WO2010092057A1 - Cold-active beta-galactosidase, a method of producing same and use of such enzyme - Google Patents

Cold-active beta-galactosidase, a method of producing same and use of such enzyme Download PDF

Info

Publication number
WO2010092057A1
WO2010092057A1 PCT/EP2010/051596 EP2010051596W WO2010092057A1 WO 2010092057 A1 WO2010092057 A1 WO 2010092057A1 EP 2010051596 W EP2010051596 W EP 2010051596W WO 2010092057 A1 WO2010092057 A1 WO 2010092057A1
Authority
WO
WIPO (PCT)
Prior art keywords
beta
galactosidase
lactose
enzyme
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2010/051596
Other languages
French (fr)
Inventor
Peter Stougaard
Mariane Schmidt
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Københavns Universitet
Original Assignee
Københavns Universitet
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Københavns Universitet filed Critical Københavns Universitet
Priority to CA2751957A priority Critical patent/CA2751957C/en
Priority to US13/148,853 priority patent/US8288143B2/en
Priority to EP10703071.0A priority patent/EP2396403B8/en
Priority to DK10703071.0T priority patent/DK2396403T3/en
Priority to CN201080012589.7A priority patent/CN102361974B/en
Publication of WO2010092057A1 publication Critical patent/WO2010092057A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23CDAIRY PRODUCTS, e.g. MILK, BUTTER OR CHEESE; MILK OR CHEESE SUBSTITUTES; PREPARATION THEREOF
    • A23C9/00Milk preparations; Milk powder or milk powder preparations
    • A23C9/12Fermented milk preparations; Treatment using microorganisms or enzymes
    • A23C9/1203Addition of, or treatment with, enzymes or microorganisms other than lactobacteriaceae
    • A23C9/1206Lactose hydrolysing enzymes, e.g. lactase, beta-galactosidase
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23CDAIRY PRODUCTS, e.g. MILK, BUTTER OR CHEESE; MILK OR CHEESE SUBSTITUTES; PREPARATION THEREOF
    • A23C19/00Cheese; Cheese preparations; Making thereof
    • A23C19/02Making cheese curd
    • A23C19/032Making cheese curd characterised by the use of specific microorganisms, or enzymes of microbial origin
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23CDAIRY PRODUCTS, e.g. MILK, BUTTER OR CHEESE; MILK OR CHEESE SUBSTITUTES; PREPARATION THEREOF
    • A23C9/00Milk preparations; Milk powder or milk powder preparations
    • A23C9/12Fermented milk preparations; Treatment using microorganisms or enzymes
    • A23C9/123Fermented milk preparations; Treatment using microorganisms or enzymes using only microorganisms of the genus lactobacteriaceae; Yoghurt
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2468Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81)
    • C12N9/2471Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01023Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase

