WO2010063610A1 - Pyridazinone derivatives - Google Patents

Pyridazinone derivatives Download PDF

Info

Publication number
WO2010063610A1
WO2010063610A1 PCT/EP2009/065692 EP2009065692W WO2010063610A1 WO 2010063610 A1 WO2010063610 A1 WO 2010063610A1 EP 2009065692 W EP2009065692 W EP 2009065692W WO 2010063610 A1 WO2010063610 A1 WO 2010063610A1
Authority
WO
WIPO (PCT)
Prior art keywords
phenyl
pyridazin
pyrazol
alkyl
fluoro
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2009/065692
Other languages
French (fr)
Inventor
Daniela Alberati
Luca Gobbi
Matthias Koerner
Bernd Kuhn
Jens-Uwe Peters
Rosa Maria Rodriguez Sarmiento
Mark Rogers-Evans
Markus Rudolph
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
F Hoffmann La Roche AG
Original Assignee
F Hoffmann La Roche AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to ES09756503T priority Critical patent/ES2401670T3/en
Priority to AU2009321601A priority patent/AU2009321601B2/en
Priority to MX2011005449A priority patent/MX2011005449A/en
Priority to SG2011040714A priority patent/SG171954A1/en
Priority to EP09756503A priority patent/EP2373641B1/en
Priority to KR1020117015172A priority patent/KR101371881B1/en
Priority to JP2011538950A priority patent/JP5502890B2/en
Priority to CN200980148519.1A priority patent/CN102239162B/en
Priority to CA2744489A priority patent/CA2744489C/en
Application filed by F Hoffmann La Roche AG filed Critical F Hoffmann La Roche AG
Publication of WO2010063610A1 publication Critical patent/WO2010063610A1/en
Priority to IL212636A priority patent/IL212636A0/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D403/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/04Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/50Pyridazines; Hydrogenated pyridazines
    • A61K31/501Pyridazines; Hydrogenated pyridazines not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/18Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/22Anxiolytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/24Antidepressants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/30Drugs for disorders of the nervous system for treating abuse or dependence
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D403/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/14Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D405/00Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/14Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings

Definitions

  • the invention is concerned with novel pyridazinone derivatives of formula (I)
  • R 1 is aryl which can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of lower-alkyl, hydro xy-lower-alkyl, lower-alkoxy, fluoro- lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, halogen, lower-alkoxy- lower-alkyl, cyano, NO 2 , lower-alkyl-SO, morpholinyl, NH 2 -SO 2 ,
  • R 3 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
  • R 4 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
  • Schizophrenia is a progressive and devastating neurological disease characterized by episodic positive symptoms such as delusions, hallucinations, thought disorders and psychosis and persistent negative symptoms such as flattened affect, impaired attention and social withdrawal, and cognitive impairments (Lewis DA and Lieberman JA, Neuron, , 28:325-33, 2000).
  • Schizophrenia is a progressive and devastating neurological disease characterized by episodic positive symptoms such as delusions, hallucinations, thought disorders and psychosis and persistent negative symptoms such as flattened affect, impaired attention and social withdrawal, and cognitive impairments (Lewis DA and Lieberman JA, Neuron, , 28:325-33, 2000).
  • For decades research has focused on the "dopaminergic hyperactivity" hypothesis which has led to therapeutic interventions involving blockade of the dopaminergic system (Vandenberg RJ and Aubrey KR., Exp. Opin. Ther.
  • Cyclic nucleotides cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) are ubiquitous second messengers responsible for mediating the biological response of a variety of extracellular signals, including neurotransmitters, light and hormones.
  • cAPM and cGMP regulate a variety of intracellular processes particularly in neurons of the central nervous system by activating cAMP- and cGMP-dependent kinases which then phosphorylate proteins involved in the regulation of synaptic transmission, neuronal differentiation and survival.
  • Phosphodiesterases are a family of widely expressed enzymes encoded by 21 different genes in humans, with each gene encoding several splice variants (Beavo, J., Physiol. Rev. 1995, 75, 725-748; Conti, M., Jin, S.L., Prog. Nucleic Acid Res. MoI. Biol. 1999, 63, 1-38; Soderling, S.H., Beavo, J.A., Curr. Opin. Cell Biol. 2000,12, 174-179, Manallack, D.T. et al. J. Med.Chem. 2005, 48 (10), 3449-3462).
  • the PDE families differ in their substrate specificy for the cyclic nucleotides, their mechanism of regulation and their sensitivity to inhibitors. Moreover, they are differentially localized in the organism, among the cells of an organ and even within the cells. These differences lead to a differentiated involvement of the PDE families in the various physiological functions.
