WO2010080724A1

WO2010080724A1 - Novel lipid nanoparticles and novel components for delivery of nucleic acids

Info

Publication number: WO2010080724A1
Application number: PCT/US2010/020013
Authority: WO
Inventors: George D. Hartman; Chandra Vargeese; Weimin Wang
Original assignee: Merck Sharp & Dohme Corp.
Priority date: 2009-01-12
Filing date: 2010-01-04
Publication date: 2010-07-15

Abstract

The instant invention provides for novel lipid nanoparticles and novel lipid nanoparticle components (specifically cationic lipids) that are useful for the delivery of nucleic acids, specifically siRNA, for therapeutic purposes.

Description

TITLE OF THE INVENTION

NOVEL LIPID NANOPARTICLES AND NOVEL COMPONENTS FOR DELIVERY OF

NUCLEIC ACIDS

BACKGROUND OF THE INVENTION

The present invention relates to lipid nanoparticles, lipid nanoparticle components (specifically cationic lipids) and methods for delivering biologically active molecules in vitro and in vivo. Specifically, the invention relates to lipid nanoparticles, lipid nanoparticle components (specifically cationic lipids) and methods for delivering nucleic acids, polynucleotides, and oligonucleotides such RNA, DNA and analogs thereof, peptides_s polypeptides, proteins, antibodies, hormones and small molecules for therapeutic purposes. More specifically, the invention relates to lipid nanoparticles, lipid nanoparticle components (specifically cationic lipids) and methods for delivering siRNA and miRNA for therapeutic purposes. Cationic lipids and the use of cationic lipids in lipid nanoparticles for the delivery of biologically active molecules, in particular siRNA and miRNA, has been previously disclosed. (See US patent applications: US 2006/0240554 and US 2008/0020058). Lipid nanoparticles and the use of lipid nanoparticles for the delivery of biologically active molecules, in particular siRNA and miRNA, has been previously disclosed. (See US patent applications: US 2006/0240554 and US 2008/0020058). siRNA and the synthesis of siRNA has been previously disclosed. (See US patent applications: US 2006/0240554 and US 2008/0020058).

It is an object of the instant invention to provide novel lipid nanoparticles and novel lipid nanoparticle components (specifically cationic lipids) that are useful for the delivery of nucleic acids, specifically siRNA, for therapeutic purposes. The lipid nanoparticles of the instant invention provide unexpected properties, in particular, enhanced efficacy and decreased toxicity, relative to other lipid nanoparticles disclosed in patent applications US 2006/0240554, US 2008/0020058 and PCT/US08/002006.

SUMMARY OF THE INVENTION The instant invention provides for novel lipid nanoparticles and novel lipid nanoparticle components (specifically cationic lipids) that are useful for the delivery of nucleic acids, specifically siRNA, for therapeutic purposes.

DETAILED DESCRIPTION OF THE INVENTION The various aspects and embodiments of the invention are directed to the utility of novel lipid nanoparticles to deliver biologically active molecules, in particular, siRNA, to any target gene. (See US patent applications: US 2006/0240554 and US 2008/0020058). The lipid nanoparticle components (cationic lipids) of the instant invention are useful components in a lipid nanoparticle for the delivery of nucleic acids, specifically siRNA. One cationic lipid is:

Butyl-CLinDMA

2-{4-[(3β)-cholest-5-en-3-yloxy]butoxy}-iV_?N-dimethyl-3-[(9Z,12Z)-octadeca-9_!12-dien-l- yloxy]propan- 1 -amine.

Another cationic lipid is:

Butyl-CLinDMA (2R)

(2_JR)-2-{4-[(3β)-cholest-5-en-3-yloxy]butoxy}-Λ^r^dimethyl-3-[(9Z,12Z)-octadeca-9_!12-dien-l- yloxyjpropan- 1 -amine.

Another cationic lipid is:

Butyl-CLinDMA (2S)

(25)-2-{4-[(3β)-cholest-5-en-3-yIoxy]butoxy}-iV_y/V-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l- yloxy]propan- 1 -amine. LNP COMPOSITIONS

The following lipid nanoparticle compositions of the instant invention are useful for the delivery of nucleic acids, specifically siRNA: Butyl-CLϊnDMA / Cholesterol / PEG-DMG 60/38/2; Butyl-CLinDMA (2R) / Cholesterol / PEG-DMG 60/38/2; and Butyl-CLinDMA (2S) / Cholesterol / PEG-DMG 60/38/2.

The following lipid nanoparticle compositions of the instant invention are useful for the delivery of nucleic acids, specifically siRNA: Butyl-CLinDMA / Cholesterol / PEG-DMG 49.3/47/3.7; Butyl-CLinDMA (2R) / Cholesterol / PEG-DMG 49.3/47/3.7; and Butyl-CLinDMA (2S) / Cholesterol / PEG-DMG 49.3/47/3.7.

