Pyridazin-4-one
Figure imgf000056_0002
l-(5-Fluoro-pyridin-3-yl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I l and 6-fluoro- quinolin-4-yl-hydrazine. MS: M = 403.2 (M+H)+
Example 50: 3-[2-f6-Fluoro-αuinolin-4-yl)-2H-pyrazol-3-yll-l-pyridin-3-yl-lH-pyridazin-4- one
3-[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-pyridin-3-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-4 and 6-fluoro-quinolin-4-yl- hydrazine.
MS: M = 385.1 (M+H)+
Example 51: l-(5-Chloro-pyridin-3-yl)-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4- one
Figure imgf000057_0001
l-(5-Chloro-pyridin-3-yl)-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-12 and quinolin-4-yl-hydrazine. MS: M = 401.1 (M+H)+
Example 52: l-(5-Chloro-pyridin-3-yl)-3-r2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000057_0002
l-(5-Chloro-pyridin-3-yl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-12 and 6-fluoro- quinolin-4-yl-hydrazine. MS: M = 419.2 (M+H)+
Example 53: 3-r2-(3-Chloro-phenyl)-2H-pyrazol-3-yll-l-(5-chloro-pyridin-3-yl)-lH- pyridazin-4-one
Figure imgf000058_0001
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(5-chloro-pyridin-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-12 and 3-chloro- pheny lhydrazine . MS: M = 384.1 (M+H)+
Example 54: l-f2-Chloro-pyridin-4-yl)-3-f2-αuinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4- one
Figure imgf000058_0002
l-(2-Chloro-pyridin-4-yl)-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-2 and quinolin-4-yl-hydrazine. MS: M = 401.1 (M+H)+
Example 55: l-(2-Chloro-pyridin-4-yl)-3-r2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000058_0003
l-(2-Chloro-pyridin-4-yl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-2 and 6-fluoro- quinolin-4-yl-hydrazine. MS: M = 419.2 (M+H)+
Example 56: 3-r2-(3-Chloro-phenyl)-2H-pyrazol-3-yll-l-(2-chloro-pyridin-4-yl)-lH- Pyridazin-4-one
Figure imgf000059_0001
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(2-chloro-pyridin-4-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-2 and 3-chloro- pheny lhydrazine . MS: M = 384.8 (M+H)+
Example 57: l-α-Chloro-pyridin-4-yl)-3-r2-α-chloro-pyridin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000059_0002
l-(2-Chloro-pyridin-4-yl)-3-[2-(2-chloro-pyridin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-2 and 2-chloro- pyridin-4-yl-hydrazine. MS: M = 385.0 (M+H)+
Example 58: l-f2-Chloro-pyridin-4-yl)-3-f2-αuinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4- one
Figure imgf000060_0001
l-(2-Chloro-pyridin-4-yl)-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-2 and quinolin-5-yl-hydrazine. MS: M = 401.1 (M+H)+
Example 59: l-(2-Chloro-pyridin-4-yl)-3-(2-isoquinolin-5-yl-2H-pyrazol-3-yl)-lH- Pyridazin-4-one
Figure imgf000060_0002
l-(2-Chloro-pyridin-4-yl)-3-(2-isoquinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-2 and isoquinolin-5-yl- hydrazine. MS: M = 401.1 (M+H)+
Example 60: l-f5-Chloro-pyridin-3-yl)-3-f2-αuinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4- one
Figure imgf000060_0003
l-(5-Chloro-pyridin-3-yl)-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-12 and quinolin-5-yl-hydrazine. MS: M = 401.1 (M+H)4
Example 61: l-f5-Chloro-pyridin-3-yl)-3-[2-f6-chloro-αuinolin-4-yl)-2H-pyrazol-3-yll-lH- Pyridazin-4-one
Figure imgf000061_0001
l-(5-Chloro-pyridin-3-yl)-3-[2-(6-chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 12 and 6-chloro- quinolin-4-yl-hydrazine. MS: M = 435.2 (M+H)+
Example 62: l-(2-Chloro-pyridin-4-yl)-3-r2-(6-chloro-quinolin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000061_0002
l-(2-Chloro-pyridin-4-yl)-3-[2-(6-chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-2 and 6-chloro- quinolin-4-yl-hydrazine. MS: M = 435.2 (M+H)+
Example 63: l-α-Chloro-pyridin-4-yl)-3-r2-α-fluoro-phenyl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000062_0001
l-(2-Chloro-pyridin-4-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-2 and 2-fluoro- pheny lhydrazine . MS: M = 368.0 (M+H)+
Example 64: l-(^-Chloro-pyridin-3-yl)-3-r2-a-fluoro-phenyl)-2H-pyrazol-3-yll-lH- Pyridazin-4-one
Figure imgf000062_0002
l-(5-Chloro-pyridin-3-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 12 and 2-fluoro- pheny lhydrazine . MS: M = 368.0 (M+H)+
Example 65: 3-[2-f2-Fluoro-phenyl)-2H-pyrazol-3-yll-l-isoαuinolin-4-yl-lH-pyridazin-4- one
Figure imgf000062_0003
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-isoquinolin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 13 and 2-fluoro-phenylhydrazine. MS: M = 384.1 (M+H)+
Example 66: 3-[2-f3-Chloro-phenyl)-2H-pyrazol-3-yll-l-isoαuinolin-4-yl-lH-pyridazin-4- one
Figure imgf000063_0001
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-isoquinolin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 13 and 3-chloro-phenylhydrazine. MS: M = 400.2 (M+H)+
Example 67: 3-r2-(3-Chloro-phenyl)-2H-pyrazol-3-yll-l-(5-trifluoromethyl-pyridin-3-yl)- lH-pyridazin-4-one
Figure imgf000063_0002
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]- 1 -(5-trifluoromethyl-pyridin-3-yl)- lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-14 and 3-chloro- phenylhydrazine . MS: M = 418.1 (M+H)+
Example 68: 3-r2-(2-Fluoro-phenyl)-2H-pyrazol-3-yll-l-(5-trifluoromethyl-pyridin-3-yl)- lH-pyridazin-4-one
Figure imgf000064_0001
3 - [2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(5 -trifluoromethyl-pyridin-3 -yl)- 1 H-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 14 and 2-fluoro- pheny lhydrazine . MS: M = 402.2 (M+H)+
Example 69: l-f2-Chloro-pyridin-4-yl)-3-[2-f7-chloro-αuinolin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000064_0002
l-(2-Chloro-pyridin-4-yl)-3-[2-(7-chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-2 and 7-chloro- quinolin-4-yl-hydrazine. MS: M = 435.2 (M+H)+
Example 70: l-(5-Chloro-pyridin-3-yl)-3-r2-(7-chloro-quinolin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000064_0003
l-(5-Chloro-pyridin-3-yl)-3-[2-(7-chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 12 and 7-chloro- quinolin-4-yl-hydrazine. MS: M = 435.2 (M+H)+
Example 71: 3-f2-Ouinolin-4-yl-2H-pyrazol-3-yl)-l-f5-trifluoromethyl-pyridin-3-yl)-lH- Pyridazin-4-one
Figure imgf000065_0001
3-(2-Quinolin-4-yl-2H-pyrazol-3-yl)-l-(5-trifluoromethyl-pyridin-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-14 and quinolin-4-yl- hydrazine. MS: M = 435.3 (M+H)+
Example 72: 3-r2-(6-Chloro-quinolin-4-yl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH-pyridazin-4- one
Figure imgf000065_0002
3-[2-(6-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and 6-chloro-quinolin-4-yl- hydrazine. MS: M = 401.1 (M+H)+
