WO2010070117A1 - Treatment method by the administration of anti-her2 targeted active compounds to patients with early breast cancer and her2-negative primary tumor - Google Patents
Treatment method by the administration of anti-her2 targeted active compounds to patients with early breast cancer and her2-negative primary tumor Download PDFInfo
- Publication number
- WO2010070117A1 WO2010070117A1 PCT/EP2009/067575 EP2009067575W WO2010070117A1 WO 2010070117 A1 WO2010070117 A1 WO 2010070117A1 EP 2009067575 W EP2009067575 W EP 2009067575W WO 2010070117 A1 WO2010070117 A1 WO 2010070117A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- her2
- patients
- cancer
- breast
- compound
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/32—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
Definitions
- the present invention is related to methods and compounds for an efficient treatment of early (non- metastatic) breast cancer patients presenting a primary tumor that is HER2-negative (for instance, according to Wolf et al . ) ) and wherein their presence is correlated with a poor prognosis, but with a positive response to anti-HER2 targeted therapeutic active compounds.
- mRNA transcripts messenger RNA level
- microRNA level e.g chromosomal aberrations, DNA mutations, DNA methylation, histone modification
- protein level e.g. exracellular domain of HER2, HER2ECD
- CTCs or HER2-positive CTCs using various commercially available platforms including but not limiting to the (CellSearch) , Veridex and the CellPoint. These platforms are based on EpCAM enrichment of CTC and detection based on antibodies.
- the present invention provides an improved treatment of cancer, especially for mammal subjects, preferably human ( woman) patients presenting (having) HER2- negative early (breast) cancer (80% of patients with early breast cancer) and presenting a predictive biomarker like HER2-positive CTCs and/or HER2-positive DTC.
- epithelial cancers such as breast cancer (and/or pre-invasive breast lesions) are treated.
- the present invention further provides a pharmaceutical composition comprising an adequate pharmaceutical carrier and a sufficient amount of an anti HER2 compound, for use in the treatment and/or the prevention of (breast) cancer in patients having HER2- positive circulating tumor (al) cells (CTCs) or HER2- positive disseminated tumor (al) cells (DTCs), and no HER2- positive tumor (for instance a HER2-negative tumor or no tumor) .
- a pharmaceutical composition comprising an adequate pharmaceutical carrier and a sufficient amount of an anti HER2 compound, for use in the treatment and/or the prevention of (breast) cancer in patients having HER2- positive circulating tumor (al) cells (CTCs) or HER2- positive disseminated tumor (al) cells (DTCs), and no HER2- positive tumor (for instance a HER2-negative tumor or no tumor) .
- the pharmaceutical composition is for use in non-metastatic (breast) cancer and/or in early (breast) cancer.
- the pharmaceutical composition is for use in (women) patients having an abnormal mammogram or preinvasive breast lesions preferably selected from the group consisting of atypical hyperplasia, Ductal Carcinoma in situ (DCIS) and Lobular Carcinoma in situ (LCIS) .
- an abnormal mammogram or preinvasive breast lesions preferably selected from the group consisting of atypical hyperplasia, Ductal Carcinoma in situ (DCIS) and Lobular Carcinoma in situ (LCIS) .
- the preferred pharmaceutical active compounds comprise a sufficient amount of an HER2-targeted therapeutic active compound (also called an anti-HER2 therapeutic active compound) .
- an anti-HER2 therapeutic active compound for use in the treatment of (breast) cancer in patients having HER2- negative primary (breast) cancer and biomarkers predictive for response to (anti-)HER2 targeted therapeutic active compounds .
- the present invention discloses an anti-HER2 therapeutic active compound for use in the treatment of early (invasive but not metastatic) breast cancer or of preinvasive (breast) lesions like atypical hyperplasia, Ductal Carcinoma in situ
- DCIS Downlink Carcinoma in situ
- LCIS Lobular Carcinoma in situ
- the present invention further relates to the administration of a sufficient amount anti HER2 (i.e. HER2/neu) therapeutic active compounds for treating patients with HER2-negative primary tumors, but having other predictive biomarkers for response to anti-HER2 agents or for the prevention of (preferably breast, ovarian and bladder) cancer.
- HER2 i.e. HER2/neu
- HER2-negative primary tumors but having other predictive biomarkers for response to anti-HER2 agents or for the prevention of (preferably breast, ovarian and bladder) cancer.
- the present invention preferably relates to an anti-HER2 therapeutic active compound for use in the treatment of early (invasive but not metastatic) epithelial
- breast cancer or of preinvasive breast lesions like atypical hyperplasia, Ductal Carcinoma in situ (DCIS) or
- LCIS Lobular Carcinoma in situ
- HER2-positive (i.e. HER2+) CTCs are identified.
- HER2 therapeutic active compound or HER2 targeted therapeutic active compound is an anti- HER2 antibody and/or a tyrosine kinase inhibitor.
- the preferred anti-HER2 antibodies are trastuzumab and pertuzumab.
- the pharmaceutical composition of the present invention may further comprise another anti-tumoral compound.
- the preferred other anti-tumoral compound possibly further present in the pharmaceutical composition of the invention is selected from the group consisting of a chemotherapeutic compound, an anti-oestrogen compound or
- chemotherapeutic compounds are anthracyclines and/or taxanes.
- the present invention is particularly well adapted to the treatment of non-metastatic (breast) cancer patients .
- the present invention further discloses a method to treat and/or to prevent (epithelial such as breast) cancer in patients comprising the steps of:
- step B) Providing to the said patients selected from step B) a pharmaceutical composition comprising an adequate pharmaceutical carrier and a sufficient amount of an anti HER2 compound.
- the patients selected under step A) are non- metastatic (epithelial such as breast) cancer patients.
- the women patients selected under step A) have no (invasive) breast cancer, but abnormal mammogram or preinvasive breast lesions preferably selected from the group consisting of atypical hyperplasia, Ductal Carcinoma in situ (DCIS) and Lobular Carcinoma in situ (LCIS) .
- this method and/or treatment using HER2-targeted compounds comprises the step of administrating to the patient a sufficient amount of one or more adequate anti-HER2 therapeutic active compound (s) , including but not limiting to monoclonal antibodies, like trastuzumab, pertuzumab and small molecules such as tyrosine kinase inhibitors, being preferably lapatinib or HKI272.
- s anti-HER2 therapeutic active compound
- this pharmaceutical composition and/or method according to the present invention consists of the administration to the patient of a sufficient amount of an anti-HER2 (i.e. anti HER2/neu) active compound.
- an anti-HER2 i.e. anti HER2/neu
- the anti-HER2 (i.e. anti HER2/neu) active compound is an anti-HER2 (i.e. anti HER2/neu) antibody, such as Trastuzumab (trade name: Herceptin produced by Genentech) or pertuzumab, that are humanized monoclonal antibodies that acts on the HER2 (i.e. HER2 : neu or erbB2) receptor.
- Trastuzumab (CAS Number 180288-69-1, ATC code L01XC03) binds to the domain IV of the extracellular segment of the HER2 (i.e. HER2:neu) receptor.