  • PDElOA is a dual substrate PDE encoded by a single gene as reported in 1999 by three separate research groups (Fujishige K., et al., Eur J Biochem (1999) 266(3):1118-1127, Soderling S.H., et al., ProcNatl Acad Sci USA (1999) 96(12):7071-7076, Loughney K., et al., Gene (1999) 234(1): 109-117).
  • PDElOA is unique from other members of the multigene family with respect to amino acid sequence (779 aa), tissue-specific pattern of expression, affinity for cAMP and cGMP and the effect on PDE activity by specific and general inhibitors.
  • PDElOA has one of the most restricted distribution of any PDE family being primarily expressed in the brain particularly in the nucleus accumbens and the caudate putamen. Additionally thalamus, olfactory bulb, hippocampus and frontal cortex show moderate levels of PDElOA expression. All these brain areas have been suggested to be involved in the pathophysiology of schizophrenia and psychosis, suggesting a central role of PDElOA in this devastating mental illness. Outside the central nervous system PDElOA transcript expression is also observed in peripheral tissues like thyroid gland, pituitary gland, insulin secreting pancreatic cells and testes (Fujishige, K. et al., J. Biol. Chem. 1999, 274, 18438-18445, Sweet, L.
  • the striatal medium spiny neurons are the principal input site and first site for information integration in the basal ganglia circuit of the mammalian brain.
  • the basal ganglia are a series of interconnected subcortical nuclei that integrate widespread cortical input with dopaminergic signaling to plan and execute relevant motor and cognitive patterns while suppressing unwanted or irrelevant patterns (Graybiel, A.M. Curr. Biol. 2000, 10, R509-R511 (2000).
  • Papaverine, a relatively specific PDElOA inhibitor, and PDElOA-knockout mice have been used to explore the physiology of this enzyme and the possible therapeutic utility of
  • PDElOA inhibition Inhibition of this enzyme pharmacologically or through gene disruption causes a reduction in activity and a reduced response to psychomotor stimulants. Inhibition also reduces the conditioned avoidance response, a behavioural response that is predictive of clinical antipsychotic activity (Siuciak, J.A.; et al., Neuropharmacology 2006, 51 (2), 386-396; Siuciak, J.A.; et al., Neuropharmacology 2006, 57 (2), 374-385).
  • PDElOA inhibition bears the potential to improve the negative and cognitive symptoms associated to schizophrenia.
  • papaverine have been shown to attenuate the deficits in the extra-dimensional shift learning induced in rats by sub-chronic treatment with PCP, an animal paradigm of NMDA receptor hypofunction (Rodefer, J,S., et al., Eur. J. Neuroscience 2005, 2, : 1070- 1076).
  • increased social interaction in PDE10A2-deficient mice have been observed (Sano, H. J. Neurochem. 2008, 105, 546-556).
  • Diseases that can be treated with PDElOA inhibitors include, but are not limited to, diseases thought to be mediated in part by dysfunction of the basal ganglia, of other parts of the central nervous system and of other PDElOA expressing tissues.
  • diseases can be treated, where inhibition of PDElOA can have therapeutic effects.
  • These diseases include, but are not limited to, certain psychotic disorders such as schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder or substance-induced psychotic disorder, anxiety disorders such as panic disorder, obsessive-compulsive disorder, acute stress disorder or generalized anxiety disorder, obsessive/compulsive disorders, drug addictions, movement disorders such as Parkinson's disease or restless leg syndrome, cognition deficiency disorders such as Alzheimer's disease or multi-infarct dementia, mood disorders such as depression or bipolar disorders, or neuropsychiatric conditions such as psychosis, attention-deficit/hyperactivity disorder (ADHD) or related attentional disorders.
  • psychotic disorders such as schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder or substance-induced psychotic disorder, anxiety disorders such as panic disorder, obsessive-compulsive disorder, acute stress disorder or generalized anxiety disorder, obsessive/compulsive disorders, drug addictions, movement disorders such as Parkinson's disease or restless leg
  • the compounds of the present invention are also suitable for the treatment of diabetes and related disorders such as obesity by regulating the cAMP signaling system.
  • PDElOA inhibitors might also be useful in preventing neurons from undergoing apoptosis by raising cAMP and cGMP levels and, thus, might possess anti- inflammatory properties.