Example 73: 3-f2-Isoαuinolin-4-yl-2H-pyrazol-3-yl)-l-pyridin-4-yl-lH-pyridazin-4-one
Figure imgf000066_0001
3-(2-Isoquinolin-4-yl-2H-pyrazol-3-yl)-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and isoquinolin-4-yl-hydrazine. MS: M = 367.0 (M+H)+
Example 74: l-(5-Difluoromethoxy-pyridin-3-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yll- lH-pyridazin-4-one
Figure imgf000066_0002
l-(5-Difluoromethoxy-pyridin-3-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4- one was obtained in analogy to the method of example 1 from intermediate A- 15 and 2-fluoro- pheny lhydrazine . MS: M = 400.1 (M+H)+
Example 75: 3-[2-f2-Fluoro-phenyl)-2H-pyrazol-3-yll-l-f6-trifluoromethyl-pyridin-3-yl)- lH-pyridazin-4-one
Figure imgf000066_0003
-OS¬
S' [2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(6-trifluoromethyl-pyridin-3 -yl)- 1 H-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 16 and 2-fluoro- pheny lhydrazine . MS: M = 402.2 (M+H)+
Example 76: 5-{3-[2-f2-Fluoro-phenyl)-2H-pyrazol-3-yll-4-oxo-4H-pyridazin-l-yl}- pyridine-2-carbonitrile
Figure imgf000067_0001
5- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -pyridine-2-carbonitrile was obtained in analogy to the method of example 1 from intermediate A- 17 and 2-fluoro- pheny lhydrazine . MS: M = 359.1 (M+H)+
Example 77: l-(6-Chloro-pyridin-3-yl)-3-r2-α-fluoro-phenyl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000067_0002
l-(6-Chloro-pyridin-3-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l H-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 18 and 2-fluoro- pheny lhydrazine . MS: M = 368.0 (M+H)+
Example 78: 3-[2-f2-Fluoro-phenyl)-2H-pyrazol-3-yll-l-αuinolin-3-yl-lH-pyridazin-4-one
Figure imgf000068_0001
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-quinolin-3-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 19 and 2-fluoro-phenylhydrazine. MS: M = 384.1 (M+H)+
Example 79: l-f2-Methyl-pyridin-4-yl)-3-f2-αuinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4- one
Figure imgf000068_0002
l-(2-Methyl-pyridin-4-yl)-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-6 and quinolin-4-yl-hydrazine. MS: M = 381.3 (M+H)+
Example 80: 3-f2-Ouinolin-5-yl-2H-pyrazol-3-yl)-l-f6-trifluoromethyl-pyridin-3-yl)-lH- pyridazin-4-one
Figure imgf000068_0003
3-(2-Quinolin-5-yl-2H-pyrazol-3-yl)-l-(6-trifluoromethyl-pyridin-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 16 and quinolin-5-yl- hydrazine. MS: M = 435.3 (M+H)4
Example 81: 3-f2-Isoαuinolin-5-yl-2H-pyrazol-3-yl)-l-f6-trifluoromethyl-pyridin-3-yl)-lH- Pyridazin-4-one
Figure imgf000069_0001
3 -(2-Isoquino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 -(6-trifluoromethyl-pyridin-3 -yl)- 1 H-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 16 and isoquinolin-5- yl-hydrazine.
MS: M = 435.3 (M+H)4
Example 82: 3-r2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yll-l-(5-methyl-pyridin-3-yl)-lH- pyridazin-4-one
Figure imgf000069_0002
3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-(5-methyl-pyridin-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-5 and 7-chloro- quinolin-4-yl-hydrazine. MS: M = 415.2 (M+H)4
Example 83: l-(2-Methyl-pyridin-4-yl)-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4- one
Figure imgf000070_0001
l-(2-Methyl-pyridin-4-yl)-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-6 and quinolin-5-yl-hydrazine. MS: M = 381.3 (M+H)+
Example 84: l-Pyridin-3-yl-3-f2-αuinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
Figure imgf000070_0002
l-Pyridin-3-yl-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-4 and quinolin-5-yl-hydrazine. MS: M = 367.1 (M+H)+
Example 85: 3-f2-Isoαuinolin-5-yl-2H-pyrazol-3-yl)-l-f2-methyl-pyridin-4-yl)-lH- pyridazin-4-one
Figure imgf000070_0003
3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)- 1 -(2-methyl-pyridin-4-yl)- lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-6 and isoquinolin-5-yl- hydrazine. MS: M = 381.3 (M+H)+ Example 86: 3-f2-Isoαuinolin-5-yl-2H-pyrazol-3-yl)-l-pyridin-3-yl-lH-pyridazin-4-one
Figure imgf000071_0001
3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)-l-pyridin-3-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-4 and isoquinolin-5-yl-hydrazine. MS: M = 367.0 (M+H)+
Example 87: 5-{3-[2-f2-Fluoro-phenyl)-2H-pyrazol-3-yll-4-oxo-4H-pyridazin-l-yl}- nicotinonitrile
Figure imgf000071_0002
5- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -nicotinonitrile was obtained in analogy to the method of example 1 from intermediate A-20 and 2-fluoro- pheny lhydrazine . MS: M = 359.1 (M+H)+
Example 88: l-(6-Chloro-pyridin-3-yl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000071_0003
l-(6-Chloro-pyridin-3-yl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 18 and 2-methyl- pyridin-4-yl-hydrazine. MS: M = 365.1 (M+H)+
Example 89: l-(5-Difluoromethoxy-pyridin-3-yl)-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH- Pyridazin-4-one
Figure imgf000072_0001
1 -(5 -Difluoromethoxy-pyridin-3 -yl)-3 -(2-quino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A- 15 and quino lin-5 -yl- hydrazine. MS: M = 433.2 (M+H)+
Example 90: 3-r2-α-Fluoro-phenyl)-2H-pyrazol-3-yll-l-(5-methyl-pyridin-3-yl)-lH- pyridazin-4-one
Figure imgf000072_0002
3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(5 -methyl-pyridin-3-yl)-l H-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-5 and 2-fluoro- phenylhydrazine HCl. MS: M = 348.2 (M+H)+ Example 91: 3-[2-f7-Chloro-αuinolin-4-yl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH-pyridazin-4- one
Figure imgf000073_0001
3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and 7-chloro-quinolin-4-yl- hydrazine. MS: M = 401.1 (M+H)+
Example 92: 3-r2-(3-Methyl-pyridin-4-yl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH-pyridazin-4- one
Figure imgf000073_0002
3-[2-(3-Methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and (3-methyl-pyridin-4-yl)- hydrazine. MS: M = 331.1 (M+H)+
Example 93: 3-r2-α-Fluoro-phenyl)-2H-pyrazol-3-yll-l-α-methyl-pyridin-4-yl)-lH- pyridazin-4-one
Figure imgf000074_0001
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(2-methyl-pyridin-4-yl)-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-6 and 2-fluoro- phenylhydrazine HCl. MS: M = 348.2 (M+H)+
Example 94: 3-[2-f2-Fluoro-phenyl)-2H-pyrazol-3-yll-l-f2-trifluoromethyl-pyridin-4-yl)- lH-pyridazin-4-one
Figure imgf000074_0002
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -(2-trifluoromethyl-pyridin-4-yl)- lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-21 and 2-fluoro- phenylhydrazine HCl. MS: M = 402.1 (M+H)+
