WO2010070278A1 - Use of foxp2 as a marker for abnormal lymphocytes and as a target for therapy of disorders associated with abnormal lymphocytes - Google Patents
Use of foxp2 as a marker for abnormal lymphocytes and as a target for therapy of disorders associated with abnormal lymphocytes Download PDFInfo
- Publication number
- WO2010070278A1 WO2010070278A1 PCT/GB2009/002887 GB2009002887W WO2010070278A1 WO 2010070278 A1 WO2010070278 A1 WO 2010070278A1 GB 2009002887 W GB2009002887 W GB 2009002887W WO 2010070278 A1 WO2010070278 A1 WO 2010070278A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- foxp2
- expression
- lymphocytes
- antibody
- cells
- Prior art date
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57426—Specifically defined cancers leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
Definitions
- FOXP2 as a marker for abnormal lymphocytes and as a target for therapy of disorders associated with abnormal lymphocytes
- the present invention is concerned with FOXP2 and its use as a marker to detect abnormal e.g. malignant or pre-malignant lymphocytes.
- abnormal lymphocytes may occur in a variety of conditions, namely certain haematological disorders or malignancies and accordingly their detection may be used to assist in the diagnosis and/or prognosis of such conditions.
- FOXP2 expression in lymphocytes may be used as a marker for malignancy.
- the invention relates to the use of agents capable of reducing or inhibiting FOXP2 expression or activity for the treatment or prevention of conditions or disorders associated with abnormal lymphocytes, or abnormal FOXP2 expression in lymphocytes, for example myeloma or lymphoma.
- the invention also concerns a monoclonal antibody which binds specifically to FOXP2.
- the forkhead box (FOX) proteins are a family of transcription factors defined by a common DNA-binding domain termed the forkhead box or winged helix domain. Many different transcription factors have been identified in this family and FOX protein family members are important for a wide range of biological processes, including development, metabolism, proliferation, differentiation, migration and longevity. There are at least 17 FOX gene subfamilies (FOXA-R) with at least 41 genes identified in humans.
- the FOXP family of transcription factors is a subfamily of the FOX protein family, with four currently identified members, namely FOXPl, FOXP2, FOXP3 and FOXP4. These forkhead proteins have an atypical C-terminal forkhead domain and an N-terminal C2H2 zinc finger motif.
- the FOXP transcription factors are able to bind to a common consensus DNA sequence and their homo and/or heterodimerisation is required for DNA binding.
- FOX transcription factors including members of the FOXP sub-family, are increasingly being implicated in cancer and suggestions have been made that they may be useful as biomarkers and potential targets for therapy. The picture as regards different specific factors is however not entirely consistent.
- FOXPl has been identified as a candidate tumour suppressor gene (Banham et al, 2001, Cancer Res., 61, 8820-8829). Additionally and in contrast, it has also been reported that FOXPl expression can be de-regulated by recurrent chromosome translocations in B-cell lymphoma patients and that high levels of protein expression are associated with a poor prognosis (Banham et al, 2005, Clin. Cancer Res., 11(3), 1065-1072), although this may reflect the expression of potentially smaller oncogenic isoforms of the FOXPl protein (Brown et al, 2008, Blood, 111(5), 2816- 2824).
- Retroviral insertion into the 5' coding sequence of the foxPl gene has been reported as an oncogenic event in an avian nephroblastoma model (Pajer et al, 2006, Cancer Res., 66(1), 78-86).
- FOXP3 has a role in regulating the development of B cells, T cells and CD25 + CD4 + regulatory T cells. It is expressed in adult T-cell leukaemia/lymphoma and is widely used as a marker of a population of regulatory T cells (Tregs) that control immunotolerance and enable tumour cells to evade the host response (Bignone and Banham, 2008, EOBT, 8(12), 1897-1920).
- Tregs regulatory T cells
- FOXP4 farnesoid protein
- mRNA is down regulated in kidney tumours and a balanced chromosome translocation involving FOXP4 in a human breast cancer cell line has been identified (Teufel et al, 2003, Biochim Biophy Acta, 1627, 147-152; Howarth et al, 2008, Oncogene, 27(23), 3345-3359).
- FOXP2 Unlike certain other FOX proteins, FOXP2 has not been extensively studied in cancer and the principal focus of research has been on the role of FOXP2 in neuronal systems. Most notably, the primary association of FOXP2 in the art is with speech and language disorders. Mutation of FOXP2 has been linked to an inherited speech and language disorder (Lai et al, 2001, Nature, 413, 519-523). In one of the cases, a three generation family referred to as "KE" has a single amino acid substitution in the forkhead domain which compromises FOXP2 DNA binding activity and thus its ability to regulate gene expression.
- the FOXP2 gene is highly conserved between different species, has several splice variants, at least four different transcriptional start sites and more highly conserved regions within its introns than virtually any known gene.
- SMAD proteins are a small family of proteins that bind DNA and regulate transcription. They can propagate the TGF- ⁇ signal downstream of the cell surface receptors, which negatively regulates the cellular proliferation and differentiation of normal B lymphocytes, together with their ability to undergo apoptosis.
- FOXP2 expression is increased and that such increased expression allows FOXP2 to be used as a marker for lymphoid malignancies, or more generally for abnormal lymphocytes, which may occur in various disorders.
- increased expression of FOXP2 can identify abnormal e.g. malignant or pre-malignant lymphocytes from their normal counterparts.
- FOXP2 is normally expressed in most normal tissues, it is notably not expressed in normal haematopoietic cells, irrespective of lineage or stage of differentiation.
- FOXP2 is not expressed in normal lymphocytes.
- abnormal lymphocytes e.g. neoplastic or malignant lymphocytes
- FOXP2 is thus proposed herein as a novel marker for abnormal lymphocytes.
- FOXP2 expression has now been shown to be detectable in a variety of cell lines derived from various haematological malignancies, and notably such malignancies are associated with lymphocytes, including various lymphomas, e.g. diffuse large B-cell lymphoma (DLBCL), Hodgkin lymphoma (HL), and myeloma.
- DLBCL diffuse large B-cell lymphoma
- HL Hodgkin lymphoma
- myeloma myeloma
- tissue samples obtained from patients with such malignancies increased FOXP2 expression in lymphocytes may be seen (for example in bone marrow samples or in other biopsy samples).
- FOXP2 expression in lymphocytes may be seen (for example in bone marrow samples or in other biopsy samples).
- myeloma a consistent increase in FOXP2 expression in bone marrow plasma cells may be seen; the expression of FOXP2 in plasma cells has been detected in more than 95% of bone marrow samples studied from patients with myeloma (as compared with 71% expressing CD56, a currently used marker for myeloma).
- FOXP2 has been detected in plasma cells from patients with monoclonal gammopathy of undetermined significance (MGUS), a benign condition characterised by an increase in plasma cells, which in certain patients can progress to myeloma.
- MGUS monoclonal gammopathy of undetermined significance
- FOXP2 expression has particularly been shown to be increased in conditions exhibiting plasma cell abnormalities, and in a specific aspect the inventors have accordingly identified a novel marker for abnormal plasma cells.
- FOXP2 as a novel disease marker is an extremely important development for the identification of patients with abnormal lymphocytes and in particular of patients with abnormal plasma cells, as may occur most notably in myeloma, and related conditions such as MGUS.
- Myeloma commonly referred to as multiple myeloma (MM), and known also as plasma cell myeloma or symptomatic myeloma, is a cancer of the plasma cells caused by proliferation and clonal expansion of terminally differentiated malignant post-germinal centre B lymphocytes (plasma cells) in the bone marrow.
- Myeloma interferes with normal plasma cell production of immunoglobulins and myeloma cells produce an abnormal immunoglobulin called M protein or paraprotein which does not function.
- Myeloma cells are addicted to an aberrant IRF4 regulatory network that fuses the gene expression programmes of activated B cells and normal plasma cells.
- MGUS monoclonal gammopathy of undetermined significance
- MGUS is a non-cancerous (benign) condition in which plasma cell numbers are increased and an abnormally high amount of a single antibody is produced (monoclonal gammopathy or paraproteinaemia), but with no evidence of cancer (either myeloma or lymphoma).
- the levels of plasma cells and antibody are raised over normal, but are not as high as in myeloma (MM).
- MM myeloma
- This disease spectrum includes also smouldering myeloma (also known as indolent or asymptomatic myeloma), in which the increase in plasma cell number and monoclonal protein is increased relative to MGUS but in which the patient is not showing overt signs of disease in terms of organ damage or tissue impairment (typically referred to as "end-organ damage").
- end-organ damage typically referred to as "end-organ damage”
- MGUS monoclonal protein
- clonal plasma cells are >10% on bone marrow biopsy and/or serum monoclonal protein is >30g/L and there is no myeloma-related organ or tissue impairment.
- clonal plasma cells are >10% on bone marrow biopsy, there is usually monoclonal protein in either serum or urine and there is evidence of related organ ' or tissue impairment (e.g. hypercalcaemia, renal insufficiency, anaemia, bone lesions (lytic lesions or osteoporosis with compression fractures), frequent severe infections (more than 2 a year), amyloidosis of other organs or hyperviscosity syndrome).
- Neoplastic plasma cells from myeloma patients also display an aberrant phenotype that can be used to distinguish them from their normal counterparts in bone marrow. This is particularly important because a high ratio of abnormal to normal plasma cells at presentation is one of the most significant predictors of MGUS and asymptomatic myeloma patients with a greatly increased likelihood of disease progression.
- CDl 38 is a universal marker of both normal and malignant plasma cells
- markers which are particularly useful for distinguishing normal from abnormal plasma cells include the B-cell marker CD 19, which is expressed in more than 70% of normal plasma cells and is absent from 95% of MM cases and the natural killer cell marker CD56 which is expressed in less than 15% of normal plasma cells and is strongly expressed in more than 75% of MM cases.
- a panel based on CD 19 and CD56 will identify approximately 90% of MM cases while the inclusion of CD20, CDl 17, CD28 and CD27 has been predicted to increase this to more than 95% of MM cases.
- no single marker has been reported systematically to differentiate neoplastic plasma cells from their normal counterparts.
- FOXP2 in abnormal lymphocytes and in particular in abnormal plasma cells, allows the use of FOXP2 as a single marker for the detection of abnormal lymphocytes, particularly abnormal plasma cells and accordingly for the detection or assessment of disease associated with abnormal lymphocytes, for example lymphoma or myeloma, and particularly abnormal plasma cells, for detection or assessment of plasma cell disorders, including myeloma.
- FOXP2 as a single marker, or in conjunction with other markers (such as CDl 38 and CD56)
- FOXP2 as ' a marker may improve or facilitate the detection of abnormal lymphocytes, and thereby aid the diagnosis or prognosis of conditions associated with abnormal lymphocytes e.g. lymphocyte malignancies.
- FOXP2 may thus be used for the detection of abnormal lymphocytes and, advantageously in conjunction with other parameters such as lymphocyte (for example plasma cell) number (count) or clinical parameters such as indicators of end-organ or tissue damage, in the detection and assessment of conditions associated with abnormal lymphocytes.
- lymphocyte for example plasma cell
- count for example plasma cell number
- clinical parameters such as indicators of end-organ or tissue damage
- FOXP2 F0XP2 mRNA expression in 96% of myeloma samples at diagnosis (26/27, including both purified plasma cells and total bone marrow) and FOXP2 protein in 95% of samples from MM patients (originally in 82% of samples but this increased to 95% after re-examination of clinical notes) and also in plasma cell samples from patients with MGUS allows the use of FOXP2, whether as FOXP2 protein or as FOXP2 nucleic acid, e.g. mRNA, as a marker and possibly a single or independent marker for detecting abnormal (e.g.
- FOXP2 is particularly advantageous over other myeloma markers previously used in the art e.g. CD56 which only identifies 75% of MM cases and which is also expressed in natural killer cells.
- the FOXP2 marker is thus more specific and may not require the detection of a combination of different molecules, particularly where FOXP2 mRNA is detected.
- FOXP2 may accordingly be used as the sole marker for abnormality or malignancy.
- FOXP2 it may be beneficial in some cases however to use FOXP2 as a marker for example in combination with other markers for cell type, such as for example in conjunction with CD 138 as a plasma cell marker.
- CD 138 labelling it can be established whether the FOXP2 positive cell is a plasma cell and it is also possible to visualise weak staining without the use of a nuclear counterstaining which increases the number of FOXP2 positive cases identified.
- FOXP2 mRNA is expressed in osteoblasts, as is the RUNX2 gene.
- plasma cells in myeloma express two genes, namely FOXP2 and RUNX2 (Colla et al, 2005, Leukemia, 19, 2166-2176) which are normally expressed in osteoblasts.
- the expression of these osteoblast transcription factors in plasma cells in myeloma may be functionally associated with the bone disease phenotype observed in myeloma.
- the level of FOXP 2 expression in plasma cells in myeloma may correlate to the severity of bone disease seen, with a high level of expression indicating an increased severity of bone disease.
- the expression of FOXP2 in lymphocytes (or indeed as discussed in more detail later on, in tumours in general, including tumours involving other cell types) may identify patients with tumours that are likely to colonise the bone marrow.
- FOXP2 can be used as a marker for abnormal lymphocytes, in view of its increased expression in such cells, a surprising and unpredictable observation given the reports in the prior art of decreased FOXP2 expression in cancer.
- FOXP2 expression in lymphocytes e.g. plasma cells and in other tumours may be associated with bone disease development and may accordingly be targeted in the treatment of bone disease, particularly malignant bone disease, both primary and secondary (i.e. primary bone tumours and bone metastases).
- the present invention accordingly provides a method for detecting abnormal lymphocytes, said method comprising detecting an amount or expression of the FOXP2 gene in lymphocytes in a sample, wherein an increased amount or expression of the FOXP2 gene in said lymphocytes indicates the presence of abnormal lymphocytes.
- the FOXP2 gene is defined herein as any gene or any DNA molecule encoding a FOXP2 protein.
- FOXP2 gene expression may be determined or detected by measuring or detecting expression of a FOXP2 protein or a FOXP2 mRNA, and as discussed below this may be achieved by a variety of methods known in the art.
- An increase in expression of the FOXP2 gene may however occur by a variety of mechanisms and the exact nature of the mechanism is not critical.
- an increase in expression may also occur as a result of an increase in gene dosage, or other effects at the DNA or gene level e.g. gene or chromosomal translocations or rearrangements which result in gene expression, or increased gene expression.
- the method of the invention thus encompasses detecting such translocations or rearrangements or determining the amount of the F0XP2 gene, namely gene copy number or dosage, as well as detecting or determining the level of gene expression.
- the sample may be any sample which contains lymphocytes.
- this will be a clinical sample, e.g. a sample of body tissue or fluid, which may be taken from a subject or patient under study or investigation.