  • Neurodegenerative disorders treatable with PDElOA inhibitors include, but are not limited to, as
  • Alzheimer's disease Huntington's disease, Parkinson's disease, multiple sclerosis, stroke or spinal cord injury.
  • cAMP and cGMP The growth of cancer cells is inhibited by cAMP and cGMP.
  • PDElOA inhibitors can also be used for the treatment of different solid tumors and hematological malignancies such as renal cell carcinoma or breast cancer.
  • lower is used to mean a group consisting of one to seven, preferably of one to four carbon atom(s).
  • halogen refers to fluorine, chlorine, bromine and iodine, with fluorine, chlorine and bromine being preferred.
  • alkyl refers to a branched or straight-chain monovalent saturated aliphatic hydrocarbon radical of one to twenty carbon atoms, preferably one to sixteen carbon atoms, more preferably one to ten carbon atoms. Lower-alkyl groups as described below also are preferred alkyl groups.
  • lower-alkyl alone or in combination with other groups, refers to a branched or straight-chain monovalent alkyl radical of one to seven carbon atoms, preferably one to four carbon atoms. This term is further exemplified by such radicals as methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, t-butyl and the like.
  • alkenyl stands for a straight-chain or branched hydrocarbon residue comprising an olefinic bond and up to 20, preferably up to 16 carbon atoms.
  • lower-alkenyl refers to a straight-chain or branched hydrocarbon residue comprising an olefinic bond and up to 7, preferably up to 4 carbon atoms, such as e.g. ethenyl or 2-propenyl.
  • alkinyl stands for a straight-chain or branched hydrocarbon residue comprising a tripple bond and up to 20, preferably up to 16 carbon atoms.
  • lower-alkinyl refers to a straight-chain or branched hydrocarbon residue comprising a tripple bond and up to 7, preferably up to 4 carbon atoms, such as e.g. ethinyl or 2-propinyl.
  • lower-alkylene refers to a branched or straight chain divalent lower-alkyl radical. This term is further exemplified by such radicals as methylene, ethylene, propylene and the like.
  • dioxo- lower-alkylene refers to the group -O-lower-alkylene-0-.
  • fluoro-lower-alkylene refers to a branched or straight chain divalent fluoro-lower-alkyl radical. This term is further exemplified by such radicals as -CF 2 - and the like.
  • dioxo-fluoro-lower-alkylene refers to the group -O-fluoro-lower-alkylene-O-.
  • cycloalkyl refers to a monovalent carbocyclic radical of 3 to 10 carbon atoms, preferably 3 to 6 carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.
  • fluoro-lower-alkyl refers to lower-alkyl groups which are mono- or multiply substituted with fluorine.
  • fluoro-lower-alkyl groups are e.g. CFH 2 , CF 2 H, CF 3 , CF 3 CH 2 , CF 3 (CH 2 ) 2 , (CF 3 ) 2 CH and CF 2 H-CF 2 .
  • hydroxy-lower-alkyl refers to a lower-alkyl group as defined above, which is substituted by 1 to 3 hydroxy groups. Examples of hydroxy-lower-alkyl groups are e.g.
  • alkoxy refers to the group R'-O-, wherein R' is an alkyl.
  • lower- alkoxy refers to the group R'-O-, wherein R' is a lower-alkyl.
  • fluoro-lower-alkoxy refers to the group R"-O-, wherein R" is fluoro-lower- alkyl.
  • fluoro-lower-alkoxy groups are e.g. CFH 2 -O, CF 2 H-O, CF3-O, CF3CH2-O, CF 3 (CH 2 ) 2 -O, (CFs) 2 CH-O, and CF 2 H-CF 2 -O.
  • aryl alone or in combination, relates to the phenyl or naphthyl group, preferably the phenyl group, which can optionally be substituted, unless specifically stated otherwise, by 1 to 5 , preferably 1 to 3, substituents, independently selected from the group consisting of halogen, hydroxy, amino, NO 2 , lower-alkyl, hydroxy-lower-alkyl, lower-alkoxy, carboxy, carboxy-lower-alkyl, H 2 NC(O), (H,lower-alkyl)NC(O), (lower-alkyl) 2 NC(O), fiuoro- lower-alkyl, lower-alkyl-SO 2 , lower-alkyl-SO 2 O, lower-alkyl-SO 2 -NH, lower-alkyl-SO 2 - N(lower-alkyl), H 2 NSO 2 , (H,lower-alkyl)NSO 2 , (lower-alkyl) 2 NSO 2 , cyano
  • Preferred substituents can be halogen, lower-alkyl and lower- alkoxy.