- Pertuzumab inhibits dimerization of HER2 and HER3 receptors and is in advanced clinical trials.
- the HER2/neu active compound can be also a small molecule: a tyrosine kinase inhibitor like lapatinib or HKI-272.
- the anti-HER2 compound may be administrated to the patient either sequentially or in combination with other anti-cancerous (anti-tumoral) compounds (based upon the Hormone therapy and/or the Chemotherapy as described by Nahta et al . ) , preferably by intravenous administration of the active compounds, either once a week or once every two or three weeks, intravenously for about 30 to about 90 minutes .
- the detection of HER2-negative tumor is advantageously obtained by a method selected from the group consisting of IHC, FISH, CISH, SISH or a mixture thereof, as described by Wolff et al(l) .
- Samples (material) from the primary tumor, peripheral blood (putatively containing CTC) or bone marrow (putatively containing DTC) are analysed for HER2 state either at the messenger RNA level (mRNA transcripts) , or by detecting genetic and/or epigenetic abnormalities specific for tumor cells (e.g chromosomal aberrations, DNA mutations, DNA methylation, histone modification) or at the protein level (e.g extracellular domain of HER2, HER2ECD) , using HER2 DNA sequencing, by HER2 nucleic acid (mRNA, DNA and/or, less preferably micro RNA) quantification and/or localization using one or two or three methods selected from the group consisting of Polymerase chain reaction (PCR), RT-PCR, Fluorescence after in situ hybridization (FISH) , Chromogenic in situ hybridization (CISH) and silver in situ hybridization
- PCR Polymerase chain reaction
- FISH Fluorescence after in situ hybridization
- CISH Chromogenic in situ hybridization
- SISH - and/or HER2 protein quantification and/or localization by using one or two or three methods selected from the group consisting of FACS, ELISA, immunofluorescence (IF), Immunocytochemical (ICC) and Immuno histo chemistry (IHC), the preferred method being IF, or a mixture thereof.
- the detection of HER2 state is performed using at least one (a) of the above non-PCR method (s) .
- the detection of CTCs or HER2+ CTCs is obtained by different systems including, but not limiting to the CellSearch, Veridex and the CellPoint. More particularly, useful methods are based on cell enrichment on EpCAM antibodies and on subsequent detection of specific cancer markers .
- HER2 state of CTC and/or of DTC may alternatively be determined by quantification of mRNA sequences (mRNA transcripts) of CTC or DTC, coupled to the detection in the tumor cells and/or in CTC or DTC of genetic and/or epigenetic abnormalities specific for tumor cells (e.g chromosomal aberrations, DNA mutations, DNA methylation, histone modification) .
- mRNA transcripts mRNA transcripts
- epigenetic abnormalities specific for tumor cells e.g chromosomal aberrations, DNA mutations, DNA methylation, histone modification
- HER2 state of CTC and/or of DTC is obtained by quantification of the HER2 protein and of the HER2 mRNA level.
- HER2 state of CTC and/or of DTC is determined by the combined quantification of the HER2 protein and of the HER2 DNA by FISH in the same CTC and/or DTC.
- HER2 state of CTC and/or of DTC may alternatively be obtained by quantification of mRNA sequences (mRNA transcripts) and of the microRNA level of CTC and/or of DTC.
- HER2 state of CTC and/or of DTC may be obtained by quantification of the HER2 protein and of the microRNA level of CTC and/or of DTC.
- HER2 state of CTC and/or of DTC may be obtained by quantification of the HER2 protein in CTC or in DTC and coupled to the detection of genetic and/or epigenetic abnormalities specific for tumor cells (e.g chromosomal aberrations, DNA mutations, DNA methylation, histone modification) evidenced in the tumor and/or in CTC or DTC.
- the diagnostic of the invention is advantageously combined with the presence of soluble HER2 extracellular domain (HER2 ECD) in the plasma.
- HER2 ECD soluble HER2 extracellular domain
- HER2/neu also known as ErbB-2 or ERBB2 or CD340 (cluster of Differentiation 340) stands for Human Epidermal growth factor 2 and is a protein giving higher aggressiveness in breast cancers.
- HER2-positive and HER2-negative primary breast tumors are preferably defined according to Wolff et al(l) .
- CD45 was originally called leukocyte common antigen. It is present on all differentiated hematopoietic cells except erythrocytes and plasma cells.
- Cytokeratins are intermediate filament keratins found in the intracytoplasmic cytoskeleton of epithelial tissue.
- the inventors unexpectedly found that, based on an improved diagnostic, it is possible to treat a new group of patients having (an epithelial) HER2-negative
- HER2- HER2- primary tumor, especially those with HER2- positive circulating tumor cells, by the administration of a sufficient amount of one or more anti-HER2 targeted therapeutic active compound (s) .
- CTCs have been detected using the CellSearch System (Veridex, USA) in early and metastatic breast cancer (BC) .
- the inventors first aimed to analyze CTCs for HER2 expression in different stages of BC progression from ductal/lobular carcinoma in situ (DCIS/LCIS) to early and metastatic BC.
- DCIS/LCIS ductal/lobular carcinoma in situ
- CTCs were defined as Cytokeratin- positive/CD45-negative cells, whereas HER2+ CTCs were defined as Cytokeratin-positive/CD45-negative/HER2-positive cells .
- Table 1 identification and HER2 characterization of circulating tumor cells in healthy woman, precancerous and cancerous patients.
- HER2+ CTCs is thus more sensitive and specific marker for CTCs positivity than total CTCs counts in early (breast) cancer and/or at the first stages of malignant transformation.
- part A the inventors studied the effect of trastuzumab on the elimination of HER2-positive CTCs.
- the inventors screened 536 women with HER2- negative early (breast) cancer during their follow-up for the presence of HER2-positive CTCs using 3 different techniques (using the CellSearch System, HER2mRNA or HER2- positive by FISH) in order to identify 133 women with detectable HER2-positive CTCs that are further randomized between adjuvant trastuzumab versus follow-up. This study is conducted using a single laboratory for CTC evaluation. [0069] The inventors compared the trastuzumab arm to the follow-up arm for HER2-positive CTC (s) elimination rate at week 18.
- the inventors performed extensive translational research on CTCs in order to identify the clinically relevant definition of HER2- positive CTCs, that is the definition of HER2-positive CTCs indicating benefit from trastuzumab: (detection of HER2mRNA using RT-PCR, detection of HER2 protein overexpression using the Veridex platform or detection of HER2 gene amplification using FISH after performing the CellSearch profiling Kit) . Furthermore, these results are correlated with the presence of soluble HER2 extracellular domain
- Identify mutations e.g PI3-kinase mutations in CTCs related to trastuzumab response / resistance.
- INCLUSION CRITERIA Patients with Oestrogen Receptor-negative (ER- negative) /HER2-negative tumors that have completed adjuvant chemotherapy (less than 2 years from their initial breast cancer diagnosis) .
- TMA tissue microarrays
- Tumor blocks are sent to the central laboratory for testing primary tumor HER2 status 4 weeks prior to start of treatment
- the central laboratory for CTC testing (Translational Research Unit, Jules Bordet Institut) is blinded concerning the blood samples that will be analyzed for HER2-positive CTCs. Patients are randomised between the trastuzumab and the follow-up arm.