The following lipid nanoparticle compositions of the instant invention are useful for the delivery of nucleic acids, specifically siRNA: Butyl-CLinDMA / Cholesterol / PEG-DMG 50.3/44.3/5.4; Butyl-CLinDMA (2R) / Cholesterol / PEG-DMG 50.3/44.3/5.4; and Butyl-CLinDMA (2S) / Cholesterol / PEG-DMG 50.3/44.3/5.4.

In an embodiment, the invention features a lipid nanoparticle composition comprising one or more biologically active molecules (e.g., a polynucleotide such as a siRNA, siNA, antisense, aptamer, decoy, ribozyme, 2-5 A, triplex forming oligonucleotide, or other nucleic acid molecule), cationic lipid selected from Butyl-CLinDMA (2R) and Butyl-CLinDMA (2S) or combinations thereof, neutral lipid which is (PEG-DMG), and cholesterol.

In another embodiment, the invention features a lipid nanoparticle composition comprising one or more siRNA molecules, cationic lipid selected from Butyl-CLinDMA (2R) and Butyl-CLinDMA (2S) or combinations thereof, neutral lipid which is (PEG-DMG), and cholesterol.

In another embodiment, the invention features a lipid nanoparticle composition comprising one or more siRNA molecules, Butyl-CLinDMA (2R), PEG-DMG, and cholesterol.

In another embodiment, the invention features a lipid nanoparticle composition comprising one or more siRNA molecules, Butyl-CLinDMA (2S), PEG-DMG, and cholesterol. hi another embodiment, the invention features a lipid nanoparticle composition comprising siRNA molecules, cationic lipid selected from Butyl-CLinDMA (2R) and Butyl- CLinDMA (2S) or combinations thereof, neutral lipid which is (PEG-DMG). and cholesterol.

In another embodiment, the invention features a lipid nanoparticle composition comprising siRNA molecules, Butyl-CLinDMA (2R), PEG-DMG, and cholesterol

In another embodiment, the invention features a lipid nanoparticle composition comprising siRNA molecules, Butyl-CLinDMA (2S), PEG-DMG, and cholesterol. In another embodiment, the ratio of the lipids in the lipid nanoparticle composition has a mole percent range of 25-75 for the cationic lipid (Butyl-CLinDMA (2R) and Butyl-CLinDMA (2S)) with a target of 45-65, the cholesterol has a mole percent range from 30- 50 with a target of 30-50 and the PEG-DMG lipid has a mole percent range from 1-6 with a target of 1-5.

In another embodiment, the ratio of the lipids in the lipid nanoparticle composition has a mole percent range of 40-65 for the cationic lipid (Butyl-CLinDMA (2R) and Butyl-CLinDMA (2S)) with a target of 50-60, the cholesterol has a mole percent range from 30- 50 with a target of 38-48 and the PEG-DMG lipid has a mole percent range from 1-6 with a target of 1-5.

In another embodiment, the ratio of the lipids in the lipid nanoparticle composition has a mole percent range of 55-65 for the cationic lipid (Butyl-CLinDMA (2R) and Butyl-CLinDMA (2S)), the cholesterol has a mole percent range from 37-41 and the PEG-DMG lipid has a mole percent range from 1-3. PEG-DMG is known in the art. (See US patent applications: US 2006/0240554 and US 2008/0020058).

Cholesterol is known in the art. (See US patent applications: US 2006/0240554 and US 2008/0020058).

In another embodiment, the invention features a method for delivering or administering a biologically active molecule (in particular, an siRNA) to a cell or cells in a subject or organism, comprising administering a formulated molecular composition of the invention under conditions suitable for delivery of the biologically active molecule component of the formulated molecular composition to the cell or cells of the subject or organism. In one embodiment, the formulated molecular composition is contacted with the cell or cells of the subject or organism as is generally known in the art, such as via parental administration (e.g., intravenous, intramuscular, subcutaneous administration) of the formulated molecular composition with or without excipients to facilitate the administration.