  • aryl groups can preferably be substituted as described in the description and claims below. Examples of aryl, wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo- lower-alkylene, dioxo-fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower-alkylene, lower-alkylene-NH-lower-alkylene, lower-alkylene-N(lower alkyl)-lower-alkylene, NH-C(O)- lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower-alkylene-NH-C(O)-lower-alkylene, lower-alkylene-N(lower alkyl)-C(O)-low
  • heteroaryl refers to an aromatic 5 to 6 membered monocyclic ring or 9 to 10 membered bicyclic ring which can comprise 1, 2 or 3 atoms selected from nitrogen, oxygen and/or sulphur, such as furyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, thienyl, isoxazolyl, oxazolyl, oxadiazolyl, imidazolyl, pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, thiadiazolyl, benzo imidazolyl, indolyl, indazolyl, benzothiazolyl, benzo isothiazolyl, benzoxazolyl, benzoisoxazolyl, quinolinyl and isoquinolinyl.
  • heteroaryl groups are thiazolyl, pyridinyl. Unless specifically stated otherwise, a heteroaryl group may optionally have a substitution pattern as described earlier in connection with the term "aryl". Furthermore, heteroaryl groups can preferably be substituted as described in the description and claims below. Preferred examples of heteroaryl, wherein two substituents at adjacent positions of the heteroaryl are bound together to form a ring are those wherein said two bound substituents are lower- alkylene, dioxo-lower-alkylene or dioxo-fluoro-lower-alyklene, e.g.
  • Compounds of formula (I) can form pharmaceutically acceptable acid addition salts.
  • pharmaceutically acceptable salts are salts of compounds of formula (I) with physiologically compatible mineral acids, such as hydrochloric acid, sulphuric acid, sulphurous acid or phosphoric acid; or with organic acids, such as methanesulphonic acid, p- toluenesulphonic acid, acetic acid, lactic acid, trifluoro acetic acid, citric acid, fumaric acid, maleic acid, tartaric acid, succinic acid or salicylic acid.
  • physiologically compatible mineral acids such as hydrochloric acid, sulphuric acid, sulphurous acid or phosphoric acid
  • organic acids such as methanesulphonic acid, p- toluenesulphonic acid, acetic acid, lactic acid, trifluoro acetic acid, citric acid, fumaric acid, maleic acid, tartaric acid, succinic acid or salicylic acid.
  • a COOH group can further form salts with bases.
  • salts examples of such salts are alkaline, earth- alkaline and ammonium salts such as e.g. Na-, K-, Ca- and trimethylammoniumsalt.
  • pharmaceutically acceptable salts also refers to such salts. Salts obtained by the addition of an acid are preferred.
  • esters embraces derivatives of the compounds of formula (I), in which a carboxy group has been converted to an ester.
  • esters are preferred esters.
  • pharmaceutically acceptable esters furthermore embraces compounds of formula (I) in which hydroxy groups have been converted to the corresponding esters with inorganic or organic acids such as, nitric acid, sulphuric acid, phosphoric acid, citric acid, formic acid, maleic acid, acetic acid, succinic acid, tartaric acid, methanesulphonic acid, p-toluenesulphonic acid and the like, which are non toxic to living organisms.
  • R 1 is aryl which can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of lower-alkyl, hydro xy-lower-alkyl, lower-alkoxy, fluoro- lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, halogen, lower-alkoxy-lower-alkyl, cyano, NO 2 , lower-alkyl-SO, morpholinyl, NH 2 -SO 2 , N(H,lower-alkyl)-SO 2 , N(lower-alkyl) 2 -SO 2 , piperidinyl-SO 2 , pyrrolidinyl-SO 2 , hydroxy,
  • R 2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower- alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkinyl, lower-alkyl- SO 2 , fiuoro-lower-alkyl-SO 2 , tri(lower-alkyl)silyl-loweralkinyl, COOH, CONH 2 , NH 2 - SO 2 , COO-lower-alkyl, 6-oxo-l,4,5,6-tetrahydropyridazinyl, lower-alkoxy-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl) 2 , N(H,lower-alkyl)-SO 2 , N(lower-alkyl) 2 -SO 2 ,
  • R is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
  • R 4 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
  • the compounds of formula (I) can have one or more asymmetric C atoms and can therefore exist as an enantiomeric mixture, mixture of stereoisomers or as optically pure compounds.