- trastuzumab arm Patients randomised to the trastuzumab arm receive a total of 6 injections of trastuzumab every 3 weeks. A loading dose of trastuzumab 8mg/kg i.v. and then 5 cycles of trastuzumab 6mg/kg every 3 weeks is administered.
- a total of 15mL is processed using a modified ficoll procedure as previously described by Rack et al . and then CTC are enumerated and profiled for HER2 using a method based on EpCAM enrichment and a subsequent detection, such as using the CellSearch System (Veridex, USA) .
- a total of 15mL is processed using ficoll enrichment of mononuclear cells and then RNA extraction, cDNA synthesis and PCR detection of CK19 (for instance using Forward primer: GCACTACAGCCACTACTACACGA and Reverse primer: CTCATGCGCAGAGCCTGTT), MammaglobinA (for instance in nested PCR using Forward primerl : CAATCAATCCACAAGTGTCTAA ; Forward primer2 : ACGGATGAAACTCTGAGCAATG; Reverse primerl: AACATGTATAGCAGGTTTCAAC and Reverse primer2 : CAGTTCTGTGAGCCAAAGGT) and HER2mRNA transcripts (for instance in nested PCR using Forward primerl : TCC TCC TCG CCC TCT TGC ; Forward primer2 : AGC CGC GAG CAC CCA AGT; Reverse primerl: GCG GGT CTC CAT TGT CTA and Reverse primer2: TTG GTG GGC AGG TAG GTG AGT.
- part B the inventors aimed to determine if the elimination of HER2-positive CTCs with secondary adjuvant trastuzumab can improve the clinical outcome.
- Towards this aim approximately 800 women were screened in order to identify 200 women with HER2-negative early (breast) cancer and detectable HER2- positive CTCs that are eligible for this study.
- DFS disease free survival
- the inventors further conclude that the same treatment can be applied to every cancer having HER2- positive CTCs and/or tumors, more particularly epithelial cancer, such as ovarian cancer or bladder cancer.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Epidemiology (AREA)
- Oncology (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The present invention is related to an anti-HER2 therapeutic active compound for use in the treatment of breast or bladder cancer in patients having HER2-negative primary breast or bladder cancer and biomarkers predictive for response to anti-HER2 targeted therapeutic active compounds, including but not limiting to HER2+ CTCs.
Description
Treatment by the administration of anti-HER2 targeted active compounds to patients with early breast cancer and
HER2-negative primary tumor
Field of the invention
[0001] The present invention is related to methods and compounds for an efficient treatment of early (non- metastatic) breast cancer patients presenting a primary tumor that is HER2-negative (for instance, according to Wolf et al . ) ) and wherein their presence is correlated with a poor prognosis, but with a positive response to anti-HER2 targeted therapeutic active compounds.
Background of the invention and state of the art
[0002] Breast cancer is the most common cancer in women in Western countries.
[0003] However, many women with HER2-negative early breast cancer today still relapse despite being treated with adjuvant chemotherapy or endocrine therapy. In order to improve the treatment of patients with HER2-negative early breast cancer, new treatment approaches are urgently needed [0004] It has been demonstrated that a short course of Trastuzumab (3 cycles every 3 weeks) , irrespective of the HER2 status of the primary tumor, eliminated chemotherapy-resistant circulating tumor cells (CTCs) or disseminated tumor cells (DTCs) in 20 of 30 patients with breast cancer (including 13% having a Stage III breast
cancer and 57% having a metastatic breast cancer) . A large majority of these CTCs was subsequently described as HER2- positive CTCs or HER2-positive DTCs. (Bozionellou et al . ) . [0005] Recently, another group of investigators have demonstrated that Trastuzumab decreases the number of circulating and disseminated tumor cells despite Trastuzumab resistance of the primary tumor in a xenograft SCID mice model (Barok et al . ) . [0006] Meng et al (Proc. Natl. Acad. Sci. USA, 2004, 101(25) 9303-9398) used a sensitive blood test to capture CTCs and evaluate their HER2 gene status by fluorescence in situ hybridization (FISH) . They reported that 9 of 24 breast cancer patients with HER2-negative primary tumors, had acquired HER2 gene amplification in their CTCs during cancer progression as measured by FISH. This is a pilot study of 9 patients that was performed in metastatic breast cancer patients with palliative intent. However, detection of HER2 mRNA in peripheral blood was not described. [0007] The optimal way to identify patients (with early breast cancer and HER2-negative primary tumor) that will benefit from anti-HER2 targeted agents, need to be established for instance based on several predictive factors either in the primary tumor or in the peripheral blood or bone marrow. [0008] Material from the above studies are analysed either at the messenger RNA level (mRNA transcripts) , at the microRNA level, or by detecting genetic and/or epigenetic abnormalities specific for tumor cells (e.g chromosomal aberrations, DNA mutations, DNA methylation, histone modification) or at the protein level (e.g. exracellular domain of HER2, HER2ECD) . This is also performed by detecting CTCs or HER2-positive CTCs using various commercially available platforms including but not limiting to the (CellSearch) , Veridex and the CellPoint.
These platforms are based on EpCAM enrichment of CTC and detection based on antibodies.
[0009] Some of these methods are at risk of producing false-positive results, especially in the case of mRNA quantification by PCR, or of results close to the background, especially in the case of quantification of the protein abundance. Conversely, the identification of one alteration at the DNA level may not necessary equates a HER2-positive state. [0010] Therefore, the method to establish whether CTC and/or DTC are indeed HER2-positive needs to be improved in order to single out patients that will truly benefit from HER2 specific treatments, and to follow the efficacy of the said HER2 treatment in these patients.
Summary of the invention
[0011] The present invention provides an improved treatment of cancer, especially for mammal subjects, preferably human (woman) patients presenting (having) HER2- negative early (breast) cancer (80% of patients with early breast cancer) and presenting a predictive biomarker like HER2-positive CTCs and/or HER2-positive DTC.
In the present invention, preferably epithelial cancers such as breast cancer (and/or pre-invasive breast lesions) are treated.
[0012] Alternatively (but less preferably) , other epithelial cancers such as bladder or ovarian cancer can be treated as well. [0013] The present invention further provides a pharmaceutical composition comprising an adequate pharmaceutical carrier and a sufficient amount of an anti HER2 compound, for use in the treatment and/or the prevention of (breast) cancer in patients having HER2- positive circulating tumor (al) cells (CTCs) or HER2-
positive disseminated tumor (al) cells (DTCs), and no HER2- positive tumor (for instance a HER2-negative tumor or no tumor) .
[0014] Preferably, the pharmaceutical composition is for use in non-metastatic (breast) cancer and/or in early (breast) cancer.
[0015] Alternatively or in addition, the pharmaceutical composition is for use in (women) patients having an abnormal mammogram or preinvasive breast lesions preferably selected from the group consisting of atypical hyperplasia, Ductal Carcinoma in situ (DCIS) and Lobular Carcinoma in situ (LCIS) .