Definitions

  • the present invention relates to a novel cold-active beta- galactosidase enzyme specific for lactose.
  • the enzyme is thus useful in e.g. the food industry for catalyzing at low temperatures the hydrolysis of lactose disaccharide into its constituent monosaccharides, glucose and galactose.
  • the present invention further provides a method of producing the cold-active beta-galactosidase by recombinant DNA technology.
  • Beta-galactosidase (beta-D-galactoside galactohydrolase, EC 3.2.1.23) is an enzyme capable of hydrolyzing the disaccharide lactose to its monosaccharide constituents, D- glucose and D-galactose.
  • Beta-galactosidases are found in a large variety of organisms, like mammals, plants, fungi, yeasts, and bacteria. In Nature, beta-galactosidases hydrolyze lactose and other D-galactose-containing carbohydrates. In the industry, beta-galactosidases have been used primarily within the food industry.
  • Beta- galactosidase hydrolysis of lactose and lactose-containing dairy products are used throughout in the dairy industry in the preparation of lactose-free or low-lactose products, which may be consumed by humans suffering from lactose intolerance.
  • Hydrolysis of lactose by beta-galactosidases may also be used in applications where the removal of lactose is required, i.e. prevention of crystallisation of lactose in food and removal of D-galactose moieties in glycosylated proteins.
  • beta- galactosidases comprise hydrolysis of lactose into D- galactose and D-glucose with the subsequent modification of the monosaccharides to high value products, like the sweetener D-tagatose (J ⁇ rgensen et al . 2004) .
  • beta-galactosidases could be used to produce lactose-free and low-lactose dairy products for lactose intolerant humans.
  • lactose hydrolysis The major applications for lactose hydrolysis are listed below.
  • Fermented milk products In some cases, lactose hydrolysis in milk used for the manufacture of cheese and yoghurt can increase the rate of acid development and thus reduce processing time.
  • sweetened condensed milk, ice cream prevents crystallisation of lactose.
  • Whey for animal feed Lactose hydrolysis in whey enables more whey solids to be fed to pigs and cattle and also prevents crystallisation in whey concentrate.
  • Whey Lactose hydrolysed whey is concentrated to produce a syrup containing 70-75 per cent solids. This syrup provides a source of functional whey protein and sweet carbohydrate and is used as a food ingredient in ice cream, bakery and confectionery products.
  • the conventional approach in food processing is to carry out the hydrolysis of lactose at 40 0 C during approximately four hours .
  • milk or lactose solution as a raw material is a preferable nutrition source for bacteria.
  • the putrefaction owing to the saprophyte contamination during the treatment is a serious problem in the food production.
  • the fact is that the conventional beta- galactosidase is of limited use.
  • beta-galactosidases in practical use are active only at temperatures above 20-30 0 C, temperatures where food spoiling bacteria thrive at best.
  • thermophilic beta-galactosidases Attempts to use thermophilic beta-galactosidases have been used but the products have suffered from off flavours and reduced organoleptic properties due to the heat treatment, and the processes have demanded high energetic costs.
  • a number of cold-active beta-galactosidases have been described from Arthrobacter (Coker, et al . 2003; Karasova- Lipovova, et al . 2003; Nakagawa et al . 2003; Nakagawa et al . 2006), from Carnobacterium piscicola (Coombs and Brenchley, 1999) and from Pseudoalteromonas (Cieslinski, et al. 2005; Fernandes, et al . 2002; Hoyoux, et al . 2001; Turkiewicz, et al . 2003) . Furthermore, Nakagawa et al .
  • beta-galactosidase from the yeast Guehomyces pullulans had approximately 17% at 0 0 C (Nakagawa et al . 2005)
  • the beta-galactosidases from Carnobacterium piscicola BA showed approximately 24% activity at 10 0 C (Coombs and Brenchley, 1999)
  • the enzymes from Pseudoalteromonas isolates showed 39% activity (Fernandes et al .
  • the cold-active beta-galactosidase from the Antarctic Arthrobacter was produced in low amounts in native cells and attempts to produce the enzyme recombinantly in E. coli were unsuccessful since about 90% of the enzyme was located in insoluble inclusion bodies (Coker et al . 2003) .
  • the cold-active beta-galactosidase from A. psychrolactophilus F2 could be produced heterologously, but had lower activity than the other Arthrobacter beta-galactosidases (Nakagawa et al . 2006) .
  • the present invention has, by using recombinant DNA technology, for the first time made it possible to provide a cold-active beta-galactosidase with high specific activity in industrially appropriate quantities for the manufacturing of food products and pharmaceuticals.
  • the present invention provides a purified cold-active beta-galactosidase, specific for lactose, having a stable enzymatic activity at temperatures less than 8 0 C, and specifically at 4 0 C, which corresponds to refrigerating conservation temperature for dairy products.
  • the enzyme of the present invention is consequently able to hydrolyse lactose in dairy products and milk processing at such a low temperature that saprophytes are hindered to proliferate.
  • the hydrolysis of lactose can be carried out in these refrigeration conditions with no need of a particular treatment to the dairy product concerned.
  • the present invention provides a cold active beta-galactosidase having the sequence as defined in SEQ ID NO. 1, or one having at least 80% homology to the amino acid sequence as defined in SEQ ID NO. 1, the amino acid sequence being selected so that the enzyme has a stable enzymatic activity at temperatures less than 8 0 C.
  • the amino acid sequence has at least 90%, and more preferably 95%, homology to the amino acid sequence as defined in SEQ ID NO. 1.
  • a DNA sequence which a) encodes a protein with an amino acid sequence as given in SEQ ID NO. 1, or b) hybridises under stringent or very stringent conditions to the sequence of a) , or c) is degenerative of the sequence of a) or b)
  • the DNA sequence is derived from the genus Alkalilactibacillus, such as the species
  • Alkalilactibacillus ikkense has a nucleotide sequence as given in SEQ ID NO. 2.
  • the present invention provides a recombinant vector comprising a DNA sequence that encodes a protein with an amino acid sequence as given in SEQ ID NO. 1, or one having at least 80% homology to the amino acid sequence as defined in SEQ ID NO. 1, the amino acid sequence being selected so that the enzyme has a stable enzymatic activity at temperatures less than 8 0 C.
  • the amino acid sequence has at least 90%, and more preferably 95%, homology to the amino acid sequence as defined in SEQ ID NO. 1.
  • Another object of the present invention is a strain of an isolated Alkalilactibacillus bacterium capable of producing a cold-active beta-galactosidase according to the present invention.
  • a preferable strain is Alkalilactibacillus ikkense deposited on the 3rd of March, 2009, under the Budapest Treaty at the BCCM/LMG-Collection (Belgian Coordinated Collections of Microorganisms) with the Accession No LMG P-24866 and variants and mutants derived therefrom.
  • beta-galactosidase To purify the cold-active beta-galactosidase according to the present invention, a bacterium living in the Greenland area was isolated and characterised in order to study how its enzymes, and particularly, the beta-galactosidase was adapted to cold. These studies led to the purification of the beta-galactosidase, meaning that this protein was obtained substantially free of other proteins using protein purification steps known in the art.
  • another object of the present invention is a strain of an isolated Alkalilactibacillus bacterium capable of producing a cold-active beta-galactosidase according to the present invention.
  • a preferable strain is alkalilactibacillus ikkense.
  • Another object of the invention is a recombinant plasmid or vector suited for transformation of a host, capable of directing the expression of a DNA sequence according to the invention in such a manner that the host expresses the cold-active beta-galactosidase of the present invention in recoverable form.
  • another object is the so transformed host.
  • a variety of host-expression systems may be conceived to express the cold-active beta-galactosidase coding sequence, for example bacteria, yeast, insect cells, plant cells, mammalian cells, etc. Particularly, in yeast and in bacteria, a number of vectors containing constitutive or inducible promoters may be used. It is also an object of the present invention to provide a process for purifying the cold-active beta-galactosidase according to the present invention from a bacterium as well as to provide a process for producing cold-active beta- galactosidase according to the invention in a transformed host .
  • the invention pertains to a method of producing a polypeptide having cold-active beta- galactosidase activity, comprising isolating a DNA fragment encoding the polypeptide, inserting said DNA fragment into an appropriate host organism, cultivating the host organism under conditions, which lead to expression of the a polypeptide with cold-active beta-galactosidase activity and recovering said polypeptide from the cultivation medium or the host organism.
  • An appropriate host organism is preferably selected from the group consisting of Escherichia, Bacillus,
  • the invention relates to a recombinant DNA molecule comprising a DNA fragment encoding a polypeptide having cold-active beta-galactosidase activity and to a microbial cell comprising such recombinant DNA molecule .
  • the invention pertains to the use of the above polypeptide with cold-active beta-galactosidase activity or a microbial cell expressing such polypeptide in the manufacturing of a food product or a pharmaceutical product .
  • a method for reducing the lactose content of a food product comprising adding to the food product an amount of the polypeptide or the microbial cell as disclosed herein, which is sufficient to remove at least part of the lactose present in said food product .
  • the invention pertains to the inactivation of the beta-galactosidase activity of the polypeptide by a moderate increase of the temperature.
  • a method using the polypeptide harbouring a cold-active beta- galactosidase activity or a microbial cell according to the invention in the hydrolysis of lactose whereby the polypeptide and/or the microbial cell is applied to a reactor containing lactose, which is hydrolyzed under low- temperature conditions.
  • Figure 2 shows temperature dependence of native Ikka-beta- galactosidase .
  • Y-axis is the relative activity in percent of the maximal activity.
  • X-axis is the incubation temperature .
  • Figure 3 shows temperature stability of native Ikka-beta- galactosidase .
  • Y-axis is the residual activity left after incubation at the time indicated on the X-axis.
  • ⁇ , •, A, ⁇ , 0, o indicate incubation temperatures at 0, 10, 20, 30, 40, and 50 0 C, respectively.
  • Figure 4 discloses pH dependence of native Ikka-beta- galactosidase .
  • Y-axis is the relative activity in percent of the maximal activity.
  • X-axis is pH in the beta- galactosidase assay.
  • Figure 5 shows SDS-PAGE of extracts from native A. ikkense cells induced with 1 mM IPTG (lanes 2 and 3) and from uninduced, native A. ikkense (lanes 4 and 5) .
  • Arrows in lanes 2 and 3 indicate the 120 kDa beta-galactosidase band.
  • Lane 1 is molecular weight marker.
  • the marker at 120 kDa is beta-galactosidase from E. coli.
  • Figure 6 shows SDS-PAGE of three extract dilutions from recombinant E. coli cells expressing Ikka-beta- galactosidase (lanes 4, 5, and 6) .
  • enzyme extract dilutions with beta-galactosidase from Kluyveromyces lactis (lanes 7, 8, and 9) and a molecular weight marker with native E. coli beta-galactosidase (marker at 120 kDa) were co-electrophoresed with the recombinant Ikka-beta-galactosidase .
  • Arrows show the position of the 120 kDa beta-galactosidase bands
  • Figure 7 discloses temperature dependence of recombinant Ikka-beta-galactosidase produced in E. coli.
  • Y-axis is the relative activity in percent of the maximal activity.
  • X- axis is the incubation temperature.
  • indicate recombinant Ikka-beta-galactosidase;
  • o indicate Kluyveromyces lactis beta-galactosidase.
  • Figure 8 shows specific activity of recombinant Ikka-beta- galactosidase produced in E. coli.
  • Y-axis is specific activity in nmoles ONP released/hour/mg enzyme.
  • X-axis is temperature in 0 C.
  • is recombinant Ikka-beta- galactosidase, o is Kluyveromyces lactis beta- galactosidase .
  • Figure 9 discloses thermal stability of recombinant Ikka- beta-galactosidase enzyme. An equal amount of enzyme was incubated at the temperature indicated and samples were withdrawn at different time intervals. Y-axis is absorbancy at wavelength 415 nm. X-axis is time in minutes.
  • Figure 10 also discloses thermal stability of recombinant Ikka-beta-galactosidase enzyme, while the X-axis is time in hours .
  • Figure 11 shows pH dependence of recombinant Ikka-beta- galactosidase.
  • Y-axis is absorbancy measured at wevelength 415.
  • X-axis is pH in the beta-galactosidase assay.
  • Figure 12 shows hydrolysis of lactose by recombinant Ikka- beta-galactosidase produced in E.coli.
  • the reaction mixture contained lactose in three concentrations, 1.25 mg/ml, 2.5 mg/ml and 5 mg/ml. Samples were withdrawn after incubation for 15, 150, and 1440 minutes.
  • the reactions were incubated at 5 0 C (A) or 20 0 C (B) and analysed by thin layer chromatography (TLC) .
  • TCL plates were sprayed with an orcinol reagent, and hydrolysis of lactose was estimated by the disappearance of the lactose spots on TLC plates and the concomitant appearance of glucose and galactose
  • Figure 13 shows SDS polyacrylamide gel electrophoresis of crude extract of E. coli cells expressing A. ikkense beta- galactosidase, Lane 1.
  • the beta-galactosidase in the crude extract was further purified on ion exchange chromatography, Lane 2, or on affinity chromatography, Lane 3.
  • the arrow indicates the position of the E. coli 120 kDa beta- galactosidase band. Numbers to the left indicate the position of protein bands in the PageRulerTM Plus Prestained Protein Ladder (Fermentas) .
  • Figure 14 shows temperature dependence (A) and pH dependence (B) of the purified, recombinant A. ikkense beta-galactosidase and of a crude extract containing recombinant enzyme.
  • Y-axis is the relative activity in percent of maximal activity.
  • X-axis is the incubation temperature (A) or pH (B) .
  • the relative activity of the purified, recombinant enzyme with ONPG as substrate is illustrated by black squares. Assays were performed in triplicates, and standard error was below 0.05.
  • Figure 15 shows thermal stability of the purified, recombinant A. ikkense beta-galactosidase enzyme. An equal amount of enzyme was incubated at the temperatures indicated and samples were withdrawn at different time intervals.
  • Y-axis is the residual activity in percent of maximal activity. Enzyme samples were incubated at temperatures from 0 0 C to 60 0 C and at the time points indicated (X-axis), samples were withdrawn and assayed for active beta-galactosidase at 20 0 C. Assays were performed in triplicates, and standard error was below 0.05.
  • Figure 16 shows benchmarking the A. ikkense beta- galactosidase (black squares) with commercially available Lactozyme® 3 3000L from K. lactis (open circles) .
  • An equal amount of enzyme (2 mg/ml) was incubated with ONPG as substrate at temperatures from 0 0 C to 20 0 C.
  • Samples were withdrawn at different time intervals and hydrolyzed ONP was measured at A420 nm. Hydrolysis efficiency was calculated as increase in A420 nm per min per microgram active enzyme. Assays were performed in triplicates, and standard error was below 0.05.
  • Figure 17 shows thin-layer chromatography (TLC) of the hydrolysis of lactose by the A. ikkense beta-galactosidase.
  • Lanes 4-6 samples incubated at 5 0 C for 2 ⁇ h (4: 1.25 mg/ml lactose, 5: 2.5 mg/ml lactose, 6: 5 mg/ml lactose) .
  • Lanes 7-9 samples incubated at 20 0 C for 2 ⁇ h (7: 1.25 mg/ml lactose, 8: 2.5 mg/ml lactose, 9: 5 mg/ml lactose) .
  • Lanes 1-3 Controls, 0.0125 ⁇ g of each of the carbohydrates 13 lactose (lane 1), galactose (lane 2) and glucose (lane 1)
  • Beta-galactosidase (beta-D-galactoside galactohydrolase, EC 3.2.1.23) is defined as an enzyme capable of hydrolysing lactose to the monosaccharides D-glucose and D-galactose.
  • Cold-active is defined as having activity at temperatures at 15 0 C and below, preferably at 10 0 C and below and most preferably at 5 0 C and below.
  • a "host cell” is selected from a group of microorganisms comprising fungi, yeasts, and prokaryotes.
  • the microorganism is more preferably a prokaryote and most preferably a bacterium.
  • Conditions of incubating beta-galactosidase with lactose are defined by performing incubation at a temperature between 0 0 C and 20 0 C, preferably between 5 0 C and 15 0 C.
  • stringent condition refers to a condition such that a hybridization is conducted in a solution containing 6xSSC (2OxSSC represents 333 mM Sodium citrate, 333 mM NaCl), 0.5% SDS and 50% formamide at 42 0 C, and then the hybridized products are washed in a solution of 0. IxSSC, 0.5% SDS at 68°C, or to conditions as described in Nakayama, et al . , Bio-Jikken-Illustrated, vol. 2, "Idenshi- Kaiseki-No-Kiso (A Basis for Gene Analysis)", pp. 148-151, Shujunsha, 1995.
  • 6xSSC represents 333 mM Sodium citrate, 333 mM NaCl
  • SDS 50% formamide
  • Ikaite material was collected by scuba divers in the Ikka Fjord, South West Greenland (61°11'N, 48°01'W) from a depth of approximately six to ten meters.
  • the columns were between 36-70 cm in length and between 5 and 30 cm in diameter. The columns were kept cold during transportation to the field laboratory.
  • DNA for phylogenetic analysis was extracted from cells of isolate 517 using FastDNA SPIN Kit for Soil as described by the manufacturer (BIO 101, Irvine, CA) . 16S rRNA gene amplification was carried out using the primers 27F and
  • the closest related 16S rRNA gene sequences were aligned using the Clustal W multiple alignment program MegAlign 5.03 (DNASTAR, Inc., Madison, WI) .
  • the Clustal W analysis showed that the closest relatives were Natronobacillus azotifigens (accession no. EU850815) (Sorokm et al . 2008), Paraliobacillus ryukyuensis (accession no. AB087828) (Ishikawa et al . 2002), Halolactibacillus halophilus (accession no. AB196783) (Ishikawa et al . 2005), Halolactibacillus miurensis (accession no.
  • Isolate 517 was most closely related to N. azotifigens, P. ryukyuensis and A. tropicus with 95, 9%, 94.4% and 93.9% sequence similarity, respectively.
  • sequence similarity between isolate 517 and both H. halophilus, H. miurensis, and G. halotolerans was 93.4%.
  • DNA-DNA hybridization and DNA base composition were carried out at DSMZ (Braunschweig, Germany) .
  • DNA was isolated using a French pressure cell (Thermo Spectronic) and was purified by chromatography on hydroxyapatite as described by Cashion et al . (1977) .
  • DNA- DNA hybridization was carried out as described by De Ley et al . (1970) under consideration of the modifications described by Huss et al . (1983) using a model Cary 100 Bio UV/VIS-spectrophotometer equipped with a Peltier- thermostatted 6x6 multicell changer and a temperature controller with in-situ temperature probe (Varian) .
  • azotifigens is 36.1-38.5 mol% (Sorokin et al . 2008), H. halophilus and H. miurensis is reported to be 38.5-40.7 mol% (Ishikawa et al . 2005), for P. ryukyuensis it is 35.6 mol% (Ishikawa et al . 2002), and for G. halotolerans it is reported to be 38 mol% (Wain ⁇ et al . 1999) .
  • isolate 517 represent a new species within a new genus, since the threshold value for DNA-DNA hybridization to separate two species is 70 % (Wayne et al . , 1987) .
  • isolate 517 represents a new genus Alkalilactibacillus gen. nov. comprising the species Alkalilactibacillus ikkense sp . nov.
  • Beta-galactosidase activity was assayed by hydrolysis of o- nitrophenyl-beta-D-galactopyranoside (ONPG) and measuring the absorbancy of the released o-nitrophenyl (ONP) compound in a spectrophotometer at 415 nm.
  • ONPG o- nitrophenyl-beta-D-galactopyranoside
  • ONP o-nitrophenyl
  • the reactions were stopped by adding 300 ⁇ l 0.6 M Na 2 CO 3 .
  • Assays were performed at 0, 5, 10, 20, 30, 40, 50, and 60 0 C for 30 minutes.
  • the sodium phosphate buffers were pre-heated to the respective temperatures prior to assay start.
  • the pH activity profile was studied using a mixed pH buffer (250 mM Tris, 250 mM MES, 250 mM acetic acid) adjusted from pH 4 to pH 10 with HCl or NaOH. The samples were incubated at 20 0 C for 1 hour and assayed as described above.
  • a mixed pH buffer 250 mM Tris, 250 mM MES, 250 mM acetic acid
  • Alkalilactibacillus ikkense cells were cultivated in liquid R2 medium supplemented with lactose and IPTG at 15 0 C for 3 days on a rotary shaker. Cells were harvested by centrifugation in a Sigma® 3-18M centrifuge at 4,700 rpm and the pellet was resuspended in 2 ml of 0.1 M NaH 2 PO 4 ZNa 2 HPO 4 , pH 7. Cells were lysed by bead beating in a FastPrep FP120 instrument (BiolOl/Savant) for 3 times 25 sec at speed 5.5. The supernatant was then removed from the glass beads and centrifuged for 15 min at 10,000*g at 4 0 C. The cell free supernatant was then used for assaying. 3.3 Characterization of temperature optimum of native Ikka- beta-galactosidase.
  • the native Ikka-beta-galactosidase displayed maximal activity at 20 0 C, 40% of the maximal activity was obtained at 0 °C, and more than 60% of the maximal activity was observed at 10 0 C (Fig. 2) . Above 30 0 C the enzyme was only moderately active and virtually no activity was observed at 60 0 C.
  • Ikka-beta-galactosidase rapidly lost activity (Fig. 3) .
  • the inactivation at high temperatures was shown to be irreversible .
  • Fig. 4 shows that maximal activity of the native Ikka-beta-galactosidase was observed at pH 7, and that the enzyme displayed approximately 70% of the maximal activity at pH 6 and at pH 8. At pH 9, approximately 25% of maximal activity was observed. The enzyme showed no activity at pH 5 and below or at pH 10 and above (Fig. 4) .
  • Extracts from cells of A. ikkense induced with 1 mM IPTG and uninduced were analysed in SDS-PAGE (sodium dodecyl sulfate - polyacrylamide gel electrophoresis) (Fig. 5) .
  • Intracellular extracts were prepared by lysing the cells using bead-beating as described above in 3.2. The extracts (0.5-5 ⁇ l) were mixed with 12.5 ⁇ l 4*LDS sample buffer, 5 ⁇ l 10*DTT and 0.1 M NaH 2 PO 4 ZNa 2 HPO 4 to a final volume of 50 ⁇ l . The samples were heated to 70 0 C for 10 minutes and 30 ⁇ l was loaded onto a 4-12% SDS gel.
  • Fig. 5 shows that a strong 120 kDa band was observed in the lanes with extracts from A. ikkense cells induced with IPTG and that this band was missing in lanes with extracts from non-induced cells. Thus, the 120 kDa band was assumed to be the native Ikka- beta-galactosidase .
  • DNA from A. ikkense was isolated from a culture of 50 ml. The cells were harvested by centrifugation and the chromosomal DNA was isolated using conventional phenol- chloroform extraction methods (Maniatis et al . , 1982) . The DNA was partially digested using Sau3AI (New England Biolabs, MA, USA), and fragments with the lengths between 3 kb and 10 kb were purified from an agarose gel using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) as described by the producer.
  • Sau3AI New England Biolabs, MA, USA
  • the vector for cloning chromosomal DNA from A. ikkense was a modified pUC18 plasmid (Stratagene, CA, USA) . Plasmid pUCl ⁇ was restricted by Ndel and Hindi I I endonucleases (New England Biolabs) . The sticky ends were refilled using Klenow fragment of DNA polymerase (New England Biolabs) and the blunt ends were ligated using T4 DNA ligase (New England Biolabs) .
  • plasmid pUCl ⁇ dlacZ was not able to mediate ⁇ -complementation when introduced into E. coli cells harbouring the beta-galactosidase ⁇ Z15 mutation.
  • Sau3AI restricted and gel-purified chromosomal DNA from A. ikkense was ligated into plasmid pUCl ⁇ dlacZ treated with the restriction endonuclease BamHI and Antarctic Phosphatase (New England Biolabs) .
  • the ligation mixture was transformed into chemically competent E. coli TOPlO cells.
  • Transformed cells were plated onto LB agar (10 g/1 Bacto tryptone, 5 g/1 yeast extract, 10 g/1 NaCl) containing 20 ⁇ g/ml X-gal, 0.1 mM IPTG, and 100 ⁇ g/ml ampicillin and incubated over night at 37 0 C.
  • the insert in the plasmid was sequenced at GATC Biotech AG (Konstanz, Germany) using primer walking with the primer M13 reverse and custom made primers specific for the insert in pUCIkka-bgal (SEQ ID 3: 5'CCGTCATCCATATCACCa'; SEQ ID 4: ⁇ 'CCTTTGCCCAAGAGCCAACCS'; SEQ ID 5: 5' GCTATTATCAGACTTGGCACC3' ; SEQ ID 6: 5'GTAATTCAAT GTTCCAACGTG3' ; Seq ID 7: 5'CGCTTATGGTGTGAAGa') and a sequence just downstream of the multiple cloning site in pUCl ⁇ dlacZ, (SEQ ID 8: 5'GGGCTGGCTTAACTATGCGGa') .
  • SEQ ID 8 5'GGGCTGGCTTAACTATGCGGa'
  • Native Alkalilactibacillus ikkense was shown to produce only moderate amounts of Ikka-beta-galactosidase. Therefore, in order to produce larger amounts of the beta- galactosidase, subcloning of the Ikka-beta-galactosidase gene into expression plasmids was carried out.
  • the Ikka-beta-galactosidase gene was subcloned further using chromosomal DNA from A. ikkense as template and the
  • the 3.9 kb DNA fragment was purified from the gel using the QIAquick Gel Extraction Kit as described by the producer.
  • the purified DNA fragment was ligated into plasmid pUCl ⁇ dlacZ similar restricted with the enzymes EcoRI and Hindi I I and gel purified as described above.
  • the ligation mixture was transformed into E. coli TOPlO cells and recombinant cells harbouring the plasmid pUCl ⁇ dlacZ with the Ikka-beta-galactosidase gene were selected as blue colonies on LA plates containing 100 ⁇ g/ml ampicillin, 1 mM IPTG, and 40 ⁇ g/ml X-gal . Transformants were selected and analysed for plasmids and inserts.
  • Plasmid DNA was prepared from a 10 ml culture and the DNA was sent for sequencing at GATC biotech (Konstanz, Germany) using the primers described above in 4.1. The entire Ikka- beta-galactosidase gene was sequenced on both strands in order to ensure that no mutations were introduced during PCR.
  • E. coli TOPlO cells harbouring plasmid pUCIkka-bgal and pUCIkka-bgal exp were cultivated in 30 ml LB broth containing 100 ⁇ g/ml ampicillin over night at 37 0 C. After an over night incubation, the cells were supplemented with 0.1 mM IPTG and incubated at 20 0 C for further 20 hours. Cells were harvested by centrifugation for 30 min at 4,700 rpm at 10 0 C and resuspended in 1 ml 0.1 M NaH 2 PO 4 ZNa 2 HPO 4 , pH 7.
  • the cells were lysed by bead beating in a Fast Prep instrument (Fast Prep FP120, BiolOl/Savant Instruments Inc., Holbrook, NY) at speed 5.5 for 3 times 25 sek.
  • the samples were cooled on ice in between the beating/shaking.
  • the lysate was centrifuged at 10,000 g for 15 min at 4 0 C, and the supernatant containing the Ikka-beta-galactosidase enzyme was transferred to a clean tube. This crude extract was used for subsequent analyses.
  • Intracellular extracts from recombinant E. coli cells harbouring plasmid pUCIkka-bgal were analysed on SDS-PAGE (SDS gel 4-12%, PAGEgel, CA, USA) as described above in 3.4. Cultures induced with 1 mM IPTG and control cultures not induced were analysed.
  • Extracts from cultures of plasmid pUCIkka-bgal harbouring E. coli were prepared as described above and diluted before electrophoresis on SDS-PAGE.
  • Beta-galactosidases from E. coli (Sigma-Aldrich, MO, USA) and K. lactis (Novozymes, Bagsvaerd, Denmark) with known molecular mass and in defined concentrations were co-electrophorezed on the same gel for comparison (arrows in Fig. 6) .
  • the temperature optimum of recombinant Ikka-beta- galactosidase was determined as described above for the native enzyme using ONPG as a substrate. The temperature profile was determined at 0, 5, 10, 20, 30, 40, 50, and 60 °C for 30, 60 and 120 minutes for the recombinant Ikka- beta-galactosidase and, as controls, for the beta- galactosidases from E. coli and K. lactis. The optimal temperature for activity of the recombinant Ikka-beta- galactosidase was determined to be 20-30 0 C (Fig. 7) .
  • the Ikka-beta-galactosidase also showed high activity at low temperatures with more than 40% activity at 0 0 C, approximately 80% activity at 5 0 C and more than 90% at 10 0 C.
  • the specific activity of the Ikka-beta-galactosidase was almost twice as high at temperatures between 0 0 C and 30 0 C (Fig. 8) . Both enzymes showed close to zero activity at 40 0 C and above (Fig. 8) .
  • Figs. 9 and 10 show that the Ikka-beta-galactosidase showed high stability at 0 0 C and 5 0 C, at 10 0 C the enzyme was stable for approximately 100 hours and at temperatures above 20 0 C the Ikka-beta-galactosidase was rather unstable. Treatment at 40 0 C for 40 minutes resulted in complete inactivation . The inactivation of the Ikka-enzyme was irreversible.
  • the pH activity profile was studied using a mixed pH buffer (250 mM Tris, 250 mM MES, 250 mM acetic acid) adjusted from pH 4 to pH 10 with HCl or NaOH. The samples were incubated at 20 °C for 2 hours.
  • the optimal pH value for the Ikka- beta-galactosidase was shown to be approximately pH 7.0. At pH 6.0 the enzyme showed 60% of maximal activity and at pH 8.0 the Ikka-enzyme displayed 90% activity. At pH 9.0 15% activity was observed whereas no activity could be detected at pH 5.0 or below or at pH 10 and above. 5.3.3 pH dependence of recombinant Ikka-beta- galactosidase .
  • the substrate specificity of the Ikka-beta-galactosidase was determined in assays performed at pH 7.0 and 20 0 C for 20 minutes using nine different chromogenic substrates, o- nitrophenyl-beta-D-galactopyranoside, p-nitrophenyl-alpha- D-galactopyranoside, o-nitrophenyl-beta-D-glucopyranoside, p-nitrophenyl-beta-D-glucopyranoside, p-nitrophenyl-beta-D- arabinopyranoside, p-nitrophenyl-beta-D-cellobioside, p- nitrophenyl-beta-D-fucopyranoside, p-nitrophenyl-beta-D- lactopyranoside, and p-nitrophenyl-beta-D-mannopyranoside .
  • Beta-galactosidase was purified from crude extracts by ion exchange chromatography. Portions of two ml were subjected to chromatography on a 1 ml High Q cartridge on a BioLogic LP System (Bio-Rad) .
  • the column was washed with 10 ml of 50 mM phosphate buffer (pH 7) and eluted by a gradient from 0 to 1 M of NaCl in 50 mM phosphate buffer (pH 7) at a flow rate of 0.5 ml/min. Fractions of 1 ml were collected. Crude extracts were also subjected to affinity chromatography on a 2 ml column of agarose coupled with p-aminobenzyl-1-thio-beta-D- galactopyranoside (PABTG-agarose, Sigma) .
  • PBTG-agarose p-aminobenzyl-1-thio-beta-D- galactopyranoside
  • the column was washed with 10 ml of 50 mM phosphate buffer (pH 7) before it was eluted by 100 mM NaCl in 50 mM phosphate buffer (pH 7) at a flow rate of 0.5 ml/min. Fractions of 1 ml were collected.
  • the fractions were analysed for the presence of proteins using a BCA Protein Assay Kit (Pierce) , and beta- galactosidase was measured in o-nitrophenyl (ONP) -beta-D- galactopyranoside assays as described above.
  • Fractions containing beta-galactosidase activity were analysed by SDS polyacrylamide gel electrophoresis (4-20 %, PAGEgel, CA, USA) . Purified beta-galactosidase was used for subsequentstability and activity experiments.
  • Fig. 13 shows that the crude extract from E. coli contained recombinant beta-galactosidase with a monomeric molecular weight of approximately 115-120 kDa .
  • Ion exchange chromatography resulted in pure beta-galactosidase (Fig. 13, lane 2), whereas affinity chromatography (Fig. 13, lane 3) only resulted in partially purified recombinant enzyme.
  • pure beta-galactosidase from ion exchange was used, unless otherwise specified.
  • the molecular weight of the A. ikkense beta-galactosidase was determined to be approximately 115-120 kDa when analyzed on SDS-PAGE using known beta-galactosidases from E. coli and K. lactis as references. This result is in agreement with the calculated molecular weight as determined from the DNA sequence (119 kDa) .
  • the crude extract from E. coli was estimated to contain 10 mg/ml A. ikkense beta-galactosidase.
  • the specific activity, calculated on the basis of purified beta-galactosidase from ion exchange chromatography was 8.4 micromoles/min/mg protein at 20 0 C with ONPG as substrate (Table 1) .
  • a culture of 200 ml E. coli cells expressing recombinant A. ikkense beta-galactosidase was harvested resulting in a 280 mg wet weight cell pellet.
  • the cells were lyzed in a Fast Prep apparatus, and the extract was subjected to ion exchange chromatography.
  • One U is 1 micromole per min at 20 0 C with ONPG as substrate.
  • Extract of E. coli expressing recombinant A. ikkense beta- galactosidase was analyzed for beta-galactosidase activity.
  • the thermal stability of the purified, recombinant A. ikkense beta-galactosidase enzyme was tested as shown in Figure 15. An equal amount of enzyme was incubated at the temperatures indicated and samples were withdrawn at different time intervals. Y-axis is the residual activity in percent of maximal activity. Enzyme samples were incubated at temperatures from 0 0 C to 60 0 C and at the time points indicated (X-axis) , samples were withdrawn and assayed for active beta-galactosidase at 20 0 C. Assays were performed in triplicates, and standard error was below 0.05.
  • the enzyme displayed more than 60 % of the maximal activity, and at 10 0 C, more than 70 % of the maximal activity was observed both for purified recombinant enzyme.
  • Analysis of enzyme stability showed that purified, recombinant beta-galactosidase was 100% stable at 0 0 C to 20 0 C for at least 5 hours (Fig. 15), and that the residual activity after 5 days storage at 0 0 C to 20 0 C was 50-60 % (data not shown) .
  • the purified beta-galactosidase lost more than 80 % of its activity within 5 hours. Complete, irreversible inactivation was achieved within 5 minutes at 50 0 C and within 10 minutes at 40 0 C (Fig. 15) .
  • Y-axis is the relative activity in percent of maximal activity.
  • X-axis is the incubation temperature (A) or pH (B) .
  • the relative activity of the purified, recombinant enzyme with ONPG as substrate is illustrated by black squares. Assays were performed in triplicates, and standard error was below 0.05.
  • the recombinant A. ikkense beta-galactosidase was benchmarked with Lactozyme 3000® 13 from K. lactis. At temperatures between 0 0 C and 20 0 C the A. ikkense beta- galactosidase showed a twofold increase in conversion rate, when compared to the K. lactis-beta-galactosidase (Fig. 16); A. ikkense beta-galactosidase (black squares) compared with commercially available Lactozyme® 3000L from K. lactis (open circles) .
  • Lanes 7-9 samples incubated at 20 0 C for 2H h (7: 1.25 mg/ml lactose, 8: 2.5 mg/ml lactose, 9: 5 mg/ml lactose) .
  • Lanes 1-3 Controls, 0.0125 mg of each of the carbohydrates lactose (lane 1), galactose (lane 2) and glucose (lane 3) .
  • Ikka-beta-galactosidase Production of recombinant Ikka-beta-galactosidase in Bacillus subtilis .
  • the Ikka-beta-galactosidase was further subcloned in a Bacillus subtilis expression vector, pALlO (MoBiTech, GmbH) .
  • PCR was performed using chromosomal DNA from Alkalilactibacillus ikkense as template and the PCR primers Bs_pAL_bGal5 ' : 5 ' GGCCATGGATCCATGGCAAAAAAATTAAAAAAATTC3 ' (BamHI restriction site underlined) (SEQ ID NO 11) and
  • Bs_pAL_bGal3' 5 ' GGCCATCCCGGGTTATCTGTTTAAACTATTCAACATG3 ' (Xmal restriction site double underlined) (SEQ ID NO 12) .
  • PCR, subsequent isolation of the fragment encoding the Ikka-beta-galactosidase, ligation into pUCl ⁇ dLacZ and transformation of E. coli was as described above in 5.1.
  • Plasmid pUCl ⁇ dLacZ carrying the Ikka-beta-galactosidase gene was prepared and sequenced, before the plasmid DNA was restricted with restriction endonucleases BamHI and Xmal .
  • the 3.1 kb fragment encoding Ikka-beta-galactosidase was purified, inserted into plasmid pALlO similarly restricted with BamHI and Xmal, and transformed into E. coli as described in 5.1.
  • Recombinant E. coli harbouring pALlO containing the Ikka-beta-galactosidase gene was isolated on LB agar plates containing 100 ⁇ g/ml ampicillin.
  • Plasmid pAL10_Ikka-bGal was purified and transformed into B. subtilis cells using an electroporation protocol for B. subtilis from Eppendorf (Germany) (Protocol No. 4308 915.504 - 08/2003) .
  • Recombinant cells harbouring plasmid pALlO were selected on LB agar containing 5 ⁇ g/ml chloramphenicol .
  • Production of recombinant Ikka-beta-galactosidase in B. subtilis was carried out by growing B. subtilis pAL10_Ikka- bGal cells in LB containing 5 ⁇ g/ml of chloramphenicol at 37 0 C for 16 hours. Induction of Ikka-beta-galactosidase synthesis was carried out by changing the temperature to 20 0 C.
  • B. subtilis pAL10_Ikka-bGal cells were cultivated at 20 °C for another 5 hours after which, the cells were harvested, and intracellular enzyme was isolated by Fast Prep as described in 5.2.
  • ONPG assays showed the presence of a cold-active Ikka-beta- galactosidase with an activity similar to the native enzyme, to the recombinant enzyme in crude E. coli extracts, and to the pure enzyme produced in E. coli cells.
  • Sorokin I. D., Zadorina, E. V., Kravchenko, I. K., Boulygina, E. S., Tourova, T. P., and Sorokin, D. Y. (2008) Natronobacillus azotifigens gen. nov., sp . nov., an anaerobic diazotrophic haloalkalophile from soda-rich habitats. Extremophiles 12: 819-827.
  • GIy Tyr Pro GIu Trp Asn Asn Asn Pro GIu lie Phe GIn Leu Asn 40
  • Trp lie Asn GIy Asp Leu VaI GIy Tyr Ser GIu Asp Thr Phe Thr
  • CCCAGAGTGG AATAATAATC CGGAAATTTT TCAACTTAAT CGAAGAGAGG 100 CGCATGCAAC ATTGGTGCCA TATTCTAATT TGGAATTGGC ACTTAAAGGG 150
  • TTCAGCCATG CGATGGGCAA CTCGCTAGGA AACTTTTATA AGTATACCGA 1700 GCTATTTGAT CAATATCCGA TCTTACAAGG AGGCTTCATT TGGGATTGGA 1750
  • MOLECULE TYPE synthetic DNA
  • xi SEQUENCE DESCRIPTION SEQ ID NO: 4 CCTTTGCCCA AGAGCCAACC
  • MOLECULE TYPE synthetic DNA
  • xi SEQUENCE DESCRIPTION SEQ ID NO: 6 GTAATTCAAT GTTCCAACGT G
  • MOLECULE TYPE synthetic DNA
  • xi SEQUENCE DESCRIPTION SEQ ID NO: 11