- the precise nature of the body or tissue fluid sample may depend on the subject and/or condition under investigation but generally will be a sample of haematological tissue or fluid, or put another way a sample containing haematological cells, particularly lymphoid tissue or cells or plasma cells.
- the sample will commonly be taken, obtained or derived from bone marrow, blood or tumour material, and may for example be a bone marrow biopsy sample (e.g.
- lymphocytes may be used, for example any biological sample containing lymphocytes, e.g. for laboratory investigation (for example a sample derived or obtained from a test animal) or lymphocyte or other cell or tissue cultures or cell lines.
- sample will be from a human subject, it may be from any non-human animal subject.
- the amount or expression of the FOXP2 gene may be increased relative to the amount or expression in normal lymphocytes, more particularly corresponding or equivalent normal lymphocytes e.g. a sample or population of lymphocytes from the same species, or from a lymphocyte cell line derived from the same species, including a disease-derived cell line such as a myeloma or lymphoma cell line (e.g. the myeloma cell line JJN3).
- the amount or expression may be increased in comparison to a control or reference sample of lymphocytes, e.g. corresponding or equivalent lymphocytes taken from a healthy subject.
- the amount or expression may also be determined in a sample from a subject relative to a sample from the same subject, taken at a different e.g.
- the amount or expression O ⁇ FOXP2 in the test sample may be determined or detected, both in absolute terms, or relative to another sample, depending on the use to which the method is put.
- a comparison to a control or reference or any other sample may not be necessary, since normal lymphocytes rarely express FOXP2 and hence expression of FOXP2 in more than a few cells e.g. in more than 10% of lymphocytes, particularly, CD138 + plasma cells is indicative of abnormal lymphocytes.
- an increase in FOXP2 expression can be seen as any expression or any significant expression (e.g. any expression over zero, or any detectable expression, or any expression over a minimum number of cells, which may occasionally occur in samples containing "normal" lymphocytes).
- a very small number, or low or very low incidence, of cells expressing FOXP2 detected may not be indicative of abnormality.
- FQZP2-expressing cells this may be accounted for using appropriate controls, or discounting de minimis expression etc.
- a cut off value may be set e.g. for the number or proportion of cells expressing FOXP2 below which the sample is not scored as positive e.g. less than 5%, 8%, 10% or 12%.
- the human FOXP2 gene has a nucleic acid sequence as set forth in SEQ ID NO.1.
- the sequence of human FOXP2 protein as well as variants generated by alternative splicing are known in the art and are shown in SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 and 37.
- Reference to the " FOXP2 gene” or to " FOXP2" as used herein hence encompasses the nucleotide sequence set forth in SEQ ID NO.1 or any nucleotide sequence encoding FOXP2 having an amino acid sequence as set out in SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 or 37.
- F0XP2 also includes substantially homologous variants of the nucleotide sequence set forth in SEQ ID NO.l or a nucleotide sequence which encodes substantially homologous variants of the FOXP2 amino acid sequence as set out in SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 or 37, since for example the method can be used to detect abnormal lymphocytes in other non-human animals, for example the method can be used on a mouse, rat, rabbit, monkey, cat or dog. Thus homologous or orthologous FOXP2 or FOXP2 sequences from other species are covered.
- the invention can be used to detect polymorphic forms of FOXP2, naturally occurring allelic variants O ⁇ FOXP2 or mutant forms 0 ⁇ F0XP2 which contain mutations compared to the sequence set out in SEQ ID NO.l . or which may encode an amino acid sequence which contains variations (mutations) as compared with SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 or 37.
- a mutation can consist of an addition or deletion or substitution of any one or more nucleotides e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides.
- Such a mutation may be a substitution, for example which results in a conservative amino acid substitution in the encoded amino acid sequence.
- Substantially homologous variants may have at least 80, 85, 90, 95, 96, 97, 98 or 99% sequence identity to the nucleotide sequence as set out in SEQ ID NO. 1 or may encode an amino acid sequence having at least 80, 85, 90, 95, 96, 97, 98 or 99% sequence identity to the amino acid sequence as set out in SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 or 37 (FOXP2).
- the detection of the amount of the FOXP2 gene in lymphocytes in a sample includes the determination of the number of copies of F0XP2 within said lymphocytes.
- An increase in the amount of FOXP2 hence can refer to an increase in the number of copies of FOXP2 present in a lymphocyte compared to the number of copies 0 ⁇ F0XP2 which occur in a normal lymphocyte.
- an increased amount 0 ⁇ F0XP2 means the presence of more than 2 copies of the FOXP2 gene, for example, 3, 4, 5 or more copies.
- the determination of the amount of FOXP2 includes the determination of the number of copies of the sequence of SEQ ID NO.1 or the number of copies of a sequence which encodes the FOXP2 protein present in a lymphocyte cell.
- the amount 0 ⁇ F0XP2 can be determined using an oligonucleotide sequence as a probe or primer comprising at least 10 consecutive nucleotides from FOXP2, for example, comprising at least 10 nucleotides from SEQ ID NO. 1 or from a sequence encoding FOXP2 e.g. encoding a sequence as set out in SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 or 37.
- Said oligonucleotide sequence may thus comprise a sequence of at least 20, 30, 40, 50, 60 or 70 consecutive nucleotides from FOXP2.
- the oligonucleotides may be produced according to techniques well known in the art e.g.
- oligonucleotides may be used as primers to initiate replication for example in PCR or as probes which are contacted with the sample under hybridising conditions where the presence of any duplex or triplex formation between the probe and any nucleic acid in the sample is detected.
- the probes used for determination of the amount of FOXP 2 may be anchored to a solid support, for example the probes may be spotted or synthesised in situ on an array.
- the copy number or amount 0 ⁇ F0XP2 may be measured by for example comparative genomic hybridisation, where sample and reference DNAs are differentially fluorescently labelled and hybridised together to the array. The resulting fluorescent ratio can be measured and an increased copy number can be detected by a stronger fluorescent signal from the sample DNA as compared to the fluorescent signal from the reference DNA i.e. from normal lymphocytes.
- Copy number gains in lymphocytes from fresh, frozen or routinely formalin fixed paraffin embedded tissues can also be detected by fluorescent in situ hybridisation (FISH).
- FISH fluorescent in situ hybridisation
- Bacterial artificial chromosome (BAC) clones containing large regions of DNA flanking and/or across the FOXP2 gene can be labelled with fluorescent conjugates that enable copy number visualisation using a microscope.
- FISH probes can also be used to simultaneously detect both copy number gains and chromosome rearrangements targeting the FOXP2 locus via labelling probes upstream and downstream of the FOXP2 gene with different fluorochromes.
- Fused signals (usually red+green, which show as yellow) indicate an intact gene, while break apart signals (separate red and green) detect chromosomal translocation.
- the method may therefore comprise a comparison step wherein the amount of FOXP2 detected in the lymphocytes from the sample (i.e. in the test sample) may be compared to the amount of FOXP2 present in a normal equivalent or corresponding lymphocyte sample or population (i.e. in a control or reference sample).
- the test sample is from a subject individual e.g. a patient, it may be compared to a reference sample from a healthy subject of the same species.
- the detection of expression of the FOXP2 gene includes the detection of FOXP2 mRNA present in lymphocytes and/or the amount of FOXP2 protein produced.
- the detection O ⁇ FOXP2 mRNA or FOXP2 protein in a lymphocyte sample is sufficient to detect abnormal lymphocytes i.e. the actual level of expression does not essentially need to be determined. Therefore, the detection of FOXP 2 mRNA or FOXP2 protein in lymphocytes generally indicates an increase in the level of expression of FOXP2.
- any detection of expression generally evidences an increase in the level of expression as compared to normal non-expressing lymphocytes.
- the detection of expression of FOXP2 can however additionally involve a step of determining the level of expression of FOXP2 in lymphocytes in the sample i.e. the level of FOXP2 mRNA or FOXP2 protein can be assessed.
- An increased level of expression may encompass an increase of for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200 or 300% in the amount of FOXP2 mRNA or FOXP2 protein present within a lymphocyte or lymphocyte sample.
- an increased level of expression is seen where an increase of up to 2-fold in the amount of FOXP 2 mRNA or FOXP2 protein is detected relative to a normal or reference lymphocyte.
- 2, 3, 4, 5, 6, 7, 8, 9 or 10 fold increase in the amount of FOXP2 mRNA or FOXP2 protein is present in a lymphocyte as compared with a normal counterpart lymphocyte or a reference cell. It will be appreciated, however, for reasons explained above, that simply the presence of FOXP2 mRNA or FOXP2 protein may be scored as increased FOXP2 expression, particularly if specific thresholds are set for detection.
- FOXP2 protein as used herein includes any known FOXP2 protein and homologies or orthologues thereof.
- Amino acid sequences for FOXP2 proteins from various species are known in the art, as indeed are various isoforms or variant sequences e.g. splice variants.
- the FOXP2 protein may have an amino acid sequence as set out in SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 or 37 or any alternative spliced isoform of the protein.
- detection of FOXP2 encompasses the detection of any FOXP2 protein or any of its alternatively spliced isoforms.
- Substantially homologous variants of FOXP2 e.g. non-human Foxp2 from different species e.g. mouse, rat, rabbit, monkey, cat, dog etc can be detected in the method and the method is hence not limited to use on human samples.
- the term "FOXP2" encompasses all such substantially homologous variants.
- Substantially homologous variants may include those which have at least 80, 85, 90, 95, 96, 97, 98 or 99% similarity or preferably identity to the amino acid sequences set out in SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 or 37.
- a naturally occurring variant of FOXP2 may differ by 1 to 10, 1 to 6, 1 to 4, 1 to 3 or 1 to 2 amino acid substitutions, insertions, and/or deletions which may be contiguous or non-contiguous as compared to SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 or 37.
- the substituted amino acid may be one of the well known 20 conventional amino acids, although typically it may be a conservative amino acid substitutions.
- an amino acid may be replaced by another which preserves the physiochemical character of FOXP2 (e.g. D may be replaced by E or vice versa, N by Q or L; I by V or vice versa).
- the reference to "detecting the expression of FOXP2" may also include the detection of specific mutations or chromosomal translocations in the FOXP2 gene which increase the level of expression of F0XP2.
- the direct detection of any mutations or translocations may indirectly detect expression 6 ⁇ FOXP2 and increased expression of F0XP2. It is possible to detect chromosomal translocations by FISH (fluorescence in situ hybridisation) or by PCR using primers than flank the breakpoints in F0XP2 and the partner gene.
- FOXP2 mRNA can be detected and/or levels of mRNA determined using many different techniques which are well known in the art, for example by Northern blotting or using microarrays. Further, real time PCR can be used to determine mRNA levels, where total RNA can be extracted from a cell and reverse transcribed. Real time PCR can then be carried out on the reverse transcribed sample and the mRNA expression level determined.
- FOXP2 protein (and its variants produced by alternative splicing) can be detected and/or levels determined using many well known techniques.
- the assays to detect FOXP2 may be qualitative, quantitative or semi-quantitative.
- Such an assay may for example simply involve contacting a sample with an antibody which can detect FOXP2 and detecting whether or not it binds.
- an antibody which can detect FOXP2 and detecting whether or not it binds.
- Such antibodies are described in greater detail below.
- Such an assay may be carried out using any of the well known immunoassay techniques which are widespread in the art e.g. sandwich assays, competitive assays, immunometric assays etc.
- Other assay formats may also be used, e.g. assays based on flow cytometry.
- Western blotting may also be used where proteins are resolved by SDS-PAGE and transferred to nitrocellulose membranes.
- FOXP2 protein can then be detected using an anti- FOXP2 antibody.
- Antibodies such as FOXP2 N- 16 sc-21069 (Santa Cruz, Ca, USA), or FOXP2-73A/8 (deposited under Accession Number 08101410 on 14 October 2008 at ECACC (European Collection of Cell Cultures), Centre for Emergency Preparedness and Response, The Health Protection Agency, Porton Down, Salisbury, SP4 OJG) may preferably be used to identify FOXP2.
- the antibody may be labelled and may be detected and/or measured by means of the label. Labelling may be by any convenient means and a wide variety of labels and labelling techniques for antibodies are well known in the art.
- Such labels may include for example, fluorochromes, radioisotopes, coloured dyes, quantum dots, or other chromogenic agents, enzymes, colloidal metals, chemi- and bio-luminescent compounds.
- the labels may be directly detectable or signal giving such as those listed above, or they may be labels which take part in a signal giving or detectable reaction, for example by binding to another molecule e.g. they may be an indirectly detectable label.
- a label may be a small molecule such as a hapten or a tag e.g. biotin, which may be bound by a binding partner therefor (e.g. streptavidin/avidin for biotin).
- FOXP2 protein may be detected and/or its levels assessed by immunohistochemistry, preferably using the antibody FOXP2-73A/8.
- the amount or level of expression of FOXP2 may not be increased in all lymphocytes present in the sample.
- a sample may comprise a heterogeneous population of lymphocytes, some of which may have an increased amount or level of expression of FOXP 2 and some of which may not.
- the present method can be used to detect the abnormal lymphocytes in such a sample which show an increased expression level or amount of FOXP2.
- the method can include a step of comparing the level of expression of FOXP2 (and also the amount of FOXP2) with the level of expression of FOXP2 (or amount of FOXP2) in normal lymphocytes, or any desired or appropriate control or reference sample.
- the invention can provide a method for detecting abnormal lymphocytes comprising determining the amount or level of expression of the FOXP2 gene in lymphocytes in a test sample and comparing said amount or expression level of the FOXP2 gene with the amount or expression level of the FOXP2 gene detected in normal lymphocytes (or in a control or reference sample), wherein an increased amount or level of expression of F0XP2 in lymphocytes in the test sample indicates the presence of abnormal lymphocytes in said test sample.
- the present invention can also be seen to provide a method for detecting abnormal lymphocytes, said method comprising detecting expression of the FOXP2 gene in lymphocytes in a sample, wherein expression of the FOXP2 gene in said lymphocytes indicates the presence of abnormal lymphocytes.
- a method may include determining the amount or proportion or percentage of lymphocytes in the sample which express FOXP2 (or any other such indication of the amount or relative amount of FOXP2- expressing lymphocytes in the sample).
- a sample may be considered to be FOXP2 positive if FOXP2 expression is detected in more than 10% of cells, particularly in more than 10% of CDl 38 + plasma cells.
- lymphocyte refers to a cell which is derived from the so-called common lymphoid progenitor.
- a lymphocyte is thus a cell of the lymphoid lineage.
- a lymphocyte may be a T-cell, a B-cell or a natural killer cell, or any cell which may differentiate therefrom.
- B and T cells and cells derived therefrom may be at various stages of differentiation or activation and all such stages are included.