Example 95: 3-r2-(3-Chloro-phenyl)-2H-pyrazol-3-yll-l-(2-trifluoromethyl-pyridin-4-yl)- lH-pyridazin-4-one
Figure imgf000075_0001
3 - [2-(3-Chloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(2-trifluoromethyl-pyridin-4-yl)- 1 H-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-21 and 3-chloro- phenylhydrazine HCl. MS: M = 418.1 (M+H)+
Example 96: 4-{3-[2-f2-Fluoro-phenyl)-2H-pyrazol-3-yll-4-oxo-4H-pyridazin-l-yl}- pyridine-2-carbonitrile
Figure imgf000075_0002
4- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -pyridine-2-carbonitrile was obtained in analogy to the method of example 1 from intermediate A-9 and 2-fluoro- phenylhydrazine HCl. MS: M = 359.1 (M+H)+
Example 97: 3-[2-f3-Bromo-phenyl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH-pyridazin-4-one
Figure imgf000075_0003
3-[2-(3-Bromo-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-I and 3-bromo-phenylhydrazine HCl. MS: M = 394.3 (M+H)+
Example 98: l-Pyridin-4-yl-3-r2-(3-trimethylsilanylethvnyl-phenyl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000076_0001
A mixture of 3-[2-(3-Bromo-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one (example 97, 81 mg, 0.21 mmol), ethynyltrimethylsilane (44 ul, 0.31 mmol), CuI (2 mg, 0.01 mmol), (PPh3)2PdCl2 (9 mg, 0.01 mmol), PPh3 (113 mg, 0.41 mmol) and dimethylamine (421 ul, 3.1 mmol of a solution in ethanol) in DMF (1.0 ml) is heated at 120 0C for 20 minutes under microwave irradiation. After purification of the crude product by preparative HPLC 33 mg (39% yield) of the product is obtained as solid material. MS: M = 412.3 (M+H)+
Example 99: 3-[2-f3-Ethvnyl-phenyl)-2H-pyrazol-3-yll-l-pyridin-4-yl-lH-pyridazin-4-one
Figure imgf000076_0002
A mixture of l-Pyridin-4-yl-3-[2-(3-trimethylsilanylethynyl-phenyl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one (example 98, 33 mg, 0.08 mmol) is dissolved in THF (1 ml). Tetrabutylammoniumfluoride trihydrate (51 mg, 0.16 mmol) is added at 0 0C and the reaction mixture is allowed to warm up to ambient temperature within 15 minutes. Stirring is continued for another 1 hour. The reaction mixture is quenched with water and extracted with ethyl acetate. The solvent is removed and the obtained crude product is purified by chromatography on silica gel using EtOAC/MeOH gradient to obtain 22 mg (81 % yield) of the product. MS: M = 340.1 (M+H)+
Example 100: 3- \2-( 2-Fluoro-phenyl)-2H-pyrazol-3-yll - 1-isoq uinolin-6-yl- lH-pyridazin-4- one
Figure imgf000077_0001
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-isoquinolin-6-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-22 and 2-fluorophenylhydrazine HCl. MS: M = 384.2 (M+H)+
Example 101: 3- \2-( 3-Fluoro-phenyl)-2H-pyrazol-3-yll - 1-isoq uinolin-6-yl- lH-pyridazin-4- one
Figure imgf000077_0002
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-isoquinolin-6-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-22 and 3-fluorophenylhydrazine. MS: M = 384.1 (M+H)+
Example 102 : 3- \2-( 2-Fluoro-phenyl)-2H-pyrazol-3-yll - 1-q uinolin-6-yl- lH-pyridazin-4-one
Figure imgf000078_0001
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-quinolin-6-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-23 and 2-fluorophenylhydrazine HCl. MS: M = 384.1 (M+H)+
Example 103: 3-[2-f3-Chloro-phenyl)-2H-pyrazol-3-yll-l-αuinolin-6-yl-lH-pyridazin-4-one
Figure imgf000078_0002
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-quinolin-6-yl-lH-pyridazin-4-one was obtained in analogy to the method of example 1 from intermediate A-23 and 3-chloro-phenylhydrazine HCl. MS: M = 400.1 (M+H)+ Example A
Film coated tablets containing the following ingredients can be manufactured in a conventional manner:
Ingredients Per tablet
Kernel:
Compound of formula (I) 10.0 mg 200.0 mg
Micro crystalline cellulose 23.5 mg 43.5 mg
Lactose hydrous 60.0 mg 70.0 mg
Povidone K30 12.5 mg 15.0 mg
Sodium starch glycolate 12.5 mg 17.0 mg
Magnesium stearate 1.5 mg 4.5 mg
(Kernel Weight) 120.0 mg 350.0 mg Film Coat:
Hydro xypropyl methyl cellulose 3.5 mg 7.0 mg
Polyethylene glycol 6000 0.8 mg 1.6 mg
Talc 1.3 mg 2.6 mg
Iron oxyde (yellow) 0.8 mg 1.6 mg
Titan dioxide 0.8 mg 1.6 mg
The active ingredient is sieved and mixed with micro cristalline cellulose and the mixture is granulated with a solution of polyvinylpyrrolidon in water. The granulate is mixed with sodium starch glycolate and magesiumstearate and compressed to yield kernels of 120 or 350 mg respectively. The kernels are lacquered with an aqueous solution / suspension of the above mentioned film coat.
Example B
Capsules containing the following ingredients can be manufactured in a conventional manner:
Ingredients Per capsule
Compound of formula (I) 25.0 mg
Lactose 150.0 mg
Maize starch 20.0 mg
Talc 5.0 mg
The components are sieved and mixed and filled into capsules of size 2.
Example C
Injection solutions can have the following composition:
Compound of formula (I) 3.0 mg
Polyethylene Glycol 400 150.0 mg
Acetic Acid q.s. ad pH 5.0
Water for injection solutions ad 1.0 mL
The active ingredient is dissolved in a mixture of Polyethylene Glycol 400 and water for injection (part). The pH is adjusted to 5.0 by Acetic Acid. The volume is adjusted to 1.0 mL by addition of the residual amount of water. The solution is filtered, filled into vials using an appropriate overage and sterilized.
Example D
Soft gelatin capsules containing the following ingredients can be manufactured in a conventional manner:
Capsule contents
Compound of formula (I) 5.0 mg
Yellow wax 8.0 mg
Hydrogenated Soya bean oil 8.0 mg
Partially hydrogenated plant oils 34.0 mg
Soya bean oil HO.O mg
Weight of capsule contents 165.0 mg Gelatin capsule
Gelatin 75.0 mg
Glycerol 85 % 32.0 mg
Karion 83 8.0 mg (dry matter)
Titan dioxide 0.4 mg
Iron oxide yellow 1.1 mg
The active ingredient is dissolved in a warm melting of the other ingredients and the mixture is filled into soft gelatin capsules of appropriate size. The filled soft gelatin capsules are treated according to the usual procedures.
Example E
Sachets containing the following ingredients can be manufactured in a conventional manner:
Compound of formula (I) 50.0 mg
Lactose, fine powder 1015.0 mg
Microcristalline cellulose (AVICEL PH 102) 1400.0 mg
Sodium carboxymethyl cellulose 14.0 mg
Po lyvinylpyrro lidon K 30 10.0 mg
Magnesiumstearate 10.0 mg
Flavoring additives 1.0 mg
The active ingredient is mixed with lactose, microcristalline cellulose and sodium carboxymethyl cellulose and granulated with a mixture of po lyvinylpyrro lidon in water. The granulate is mixed with magnesiumstearate and the flavouring additives and filled into sachets.