  • R 1 is aryl which can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, halogen, lower-alkoxy-lower-alkyl, cyano, NO 2 , lower-alkyl-SO, morpholinyl, NH 2 -SO 2 , N(H,lower-alkyl)-SO 2 , N(lower-alkyl) 2 -SO 2 , hydroxy, COOH, COO-lower-alkyl, lower-alkyl-C(O)O, CO-lower-alkyl, CONH 2 , CON(H,lower-alkyl), CON(lower-alkyl) 2 , lower- alkyl-CO-NH, lower-alkyl-CO-N(lower-al
  • R 2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO 2 , tri(lower-alkyl)silyl- loweralkinyl, COOH, CONH 2 , NH 2 -SO 2 , COO-lower-alkyl, 6-oxo-l,4,5,6-tetrahydropyridazinyl, lower-alkoxy-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl) 2 , N(H,lower-alkyl)-SO 2 , N(lower-alkyl) 2 -SO 2 , lower-alkenyl, hydroxy, NO 2 , morpholinyl, tetrahydropyri
  • a preferred embodiment of the present invention relates to compounds of formula (I) as described above, wherein R 1 is phenyl which can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy and lower-alkyl-SO2, or wherein two substituents at adjacent positions of the phenyl are bound together to form a ring and said two bound substituents are dioxo-fluoro-lower-alyklene.
  • R 1 is phenyl which can optionally be substituted with fluoro-lower-alkyl, fluoro-lower-alkoxy or lower-alkyl-SO2.
  • R 1 is phenyl, 3-trifluoromethyl-phenyl, 3-trifluoromethoxy-phenyl, 3-methylsulfonyl-phenyl, 4- trifluoromethoxy-phenyl or 4-difluoromethyl-phenyl.
  • R 1 is phenyl which can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of hydro xy- lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro- lower-alkyl-SO2, halogen, cyano, N(H,lower-alkyl)-S ⁇ 2, N(lower-alkyl)2-SO2, piperidinyl-SO2, pyrrolidinyl-SO2, hydroxy, COO-lower-alkyl, COO-fluoro-lower-alkyl, CO-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl) 2 , lower-alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl) and N(lower-alkyl) 2 -lower-alkyl,
  • R 1 is phenyl which can optionally be substituted with hydroxy-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, cyano, hydroxy, COO-fluoro-lower-alkyl, CON(H,lower-alkyl), lower-alkyl-CO-NH or lower-alkyl- CO-N(Io was-alkyl).
  • R 1 is 3-trifluoromethoxy-phenyl, 3-methylsulfonyl-phenyl, 3-difluoromethoxy-phenyl, 4-trifluoromethoxy-phenyl, 3 -hydroxy-phenyl, 3-cyano-phenyl, 4- trifluoromethylsulfonyl-phenyl, 4-(2,2,2-trifluoroethoxy)-phenyl, 3-trifluoromethylsulfonyl- phenyl, 3-acetamide-phenyl, 3-(methylamide)-phenyl, 3-(N-methyl-acetamide)-phenyl, 3-(2- fluoro-ethoxycarbonyl)-phenyl or 3-(l -hydro xy-ethyl)-phenyl.
  • R 2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of pyridinyl and thiazolyl, which aryl or heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of halogen, cyano, lower- alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO2, tri(lower-alkyl)silyl- loweralkinyl, COOH, CONH 2 , NH 2 -SO 2 , COO-Io was-alkyl, 6-oxo-l ,4,5,6-tetrahydropyridazinyl, and phenyl which is optionally substituted with 1 to 3 substituents independently selected from halogen and lower-alkoxy, or wherein two substituents at adjacent positions of the aryl or heteroary
  • R 2 is aryl selected from the group consisting of phenyl and naphthyl or pyridinyl, which aryl or pyridinyl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, and lower-alkinyl, or wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene.
  • R 2 is phenyl, 2,5-difluoro-phenyl, 3-cyano-phenyl, 3-ethinyl-phenyl, 3-chloro-phenyl, 4-fluoro-phenyl, naphthyl, 3 -fluoro -phenyl, pyridin-4-yl, 3-methyl-pyridin-4-yl or 2,3-dihydro- benzo[l,4]dioxin-6-yl.
  • R 2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of quinolinyl, thiazolyl, pyridinyl, isoquinolinyl and isothiazolyl, which aryl or heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower- alkoxy, lower-alkyl-SO 2 , fluoro-lower-alkyl-SO 2 , NH 2 -SO 2 , N(lower-alkyl) 2 -SO 2 , hydroxy and lower-alkyl-CO-NH, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are di
  • R 2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of quinolinyl and pyridinyl, which aryl or heteroaryl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of halogen, cyano and lower-alkyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene.