- T and B cells and their derivative cells are particular lymphocytes where abnormalities may occur and which may give rise to pathological or clinical conditions associated with such abnormalities, particularly neoplastic disorders or malignancies.
- a type of lymphocyte of particular interest according to the present invention is a plasma cell.
- Plasma cells are differentiated from B cells upon stimulation by CD4+ lymphocytes and usually secrete antibodies. Plasma cells are hence generally considered to be terminally differentiated B cells. Plasma cells do not express common pan B cell markers such as CD 19 and CD20 and instead are usually identified by their expression of CD38, CD78 and the , Interleukin-6 receptor.
- T cells can be distinguished from other lymphocytes by the presence of the T-cell receptor on their cell surface and include several different subsets e.g. cytotoxic T cells and helper T cells.
- B cells are lymphocytes that play a large role in the humoral immune response and their principal functions are the production of antibody, their role as antigen presenting cells and eventually their development into memory B cells.
- the method of the invention can be used to detect abnormal T cells, B cells and/or plasma cells in a sample.
- the abnormal lymphocytes detected are abnormal plasma cells.
- a method for detecting abnormal plasma cells comprises detecting the amount or expression of FOXP2 in plasma cells in a sample wherein an increased amount or level of expression of FOXP2 in said plasma cells indicates the presence of abnormal plasma " cells.
- plasma cells may be identified or characterised by the expression of the plasma cell marker CDl 38.
- the method of the invention for detecting abnormal plasma cells combines the detection 0 ⁇ F0XP2 amount or expression with the detection of CDl 38.
- the FOXP2 protein and CDl 38 protein may be detected, e.g. the presence or absence, or amount of FOXP2 and CDl 38. This may be achieved for example using antibody labelling techniques, as discussed further herein.
- F0XP2 mRNA may be used reliably and efficiently for detection of F0XP2 expression.
- F0XP2 mRNA may be detected as a single marker for abnormal plasma cells.
- F0XP2 mRNA may conveniently be detected using PCR or PCR-based techniques.
- abnormal refers to cells e.g. to lymphocytes which may be differentiated or distinguished from a corresponding normal lymphocyte (i.e. from their normal counterpart), in terms of phenotypic characteristics and/or behaviour.
- An abnormal lymphocyte is thus different from a normal lymphocyte. Typically this may be manifested by altered phenotypic characteristics which may include altered cellular morphology (e.g. altered appearance), but most commonly include the altered expression of proteins, including cell surface proteins.
- an abnormal cell e.g. an abnormal lymphocyte shows an altered or aberrant phenotype (a phenotype different from that expected of it).
- markers e.g. markers used to identify or classify lymphocytes may be altered e.g. usual cell markers may be absent and different cell markers may be present, and/or may exhibit an altered gene expression profile compared to normal lymphocytes under the same conditions.
- abnormal cells e.g. lymphocytes may contain one or more gene mutations, alterations or chromosome translocations and may demonstrate a spectrum of abnormality.
- An abnormal cell e.g. an abnormal lymphocyte may also show abnormal characteristics in terms of abnormal proliferation compared to its normal counterpart. Thus proliferation (or the proliferative capacity) of the cell may be increased. Such increased or abnormal proliferation may result in the production of a clonal population of cells. Proliferation may be increased by more than 1%, for example by more than 2, 3, 4, 5, 6, 7, 8, 9, or 10% or possibly in some cases by more than 20, 30, 40 or 50%. In terms of plasma cells, for example, it is believed that in normal conditions the majority of these are not actively proliferating.
- the proportion or amount of proliferating cells may increase. This may be assessed by techniques known in the art, for example immunohistochemistry with ki67/MIBl staining or flow cytometry and staining with propidium iodide or Hoescht dye.
- An abnormal lymphocyte may thus be a neoplastic lymphocyte. More particularly, the abnormal lymphocyte may be malignant or pre-malignant.
- a pre- malignant lymphocyte, or a pre-cancerous lymphocyte is one which is not malignant but which shows changes which are associated with progression to malignancy e.g. which is at risk of or likely to become malignant i.e. is potentially malignant.
- pre-malignant cells do not exhibit malignant behaviour, (for example invade tissues or cause overt symptoms of disease or tumour development, or exhibit increased proliferation etc) but have a risk of developing into cells which will.
- Malignant lymphocytes are lymphocytes which exhibit abnormal behaviour, particularly in terms of growth, death and/or differentiation.
- Malignant lymphocytes may not be self-limited in their growth, they may fail to die at the appropriate time, and/or they may be arrested at a particular stage of development or differentiation or may exhibit altered differentiation. Alternatively viewed, a malignant lymphocyte is a cancerous lymphocyte.
- an abnormal lymphocyte includes reference to an abnormal (e.g. malignant or pre-malignant) plasma cell, B-cell or T-cell.
- Abnormal plasma cells are of particular interest in the present invention.
- An abnormal plasma cell may be identified by an aberrant phenotype, for example as reported in the art with reference to expression of cell markers.
- an abnormal plasma cell may be identified or classified as CD 19 " CD56 + , and optionally CDl 1 T, CD20 + , CD28 ++ and CD27 " or weak (normal cells tend to be strongly CD27 + ).
- Further markers which may be included in a marker panel for identification of an abnormal plasma cell include CD81 (weak or negative) and CD200 (strongly positive).
- Abnormal, e.g. neoplastic, pre-malignant or malignant lymphocytes can be found in patients with a variety of different conditions, including abnormal plasma cells in plasma cell disorders which may include MGUS and myeloma and which may thus be non-malignant (benign) or malignant, and in various lymphomas, for example, Hodgkin Lymphoma (HL) and diffuse large B-cell lymphoma (DLBCL).
- HL Hodgkin Lymphoma
- DLBCL diffuse large B-cell lymphoma
- abnormal plasma cells in myeloma may lack the B-cell marker CD 19, and express the natural killer cell marker CD56.
- the methods of the present invention have been used to detect abnormal lymphocytes expressing the FOXP2 gene in subjects with MGUS, MM, Hodgkin lymphoma, ABC-like DLBCL and T-cell lymphomas.
- the method of the invention can be used to detect abnormal lymphocytes, particularly malignant and/or pre-malignant lymphocytes in the diagnosis and/or assessment of such disorders or conditions or their treatment e.g. diagnosis and/or prognosis of such conditions, or to monitor treatment response or detect minimal residual disease etc.
- the method of the invention can be used to detect malignant and/or pre-malignant lymphocytes.
- the methods of the invention can hence detect malignant or pre-malignant T cells, B cells or plasma cells.
- the invention provides a method as previously defined for detecting malignant or pre-malignant plasma cells.
- abnormal and particularly malignant and pre-malignant lymphocytes are associated with many different disorders or disease conditions. It is possible to use the FOXP2 marker of the invention to indicate or identify the presence of such a disease condition associated with the presence of abnormal lymphocytes, optionally in association with other measures or parameters.
- the invention extends to a method for detecting or assessing in a subject a condition associated with the presence of abnormal lymphocytes, said method comprising detecting the amount or expression of the FOXP2 gene in lymphocytes in a sample from said subject, wherein an increased amount or level of expression of the FOXP2 gene indicates or suggests the presence or status of said condition.
- Detecting a condition may be seen as identifying a subject with the condition or identifying the condition in a subject.
- the term "assessing” broadly includes assessing the status of the condition, in terms of for example severity of disease, risk of or potential for progression, early detection of relapse, monitoring of response to treatment (i.e. any therapeutic intervention) or the presence of disease following treatment e.g. monitoring for the presence of minimal residual disease.
- the invention provides a method for diagnosis and/or prognosis of a condition associated with the presence of abnormal lymphocytes in a subject, said method including the step of detecting an increased amount of the FOXP2 gene or expression of the FOXP2 gene in lymphocytes in a sample from said subject.
- a sample of lymphocytes obtained from a subject in which a high percentage of lymphocytes express the FOXP2 gene and/or in which a high amount or expression of the F0XP2 gene is detected may be associated with a poor prognosis.
- a " poor prognosis" may relate to an increased severity of disease, a shorter life expectancy, a more rapid progression of disease and/or a reduced efficacy of treatment by therapeutics, e.g. as compared to usual or average disease progression/severity.
- a poor prognosis may indicate a life expectancy of less than two years, more particularly of less than one year.
- a poor prognosis may relate to an increased severity of bone disease or colonisation.
- a high percentage of lymphocytes expressing FOXP2 may refer to more than 50, 60, 70, 80 or 90% of lymphocytes in a sample being FOXP2 positive i.e. expressing the FOXP2 gene.
- a high level of expression of the FOXP2 gene may be the result of the FOXP2 positive cells strongly expressing FOXP2 and/or an increased percentage of lymphocytes expressing the FOXP2 gene e.g. more than 50, 60, 70, 80 or 90% of lymphocytes in the sample expressing the FOXP2 gene.
- a high expression level includes a sample in which more than 50% e.g. more than 60, 70, 80 or 90% of lymphocytes, particularly plasma cells, express the FOXP2 gene.
- Samples with a high level of expression of the FOXP2 gene include those which have FOXP2 mRNA or FOXP2 protein levels more than 50, 100, 200, 300, 400 or 500% higher than that seen in a normal sample or a sample taken from a patient with MGUS.
- the invention provides a method of determining the prognosis of a condition associated with the presence of abnormal lymphocytes in a subject, said method including the step of detecting an amount or expression of the FOXP2 gene in lymphocytes in a sample from said patient, wherein the detection of a high amount or expression level of FOXP2 is indicative of a poor prognosis.
- Conditions associated with the presence of abnormal lymphocytes include conditions associated with the presence of abnormal plasma cells, T cells or B cells e.g. malignant or pre-malignant plasma cells, T cells or B cells.
- the term "associated with” includes conditions which are characterised by the presence of abnormal lymphocytes, caused by the presence of abnormal lymphocytes, which exhibit abnormal lymphocytes or in which abnormal lymphocytes occur or exist.
- a condition associated with abnormal lymphocytes may thus include a lymphocytic neoplastic disorder or a lymphocyte malignancy.
- a lymphocytic neoplastic disorder or a lymphocyte malignancy.
- plasma cell disorders which may or may not be malignant, specifically MGUS and myeloma, which may include smouldering myeloma.
- the present invention includes detecting or assessing a condition associated with abnormal plasma cells and particularly detecting or assessing a plasma cell disorder
- Plasma cell disorders may be included under the general term "plasma cell dycrasia" and such dyscrasias are included within the scope of the present invention.
- a plasma cell dyscrasia has been defined as a plasma cell disorder. More particularly, a plasma cell dyscrasia may be seen as a diverse group of diseases characterised by the proliferation of a single clone of cells producing a monoclonal immunoglobulin or immunoglobulin fragment (a serum M component). The cells usually have plasma cell morphology, but may have lymphocytic or lymphoplasmacytic morphology.
- This group includes multiple myeloma, Waldenstrom's macroglobulinaemia, the heavy chain disease, benign monoclonal gammopathy, immunocytic amyloidosis, primary amyloidosis, plasmacytoma, plasma cell leukaemia, and POEMS syndrome.
- a plasma cell disorder includes MGUS and myeloma, and more specifically multiple myeloma and asymptomatic myeloma.
- lymphomas which may include both Hodgkin and non-Hodgkin's lymphomas.
- the latter may include various lymphoma sub-types including both T- and B-cell lymphomas, for example diffuse large B cell lymphoma, small lymphocytic lymphoma, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, extranodal marginal B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, Adult T-cell leukaemia/lymphoma, Enteropathy- type T-cell lymphoma, hepatosplenic T-cell lymphoma and angioimmunoblastic T- cell lymphoma.
- the method of the invention may be used to detect abnormal lymphocytes, which may occur in certain lymphomas and thus may used to aid the diagnosis of such lymphomas or in the prognosis of lymphoma.
- Lymphoid malignancies refers to a tumour of lymphoid tissue or any malignant disease that usually start in the lymph nodes or lymphoid tissue. Lymphoid malignancies include the following conditions which are classified by the WHO as (i) Precursor Lymphoid Malignancies e.g. B lymphomoblastic leukaemia/ lymphoma and T lymphomoblastic lymphoma, (ii) Mature B-cell neoplasms e.g.
- Chronic lympocytic leukaemia/ small lymphocytic lymphoma B-cell prolymphocyte leukaemia, Splenic B-cell marginal zone lymphoma, Hairy cell leukaemia, Lymphoplasmacytic lymphoma, Extranodal marginal zone lymphoma of mucosa associated tissue, Nodal marginal zone lymphoma, Follicular lymphoma, Primary cutaneous follicle centre lymphoma, Mantle cell lymphoma, Diffuse large B-cell lymphoma, Lymphotoid granulomatosis, Primary mediastinal large B-cell lymphoma, Intravascular large B-cell lymphoma, ALK positive large B- cell lymphoma, Plasmablastic lymphoma, Large B-cell lymphoma arising in HHV8- associated multicentric Castleman disease, Primary effusion lymphoma, Burkitt lymphoma, B-cell lymphoma, unclassifiable, with features intermediate between diffuse large
- T-cell prolymphocyte leukaemia T-cell large granular lymphocytic leukaemia, Aggressive NK cell leukaemia, Systemic EBV positive T-cell lymphoproliferative disease of childhood, Hydroa vacciniforme-like lymphoma, Adult T-cell leukaemia/ lymphoma, Extranodal NK/T cell lymphoma, nasal type, Enteropathy- associated T- cell lymphoma, Hepatosplenic T-cell lymphoma, Subcutaneous panniculitis-like T- cell lymphoma,Mycosis fungoides, Sezary syndrome, Primary cutanoeus CD30 positive T-cell lymphoproliferative disorders, Primary cutaneous gamma-delta T- cell lymphoma, Peripheral T-cell lymphoma, NOS, Angioimmunoblastic T-cell lymphoma, Anaplastic large cell lymphoma, ALK positive and negative, (iv) Hodgkin lymphoma
- Nodular lymphocyte predominant Hodgkin lymphoma Nodular lymphocyte predominant Hodgkin lymphoma, Classical Hodgkin lymphoma, (v) Post Transplant Lymphoproliferative Disorders e.g. Early lesions, Polymorphic PTLD, Monomorphic PTLD and Classical Hodgkin lymphoma type PTLD.
- tumours which are likely to colonise the bone marrow by detecting an amount or the expression of the FOXP2 gene in lymphocytes in a sample from a subject and the invention extends to the detection of such tumours.
- the detection of an amount or the expression of the F0XP2 gene in a sample of lymphocytes may be indicative not only of the presence of abnormal lymphocytes but also of a disease e.g. a malignancy which is likely to colonise the bone marrow and/or lead to bone disease.
- a high amount or a high level of expression of the FOXP2 gene may be associated with an increased severity of bone disease.