Claims

Claims
1. Compounds of formula (I)
Figure imgf000083_0001
wherein
R1 is heteroaryl which can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, halogen, lower-alkoxy- lower-alkyl, cyano, NO2, morpholinyl, NH2-SO2, N(H,lower-alkyl)-SO2, N(lower- alkyl)2-SO2, pyrrolidinyl-SO2, piperidinyl-SO2, morpholinyl- S O2, hydroxy, COOH, COO-lower-alkyl, lower-alkyl-C(O)O, CO-lower-alkyl, CONH2, CON(H,lower-alkyl), CON(lower-alkyl)2, lower-alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl), NH2-CO- lower-alkyl, NH(Io wer-alkyl)-CO-lower-alkyl, N(lower-alkyl)2-CO-lower-alkyl, NH2,
N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower-alkyl)-lower-alkyl, N(lower-alkyl)2-lower-alkyl, cycloalkyl, piperidinyl, piperazinyl and (N-lower-alkyl)- piperazinyl;
R2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower- alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO2, COOH, CONH2, NH2-SO2, COO-lower-alkyl, lower-alkoxy-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl)2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, lower-alkenyl, hydroxy, NO2, morpholinyl, piperidinyl, piperazinyl, (N-lower-alkyl)-piperazinyl, pyrrolidinyl, lower-alkyl-C(O)O, lower-alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl), NH2-CO- lower-alkyl, NH(lower-alkyl)-CO-lower-alkyl, N(lower-alkyl)2-CO-lower-alkyl, CO- lower-alkyl, NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower- alkyl)-lower-alkyl, N(lower-alkyl)2-lower-alkyl, tri(lower-alkyl)silyl-loweralkinyl and cycloalkyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower- alkylene, dioxo-fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower- alkylene, lower-alkylene-NH-lower-alkylene, lower-alkylene-N(lower alkyl)-lower- alkylene, NH-C(O)-lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower- alkylene-NH-C(O)-lower-alkylene, lower-alkylene -N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)-N(lower-alkyl)-lower-alkylene;
R is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
R4 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
and pharmaceutically acceptable salts and esters thereof.
2. Compounds according to claim 1, wherein R2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO2, COOH, CONH2, NH2-SO2, COO-lower-alkyl, lower-alkoxy-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl)2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, lower- alkenyl, hydroxy, NO2, morpholinyl, piperidinyl, piperazinyl, (N-lower-alkyl)-piperazinyl, pyrrolidinyl, lower-alkyl-C(O)O, lower-alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl), NH2- CO-lower-alkyl, NH(lower-alkyl)-CO-lower-alkyl, N(lower-alkyl)2-CO-lower-alkyl, CO-lower- alkyl, NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower-alkyl)-lower-alkyl, N(lower-alkyl)2-lower-alkyl and cycloalkyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower-alkylene, dioxo- fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower-alkylene, lower-alkylene-NH- lower-alkylene, lower-alkylene-N(lower alkyl)-lower-alkylene, NH-C(O)-lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower-alkylene-NH-C(O)-lower-alkylene, lower-alkylene- N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)-N(lower-alkyl)-lower- alkylene.
3. Compounds according to any of claims 1 - 2, wherein R1 is heteroaryl selected from the group consisting of pyridinyl, isoquinolinyl and quinolinyl, which heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl- SO2, halogen, cyano, morpholinyl and hydroxy.
4. Compounds according to any of claims 1 - 3, wherein R1 is heteroaryl selected from the group consisting of pyridinyl and quinolinyl, which heteroaryl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of lower- alkyl, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, halogen, morpholinyl and hydroxy.
5. Compounds according to any of claims 1 - 4, wherein R1 is pyridin-4-yl, 2-chloro- pyridin-4-yl, 2-methansulfonyl-pyridin-4-yl, pyridin-3-yl, 5-methyl-pyridin-3-yl, 2-morpholin-4- yl-pyridin-4-yl, 2-hydroxy-pyridin-4-yl, 5-chloro-pyridin-3-yl, 5-trifluoromethyl-pyridin-3-yl, 5- difluoromethoxy-pyridin-3-yl, 6-trifluoromethyl-pyridin-3-yl, quinolin-3-yl or 2-methyl-pyridin- 4-yl.
6. Compounds according to any of claims 1 - 5, wherein R2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of pyridinyl, quinolinyl and isoquinolinyl, which aryl or heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, fluoro-lower-alkyl, COOH, NH2-SO2, COO-lower-alkyl, N(lower-alkyl)2-SO2, piperazinyl, (N-lower-alkyl)-piperazinyl, lower-alkinyl and tri(lower-alkyl)silyl-loweralkinyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene.
7. Compounds according to any of claims 1 - 6, wherein R2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of quinolinyl and isoquinolinyl, which aryl or heteroaryl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of halogen and lower-alkinyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene.
8. Compounds according to any of claims 1 - 7, wherein R2 is napthalen-1-yl, quinolin-4-yl, phenyl, benzo[l,3]dioxol-5-yl, 3-fluoro-phenyl, 2,3-dihydro-benzo[l,4]dioxin-6-yl, 3-chloro-phenyl, 2-fluoro-phenyl, 3-bromo-phenyl, 3-ethynyl-phenyl or isoquinolin-5-yl.
9. Compounds according to any of claims 1 - 8, wherein R3 is hydrogen.
10. Compounds according to any of claims 1 - 9, wherein R4 is hydrogen.
11. Compounds according to any of claims 1 - 10, selected from the group consisting of 3-[2-(6-Chloro-pyridin-2-yl)-2H-pyrazol-3-yl]- 1 -pyridin-4-yl- lH-pyridazin-4-one, l-Pyridin-4-yl-3-(2-pyridin-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-[5-(4-Oxo- 1 -pyridin-4-yl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl]-benzonitrile, 3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -pyridin-4-yl- lH-pyridazin-4-one, 3-[5-(4-Oxo- 1 -pyridin-4-yl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl]-benzoic acid, 3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yl]-l -pyridin-4-yl- lH-pyridazin-4-one, 3 -[2-(4-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -pyridin-4-yl- lH-pyridazin-4-one, 4-[5-(4-Oxo- 1 -pyridin-4-yl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl]-benzenesulfonamide, 3 - [2-(3 ,5 -Dichloro-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -pyridin-4-yl- 1 H-pyridazin-4-one, 3-[5-(4-Oxo-l -pyridin-4-yl- l,4-dihydro-pyridazin-3-yl)-pyrazol-l-yl]-benzoic acid methyl ester, l-Pyridin-4-yl-3-(2-p-tolyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-[2-(2-Chloro-phenyl)-2H-pyrazol-3-yl]-l -pyridin-4-yl- 1 H-pyridazin-4-one,