In another embodiment, the invention features a method for delivering or administering a biologically active molecule (in particular, an siRNA) to liver or liver cells (e.g., hepatocytes), kidney or kidney cells, tumor or tumor cells, CNS or CNS cells (e.g., brain, spinal cord), lung or lung cells, vascular or vascular cells, skin or skin cells (e.g., dermis or dermis cells, follicle or follicular cells), eye or ocular cells (e.g., macula, fovea, cornea, retina etc.), ear or cells of the ear (e.g., inner ear, middle ear, outer ear), in a subject or organism, comprising administering a formulated molecular composition of the invention under conditions suitable for delivery of the biologically active molecule component of the formulated molecular composition to the above described cells of the subject or organism. The formulated molecular composition is contacted with the above described cells of the subject or organism as is generally known, in the art, such as via parental administration (e.g., intravenous, intramuscular, subcutaneous administration) or local administration (e.g., direct injection, direct dermal application, ionophoresis, intraocular injection, periocular injection, eye drops, implants, portal vein injection, pulmonary administration, catheterization, clamping, stenting etc.) of the formulated molecular composition with or without excipients to facilitate the administration. In another embodiment, the invention features a formulated siRNA composition comprising short interfering ribonucleic acid (siRNA) molecules that down-regulate expression of a target gene or target genes. siRNA molecules (chemically modified or unmodified) are known in the art. (See US patent applications: US 2006/0240554 and US 2008/0020058).

In another embodiment, the invention features a formulated siRNA composition comprising a double stranded short interfering ribonucleic acid (siRNA) molecule that directs cleavage of a target RNA via RNA interference (RNAi), wherein the double stranded siRNA molecule comprises a first and a second strand, each strand of the siRNA molecule is about 18 to about 28 nucleotides in length or about 18 to about 23 nucleotides in length, the first strand of the siRNA comprises nucleotide sequence having sufficient complementarity to the target RNA for the siRNA molecule to direct cleavage of the target RNA via RNA interference, and the second strand of said siRNA molecule comprises nucleotide sequence that is complementary to the first strand.

In another embodiment, the invention features a formulated siRNA composition comprising a chemically synthesized double stranded short interfering ribonucleic acid (siRNA) molecule that directs cleavage of a target RNA via RNA interference (RNAi), wherein each strand of the siRNA molecule is about 18 to about 23 nucleotides in length; and one strand of the siRNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA for the siRNA molecule to direct cleavage of the target RNA via RNA interference.

In another embodiment, the invention features a formulated siRNA composition comprising a siRNA molecule that down-regulates expression of a target gene, for example, wherein the target gene comprises a target encoding sequence, hi another embodiment, the invention features a siRNA molecule that down-regulates expression of a target gene, for example, wherein the target gene comprises a target non-coding sequence or regulatory elements involved in target gene expression. An siRNA molecule may be used to inhibit the expression of target genes or a target gene family, wherein the genes or gene family sequences share sequence homology. Such homologous sequences can be identified as is known in the art, for example using sequence alignments. siRNA molecules can be designed to target such homologous sequences, for example using perfectly complementary sequences or by incorporating non-canonical base pairs, for example mismatches and/or wobble base pairs that can provide additional target sequences, hi instances where mismatches are identified, non-canonical base pairs (for example, mismatches and/or wobble bases) can be used to generate siRNA molecules that target more than one gene sequence. In a non-limiting example, non-canonical base pairs such as UU and CC base pairs are used to generate siRNA molecules that are capable of targeting sequences for differing targets that share sequence homology. As such, one advantage of using siRNAs is that a single siRNA can be designed to include nucleic acid sequence that is complementary to the nucleotide sequence that is conserved between the homologous genes. In this approach, a single siRNA can be used to inhibit expression of more than one gene instead of using more than one siRNA molecule to target the different genes.

In another embodiment, the invention features a formulated siRNA composition comprising a siRNA molecule having RNAi activity against a target RNA, wherein the siRNA molecule comprises a sequence complementary to any RNA having target encoding sequence. Examples of siRNA molecules suitable for the formulations described herein are provided in International Application Serial Number US 04/106390 (WO 05/19453), which is hereby incorporated by reference in its entirety. Chemical modifications of siRNA are as described in PCT/US 2004/106390 (WO 05/19453), U.S. Ser. No. 10/444,853, filed May 23, 2003 U.S. Ser. No. 10/923,536 filed Aug. 20, 2004, U.S. Ser. No. 11/234,730, filed Sep. 23, 2005 or U.S. Ser. No. 11/299,254, filed Dec. 8, 2005, all incorporated by reference in their entireties herein.

An siRNA molecule may include a nucleotide sequence that can interact with a nucleotide sequence of a target gene and thereby mediate silencing of target gene expression, for example, wherein the siRNA mediates regulation of target gene expression by cellular processes that modulate the chromatin structure or methylation patterns of the target gene and prevent transcription of the target gene .

EXAMPLES

Examples provided are intended to assist in a further understanding of the invention. Particular materials employed, species and conditions are intended to be further illustrative of the invention and not limitative of the reasonable scope thereof. The reagents utilized in synthesizing the cationic lipids are either commercially available or are readily prepared by one of ordinary skill in the art.