- a high amount or level of expression of the FOXP2 gene in plasma cells in a myeloma sample may indicate a patient who is likely to have an increased severity of bone disease.
- the high level of expression of the FOXP 2 gene may be the result of the presence of plasma cells strongly expressing the FOXP2 gene and/or an increased percentage of plasma cells expressing FOXP2 e.g more than 50, 60, 70, 80 or 90% of CD138 + cells in the sample expressing the FOXP2 gene.
- a high expression level includes a sample in which more than 50%, e.g. more than 60, 70, 80 or 90% of plasma cells express the FOXP2 gene.
- Samples with a high expression of FOXP2 include those which have FOXP2 mRNA or FOXP2 protein levels more than 50, 100, 200, 300, 400 or 500% higher than that seen in a normal sample or seen in a sample (e.g. comprising plasma cells) obtained from a patient with a low level of bone disease or in an MGUS patient.
- a method of predicting the severity of bone disease in myeloma is therefore encompassed comprising the step of detecting the amount or expression level of the FOXP2 gene (e.g.
- a step of comparing the expression level measured with a normal sample or sample obtained from a myeloma patient with a low level of bone disease or an MGUS patient may also be carried out.
- the methods of the invention may be used in the diagnosis or identification of MGUS or myeloma in a subject, including particularly multiple myeloma (MM).
- MM multiple myeloma
- the invention can be seen to provide a method of diagnosis of MGUS or myeloma which includes the step of detecting abnormal plasma cells as described herein.
- symptomatic or smouldering myeloma and MGUS are currently diagnosed in the art by determining the percentage of clonal plasma cells present in the bone marrow, the presence or amount of paraprotein in either serum or urine, and end-organ damage.
- the detection of increased FOXP2 expression levels in more than 95% of MM samples as shown by the present inventors allows FOXP2 to be used in the diagnosis of MM, together with a determination or measurement of the percentage of clonal plasma cells present in the bone marrow to enable distinction between MM and MGUS.
- the invention provides a method for diagnosing myeloma in a subject having >10% clonal plasma cells in bone marrow, said method comprising detecting an amount or expression of the FOXP2 gene in said plasma cells, wherein an increased amount or expression of the FOXP2 gene indicates the presence of myeloma.
- a method of diagnosing myeloma comprising the steps of determining the percentage of clonal plasma cells in a bone marrow sample and detecting an amount or expression of FOXP 2 in said plasma cells, wherein the detection of >10% clonal plasma cells in said sample and an increased amount or expression of FOXP 2 in said plasma cells is indicative of myeloma.
- Multiple myeloma may further be distinguished from asymptomatic myeloma by one or more parameters of end-organ damage, as indicated above.
- the invention provides a method for diagnosing MGUS in a subject having ⁇ 10% clonal plasma cells in bone marrow, said method comprising detecting an amount or expression of the FOXP2 gene in said plasma cells, wherein an increased amount or expression of the FOXP2 gene indicates the presence of MGUS.
- a method of diagnosing MGUS is provided, said method comprising the steps of determining the percentage of clonal plasma cells in a bone marrow sample and detecting an amount or expression of FOXP2 in said plasma cells, wherein the detection of ⁇ 10% clonal plasma cells in said sample and an increased amount or expression O ⁇ FOXP2 in said plasma cells is indicative of MGUS.
- the determination of the amount or expression of the FOXP2 gene in abnormal lymphocytes may also be utilised in the prognosis for patients with conditions associated with abnormal lymphocytes, including determining or identifying a risk or potential for disease progression.
- the methods of the invention may be used in the prognosis of certain types of lymphoma.
- results obtained by the present inventors suggest that increased expression of FOXP2 or increased amounts of FOXP2 may indicate a poor prognosis.
- the present inventors have found that FOXP2 expression may be increased in aggressive lymphomas e.g. in lymphomas which progress rapidly or are resistant to therapy.
- a further embodiment of the invention is therefore a method for determining the prognosis of a subject having a lymphoma, said method comprising detecting an amount or expression of the F0XP2 gene in a sample of said lymphoma, wherein an increased amount or expression of FOXP2 is indicative of a poor prognosis.
- Said amount or expression of FOXP2 may be detected in a sample of lymphocytes from said subject, which may be for example a sample of lymphocytes taken from a tumour or from a site of disease.
- abnormal lymphocytes expressing the F0XP2 gene may be detected in ABC (activated B-cell-like)-type DLBCL but not GC (germinal centre)-type.
- ABC-type patients have a poorer prognosis than GC- type.
- the methods of the present invention may be used to identify high or increased-risk DLBCL patients.
- the detection of an increase in FOXP2 expression or the amount of F0XP2 can be used to assess the prognosis of a patient with MGUS or asymptomatic myeloma.
- a high ratio of abnormal to normal plasma cells in patients with MGUS and asymptomatic myeloma is considered to be a significant predictor of patients with a greatly increased likelihood.of disease progression.
- a high ratio of plasma cells with expression of F0XP2 or an increased amount O ⁇ FOXP2 may be indicative of a poor prognosis and of disease progression to multiple myeloma.
- the invention thus provides a method for determining the prognosis of a subject having MGUS or asymptomatic myeloma, said method comprising determining the ratio of FOXP 2 - expressing plasma cells to non- FOXP2 expressing plasma cells in a bone marrow sample from said subject, wherein a high ratio is indicative of a poor prognosis and/or of disease progression.
- a method for determining the prognosis of a subject having MM comprising determining the ratio of FOXP2 expressing plasma cells to non- FOXP2 expressing plasma cells in a bone marrow sample from said subject wherein a high ratio is indicative of a poor prognosis.
- high ratio refers to a ratio of FOXP2 expressing cells :non- FOXP2 expressing cells of at least 1 :1, for example 2:1, 3:1, 4: 1 , 5:1 or more.
- a poor prognosis could be indicated where more than 10% of the plasma cells present in a sample express FOXP2 or have an increased amount O ⁇ FOXP2.
- more than 20, 30, 40, 50, 60, 70, 80, or 90% or all of the plasma cells present in a sample expressing FOXP2 may be indicative of a poor prognosis.
- detection of the proportion of plasma cells in S-phase is prognostically significant in myeloma and that, combined with CD138-based detection of plasma cells, it may be used as an important staging system in the prognosis of MM. Accordingly, in an embodiment of the present invention detection of FOXP2 amount or expression may be combined with detecting the number or proportion of cells in a sample in S-phase, or more particularly with detecting the number or proportion of plasma cells in S-phase. Such a method may be used as the basis of an improved method of prognosis of a plasma cell disorder, and particularly myeloma, for example to predict or assess the risk or likelihood of relapse.
- the methods of the invention described above may be performed on cells or tissues removed from a human subject or patient. However, as indicated above it is also within the scope of the invention to perform the method on cells or tissues removed from a non-human mammal, such as a laboratory, livestock or domestic animal e.g. a mouse, rat, rabbit, monkey, dog or cat.
- a non-human mammal such as a laboratory, livestock or domestic animal e.g. a mouse, rat, rabbit, monkey, dog or cat.
- Samples may be obtained from subjects by methods known in the art, for example by biopsy.
- the samples may be used directly in the methods, or they may be treated in any desired or convenient way.
- lymphocytes may be isolated or purified therefrom.
- the invention may be viewed as providing a use of the FOXP2 gene as a marker for abnormal lymphocytes, wherein detection of FOXP2 expression or of an increased amount of FOXP2 indicates the presence of abnormal lymphocytes, particularly abnormal plasma cells.
- F0XP2 may be used as a marker for pre- malignant or malignant lymphocytes.
- the invention includes the use of the FOXP 2 gene as a marker for detecting or assessing a condition associated with the presence of abnormal lymphocytes.
- the FOXP2 gene (or indeed the FOXP2 protein) may thus be used a prognostic and/or diagnostic marker for such a condition, and in particular plasma cell disorders or lymphomas.
- the association Q ⁇ FOXP2 expression with abnormal lymphocytes identifies it as a potential therapeutic target in the treatment of conditions associated with the presence of abnormal lymphocytes.
- F0XP2 expression may be indicative of tumours or diseases (including malignancies and tumours) which are likely to colonise bone or which may have an increased severity of accompanying or associated bone disease
- targeting FOXP2 expression may reduce the severity of the bone disease and/or reduce colonisation of bone.
- a further aspect of the invention provides a method for treating, in a subject suffering therefrom, a condition associated with abnormal lymphocytes, said method comprising administering to said subject an agent which inhibits FOXP2 expression and/or FOXP2 activity.
- This aspect of the invention also provides an agent which inhibits FOXP2 expression and/or FOXP2 activity for use in the treatment of a condition associated with abnormal lymphocytes. Further, the invention encompasses the use of an agent which inhibits FOXP2 expression and/or FOXP2 activity in the manufacture of a medicament for treating a condition associated with abnormal lymphocytes.
- Said condition associated with abnormal lymphocytes may include a primary disease (including particularly a malignancy) or a secondary disease (e.g. metastases) or indeed any accompanying or associated disease which may accompany or be associated with a primary disorder, such as bone disease as discussed above.
- a primary disease including particularly a malignancy
- a secondary disease e.g. metastases
- indeed any accompanying or associated disease which may accompany or be associated with a primary disorder such as bone disease as discussed above.
- a method of reducing the severity of bone disease and/or colonisation of the bone in conditions associated with abnormal lymphocytes comprising administering an agent which inhibits FOXP2 expression and/or FOXP2 activity.
- This aspect also provides an agent which inhibits F0XP2 expression and/or FOXP2 activity for use in reducing the severity of bone disease and/or colonisation of the bone in conditions associated with abnormal lymphocytes.
- SMAD3 As discussed further below in the Examples, it has been shown by the present inventors that silencing FOXP2 expression results in upregulation of SMAD- 3 expression.
- the SMAD proteins are involved in the propagation of the TGF- ⁇ signal which negatively regulates cellular proliferation.
- SMAD3 also negatively regulates both Runx2 expression and Runx2 activity (Borton Hjelmeland et al, 2005, MoI. Cell Biol., 25(21), 9460-9468), thus FOXP2 regulation of SMAD3 may be necessary to activate Runx2.
- upregulating the expression of SMAD3 (by inhibiting FOXP2 expression) may present a method for preventing cellular proliferation and for treating conditions associated with the presence of abnormal lymphocytes.
- IRF-4 expression and cyclin Dl expression are repressed when FOXP2 expression is silenced.
- Inhibition of the IRF-4 pathway is toxic to myeloma tumour cells and cyclin Dl has a role in cell proliferation and hence these results also show that inhibition of FOXP2 expression can be used to treat conditions associated with the presence of abnormal lymphocytes.
- myeloma in vivo the cells localise to the bone marrow and interact with stromal cells. This is a particularly important aspect of myeloma biology because cell adhesion mediated drug resistance is an intrinsic mechanism of myeloma resistance to chemotherapeutic drugs.
- FOXP2 silencing reduces the number of myeloma cells adhering to the stromal cell monolayer and thus targeting FOXP2 expression or function may be able to overcome cell adhesion mediated drug resistance and allow the effective treatment of myeloma. «
- Conditions which may be treated according to this aspect of the invention may be any condition associated with the presence of abnormal lymphocytes, as discussed above, including particularly plasma cell disorders, and particularly plasma cell malignancies, notably myeloma, and lymphomas, including both Hodgkin lymphoma and non-Hodgkin's lymphomas, which may include various T- cell lymphomas, and B-cell lymphomas, e.g. diffuse large B-cell lymphoma.
- T-cell lymphomas include Adult T-cell lymphoma, Enteropathy-type T-cell lymphoma, hepatosplenic T-cell lymphoma and angioimmunoblastic T-cell lymphoma. Other lymphomas are listed above.
- the condition is multiple myeloma, asymptomatic myeloma or MGUS.
- treatment is used herein to broadly include both therapeutic and prophylactic treatment i.e. both therapy and prevention.
- the agent or more particularly a pharmaceutical composition comprising the agent may be administered to a patient who may not yet have developed a condition associated with the presence of abnormal lymphocytes. Such a patient may for example be at risk of developing the condition.
- the agent which inhibits FOXP2 expression and/or activity may be any agent (e.g. inhibitor or antagonist) which can prevent or reduce the transcription or translation of FOXP 2 mRNA or FOXP2 protein, can degrade FOXP2 mRNA or protein or can prevent or reduce the activity of FOXP2 protein e.g. can alter its binding or functionality.
- agent e.g. inhibitor or antagonist
- Such an agent can for example reduce the expression of FOXP2 by 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100%.
- a reduction in the level of expression of FOXP2 can be determined or detected by any of the methods described previously above.
- An agent which inhibits FOXP2 expression includes an antisense molecule (e.g. an antisense oligonucleotide) of FOXP 2 or a nucleic acid molecule capable of hybridising to FOXP2 to inhibit expression thereof.
- Antisense technology can be used to control gene expression through triple-helix formation of antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
- the 5' coding portion or the mature protein sequence which encodes for the FOXP2 protein can be used to design an antisense RNA oligonucleotide of from 10 to 40 base pairs in length.
- the antisense RNA oligonucleotide hybridises to the mRNA and blocks translation of an mRNA molecule into protein.
- a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and protein production.
- an antisense nucleic acid molecule comprising at least 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides which is capable of hybridising to FOXP2 can be used to treat a condition associated with the presence of abnormal lymphocytes. Absolute complementarity is not required and any oligonucleotide having sufficient complementarity to form a stable duplex with the target is suitable.
- antisense sequence are usually designed to complement the mRNA target (FOXP2) and form RNA:antisense duplex. This duplex formation can prevent processing, splicing, transport, or translation of FOXP 2 mRNA. Certain antisense sequences can also elicit cellular RNase H activity when hybridised with the mRNA, resulting in mRNA degradation. In that case, RNase H will cleave the RNA of the duplex and can potentially release the antisense molecule to hybridise further with additional molecules of F0XP2 mRNA. As described above, an additional mode of action results from the interaction of antisense with genomic DNA to form a triple helix which may be transcriptionally inactive.
- sequence target segment of F0XP2 for the antisense oligonucleotide is selected such that the sequence exhibits suitable energy related characteristics important for oligonucleotide duplex formation with their complementary templates, and shows a low potential for self- dimerisation or self-complementation. It is possible to use the OLIGO computer program (primer analysis software version 3.4) to determine the antisense sequence melting temperature, free energy properties and to estimate potential self-dimer formation and self-complementarity properties. The program allows the determination of a qualitative estimation of these two parameters and provides an indication of "no potential” or "some potential” or "essentially complete potential”.
- An antisense oligonucleotide may be delivered to cells by procedures well known in the art, for example, in vectors e.g. in plasmid vectors or viruses.
- siNA small nucleic acid molecules
- shRNA is a sequence of RNA that makes a tight hairpin turn that can be used to silence gene expression via RNAi.