[0016] In the present invention, the preferred pharmaceutical active compounds comprise a sufficient amount of an HER2-targeted therapeutic active compound (also called an anti-HER2 therapeutic active compound) . [0017] The present invention further discloses an anti-HER2 therapeutic active compound for use in the treatment of (breast) cancer in patients having HER2- negative primary (breast) cancer and biomarkers predictive for response to (anti-)HER2 targeted therapeutic active compounds .
[0018] More particularly, the present invention (further) discloses an anti-HER2 therapeutic active compound for use in the treatment of early (invasive but not metastatic) breast cancer or of preinvasive (breast) lesions like atypical hyperplasia, Ductal Carcinoma in situ
(DCIS) or Lobular Carcinoma in situ (LCIS) in case of predictive biomarker(s) for response to an anti- HER2 targeted therapeutic active compound is (are) present.
[0019] The present invention further relates to the administration of a sufficient amount anti HER2 (i.e. HER2/neu) therapeutic active compounds for treating patients with HER2-negative primary tumors, but having
other predictive biomarkers for response to anti-HER2 agents or for the prevention of (preferably breast, ovarian and bladder) cancer.
[0020] The present invention preferably relates to an anti-HER2 therapeutic active compound for use in the treatment of early (invasive but not metastatic) epithelial
(breast) cancer or of preinvasive breast lesions like atypical hyperplasia, Ductal Carcinoma in Situ (DCIS) or
Lobular Carcinoma in situ (LCIS) in case where predictive biomarkers for response to an anti-HER2 targeted therapeutic active compound, including but not limiting to
HER2-positive (i.e. HER2+) CTCs are identified.
[0021] In the present invention, the preferred anti-
HER2 therapeutic active compound or HER2 targeted therapeutic active compound is an anti- HER2 antibody and/or a tyrosine kinase inhibitor.
[0022] The preferred anti-HER2 antibodies are trastuzumab and pertuzumab.
[0023] Advantageously, the pharmaceutical composition of the present invention may further comprise another anti-tumoral compound.
[0024] The preferred other anti-tumoral compound possibly further present in the pharmaceutical composition of the invention is selected from the group consisting of a chemotherapeutic compound, an anti-oestrogen compound or
(less preferably) a mixture thereof.
[0025] These preferred, chemotherapeutic compounds are anthracyclines and/or taxanes.
[0026] The present invention is particularly well adapted to the treatment of non-metastatic (breast) cancer patients .
[0027] The present invention further discloses a method to treat and/or to prevent (epithelial such as breast) cancer in patients comprising the steps of:
A) Selecting (women) patients having no HER2-positive (epithelial such as breast) tumor, but having a (epithelial such as breast) cancer or suspected to develop (epithelial such as breast) cancer;
B) Selecting among the said (woman) patients having no HER2-positive (epithelial such as breast) tumor those having biomarkers predictive for a response to anti- HER2 targeted therapeutic active compounds;
C) Providing to the said patients selected from step B) a pharmaceutical composition comprising an adequate pharmaceutical carrier and a sufficient amount of an anti HER2 compound.
[0028] Preferably, in the method of the present invention, the patients selected under step A) are non- metastatic (epithelial such as breast) cancer patients. [0029] More preferably, in the method of the present invention, the women patients selected under step A) have no (invasive) breast cancer, but abnormal mammogram or preinvasive breast lesions preferably selected from the group consisting of atypical hyperplasia, Ductal Carcinoma in situ (DCIS) and Lobular Carcinoma in situ (LCIS) . [0030] Preferably, this method and/or treatment using HER2-targeted compounds comprises the step of administrating to the patient a sufficient amount of one or more adequate anti-HER2 therapeutic active compound (s) , including but not limiting to monoclonal antibodies, like trastuzumab, pertuzumab and small molecules such as tyrosine kinase inhibitors, being preferably lapatinib or HKI272.
[0031] Advantageously, this pharmaceutical composition and/or method according to the present
invention consists of the administration to the patient of a sufficient amount of an anti-HER2 (i.e. anti HER2/neu) active compound.
[0032] Advantageously, the anti-HER2 (i.e. anti HER2/neu) active compound is an anti-HER2 (i.e. anti HER2/neu) antibody, such as Trastuzumab (trade name: Herceptin produced by Genentech) or pertuzumab, that are humanized monoclonal antibodies that acts on the HER2 (i.e. HER2 : neu or erbB2) receptor. Trastuzumab (CAS Number 180288-69-1, ATC code L01XC03) binds to the domain IV of the extracellular segment of the HER2 (i.e. HER2:neu) receptor. Pertuzumab inhibits dimerization of HER2 and HER3 receptors and is in advanced clinical trials.
[0033] The HER2/neu active compound can be also a small molecule: a tyrosine kinase inhibitor like lapatinib or HKI-272.
[0034] The anti-HER2 compound may be administrated to the patient either sequentially or in combination with other anti-cancerous (anti-tumoral) compounds (based upon the Hormone therapy and/or the Chemotherapy as described by Nahta et al . ) , preferably by intravenous administration of the active compounds, either once a week or once every two or three weeks, intravenously for about 30 to about 90 minutes . [0035] The detection of HER2-negative tumor is advantageously obtained by a method selected from the group consisting of IHC, FISH, CISH, SISH or a mixture thereof, as described by Wolff et al(l) .
[0036] Samples (material) from the primary tumor, peripheral blood (putatively containing CTC) or bone marrow (putatively containing DTC) are analysed for HER2 state either at the messenger RNA level (mRNA transcripts) , or
by detecting genetic and/or epigenetic abnormalities specific for tumor cells (e.g chromosomal aberrations, DNA mutations, DNA methylation, histone modification) or at the protein level (e.g extracellular domain of HER2, HER2ECD) , using HER2 DNA sequencing, by HER2 nucleic acid (mRNA, DNA and/or, less preferably micro RNA) quantification and/or localization using one or two or three methods selected from the group consisting of Polymerase chain reaction (PCR), RT-PCR, Fluorescence after in situ hybridization (FISH) , Chromogenic in situ hybridization (CISH) and silver in situ hybridization
(SISH) , - and/or HER2 protein quantification and/or localization by using one or two or three methods selected from the group consisting of FACS, ELISA, immunofluorescence (IF), Immunocytochemical (ICC) and Immuno histo chemistry (IHC), the preferred method being IF, or a mixture thereof.
[0037] Advantageously, the detection of HER2 state is performed using at least one (a) of the above non-PCR method (s) . [0038] The detection of CTCs or HER2+ CTCs is obtained by different systems including, but not limiting to the CellSearch, Veridex and the CellPoint. More particularly, useful methods are based on cell enrichment on EpCAM antibodies and on subsequent detection of specific cancer markers .
[0039] HER2 state of CTC and/or of DTC may alternatively be determined by quantification of mRNA
sequences (mRNA transcripts) of CTC or DTC, coupled to the detection in the tumor cells and/or in CTC or DTC of genetic and/or epigenetic abnormalities specific for tumor cells (e.g chromosomal aberrations, DNA mutations, DNA methylation, histone modification) .
[0040] Advantageously HER2 state of CTC and/or of DTC is obtained by quantification of the HER2 protein and of the HER2 mRNA level.