1 -(2-Chloro-pyridin-4-yl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one,
3 - [2-(2, 8-Bis-trifluoromethyl-quino lin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -pyridin-4-yl- 1 H-pyridazin-4- one, 3-[2-(2,3-Dihydro-benzo[ 1 ,4]dioxin-6-yl)-2H-pyrazol-3-yl]- 1 -pyridin-4-yl- 1 H-pyridazin-4-one, 1 -(2-Methanesulfonyl-pyridin-4-yl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one, 3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-methanesulfonyl-pyridin-4-yl)- 1 H-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 3-[2-(2-Methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, l-Pyridin-4-yl-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)-l-pyridin-4-yl-lH-pyridazin-4-one, l-Pyridin-4-yl-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-[2-(2-Chloro-pyridin-4-yl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one,
3- {2-[2-(4-Methyl-piperazin- 1 -yl)-pyridin-4-yl]-2H-pyrazol-3-yl} - 1 -pyridin-4-yl- lH-pyridazin- 4-one,
3-[2-(2-Piperazin- 1 -yl-pyridin-4-yl)-2H-pyrazol-3-yl]- 1 -pyridin-4-yl- lH-pyridazin-4-one, l-Pyridin-4-yl-3-(2-quinolin-8-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-(2-Isoquinolin-8-yl-2H-pyrazol-3-yl)-l -pyridin-4-yl- lH-pyridazin-4-one,
N,N-Dimethyl-3-[5-(4-oxo- 1 -pyridin-4-yl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl]- benzenesulfonamide,
3-[2-(2,3-Difluoro-phenyl)-2H-pyrazol-3-yl]-l -pyridin-4-yl- lH-pyridazin-4-one, 3-(2-Phenyl-2H-pyrazol-3-yl)- 1 -pyridin-4-yl- 1 H-pyridazin-4-one, l-Pyridin-4-yl-3-(2-pyridin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-(2-Benzo[l,3]dioxol-5-yl-2H-pyrazol-3-yl)-l-pyridin-3-yl-lH-pyridazin-4-one, l-Pyridin-3-yl-3-(2-pyridin-2-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[ 1 ,4]dioxin-6-yl)-2H-pyrazol-3-yl]- 1 -pyridin-3-yl- 1 H-pyridazin-4-one, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l -pyridin-3-yl- 1 H-pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(5-methyl-pyridin-3-yl)-lH- pyridazin-4-one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(5-methyl-pyridin-3-yl)-lH-pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-methyl-pyridin-4-yl)-lH- pyridazin-4-one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(2-methyl-pyridin-4-yl)-lH-pyridazin-4-one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(2-methoxy-pyridin-4-yl)-lH-pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-morpholin-4-yl-pyridin-4-yl)-
1 H-pyridazin-4-one, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(2-morpholin-4-yl-pyridin-4-yl)-lH-pyridazin-4-one,
4- {3-[2-(2,3-Dihydro-benzo[ 1 ,4]dioxin-6-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} - pyridine-2-carbonitrile,
4- {3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -pyridine-2-carbonitrile, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(5-methanesulfonyl-pyridin-3-yl)-lH-pyridazin-4- one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-hydroxy-pyridin-4-yl)-lH- pyridazin-4-one, 3 - [2-(2,5 -Difluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -pyridin-3 -yl- 1 H-pyridazin-4-one,
3-[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-(5-methyl-pyridin-3-yl)-lH-pyridazin-4-one, l-(5-Fluoro-pyridin-3-yl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3 -[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazo 1-3 -yl]-l -pyridin-3 -yl-1 H-pyridazin-4-one, 1 -(5 -Chloro-pyridin-3-yl)-3-(2-quinolin-4-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, l-(5-Chloro-pyridin-3-yl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(5-chloro-pyridin-3-yl)-lH-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-(2-quinolin-4-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(2-chloro-pyridin-4-yl)-lH-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-[2-(2-chloro-pyridin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-(2-quinolin-5-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-(2-isoquinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 1 -(5 -Chloro-pyridin-3-yl)-3-(2-quinolin-5-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, l-(5-Chloro-pyridin-3-yl)-3-[2-(6-chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-[2-(6-chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l H-pyridazin-4-one, 1 -(5 -Chloro-pyridin-3-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l H-pyridazin-4-one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-isoquinolin-4-yl-lH-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-isoquinolin-4-yl-lH-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(5-trifluoromethyl-pyridin-3-yl)-lH-pyridazin-4-one, 3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(5 -trifluoromethyl-pyridin-3-yl)-l H-pyridazin-4-one, l-(2-Chloro-pyridin-4-yl)-3-[2-(7-chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(5-Chloro-pyridin-3-yl)-3-[2-(7-chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3 -(2-Quino lin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(5 -trifluoromethyl-pyridin-3 -yl)- 1 H-pyridazin-4-one, 3-[2-(6-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 3-(2-Isoquinolin-4-yl-2H-pyrazol-3-yl)-l-pyridin-4-yl-lH-pyridazin-4-one, l-(5-Difluoromethoxy-pyridin-3-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4- one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(6-trifluoromethyl-pyridin-3-yl)-lH-pyridazin-4-one, 5- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -pyridine-2-carbonitrile, l-(6-Chloro-pyridin-3-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-quinolin-3-yl-lH-pyridazin-4-one, l-(2-Methyl-pyridin-4-yl)-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3 -(2-Quino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 -(6-trifluoromethyl-pyridin-3 -yl)- 1 H-pyridazin-4-one, 3 -(2-Isoquino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 -(6-trifluoromethyl-pyridin-3 -yl)- 1 H-pyridazin-4-one, 3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-(5-methyl-pyridin-3-yl)-lH-pyridazin-4-one, l-(2-Methyl-pyridin-4-yl)-3-(2-quino lin-5 -yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, l-Pyridin-3-yl-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)-l-(2-methyl-pyridin-4-yl)-lH-pyridazin-4-one,
3 -(2-Isoquino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 -pyridin-3 -yl- 1 H-pyridazin-4-one,
5- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -nicotinonitrile, and l-(6-Chloro-pyridin-3-yl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, and pharmaceutically acceptable salts and esters thereof.