- siRNA are a class of double- stranded RNA molecules that may be from 18 to 25 (e.g. 19, 20, 21, 22, 23, 24) nucleotides in length.
- a duplex siRNA of ATGGAAGAC AATGGCATT AAA may be used as an inhibitor of FOXP2.
- siRNAs (Invitrogen) may be used: 2580 - double stranded made from 5'-GACAGGCAGUUAACACUU AAUGAAA-3 1 plus 5'-UUUCAUUAAGUGUUAACUGCCUGUC-S '
- Aptamers are nucleic acid molecules that can bind to proteins, nucleotides and complexes and can be use to inhibit FOXP2 expression and/or FOXP2 activity.
- Aptamers can be modified for stability or other desired qualities and modifications can be introduced anywhere in the molecule such as at the 5' or 3' termini or at any internally defined modification site.
- RNA aptamers can be stabilised with 2'-fluoro or 2'-amino modified pyrimidines.
- Aptamers can also be linked to reporter molecules or linkers.
- An aptamer inhibitor of FOXP2 may be from 10 to 50 nucleotides (e.g. from 15, 20, 30, 40 nucleotides) in length.
- Ribozymes may further be used as inhibitors 0 ⁇ F0XP2 expression in accordance with the present invention.
- Ribozymes possess RNA catalytic ability and can cleave a specific site in RNA. Ribozymes catalyse the phosphodiester bond cleavage of RNA and several ribozyme structural families have been identified including Group I introns, RNase P, the hepatitis delta virus ribozyme, hammerhead ribozymes and the hairpin ribozyme originally derived from the negative strand of the tobacco ringspot virus satellite RNA. In general, the ribozyme has a length of from 30 to 100 nucleotides.
- decoy oligonucleotides that prevent DNA binding i.e. the binding of FOXP2 to DNA
- FOXP2 is a transcription factor
- any molecules which prevent or disrupt FOXP2 interaction with a coregulatory protein which is necessary for transcription may be used to inhibit FOXP2.
- Dimerisation of FOXP2 may be required for DNA binding and hence disruption of dimerisation can be used to inhibit FOXP2.
- the agent may be an anti-FOXP2 antibody.
- An antibody to FOXP2 may be raised according to standard techniques well known to those skilled in.the art by using a FOXP2 protein as previously described herein, or a fragment thereof as an antigen/immunogen in a host animal e.g. the FOXP2 protein of SEQ ID NO 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 or 37 or a fragment or epitope from the protein
- the antibody may be monoclonal or polyclonal and may be of any convenient or desired species, class or sub-type. Furthermore, the antibody may be natural, derivatised or synthetic.
- the "anti- FOXP2 antibody” which can be used as an inhibitory agent thus includes:
- immunoglobulin e.g. IgG, IgA, IgM, IgD or IgE derived from any animal e.g. any of the animals conventionally used e.g. sheep, rabbits, goats, or mice or egg yolk;
- Fv may be defined as a fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains
- antibodies produced or modified by recombinant DNA or other synthetic techniques including monoclonal antibodies, fragments of antibodies, humanised antibodies, chimeric antibodies, or synthetically made or altered antibody-like structures.
- functional derivatives or "equivalents" of antibodies e.g. single chain antibodies.
- a single chain antibody may be defined as a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a fused single chain molecule.
- Anti-FOXP2 antibodies known in the art include FOXP2 N- 16 sc-21069 (Santa Cruz, CA, USA). Such antibodies may form the basis for preparing derivatives or synthetic constructs which might be used as therapeutic antibodies according to this aspect of the invention.
- single chain Sv intrabodies may be engineered, to target the FOXP2 protein.
- FOXP2 protein p53 and EGFR in Caron de Fromentel et al. 1999 Oncogene 18: 551-557 and Beerli et al. 1996 Breast Cancer Res. Treat. 38: 1 1-17.
- inhibitory agents which can be used to inhibit FOXP2 activity may be agents which can inhibit dimerisation of FOXP2. Additionally, it is possible to inhibit FOXP2 activity by administering a binding partner for FOXP2, which would have the effect of "mopping up” or sequestering FOXP2 in a cell and hence preventing it from exerting its effect in the cell. It will be appreciated that such a binding partner may be an antibody, but it may also be any binding partner for FOXP2 and such a binding partner may be identified by a variety of techniques known in the art. By way of example, such agents may include CtBPl and NFAT, or FOXP2 binding fragments thereof, or other proteins or protein fragments, peptides etc.
- Molecules which alter (increase or decrease) the phosphorylation, ubiquitination, acetylation or SUMOlation of FOXP2 can also be used as agents in the present invention.
- Small molecules may also be used as agents, for example non-biological molecules such as organic compounds, organometallic compounds, salts of organic and organometallic compounds, saccharides, and amino acids. Additionally, other small molecules can include biological molecules of low molecular weight including lipids, oligosaccharides, oligopeptides or their derivatives. Such inhibitory small molecules may be identified by screening for ability to inhibit FOXP2 expression or FOXP2 activity according to principles or techniques known and described in the art.
- An agent which inhibits FOXP2 expression or activity can be a known agent or novel agents can be identified by screening for their ability to inhibit FOXP2 expression or activity.
- Test agents for screening may be obtained from a variety of sources e.g. compound libraries, for example combinatorial libraries or peptide libraries such as phage display libraries, which may be generated according to procedures or principles well known in the art, or from libraries of natural compounds e.g. in the form of bacterial, plant, fungal and animal extracts which can be obtained from commercial sources or collected in the field.
- the agent which inhibits FOXP2 expression or activity may also be obtained by rational design, for example based on structures of known agents which inhibit FOXP2 expression or activity.
- Known agents which inhibit FOXP2 expression or activity may be subjected to directed or random chemical modification to produce structural analogues.
- the agent may be formulated in a pharmaceutical composition together with any suitable pharmaceutically acceptable carrier, diluent or excipient.
- the agents may be encapsulated and/or combined with suitable carriers in solid dosage forms for oral administration or alternatively with suitable carriers for administration in aerosol form.
- the inhibitors may further be combined with any other carrier for administration by injection e.g. by subcutaneous or intramuscular injection.
- the pharmaceutical compositions may include pharmaceutically acceptable carriers including for example non-toxic salts, sterile water or the like.
- a suitable buffer may also be present allowing the compositions to be lyophilised and stored in sterile conditions prior to reconstitution by the addition of sterile water for subsequent administration.
- the carrier can also contain other pharmaceutically acceptable excipients for modifying other conditions such as pH, osmolality, viscosity, sterility, lipophilicity, somobility or the like. Pharmaceutical compositions which permit sustained or delayed release following administration may also be used.
- the dosage regime may be determined according to the nature and weight of the patient, and may depend on the particular route of administration to be used.
- the dosage administered may readily be determined by a medical practitioner based on the circumstances pertaining to the disorder to be treated, such as the severity of the symptoms, the age, weight, and response of the individual etc.
- the amount of agent in the composition may vary considerably e.g. from less than 0.5%, usually 1% to as much as 15 or 20% by weight. This can also be dependent on the fluid volumes, viscosities, etc., preferable for the particular mode of administration selected.
- Single or multiple administrations of the compositions can be carried out with dose levels and patterns being selected by the treating physician.
- the agents may also be administered in combination together, separately, sequentially, or simultaneously, with other therapeutic agents effective against, or used in the treatment of the condition in question.
- FOXP2 silencing reduces the number of myeloma cells adhering to the stromal cell monolayer
- targeting FOXP2 expression or function in this way may be able to overcome cell adhesion mediated drug resistance and allow the effective treatment of myeloma.
- the invention encompasses the treatment of a condition associated with abnormal lymphocytes using an agent which is capable of inhibiting FOXP2 expression or FOXP2 activity, in combination with a further therapeutic agent which can treat the condition.
- a product which contains an agent which inhibits FOXP2 expression and/or FOXP2 activity and a therapeutic agent effective against or used in the treatment of a condition associated with abnormal lymphocytes as a combined preparation for simultaneous, separate or sequential use in treating a condition associated with abnormal lymphocytes.
- the therapeutic agent may be a chemotherapeutic agent.
- Chemotherapy is the use of drugs to destroy or control cancer cells and thus a chemotherapeutic agent may have a cytotoxic or cytostatic or other controlling effect on cancer cells.
- Many different drugs or chemotherapeutic agents are commonly use to treat MM, for example: melphalan, vincristine, cyclophosphamide, carmustine, doxorubicin, Thalidomid ® (thalidomide), Velcade ® (bortezomib), Lenalidomide or Revlimid ® . .
- drugs may be given in combination and may be combined with other drugs such as immunomodulating agents or corticosteroids, immunotherapies or other treatments such as radiotherapy and autologous or allogeneic peripheral blood stem cell transplants. Combinations are determined by many factors and include melphalan and prednisone (MP), with or without thalidomide or bortezomib; vincristine, doxorubicin and dexamethasone (VAD); thalidomide and dexamethasone; bortezomib, thalidomide, plus dexamethasone; and liposomal doxorubicin, vincristine, dexamethasone.
- MP melphalan and prednisone
- VAD doxorubicin and dexamethasone
- thalidomide and dexamethasone thalidomide and dexamethasone
- bortezomib thalidomide, plus dexamethasone
- the product may comprise an antisense RNA e.g. a siRNA molecule as described previously or an antibody as described herein.
- the invention provides a method of treating a condition associated with abnormal lymphocytes in a subject suffering therefrom said method comprising administering to said subject an agent which inhibits FOXP2 expression and/or FOXP2 activity, together with a therapeutic agent, wherein said agent and therapeutic agent are administered either simultaneously, sequentially or separately.
- the therapeutic agent may be a chemotherapeutic agent.
- FOXP2 an increased expression of FOXP2 occurs in other tumours which have a bone disease phenotype, for example in Ewing's sarcoma.
- This data together with the bone disease phenotype observed in myeloma where an increase of FOXP2 expression in lymphocytes is also seen, indicates that inhibition of the activity of FOXP2 or expression of the FOXP2 gene could be used for the treatment of bone disease associated with FOXP2-expressing tumours.
- the inhibition of FOXP2 activity or FOXP2 expression may prevent such tumours from homing to the bone marrow e.g. colonising the bone, or may reduce the severity of bone disease seen.
- the invention provides a method of treating bone disease associated with a tumour having an increased amount or expression of FOXP2 gene, said method comprising administering to a subject having or at risk of said bone disease, an agent which inhibits F0XP2 expression and/or FOXP2 activity.
- This aspect of the invention also provides an agent which inhibits FOXP2 expression and/or FOXP2 activity for use in the treatment of bone disease associated with tumours having an increased amount or expression of the FOXP2 gene.
- This may include primary tumours localised in the bone marrow, such as myeloma and some lymphomas together with those where the cancer metastasizes to the bone marrow e.g. lymphoma and some carcinomas e.g. thyroid and kidney.
- Bone disease which may be associated with a FOXP2-expressing tumour encompasses osteoporosis, bone lesions, bone pain, fractures, immunosuppression or other such phenotypes which can occur as the result of the presence of a tumour.
- the treatment of bone disease may reduce the severity of the bone disease which occurs e.g. the number of lesions in the bones may be reduced by at least 10, 20, 30, 40 or 50% or may prevent bone disease from occurring.
- a tumour having an increased amount or expression of FOXP2 refers to an abnormal mass of tissue (e.g. comprising abnormal cells which may have an increased size, increased proliferation, loss of characteristics e.g. cell markers, may be less differentiated etc than their normal cell counterparts), which results from excessive cell division.
- the tumour may comprise malignant cells and the tumour (or a sample thereof) has an increased amount or expression O ⁇ FOXP2 compared to normal or non-malignant cells of the same type.
- the tumour may be heterogeneous and may therefore comprise both abnormal (e.g. malignant) cells and normal cells.
- the tumour may include primary tumours localised in the bone marrow, such as myeloma and some lymphomas together with those where the cancer metastasizes to the bone marrow e.g. lymphoma and some carcinomas e.g. thyroid and kidney.
- an increased expression of the FOXP2 gene in a tumour may be the detection of any expression of the FOXP2 gene, as discussed previously for abnormal lymphocytes (and the comments regarding the expression of FOXP2 made previously with respect to abnormal lymphocytes apply equally here). However, preferably, as discussed above, at least 5 % or 10% of cells in' the tumour should express FOXP2 for the tumour to be considered as FOXP2 expressing, to rule out de minimis expression.
- tumour cells may contain more copies of the FOXP2 gene than the normal counterpart cells, or may have an increased level O ⁇ FOXP2 mRNA or FOXP2 protein than the normal counterpart cells e.g. more than 10, 20, 30, 40, 50, 60, 70, 80 or 90%.
- tumours having an increased amount or expression of FOXP 2 include Ewing's sarcoma and bone-metastatic lesions of other mesenchymal tumours eg rhabdomyosarcoma.
- malignant refers to cells which exhibit abnormal behaviour, particularly in terms of growth, death or differentiation. Malignant cells may not be self limited in their growth, they may fail to die at the appropriate time and/or they may be arrested at a particular stage of development or differentiation. For example, malignant cells may have increased proliferation compared to their normal counterparts e.g. increased by more than 5, 10, 15, 20, 25, 30, 40 or 50%. A malignant cell may be considered as a cancerous cell.
- An agent which inhibits FOXP2 expression and/or FOXP2 activity to treat bone disease is as defined previously for the treatment of conditions associated with abnormal lymphocytes. Further, as described previously, such an agent can be combined with a therapeutic agent which is active against the tumour having an increased amount or expression O ⁇ FOXP2 e.g. a chemotherapeutic agent as defined above.
- the detection of FOXP2 in the method of detecting abnormal lymphocytes can be achieved by using an antibody.
- the antibodies of the prior art were not suitable for detecting endogenous FOXP2 by immunohistochemistry, although they were reactive with recombinantly expressed FOXP2 protein.
- the inventors therefore sought to develop antibodies which could reliably be used to detect FOXP2 protein using any method. It was surprisingly discovered that antibodies directed to the N- terminus of FOXP2 could be used to detect endogenous FOXP2.
- a further aspect of the present invention is directed to an antibody which binds specifically to the N-terminus of FOXP2.
- the antibody may bind specifically to the N-terminus of FOXP2 and not to other FOXP proteins.
- the antibody can bind to both recombinant FOXP2 and to native endogenous FOXP2.
- a preferred and advantageous feature of the antibodies of the present invention is that may bind to native FOXP2 protein as expressed by a native cell, i.e. in situ in a native cell (namely a cell which has not been recombinantly or genetically engineered or manipulated in any way).
- binding specifically is meant that the antibody is capable of binding to the FOXP2 protein in a manner which distinguishes it from the binding to non-target molecules.