[0041] Preferably, HER2 state of CTC and/or of DTC is determined by the combined quantification of the HER2 protein and of the HER2 DNA by FISH in the same CTC and/or DTC.
[0042] HER2 state of CTC and/or of DTC may alternatively be obtained by quantification of mRNA sequences (mRNA transcripts) and of the microRNA level of CTC and/or of DTC.
[0043] HER2 state of CTC and/or of DTC may be obtained by quantification of the HER2 protein and of the microRNA level of CTC and/or of DTC. [0044] Advantageously, HER2 state of CTC and/or of DTC may be obtained by quantification of the HER2 protein in CTC or in DTC and coupled to the detection of genetic and/or epigenetic abnormalities specific for tumor cells (e.g chromosomal aberrations, DNA mutations, DNA methylation, histone modification) evidenced in the tumor and/or in CTC or DTC.
[0045] The diagnostic of the invention is advantageously combined with the presence of soluble HER2 extracellular domain (HER2 ECD) in the plasma.
Detailed description of the invention
[0046] HER2/neu, also known as ErbB-2 or ERBB2 or CD340 (cluster of Differentiation 340) stands for Human Epidermal growth factor 2 and is a protein giving higher aggressiveness in breast cancers.
[0047] HER2-positive and HER2-negative primary breast tumors are preferably defined according to Wolff et al(l) . [0048] CD45 was originally called leukocyte common antigen. It is present on all differentiated hematopoietic cells except erythrocytes and plasma cells.
[0049] Cytokeratins are intermediate filament keratins found in the intracytoplasmic cytoskeleton of epithelial tissue. [0050] The inventors unexpectedly found that, based on an improved diagnostic, it is possible to treat a new group of patients having (an epithelial) HER2-negative
(i.e. HER2-) primary tumor, especially those with HER2- positive circulating tumor cells, by the administration of a sufficient amount of one or more anti-HER2 targeted therapeutic active compound (s) .
[0051] The present invention will be explained in more details in the following non-limiting detailed description and protocols. [0052] The skilled person may develop alternative without being outside the scope of the present invention. More particularly, the skilled person may find and/or use and/or develop other means to enrich and detect circulating tumor cells, to label them and to assess HER2 state of these cells.
[0053] Also, other forms of cancer presenting the features as disclosed in the present invention are encompassed.
[0054] The skilled person is furthermore aware of other putative anti-HER2 treatments or compounds that are under development or that may present benefit for the subset of patients according to the present invention.
Improved diagnosis of circulating tumor cells : [0055] CTCs have been detected using the CellSearch System (Veridex, USA) in early and metastatic breast cancer (BC) . In this study, the inventors first aimed to analyze CTCs for HER2 expression in different stages of BC progression from ductal/lobular carcinoma in situ (DCIS/LCIS) to early and metastatic BC.
Patients and Methods : [0056] 20ml of peripheral blood per woman was analyzed from healthy women, DCIS/LCIS or early BC patients, whereas 7.5ml of blood was analyzed from metastatic BC patients. The presence of CTCs as well as HER2 expression was assessed with the CellSearch System. After immunomagnetic enrichment with an anti-Epcam- antibody, cells were labeled with anti-cytokeratin (8, 18 or 19), anti-HER2 and anti-CD45 antibodies.
[0057] CTCs were defined as Cytokeratin- positive/CD45-negative cells, whereas HER2+ CTCs were defined as Cytokeratin-positive/CD45-negative/HER2-positive cells .
Results :
[0058] The presence of CTCs and HER2+ CTCs in healthy women, DCIS/LCIS, early and metastatic BC is depicted in table 1.
Table 1: identification and HER2 characterization of circulating tumor cells in healthy woman, precancerous and cancerous patients.
[0059] Since 1 and 2 CTCs were detected in 7 (14.8%) and 4 (8.5%) of 47 healthy women, respectively, >1CTC or >2CTCs were selected as cutoffs for further analysis. [0060] Using the above cutoffs, only 7 (18.9%) and 5 (13.5%) of 37 patients with early BC were considered CTC- positive, respectively.
[0061] Since no HER2+ CTCs were detected in any of the 47 healthy women, a cutoff of 1 HER2+ CTCs was advantageously chosen. [0062] With this refined cutoff, more women with early BC [11 (29.7%) of 37 women] were considered CTC- positive .
[0063] In addition, women with pre-invasive lesions such as DCIS or LCIS, although having few CTCs, tend to have HER2-positive CTCs in a rather important proportion. [0064] HER2+ CTCs is thus more sensitive and specific marker for CTCs positivity than total CTCs counts in early (breast) cancer and/or at the first stages of malignant transformation.
[0065] Clinical relevance of the above cutoff for CTCs positivity and/or for prediction for response towards
HER2-targeted therapies using HER2+ CTCs detection is analyzed in clinical trials of HER2 positive early breast cancer .
Treatment of breast cancer patients with HER2-negative tumor and HER2-positive circulating tumor cells:
(Pilot study of secondary adjuvant treatment with trastuzumab for elimination of HER2-positive Circulating Tumor Cells (CTCs) in women with HER2-negative early breast cancer)
[0066] The inventors launched a two-phase project. [0067] In part A, the inventors studied the effect of trastuzumab on the elimination of HER2-positive CTCs. The primary endpoint was the comparison of the trastuzumab arm with the follow-up arm for HER2-positive CTC (s) elimination rate (i.e. percentages of patients achieving HER2-positive CTC (s) elimination in the two arms) at week 18. [0068] The inventors screened 536 women with HER2- negative early (breast) cancer during their follow-up for the presence of HER2-positive CTCs using 3 different techniques (using the CellSearch System, HER2mRNA or HER2- positive by FISH) in order to identify 133 women with detectable HER2-positive CTCs that are further randomized between adjuvant trastuzumab versus follow-up. This study is conducted using a single laboratory for CTC evaluation. [0069] The inventors compared the trastuzumab arm to the follow-up arm for HER2-positive CTC (s) elimination rate at week 18. [0070] The inventors performed extensive translational research on CTCs in order to identify the clinically relevant definition of HER2- positive CTCs, that is the definition of HER2-positive CTCs indicating benefit from trastuzumab: (detection of HER2mRNA
using RT-PCR, detection of HER2 protein overexpression using the Veridex platform or detection of HER2 gene amplification using FISH after performing the CellSearch profiling Kit) . Furthermore, these results are correlated with the presence of soluble HER2 extracellular domain
(HER2 ECD) in the plasma.
Identify mutations (e.g PI3-kinase mutations) in CTCs related to trastuzumab response / resistance.
Identify subpopulations of CTCs that harbor stem-cell like properties.
- Identify germ line polymorphisms related to response to trastuzumab .
[0071] INCLUSION CRITERIA 1. Patients with Oestrogen Receptor-negative (ER- negative) /HER2-negative tumors that have completed adjuvant chemotherapy (less than 2 years from their initial breast cancer diagnosis) .
2. Patients with ER-positive/HER2-negative tumors that have completed adjuvant chemotherapy and are now receiving hormonotherapy or patients receiving hormonotherapy as the only adjuvant treatment (less than 2 years from their initial breast cancer diagnosis) .