12. Compounds according to any of claims 1 - 11, selected from the group consisting of
1 -(2-Chloro-pyridin-4-yl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one, 1 -(2-Methanesulfonyl-pyridin-4-yl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one, l-Pyridin-4-yl-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-(2-Phenyl-2H-pyrazol-3-yl)- 1 -pyridin-4-yl- 1 H-pyridazin-4-one,
3-(2-Benzo[l,3]dioxol-5-yl-2H-pyrazol-3-yl)-l-pyridin-3-yl-lH-pyridazin-4-one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(5-methyl-pyridin-3-yl)-lH-pyridazin-4-one, 3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-morpholin-4-yl-pyridin-4-yl)-
1 H-pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(2-hydroxy-pyridin-4-yl)-lH- pyridazin-4-one,
1 -(5 -Chloro-pyridin-3-yl)-3-(2-quinolin-4-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(2-chloro-pyridin-4-yl)-lH-pyridazin-4-one,
3 - [2-(3-Chloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(5 -trifluoromethyl-pyridin-3 -yl)- 1 H-pyridazin-4-one, l-(5-Difluoromethoxy-pyridin-3-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4- one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(6-trifluoromethyl-pyridin-3-yl)-lH-pyridazin-4-one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-quinolin-3-yl-lH-pyridazin-4-one, l-(2-Methyl-pyridin-4-yl)-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, and 3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)-l-(2-methyl-pyridin-4-yl)-lH-pyridazin-4-one, and pharmaceutically acceptable salts and esters thereof.
13. Compounds according to any of claims 1 - 10, selected from the group consisting of
1 -(5 -Difluoromethoxy-pyridin-3 -yl)-3 -(2-quino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -(5 -methyl-pyridin-3 -yl)- 1 H-pyridazin-4-one, 3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 3-[2-(3-Methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l-(2-methyl-pyridin-4-yl)-l H-pyridazin-4-one, 3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l-(2-trifluoromethyl-pyridin-4-yl)-l H-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(2-trifluoromethyl-pyridin-4-yl)-lH-pyridazin-4-one, 4- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -pyridine-2-carbonitrile, 3-[2-(3-Bromo-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 1 -Pyridin-4-yl-3 - [2-(3 -trimethylsilanylethynyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 H-pyridazin-4-one, 3-[2-(3-Ethynyl-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-isoquinolin-6-yl-lH-pyridazin-4-one, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-isoquinolin-6-yl-lH-pyridazin-4-one, 3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l-quinolin-6-yl-l H-pyridazin-4-one, and 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-quinolin-6-yl-lH-pyridazin-4-one and pharmaceutically acceptable salts and esters thereof.
14. Compounds according to any of claims 1 - 10, selected from the group consisting of
3-[2-(3-Bromo-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one, and 3-[2-(3-Ethynyl-phenyl)-2H-pyrazol-3-yl]-l-pyridin-4-yl-lH-pyridazin-4-one and pharmaceutically acceptable salts and esters thereof.
15. A process for the manufacture of compounds of formula (I) as defined in any of claims 1 - 14, which process comprises reacting a compound of formula (II)
Figure imgf000091_0001
with a compound of the formula R2 -NH-NH2, wherein R1, R2, R3 and R4 are as defined in any of claims 1 - 14.
16. Compounds according to any of claims 1 - 14, when manufactured by a process according to claim 15.
17. Pharmaceutical compositions comprising a compound according to any of claims 1 - 14 and a pharmaceutically acceptable carrier and/or adjuvant.
18. Compounds according to any of claims 1 - 14 for use as therapeutic active substances.
19. Compounds according to any of claims 1 - 14 for use as therapeutic active substances for the treatment and/or prophylaxis of diseases which are modulated by PDElOA inhibitors.
20. A method for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention- defϊcit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer, which method comprises administering a compound according to any of claims 1 - 14 to a human being or animal.
21. The use of compounds according to any of claims 1 - 14 for the therapeutic and/or prophylactic treatment of diseases which are modulated PDElOA inhibitors.
22. The use of compounds according to any of claims 1 - 14 for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi- infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention- defϊcit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer.
23. The use of compounds according to any of claims 1 - 14 for the preparation of medicaments for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors.
24. The use of compounds according to any of claims 1 - 14 for the preparation of medicaments for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-defϊcit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer.
25. The invention as hereinbefore defined.
PCT/EP2010/052116 2009-02-23 2010-02-19 Heteroaryl substituted pyridazinone derivatives Ceased WO2010094762A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
BRPI1008007A BRPI1008007A2 (en) 2009-02-23 2010-02-19 heteroaryl substituted pyridazinone derivatives
ES10711618.8T ES2526251T3 (en) 2009-02-23 2010-02-19 Heteroaryl substituted pyridazinone derivatives
CA2749867A CA2749867C (en) 2009-02-23 2010-02-19 Heteroaryl substituted pyridazinone derivatives
AU2010215428A AU2010215428B2 (en) 2009-02-23 2010-02-19 Heteroaryl substituted pyridazinone derivatives
CN201080008620.XA CN102325766B (en) 2009-02-23 2010-02-19 Heteroaryl substituted pyridazinone derivatives
MX2011008360A MX2011008360A (en) 2009-02-23 2010-02-19 Heteroaryl substituted pyridazinone derivatives.
SG2011058278A SG173671A1 (en) 2009-02-23 2010-02-19 Heteroaryl substituted pyridazinone derivatives
KR1020117019449A KR101363091B1 (en) 2009-02-23 2010-02-19 Heteroaryl substituted pyridazinone derivatives
JP2011550576A JP5518902B2 (en) 2009-02-23 2010-02-19 Heteroaryl substituted pyridazinone derivatives
EP10711618.8A EP2398795B1 (en) 2009-02-23 2010-02-19 Heteroaryl substituted pyridazinone derivatives
IL213983A IL213983A (en) 2009-02-23 2011-07-07 Heteroaryl substituted pyridazinone derivatives, process for their preparation, pharmaceutical compositions comprising them and use thereof in the manufacture of medicaments