- the antibody either does not bind to non-target molecules or exhibits negligible or substantially reduced (as compared to FOXP2) e.g. background, binding to non-target molecules.
- FOXP2 in particular specifically recognises or binds to the N-terminus (also referred to herein as the N-terminal domain of FOXP2).
- the antibody does not therefore bind or exhibits negligible binding to FOXPl, FOXP3 or FOXP4 proteins.
- the antibody of the present invention is capable of binding to the N-terminal domain of the FOXP2 protein sequence defined above and hence may be capable of recognising any FOXP2 variants or isoforms comprising this region or an epitope therefrom.
- the N-terminal domain of FOXP2 may consist of the region from position 1 to position 250 from a FOXP2 protein, and particularly FOXP2 as defined above.
- an antibody of the invention may bind to any epitope or at any point within this N-terminal domain.
- the N-terminal domain is from position 1 to position 200, from position 1 to position 150, from position 1 to position 100 or from position 1 to position 90.
- the antibody binds to the N-terminal region as defined by position 1 to position 86 for example in SEQ ID NO. 2.
- the antibody of the invention may be of any type, including both polyclonal and monoclonal antibodies, it is advantageous that the antibody is of a single specificity.
- the antibody may be of any convenient or desired species, class or sub-type. Furthermore, the antibody may be natural, derivatised or synthetic. The term antibody as used herein thus includes all types of antibody molecules and antibody fragments.
- an antibody includes:
- immunoglobulin e.g. IgG, IgA, IgM, IgD or IgE derived from any animal e.g. any of the animals conventionally Used e.g. sheep, rabbits, goats, or mice or egg yolk
- Fv may be defined as a fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains
- antibodies produced or modified by recombinant DNA or other synthetic techniques including monoclonal antibodies, fragments of antibodies, humanised antibodies, chimeric antibodies, or synthetically made or altered antibody-like structures.
- functional derivatives or "equivalents" of antibodies e.g. single chain antibodies.
- a single chain antibody may be defined as a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a fused single chain molecule.
- Sv single chain
- CDRs complementarity-determining regions
- hypervariable regions of the antibodies may be defined as the region comprising the amino acid sequences on the light and heavy chains of an antibody which form the three dimensional loop structure that contributes to the formation of the antigen binding site.
- CDRs may be used to generate CDR-grafted antibodies.
- CDR grafted defines an antibody having an amino acid sequence in which at least parts of one or more sequences in the light and/or variable domains have been replaced by analogous parts of CDR sequences from an antibody having a different binding specificity for a given antigen.
- One of skill in the art can readily produce such CDR grafted antibodies using methods well known in the art.
- a chimeric antibody may be prepared by combining the variable domain of an anti-FOXP2 antibody of one species with the constant regions of an antibody derived from a different species.
- Monoclonal antibodies and their fragments and derivatives are preferred antibodies according to the present invention.
- a further aspect of the invention is thus a hybridoma or cell line producing an antibody of the invention as defined above.
- This antibody has been obtained having the properties defined above.
- This antibody is defined herein as FOXP2-73A/8 and the hybridoma producing this antibody has been deposited under the terms of the Budapest Treaty at the ECACC (Porton Down, Salisbury) on 14 October 2008 under the Accession Number 08101410.
- a preferred embodiment of this aspect of the invention provides a monoclonal antibody produced by or obtainable from the hybridoma cell line of ECACC deposit Accession Number 08101410.
- the invention provides a hybridoma (or hybrid cell line) being that on deposit at the ECACC under Accession Number 08101410.
- antibodies and hybridomas or cell lines having the identifying characteristics of antibody FOXP2-73A/8 or the hybridoma of ECACC Accession Number 08101410.
- identifying characteristics is meant for example the properties and characteristics e.g. functional effects of the antibodies of the invention (e.g. the ability to bind to the N-terminus of FOXP2).
- the genes encoding antibody FOXP2-73A/8 may be identified, cloned and examined. These may be utilised to create an antibody construct (e.g. a synthetic antibody chain, a CDR grafted antibody or a chimeric antibody) having a binding pattern and/or specificity identical to that of antibody FOXP2-73A/8.
- An antibody having the identifying characteristics or binding specificity of antibody FOXP2-73A/8 may thus be a derivative of the antibody FOXP2-73A/8 (the antibody produced by hybridoma ECACC Deposit Accession No.) 08101410.
- An antibody of the invention can be obtained or made according to techniques standard and well known in the art and widely described in the literature.
- a host animal may be immunised with a FOXP2 immunogen from the N- terminal region and used to generate a polyclonal or more preferably a monoclonal antibody using well known standard techniques.
- techniques for generating fragments of antibodies or antibody derivatives are also well known in the art.
- phage display methods may be used to make antibodies.
- the antibody of the invention may also be labelled e.g. with a small molecule such as hapten, biotin etc, or with a fluorochrome, radioisotope, coloured dye, enzyme, colloidal metal, chemi or bio-luminescent compound.
- the antibody of the invention may be bound to a carrier or immobilised on a solid support.
- the antibody may be immobilised on glass, polystyrene, polyethylene etc, dextran, nylon, amyloses, celluloses, polyacrylamides, agaroses, or solid surfaces such as particles e.g. magnetic or non-magnetic beads, the surfaces of plates, wells and tubes or strips. Methods for coupling or immobilising antibodies are well known in the art.
- the antibody of the invention can be used to detect the FOXP2 protein and hence can be used in the methods described above e.g. in the methods of detecting abnormal lymphocytes. Further, the antibody of the invention can be used in the methods of treating conditions associated with the presence of abnormal lymphocytes as described above.
- an antibody of the invention as defined herein for use in therapy, and particularly for use in treating a condition associated with abnormal lymphocytes a pharmaceutical composition containing an antibody of the invention and the use of antibody of the invention in the manufacture of a medicament for use in treating a condition associated with abnormal lymphoctyes.
- kits comprising the antibody of the invention are also encompassed where the kit is for use in detecting FOXP2.
- Other components of such a kit may include secondary antibodies.
- Figure 1 shows expression of F0XP2 mRNA in normal human tissues.
- Figure IA shows results obtained from hybridising the FOXP2 cDNA to an MTE array (Clontech Takara BioEurope, France). The top right panel shows the identity and location of tissues on the MTE array.
- qRT-PCR analysis of FOXP2 expression in normal human tissues is shown in Figure 1 B and in purified mononuclear cell populations is shown in Figure 1C.
- FOXP2 levels are relative to those in the MM cell line J JN3.
- Figure 2 shows FOXP2 mRNA and protein is expressed in lymphoma and myeloma cell lines.
- Figure 2 A shows qRT-PCR analysis of FOXP2 mRNA expression in cell lines derived from haematological malignancies.
- Figure 2B shows Western blotting analysis of FOXP2 protein expression in the same panel of cell lines, using the Santa Cruz polyclonal anti-FOXP2 antibody, with the lower panel showing a TBP loading control.
- Validation of the specificity of commercial FOXP2 antibodies for FOXP2 showing the additional cross reactivity of the Abeam antibody with FOXPl and FOXP4 (Figure 2C) while the Santa Cruz antibody was specific for FOXP2 (as shown in Figure 2D).
- FIG. 2F Silencing FOXP2 expression using RNAi confirmed the knock down of both endogenous F0XP2 mRNA expression (Figure 2F) and protein expression (Figure 2E) in the JJN3 myeloma cell line.
- Figure 3 shows an investigation of FOXP 2 mRNA expression in B-CLL tumour cells and biopsies from DLBCL and FL patients. qRT-PCR analysis of FOXP2 mRNA expression showed expression in a subgroup of DLBCL biopsies but not in FL (FCL) biopsies. There was no FOXP2 expression in B-CLL patients or those with B-PLL (B-cell prolymphocytic leukaemia) or SLVL (splenic lymphoma with villous lymphocytes).
- B-PLL B-cell prolymphocytic leukaemia
- SLVL splenic lymphoma with villous lymphocytes
- Figure 4 shows an investigation of FOXP2 mRNA expression in purified CD138 + plasma cells and total bone marrow aspirates.
- Figure 4A shows expression in CDl 38+ purified bone marrow plasma cells.
- Those indicated with a * represent two non-MM patients with elevated FOXP2 expression; one patient had a trephine reported as either LPL or myeloma, although clinical data suggested the more likely diagnosis was a low grade lymphoma and the other patient had a bone plasmacytoma with insufficient bone marrow trephine to define a malignant infiltrate.
- qRT-PCR analysis of both FOXP2 expression Figure 4B
- CDl 38 expression Figure 4C was also performed using 38 aspirate samples from total bone marrow.
- Figure 5 shows validation of the FOXP2-73A/8 monoclonal antibody.
- Western blotting (Figure 5A) showed that 73 A/8 specifically recognised FOXP2 transfected cells and not the other FOXP proteins (top left).
- Silencing using FOXP2- targeted siRNA confirmed the identity of the endogenous protein in the JJN3 cell line as FOXP2.
- Western blotting of nuclear extracts from lymphoma and MM cell lines confirms the pattern of reactivity observed using the polyclonal FOXP2 antibody from Santa Cruz.
- the 73 A/8 antibody also detects two additional lower molecular weight bands that might represent additional FOXP2 isoforms (possibly generated via the known alternative splicing of this gene).
- FOXP2 protein Although the full length FOXP2 protein was not expressed in the MEDBl cell line, although it did express some FOXP2 mRNA, 73 A/8 detected significant amounts of the smallest protein. The differences between the two antibodies may reflect their differential ability to recognise epitopes in individual FOXP2 isoforms.
- Figure 6 shows immunolabelling with antibody FOXP2-73A/8 and analysis of the data obtained using immunohistochemistry.
- the top panel of Figure 6A illustrates FOXP2-73 A/8 peroxidase immunolabelling of FOXP transfectants (detection using the Dako Envision System).
- FOXP2 cDNA The strong nuclear labelling of cells transfected with the FOXP2 cDNA, and not those transfected with the related FOXP proteins (FOXPl, FOXP3 and FOXP4), confirms the ability of this antibody to specifically detect FOXP2 by immunohistochemistry.
- the bottom panel of Figure 6B illustrates a FOXP2-positive MM case stained for CD 138 (cell surface labelling of plasma cells) and FOXP2 (nuclear labelling), confirming the expression of FOXP2 in malignant plasma cells.
- Arrowheads indicate the occasional CD138-positive cells that lack FOXP2 expression, while the arrows indicate examples of the majority of the CD138-positive cells that express nuclear FOXP2.
- Figure 6C shows the percentage of FOXP2+ plasma cells in MM, MGUS and reactive BM (no MM) in the CDl 38+ population. Both MGUS and MM patients exhibit a significantly higher frequency of FOXP2 plasma cell expression than reactive BM plasma cells.
- the MM patients are grouped by CD56 expression, CD56 positive cases on the left and CD56 negative on the right.
- Figure 8 shows silencing FOXP2 expression up-regulates SMADS expression in the JJN3 MM cell line.
- the top panels show Western blotting with FOXP2-73A/8 demonstrating the effective silencing of FOXP2 at the protein level using siRNA.
- FOXP2 silencing was not observed using a universal control duplex, and equal sample loading was confirmed using TBP protein expression.
- the bottom panel illustrates qRT-PCR analysis of SMAD 3 mRNA expression in RNA prepared from the same experiment, showing specific up-regulation ofSMAD3 expression on silencing FOXP2 (FOXP2 siRNA) compared to untransfected cells or those transfected with a control siRNA.
- Figure 9 shows silencing FOXP2 expression down-regulates IRF4 expression in the JJN3 MM cell line. qRT-PCR showing specific down-regulation of IRF4 expression on silencing FOXP2 (FOXP2) compared to cells treated with a universal siRNA (CON KO) or cells just grown normally in culture medium (JM).
- FOXP2 silencing FOXP2
- CON KO universal siRNA
- JM just grown normally in culture medium
- Figure 10 shows all 19 mRNA sequences from the Unigene folder for FOXP2, including all the known variant transcripts. Their encoded protein products are also shown.
- Figure 11 shows the genomic sequence of the FOXP2 gene (SEQ ID NO.l).
- Figure 12 shows FOXP2 mRNA expression in purified CD138 + plasma cells and total bone marrow aspirates. This figure corresponds to figure 4 but has reclassified patient 7 in panel A.
- Figure 12 A) shows FOXP2 expression in CD138 + purified bone marrow plasma cells. Those indicated with a * represent three patients that were difficult to classify; two patients had a trephine reported as either LPL or myeloma, although clinical data suggested the more likely diagnosis was a low grade lymphoma and the other patient (number 9) had a bone plasmacytoma with insufficient bone marrow trephine to define a malignant infiltrate.
- Figure 13 shows qRT-PCR of murine FOXP2 expression in a panel of adult murine tissues and in embryonic tissues.
- El 1, 7, 15 and 17 refer to days of embryonic development, LNilymph node, SKM: skeletal muscle, SMM: smooth muscle.
- FOXP2 expression levels were normalised using murine Tbp expression and are expressed relative to those in the El 1 embryo.
- Figure 14 shows an investigation of murine Foxp2 mRNA expression in normal tissues.
- the boxed section illustrates lack of osteoclast expression in the top sample, while high levels o ⁇ Foxp2 expression were observed in the three osteoblast samples below.
- Figure 15 shows FOXP2 mRNA expression in human osteoblasts and Ewing's sarcoma cells lines. F0XP2 expression was normalised using TBP and expressed relative to levels in the JJN3 myeloma cell line. RHl and TC 32 are Ewing's sarcoma cell lines.
- Figure 16 shows Foxp2 mRNA expression is elevated in the bones of Runx2 null mice during embryonic development.
- Figure 17 shows Western blotting using antibody FOXP2-73A/8 of Ewing's sarcoma cell lines. Strong expression of two proteins with a molecular weight comparable to that of the full length FOXP2 protein, and additional smaller proteins that may represent FOXP2 isoforms, was observed in ES-derived cell lines.
- 1 ND7 cells a murine neuroblastoma/primary sensory neuron hybrid
- 2 RHl cells EWS/FLI1 Ewing's sarcoma cells human
- 3 TC32 cells EWS/FLI1 Ewing's sarcoma cells human
- 4 SKNMC cells EWS/FLI1 Ewing's sarcoma cells human
- 5 RDES cells EWS/FLI1 Ewing's sarcoma cells human
- 6 RH30 cells PAX37FKHR alveolar rhabdomyosarcoma human
- 7 RD cells embryonal rhabdomyosarcoma human
- 8 SHSY5Y cells neuroblastoma human.
- Figure 18 shows FOXP2 silencing in the JJN3 MM cell line. Silencing was performed using three individual stealth siRNAs from Invitrogen (#0275, #2580, #0274). Silencing was compared to universal control siRNAs. FOXP2 expression levels were normalised using TBP expression and are expressed relative to those in the medGC control siRNA treated cells.