3. Patients with detectable HER2-positive CTCs (see definition below) .
4. Patients with adequate cardiac function and a LVEF>50%.
5. Tumor block available for centralized HER2 testing and construction of tissue microarrays (TMA)
[0072] TREATMENT ALLOCATION PROCEDURE
Tumor blocks are sent to the central laboratory for testing primary tumor HER2 status 4 weeks prior to start of treatment
The central laboratory for CTC testing (Translational Research Unit, Jules Bordet Institut) is blinded concerning the blood samples that will be analyzed for HER2-positive CTCs. Patients are randomised between the trastuzumab and the follow-up arm.
Patients randomised to the trastuzumab arm receive a total of 6 injections of trastuzumab every 3 weeks. A loading dose of trastuzumab 8mg/kg i.v. and then 5 cycles of trastuzumab 6mg/kg every 3 weeks is administered.
Patients randomised to the follow-up arm are followed for 18 weeks with blood draws for CTC measurements. Patients then crossover and receive the same treatment as patients on trastuzumab arm.
[0073] CTC DETECTION BLOOD DRAWS
In order to characterise a woman as having HER2-positive CTC to be eligible for the trial, a blood draw is performed at week -4 and is processed using three different techniques:
1. A total of 15mL is processed using a modified ficoll procedure as previously described by Rack et al . and then CTC are enumerated and profiled for HER2 using a method based on EpCAM enrichment and a subsequent detection, such as using the CellSearch System (Veridex, USA) .
2. A total of 15mL is processed using ficoll enrichment of mononuclear cells and then RNA extraction, cDNA synthesis and PCR detection of CK19 (for instance using Forward primer: GCACTACAGCCACTACTACACGA and Reverse primer: CTCATGCGCAGAGCCTGTT), MammaglobinA (for instance in nested PCR using Forward primerl : CAATCAATCCACAAGTGTCTAA ; Forward primer2 : ACGGATGAAACTCTGAGCAATG; Reverse primerl: AACATGTATAGCAGGTTTCAAC and Reverse primer2 : CAGTTCTGTGAGCCAAAGGT) and HER2mRNA transcripts (for
instance in nested PCR using Forward primerl : TCC TCC TCG CCC TCT TGC ; Forward primer2 : AGC CGC GAG CAC CCA AGT; Reverse primerl: GCG GGT CTC CAT TGT CTA and Reverse primer2: TTG GTG GGC AGG TAG GTG AGT. 3. A total of 15mL is processed using a modified ficoll procedure and the CellSearch profiling Kit followed by double immunofluoresence for cytokeratin and HER2 and then FISH for HER2 as described by Meng et al . [0074] Overall, the inventors have noticed a reduction of HER2-positive CTCs in trastuzumab-treated early (non-metastatic) breast cancer patients. The inventors further conclude that this approach is robust enough to treat patients with pre-invasive lesions and possibly metastatic patients (having a HER2-negative tumor), provided they have Her-2 positive CTCs.
[0075] In part B, the inventors aimed to determine if the elimination of HER2-positive CTCs with secondary adjuvant trastuzumab can improve the clinical outcome. [0076] This was a 2:1 randomized, double blinded trial of trastuzumab versus follow-up in women with HER2- negative early breast cancer and detectable HER2-positive CTCs following standard adjuvant therapy, within 2 years of initial diagnosis. [0077] The primary endpoint of this trial was the disease free survival (DFS) . Towards this aim approximately 800 women were screened in order to identify 200 women with HER2-negative early (breast) cancer and detectable HER2- positive CTCs that are eligible for this study. [0078] At any time point a woman is considered as having "HER2-positive CTCs" if
1. > lHER2-positive CTC / 15mL of blood is detected using the CellSearch System OR
2. One of the following molecular profiles is present when a 3-marker RT-PCR (CKl 9, mammaglobin and HER2) is applied in cDNA extracted from 15ml of peripheral blood: CK19mRNA+ / MammaglobinAmRNA- / HER2mRNA+, or CK19mRNA- /MammaglobinAmRNA+ / HER2mRNA+ or CK19mRNA+ / MammaglobinAmRNA+ / HER2mRNA+ OR
3. > 1 Cytokeratin-positive/HER2-positive CTC with HER2 amplification by FISH / 15mL of blood is detected using the CellSearch profiling kit and double immufluoresensce with FISH.
[0079] At any time point "Elimination of HER2- positive CTC (s)" will be defined as
1. No HER2-positive CTC is detected using the CellSearch System (HER2-negative CTC (s) could still be detected) or
2. No HER2mRNA is detected in the peripheral blood (CK19mRNA and Mammaglobin AmRNA could still be detected) or
3. No Cytokeratin-positive / HER2-positive CTC with HER2 amplification by FISH is detected
[0080] For patients randomised to the trastuzumab arm, blood is drawn for HER2-positive CTCs detection on weeks 0, 9, 18. For patients randomised to the follow-up arm, blood is drawn for HER2-positive CTCs detection on weeks 0, 9, 18, 27, 36.
[0081] For all patients participating in the study, blood is drawn during the follow-up period, 24 weeks after the last dose of trastuzumab. [0082] Blood drawn for HER2-positive CTCs detection on week 0 was for the comparison of the reproducibility of HER2-positive CTCs detection at two time points (week -4 and week 0) and for the correlation of HER2-positive CTCs
detection with findings from the translational research blood draws (see below) .
[0083] Overall, the inventors noticed an increased survival in trastuzumab-treated early breast cancer patients. The inventors further conclude that this approach is robust enough to treat patients with pre-invasive breast lesions and possibly metastatic breast cancer patients
(having a HER2 -negative tumor) , provided they have Her-2 positive CTCs. [0084] The inventors further conclude that the same treatment can be applied to every cancer having HER2- positive CTCs and/or tumors, more particularly epithelial cancer, such as ovarian cancer or bladder cancer.
[0085] CTC TRANSLATIONAL RESEARCH BLOOD DRAWS
In addition to the blood draws for the detection of HER2- positive CTCs, further blood draws (15mL) are performed in order to characterize the biology of CTCs (Identify mutations e.g. PI3-kinase mutations in CTCs related to trastuzumab response / resistance or identify subpopulations of CTCs that harbor stem-cell like properties) as well as to study germ line polymorphisms related to trastuzumab resistance, the presence of CTCs and the development of later metastasis. [0086] For patients randomised to the trastuzumab arm, CTC translational research blood draws is performed on weeks 0 and 18.
[0087] For patients randomised to the follow-up arm, CTC translational research blood draws is performed on weeks 0 and 36.
Reference List
Wolff AC, et al. J Clin Oncol 2007; 25 (1) : 118-145.
Meng et al (Proc. Natl. Acad. Sci. USA, 2004, 101(25) 9303- 9398
B. K. Rack, C. et al, Abstract 503, ASCO conference 2008.
Nahta R, Esteva FJ., 2003. Clin Cancer Res. 2003 Nov
1;9(14) :5078-84. Bozionellou V et al, 2004. Clin Cancer Res. 8185-94.