  • R 2 is 2,4-difluoro-phenyl, 3-cyano- phenyl, 2,5-difluoro-phenyl, phenyl, 2-fluoro-phenyl, 3-chloro-phenyl, naphthyl, 2,3-dihydro- benzo[l,4]dioxin-6-yl, 6-fluoro-quinolin-4-yl, 2-methyl-pyridin-4-yl or quinolin-4-yl.
  • R 3 is hydrogen or lower-alkyl, particularly wherein R 3 is hydrogen.
  • Other preferred compounds of the present invention are those, wherein R 4 is hydrogen.
  • preferred compounds are the compounds of formula (I) described in the examples as individual compounds as well as pharmaceutically acceptable salts as well as pharmaceutically acceptable esters thereof. Furthermore, the substituents as found in the specific examples described below, individually constitute separate preferred embodiments of the present invention.
  • Preferred compounds of formula (I) are those selected from the group consisting of: 3-(2-Benzo[l,3]dio xo l-5-yl-2H-pyrazol-3-yl)-l -phenyl- lH-pyridazin-4-one, l-(4-Methoxy-phenyl)-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-[2-(2-Methoxy-phenyl)-2H-pyrazol-3-yl]-l -phenyl- lH-pyridazin-4-one, 1 -Phenyl-3-(2-o-tolyl-2H-pyrazol-3-yl)- lH-pyridazin-4-one,
  • Particularly preferred compounds of formula (I) are those selected from the group consisting of:
  • the compounds of formula (I) as described above do not comprise compounds selected from the group consisting of
  • the compounds of general formula (I) in this invention may be derivatised at functional groups to provide derivatives which are capable of conversion back to the parent compound in vivo.
  • the invention further relates to a process for the manufacture of compounds of formula (I) as defined above, which process comprises reacting a compound of formula (II)
  • reaction of a compound of formula (II) with a compound of the formula R 2 -NH-NH 2 can be carried out under conditions as described in the examples or under conditions well known to the person skilled in the art.
  • the reaction can be performed in solvents like DMF, acetic acid, ethanol, water, a mixture of ethanol with hydrochloric acid and the like at elevated temperatures e.g. at 100-200 0 C, at atmospheric pressure or elevated pressure.
  • the reaction can be performed at the reflux temperature of the respective solvent, or it can be performed at temperatures above boiling point by applying sealed tubes and using microwave irradiation conditions.
  • the present invention also relates to compounds of formula (I) as defined above, when prepared by a process as described above.
  • R 1 , R 2 , R 3 , and R 4 are as described above.
  • the pyridazinones of the general formula I of the present invention can be prepared starting from anilines of formula 2 (see scheme 1 below).
  • Anilines 2 are either commercially available or can be prepared from commercial precursors as e.g. from their corresponding nitro compounds by reductive methods.
  • Another option is to convert commercial anilines into the desired anilines 2 by standard methods known in the art.
  • Conversion of anilines 2 into their corresponding diazonium salts of general formula 3 can be done using standard methods known to those skilled in the art as e.g. treatment of the aniline in a mineral acid as e.g. hydrochloric acid, sulfuric acid or phosphoric acid with sodium nitrite.
  • the formed diazonium salts 3 can be used without any further purification for the condensation with suitable 1,3-diketones 4 resulting in diazo compounds of general formula 5.
  • This reaction is preferentially performed in an alcohol/water mixture at low temperatures (0-5 0 C) at almost neutral pH value (pH 5-6) which can be achieved by adding suitable basic salts like e.g. ammonium acetate.
  • suitable basic salts like e.g. ammonium acetate.
  • the diazo compounds of formula 5 can tautomerize to the corresponding hydrazones.
  • the pyridazin-4-one ring can be formed by reacting the intermediate diazo compounds of formula 5 with Ci -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N 5 N- dimethylformamide dimethyl acetal.
  • Ci -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N 5 N- dimethylformamide dimethyl acetal.
  • the reaction with N,N-dimethylformamide dimethyl acetal affords the pyridazinone intermediates of general formula 6 bearing a 1,3-diketone equivalent as side chain.
  • the side chain 1,3-diketone equivalent of pyridazinones 6 is used to form the final products of general formula I by condensing pyridazinones 6 with suitable hydrazines of general formula 7.
  • This reaction is usually performed in solvents like DMF, acetic acid, ethanol, water, a mixture of ethanol with hydrochloric acid and the like at elevated temperatures.