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Health & Medical Sciences (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

There is provided a novel cold-active beta-galactosidase enzyme specific for lactose. The enzyme is thus useful in e.g. the food industry for catalyzing at low temperatures the hydrolysis of lactose disaccharide into its constituent monosaccharides, glucose and galactose. The present invention further provides a method of producing the cold-active beta-galactosidase by recombinant DNA technology.

Description

COLD-ACTIVE BETA-GALACTOSIDASE, A METHOD OF PRODUCING SAME AND USE OF SUCH ENZYME
FIELD OF THE INVENTION
The present invention relates to a novel cold-active beta- galactosidase enzyme specific for lactose. The enzyme is thus useful in e.g. the food industry for catalyzing at low temperatures the hydrolysis of lactose disaccharide into its constituent monosaccharides, glucose and galactose. The present invention further provides a method of producing the cold-active beta-galactosidase by recombinant DNA technology.
BACKGROUND OF THE INVENTION
Beta-galactosidase (beta-D-galactoside galactohydrolase, EC 3.2.1.23) is an enzyme capable of hydrolyzing the disaccharide lactose to its monosaccharide constituents, D- glucose and D-galactose. Beta-galactosidases are found in a large variety of organisms, like mammals, plants, fungi, yeasts, and bacteria. In Nature, beta-galactosidases hydrolyze lactose and other D-galactose-containing carbohydrates. In the industry, beta-galactosidases have been used primarily within the food industry. Beta- galactosidase hydrolysis of lactose and lactose-containing dairy products are used throughout in the dairy industry in the preparation of lactose-free or low-lactose products, which may be consumed by humans suffering from lactose intolerance. Hydrolysis of lactose by beta-galactosidases may also be used in applications where the removal of lactose is required, i.e. prevention of crystallisation of lactose in food and removal of D-galactose moieties in glycosylated proteins. Other applications of beta- galactosidases comprise hydrolysis of lactose into D- galactose and D-glucose with the subsequent modification of the monosaccharides to high value products, like the sweetener D-tagatose (Jørgensen et al . 2004) .
Application of beta-galactosidases could be used to produce lactose-free and low-lactose dairy products for lactose intolerant humans.
The major applications for lactose hydrolysis are listed below. a) Liquid milk. Lactose hydrolysis in liquid milk improves digestibility for lactose intolerant consumers. In flavoured milks, lactose hydrolysis increases sweetness and enhances flavours. b) Milk powders. Lactose hydrolysed milk powders for dietetic uses, especially for infants with temporary beta- galactosidase deficiency. c) Fermented milk products. In some cases, lactose hydrolysis in milk used for the manufacture of cheese and yoghurt can increase the rate of acid development and thus reduce processing time. d) Concentrated milk products. Lactose hydrolysis in concentrated milk products (e.g. sweetened condensed milk, ice cream) prevents crystallisation of lactose. e) Whey for animal feed. Lactose hydrolysis in whey enables more whey solids to be fed to pigs and cattle and also prevents crystallisation in whey concentrate. f) Whey. Lactose hydrolysed whey is concentrated to produce a syrup containing 70-75 per cent solids. This syrup provides a source of functional whey protein and sweet carbohydrate and is used as a food ingredient in ice cream, bakery and confectionery products.
The conventional approach in food processing is to carry out the hydrolysis of lactose at 40 0C during approximately four hours .
However, milk or lactose solution as a raw material is a preferable nutrition source for bacteria. As the result, the putrefaction owing to the saprophyte contamination during the treatment is a serious problem in the food production. Thus, the fact is that the conventional beta- galactosidase is of limited use.
Most beta-galactosidases in practical use are active only at temperatures above 20-30 0C, temperatures where food spoiling bacteria thrive at best.
Attempts to use thermophilic beta-galactosidases have been used but the products have suffered from off flavours and reduced organoleptic properties due to the heat treatment, and the processes have demanded high energetic costs.
A number of cold-active beta-galactosidases have been described from Arthrobacter (Coker, et al . 2003; Karasova- Lipovova, et al . 2003; Nakagawa et al . 2003; Nakagawa et al . 2006), from Carnobacterium piscicola (Coombs and Brenchley, 1999) and from Pseudoalteromonas (Cieslinski, et al. 2005; Fernandes, et al . 2002; Hoyoux, et al . 2001; Turkiewicz, et al . 2003) . Furthermore, Nakagawa et al . (2006) described a cold-active beta-galactosidase from the yeast Guehomyces pullulans . However, the activity of cold- active beta-galactosidases described so far is low at the low temperatures, which is wanted by the dairy industry. The beta-galactosidase from the yeast Guehomyces pullulans had approximately 17% at 0 0C (Nakagawa et al . 2005), the beta-galactosidases from Carnobacterium piscicola BA showed approximately 24% activity at 10 0C (Coombs and Brenchley, 1999) and the enzymes from Pseudoalteromonas isolates showed 39% activity (Fernandes et al . 2002), 22% activity (Cieslinski et al . 2005), and 12% activity (Hoyoux et al . 2001) at 10 0C. So far, the beta-galactosidases with highest activity at low temperatures have been isolated from Antarctic Arthrobacter isolates. Karasova-Lipovova, et al . (2003) showed that a psychrotolerant Arthrobacter sp . C2-2 isolate produced beta-galactosidase, which displayed 19% of its maximal activity at 10 0C, Coker et al . (2003) described an enzyme from an Antarctic Arthrobacter isolate with approximately 50% at 0 0C, and Nakagawa et al . (2003, 2006) described a beta-galactosidase from A. psychrolactophilus F2, which had its temperature optimum at 10 0C.
However, the cold-active beta-galactosidase from the Antarctic Arthrobacter was produced in low amounts in native cells and attempts to produce the enzyme recombinantly in E. coli were unsuccessful since about 90% of the enzyme was located in insoluble inclusion bodies (Coker et al . 2003) . The cold-active beta-galactosidase from A. psychrolactophilus F2 could be produced heterologously, but had lower activity than the other Arthrobacter beta-galactosidases (Nakagawa et al . 2006) .
Therefore, in order to develop a low-temperature process for hydrolysis of lactose there is a need for a novel cold- active beta-galactosidase and a method for producing such enzyme .
SUMMARY OF THE INVENTION
The present invention has, by using recombinant DNA technology, for the first time made it possible to provide a cold-active beta-galactosidase with high specific activity in industrially appropriate quantities for the manufacturing of food products and pharmaceuticals.
Accordingly, the present invention provides a purified cold-active beta-galactosidase, specific for lactose, having a stable enzymatic activity at temperatures less than 80C, and specifically at 40C, which corresponds to refrigerating conservation temperature for dairy products. The enzyme of the present invention is consequently able to hydrolyse lactose in dairy products and milk processing at such a low temperature that saprophytes are hindered to proliferate. The hydrolysis of lactose can be carried out in these refrigeration conditions with no need of a particular treatment to the dairy product concerned.
Specifically, the present invention provides a cold active beta-galactosidase having the sequence as defined in SEQ ID NO. 1, or one having at least 80% homology to the amino acid sequence as defined in SEQ ID NO. 1, the amino acid sequence being selected so that the enzyme has a stable enzymatic activity at temperatures less than 8 0C.
Preferably the amino acid sequence has at least 90%, and more preferably 95%, homology to the amino acid sequence as defined in SEQ ID NO. 1. In order to obtain the cold-active beta-galactosidase of the present invention there is further provided a DNA sequence, which a) encodes a protein with an amino acid sequence as given in SEQ ID NO. 1, or b) hybridises under stringent or very stringent conditions to the sequence of a) , or c) is degenerative of the sequence of a) or b)
Preferably the DNA sequence is derived from the genus Alkalilactibacillus, such as the species
Alkalilactibacillus ikkense, and has a nucleotide sequence as given in SEQ ID NO. 2.
In a further embodiment, the present invention provides a recombinant vector comprising a DNA sequence that encodes a protein with an amino acid sequence as given in SEQ ID NO. 1, or one having at least 80% homology to the amino acid sequence as defined in SEQ ID NO. 1, the amino acid sequence being selected so that the enzyme has a stable enzymatic activity at temperatures less than 8 0C. Preferably the amino acid sequence has at least 90%, and more preferably 95%, homology to the amino acid sequence as defined in SEQ ID NO. 1.
Another object of the present invention is a strain of an isolated Alkalilactibacillus bacterium capable of producing a cold-active beta-galactosidase according to the present invention. A preferable strain is Alkalilactibacillus ikkense deposited on the 3rd of March, 2009, under the Budapest Treaty at the BCCM/LMG-Collection (Belgian Coordinated Collections of Microorganisms) with the Accession No LMG P-24866 and variants and mutants derived therefrom.
To purify the cold-active beta-galactosidase according to the present invention, a bacterium living in the Greenland area was isolated and characterised in order to study how its enzymes, and particularly, the beta-galactosidase was adapted to cold. These studies led to the purification of the beta-galactosidase, meaning that this protein was obtained substantially free of other proteins using protein purification steps known in the art.
Thus, another object of the present invention is a strain of an isolated Alkalilactibacillus bacterium capable of producing a cold-active beta-galactosidase according to the present invention. A preferable strain is alkalilactibacillus ikkense.
Another object of the invention is a recombinant plasmid or vector suited for transformation of a host, capable of directing the expression of a DNA sequence according to the invention in such a manner that the host expresses the cold-active beta-galactosidase of the present invention in recoverable form.
According to the invention, another object is the so transformed host. A variety of host-expression systems may be conceived to express the cold-active beta-galactosidase coding sequence, for example bacteria, yeast, insect cells, plant cells, mammalian cells, etc. Particularly, in yeast and in bacteria, a number of vectors containing constitutive or inducible promoters may be used. It is also an object of the present invention to provide a process for purifying the cold-active beta-galactosidase according to the present invention from a bacterium as well as to provide a process for producing cold-active beta- galactosidase according to the invention in a transformed host .
Accordingly, the invention pertains to a method of producing a polypeptide having cold-active beta- galactosidase activity, comprising isolating a DNA fragment encoding the polypeptide, inserting said DNA fragment into an appropriate host organism, cultivating the host organism under conditions, which lead to expression of the a polypeptide with cold-active beta-galactosidase activity and recovering said polypeptide from the cultivation medium or the host organism.
An appropriate host organism is preferably selected from the group consisting of Escherichia, Bacillus,
Bifidobacterium, Lactococcus, Lactobacillus, Streptomyces, Leuconostoc, Streptomyces, Saccharomyces, Kluyveromyces, Candida, Torula, Torulopsis and Aspergillus .
In a further aspect, the invention relates to a recombinant DNA molecule comprising a DNA fragment encoding a polypeptide having cold-active beta-galactosidase activity and to a microbial cell comprising such recombinant DNA molecule .
In another aspect, the invention pertains to the use of the above polypeptide with cold-active beta-galactosidase activity or a microbial cell expressing such polypeptide in the manufacturing of a food product or a pharmaceutical product .
In another useful aspect, there is provided a method for reducing the lactose content of a food product, comprising adding to the food product an amount of the polypeptide or the microbial cell as disclosed herein, which is sufficient to remove at least part of the lactose present in said food product .
In a practical aspect, the invention pertains to the inactivation of the beta-galactosidase activity of the polypeptide by a moderate increase of the temperature.
In a further interesting aspect, there is provided a method using the polypeptide harbouring a cold-active beta- galactosidase activity or a microbial cell according to the invention in the hydrolysis of lactose, whereby the polypeptide and/or the microbial cell is applied to a reactor containing lactose, which is hydrolyzed under low- temperature conditions.
These and other objects of the present invention will be apparent from the following disclosure.
Other characteristics of the present invention are listed in the annexed claims.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 discloses a phylogenetic tree of 16S rRNA gene sequences from Alkalilactibacillus ikkense strain 517 and its closest relatives within the rRNA group 1 in the phyletic assemblage classically defined as the genus Bacillus . Bootstrap (n=100) values are shown. Bar, 0.015 substitutions per nucleotide position.
Figure 2 shows temperature dependence of native Ikka-beta- galactosidase . Y-axis is the relative activity in percent of the maximal activity. X-axis is the incubation temperature .
Figure 3 shows temperature stability of native Ikka-beta- galactosidase . Y-axis is the residual activity left after incubation at the time indicated on the X-axis. ♦, •, A, ■, 0, o, indicate incubation temperatures at 0, 10, 20, 30, 40, and 50 0C, respectively.
Figure 4 discloses pH dependence of native Ikka-beta- galactosidase . Y-axis is the relative activity in percent of the maximal activity. X-axis is pH in the beta- galactosidase assay.
Figure 5 shows SDS-PAGE of extracts from native A. ikkense cells induced with 1 mM IPTG (lanes 2 and 3) and from uninduced, native A. ikkense (lanes 4 and 5) . Arrows in lanes 2 and 3 indicate the 120 kDa beta-galactosidase band. Lane 1 is molecular weight marker. The marker at 120 kDa is beta-galactosidase from E. coli.
Figure 6 shows SDS-PAGE of three extract dilutions from recombinant E. coli cells expressing Ikka-beta- galactosidase (lanes 4, 5, and 6) . For comparison, enzyme extract dilutions with beta-galactosidase from Kluyveromyces lactis (lanes 7, 8, and 9) and a molecular weight marker with native E. coli beta-galactosidase (marker at 120 kDa) were co-electrophoresed with the recombinant Ikka-beta-galactosidase . Arrows show the position of the 120 kDa beta-galactosidase bands
Figure 7 discloses temperature dependence of recombinant Ikka-beta-galactosidase produced in E. coli. Y-axis is the relative activity in percent of the maximal activity. X- axis is the incubation temperature. ♦, indicate recombinant Ikka-beta-galactosidase; o, indicate Kluyveromyces lactis beta-galactosidase.
Figure 8 shows specific activity of recombinant Ikka-beta- galactosidase produced in E. coli. Y-axis is specific activity in nmoles ONP released/hour/mg enzyme. X-axis is temperature in 0C. ♦ is recombinant Ikka-beta- galactosidase, o is Kluyveromyces lactis beta- galactosidase .
Figure 9 discloses thermal stability of recombinant Ikka- beta-galactosidase enzyme. An equal amount of enzyme was incubated at the temperature indicated and samples were withdrawn at different time intervals. Y-axis is absorbancy at wavelength 415 nm. X-axis is time in minutes.
Figure 10 also discloses thermal stability of recombinant Ikka-beta-galactosidase enzyme, while the X-axis is time in hours .
Figure 11 shows pH dependence of recombinant Ikka-beta- galactosidase. Y-axis is absorbancy measured at wevelength 415. X-axis is pH in the beta-galactosidase assay. Figure 12 shows hydrolysis of lactose by recombinant Ikka- beta-galactosidase produced in E.coli. The reaction mixture contained lactose in three concentrations, 1.25 mg/ml, 2.5 mg/ml and 5 mg/ml. Samples were withdrawn after incubation for 15, 150, and 1440 minutes. The reactions were incubated at 5 0C (A) or 20 0C (B) and analysed by thin layer chromatography (TLC) . The TCL plates were sprayed with an orcinol reagent, and hydrolysis of lactose was estimated by the disappearance of the lactose spots on TLC plates and the concomitant appearance of glucose and galactose spots.
Figure 13 shows SDS polyacrylamide gel electrophoresis of crude extract of E. coli cells expressing A. ikkense beta- galactosidase, Lane 1. The beta-galactosidase in the crude extract was further purified on ion exchange chromatography, Lane 2, or on affinity chromatography, Lane 3. The arrow indicates the position of the E. coli 120 kDa beta- galactosidase band. Numbers to the left indicate the position of protein bands in the PageRuler™ Plus Prestained Protein Ladder (Fermentas) .