SCHEME 1

Butyl-CLinDMA

Synthetic Scheme for the 2R, 2S, and diastereomeric mixture: NaOH {solid beads) cat Bu₄NBr a = racemic b= (R) C = (S)

1a,b,c

1,8-octaπediol dioxane, 9O⁰C

6a,b,c

Experimental Procedures:

(3β)-choϊest-5-en-3-yl 4-methyIbenzenesulfonate (3). To a solution of cholesterol (100 g, 259 mmol) in pyridine (1500 mL) was added tosyl chloride (74 g, 388 mmol). The reaction was stirred for 16 hours. The solvent was removed in vacuo. The residue was dissolved in ethyl acetate and filtered through a pad of celite. The solvent was removed in vacuo to yield the crude product as a residue. The residue was taken up in a small amount of DCM. Addition of methanol yielded a colorless precipitate. The product was collected by filtration through a Buchner funnel followed by rinses of cold methanol to give 122 g (87%) of (3 β)-cholest-5-en-3- yl 4-methylbenzenesulfonate (3) as colorless crystals. lH NMR (400 MHz, CDCI3) δ 7.79 (d, J

= 8.0 Hz₅ 2H), 7.32 (d, J = 8 Hz, 2H), 5.30 (m, IH), 4.32 (m, IH), 2.45 (m, 4H)₅ 2.25 (m, IH), 2.05 - 1.90 (m, 2H), 1.85 - 1.65 (m, 4H), 1.58 - 1.25 (m₅ 12H), 1.12 - 1.05 (m, 5H)₅ 1.04 - 0.94 (m, 10H)₅ 0.66 (s, 3H).

4-[(3β)-cholest-5-en-3-yloxyIbutan-l~ol (4). 1,4-Butanediol (233 g, 2589 mmol) was dissolved in 100 mL dioxane and heated to 9O⁰C until dissolution of solids was complete. To this solution was added a solution of 3 (70 g, 129 mmol) dissolved in 400 mL dioxane through an addition funnel. Afterlθ hours, the reaction was cooled and concentrated in vacuo. The residue was evaporated and reconstituted in EtOAc. The solution was washed with water (3 x 250 mL) to remove excess butanediol. The resulting solution dried over sodium sulfate and concentrated in vacuo to yield the crude product as a viscous oil. Purified using silica gel chromatography and a gradient of 0 - 100% ethyl acetate in hexanes to yield pure 4-[(3β)-cholest-5-en-3-yloxy]butan-l- ol (4) (38.5 g, 65%) as a colorless solid. lH NMR (400 MHz, CDCI3) δ 5.35 (m, 2H), 3.64 (m, IH) 3.53 (m. 2H), 3.17 (m, IH), 2.35 (m, IH)₅ 2.20 (m₅ IH), 2.03 - 1.79 (m, 5H)₅ 1.59 - 1.40 (m, 14H)₅ 1.33 (br s, 13H)₅ 1.22 - 1.05 (m, 10H), 1.00 (s, 4H)₅ 0.93 - 0.83 (m, 10H)₅ 0.67 (s, 3H).

4-[(3β)-cholest~5-en-3-yloxy] butyl meihanesulfonate (5). To a cooled (O⁰C) solution of 4_.(55 g, 120 mmol) and diisopropylethylamine (25 mL, 144 mmol) in 300 mL of DCM was added methanesulfonylchloride (11.14 mL, 144 mmol) dropwise over 25 minutes. The solution stirred for 15 minutes at O⁰C₅ and then was allowed to warm to 23⁰C over 1.5 hours. The reaction was quenched with brine and extracted with DCM (2x). The organic layers were combined, dried over sodium sulfate, and concentrated in vacuo to yield the crude product as a semisolid. The crude product was recrystallized from hot hexanes/EtOAc to yield pure 4-[(3β)-cholest-5-en-3- yioxy]butyl methanesulfonate (S) as colorless crystals. lH NMR (400 MHz, CDCI3) δ 5.34 (m, IH), 4.27 (t, J = 6.4 Hz, 2H) 3.65 (m, 2H) 3.44 (t, J = 6.4 Hz, 2H), 3.10 (m, 2H), 3.07 (s, 3H), 2.35 (m, IH)₉2.18 (m, IH), 2.03 - 1.94 (m, 2H), 1.89 - 1.78 (m, 5H), 1.71 - 1.60 (m, 4H), 1.60 - 1.40 (m. 14H), 1.39 - 1.20 (m, 4H), 1.20 - 1.05 (m, 7H), 1.03 - 0.98 (m, 6H), 0.93 - 0.83 (m, 10H), 0.67 (s, 3H).