- Figure 19 shows CCNDl expression is reduced on FOXP2 silencing in the JJN3 cell line.
- Silencing was compared to a universal medGC control siRNA.
- FOXP2 and CCNDl expression levels were normalised using TBP expression and expressed relative to those in the medGC control siRNA treated cells.
- Figure 20 shows that cell viability is not dramatically affected by FOXP2 silencing.
- Silencing was performed in duplicate experiments using three individual stealth siRNAs from Invitrogen (#0275, #2580, #0274). Silencing was compared to universal control siRNAs. Total cell numbers were counted after the time indicated (48h or 72h). The number of non-viable cells, that were stained with trypan blue, were subtracted from the total to yield the number of viable cells.
- Figure 21 shows that FOXP2 silencing reduces JJN3 cell adhesion to stromal cells.
- the percentage of adherent cells was calculated relative to the 200,000 that were plated.
- both adherent and non-adherent populations were counted and the percentage adherence was determined in relation to the combined number of adherent and non-adherent myeloma cells.
- Figure 22 shows JJN3 cell adhesion to stromal cells after FOXP2 silencing. Clumps of small round JJN3 myeloma cells are shown adhering to the OP9-GFP stromal cell layer after washing. Larger clumps are present in the cells treated with the control siRNA when compared to those treated with FOXP2 siRNA. This is consistent with the reduction in the number of FOXP '2 siRNA treated cells adhering to the stromal cell monolayer.
- SUDHL9 was a kind gift from Professor Martin Dyer, Leicester; the OCI-Ly3, OCI- LyIO (ABC-derived), SUDHL6, SUDHLlO and DB (GC-derived) DLBCL cell lines were a kind gift from Dr Eric Davis, Bethesda USA; the MIEU and HLY-I DLBCL cell lines were generously provided by Dr Talal Al Saati, Toulouse, France.
- MEDB 1 was kindly provided by Drs S. Briiderlein, P.M ⁇ ller and T. Barth (Institute of Pathology, UIm, Germany).
- RNA from BM aspirates was isolated using QIAamp RNA Blood Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol.
- QIAamp RNA Blood Mini Kit QIAGEN, Hilden, Germany
- One microgram of total RNA was used for cDNA synthesis using GeneAmp Gold RNA PCR Core Kit (Applied BioSystems, New Jersey, USA) according to the manufacturer's protocol.
- Real-Time PCR amplification was performed with a Chromo 4 continuous fluorescence detector (MJ Research, Waltham, MA).
- a TaqMan inventoried pre-verified assay reagent was used to amplify FOXP2, (HsOO362817_ml), CD138 (Hs00896423_ml) and SMAD3 (Hs00706299_sl); Applied Biosystems. Experiments were performed in triplicate for each data point. The relative gene expression level was normalized on the basis of the expression of a reference gene, TATA Box binding protein (TBP; 4326322E; Applied Biosystems). The formula 2 (cycle threshold FOXP2-cycle threshold TBP) was used to calculate normalized expression.
- Nuclear extracts were prepared using the Panomics Nuclear extraction kit according to the manufacturer's instructions (Panomics, CA, USA). Proteins were resolved by SDS-PAGE and transferred to Hybond nitrocellulose membrane (GE Healthcare, Amersham, UK). The membrane was blocked (1 X PBS, 5 % Marvel) for 1 hour followed by incubation with primary antibody overnight at 4oC. Primary antibodies used were FOXP2 N-16 sc-21069 at 1/2000 (Santa Cruz, CA, USA), FOXP2 ab 16046 at 1/1000 (AbCam, Cambridge,UK), TATA binding protein (TBP) ITBP 18 at 1/2000 (AbCam) and Actin ab6276 at 1/10,000 (AbCam).
- HRP horseradish peroxidase linked secondary antibody
- ECL enhanced chemiluminescence
- JJN3 cells were transfected using the siRNA duplex FOXP2 - ATGGAAGACAATGGCATTAAA or standard non-silencing control (Qiagen, Crawley, UK). Nucleofection was used to introduce the duplex into cells according to manufacturer's protocols (Amaxa Inc, Gaithersburg, MD). Cells were harvested at 48 hours and underwent either nuclear extraction (for Western Blotting) or total RNA extraction (for qRT-PCR). The duplex concentration used for nucleofection was 3.3 ⁇ M.
- Balb-c mice were immunised with a bacterially expressed recombinant protein comprising the N-terminal region of FOXP2 (aa 1-86) fused to glutathione- S- transferase.
- the FOXP2-73 A/8 antibody was found to have specific reactivity against FOXP2 by screening for ELISA reactivity with the recombinant protein, validation on FOXP2, FOXPl, FOXP3 and FOXP4 transfectants and staining of the JJN3 cell line.
- Fresh frozen sections and cytospins were stored at -20°C and fixed for 10 minutes in acetone and air-dried for 30 minutes. Paraffin embedded slides were dewaxed in Citroclear (HD Supplies, Aylesbury, UK) followed by antigen retrieval using microwaving in 5OmM Tris/2mM EDTA (pH 9.0).
- the Xpress antibody (R910-25 1/2000; Invitrogen, Paisley, UK) or the CD56 antibody (CD56-1B6-L-CE 1/80; Leica Microsystems, Wetzlar, Germany) was applied for 30 minutes at room temperature, while the FOXP2-73A/8 antibody was applied at a 1/1000 dilution overnight at 4oC.
- Immuno staining was performed using the Envision system (Dako) for Xpress and CD56, while FOXP2 staining was performed using the NovoLink polymer detection system according to the manufacturer's instructions (Novocastra, Newcastle upon Tyne, UK). Counterstaining was with hematoxylin (Gill's No. 2; Sigma-Aldrich, St Louis, MO) and slides were mounted in Aquamount (VWR International, Lutterworth, UK). For double immunoenzymatic labelling the FOXP2 staining was performed as described above, without applying the counterstain, followed by the second antibody that was detected by means of a Vector SG blue horseradish peroxidase substrate kit (Vector Laboratories, Peterborough, UK).
- a Vector SG blue horseradish peroxidase substrate kit Vector Laboratories, Peterborough, UK.
- Second antibodies included CDl 38 (M7228; dilution 1/50; Dako); CD3 (M7254; dilution 1/100; Dako) and hybridoma supernatants Ki67, JC70, PGMl (all used neat), PD7+2B11 (CD45, dilution 1/5), KPl, L26 (both diluted 1/20) and VS38C (diluted 1/50). Slides were washed in water, dehydrated in xylene and mounted in VectorMount (Vector Laboratories). The cases were scored without information on the diagnosis.
- the expression of FOXP2 in five of the seven strongly positive lymphoma/MM cell lines was higher than observed in any normal human tissue.
- One DLBCL biopsy (n 10) contained high levels of FOXP2 and a further three cases had more expression than observed in normal lymph node or FL biopsies ( Figure 3).
- Hodgkin lymphomas were not studied by qRT-PCR due to the scarcity of the malignant Reed Sternberg cells.
- FOXP2-73A/8 antibody was also effective in immunohistochemistry applications and specifically recognized a formalin resistant FOXP2 epitope that was not cross-reactive with the related FOXPl, 3 and 4 proteins (Figure 6).
- Immunolabelling studies confirmed the expression levels of FOXP2 and its nuclear localization in MM and lymphoma cell lines and demonstrated heterogeneity in FOXP2 levels at the single cell level ( Figure 6).
- FOXP2 protein expression was assessed by immunohistochemistry with antibody FOXP2-73A/8 on whole sections of tonsil and a normal tissue microarray containing 39 different human tissues.
- FOX2 was widely but not ubiquitously expressed in normal human tissues with FOXP2-73A/8 exhibiting primarily nuclear but also cytoplasmic labelling patterns (Figure 6).
- FOXP2 expression in tonsil was restricted to epithelial and endothelial cell nuclei and to scattered nuclei in the interfollicular areas.
- Double labelling studies confirmed the absence of FOXP2 protein expression in haematopoietic cells including CD20 + B-cells, CD3 + T cells and CDl 38+ plasma cells.
- FOXP2 expression was predominantly nuclear, cytoplasmic labelling lacked reproducibility, and showed heterogeneity of nuclear expression in terms of both the intensity and frequency of labelling.
- Double labeling with CDl 38 confirmed FOXP2 expression in the plasma cell infiltrate, demonstrated the existence of a small CD138TOXP2 + population in some cases and enabled the percentage of FOXP2 + plasma cells to be assessed.
- Double labeling was used for scoring FOXP2 expression as it resulted in a higher frequency of FOXP2 + cases (55 versus 44 FOXP2 + MM within 61 cases) due to the improved visibility of weak nuclear labeling in the absence of a nuclear counterstain and the detection of low frequency FOXP2 expression in plasma cells.
- FOXP2 protein expression was detectable in plasma cells in 8/10 of the reactive marrows, 11/11 MGUS and 58/61 MM.
- One uninvolved marrow from a Non-Hodgkin's lymphoma patient contained 10% FOXP2 + plasma cells.
- Double labelling with anti-CD20 confirmed FOXP2-negativity in B cells and excluded the possibility of marrow infiltration with a FOXP2 + CD138 + B-cell lymphoma.
- a cut-off of > 10% plasma cell FOXP2-positivity excluded all reactive marrows, WM, PCL, and LPL cases, while including 90.2% of MM (55/61), 90.9% (10/1 1) of MGUS and 66.7% (2/3) of primary amyloid patients.
- FOXP2 expression was compared to that of the natural killer (NK) cell marker CD56, which is expressed in more than 75% of MM.
- NK natural killer
- Greater than 10% FOXP2 plasma cell positivity (range 46.5-94.1%) was detectable in 75% (9/12) of MM that lacked CD56 expression, while only 50% (3/6) of the FOXP2-negative cases were CD56 + ( Figure 6C).
- Combining FOXP2 (>10% positivity) and CD56 expression detected 95.1% of MM (58/61).
- MM there are 368 MM, including the RPMI 8226 MM cell line (having seven copies of chromosome 7), 225 cases of DLBCL, and 18 cases of HL with gains of the FOXP2 locus (7q31) in the NCBI Cancer Chromosomes database
- TGF- ⁇ transforming growth factor- ⁇
- the transforming growth factor- ⁇ (TGF- ⁇ ) signalling pathway negatively regulates the cellular proliferation and differentiation of normal B lymphocytes, together with their ability to undergo apoptosis (Dong and Blobe, 2006, Blood, 107(12), 4589- 4596; Isufi et al, 2007, J Interferon Cytokine Res, 27(7), 543-552). Alterations in this pathway that result in the resistance of the growth inhibitory affects of TGF- ⁇ have been described in many haematological malignancies, including lymphomas and in MM. Downstream of the cell surface receptors, the TGF- ⁇ signal is propagated by a small family of SMAD proteins that bind DNA and regulate transcription.
- MM are addicted to an aberrant IRF4 regulatory network that fuses the gene expression programmes of activated B cells and normal plasma cells and inhibition of this pathway is toxic to the rumour cells (Shaffer et al, 2008, Nature, 454(7201), 226-231). Data is also provided demonstrating the repression of IRF-4 expression on silencing FOXP2 expression in the JJN3 cell line ( Figure 9).
- FOXP2 mRNA expression was categorised as high (>0.2 relative to the JJN3 cell line) or low ( ⁇ 0.2).
- FOXP2 expression was not detected in haematological cell populations in human tissues.
- a report of high level Foxp2 expression in murine spleen (Shu et al, 2001, J. Biol Chem, 276, 27488-27497) raised the possibility that there might be differences between species, which could become relevant when studying Foxp2 function in murine models.
- Foxp2 mRNA expression was investigated in a commercially available panel of murine cDNAs (Clontech) by real-time PCR using a pre-designed Foxp2 Taqman probe (Mm00475030_ml ; Applied Biosystems).
- FOXP2 mRNA is highly expressed in osteoblasts
- Microarray expression data for murine F0XP2 was also analysed using the BioGPS website (http://biogps.gnf.org/). Four array probes indicated that F0XP2 was particularly highly expressed in osteoblasts ( Figure 14). Two further probes did not detect the osteoblast expression but did still identify the high level F0XP2 mRNA expression in brain and eye; indicating that F0XP2 splice variants might be differentially expressed.
- FOXP2 mRNA is expressed in primary human osteoblasts
- Osteoblasts have an established role in new bone formation (Giuliani et al., 2006, Blood, 108, 3992-3996), and in myeloma bone remodelling is unbalanced, with bone reabsorption being increased while bone formation is either decreased or absent.
- therapeutic targets proposed examples including Runx2 and Wnt pathways
- for the treatment of multiple myeloma bone disease that counterbalance the block of osteogenic differentiation in the bone marrow microenvironment induced by multiple myeloma cells (Giuliani et al., 2009, Exp. Hematol., 37(8), 879- 886).
- FOXP2 may interact with RUNX2 in myeloma cells.
- Runx2 is a key osteoblast transcription factor that is also expressed in myeloma plasma cells (as is Runxl), where it regulates osteopontin (OPN) production that is involved in the pathophysiology of myeloma-induced angiogenesis (Colla et al, 2005, Leukemia, 19, 2166-2176).
- OPN osteopontin
- osteoblast transcription factors may be functionally associated with the bone disease phenotype observed in myeloma and these may also be expressed in other tumours associated with bone disease either as primary tumours or as bone metastases.
- FOXP2 is expressed in the bone tumour Ewing's sarcoma
- Ewing's sarcoma arises in mesenchymal tissue and is the second most common primary malignant bone tumour. It was therefore investigated whether the FOXP2 protein was highly expressed in a panel of ES-derived dell lines by Western blotting (Figure 17).
- FOXP2 expression might represent a marker whose high level expression promotes tumour cell interaction with the bone marrow environment and/or promotes bone loss.
- FOXP2 expression in some malignancies e.g. lymphoma where only a proportion of patients are FOXP2- positive
- high-level FOXP2 expression in malignancies that normally home to the bone marrow, such as myeloma may have an association with the severity of bone disease.
- siRNAs Three commercial siRNAs were purchased from Invitrogen for silencing FOXP2 expression in the JJN3 myeloma cells using Amaxa-mediated electroporation. Universal medium GC-content or low GC-content scrambled control siRNAs were used (Invitrogen) as controls in siRNA experiments. Amaxa-mediated electroporation of JJN3 was performed under standard conditions, Program X-005, Solution C, 2x10 6 cells in lOO ⁇ l, l ⁇ M oligo, plated into 3mls RPMI culture medium.
- RNA isolation Trizol method, Invitrogen
- cDNA production Superscript II, Invitrogen
- real-time PCR TBP as control and human FOXP 2 as test, both commercial TaqMan probes.
- Relative expression compared with untreated or control-siRNA treated samples, was determined by ddCT method (as per Applied Biosystems).