  • the reaction can be performed at the reflux temperature of the respective solvent, or it can be performed at temperatures above boiling point by applying sealed tubes and using microwave irradiation conditions.
  • Hydrazines of general formula 7 are commercially available or can be prepared by methods known to those skilled in the art. Straightforward synthetic methods starting from commercial precursors include the conversion of the corresponding anilines with sodium nitrite and tin-(II)-chloride and the treatment of hydrazine hydrate with aromatic/hetero aromatic halides.
  • the pyridazinones of the general formula I can also be prepared starting from anilines of formula 2 according to scheme 2 (see below).
  • Conversion of anilines 2 into their corresponding diazonium salts of general formula 3 can be done as described above.
  • the formed diazonium salts 3 can be used without any further purification for the condensation with suitable ketoesters 8 resulting in diazo compounds of general formula 9.
  • This reaction is preferentially performed in an alcohol/water mixture at low temperatures (0-5 0 C) at almost neutral pH value (pH 5-6) which can be achieved by adding suitable basic salts like e.g. ammonium acetate.
  • the diazo compounds of formula 9 can tautomerize to the corresponding hydrazones.
  • the pyridazin-4-one ring can be formed by reacting the intermediate diazo compounds of formula 9 with Ci -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N 5 N- dimethylformamide dimethyl acetal.
  • Ci -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N 5 N- dimethylformamide dimethyl acetal.
  • the reaction with N,N-dimethylformamide dimethyl acetal affords the pyridazinone intermediates of general formula 10 bearing an ester equivalent as side chain.
  • the ester side chain equivalent of pyridazinones 10 can be converted into a ketone most conveniently by functionalisation into a suitable activated species such as a Weinreb amide 11 therefore disposed towards displacement with an organometalic species, most commonly a Grignard reagent of general formula 12 in e.g.
  • Hydrazines of general formula 7 are commercially available or can be prepared by methods known to those skilled in the art. Straightforward synthetic methods starting from commercial precursors include the conversion of the corresponding anilines with sodium nitrite and tin-(II)-chloride and the treatment of hydrazine hydrate with aromatic/hetero aromatic halides.
  • substituents on the groups R 1 , R 2 , R 3 , and R 4 may not be inert to the conditions of the synthesis sequences described above and may require protection by standard protecting groups known in the art. For instance, an amino or hydroxyl group may be protected as an acetyl or tert.-butoxycarbonyl derivative. Alternatively, some substituents may be derived from others at the end of the reaction sequence. For instance, a compound of formula I may be synthesized bearing a nitro-, an ethoxycarbonyl, an ether, a sulfonic acid substituent on the groups R 1 , R 2 , R 3 , and R 4 , which substituents are finally converted to an amino- (e.g.
  • alkylamino- e.g. by reductive amination of an amino group
  • dialkylamino- e.g. by alkylation of an amino group, reduction of an appropriate acylamino group with lithium aluminum hydride or Eschweiler-Clarke reaction with an appropriate amino or alkylamino group
  • acylamino- by amide formation from an amino group e.g. with appropriate acyl halides or with appropriate carboxylic acids after their activation with CDI, EDC etc.
  • alkylsulfonylamino e.g.
  • the corresponding salts with acids can be obtained by standard methods known to the person skilled in the art, e.g. by dissolving the compound of formula(I) in a suitable solvent such as e.g. dioxan or THF and adding an appropriate amount of the corresponding acid.
  • a suitable solvent such as e.g. dioxan or THF
  • the products can usually be isolated by filtration or by chromatography.
  • the conversion of a compound of formula (I) into a pharmaceutically acceptable salt with a base can be carried out by treatment of such a compound with such a base.
  • One possible method to form such a salt is e.g. by addition of 1/n equivalents of a basic salt such as e.g.
  • a suitable solvent e.g. ethanol, ethanol-water mixture, tetrahydrofuran- water mixture
  • the conversion of compounds of formula (I) into pharmaceutically acceptable esters can be carried out e.g. by treatment of a suitable carboxy group present in the molecule with a suitable alcohol using e.g. a condensating reagent such as benzotriazol-1- yloxytris(dimethylamino)phosphonium hexafluorophosphate (BOP), N 5 N- dicylohexylcarbodiimide (DCC), N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC) or O-(l,2-dihydro-2-oxo-l-pyridyl)-N,N,N',N'- tetramethyluroniumtetrafluoroborate (TPTU), or by direct reaction with a suitable alcohol under acidic conditions, as for example in the presence of a strong mineral acid like hydrochloric acid, sulfuric acid and the like.