(2R)-2-{[(9Z,12Z)-Octadeca-9,12-dien-l-yloxyJmethyl}oxirane (Ib). Linoleyl alcohol (48g, 180 mmol), sodium hydroxide (7.21 g, 180 mmol) and tetrabutylammonium bromide (2.90 g, 9.01 mmol) were combined in a 200 mL flask, stirred for 10 min, and then (R)-(-)- epichlorohydrin (21.19 ml, 270 mmol) was added. After 5 hours, 50% more of the chloride, hydroxide and salt were added and stirred overnight, then diluted with 1500 mL EtOAc and extracted with water, brine, dry (Na₂S(X), and filtered. Solvent was removed in vacuo, and hivac distilled through a 6" Vigreux column (mantle temp 300⁰C, head temp 145-155⁰C) to get 45.1 g (.140 mol, 78%) of (2Λ)-2-{[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]methyl}oxirane (Ib) as a water white oil. * H NMR (400 MHz, CDCI3) δ 5.40 (m, 4H), 3.70 (m, dd, J = 11.2, J = 2.8,

IH), 3.52 - 3.42 (m, 2H), 3.38 (m, IH), 3.14 (m, IH), 2.80 - 2.74 (m, 3H), 2.6 (m, IH), 2.10 (m, 4H), 1.60 (m, 2H), 1.40 ~ 1.22 (m, 16H), 0.88 (m, 3H).

(2iϊ)-l-(DimethyIammo)-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propaii-2-oI (2Jb). Ib (10 g,

31.0 mmol) was dissolved in 200 mL of a 5.6 M (33%) dimethylamine solution in ethanol and stirred overnight. The solvent was removed in vacuo to get 11.21 g (30.5 mmol, 98%) of (2R)-I - (dimethylanτino)-3-[(9Z_f12Z)-octadeca-9.12-dien-l-yloxy]propan-2-ol (2b) which was used without further purification. ¹H NMR (400 MHz, CDCI3) δ 5.44 - 5.28 (m, 4H), 3.84 (m, IH), 3.5 - 3.38 (m, 5H), 3.30 (s, IH), 2.77 (t, J = 6.4 Hz, 2H), 2.44 - 2.39 (m, IH), 2.30 - 2.21 (m, 7H)₅ 2.05 (m, 4H), 1.60 (m, 2H), 1.40 ~~ 1.26 (m, 16H), 0.88 (t, J = 7.2, 3H).

(2R)-2-{4-[(3β)-Cholest-5-en-3-yloxy]butoxy}-ΛyV-dimethyl-3-l(9Z,12Z)-octadeca-9,12-dien- l-yloxyjpropan-l-amine (6JbJ. 2b 15 g (40.8 mmol) of 2c was dissolved in 200 mL toluene and was reacted with sodium hydride (3.26 g, 82 mmol) for 45 minutes at 85⁰C. To this solution was added a solution of 5 (23 g, 42.8 mmol) in 200 mL toluene over 30 minutes. The reaction continued to stir at 85⁰C for 4 hours. The solution was cooled to RT and quenched slowly with drops of methanol. Decolorizing carbon was added, and the solution stirred for 2 hours. The solution was filtered through celite and concentrated in vacuo to yield a viscous oil, which was purified by normal phase chromatography (0 - 100% EtOAc in hexaes) over one hour to yield 22.9 g (28.3 mmol, 69%) (2iϊ>2-({4-[(3β)-cholest-5-en-3-yloxy]butyl}oxy)-N,N-dimethyl-3- [(9Z,12Z)-octadeca-9,12-dien4-yloxy]propan-l-amine (6b). ¹HKMR (400 MHz, CDCl₃) δ 5.34 (m, 4H), 3.60 - 3.41 (m, 8H), 3.12 (ΠJ, IH), 2.77 (t, J = 6.4 Hz, 2H), 2.41 - 2.33 (m, 2H), 2.25 (s, 6H), 2.17 - 2.15 (m, IH), 2.05 - 1.89 (m, 6H), 1.87 - 1.79 (m, 2H), 1.70 (s, 1 H) 1.60 - 1.40 (m, 12H), 1.40 - 1.21 (m, 20H), 1.20 - 1.12 (in, 8H), 1.0 (s, 4H), 0.92 - 0.83 (m, 12H), 0.68 (s, 3H). HRMS m/z calcd for C58H105NO3 (M - 1) 808.7541, found 808.7553