- Foxp2 knockout mice show early post-natal lethality with defects in lung development. These defects are more severe in mice that also lack one Foxpl allele, indicating that these molecules cooperatively regulate lung development (Shu et al, 2007, Development, 134, 1991-2000).
- the reduced proliferation in lung epithelial cells was accompanied by a reduction in the expression of cyclin Dl and an increase in p57 expression in the Foxp2-/-;Foxpl +/- mutants.
- these transcription factors are able to affect the expression of cell cycle regulators.
- Cyclin D dysregulation has been proposed to represent an early and unifying pathogenic event in multiple myeloma and recurrent translocations target the cyclin Dl (CCNDl) gene (Bergsagel et al, 2005, Blood, 106(1), 296-303).
- the FOXP2 48 hour siRNA treated samples from the previous experiment 1 were analysed for CCNDl expression to investigate whether FOXP2 had the ability to upregulate the expression of CCNDl in the myeloma cell line JJN3 ( Figure 19).
- FOXP2 silencing did not affect the viability of the JJN3 cells and the lack of significant change in cell numbers suggests that their proliferation and/or survival in vitro were not affected by the loss of FOXP2 expression (Figure 20).
- a key feature of myeloma is that in vivo the cells localise to the bone marrow and interact with stromal cells; this initiates the production of proteins that stimulate or support tumour survival (Dalton, 2003, Cancer Treatment Reviews, 29, 11-19). This is a particularly important aspect of myeloma biology because cell adhesion- mediated drug resistance (CAM-DR) is an intrinsic mechanism of myeloma resistance to chemotherapeutic drugs (Dalton, 2003, supra).
- CAM-DR cell adhesion- mediated drug resistance
- JJN3 cell samples were taken (200,000 cell per condition) 48 hours after siRNA and were plated onto confluent monolayers of adherent OP9-GFP stromal cells. After an overnight incubation, to enable cellxell interactions to take place, the co-cultures were washed vigorously twice with fresh medium and then the medium was replaced. In the second experiment non-attached cells were also retained for counting. Photographs of multiple fields were then taken.
- Co-cultures were then vigorously resuspended with p 1000 Gilson pipette and cells were passed through a 40 ⁇ M cell strainer to separate myeloma cells ( ⁇ 40 ⁇ M) and stromal sheets (>40 ⁇ M). The myeloma cells that passed through the cell strainer were then counted to quantify the number of adherent cells.
- FOXP2 silencing reduced the number of myeloma cells adhering to the stromal cell monolayer ( Figures 21 and 22). Cells transfected with those siRNAs with the greatest ability to silence FOXP2 expression were the least able to adhere to the stromal monolayer. The data therefore suggest that FOXP2 has a role in mediating the ability of myeloma cells to bind to cells in their microenvironment. Thus targeting FOXP2 expression and/or function may be able to overcome cell adhesion- mediated drug resistance.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Hematology (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Physics & Mathematics (AREA)
- Pharmacology & Pharmacy (AREA)
- Hospice & Palliative Care (AREA)
- Pathology (AREA)
- Public Health (AREA)
- General Physics & Mathematics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Food Science & Technology (AREA)
- Veterinary Medicine (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Diabetes (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US13/139,028 US20110300128A1 (en) | 2008-12-17 | 2009-12-16 | Use of foxp2 as a marker for abnormal lymphocytes and as a target for therapy of disorders associated with abnormal lymphocytes |
CA2747208A CA2747208A1 (en) | 2008-12-17 | 2009-12-16 | Use of foxp2 as a marker for abnormal lymphocytes and as a target for therapy of disorders associated with abnormal lymphocytes |
EP09785208A EP2359141A1 (en) | 2008-12-17 | 2009-12-16 | Use of foxp2 as a marker for abnormal lymphocytes and as a target for therapy of disorders associated with abnormal lymphocytes |
AU2009329380A AU2009329380A1 (en) | 2008-12-17 | 2009-12-16 | Use of FOXP2 as a marker for abnormal lymphocytes and as a target for therapy of disorders associated with abnormal lymphocytes |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GBGB0823020.3A GB0823020D0 (en) | 2008-12-17 | 2008-12-17 | Use of FOXP2 as a marker for abnormal lymphocytes and as a target for therapy of disorders associated with abnormal lymphocytes |
GB0823020.3 | 2008-12-17 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2010070278A1 true WO2010070278A1 (en) | 2010-06-24 |
Family
ID=40343752
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/GB2009/002887 WO2010070278A1 (en) | 2008-12-17 | 2009-12-16 | Use of foxp2 as a marker for abnormal lymphocytes and as a target for therapy of disorders associated with abnormal lymphocytes |
Country Status (6)
Country | Link |
---|---|
US (1) | US20110300128A1 (en) |
EP (1) | EP2359141A1 (en) |
AU (1) | AU2009329380A1 (en) |
CA (1) | CA2747208A1 (en) |
GB (1) | GB0823020D0 (en) |
WO (1) | WO2010070278A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113528640A (en) * | 2021-06-23 | 2021-10-22 | 华中科技大学同济医学院附属同济医院 | Molecular marker for detecting COVID-19 susceptibility, kit and application |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004022104A2 (en) | 2002-09-06 | 2004-03-18 | Isis Innovation Ltd. | Foxp2 and uses thereof |
-
2008
- 2008-12-17 GB GBGB0823020.3A patent/GB0823020D0/en not_active Ceased
-
2009
- 2009-12-16 WO PCT/GB2009/002887 patent/WO2010070278A1/en active Application Filing
- 2009-12-16 US US13/139,028 patent/US20110300128A1/en not_active Abandoned
- 2009-12-16 CA CA2747208A patent/CA2747208A1/en not_active Abandoned
- 2009-12-16 AU AU2009329380A patent/AU2009329380A1/en not_active Abandoned
- 2009-12-16 EP EP09785208A patent/EP2359141A1/en not_active Ceased
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004022104A2 (en) | 2002-09-06 | 2004-03-18 | Isis Innovation Ltd. | Foxp2 and uses thereof |
Non-Patent Citations (42)
Title |
---|
ANDREWS JARED M ET AL: "Clinical predictors of abnormal peripheral blood lymphocytoses diagnosed by flow cytometry: An algorithmic approach that can be applied in routine clinical practice.", BLOOD, vol. 106, no. 11, Part 2, November 2005 (2005-11-01), & 47TH ANNUAL MEETING OF THE AMERICAN-SOCIETY-OF-HEMATOLOGY; ATLANTA, GA, USA; DECEMBER 10 -13, 2005, pages 63B, XP002575341, ISSN: 0006-4971 * |
BANHAM, CANCER RES., vol. 61, 2001, pages 8820 - 8829 |
BANHAM, CLIN. CANCER RES., vol. 11, no. 3, 2005, pages 1065 - 1072 |
BEERLI ET AL., BREAST CANCER RES. TREAT., vol. 38, 1996, pages 11 - 17 |
BERGSAGEL ET AL., BLOOD, vol. 106, no. 1, 2005, pages 296 - 303 |
BIGNONE; BANHAM, EOBT, vol. 8, no. 12, 2008, pages 1897 - 1920 |
BORTON HJELMELAND, MOL. CELL BIOL., vol. 25, no. 21, 2005, pages 9460 - 9468 |
BROWN ET AL., BLOOD, vol. 111, no. 5, 2008, pages 2816 - 2824 |
CARON DE FROMENTEL ET AL., ONCOGENE, vol. 18, 1999, pages 551 - 557 |
COLLA ET AL., LEUKEMIA, vol. 19, 2005, pages 2166 - 2176 |
COLLA, LEUKEMIA, vol. 19, 2005, pages 2166 - 2176 |
DALTON, CANCER TREATMENT REVIEWS, vol. 29, 2003, pages 11 - 19 |
DONG; BLOBE, BLOOD, vol. 107, no. 12, 2006, pages 4589 - 4596 |
GIULIANI ET AL., BLOOD, vol. 108, 2006, pages 3992 - 3996 |
GIULIANI ET AL., EXP. HEMATOL., vol. 37, no. 8, 2009, pages 879 - 886 |
HAROUSSEAU, ANN ONCOL, vol. 19, no. 5, 2008, pages 68 - 70 |
HOWARTH, ONCOGENE, vol. 27, no. 23, 2008, pages 3345 - 3359 |
HUANG ET AL., LEUKAEMIA RESEARCH, vol. 33, no. 6, 2008, pages 847 - 853 |
HUANG W T ET AL: "Multiple distinct clones may co-exist in different lineages in myelodysplastic syndromes", LEUKEMIA RESEARCH, NEW YORK,NY, US, vol. 33, no. 6, 11 December 2008 (2008-12-11), pages 847 - 853, XP026023443, ISSN: 0145-2126, [retrieved on 20081211] * |
ISUFI ET AL., J INTERFERON CYTOKINE RES, vol. 27, no. 7, 2007, pages 543 - 552 |
JARED ET AL., BLOOD, vol. 106, no. 11, November 2005 (2005-11-01), pages 63B |
KITOH ET AL., IMMUNITY, vol. 31, no. 4, 2009, pages 609 - 620 |
KRAUSE ET AL., CURR BIOL, vol. 17, no. 21, 2007, pages 1908 - 1912 |
LAI ET AL., NATURE, vol. 413, 2001, pages 519 - 523 |
LAWRIE ET AL., INT J CANCER, vol. 121, no. 5, 2007, pages 1156 - 1161 |
ONO ET AL., NATURE, vol. 446, no. 7136, 2007, pages 685 - 689 |
PAJER, CANCER RES., vol. 66, no. 1, 2006, pages 78 - 86 |
PIAZZA ET AL., ANN HEMATOL, vol. 86, no. 3, 2007, pages 159 - 172 |
PRATAP ET AL., CANCER METASTASIS REV., vol. 25, no. 4, 2006, pages 589 - 600 |
SAN MIGUEL ET AL., BLOOD, vol. 85, 1995, pages 448 - 465 |
SAN-MIGUEL ET AL., J CLIN ONCOL, vol. 26, no. 16, 2008, pages 2761 - 2766 |
SCHROEDER; MYERS, GENE, vol. 413, no. 1-2, 2008, pages 42 - 48 |
See also references of EP2359141A1 * |
SHAFFER ET AL., NATURE, vol. 454, no. 7201, 2008, pages 226 - 231 |
SHAFFER, NATURE, vol. 454, no. 7201, 2008, pages 226 - 231 |
SHU ET AL., DEVELOPMENT, vol. 134, 2007, pages 1991 - 2000 |
SHU ET AL., J. BIOL CHEM, vol. 276, 2001, pages 27488 - 27497 |
SHU ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 27488 - 27497 |
SHU ET AL., THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 276, no. 29, 2001, pages 27488 - 27497 |
SHU WEIGUO ET AL: "Characterization of a new subfamily of winged-helix/forkhead (Fox) genes that are expressed in the lung and act as transcriptional repressors", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, INC, US, vol. 276, no. 29, 20 July 2001 (2001-07-20), pages 27488 - 27497, XP002264690, ISSN: 0021-9258 * |
SPITERI ET AL., AM J HUM GENET, vol. 81, no. 6, 2007, pages 1144 - 1157 |
TEUFEL, BIOCHIM BIOPHY ACTA, vol. 1627, 2003, pages 147 - 152 |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113528640A (en) * | 2021-06-23 | 2021-10-22 | 华中科技大学同济医学院附属同济医院 | Molecular marker for detecting COVID-19 susceptibility, kit and application |
Also Published As
Publication number | Publication date |
---|---|
CA2747208A1 (en) | 2010-06-24 |
AU2009329380A1 (en) | 2011-07-07 |
US20110300128A1 (en) | 2011-12-08 |
GB0823020D0 (en) | 2009-01-28 |
EP2359141A1 (en) | 2011-08-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Dumars et al. | Dysregulation of macrophage polarization is associated with the metastatic process in osteosarcoma | |
Palumbo et al. | CD200 expression may help in differential diagnosis between mantle cell lymphoma and B-cell chronic lymphocytic leukemia | |
Retz et al. | CXCR4 expression reflects tumor progression and regulates motility of bladder cancer cells | |
Mittal et al. | Chronic lymphocytic leukemia cells in a lymph node microenvironment depict molecular signature associated with an aggressive disease | |
Kislin et al. | NHERF-1: modulator of glioblastoma cell migration and invasion | |
AU2010295172B2 (en) | Methods and compositions for the diagnosis and treatment of thyroid cancer | |
US20060223108A1 (en) | Methods and kits for diagnosing and monitoring hematopoietic cancers | |
GB2546213A (en) | Method of isolating circulating tumor cells | |
JP2008546387A (en) | Compositions and methods for treating and diagnosing cancer | |
US20120304318A1 (en) | Cancer diagnosis and treatment | |
JP2016525883A (en) | Prognostic classification and treatment of adenocarcinoma | |
Bouvier et al. | ALDH1 is an immunohistochemical diagnostic marker for solitary fibrous tumours and haemangiopericytomas of the meninges emerging from gene profiling study | |
Marquez et al. | Bone marrow stromal mesenchymal cells induce down regulation of CD 20 expression on B‐CLL: implications for rituximab resistance in CLL | |
Salo et al. | Human bone marrow mesenchymal stem cells induce collagen production and tongue cancer invasion | |
Wang et al. | Overexpression of caveolin-1 in cancer-associated fibroblasts predicts good outcome in breast cancer | |
Liu et al. | ∆ Np63/p40 correlates with the location and phenotype of basal/mesenchymal cancer stem‐like cells in human ER+ and HER2+ breast cancers | |
EP3724357B1 (en) | New onco-immunologic prognostic and theranostic markers | |
JP2017508147A (en) | G alpha-interacting vesicle binding protein (GIV) as a predictive marker in stage II colorectal cancer | |
JP2019528437A (en) | Method for treating cancer diseases by targeting tumor-associated macrophages | |
WO2013109944A1 (en) | Methods for assessing risk for cancer using biomarkers | |
US20110300128A1 (en) | Use of foxp2 as a marker for abnormal lymphocytes and as a target for therapy of disorders associated with abnormal lymphocytes | |
EP2720044A1 (en) | Sialyltransferase ST3GAL6 as a marker for multiple myeloma | |
KR101628035B1 (en) | Method for screening therapeutic agents of ovarian cancer using VSIG4 | |
US20190154695A1 (en) | Method for detecting and isolating invasive cancer stem cells employing cell-surface amfr and the use thereof | |
KR102401005B1 (en) | A composition for preventing or treating high-risk endometriosis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09785208 Country of ref document: EP Kind code of ref document: A1 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2747208 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2009329380 Country of ref document: AU |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2009785208 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2009329380 Country of ref document: AU Date of ref document: 20091216 Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 13139028 Country of ref document: US |