Figure 14 shows temperature dependence (A) and pH dependence (B) of the purified, recombinant A. ikkense beta-galactosidase and of a crude extract containing recombinant enzyme. Y-axis is the relative activity in percent of maximal activity. X-axis is the incubation temperature (A) or pH (B) . The relative activity of the purified, recombinant enzyme with ONPG as substrate is illustrated by black squares. Assays were performed in triplicates, and standard error was below 0.05. Figure 15 shows thermal stability of the purified, recombinant A. ikkense beta-galactosidase enzyme. An equal amount of enzyme was incubated at the temperatures indicated and samples were withdrawn at different time intervals. Y-axis is the residual activity in percent of maximal activity. Enzyme samples were incubated at temperatures from 0 0C to 60 0C and at the time points indicated (X-axis), samples were withdrawn and assayed for active beta-galactosidase at 20 0C. Assays were performed in triplicates, and standard error was below 0.05.
Figure 16 shows benchmarking the A. ikkense beta- galactosidase (black squares) with commercially available Lactozyme® 3 3000L from K. lactis (open circles) . An equal amount of enzyme (2 mg/ml) was incubated with ONPG as substrate at temperatures from 0 0C to 20 0C. Samples were withdrawn at different time intervals and hydrolyzed ONP was measured at A420 nm. Hydrolysis efficiency was calculated as increase in A420 nm per min per microgram active enzyme. Assays were performed in triplicates, and standard error was below 0.05.
Figure 17 shows thin-layer chromatography (TLC) of the hydrolysis of lactose by the A. ikkense beta-galactosidase. Lanes 4-6: samples incubated at 5 0C for 2^ h (4: 1.25 mg/ml lactose, 5: 2.5 mg/ml lactose, 6: 5 mg/ml lactose) .
Lanes 7-9: samples incubated at 20 0C for 2^ h (7: 1.25 mg/ml lactose, 8: 2.5 mg/ml lactose, 9: 5 mg/ml lactose) .
Lanes 1-3: Controls, 0.0125 μg of each of the carbohydrates 13 lactose (lane 1), galactose (lane 2) and glucose (lane
3) . DETAILED DESCRIPTION OF THE INVENTION
"Beta-galactosidase" (beta-D-galactoside galactohydrolase, EC 3.2.1.23) is defined as an enzyme capable of hydrolysing lactose to the monosaccharides D-glucose and D-galactose.
"Cold-active" is defined as having activity at temperatures at 15 0C and below, preferably at 10 0C and below and most preferably at 5 0C and below.
A "host cell" is selected from a group of microorganisms comprising fungi, yeasts, and prokaryotes. The microorganism is more preferably a prokaryote and most preferably a bacterium.
Conditions of incubating beta-galactosidase with lactose are defined by performing incubation at a temperature between 0 0C and 20 0C, preferably between 5 0C and 15 0C.
The term "stringent condition" refers to a condition such that a hybridization is conducted in a solution containing 6xSSC (2OxSSC represents 333 mM Sodium citrate, 333 mM NaCl), 0.5% SDS and 50% formamide at 42 0C, and then the hybridized products are washed in a solution of 0. IxSSC, 0.5% SDS at 68°C, or to conditions as described in Nakayama, et al . , Bio-Jikken-Illustrated, vol. 2, "Idenshi- Kaiseki-No-Kiso (A Basis for Gene Analysis)", pp. 148-151, Shujunsha, 1995. EXAMPLES
EXAMPLE 1
Isolation of bacteria producing cold-active beta- galactosidases
1.1 Sampling of bacteria
Ikaite material was collected by scuba divers in the Ikka Fjord, South West Greenland (61°11'N, 48°01'W) from a depth of approximately six to ten meters. The columns were between 36-70 cm in length and between 5 and 30 cm in diameter. The columns were kept cold during transportation to the field laboratory.
1.2 Screening bacteria for beta-galactosidase production
Approximately 3 cm3 of ikaite material from a slice 15-18 cm from the top of an ikaite column was drilled out and suspended in 250 ml R2 broth (Schmidt et al . 2006) buffered to pH 10 with 0.2 M Na2CO3/NaHCO3 buffers as described by Stoll and Blanchard (1990) . After incubation at 5 0C for 2 months the culture was inoculated onto R2 medium, pH 10 without glucose but supplemented with lactose (1% w/v) , 5- bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) (40 μg/ml) , 10 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) and agar (1.5 %, w/v) . The plates were incubated at 5 0C for one to two weeks. A total of 17 blue colonies indicating production of beta-galactosidase were detected. Since 16S rRNA gene analyses of the seventeen isolates showed identical sequences only one of the isolates, strain 517, was chosen for further characterization.
EXAMPLE 2
Taxonomical analysis of Isolate 517 and description of a new genus and species, Alkalilactibacillus ikkense
2.1 Phylogenetic analysis of 16S rRNA gene sequences
DNA for phylogenetic analysis was extracted from cells of isolate 517 using FastDNA SPIN Kit for Soil as described by the manufacturer (BIO 101, Irvine, CA) . 16S rRNA gene amplification was carried out using the primers 27F and
1492R (Lane 1991), and DNA sequencing was carried out at MWG Biotech AG (Ebersberg, Germany) using the same two primers plus additional primers 519R, 532F, 907F, and 907R (Lane 1991) . The near full length DNA sequence of the 16S rRNA gene from isolate 517 was submitted to GenBank/EMBL/DDBJ with the accession number EU281853. Related sequences were retrieved from public databases using BLASTn at the NCBI server (ht \ p : / /'www, r.^ci .n ,rι . ir h . qnv /L dot/) . The closest related 16S rRNA gene sequences were aligned using the Clustal W multiple alignment program MegAlign 5.03 (DNASTAR, Inc., Madison, WI) . The Clustal W analysis showed that the closest relatives were Natronobacillus azotifigens (accession no. EU850815) (Sorokm et al . 2008), Paraliobacillus ryukyuensis (accession no. AB087828) (Ishikawa et al . 2002), Halolactibacillus halophilus (accession no. AB196783) (Ishikawa et al . 2005), Halolactibacillus miurensis (accession no. AB196784) (Ishikawa et al . 2005), Amphibacillus tropicus (accession no. AF418602) (Zhilina et al . 2001, 2002), and Gracilibacillus halotolerans (accession no. AF036922) (Wainø et al . 1999) . Isolate 517 was most closely related to N. azotifigens, P. ryukyuensis and A. tropicus with 95, 9%, 94.4% and 93.9% sequence similarity, respectively. The sequence similarity between isolate 517 and both H. halophilus, H. miurensis, and G. halotolerans was 93.4%. Thus, the distance in 16S rRNA gene sequence similarity between isolate 517 and the closest related is below the 97% similarity, which is often used as a preliminary guideline for species separation. A phylogenetic tree was created by neighbour-j oining analysis (bootstrap=100) using TREECON 1.3b software (Van de Peer and De Wachter, R. 1994) Fig. 1.
2.2 DNA-DNA hybridization and base composition analysis of genomic DNA
DNA-DNA hybridization and DNA base composition (G+C content) was carried out at DSMZ (Braunschweig, Germany) . DNA was isolated using a French pressure cell (Thermo Spectronic) and was purified by chromatography on hydroxyapatite as described by Cashion et al . (1977) . DNA- DNA hybridization was carried out as described by De Ley et al . (1970) under consideration of the modifications described by Huss et al . (1983) using a model Cary 100 Bio UV/VIS-spectrophotometer equipped with a Peltier- thermostatted 6x6 multicell changer and a temperature controller with in-situ temperature probe (Varian) . DNA-DNA hybridization between isolate 517 and the closest related based on 16S rRNA sequence similarity P. ryukyuensis was 28.8%, and between isolate 517 and H. miurensis it was 24.7%. For determination of GC content, the DNA was hydrolyzed with Pl nuclease and the nucleotides dephosphorylated with bovine alkaline phosphatase (Mesbah et al . 1989) . The resulting deoxyribonucleotides were analyzed by HPLC. The DNA G+C content of isolate 517 was 38.4 mol%, which is fairly similar to the closest related species. The G+C content of N. azotifigens is 36.1-38.5 mol% (Sorokin et al . 2008), H. halophilus and H. miurensis is reported to be 38.5-40.7 mol% (Ishikawa et al . 2005), for P. ryukyuensis it is 35.6 mol% (Ishikawa et al . 2002), and for G. halotolerans it is reported to be 38 mol% (Wainø et al . 1999) .
The phylogenetic results and data on GC content indicate that isolate 517 represent a new species within a new genus, since the threshold value for DNA-DNA hybridization to separate two species is 70 % (Wayne et al . , 1987) . Thus, we propose that isolate 517 represents a new genus Alkalilactibacillus gen. nov. comprising the species Alkalilactibacillus ikkense sp . nov.
EXAMPLE 3
Characterization of native Ikka-beta-galactosidase from Alkalilactobacillus ikkense
3.1 Beta-galactosidase assay.
Beta-galactosidase activity was assayed by hydrolysis of o- nitrophenyl-beta-D-galactopyranoside (ONPG) and measuring the absorbancy of the released o-nitrophenyl (ONP) compound in a spectrophotometer at 415 nm. In the assay, the release of ONP from 1 mM ONPG by the recombinant beta-galactosidase activity was measured at 415 nm at 20 0C and pH 7.0 (0.1 M NaH2PO4/Na2HPθ4) . The reactions were stopped by adding 300 μl 0.6 M Na2CO3. Assays were performed at 0, 5, 10, 20, 30, 40, 50, and 60 0C for 30 minutes. The sodium phosphate buffers were pre-heated to the respective temperatures prior to assay start.
Thermostability analysis of the enzyme was carried out by placing an aliquot of enzyme at temperatures 0, 10, 20, 30, 40, and 50 0C and taking samples at t = 0 to t = 24 hours. Immediately after taking the samples, they were cooled and assayed at 20 0C as described above.
The pH activity profile was studied using a mixed pH buffer (250 mM Tris, 250 mM MES, 250 mM acetic acid) adjusted from pH 4 to pH 10 with HCl or NaOH. The samples were incubated at 20 0C for 1 hour and assayed as described above.
3.2 Production of native Ikka-beta-galactosidase .
Alkalilactibacillus ikkense cells were cultivated in liquid R2 medium supplemented with lactose and IPTG at 15 0C for 3 days on a rotary shaker. Cells were harvested by centrifugation in a Sigma® 3-18M centrifuge at 4,700 rpm and the pellet was resuspended in 2 ml of 0.1 M NaH2PO4ZNa2HPO4, pH 7. Cells were lysed by bead beating in a FastPrep FP120 instrument (BiolOl/Savant) for 3 times 25 sec at speed 5.5. The supernatant was then removed from the glass beads and centrifuged for 15 min at 10,000*g at 4 0C. The cell free supernatant was then used for assaying. 3.3 Characterization of temperature optimum of native Ikka- beta-galactosidase.
The native Ikka-beta-galactosidase displayed maximal activity at 20 0C, 40% of the maximal activity was obtained at 0 °C, and more than 60% of the maximal activity was observed at 10 0C (Fig. 2) . Above 30 0C the enzyme was only moderately active and virtually no activity was observed at 60 0C.
The temperature stability of the Ikka-beta-galactosidase was investigated. Fig. 3 shows that almost 100% of the residual activity was observed after 24 hours incubation at 0 0C and that more than 80% activity was left after 24 hours at 20 0C. At temperatures above 20 0C, the native
Ikka-beta-galactosidase rapidly lost activity (Fig. 3) . The inactivation at high temperatures was shown to be irreversible .
The pH dependence of the native Ikka-beta-galactosidase was investigated. Fig. 4 shows that maximal activity of the native Ikka-beta-galactosidase was observed at pH 7, and that the enzyme displayed approximately 70% of the maximal activity at pH 6 and at pH 8. At pH 9, approximately 25% of maximal activity was observed. The enzyme showed no activity at pH 5 and below or at pH 10 and above (Fig. 4) .
3.4 SDS-PAGE of native Ikka-beta-galactosidase.
Extracts from cells of A. ikkense induced with 1 mM IPTG and uninduced were analysed in SDS-PAGE (sodium dodecyl sulfate - polyacrylamide gel electrophoresis) (Fig. 5) . Intracellular extracts were prepared by lysing the cells using bead-beating as described above in 3.2. The extracts (0.5-5 μl) were mixed with 12.5 μl 4*LDS sample buffer, 5 μl 10*DTT and 0.1 M NaH2PO4ZNa2HPO4 to a final volume of 50 μl . The samples were heated to 70 0C for 10 minutes and 30 μl was loaded onto a 4-12% SDS gel. The gel was run in a XCeIl SureLock™ Mini-Cell (Invitrogen, CA, USA) at 150 V for 1 hour at room temperature. After electrophoresis, the gel was stained using Coomassie Brilliant Blue R-250 (0.1% Coomassie Brilliant Blue R-250 (Serva, Heidelberg, Germany) in 40% EtOH and 10% acetic acid) . Fig. 5 shows that a strong 120 kDa band was observed in the lanes with extracts from A. ikkense cells induced with IPTG and that this band was missing in lanes with extracts from non-induced cells. Thus, the 120 kDa band was assumed to be the native Ikka- beta-galactosidase .
EXAMPLE 4
Isolation and characterization of the Ikka-beta- galactosidase gene from Alkalilactobacillus ikkense
4.1 Isolation of the Ikka-beta-galactosidase gene
DNA from A. ikkense was isolated from a culture of 50 ml. The cells were harvested by centrifugation and the chromosomal DNA was isolated using conventional phenol- chloroform extraction methods (Maniatis et al . , 1982) . The DNA was partially digested using Sau3AI (New England Biolabs, MA, USA), and fragments with the lengths between 3 kb and 10 kb were purified from an agarose gel using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) as described by the producer.
The vector for cloning chromosomal DNA from A. ikkense was a modified pUC18 plasmid (Stratagene, CA, USA) . Plasmid pUClδ was restricted by Ndel and Hindi I I endonucleases (New England Biolabs) . The sticky ends were refilled using Klenow fragment of DNA polymerase (New England Biolabs) and the blunt ends were ligated using T4 DNA ligase (New England Biolabs) . DNA sequencing of the modified pUC18 plasmids, denoted pUClδdlacZ, at GATC Biotech AG (Konstanz, Germany) and analysis of the DNA sequence in the CLC Workbench 4 software (CLC bio, Aarhus, Denmark) confirmed that the α-subunit sequence of pUC18 was deleted in plasmid pUClδdlacZ. Thus, plasmid pUClδdlacZ was not able to mediate α-complementation when introduced into E. coli cells harbouring the beta-galactosidase ΔZ15 mutation.
Sau3AI restricted and gel-purified chromosomal DNA from A. ikkense was ligated into plasmid pUClδdlacZ treated with the restriction endonuclease BamHI and Antarctic Phosphatase (New England Biolabs) . The ligation mixture was transformed into chemically competent E. coli TOPlO cells. Transformed cells were plated onto LB agar (10 g/1 Bacto tryptone, 5 g/1 yeast extract, 10 g/1 NaCl) containing 20 μg/ml X-gal, 0.1 mM IPTG, and 100 μg/ml ampicillin and incubated over night at 37 0C. After a 16 hours over night incubation, the plates were transferred to 20 0C and incubated for another 20 hours. A total of 5δO colonies were screened and 1 blue colony was detected. The colony that turned blue during incubation at 20 °C was selected and transferred to 10 ml LB broth and grown at 37 0C over night. Recombinant E. coli cells from over night cultures were harvested by centrifugation, and plasmid DNA was purified using the QIAprep Spin Miniprep Kit (Qiagen) . Plasmid DNA was analysed for inserts by digestion with restriction endonucleases EcoRI and Pstl (New England Biolabs) . The insert in the plasmid, denoted pUCIkka-bgal, was sequenced at GATC Biotech AG (Konstanz, Germany) using primer walking with the primer M13 reverse and custom made primers specific for the insert in pUCIkka-bgal (SEQ ID 3: 5'CCGTCATCCATATCACCa'; SEQ ID 4: δ'CCTTTGCCCAAGAGCCAACCS'; SEQ ID 5: 5' GCTATTATCAGACTTGGCACC3' ; SEQ ID 6: 5'GTAATTCAAT GTTCCAACGTG3' ; Seq ID 7: 5'CGCTTATGGTGTGAAGa') and a sequence just downstream of the multiple cloning site in pUClδdlacZ, (SEQ ID 8: 5'GGGCTGGCTTAACTATGCGGa') . The Ikka-beta- galactosidase gene sequence harboured by the DNA insert is shown as SEQ ID NO 2.
4.2 Characterization of the Ikka-beta-galactosidase gene sequence
Analysis of the DNA sequence, SEQ ID NO 2, using the CLC Workbench 4 software (CLC bio, Aarhus, Denmark) showed an open reading frame with the coding capacity of 1,041 amino acids, SEQ ID NO 1. The NCBI search tool Blastp was used to search for related sequences in databases. The closest related sequences were beta-galactosidases from Bacillus megaterium (accession no ABN13675) 56.7% identity,
Paenibacillus sp . JDR-2 (accession no ZP_02849115) 55.3% identity, and Geobacillus sp . Y412MC10 (accession no ZP_03036811) 54% identity, all of which belong to the Glycosyl Hydrolase Family 2. Thus, it is concluded that the Ikka-beta-galactosidase belongs to this family. The calculated subunit molecular weight and pi of the Ikka- beta-galactosidase was 119 kDa and pi 5.0, respectively (ExPASy ProtParam tool) . The calculated subunit molecular weight was confirmed by SDS-PAGE, Figs. 5 and 6. Alignment of the Ikka-beta-galactosidase with structurally resolved enzymes showed that the conserved active site region in E. coli (ILCEYAHAMGN) (pos. 534-544) (Gebler et al. 1992) is well conserved in the Ikka-beta-galactosidase (ILCEFSHAMGN) (pos. 547-557), and the active site nucleophile Glu-537 is probably found as Glu-550.
EXAMPLE 5
Production of recombinant Ikka-beta-galactosidase in Escherichia coli.
Native Alkalilactibacillus ikkense was shown to produce only moderate amounts of Ikka-beta-galactosidase. Therefore, in order to produce larger amounts of the beta- galactosidase, subcloning of the Ikka-beta-galactosidase gene into expression plasmids was carried out.
5.1 Construction of a vector for the expression of recombinant Ikka-beta-galactosidase in Escherichia coli.
The Ikka-beta-galactosidase gene was subcloned further using chromosomal DNA from A. ikkense as template and the
PCR primers bGal5' :
5 ' CTGAATTCGCATATGGCAAAAAAATTAAAAAAATTCB ' (EcoRI restriction site underlined) (SEQ ID 9), and bGal3' :
5 ' CCAAGCTTATCTGTTTAAACTATTCAACATG3 ' (Hindi I I site double underlined) (SEQ ID 10) . The polymerase used was the proofreading polymerase Phusion® High-Fidelity DNA