(25)-2-{[(9Z,12Z)-Octadeca-9,12-dien-l-yϊoxy]methyI}oxirane Qc). I_{n a} similar manner to the above example, linoleyl alcohol (50 g, 188 mmol), sodium hydroxide (7.51 g, 188 mmol), tetrabutylammonium bromide (3.02 g, 9.38 mmol) and (S)-(+)-epichlorohydrin (22.01 ml, 281 mmol) were reacted to get 47.4 (.148 mol, 79%) of (25)-2-{[(9Z,l2Z)-octadeca-9,12-dien-l- yloxy]methyl}oxirane (Ic) as a water white oil after distillation (mantle temp 293 -7°C, head temp 150-155⁰C). ¹H NMR (400 MHz, CDCI3) δ 5.40 (m, 4H), 3.70 (m, dd, J = 11.2, J = 2.8, IH)₅ 3.52 - 3.42 (m, 2H)₅ 3.38 (m, IH), 3.14 (m, IH), 2.80 - 2.74 (m, 3H), 2.6 (m, IH), 2.10 (m, 4H), 1.60 (m, 2H), 1.40 - 1.22 (m. 16H), 0.88 (m, 3H).

(25)-l-(Dimethylamino)-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-2-ol (2c). I_{n a} similar manner as the above example, 5.1 g (15.81 mmol) of Ic was reacted in 100 mL of a 5.6 M (33%) dimethyϊaraiπe solution in ethanol to give 5.8 g (15.78 mmol, 100%) of (2S)-I- (dimethylamino)-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-2-ol (2c). ¹H NMR (400 MHz, CDCI3) δ 5.44 - 5.28 (m, 4H)₅ 3.84 (m, IH), 3.5 - 3.38 (m, 5H), 3.30 (s, IH), 2.77 (t, J = 6.4 Hz, 2H), 2.44 - 2.39 (m, IH), 2.30 - 2.21 (m, 7H), 2.05 (m, 4H), 1.60 (m, 2H), 1.40 - 1.26 (m, 16H), 0.88 (t, J - 7.2, 3H).

(25)-2-{4-[(3β)~Cholest-5-en-3-yloxy]butoxy}-iVy?V-dimethyl-3-[(9Z,122)-octadeca-9,12-dien- l-yloxy]propan-l-amine (6c). In a similar manner as the above example, 15 g (40.8 mmol) of 2c was dissolved in 200 mL toluene and was reacted with sodium hydride (3.26 g, 82 mmol) for 45 minutes at 85⁰C. To this solution was added a solution of 5 (23 g, 42.8 mmol) in 200 mL toluene over 30 minutes. The reaction continued to stir at 85⁰C for 4 hours. The solution was cooled to RT and quenched slowly with drops of methanol. Decolorizing carbon was added, and the solution stirred for 2 hours. The solution was filtered through celite and concentrated in vacuo to yield a viscous oil, which was purified by normal phase chromatography (0 - 100% EtOAc in hexaes) over one hour to give 22.4 g (27.7 mmol, 68%) of (25)~2~({4-[(3β)-cholest-5- en-3-yloxy]butyl }oxy)-N,N~dimethyl-3-[(9Z, 12Z)~octadeca-9, 12-dien- 1 -yloxy]propan- 1 -amine (6c). lH ISfMR (400 MHz, CDCI3) δ 5.34 (m, 4H), 3.60 - 3.41 (m, SH), 3.12 (m, IH), 2.77 (t, J == 6.4 Hz, 2H),

2.41 -2.33 (m, 2H), 2.25 (s, 6H), 2.17 - 2.15 (m, IH), 2.05 ~ 1.89 (m, 6H), 1.87 - 1.79 (m, 2H), 1.70 (s, 1 H) 1.60 - 1.40 (ra, 12H), 1.40 - 1.21 (m, 20H), 1.20 - 1.12 (m, 8H), 1.0 (s, 4H), 0.92 - 0.83 (m, 12H), 0.68 (s, 3H). HRMS mf∑ calcd for C58H105NO3 (M = 1) 808.7541, found 808.7558

LNP COMPOSITIONS LNP process description:

The Lipid Nano-Particles (LNP) are prepared by an impinging jet process. The particles are formed by mixing equal volumes of lipids dissolved in alcohol with siRNA dissolved in a citrate buffer. The lipid solution contains a cationic (Butyl-CLinDMA, Butyl- CLinDMA (2R) and Butyl-CLinDMA (2S)), helper (cholesterol) and PEG (PEG-DMG) lipids at a concentration of 5-15 mg/niL with a target of 9-12 mg/mJL in an alcohol (for example ethanol). The ratio of the lipids has a mole percent range of 25-98 for the cationic lipid with a target of 45- 65, the helper lipid has a mole percent range from 0-75 with a target of 30-50 and the PEG lipid has a mole percent range from 1-6 with a target of 2-5. The siRNA solution contains one or more siRNA sequences at a concentration range from 0.7 to 1 .0 mg/rnL with a target of 0.8 -0.9 mg/mL in a sodium citrate: sodium chloride buffer pH 4. The two liquids are mixed in an impinging jet mixer instantly forming the LNP. The teeID has a range from 0.25 to 1.0 mm and a total flow rate from 10 -200 mL/min. The combination of flow rate and tubing ID has effect of controlling the particle size of the LNPs between 50 and 200 nrn. The mixed LNPs are held from 30 minutes to 48 hrs prior to a dilution step. The dilution step comprises similar impinging jet mixing which instantly dilutes the LNP. This process uses tubing IDs ranging from 1 mm ID to 5 mm ED and a flow rate from 10 to 400 mL/min. The LNPs are concentrated and diafiltered via an ultrafiltration process where the alcohol is removed and the citrate buffer is exchanged for the final buffer solution such as phosphate buffered saline. The ultrafiltration process uses a tangential flow Filtration format (TFF). This process uses a membrane nominal molecular weight cutoff range from 30 -500 KD. The membrane format can be hollow fiber or flat sheet cassette. The TFF processes with the proper molecular weight cutoff retains the LNP in the retentate and the filtrate or permeate contains the alcohol; citrate buffer; final buffer wastes. The TFF process is a multiple step process with an initial concentration to a siRNA concentration of 1 -3 mg/mL. Following concentration, the LNPs solution is diafiltered against the final buffer for 15 -20 volumes to remove the alcohol and perform buffer exchange. The material is then concentrated an additional 1-3 fold. The final steps of the LNP process are to sterile filter the concentrated LNP solution and vial the product. Analytical Procedure:

1) siRNA concentration

The siRNA duplex concentrations are determined by Strong Anion-Exchange High-Performance Liquid Chromatography (SAX-HPLC) using Waters 2695 Alliance system (Water Corporation, Milford MA) with a 2996 PDA detector. The LNPs, otherwise refered to as RNAi Delivery Vehicles (RDVs), are treated with 0.5% Triton X-100 to free total siRNA and analyzed by SAX separation using a Dionex BioLC DNAPac PA 200 (4 x 250 mm) column with UV detection at 254 ran. Mobile phase is composed of A: 25 mM NaClO₄, 10 mM Tris, 20% EtOH. pH 7.0 and B: 250 mM NaClO₄, 10 mM Tris, 20% EtOH, pH 7.0 with liner gradient from 0-15 min and flow rate of 1 ml/min. The siRNA amount is determined by comparing to the siRNA standard curve.

2) Encapsulation rate

Fluorescence reagent SYBR Gold is employed for RNA quantitation to monitor the encapsulation rate of RDVs. RDVs with or without Triton X-100 are used to determine the free siRNA and total siRNA amount. The assay is performed using a SpectraMax M5e microplate spectrophotometer from Molecular Devices (Sunnyvale, CA). Samples are excited at 485 nm and fluorescence emission was measured at 530 nm. The siRNA amount is determined by comparing to the siRNA standard curve. Encapsulation rate - ( 1 - free siRN A/total siRNA) x 100%

3) Particle size and polydispersity

RDVs containing 1 μg siRNA are diluted to a final volume of 3 ml with 1 ^χ PBS. The particle size and polydispersity of the samples is measured by a dynamic light scattering method using ZetaPALS instrument (Brookhaven Instruments Corporation, Holtsville, NY). The scattered intensity is measured with He-Ne laser at 25°C with a scattering angle of 90°.

4) Zeta Potential analysis

RDVs containing 1 μg siRNA are diluted to a final volume of 2 ml with milHQ H₂O. Electrophoretic mobility of samples is determined using ZetaPALS instrument (Brookhaven Instruments Corporation, Holtsville_t NY) with electrode and He-Ne laser as a light source. The Smoluchowski limit is assumed in the calculation of zeta potentials.

5) Lipid analysis

Individual lipid concentrations are determined by Reverse Phase High- Performance Liquid Chromatopaphy (RP-HPLC) using Waters 2695 Alliance system (Water Corporation, Milford MA) with a Corona charged aerosol detector (CAD) (ESA Biosciences, Inc, Chehnsford, MA). Individual lipids in RDVs are analyzed using a Agilent Zorbax SB-Cl 8 (50 x 4.6 mm, 1.8 μm particle size) column with CAD at 60 ⁰C. The mobile phase is composed of A: 0.1% TFA in H₂O and B: 0.1% TFA in IPA. The gradient is 75% mobile phase A and 25% mobile phase B from time 0 to 0.10 min; 25% mobile phase A and 75% mobile phase B from 0.10 to 1.10 min; 25% mobile phase A and 75% mobile phase B from 1.10 to 5.60 min; 5% mobile phase A and 95% mobile phase B from 5.60 to 8.01 min; and 75% mobile phase A and 25% mobile phase B from 8.01 to 13 min with flow rate of 1 rnl/min. The individual lipid concentration is determined by comparing to the standard curve with all the lipid components in the RDVs with a quadratic curve fit. The molar percentage of each lipid is calculated based on its molecular weight. Utilizing the above described LNP process, specific LNPs with the following ratios were identified: Nominal composition:

Butyl-CLinDMA / Cholesterol / PEG-DMG 50.3/44.3/5.4 Butyl-CLinDMA (2S) / Cholesterol / PEG-DMG 49.3/47.0/3.7 EXAMPLE l

In Vivo Evaluation of Efficacy and Toxicity

Lipid/siRNA RDVs utilizing butyl-CLinDMA or the diastereomer specific butyl-CLinDMA (2S), in the nominal compositions described immediately above, were evaluated for in vivo efficacy and induction of inflammatory cytokines in mice. The siRNA targets the mRNA transcript (nm009278) for the gene SSB (Sjogren Syndrome Antigen). The primary sequence and chemical modification pattern of the SSB siRNA is displayed below. The lipid/siRNA RDVs, in PBS vehicle, were tail vein injected in a volume of 0.2 mL. Final dose levels ranged from 0.25 to 4 mg/kg siRNA. PBS vehicle alone was dosed as a control. Three hours post dose, mice were bled retro-orbitally to obtain plasma for cytokine analysis. Mice were sacrificed 24 hours post dose and liver tissue samples were immediately preserved in RNALater (Ambion). Preserved liver tissue was homogenized and total RNA isolated using a Qiagen bead mill and the Qiagen miRNA-Easy RNA isolation kit following the manufacturer's instructions. Liver SSB mRNA levels were determined by quantitative RT-PCR. Message was amplified from purified RNA utilizing custom primers against the mouse SSB mRNA (Probe 1 : TGGAAGGAGGACAAGATTTGATG (SEQ.ID.NO.:1); Probe 2: CTTATGCTTTGATGCGGGTTCT (SEQ.ID.NO.:2); Probe 3: 6FAM- TCGTCGTGGACCAATGAAAAGAGGAAGA (SEQ.ID.NO. :3)). The PCR reaction was run on an ABI 7500 instrument with a 96- well Fast Block. The SSB mRNA level is normalized to the housekeeping PPIB (NM 011149) mRNA. PPIB mRNA levels were determined by RT-PCR using a commercial probe set (Applied Biosytems Cat. No. Mm00478295_ml). Results are expressed as a ratio of SSB mRNA/ PPDB mRNA. All mRNA data is expressed relative to the PBS control dose. Plasma cytokine levels were determined using the Searchlight multiplexed cytokine chemoluminescent array (Pierce/Thermo). Systemic administration of the SSB siRNA RDVs decreased mouse liver SSB mRNA levels in a dose dependant manner. Similar efficacy was observed for both RDVs assembled using either the butyl-CLinDMA diastereomer mixture or the butyl-CLinDMA (2S) single diastereomer (Figures 1 & 2). Both RDVs increased mouse plasma levels of the cytokines IL-6 and mKC (Figures 3 & 4). It should be noted that the mRNA and cytokine data for the two RDVs were generated in separate experiments and so may not be directly comparable.

SSB siRNA S'-iB-ACAACAGACMTl/AAJyGf/AATT-iB 3' (SEQ.ID.NO.:4) y-υυUGUUGUCUGAAAUUACAUυ^ (SEQ.π)NO.:5) AUGC - Ribose iB - Inverted deoxy abasic

WC - 2' Fluoro

AGT - 2^! Deoxy

AGU - 2' OCH₃

Claims

WHAT IS CLAIMED IS:

1. A cationic lipid which is: (25)~2-{4-[(3β)-cholest-5-en-3-yloxy]butoxy}-iV₅Λ^Ldimethyl-3-[(9Z,l 2Z)-octadeca-9, 12-dien-l- yloxy]propan-l -amine.

2. A cationic lipid which is:

(2^)-2-{4-[(3β)-cholest-5-en-3-yloxy]butoxy}-N_;Λ^r-dimethyl-3-[(9Z,12Z)-octadeca-9_!12-dien-l- yloxy]propan- 1 -amine.

3. A lipid nanoparticle composition comprising the cationic lipid of Claim 1, one or more siRNA molecules, PEG-DMG₅ and cholesterol.

4. A lipid nanoparticle composition comprising the cationic lipid of Claim 2, one or more siRNA molecules, PEG-DMG, and cholesterol.

- 17 -