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP09153391 2009-02-23
EP09153391.9 2009-02-23

Publications (1)

Publication Number Publication Date
WO2010094762A1 true WO2010094762A1 (en) 2010-08-26

Family

ID=42312870

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2010/052116 Ceased WO2010094762A1 (en) 2009-02-23 2010-02-19 Heteroaryl substituted pyridazinone derivatives

Country Status (15)

Country Link
US (1) US9187455B2 (en)
EP (1) EP2398795B1 (en)
JP (1) JP5518902B2 (en)
KR (1) KR101363091B1 (en)
CN (1) CN102325766B (en)
AR (1) AR075534A1 (en)
AU (1) AU2010215428B2 (en)
BR (1) BRPI1008007A2 (en)
CA (1) CA2749867C (en)
ES (1) ES2526251T3 (en)
IL (1) IL213983A (en)
MX (1) MX2011008360A (en)
SG (1) SG173671A1 (en)
TW (1) TW201033193A (en)
WO (1) WO2010094762A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012020780A1 (en) * 2010-08-10 2012-02-16 武田薬品工業株式会社 Heterocyclic compound and use thereof
WO2012112946A1 (en) 2011-02-18 2012-08-23 Allergan, Inc. Substituted 6,7-dialkoxy-3-isoquinolinol derivatives as inhibitors of phosphodiesterase 10 (pde10a)
WO2014071044A1 (en) 2012-11-01 2014-05-08 Allergan, Inc. Substituted 6,7-dialkoxy-3-isoquinoline derivatives as inhibitors of phosphodiesterase 10 (pde10a)
US9200016B2 (en) 2013-12-05 2015-12-01 Allergan, Inc. Substituted 6, 7-dialkoxy-3-isoquinoline derivatives as inhibitors of phosphodiesterase 10 (PDE 10A)
US10174004B2 (en) 2013-02-21 2019-01-08 Takeda Pharmaceutical Company Limited Production method of pyridazinone compounds

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MY170610A (en) 2009-02-05 2019-08-20 Takeda Pharmaceuticals Co Pyridazinone compounds
KR20160063366A (en) * 2013-10-21 2016-06-03 메르크 파텐트 게엠베하 Heteroaryl compounds as btk inhibitorsand uses thereof
CN103772352B (en) * 2014-01-16 2017-01-18 四川百利药业有限责任公司 Pyridazinone derivatives and preparation method and application thereof
EP3886854A4 (en) 2018-11-30 2022-07-06 Nuvation Bio Inc. PYRROLE AND PYRAZOLE COMPOUNDS AND METHODS OF USE THEREOF
KR102718721B1 (en) 2021-12-14 2024-10-18 안희철 Wireless tag apparatus

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005012485A2 (en) 2003-07-31 2005-02-10 Bayer Pharmaceuticals Corporation Methods for treating diabetes and related disorders using pde10a inhibitors
WO2007129183A2 (en) * 2006-05-02 2007-11-15 Pfizer Products Inc. Bicyclic heteroaryl compounds as pde10 inhibitors

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6967254B2 (en) * 2002-09-09 2005-11-22 Amgen Inc. Substituted heterocyclic compounds and methods of use
CA2500225C (en) 2002-09-25 2011-01-18 Ube Industries, Ltd. Pyrazole compounds
BRPI0907122B8 (en) * 2008-01-11 2021-05-25 Albany Molecular Res Inc substituted pyridoindoles (1-azinone) compounds, pharmaceutical composition comprising said compounds, and uses thereof
KR101371881B1 (en) 2008-12-04 2014-03-07 에프. 호프만-라 로슈 아게 Pyridazinone derivatives

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005012485A2 (en) 2003-07-31 2005-02-10 Bayer Pharmaceuticals Corporation Methods for treating diabetes and related disorders using pde10a inhibitors
WO2007129183A2 (en) * 2006-05-02 2007-11-15 Pfizer Products Inc. Bicyclic heteroaryl compounds as pde10 inhibitors

Non-Patent Citations (22)