Polymerase (New England BioLabs) . The PCR reaction was analyzed by gel electrophoresis on a 0.8% agarose gel (Seakem GTG) and the 3.9 kb fragment was ligated into pJETl .2/blunt cloning vector (Fermentas, Helsingborg, Sweden) and transformed into E. coli TOPlO cells. E. coli transformants containing pJETl .2/blunt were isolated on ampicillin containing LB agar plates and plasmid DNA was prepared as described above. Plasmid DNA was restricted with the enzymes EcoRI and Hindi I I and analysed on 0.8% (w/v) agarose gels as described. The 3.9 kb DNA fragment was purified from the gel using the QIAquick Gel Extraction Kit as described by the producer. The purified DNA fragment was ligated into plasmid pUClδdlacZ similar restricted with the enzymes EcoRI and Hindi I I and gel purified as described above. The ligation mixture was transformed into E. coli TOPlO cells and recombinant cells harbouring the plasmid pUClδdlacZ with the Ikka-beta-galactosidase gene were selected as blue colonies on LA plates containing 100 μg/ml ampicillin, 1 mM IPTG, and 40 μg/ml X-gal . Transformants were selected and analysed for plasmids and inserts. Plasmid DNA was prepared from a 10 ml culture and the DNA was sent for sequencing at GATC biotech (Konstanz, Germany) using the primers described above in 4.1. The entire Ikka- beta-galactosidase gene was sequenced on both strands in order to ensure that no mutations were introduced during PCR. One of the recombinant clones, which contained plasmid pUClδdlacZ with the Ikka-beta-galactosidase gene, denoted plasmid pUCIkka-bgal_exp, was selected for further expression studies.
5.2 Expression of recombinant Ikka-beta-galactosidase in Escherichia coli.
E. coli TOPlO cells harbouring plasmid pUCIkka-bgal and pUCIkka-bgal exp were cultivated in 30 ml LB broth containing 100 μg/ml ampicillin over night at 37 0C. After an over night incubation, the cells were supplemented with 0.1 mM IPTG and incubated at 20 0C for further 20 hours. Cells were harvested by centrifugation for 30 min at 4,700 rpm at 10 0C and resuspended in 1 ml 0.1 M NaH2PO4ZNa2HPO4, pH 7. The cells were lysed by bead beating in a Fast Prep instrument (Fast Prep FP120, BiolOl/Savant Instruments Inc., Holbrook, NY) at speed 5.5 for 3 times 25 sek. The samples were cooled on ice in between the beating/shaking. The lysate was centrifuged at 10,000 g for 15 min at 4 0C, and the supernatant containing the Ikka-beta-galactosidase enzyme was transferred to a clean tube. This crude extract was used for subsequent analyses.
5.3 Properties of recombinant Ikka-beta-galactosidase produced in Escherichia coli.
5.3.1. SDS-PAGE of recombinant Ikka-beta-galactosidase and determination of yield produced.
Intracellular extracts from recombinant E. coli cells harbouring plasmid pUCIkka-bgal were analysed on SDS-PAGE (SDS gel 4-12%, PAGEgel, CA, USA) as described above in 3.4. Cultures induced with 1 mM IPTG and control cultures not induced were analysed.
The protein bands in extracts from cultures grown with and without IPTG were identical apart from a band of approximately 120 kDa in cultures induced with IPTG (arrow in Fig. 6) . Thus, as the calculated molecular mass of the Ikka-beta-galactosidase is 119 kDa, and since the strong band at 120 kDa was observed only in cultures induced with IPTG, it is assumed that the 120 kDa band represent the Ikka-beta-galactosidase .
Extracts from cultures of plasmid pUCIkka-bgal harbouring E. coli were prepared as described above and diluted before electrophoresis on SDS-PAGE. Beta-galactosidases from E. coli (Sigma-Aldrich, MO, USA) and K. lactis (Novozymes, Bagsvaerd, Denmark) with known molecular mass and in defined concentrations were co-electrophorezed on the same gel for comparison (arrows in Fig. 6) . By comparing the migration and Coomassie Brilliant Blue staining of the known beta-galactosidases with that of the Ikka-beta- galactosidase an estimate of the amount of the Ikka-beta- galactosidase was obtained. The extract, which was used for the subsequent analyses was estimated to have a concentration of Ikka-beta-galactosidase of 2 mg/ml .
5.3.2 Temperature dependence of recombinant Ikka-beta- galactosidase .
The temperature optimum of recombinant Ikka-beta- galactosidase was determined as described above for the native enzyme using ONPG as a substrate. The temperature profile was determined at 0, 5, 10, 20, 30, 40, 50, and 60 °C for 30, 60 and 120 minutes for the recombinant Ikka- beta-galactosidase and, as controls, for the beta- galactosidases from E. coli and K. lactis. The optimal temperature for activity of the recombinant Ikka-beta- galactosidase was determined to be 20-30 0C (Fig. 7) . However, the Ikka-beta-galactosidase also showed high activity at low temperatures with more than 40% activity at 0 0C, approximately 80% activity at 5 0C and more than 90% at 10 0C. Compared to the K. lactis beta-galactosidase, the specific activity of the Ikka-beta-galactosidase was almost twice as high at temperatures between 0 0C and 30 0C (Fig. 8) . Both enzymes showed close to zero activity at 40 0C and above (Fig. 8) .
The thermostability of the Ikka-beta-galactosidase was determined at 0, 10, 20, 30, 40, 50, and 60 0C. Samples were taken from t = 0 hours to t = 123 hours with increasing intervals from 5 minutes during the first hour to several hours at the end of the experiment (Fig. 9) .
Figs. 9 and 10 show that the Ikka-beta-galactosidase showed high stability at 0 0C and 5 0C, at 10 0C the enzyme was stable for approximately 100 hours and at temperatures above 20 0C the Ikka-beta-galactosidase was rather unstable. Treatment at 40 0C for 40 minutes resulted in complete inactivation . The inactivation of the Ikka-enzyme was irreversible.
5.3.3 pH dependence of recombinant Ikka-beta- galactosidase .
The pH activity profile was studied using a mixed pH buffer (250 mM Tris, 250 mM MES, 250 mM acetic acid) adjusted from pH 4 to pH 10 with HCl or NaOH. The samples were incubated at 20 °C for 2 hours. The optimal pH value for the Ikka- beta-galactosidase was shown to be approximately pH 7.0. At pH 6.0 the enzyme showed 60% of maximal activity and at pH 8.0 the Ikka-enzyme displayed 90% activity. At pH 9.0 15% activity was observed whereas no activity could be detected at pH 5.0 or below or at pH 10 and above. 5.3.3 pH dependence of recombinant Ikka-beta- galactosidase .
The substrate specificity of the Ikka-beta-galactosidase was determined in assays performed at pH 7.0 and 20 0C for 20 minutes using nine different chromogenic substrates, o- nitrophenyl-beta-D-galactopyranoside, p-nitrophenyl-alpha- D-galactopyranoside, o-nitrophenyl-beta-D-glucopyranoside, p-nitrophenyl-beta-D-glucopyranoside, p-nitrophenyl-beta-D- arabinopyranoside, p-nitrophenyl-beta-D-cellobioside, p- nitrophenyl-beta-D-fucopyranoside, p-nitrophenyl-beta-D- lactopyranoside, and p-nitrophenyl-beta-D-mannopyranoside . Each substrate was used at a concentration of 10 mM. The assays showed that the Ikka-beta-galactosidase was only able to hydrolyze o-nitrophenyl-beta-D-galactopyranoside
(ONPG) and p-nitrophenyl-beta-D-fucopyranoside (4 % of the relative activity compared to hydrolysis of ONPG) . The utilization of the remaining substrates was below detection .
Hydrolysis of lactose was determined in a solution of lactose in water. Three different lactose concentrations were tested: 1.25 mg/ml, 2.5 mg/ml, and 5 mg/ml . Total reaction volume was 0.2 ml and each reaction contained 0.2 mg/ml of recombinant Ikka-beta-galactosidase enzyme. The enzyme reactions were incubated at 5 0C and 20 0C, and samples were collected after 15 minutes, 2^ hour, and 24 hours. After incubation, the reactions were stopped by heating at 95 0C for 20 minutes. Visualization of the products was carried out by thin-layer chromatography (TLC) on a TLC Silica gel 60 (Merck, Darmstadt, Germany) in a solvent containing 1-butanol, 2-propanol, and water (3:12:4) . Volumes containing 0.005 mg lactose were run on the TLC. Controls were 0.5 μl lactose (2.5 %) , 0.5 μl galactose (2.5 %) and 0.5 μl glucose (2.5 %) . After being dried, the sugars were visualized by spraying with an orcinol reagent followed by incubation for 5-10 min at 100 0C.
Hydrolysis of lactose was observed both at 5 0C and at 20 0C. At 5 0C, approximately 75-85% lactose was hydrolysed in the 1.25 mg/ml reaction after 15 minutes and 100% was hydrolysed within 2^ hours, (Fig. 12 A) . Similar hydrolysis efficiency was observed in the 1.25 mg/ml reaction incubated at 20 0C (Fig. 12 B) . Hydrolysis effectiveness in the 2.5 mg/ml lactose reaction showed approximately 90-95% hydrolysis within 2^ hours at both temperatures. After 24 hours, 100% hydrolysis was observed for all three lactose concentrations at both temperatures (Fig. 12) .
5.3.4 Purification of recombinant Ikka-beta- galactosidase .
Beta-galactosidase was purified from crude extracts by ion exchange chromatography. Portions of two ml were subjected to chromatography on a 1 ml High Q cartridge on a BioLogic LP System (Bio-Rad) .
The column was washed with 10 ml of 50 mM phosphate buffer (pH 7) and eluted by a gradient from 0 to 1 M of NaCl in 50 mM phosphate buffer (pH 7) at a flow rate of 0.5 ml/min. Fractions of 1 ml were collected. Crude extracts were also subjected to affinity chromatography on a 2 ml column of agarose coupled with p-aminobenzyl-1-thio-beta-D- galactopyranoside (PABTG-agarose, Sigma) . The column was washed with 10 ml of 50 mM phosphate buffer (pH 7) before it was eluted by 100 mM NaCl in 50 mM phosphate buffer (pH 7) at a flow rate of 0.5 ml/min. Fractions of 1 ml were collected.
The fractions were analysed for the presence of proteins using a BCA Protein Assay Kit (Pierce) , and beta- galactosidase was measured in o-nitrophenyl (ONP) -beta-D- galactopyranoside assays as described above. Fractions containing beta-galactosidase activity were analysed by SDS polyacrylamide gel electrophoresis (4-20 %, PAGEgel, CA, USA) . Purified beta-galactosidase was used for subsequentstability and activity experiments.
Fig. 13 shows that the crude extract from E. coli contained recombinant beta-galactosidase with a monomeric molecular weight of approximately 115-120 kDa . Ion exchange chromatography resulted in pure beta-galactosidase (Fig. 13, lane 2), whereas affinity chromatography (Fig. 13, lane 3) only resulted in partially purified recombinant enzyme. Thus, for the subsequent analyses, pure beta-galactosidase from ion exchange was used, unless otherwise specified.
5.3.5 Characterization of native and recombinant A. ikkense beta-galactosidase.
The molecular weight of the A. ikkense beta-galactosidase was determined to be approximately 115-120 kDa when analyzed on SDS-PAGE using known beta-galactosidases from E. coli and K. lactis as references. This result is in agreement with the calculated molecular weight as determined from the DNA sequence (119 kDa) . The crude extract from E. coli was estimated to contain 10 mg/ml A. ikkense beta-galactosidase. The specific activity, calculated on the basis of purified beta-galactosidase from ion exchange chromatography was 8.4 micromoles/min/mg protein at 20 0C with ONPG as substrate (Table 1) .
Table 1
Figure imgf000033_0001
A culture of 200 ml E. coli cells expressing recombinant A. ikkense beta-galactosidase was harvested resulting in a 280 mg wet weight cell pellet. The cells were lyzed in a Fast Prep apparatus, and the extract was subjected to ion exchange chromatography. One U is 1 micromole per min at 20 0C with ONPG as substrate. b
Extract of E. coli expressing recombinant A. ikkense beta- galactosidase was analyzed for beta-galactosidase activity.
The thermal stability of the purified, recombinant A. ikkense beta-galactosidase enzyme was tested as shown in Figure 15. An equal amount of enzyme was incubated at the temperatures indicated and samples were withdrawn at different time intervals. Y-axis is the residual activity in percent of maximal activity. Enzyme samples were incubated at temperatures from 0 0C to 60 0C and at the time points indicated (X-axis) , samples were withdrawn and assayed for active beta-galactosidase at 20 0C. Assays were performed in triplicates, and standard error was below 0.05.
At 0 °C the enzyme displayed more than 60 % of the maximal activity, and at 10 0C, more than 70 % of the maximal activity was observed both for purified recombinant enzyme. Analysis of enzyme stability showed that purified, recombinant beta-galactosidase was 100% stable at 0 0C to 20 0C for at least 5 hours (Fig. 15), and that the residual activity after 5 days storage at 0 0C to 20 0C was 50-60 % (data not shown) . At 30 0C, the purified beta-galactosidase lost more than 80 % of its activity within 5 hours. Complete, irreversible inactivation was achieved within 5 minutes at 50 0C and within 10 minutes at 40 0C (Fig. 15) .
The Temperature dependence (A) and pH dependence (B) of the purified, recombinant A. ikkense beta-galactosidase was tested (Figure 14) . Y-axis is the relative activity in percent of maximal activity. X-axis is the incubation temperature (A) or pH (B) . The relative activity of the purified, recombinant enzyme with ONPG as substrate is illustrated by black squares. Assays were performed in triplicates, and standard error was below 0.05.
Maximal activity of the purified, recombinant enzyme was observed at pH 8 (Fig. 14B) . About 60 % of the maximal activity was maintained at pH 7, and at pH 9 approximately 90 % activity was observed (Fig. 14B) .
The recombinant A. ikkense beta-galactosidase was benchmarked with Lactozyme 3000® 13 from K. lactis. At temperatures between 0 0C and 20 0C the A. ikkense beta- galactosidase showed a twofold increase in conversion rate, when compared to the K. lactis-beta-galactosidase (Fig. 16); A. ikkense beta-galactosidase (black squares) compared with commercially available Lactozyme® 3000L from K. lactis (open circles) . Specically the experiment was conducted in the following way: An equal amount of enzyme (2 mg/ml) was incubated with ONPG as substrate at temperatures from 0 0C to 20 0C. Samples were withdrawn at different time intervals and hydrolyzed ONP was measured at A420 nm. Hydrolysis efficiency was calculated as increase in A420 nm per min per microgram active enzyme. Assays were performed in triplicates, and standard error was below 0.05.
Investigation of substrate specificity of the A. ikkense β- galactosidase was carried out using nine different chromogenic substrates. Hydrolysis was only observed with ONPG and with p-nitrophenyl-beta-D-fucopyranoside (4 % of the relative activity compared to hydrolysis of ONPG) . Thin-layer chromatography (TLC) was used to demonstrate the hydrolysis of lactose by the A. ikkense beta-galactosidase (Figure 17) . Lanes 4-6: samples incubated at 5 0C for 2H h (4: 1.25 mg/ml lactose, 5: 2.5 mg/ml lactose, 6: 5 mg/ml lactose) . Lanes 7-9: samples incubated at 20 0C for 2H h (7: 1.25 mg/ml lactose, 8: 2.5 mg/ml lactose, 9: 5 mg/ml lactose) . Lanes 1-3: Controls, 0.0125 mg of each of the carbohydrates lactose (lane 1), galactose (lane 2) and glucose (lane 3) .
Hydrolysis of the remaining substrates was below detection limit. Hydrolysis of lactose was observed at both 5 0C and at 20 0C (Fig. 17) . At 5 0C, approximately 75-85 % of the lactose was hydrolyzed in the 1.25 mg/ml reaction after 15 minutes, and 100 % of the lactose was hydrolyzed within 2H hours (Fig. 17, lane 4) . Similar hydrolysis efficiency was observed in the 1.25 mg/ml reaction incubated at 20 0C for 2^ hours (Fig. 17, lane 7) . Hydrolysis effectiveness in the 2.5 mg/ml lactose reaction showed approximately 90-95 % hydrolysis within 2^ hours at both temperatures (Fig. 17, lanes 5 and 8) . After 24 hours, 100 % hydrolysis was observed for all three lactose concentrations at both temperatures (not shown) . At the highest lactose concentration (27 mg/ml) , the TLC gel indicated the formation of oligosaccharides (Fig. 17, lanes 6 and 9) .
EXAMPLE 6
Production of recombinant Ikka-beta-galactosidase in Bacillus subtilis . The Ikka-beta-galactosidase was further subcloned in a Bacillus subtilis expression vector, pALlO (MoBiTech, GmbH) . PCR was performed using chromosomal DNA from Alkalilactibacillus ikkense as template and the PCR primers Bs_pAL_bGal5 ' : 5 ' GGCCATGGATCCATGGCAAAAAAATTAAAAAAATTC3 ' (BamHI restriction site underlined) (SEQ ID NO 11) and
Bs_pAL_bGal3' : 5 ' GGCCATCCCGGGTTATCTGTTTAAACTATTCAACATG3 ' (Xmal restriction site double underlined) (SEQ ID NO 12) . PCR, subsequent isolation of the fragment encoding the Ikka-beta-galactosidase, ligation into pUClδdLacZ and transformation of E. coli was as described above in 5.1. Plasmid pUClδdLacZ carrying the Ikka-beta-galactosidase gene was prepared and sequenced, before the plasmid DNA was restricted with restriction endonucleases BamHI and Xmal . The 3.1 kb fragment encoding Ikka-beta-galactosidase was purified, inserted into plasmid pALlO similarly restricted with BamHI and Xmal, and transformed into E. coli as described in 5.1. Recombinant E. coli harbouring pALlO containing the Ikka-beta-galactosidase gene was isolated on LB agar plates containing 100 μg/ml ampicillin. Plasmid pAL10_Ikka-bGal was purified and transformed into B. subtilis cells using an electroporation protocol for B. subtilis from Eppendorf (Germany) (Protocol No. 4308 915.504 - 08/2003) . Recombinant cells harbouring plasmid pALlO were selected on LB agar containing 5 μg/ml chloramphenicol .
Production of recombinant Ikka-beta-galactosidase in B. subtilis was carried out by growing B. subtilis pAL10_Ikka- bGal cells in LB containing 5 μg/ml of chloramphenicol at 37 0C for 16 hours. Induction of Ikka-beta-galactosidase synthesis was carried out by changing the temperature to 20 0C. B. subtilis pAL10_Ikka-bGal cells were cultivated at 20 °C for another 5 hours after which, the cells were harvested, and intracellular enzyme was isolated by Fast Prep as described in 5.2.
A crude, intracellular extract from B. subtilis pALlO Ikka- bGal cells was analysed in ONPG assays as described in 5.3. ONPG assays showed the presence of a cold-active Ikka-beta- galactosidase with an activity similar to the native enzyme, to the recombinant enzyme in crude E. coli extracts, and to the pure enzyme produced in E. coli cells.
References