Barok M et al, 2008. Cancer Lett. Feb 18 ; 260 (1-2) : 198-208. Epub 2007 Dec 21.
Claims
1. A pharmaceutical composition comprising an adequate pharmaceutical carrier and a sufficient amount of an anti-HER2 (targeted therapeutic active compound) , for use in the treatment and/or the prevention of cancer in patients having HER2 positive circulating tumoral cells (CTCs) or HER2 positive disseminated tumoral cells (DTCs) , and no HER2 positive tumor.
2. The pharmaceutical composition according to claim 1 for use in the treatment of epithelial cancers.
3. The pharmaceutical composition according to claims 1 or 2 for use in the treatment of non-metastatic cancer .
4. The pharmaceutical composition according to any of the claims 1 to 3 for use in the treatment of early breast cancer.
5. The pharmaceutical composition according to any of the preceding claims for use in the treatment of patients having an abnormal mammogram or preinvasive breast lesions preferably selected from the group consisting of atypical hyperplasia, Ductal Carcinoma in situ (DCIS) and Lobular Carcinoma in situ (LCIS) .
6. The pharmaceutical composition according to any of the preceding claims, wherein the anti HER2 compound is an anti HER2 antibody or a tyrosine kinase inhibitor .
7. The pharmaceutical composition according to any of the preceding claims, further comprising another anti-tumoral compound.
8. The pharmaceutical composition of claim
7, wherein the other anti-tumoral compound is a chemotherapeutic compound, preferably selected from the group of anthracyclines and taxanes.
9. The pharmaceutical composition of claim 7 or 8, wherein the other anti-tumoral compound is an anti- oestrogen .
10. An (anti-)HER2 therapeutic active compound for use in the treatment of breast cancer in patients having HER2-negative primary breast cancer and biomarkers predictive for response to (anti-)HER2 targeted therapeutic active compounds.
11. An anti-HER2 therapeutic active compound for use in the treatment of bladder cancer in patients having HER2-negative primary bladder cancer and biomarkers predictive for response to anti-Her2 targeted therapeutic active compounds.
12. An anti-HER2 therapeutic active compound for use in the treatment of ovarian cancer in patients having HER2-negative primary ovarian cancer and biomarkers predictive for response to anti-Her2 targeted therapeutic active compounds.
13. The compound according to any of the claims 10 to 12, wherein the breast, ovarian or bladder cancer patient is non-metastatic and/or early cancer.
14. An (anti-)HER2 therapeutic active compound for use in the treatment of preinvasive breast lesions like atypical hyperplasia, Ductal Carcinoma in Situ (DCIS) or Lobular Carcinoma in situ (LCIS) and biomarkers predictive for response to an (anti-)HER2 targeted therapeutic active compounds.
15. The therapeutic compound according to the preceding claims 10 to 14, wherein predictive biomarkers for response to an (anti-)HER2 targeted therapeutic active compound are the presence of HER2 positive CTCs and/or DTCs.
16. The compound according to any of the preceding claims 10 to 15, which is an anti-HER2 antibody.
17. The compound according to the claim 16, which is trastuzumab.
18. The compound according to the claim 16, which is pertuzumab.
19. The compound according to any of the preceding claims 10 to 15, which is a tyrosine kinase inhibitor .
20. A method to treat and/or to prevent epithelial (breast or bladder or ovarian) cancer in patients comprising the steps of:
A) Selecting (women) patients having no HER2-positive (breast or ovarian or bladder) tumor, but having a (breast or ovarian or bladder) cancer or suspected to develop (breast or ovarian or bladder) cancer; B) Selecting within the said (woman) patients having no
HER2-positive (breast or ovarian or bladder) tumor those having biomarkers predictive for a response to anti-
HER2 targeted therapeutic active compounds;
C) Providing to the said patients selected at step B a pharmaceutical composition comprising an adequate pharmaceutical carrier and a sufficient amount of an anti HER2 compound.
21. The method of Claim 20, wherein the patients selected at step A are non-metastatic (breast) cancer patients.
22. The method of Claim 20, wherein the women patients selected at step A have no (diagnosed) breast cancer, but abnormal mammogram, or preinvasive breast
(cancer) lesions preferably selected from the group consisting of atypical hyperplasia, Ductal Carcinoma in Situ (DCIS) and Lobular Carcinoma in situ (LCIS) .
23. The method of Claim 20, wherein the patients selected at step B have HER2 positive CTCs and/or DTCs.
24. The method of Claim 20, wherein the anti- HER2 targeted therapeutic active compounds is selected from the group consisting of antibodies and tyrosine kinase inhibitors .
25. The method of Claim 24, wherein the antibodies are selected from the group consisting of trastuzumab and pertuzumab.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13865808P | 2008-12-18 | 2008-12-18 | |
| US61/138,658 | 2008-12-18 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010070117A1 true WO2010070117A1 (en) | 2010-06-24 |
Family
ID=41800790
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2009/067575 Ceased WO2010070117A1 (en) | 2008-12-18 | 2009-12-18 | Treatment method by the administration of anti-her2 targeted active compounds to patients with early breast cancer and her2-negative primary tumor |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2010070117A1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3069735A1 (en) * | 2014-01-10 | 2016-09-21 | Synthon Biopharmaceuticals B.V. | Duocarmycin adcs showing improved in vivo antitumor activity |
| US9714294B2 (en) | 2010-05-27 | 2017-07-25 | Genmab A/S | Monoclonal antibodies against HER2 epitope |
| US9862769B2 (en) | 2010-05-27 | 2018-01-09 | Genmab A/S | Monoclonal antibodies against HER2 |
| US20220288019A1 (en) * | 2021-03-09 | 2022-09-15 | Eli Lilly And Company | Methods of treating cancer using a combination of SERD Dosing Regimens |
| US11578141B2 (en) | 2011-04-20 | 2023-02-14 | Genmab A/S | Bispecific antibodies against HER2 and CD3 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006041959A2 (en) * | 2004-10-06 | 2006-04-20 | Wellstat Biologics Corporation | Detection of elevated levels of her-2/neu protein on circulating cancer cells and treatment |
| WO2007056118A1 (en) * | 2005-11-04 | 2007-05-18 | Wyeth | Antineoplastic combinations with mtor inhibitor, herceptin, and/or hki-272 |
-
2009
- 2009-12-18 WO PCT/EP2009/067575 patent/WO2010070117A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006041959A2 (en) * | 2004-10-06 | 2006-04-20 | Wellstat Biologics Corporation | Detection of elevated levels of her-2/neu protein on circulating cancer cells and treatment |
| WO2007056118A1 (en) * | 2005-11-04 | 2007-05-18 | Wyeth | Antineoplastic combinations with mtor inhibitor, herceptin, and/or hki-272 |