* Cited by examiner, † Cited by third party
Title
BEAVO, J., PHYSIOL. REV., vol. 75, 1995, pages 725 - 748
CONTI, M.; JIN, S.L., PROG. NUCLEIC ACID RES. MOL. BIOL., vol. 63, 1999, pages 1 - 38
COSKRAN T.M ET AL., J. HISTOCHEM. CYTOCHEM., vol. 54, no. 11, 2006, pages 1205 - 1213
FAWCETT, L. ET AL., PROCNATL ACAD SCI USA, vol. 97, no. 7, 2000, pages 3702 - 3707
FUJISHIGE K. ET AL., EUR J BIOCHEM, vol. 266, no. 3, 1999, pages 1118 - 1127
FUJISHIGE, K. ET AL., EUR. J. BIOCHEM., vol. 266, 1999, pages 1118 - 1127
FUJISHIGE, K. ET AL., J. BIOL. CHEM., vol. 274, 1999, pages 18438 - 18445
GRAYBIEL, A.M., CURR. BIOL. 2000, vol. 10, 2000, pages R509 - R511
JAVITT DC ET AL., BIOL. PSYCHIATRY, vol. 45, 1999, pages 668 - 679
LEWIS DA; LIEBERMAN JA, NEURON, vol. 28, 2000, pages 325 - 33
LOUGHNEY K. ET AL., GENE, vol. 234, no. 1, 1999, pages 109 - 117
MANALLACK, D.T. ET AL., J. MED.CHEM., vol. 48, no. 10, 2005, pages 3449 - 3462
NAKAZATO A; OKUYAMA S ET AL., EXP. OPIN. THER. PATENTS, vol. 10, no. 1, 2000, pages 75 - 98
RODEFER, J,S. ET AL., EUR. J. NEUROSCIENCE, vol. 2, 2005, pages 1070 - 1076
SANO, H., J. NEUROCHEM, vol. 105, 2008, pages 546 - 556
SEEGER, T.F. ET AL., BRAIN RES., vol. 985, 2003, pages 113 - 126
SHARMA T., BRJ PSYCHIATRY, vol. 174, no. 28, 1999, pages 44 - 51
SIUCIAK, J.A. ET AL., NEUROPHARMACOLOGY, vol. 51, no. 2, 2006, pages 374 - 385
SIUCIAK, J.A. ET AL., NEUROPHARMACOLOGY, vol. 51, no. 2, 2006, pages 386 - 396
SODERLING S.H. ET AL., PROCNATL ACAD SCI USA, vol. 96, no. 12, 1999, pages 7071 - 7076
SODERLING, S.H.; BEAVO, J.A., CURR. OPIN. CELL BIOL., vol. 12, 2000, pages 174 - 179
VANDENBERG RJ; AUBREY KR, EXP. OPIN. THER. TARGETS, vol. 5, no. 4, 2001, pages 507 - 518

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012020780A1 (en) * 2010-08-10 2012-02-16 武田薬品工業株式会社 Heterocyclic compound and use thereof
US9150588B2 (en) 2010-08-10 2015-10-06 Takeda Pharmaceutical Company Limited Substituted pyridazin-4(1H)-ones as phosphodiesterase 10A inhibitors
WO2012112946A1 (en) 2011-02-18 2012-08-23 Allergan, Inc. Substituted 6,7-dialkoxy-3-isoquinolinol derivatives as inhibitors of phosphodiesterase 10 (pde10a)
US8772316B2 (en) 2011-02-18 2014-07-08 Allergan, Inc. Substituted 6,7-dialkoxy-3-isoquinolinol derivatives as inhibitors of phosphodiesterase 10 (PDE10A)
US9670181B2 (en) 2011-02-18 2017-06-06 Allergan, Inc. Substituted 6,7-dialkoxy-3-isoquinolinol derivatives as inhibitors of phosphodiesterase 10 (PDE 10A)
WO2014071044A1 (en) 2012-11-01 2014-05-08 Allergan, Inc. Substituted 6,7-dialkoxy-3-isoquinoline derivatives as inhibitors of phosphodiesterase 10 (pde10a)
US10174004B2 (en) 2013-02-21 2019-01-08 Takeda Pharmaceutical Company Limited Production method of pyridazinone compounds
US9200016B2 (en) 2013-12-05 2015-12-01 Allergan, Inc. Substituted 6, 7-dialkoxy-3-isoquinoline derivatives as inhibitors of phosphodiesterase 10 (PDE 10A)
US9902710B2 (en) 2013-12-05 2018-02-27 Exonhit Therapeutics, Sa Substituted 6, 7-dialkoxy-3-isoquinoline derivatives as inhibitors of phosphodiesterase 10 (PDE 10A)

Also Published As

Publication number Publication date
ES2526251T3 (en) 2015-01-08
TW201033193A (en) 2010-09-16
US20100216793A1 (en) 2010-08-26
IL213983A (en) 2016-07-31
KR20110111495A (en) 2011-10-11
CA2749867C (en) 2017-06-06
US9187455B2 (en) 2015-11-17
JP2012518619A (en) 2012-08-16
CA2749867A1 (en) 2010-08-26
MX2011008360A (en) 2011-08-24
EP2398795A1 (en) 2011-12-28
BRPI1008007A2 (en) 2016-03-15
AU2010215428A1 (en) 2011-08-11
CN102325766B (en) 2015-03-18
SG173671A1 (en) 2011-09-29
IL213983A0 (en) 2011-08-31
JP5518902B2 (en) 2014-06-11
AR075534A1 (en) 2011-04-06
KR101363091B1 (en) 2014-02-13
AU2010215428B2 (en) 2016-06-23
EP2398795B1 (en) 2014-10-15
CN102325766A (en) 2012-01-18

Similar Documents

Publication Publication Date Title
EP2373641B1 (en) Pyridazinone derivatives
EP2398795B1 (en) Heteroaryl substituted pyridazinone derivatives
US8470820B2 (en) Nitrogen-containing heteroaryl derivatives
EP2480546B1 (en) Imidazopyridine or imidazopyrimidine derivatives as phosphodiesterase 10A inhibitors
NO340476B1 (en) Heteroaromatic quinoline compounds, and their use as inhibitors of PDE10
CA2868240A1 (en) Triazolo compounds as pde10 inhibitors
EP2604597A1 (en) Heterocyclic compound and use thereof
AU2010299927B2 (en) Imidazopyridine or imidazopyrimidine derivatives as phosphodiesterase 10A inhibitors
US20090075988A1 (en) Cyanoisoquinoline

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080008620.X

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10711618

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2010711618

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2749867

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2010215428

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: MX/A/2011/008360

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2010215428

Country of ref document: AU

Date of ref document: 20100219

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 5980/CHENP/2011

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 20117019449

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2011550576

Country of ref document: JP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: PI1008007

Country of ref document: BR

ENP Entry into the national phase

Ref document number: PI1008007

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20110823