Cieslinski, H., Kur, J., Bialkowska, A., Baran, I., Makowski, K., and Turkiewicz, M. (2005) Cloning and expression, and purification of a recombinant cold-adapted β-galactosidase from Antarctic bacterium Pseudoalteromonas sp . 22b. Prot. Expres. Purific.
Cashion, P., Hodler-Franklin, M. A., McCully, J. and Franklin, M. (1977) A rapid method for base ratio determination of bacterial DNA, Anal. Biochem. 81: 461-466.
Coker, J. A., Sheridan, P.P., Loveland-Curtze, J., Gutshall, K. R., Auman, A., and Brenchley, J. E. (2003) Biochemical characterization of a β-galactosidase with low temperature optimum obtained from an Arctic Arthrobacter isolate. J. Bacterid. 185: 5473-5482.
Coombs, J. M. and Brenchley, J. E. (1999) Biochemical and phylogenetical analysis of a cold-active β-galactosidase from the lactic acid bacterium Carnobacterium piscicola BA. Appl. Environ. Microbiol. 65: 5443-5460.
De Ley, J., Cattoir, H. and Reynaerts, A. (1970) The quantitative measurement of DNA hybridization from renaturation rates, Eur. J. Biochem. 12 : 133-142.
Fernandes, S., Geueke, B., Delgado, 0., Coleman, J., and Hatti-Kaul, R. (2002) β-galactosidase from a cold-adapted bacterium: purification, characterization and application for lactose hydrolysis. Appl. Microbiol. Biotechnol. 58: 313-321. Gebler, J. C, Aebersold, R., and Withers, S. G. (1992) GIu- 537, not Glu-461, is the nucleophile in the active site of (lac Z) beta-galactosidase from Escherichia coli. J. Biol Chem 267: 11126-11130.
Hoyoux, A., Jennes, I., Dubois, P., Genicot, S., Dubail, F., Francois, J. M., Baise, E., Feller, G., and Gerday, C.
(2001) Cold-adapted β-galactosidase from the Antarctic psychrophile Pseudoalteromonas haloplanktis . Appl . Environ. Microbiol. 67: 1529-1535.
Huss, V. A. R.. Festl, H., and Schleifer, K. H. (1983) Studies on the spectrophotometric determination of DNA hybridization from renaturation rates, Syst. Appl. Microbiol. 4: 184-192.
Ishikawa, M., Ishizaki, S., Yamamoto, Y., and Yamasato, K.
(2002) Paraliobacillus ryukyuensis gen. nov., sp . nov., a new Gram-positive, slightly halophilic, extremely halotolerant, facultative anaerobe isolated from a decomposing marine alga, J. Gen. Appl. Microbiol. 48: 269- 279.
Ishikawa, M., Nakajima, K., Itamiya, Y., Furukawa, S., Yamamoto, Y., and Yamasato K. (2005) Halolactibacillus halophilus gen. nov., sp . nov. and Halolactibacillus miurensis sp . nov., halophilic and alkaliphilic marine lactic acid bacteria constituting a phylogenetic lineage in Bacillus rRNA group 1, Int. J. Syst. Evol. Microbiol. 55: 2427-2439.
Jørgensen F, Hansen OC, Stougaard P (2004) Enzymatic conversion of D-galactose to D-tagatose: Heterologous expression and characterisation of a thermostable L- arabinose isomerase from Thermoanaerobacter mathranii Appl . Environ. Microbiol. 64: 816-822.
Karasova-Lipovova, P., Strnad, H., Spiwok, V., Mala, S, Kralova, B., and Russell, N. (2003) The cloning, purification and characterization of a cold-active β- galactosidase from the psychrotolerant Antactic bacterium Arthrobacter sp . C2-2. Enzyme Microbiol. Technol. 33: 836- 844.
Lane, D.J. 16S/23S rRNA sequencing, In: E. Stackebrandt, M. Goodfellow (Eds.), Nucleic acid techniques in bacterial systematics, Wiley, New York, 1991, pp. 115-175.
Maniatis, T., Fritsch, E. F, Sambrook, J. (1982) . Molecular cloning : a laboratory manual. Cold Spring Harbor, N. Y.: Cold Spring Harbor Laboratory
Mesbah, M., Premachandran, U. and Whitman, W. (1989)
Precise measurement of the G+C content of deoxyribonucleic acid by high performance liquid chromatography, Int. J. Syst. Bact. 39: 159-167.
Nakagawa, T., Fujimoto, Y., Ikehata, R., Miyaji, T., and Tomizuka, N. (2006) Purification and molecular characterization of cold-active β-galactosidase from Arthrobacter psychrolactophilus strain F2. Appl. Microbiol. Biotechnol. 72: 720-725.
Nakagawa, T., Fujimoto, Y., Uchino, M., Miyaji, T., Takano, K. and Tomizuka, N. (2006) Isolation and characterization of psychrophiles producing cold-active β-galactosidase . Lett. Appl. Microbiol. 37: 154-157.
Nakagawa, T., Ikehata, R., Uchino, M., Mijaji, T., Takano, K., and Tomizuka, N. (2006) Cold-active acid β- galactosidase activity of isolated psychrophilic basidiomycetous yeast Guehomyces pulluland. Microbiol. Res. 161: 75-79.
Nakayama, et al . , Bio-Jikken-Illustrated, vol. 2, "Idenshi- Kaiseki-No-Kiso (A Basis for Gene Analysis)", pp. 148-151, Shujunsha, 1995.
Sorokin , I. D., Zadorina, E. V., Kravchenko, I. K., Boulygina, E. S., Tourova, T. P., and Sorokin, D. Y. (2008) Natronobacillus azotifigens gen. nov., sp . nov., an anaerobic diazotrophic haloalkalophile from soda-rich habitats. Extremophiles 12: 819-827.
Stoll, V. S. and Blanchard, J. S. (1990) Buffers: Principles and practice. Methods Enzymol. 182: 24-38.
Turkiewicz, M., Kur, J., Bialkowska, A., Cieslinski, H., Kalinowska, H., Bielecki, S. (2003) Antarctic marine bacterium Pseudoalteromonas sp . 22b as a source of cold- adapted β-galactosidase. Biomolec. Engineer. 20: 317-324.
Van de Peer, Y. De Wachter, R. (1994) TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment, Comput. Appl. Biosci. 10 569-570. Wainø, M., Tindall, B.J., Schumann, P., and Ingvorsen, K. (1999) Gracilibacillus gen. nov., with description of Gracilibacillus halotolerans gen. nov., sp . nov.; transfer of Bacillus dipsosauri to Gracilibacillus dipsosauri comb. nov., and Bacillus salexigens to the genus Salibacillus gen. nov., as Salibacillus salexigens comb, nov., Int. J. Syst. Bacterid. 49: 821-831.
Wayne, L. G., Brenner, D.J., Colwell, R. R., Grimont, P. A. D., Kandler, 0., Krichevsky, M. I., Moore, L. H., Moore, W. E. C, Murray, R. G. E., Stackebrandt, E., Starr, M. P. and Truper, H. G. (1987) Report of the ad hoc committee on reconciliation of approaches to bacterial systematics, Int. J. Syst. Bacterid. 37: 463-464.
Zhilina, T.N., Garnova, E. S., Tourova, T. P., Kostrikina, N. A. and Zavarzin, G. A. (2001) Amphibacillus fermentum sp . nov., Amphibacillus tropicus sp . nov., new alkaliphilic, facultatively anaerobic, saccharolytic bacilli from Lake Magadi, Microbiology (English translation of Mikrobiologiia) 70: 711-722.
Zhilina, T.N., Garnova, E. S., Tourova, T. P., Kostrikina, N. A. and Zavarzin, G. A. (2002) Amphibacillus fermentum sp . nov. and Amphibacillus tropicus sp . nov. In Validation of Publication of New Names and New Combinations Previously Effectively Published Outside the IJSEM, List no. 85, Int. J. Syst. Evol. Microbiol. 52: 685-690. SEQ ID NO : 1
(1) GENERAL INFORMATION: (i) APPLICANT:
(A) NAME: University of Copenhagen
(B) STREET:
(C) CITY:
(D) COUNTRY: (E) POSTAL CODE:
(ii) TITLE OF INVENTION: Cold-active beta-galactosidase, a method of producing same and use of such enzyme (iϋ) NUMBER OF SEQUENCES: 10
(2) INFORMATION FOR SEQ ID NO: 1
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1,041 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: Not relevant
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION SEQ ID NO: 1
1 10 Met Ala Lys Lys Leu Lys Lys Phe Asn Tyr Leu Pro Pro Lys Asn
20 30
GIy Tyr Pro GIu Trp Asn Asn Asn Pro GIu lie Phe GIn Leu Asn 40
Arg Arg GIu Ala His Ala Thr Leu VaI Pro Tyr Ser Asn Leu GIu
50 60
Leu Ala Leu Lys GIy GIu Arg Thr Ala Ser Ser Phe Tyr GIn Ser
70 Leu Asn GIy Ser Trp GIn Phe Ala Phe Ala GIn GIu Pro Thr Lys
80 90 Arg VaI lie Asp Phe Tyr Arg Lys Asp Phe Asp His Arg Asp Trp
100 Asp Ser lie Lys VaI Pro Ser His Trp GIn Leu GIu GIy Tyr Asp
110 120
Tyr Pro GIn Tyr Thr Asn Thr Thr Tyr Pro Trp VaI GIu Lys GIu
130
Thr lie Lys Pro Pro Phe Ala Pro Thr Asn Tyr Asn Pro VaI GIy
140 150 GIn Tyr VaI Arg Thr Phe GIu Leu Pro Thr Asp Trp Asn GIy Ala
160
Pro VaI Tyr Leu Asn Phe GIn GIy VaI GIu Ser Ala Phe Tyr VaI 170 180
Trp lie Asn GIy Asp Leu VaI GIy Tyr Ser GIu Asp Thr Phe Thr
190
Pro Ala GIu Phe Asp lie Thr Pro Tyr Leu lie GIu GIy GIu Asn
200 210
Lys Leu Ala VaI GIu VaI Tyr Arg Trp Ser Asp Ala Ser Trp Leu
220 GIu Asp GIn Asp Phe Trp Arg Leu Ser GIy lie Phe Arg Asp VaI
230 240
Tyr Leu Tyr Ala Thr Pro Ala GIn His lie Asp Asp Phe Phe VaI 250
Thr His GIu Leu Asp Ala Asp Tyr Arg Asn Ala Thr Leu Lys lie
260 270
Asp Met Lys VaI Arg Asp Tyr Phe GIu He GIy GIu Pro VaI Thr
280
VaI Asn Ala Met Leu Phe Asp Leu Asn GIy Asn Pro VaI Leu Lys
290 300 GIn Pro Leu Leu Ser Ala VaI Asp Phe Ser GIy Lys GIu VaI Ala
310
Asp VaI Ser VaI He Thr Thr He Asp Asn Pro Leu Lys Trp Ser 320 330
Ala GIu Asp Pro Asn Leu Tyr Thr Leu VaI Leu Ser Leu VaI Asp
340 GIn Asn GIy Lys Leu Leu GIu Thr GIu Ser Cys Arg VaI GIy Phe
350 360
Arg Lys Phe GIu Arg Lys Asp GIy Leu Met GIn lie Asn GIy Lys
370
Arg lie VaI Phe Lys GIy Thr Asn Arg His GIu Phe Ala Ser Asp
380 390 Lys GIy Arg Ala lie Thr lie Asp Asp Met VaI Asn Asp lie GIn
400
Leu Met Lys GIn His Asn lie Asn Ala VaI Arg Thr Ser His Tyr 410 420
Pro Asn His Pro Leu Trp Tyr GIu Leu Cys Asp Thr Tyr GIy Leu
430
Tyr VaI He Asp GIu Thr Asn Leu GIu Thr His GIy Thr Trp VaI
440 450
Tyr GIy GIn Lys GIy Leu Ala GIu Thr He Pro GIy Ser Leu Pro
460 Lys Trp Thr GIu Asn VaI Leu Asp Arg Cys Asn Ser Met Phe GIn
470 480
Arg Asp Lys Asn His Pro Ser He Leu Asp Trp Ser Leu GIy Asn 490
GIu Ser Phe GIy GIy Asp Asn Phe Leu Lys Met His Asp Phe Phe
500 510
Thr GIu GIn Asp Pro Ala Arg Leu VaI His Tyr GIu GIy He Phe
520
His Tyr Arg GIu Ser GIu Arg Ala Ser Asp Met GIu Ser Thr Met
530 540 Tyr He Ser Pro GIu GIy He GIu Asp Tyr Ala Lys Lys Ala Thr
550
Lys GIu Thr Lys Pro Tyr He Leu Cys GIu Phe Ser His Ala Met 560 570
GIy Asn Ser Leu GIy Asn Phe Tyr Lys Tyr Thr GIu Leu Phe Asp
580 GIn Tyr Pro lie Leu GIn GIy GIy Phe lie Trp Asp Trp Lys Asp
590 600
GIn Ser Leu Leu Thr Lys Thr Ala GIy GIy Thr Pro Tyr Leu Ala
610
Tyr GIy GIy Asp Phe GIy GIu Ser Pro His Asp GIy Asn Phe Ala
620 630 GIy Asn GIy Leu He Phe GIy Asp GIy Lys VaI Ser Pro Lys He
640
Phe GIu VaI Lys Arg Cys Tyr GIn Asn VaI Asp Phe Lys Ala He 650 660
Asp Leu VaI His GIy GIn He GIu Leu Thr Asn Lys Tyr Leu Phe
670
Thr Asn Leu Ala Asp Tyr GIn Leu Asn Trp VaI He Thr Arg Asn
680 690
GIy Asp Ala He GIu Ser GIy Ala Thr Asn He Asn VaI Leu Pro
700 GIy GIu Lys Arg GIu VaI He Leu Asp Tyr Thr Phe Pro Thr GIy
710 720
VaI Cys Met Thr Asp GIu Tyr He Leu Thr Leu Arg Phe Ser GIu 730
Lys GIy Asp Arg Leu Trp Cys GIu Ala GIy His GIu VaI Ala Phe
740 750
Asn GIn Phe VaI Leu Pro Thr Lys VaI Thr Lys Leu Arg GIu Lys
760
Thr GIn Asp Thr Lys Thr Leu Ser VaI GIu VaI Met GIn Asp Arg
770 780 Leu VaI Thr Ser GIy Ala GIy Phe Ser VaI GIy Phe Asp Thr Lys
790
Ser GIy Met Leu VaI Ser Tyr GIn VaI GIy GIy Asn GIu Leu VaI 800 810
Lys GIu Ala Leu VaI Pro Asn Phe Trp Arg Ala Met Thr Asp Asn
820 Asp Arg GIy Asn GIy Leu Asp GIn Arg Ser GIn lie Trp Arg Asp
830 840
Ala Asn GIu VaI Arg GIu Leu VaI Ser Phe GIn Tyr GIu VaI Leu
850 Thr Asn Arg VaI Ser lie Ser Thr VaI Phe Leu Tyr GIu Asp Leu
860 870 Asn His Ser Arg VaI GIu Leu Asn Phe Leu He Thr GIy Thr GIy
880 GIu He Lys VaI Asp Tyr VaI Leu Lys Pro GIy GIu Asp Leu Pro 890 900
GIu He Pro GIu He GIy Leu Met Leu Thr Met Pro Lys Ser Phe
910
Asp GIn Leu Ser Trp Tyr GIy Lys GIy Pro His GIu Ser Tyr Trp
920 930
Asp Lys GIn Lys GIy Ala Lys He GIy Leu Tyr GIn GIy Phe VaI
940 GIy Asp GIn Tyr VaI Pro Tyr Leu Lys Pro GIn GIu Cys GIy Asn
950 960
Lys VaI GIy VaI Arg Ser Ala GIu Leu VaI Asn Asp VaI GIy VaI 970
GIy Leu He He Ser GIy Leu Pro Thr Leu GIu Leu Asn VaI Leu
980 990
Pro Tyr Thr Pro VaI GIn Leu GIu Ser Ala Asp His Ser Tyr GIn
1000 Leu Pro GIu Thr Asp GIn Thr VaI VaI Arg He Asn Leu GIy GIn
1010 1020 Met GIy VaI GIy GIy Asp Asp Ser Trp GIy GIn Arg Thr His GIn
1030 Asp Phe Thr Leu Phe Ala Asn Lys Thr Tyr His Tyr Ser Phe Met 1040
Leu Asn Ser Leu Asn Arg SEQ ID NO : 2
(2) INFORMATION FOR SEQ ID NO: 2 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3, 123nucleotides
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: genomic DNA
(xi) SEQUENCE DESCRIPTION SEQ ID NO: 2
ATGGCAAAAA AATTAAAAAA ATTCAACTAC CTCCCACCAA AAAACGGGTA 50
CCCAGAGTGG AATAATAATC CGGAAATTTT TCAACTTAAT CGAAGAGAGG 100 CGCATGCAAC ATTGGTGCCA TATTCTAATT TGGAATTGGC ACTTAAAGGG 150
GAGCGGACAG CATCATCATT TTATCAATCT TTAAATGGTA GTTGGCAGTT 200
TGCCTTTGCC CAAGAGCCAA CCAAGCGAGT GATAGATTTT TATCGGAAAG 250
ATTTTGATCA TCGCGATTGG GATTCGATTA AAGTACCAAG TCATTGGCAG 300
TTAGAAGGCT ATGACTACCC GCAATACACC AACACAACGT ACCCATGGGT 350 AGAAAAAGAA ACGATTAAAC CTCCATTTGC ACCAACAAAT TATAATCCAG 400
TCGGACAATA TGTTCGCACG TTTGAATTAC CGACTGATTG GAATGGAGCT 450
CCCGTTTATC TGAATTTCCA AGGTGTTGAA TCAGCTTTCT ACGTCTGGAT 500
AAATGGTGAT TTGGTCGGAT ACAGTGAGGA CACTTTCACA CCAGCTGAAT 550
TTGATATAAC TCCCTATTTA ATAGAGGGTG AAAATAAGCT AGCGGTAGAA 600 GTCTATCGTT GGAGTGATGC GAGCTGGCTT GAAGACCAGG ATTTCTGGAG 650
GTTAAGCGGG ATTTTTCGTG ACGTCTATCT ATATGCAACA CCAGCTCAGC 700
ACATTGATGA TTTCTTTGTC ACACACGAAC TTGATGCAGA CTATCGAAAT 750
GCAACGTTGA AGATTGATAT GAAAGTGCGC GATTATTTCG AGATTGGCGA 800
GCCTGTCACA GTTAATGCGA TGCTCTTTGA TCTTAATGGG AATCCGGTTC 850 TCAAGCAACC GCTTTTATCG GCAGTAGATT TTTCAGGTAA AGAAGTTGCT 900
GATGTGAGCG TAATAACAAC AATTGATAAT CCATTGAAAT GGAGTGCGGA 950 AGATCCCAAT CTGTACACTT TGGTTTTAAG TTTAGTTGAT CAGAATGGCA 1000
AGTTGCTTGA AACAGAAAGC TGTCGCGTTG GATTTCGTAA ATTTGAACGC 1050
AAGGACGGAT TGATGCAAAT TAATGGAAAG CGGATTGTCT TTAAAGGGAC 1100
AAATCGTCAC GAATTCGCTT CTGATAAAGG TCGGGCGATA ACGATAGATG 1150
ATATGGTTAA TGATATTCAG CTGATGAAGC AGCATAACAT TAATGCCGTT 1200 CGAACCTCAC ATTATCCGAA TCATCCGCTT TGGTATGAGT TGTGTGATAC 1250
GTATGGGTTA TATGTGATTG ACGAGACAAA CTTAGAGACG CACGGGACAT 1300
GGGTTTATGG TCAAAAAGGA TTGGCTGAGA CAATACCAGG TAGTCTACCA 1350
AAGTGGACTG AAAACGTCTT GGATCGTTGT AATTCAATGT TCCAACGTGA 1400
TAAAAACCAC CCATCGATTC TGGATTGGTC ACTTGGTAAT GAATCTTTTG 1450 GTGGCGATAA CTTCTTGAAG ATGCATGACT TCTTTACGGA ACAAGATCCA 1500
GCTCGTCTGG TGCACTATGA GGGGATTTTT CATTATCGTG AATCTGAACG 1550
GGCATCTGAT ATGGAGAGTA CCATGTATAT TTCGCCAGAA GGCATTGAGG 1600
ACTATGCAAA GAAAGCGACC AAGGAGACGA AACCATATAT TTTATGCGAA 1650
TTCAGCCATG CGATGGGCAA CTCGCTAGGA AACTTTTATA AGTATACCGA 1700 GCTATTTGAT CAATATCCGA TCTTACAAGG AGGCTTCATT TGGGATTGGA 1750
AGGATCAATC GCTGCTAACG AAGACAGCAG GAGGCACACC GTATCTTGCT 1800
TATGGTGGTG ATTTTGGTGA ATCGCCACAC GACGGCAACT TTGCTGGTAA 1850
TGGTTTGATT TTTGGAGATG GCAAGGTTAG CCCGAAGATT TTTGAAGTGA 1900
AGCGTTGTTA CCAAAATGTT GATTTCAAAG CAATAGACTT AGTGCACGGA 1950 CAAATCGAAT TGACCAATAA ATACTTGTTC ACCAATCTCG CTGACTACCA 2000
ACTAAATTGG GTTATCACTC GAAACGGTGA TGCAATAGAG TCGGGTGCTA 2050
CTAACATCAA TGTCTTACCA GGTGAAAAAA GAGAGGTTAT ACTTGACTAC 2100 ACGTTCCCAA CAGGCGTTTG CATGACGGAT GAATATATTT TGACCCTTCG 2150
TTTTTCTGAG AAAGGTGATC GCTTATGGTG TGAAGCGGGA CATGAAGTTG 2200
CATTTAATCA GTTTGTTTTA CCAACAAAAG TTACGAAATT ACGTGAGAAG 2250
ACACAAGATA CCAAGACGCT TTCAGTTGAA GTAATGCAAG ATCGACTTGT 2300 TACATCTGGT GCTGGATTTA GCGTCGGATT TGACACTAAA TCGGGTATGC 2350
TTGTTTCTTA CCAAGTTGGA GGTAATGAAT TGGTGAAAGA GGCACTTGTG 2400
CCAAACTTCT GGCGTGCAAT GACTGATAAT GATCGCGGGA ACGGACTCGA 2450
TCAACGGAGT CAGATTTGGC GTGATGCAAA TGAGGTACGT GAATTGGTTT 2500
CATTTCAGTA TGAAGTGTTG ACCAATAGAG TAAGCATATC AACGGTTTTC 2550 TTATATGAAG ACCTCAACCA TTCACGCGTT GAACTTAACT TTTTGATTAC 2600
TGGAACTGGT GAAATAAAGG TGGATTATGT ACTGAAACCG GGAGAAGATT 2650
TACCAGAAAT ACCAGAGATA GGTTTGATGT TAACGATGCC TAAGTCGTTT 2700
GATCAGTTAA GTTGGTATGG AAAAGGCCCA CATGAATCGT ATTGGGATAA 2750
ACAAAAAGGC GCGAAAATAG GTCTTTATCA AGGATTTGTC GGCGATCAGT 2800 ATGTGCCGTA TTTGAAACCA CAAGAATGTG GCAACAAAGT AGGAGTTCGT 2850
TCAGCAGAAT TGGTTAATGA TGTTGGTGTT GGTTTGATTA TAAGTGGACT 2900
TCCAACGCTG GAGTTAAATG TCTTACCATA CACACCAGTG CAACTGGAAT 2950
CAGCTGATCA TAGCTATCAA TTACCAGAAA CAGATCAGAC TGTTGTGCGT 3000
ATTAATTTAG GACAAATGGG AGTTGGTGGT GATGATAGTT GGGGACAGCG 3050 AACACACCAA GACTTTACCT TATTTGCAAA TAAAACCTAT CACTATAGCT 3100
TCATGTTGAA TAGTTTAAAC AGA 3123 SEQ ID NO : 3
(2) INFORMATION FOR SEQ ID NO: 3 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 nucleotides
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: synthetic DNA
(xi) SEQUENCE DESCRIPTION SEQ ID NO: 3 CCGTCATCCA TATCACC
SEQ ID NO: 4 (2) INFORMATION FOR SEQ ID NO: 4
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 nucleotides
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: synthetic DNA (xi) SEQUENCE DESCRIPTION SEQ ID NO: 4 CCTTTGCCCA AGAGCCAACC
SEQ ID NO: 5
(2) INFORMATION FOR SEQ ID NO: 5
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 nucleotides
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: synthetic DNA
(xi) SEQUENCE DESCRIPTION SEQ ID NO: 5 GCTATTATCA GACTTGGCAC C SEQ ID NO : 6 (2) INFORMATION FOR SEQ ID NO: 6
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 nucleotides
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: synthetic DNA (xi) SEQUENCE DESCRIPTION SEQ ID NO: 6 GTAATTCAAT GTTCCAACGT G
SEQ ID NO: 7
(2) INFORMATION FOR SEQ ID NO: 7
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 16 nucleotides
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: synthetic DNA
(xi) SEQUENCE DESCRIPTION SEQ ID NO: 7
CGCTTATGGT GTGAAG
SEQ ID NO: 8
(2) INFORMATION FOR SEQ ID NO: 8
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 nucleotides
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: synthetic DNA
(xi) SEQUENCE DESCRIPTION SEQ ID NO: 8 GGGCTGGCTT AACTATGCGG
SEQ ID NO: 9
(2) INFORMATION FOR SEQ ID NO: 9
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 nucleotides
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: synthetic DNA
(xi) SEQUENCE DESCRIPTION SEQ ID NO: 9
CTGAATTCGC ATATGGCAAA AAAATTAAAA AAATTC
SEQ ID NO: 10
(2) INFORMATION FOR SEQ ID NO: 10
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 nucleotides
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: synthetic DNA
(xi) SEQUENCE DESCRIPTION SEQ ID NO: 10
CCAAGCTTAT CTGTTTAAAC TATTCAACAT G
SEQ ID NO: 11 (2) INFORMATION FOR SEQ ID NO: 11
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 nucleotides
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: synthetic DNA (xi) SEQUENCE DESCRIPTION SEQ ID NO: 11
GGCCATGGAT CCATGGCAAA AAAATTAAAA AAATTC
SEQ ID NO: 12
(2) INFORMATION FOR SEQ ID NO: 12 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 nucleotides
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: synthetic DNA
(xi) SEQUENCE DESCRIPTION SEQ ID NO: 12 GGCCATCCCG GGTTATCTGT TTAAACTATT CAACATG