Non-Patent Citations (11)
| Title |
|---|
| B. K. RACK, C. ET AL., ASCO CONFERENCE, 2008 |
| BAROK ET AL: "Trastuzumab decreases the number of circulating and disseminated tumor cells despite trastuzumab resistance of the primary tumor", CANCER LETTERS, NEW YORK, NY, US, vol. 260, no. 1-2, 21 December 2007 (2007-12-21), pages 198 - 208, XP022424292, ISSN: 0304-3835 * |
| BAROK M ET AL., CANCER LETT., vol. 260, no. 1-2, 21 December 2007 (2007-12-21), pages 198 - 208 |
| BOZIONELLOU V ET AL., CLIN CANCER RES., 2004, pages 8185 - 94 |
| BOZIONELLOU VASSILIKI ET AL: "Trastuzumab administration can effectively target chemotherapy-resistant cytokeratin-19 messenger RNA-positive tumor cells in the peripheral blood and bone marrow of patients with breast cancer.", CLINICAL CANCER RESEARCH : AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH 15 DEC 2004, vol. 10, no. 24, 15 December 2004 (2004-12-15), pages 8185 - 8194, XP002573884, ISSN: 1078-0432 * |
| ERICH F SOLOMAYER ET AL: "Comparison of HER2 status between primary tumor and disseminated tumor cells in_primary breast cancer patients", BREAST CANCER RESEARCH AND TREATMENT, KLUWER ACADEMIC PUBLISHERS, BO, vol. 98, no. 2, 22 March 2006 (2006-03-22), pages 179 - 184, XP019392302, ISSN: 1573-7217 * |
| JUECKSTOCK J K ET AL: "Treatment with trastuzumab in recurrence free patients with early breast cancer and persistent disseminated tumor cells (DTC) in bone marrow", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, BALTIMORE, MD., US, vol. 69, no. 2, Suppl. S, 14 December 2008 (2008-12-14), pages 242S - 243S, XP009131019, ISSN: 0008-5472 * |
| MENG ET AL., PROC. NATL. ACAD. SCI., vol. 101, no. 25, 2004, pages 9303 - 9398 |
| MENG SONGDONG ET AL: "HER-2 gene amplification can be acquired as breast cancer progresses", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 101, no. 25, 22 June 2004 (2004-06-22), pages 9393 - 9398, XP002573885, ISSN: 0027-8424 * |
| NAHTA R; ESTEVA FJ, CLIN CANCER RES, vol. 9, no. 14, 1 November 2003 (2003-11-01), pages 5078 - 84 |
| WOLFF AC ET AL., J CLIN ONCOL, vol. 25, no. 1, 2007, pages 118 - 145 |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9714294B2 (en) | 2010-05-27 | 2017-07-25 | Genmab A/S | Monoclonal antibodies against HER2 epitope |
| US9862769B2 (en) | 2010-05-27 | 2018-01-09 | Genmab A/S | Monoclonal antibodies against HER2 |
| US10793640B2 (en) | 2010-05-27 | 2020-10-06 | Genmab A/S | Monoclonal antibodies against HER2 epitope |
| US11046771B2 (en) | 2010-05-27 | 2021-06-29 | Genmab A/S | Monoclonal antibodies against HER2 |
| US11091553B2 (en) | 2010-05-27 | 2021-08-17 | Genmab A/S | Monoclonal antibodies against HER2 |
| US11578141B2 (en) | 2011-04-20 | 2023-02-14 | Genmab A/S | Bispecific antibodies against HER2 and CD3 |
| EP3069735A1 (en) * | 2014-01-10 | 2016-09-21 | Synthon Biopharmaceuticals B.V. | Duocarmycin adcs showing improved in vivo antitumor activity |
| US20220288019A1 (en) * | 2021-03-09 | 2022-09-15 | Eli Lilly And Company | Methods of treating cancer using a combination of SERD Dosing Regimens |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fehm et al. | HER2 status of circulating tumor cells in patients with metastatic breast cancer: a prospective, multicenter trial | |
| Garcia et al. | A phase II evaluation of lapatinib in the treatment of persistent or recurrent epithelial ovarian or primary peritoneal carcinoma: a gynecologic oncology group study | |
| US20240103003A1 (en) | Detection of prostate specific membrane antigen (psma) expression on circulating tumor cells (ctc) | |
| Pernot et al. | Dynamic evaluation of circulating tumour cells in patients with advanced gastric and oesogastric junction adenocarcinoma: Prognostic value and early assessment of therapeutic effects | |
| Zhu et al. | CD8+/FOXP3+ ratio and PD-L1 expression associated with survival in pT3N0M0 stage esophageal squamous cell cancer | |
| Cornejo et al. | Theranostic and molecular classification of breast cancer | |
| Odicino et al. | HER-2/neu overexpression and amplification in uterine serous papillary carcinoma: comparative analysis of immunohistochemistry, real-time reverse transcription-polymerase chain reaction, and fluorescence in situ hybridization | |
| KR102097859B1 (en) | Biomarkers for predicting the response of anticancer drugs to gastric cancer and their uses | |
| WO2017198631A1 (en) | Markers selectively deregulated in tumor-infiltrating regulatory t cells | |
| Xiao et al. | Stability of HER2-positive status in breast carcinoma: a comparison between primary and paired metastatic tumors with regard to the possible impact of intervening trastuzumab treatment | |
| EP3052657A2 (en) | Nucleic acid biomarker and use thereof | |
| US20220162706A1 (en) | Intra-patient genomic heterogeneity of single circulating tumor cells (ctcs) associated to phenotypic ctc heterogeneity in metastatic castrate resistant prostate cancer (mcrpc) | |
| Wang et al. | Tumor border sharpness correlates with HLA-G expression in low-grade gliomas | |
| WO2010070117A1 (en) | Treatment method by the administration of anti-her2 targeted active compounds to patients with early breast cancer and her2-negative primary tumor | |
| WO2014153018A1 (en) | Use of egfr biomarkers for the treatment of gastric cancer with anti-egfr agents | |
| KR20190056420A (en) | Diagnosis and treatment of aviratorone acetate-glucocorticoid-resistant or -responsive metastatic castration-resistant prostate cancer | |
| Lu et al. | Basic transcription factor 3 like 4 enhances malignant phenotypes through modulating tumor cell function and immune microenvironment in glioma | |
| Zhong et al. | Diagnostic and therapeutic ERβ, HER2, BRCA biomakers in the histological subtypes of lung adenocarcinoma according to the IASLC/ATS/ERS classification | |
| EP2542692B1 (en) | Method for selecting patients for treatment with an egfr inhibitor | |
| García-Sáenz et al. | Circulating tumour cells in locally advanced breast cancer | |
| Sami et al. | Breast cancer profile in Ras Al Khaimah, United Arab Emirates–a histopathological and immunohistochemical study | |
| JP7377713B2 (en) | HER2 as a predictor of response to dual HER2 blockade without cytotoxic therapy | |
| Moatter et al. | Status of HER2 amplification, polysomy 17 and histopathological features of 425 Pakistani breast cancer patients | |
| Müller et al. | Clinical relevance of disseminated tumor cells in the bone marrow and circulating tumor cells in the blood of breast cancer patients | |
| 서정민 | Association of survival outcome and HER2/CEP17 ratio in advanced HER2-positive breast cancer treated with pertuzumab, trastuzumab, and docetaxel |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09798921 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 09798921 Country of ref document: EP Kind code of ref document: A1 |