Claims

1. A purified cold-active beta-galactosidase having the amino acid sequence as defined in SEQ ID NO. 1 or one having at least 80% homology to the amino acid sequence as defined in SEQ ID NO. 1, the amino acid sequence being selected so that the enzyme has a stable enzymatic activity at temperatures less than 8 0C.
2. A beta-galactosidase according to claim 1, wherein the amino acid sequence has at least 90%, preferably 95%, homology to the amino acid sequence as defined in SEQ ID NO. 1.
3. A beta-galactosidase according to claim 1 or 2, wherein it is produced by a strain of an Alkalilactibacillus .
4. A beta-galactosidase according to claim 1, 2 or 3, wherein it is produced by Alkalilactibacillus ikkense.
5. An isolated DNA sequence comprising a gene which encodes the beta-galactosidase according to any one of claims 1 to 4.
6. An isolated DNA sequence, which a) encodes a protein with an amino acid sequence as given in SEQ ID NO. 2, or b) hybridises under stringent conditions to the sequence of a) , or c) is degenerative of the sequence of a) or b)
7. A DNA sequence according to claim 6, wherein the sequence is as given in SEQ ID NO. 2.
8. A recombinant vector comprising a DNA sequence of any one of claims 5 to 7.
9. A vector of claim 8, wherein said vector is an expression vector.
10. A host cell transformed with a vector of claim 8 or 9.
11. A cell according to claim 10, wherein the cell is selected from the group consisting of Escherichia, Bacillus , Bifidobacterium, Lactococcus , Lactobacillus , Streptomyces , Leuconostoc, Streptomyces , Saccharomyces , Kluyveromyces , Candida, Torula, Torulopsis and Aspergillus .
12. A cell of claim 11, wherein the cell is selected from the group consisting of Bifidobacterium breve, Bifidobacterium longum, Bifidobacteriuminfantis, Bifidobacterium bifidum, Bifidobacterium animalis, and Lactococcus lactis.
13. Use of a cell of any one of claims 10 to 12 for producing a product selected from the group consisting of lactose-free milk, low-lactose milk, yoghurt, cheese, fermented milk products, dietary supplement and probiotic comestible product.
14. Use according to claim 13 for producing a dairy product with a lactose concentration at 1% or lower.
15. Use according to claim 14, wherein the lactose concentration is 0.1% or lower.
16. Use according to claim 15, wherein the lactose concentration is 0.01% or lower.
17. Use of a beta-galactosidase according to any one of claims 1 to 4 for producing a product selected from the group consisting of lactose-free milk, low-lactose milk, yoghurt, cheese, fermented milk products, dietary supplement and probiotic comestible product.
18. Use according to claim 17 for producing a dairy product with a lactose concentration at 1% or lower.
19. Use according to claim 18, wherein the lactose concentration is 0.1% or lower.
20. Use according to claim 19, wherein the lactose concentration is 0.01% or lower.
21. A process for producing an enzyme of any one of claims 1 to 4, comprising culturing a cell of any one of claims 10 to 12 in a suitable culture medium under conditions permitting expression of said enzyme, and recovering the resulting enzyme from the culture.
22. A process according to claim 21, wherein the resulting enzyme is immobilized.
23. A process for hydrolysis of lactose, comprising contacting of an enzyme of any of the claims 1 to 4 or a cell of any one of the claims 10 to 12 with a solution of lactose.
24. A psychrophilic bacterium Alkalilactibacillus ikkense BCCM Accession No LMG P-24866 and variants and mutants derived therefrom capable of producing a cold-active beta galactosidase defined by claim 1 or 2.
PCT/EP2010/051596 2009-02-10 2010-02-09 Cold-active beta-galactosidase, a method of producing same and use of such enzyme Ceased WO2010092057A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA2751957A CA2751957C (en) 2009-02-10 2010-02-09 Cold-active beta-galactosidase, a method of producing same and use of such enzyme
US13/148,853 US8288143B2 (en) 2009-02-10 2010-02-09 Cold-active beta-galactosidase, a method of producing same and use of such enzyme
EP10703071.0A EP2396403B8 (en) 2009-02-10 2010-02-09 Cold-active beta-galactosidase, a method of producing same and use of such enzyme
DK10703071.0T DK2396403T3 (en) 2009-02-10 2010-02-09 COLD-ACTIVE beta-galactosidase, MANUFACTURING METHOD THEREOF AND USE OF SUCH ENZYME
CN201080012589.7A CN102361974B (en) 2009-02-10 2010-02-09 Cold-active beta-galactosidase, method for its production, and use of said enzyme

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US15120809P 2009-02-10 2009-02-10
US61/151,208 2009-02-10
US17695609P 2009-05-11 2009-05-11
US61/176,956 2009-05-11

Publications (1)

Publication Number Publication Date
WO2010092057A1 true WO2010092057A1 (en) 2010-08-19

Family

ID=42105847

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2010/051596 Ceased WO2010092057A1 (en) 2009-02-10 2010-02-09 Cold-active beta-galactosidase, a method of producing same and use of such enzyme

Country Status (6)

Country Link
US (1) US8288143B2 (en)
EP (1) EP2396403B8 (en)
CN (1) CN102361974B (en)
CA (1) CA2751957C (en)
DK (1) DK2396403T3 (en)
WO (1) WO2010092057A1 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102220301A (en) * 2011-05-30 2011-10-19 云南师范大学 Alkali-resistant low-temperature alpha-galactosidase AgaAJB13 and genes thereof
EP2530148A1 (en) 2011-05-30 2012-12-05 B.R.A.I.N. Biotechnology Research And Information Network AG Novel beta-galactosidases useful for the production of lactose depleted milk products
EP3228704A4 (en) * 2014-12-05 2018-05-16 Godo Shusei Co., Ltd. Lactase solution and dairy product using same
WO2018189224A1 (en) 2017-04-11 2018-10-18 Chr. Hansen A/S Lactase enzymes with improved properties
WO2018189238A1 (en) 2017-04-11 2018-10-18 Chr. Hansen A/S Lactase enzymes with improved properties
WO2018189242A1 (en) 2017-04-11 2018-10-18 Chr. Hansen A/S Lactase enzymes with improved activity at low temperatures
WO2021037986A1 (en) 2019-08-30 2021-03-04 Chr. Hansen A/S Production of lactase enzymes using altered regulation strains
US12435326B2 (en) 2017-04-11 2025-10-07 Kerry Group Services International Ltd Lactase enzymes with improved properties
RU2858733C1 (en) * 2024-12-27 2026-03-24 Федеральное государственное бюджетное образовательное учреждение высшего образования "Московский государственный университет имени М.В. Ломоносова" (МГУ) RECOMBINANT PLASMID pKLAC3_bac2Gal, ENSURING SYNTHESIS OF BETA-GALACTOSIDASE OF MICROBACTERIUM sp. BACTERIA bac2Gal (Mbac2Gal) IN KLUYVEROMYCES LACTIS CELLS, AND RECOMBINANT STRAIN KLUYVEROMYCES LACTIS GG799/Gal4::bac2Gal VKPM Y-5264 - PRODUCER OF bac2Gal

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101619863B1 (en) * 2014-05-23 2016-05-24 주식회사 제노포커스 New beta-galactosidase
EP3778625A4 (en) * 2018-04-05 2022-02-09 Godo Shusei Co., Ltd. ENZYME DERIVED FROM P AENIBACILLUS PABULI AND CAPABLE OF PRODUCING A GALACTO-OLIGOSACCHARIDE, AND METHOD FOR PRODUCING A GALACTO-OLIGOSACCHARIDE
BR112021007244A2 (en) * 2018-10-17 2021-08-10 Chr. Hansen A/S lactase enzymes with improved properties in acidic ph
CN112626052B (en) * 2020-12-09 2021-11-19 山东隆科特酶制剂有限公司 Polygalacturonase mutant with improved thermal stability and application thereof
CN113637660B (en) * 2021-08-05 2023-09-08 云南师范大学 A kind of β-galactosidase GalNC3-89 and its preparation method and application
CN113621550B (en) * 2021-09-23 2022-06-21 武汉瀚海新酶生物科技有限公司 Culture medium for producing alkaline phosphatase by fermentation and preparation method of alkaline phosphatase

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001004276A1 (en) * 1999-07-09 2001-01-18 Universite De Liege Cold-active beta galactosidase, the process for its preparation and the use thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001004276A1 (en) * 1999-07-09 2001-01-18 Universite De Liege Cold-active beta galactosidase, the process for its preparation and the use thereof

Non-Patent Citations (31)

* Cited by examiner, † Cited by third party
Title
CASHION, P.; HODLER-FRANKLIN, M.A.; MCCULLY, J.; FRANKLIN, M.: "A rapid method for base ratio determination of bacterial DNA", ANAL. BIOCHEM., vol. 81, 1977, pages 461 - 466, XP024822009, DOI: doi:10.1016/0003-2697(77)90720-5
CIESLINSKI, H.; KUR, J.; BIALKOWSKA, A.; BARAN, I.; MAKOWSKI, K.; TURKIEWICZ, M.: "Cloning and expression, and purification of a recombinant cold-adapted P-galactosidase from Antarctic bacterium Pseudoalteromonas sp. 22b", PROT. EXPRES. PURIFIC., 2005
COKER, J.A.; SHERIDAN, P.P.; LOVELAND-CURTZE, J.; GUTSHALL, K.R.; AUMAN, A.; BRENCHLEY, J.E.: "Biochemical characterization of a P-galactosidase with low temperature optimum obtained from an Arctic Arthrobacter isolate", J. BACTERIOL., vol. 185, 2003, pages 5473 - 5482
COOMBS, J.M.; BRENCHLEY, J.E.: "Biochemical and phylogenetical analysis of a cold-active ?-galactosidase from the lactic acid bacterium Carnobacterium piscicola BA.", APPL. ENVIRON. MICROBIOL., vol. 65, 1999, pages 5443 - 5460
DATABASE EMBL [online] 13 April 2009 (2009-04-13), "Alkalilactibacillus ikkense strain 517 beta-galactosidase gene, partial cds.", XP002579363, retrieved from EBI accession no. EMBL:FJ811841 Database accession no. FJ811841 *
DE LEY, J.; CATTOIR, H.; REYNAERTS, A.: "The quantitative measurement of DNA hybridization from renaturation rates", EUR. J. BIOCHEM., vol. 12, 1970, pages 133 - 142, XP055093106, DOI: doi:10.1111/j.1432-1033.1970.tb00830.x
FERNANDES, S.; GEUEKE, B.; DELGADO, 0.; COLEMAN, J.; HATTI-KAUL, R.: "p-galactosidase from a cold-adapted bacterium: purification, characterization and application for lactose hydrolysis", APPL. MICROBIOL. BIOTECHNOL., vol. 58, 2002, pages 313 - 321
GEBLER, J.C.; AEBERSOLD, R.; WITHERS, S.G.: "Glu-537, not Glu-461, is the nucleophile in the active site of (lac Z) beta-galactosidase from Escherichia coli", J. BIOL CHEM, vol. 267, 1992, pages 11126 - 11130
HANS P SÖRENSEN ET AL: "Secreted [beta]-galactosidase from a Flavobacterium sp. isolated from a low-temperature environment", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, SPRINGER, BERLIN, DE LNKD- DOI:10.1007/S00253-005-0153-0, vol. 70, no. 5, 1 May 2006 (2006-05-01), pages 548 - 557, XP019332151, ISSN: 1432-0614 *
HOYOUX, A.; JENNES, I.; DUBOIS, P.; GENICOT, S.; DUBAIL, F.; FRANCOIS, J.M.; BAISE, E.; FELLER, G.; GERDAY, C.: "Cold-adapted P-galactosidase from the Antarctic psychrophile Pseudoalteromonas haloplanktis", APPL. ENVIRON. MICROBIOL., vol. 67, 2001, pages 1529 - 1535
HUSS, V.A.R.; FESTL, H.; SCHLEIFER, K.H.: "Studies on the spectrophotometric determination of DNA hybridization from renaturation rates", SYST. APPL. MICROBIOL., vol. 4, 1983, pages 184 - 192, XP009175122
ISHIKAWA, M.; ISHIZAKI, S.; YAMAMOTO, Y.; YAMASATO, K.: "Paraliobacillus ryukyuensis gen. nov., sp. nov., a new Gram-positive, slightly halophilic, extremely halotolerant, facultative anaerobe isolated from a decomposing marine alga", J. GEN. APPL. MICROBIOL., vol. 48, 2002, pages 269 - 279
ISHIKAWA, M.; NAKAJIMA, K.; ITAMIYA, Y.; FURUKAWA, S.; YAMAMOTO, Y.; YAMASATO K.: "Halolactibacillus halophilus gen. nov., sp. nov. and Halolactibacillus miurensis sp. nov., halophilic and alkaliphilic marine lactic acid bacteria constituting a phylogenetic lineage in Bacillus rRNA group 1", INT. J. SYST. EVOL. MICROBIOL., vol. 55, 2005, pages 2427 - 2439
JORGENSEN F; HANSEN OC; STOUGAARD P: "Enzymatic conversion of D-galactose to D-tagatose: Heterologous expression and characterisation of a thermostable L- arabinose isomerase from Thermoanaerobacter mathranii", APPL. ENVIRON. MICROBIOL., vol. 64, 2004, pages 816 - 822, XP002499985, DOI: doi:10.1007/S00253-004-1578-6
JOURNAL OF BACTERIOLOGY 200309 US LNKD- DOI:10.1128/JB.185.18.5473-5482.2003, vol. 185, no. 18, September 2003 (2003-09-01), pages 5473 - 5482, XP002579364, ISSN: 0021-9193 *
KARASOVÁ-LIPOVOVÁ, P.; STRNAD, H.; SPIWOK, V.; MALA, S; KRÁLOVÁ, B.; RUSSELL, N.: "The cloning, purification and characterization of a cold-active P-galactosidase from the psychrotolerant Antactic bacterium Arthrobacter sp. C2-2", ENZYME MICROBIOL. TECHNOL., vol. 33, 2003, pages 836 - 844
LANE,D.J.: "Nucleic acid techniques in bacterial systematics", 1991, WILEY, article "16S/23S rRNA sequencing, In: E. Stackebrandt", pages: 115 - 175
MANIATIS, T.; FRITSCH, E. F; SAMBROOK, J.: "Molecular cloning : a laboratory manual.", 1982, COLD SPRING HARBOR LABORATORY
MESBAH, M.; PREMACHANDRAN, U.; WHITMAN, W.: "Precise measurement of the G+C content of deoxyribonucleic acid by high performance liquid chromatography", INT. J. SYST. BACT., vol. 39, 1989, pages 159 - 167, XP008153656, DOI: doi:10.1099/00207713-39-2-159
NAKAGAWA, T.; FUJIMOTO, Y.; IKEHATA, R.; MIYAJI, T.; TOMIZUKA, N.: "Purification and molecular characterization of cold-active P-galactosidase from Arthrobacter psychrolactophilus strain F2", APPL. MICROBIOL. BIOTECHNOL., vol. 72, 2006, pages 720 - 725, XP019441633, DOI: doi:10.1007/s00253-006-0339-0
NAKAGAWA, T.; FUJIMOTO, Y.; UCHINO, M.; MIYAJI, T.; TAKANO, K.; TOMIZUKA, N.: "Isolation and characterization of psychrophiles producing cold-active P-galactosidase", LETT. APPL. MICROBIOL., vol. 37, 2006, pages 154 - 157
NAKAGAWA, T.; IKEHATA, R.; UCHINO, M.; MIJAJI, T.; TAKANO, K.; TOMIZUKA, N.: "Cold-active acid ?? galactosidase activity of isolated psychrophilic basidiomycetous yeast Guehomyces pulluland", MICROBIOL. RES., vol. 161, 2006, pages 75 - 79, XP028022039, DOI: doi:10.1016/j.micres.2005.07.003
NAKAYAMA ET AL.: "Bio-Jikken-Illustrated", vol. 2, 1995, SHUJUNSHA, article "Idenshi-Kaiseki-No-Kiso", pages: 148 - 151
SOROKIN , I.D.; ZADORINA, E.V.; KRAVCHENKO, I.K.; BOULYGINA, E.S.; TOUROVA, T.P.; SOROKIN, D.Y.: "Natronobacillus azotifigens gen. nov., sp. nov., an anaerobic diazotrophic haloalkalophile from soda-rich habitats", EXTREMOPHILES, vol. 12, 2008, pages 819 - 827, XP019660906, DOI: doi:10.1007/s00792-008-0188-0
STOLL, V.S.; BLANCHARD, J.S.: "Buffers: Principles and practice", METHODS ENZYMOL., vol. 182, 1990, pages 24 - 38, XP009188577
TURKIEWICZ, M.; KUR, J.; BIALKOWSKA, A.; CIESLINSKI, H.; KALINOWSKA, H.; BIELECKI, S.: "Antarctic marine bacterium Pseudoalteromonas sp. 22b as a source of cold-adapted P-galactosidase", BIOMOLEC. ENGINEER., vol. 20, 2003, pages 317 - 324, XP004446930, DOI: doi:10.1016/S1389-0344(03)00039-X
VAN DE PEER, Y.; DE WACHTER, R.: "TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment", COMPUT. APPL. BIOSCI., vol. 10, 1994, pages 569 - 570
WAIN0, M.; TINDALL, B.J.; SCHUMANN, P.; INGVORSEN, K.: "Gracilibacillus gen. nov., with description of Gracilibacillus halotolerans gen. nov., sp. nov.; transfer of Bacillus dipsosauri to Gracilibacillus dipsosauri comb. nov., and Bacillus salexigens to the genus Salibacillus gen. nov., as Salibacillus salexigens comb. nov.", INT. J. SYST. BACTERIOL., vol. 49, 1999, pages 821 - 831
WAYNE, L.G.; BRENNER, D.J.; COLWELL, R.R.; GRIMONT, P.A.D.; KANDLER, 0.; KRICHEVSKY, M.I.; MOORE, L.H.; MOORE, W.E.C.; MURRAY, R.G: "Report of the ad hoc committee on reconciliation of approaches to bacterial systematics", INT. J. SYST. BACTERIOL., vol. 37, 1987, pages 463 - 464
ZHILINA, T.N.; GARNOVA, E. S.; TOUROVA, T.P.; KOSTRIKINA, N.A.; ZAVARZIN, G.A.: "Amphibacillus fermentum sp. nov. and Amphibacillus tropicus sp. nov. In Validation of Publication of New Names and New Combinations Previously Effectively Published Outside the IJSEM, List no. 85", INT. J. SYST. EVOL. MICROBIOL., vol. 52, 2002, pages 685 - 690
ZHILINA, T.N.; GARNOVA, E. S.; TOUROVA, T.P.; KOSTRIKINA, N.A.; ZAVARZIN, G.A.: "Amphibacillus fermentum sp. nov., Amphibacillus tropicus sp. nov., new alkaliphilic, facultatively anaerobic, saccharolytic bacilli from Lake Magadi", MICROBIOLOGY, vol. 70, 2001, pages 711 - 722

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2530148A1 (en) 2011-05-30 2012-12-05 B.R.A.I.N. Biotechnology Research And Information Network AG Novel beta-galactosidases useful for the production of lactose depleted milk products
CN102220301A (en) * 2011-05-30 2011-10-19 云南师范大学 Alkali-resistant low-temperature alpha-galactosidase AgaAJB13 and genes thereof
US10368558B2 (en) 2014-12-05 2019-08-06 Godo Shusei Co., Ltd. Lactase solution and dairy product using same
EP3228704A4 (en) * 2014-12-05 2018-05-16 Godo Shusei Co., Ltd. Lactase solution and dairy product using same
US12369597B2 (en) 2017-04-11 2025-07-29 Kerry Group Services International Ltd Lactase enzymes with improved activity at low temperatures
US12486305B2 (en) 2017-04-11 2025-12-02 Kerry Group Services International Ltd Lactase enzymes with improved properties
WO2018189238A1 (en) 2017-04-11 2018-10-18 Chr. Hansen A/S Lactase enzymes with improved properties
CN110709411A (en) * 2017-04-11 2020-01-17 科·汉森有限公司 Lactase with improved performance
EP4674957A3 (en) * 2017-04-11 2026-04-01 Kerry Group Services International Limited Lactase enzymes with improved activity at low temperatures
EP4011906A3 (en) * 2017-04-11 2022-09-07 Chr. Hansen A/S Lactase enzymes with improved properties
US11525129B2 (en) 2017-04-11 2022-12-13 Chr. Hansen A/S Lactase enzymes with improved properties
US12215367B2 (en) 2017-04-11 2025-02-04 Kerry Group Services International Ltd Lactase enzymes with improved properties
WO2018189224A1 (en) 2017-04-11 2018-10-18 Chr. Hansen A/S Lactase enzymes with improved properties
US12435326B2 (en) 2017-04-11 2025-10-07 Kerry Group Services International Ltd Lactase enzymes with improved properties
WO2018189242A1 (en) 2017-04-11 2018-10-18 Chr. Hansen A/S Lactase enzymes with improved activity at low temperatures
EP4674957A2 (en) 2017-04-11 2026-01-07 Kerry Group Services International Limited Lactase enzymes with improved activity at low temperatures
WO2021037986A1 (en) 2019-08-30 2021-03-04 Chr. Hansen A/S Production of lactase enzymes using altered regulation strains
RU2858733C1 (en) * 2024-12-27 2026-03-24 Федеральное государственное бюджетное образовательное учреждение высшего образования "Московский государственный университет имени М.В. Ломоносова" (МГУ) RECOMBINANT PLASMID pKLAC3_bac2Gal, ENSURING SYNTHESIS OF BETA-GALACTOSIDASE OF MICROBACTERIUM sp. BACTERIA bac2Gal (Mbac2Gal) IN KLUYVEROMYCES LACTIS CELLS, AND RECOMBINANT STRAIN KLUYVEROMYCES LACTIS GG799/Gal4::bac2Gal VKPM Y-5264 - PRODUCER OF bac2Gal
RU2860395C1 (en) * 2024-12-27 2026-04-17 Федеральное государственное бюджетное образовательное учреждение высшего образования "Московский государственный университет имени М.В. Ломоносова" (МГУ) RECOMBINANT PLASMID pKLAC3_bac4Gal, PROVIDING SYNTHESIS OF BETA-GALACTOSIDASE FROM MICROBACTERIUM sp. BAC4GAL (Mbac4Gal) IN KLUYVEROMYCES LACTIS CELLS, AND RECOMBINANT STRAIN KLUYVEROMYCES LACTIS GG799/Gal4::bac4Gal VKPM Y-5263 - PRODUCER OF bac4Gal

Also Published As

Publication number Publication date
DK2396403T3 (en) 2016-01-11
CN102361974B (en) 2013-11-06
EP2396403B8 (en) 2015-11-18
US8288143B2 (en) 2012-10-16
CA2751957C (en) 2018-07-24
US20120058223A1 (en) 2012-03-08
EP2396403B1 (en) 2015-09-23
EP2396403A1 (en) 2011-12-21
CN102361974A (en) 2012-02-22
CA2751957A1 (en) 2010-08-19

Similar Documents

Publication Publication Date Title
US8288143B2 (en) Cold-active beta-galactosidase, a method of producing same and use of such enzyme
US12215367B2 (en) Lactase enzymes with improved properties
CA2645783C (en) Beta-galactosidase with transgalactosylating activity
CN110121267B (en) Process for producing fermented dairy products
CN112654251A (en) Lactase with improved properties at acidic pH
US12486305B2 (en) Lactase enzymes with improved properties
US12435326B2 (en) Lactase enzymes with improved properties
CN113692410A (en) Novel lactic acid bacterium
US12538929B2 (en) Production of lactase enzymes using altered regulation strains
RU2814542C2 (en) LACTASE ENZYMES WITH IMPROVED PROPERTIES AT ACIDIC pH
CN114072508A (en) Novel lactic acid bacterium
Srila et al. Cloning of beta-galactosidase gene from Lactobacillus delbrueckii subsp. bulgaricus TISTR 892 and expression in Escherichia coli.

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080012589.7

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10703071

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2010703071

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2751957

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 13148853

Country of ref document: US