  • the compounds of formula (I) as well as all intermediate products can be prepared according to analogous methods or according to the methods set forth above. Starting materials are commercially available, known in the art or can be prepared by methods known in the art or in analogy thereto.
  • the novel compounds of the present invention have been found to inhibit PDElOA activity.
  • the compounds of the present invention can therefore be used, either alone or in combination with other drugs, for the treatment and/or prophylaxis of diseases which are modulated by PDElOA inhibitors.
  • These diseases include, but are not limited to, certain psychotic disorders such as schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder or substance-induced psychotic disorder, anxiety disorders such as panic disorder, obsessive/compulsive disorders, acute stress disorder or generalized anxiety disorder, drug addictions, movement disorders such as Parkinson's disease or restless leg syndrome, cognition deficiency disorders such as Alzheimer's disease or multi- infarct dementia, mood disorders such as depression or bipolar disorders, or neuropsychiatric conditions such as psychosis, attention-def ⁇ cit/hyperactivity disorder (ADHD) or related attentional disorders.
  • psychotic disorders such as schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder or substance-induced psychotic disorder, anxiety disorders such as panic disorder, obsessive/compulsive disorders, acute stress disorder or generalized anxiety disorder, drug addictions, movement disorders such as Parkinson's disease or restless leg syndrome, cognition deficiency disorders such as Alzheimer's disease or multi- infarc
  • diabetes and related disorders such as type 2 diabetes mellitus, neurodegenerative disorders such as Alzheimer's disease, Huntington's disease, Parkinson's disease, multiple sclerosis, stroke or spinal cord injury, solid tumors and hematological malignancies such as renal cell carcinoma or breast cancer.
  • the invention therefore also relates to pharmaceutical compositions comprising a compound as defined above and a pharmaceutically acceptable carrier and/or adjuvant.
  • the invention likewise embraces compounds as described above for use as therapeutically active substances, especially as therapeutically active substances for the treatment and/or prophylaxis of diseases which are modulated by PDElOA inhibitors, particularly as therapeutically active substances for the treatment and/or prophylaxis of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-def ⁇ cit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer.
  • the invention relates to a method for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-def ⁇ cit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer, which method comprises administering a compound as defined above to a human being or animal.
  • the invention also embraces the use of compounds as defined above for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-def ⁇ cit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer.
  • psychotic disorders schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, de
  • the invention also relates to the use of compounds as described above for the preparation of medicaments for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention- deficit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer.
  • Such medicaments comprise a compound as described above.
  • Prevention and/or treatment of schizophrenia is a preferred indication. Furthermore, prevention and/or treatment of positive, negative and/or cognitive symptoms associated with schizophrenia is preferred.
  • PDElO activity of the compounds of the present invention is determined using a Scintillation Proximity Assay (SPA) -based method similar to the one previously described (Fawcett, L. et al., ProcNatl Acad Sci USA (2000) 97(7):3702-3707).
  • SPA Scintillation Proximity Assay
  • PDElOAl and PDE10A2 are two splice variants of PDElOA. There are these 2 splice variants known, which differ in the N-terminal part of the protein. The catalytic domains of PDElOAl and PDE10A2 are identical. The assay for PDE10A2 described below is therefore also representative for PDElOAl and also for PDElOA in general.
  • the PDE10A2 assay was performed in a two step procedure in 96-well micro titer plates.
  • the reaction mixture of 80 ⁇ l contained 20 mM HEPES/ 10 mM MgCl 2 /0.05 mg/ml buffer (pH 7.5), 50 nM cGMP (Sigma) and 50 nM [ 3 H] -cGMP (GE Healthcare), 0.25 nM PDE10A2 with or without a specific test compound.
  • a range of concentrations of the potential inhibitor was used to generate data for calculating the concentration of inhibitor resulting in 50% of the effect (e.g. IC 5 O, the concentration of the competitor inhibiting PDE10A2 activity 50%). Non-specific activity was tested without the enzyme.
  • the reaction was initiated by addition of the substrate solution (cGMP and [ 3 H] -cGMP) and allowed to progress for 30 minutes at room temperature.
  • the reaction was terminated by transferring 50 ⁇ l of the reaction mixture into an OptiPlate (Perkin Elmer) containing 25 ⁇ l of YSi-SPA scintillation beads (GE Healthcare) in 18 mM zinc sulphate solution (stop reagent). After 1 h under shaking, the plate was centrifuged one minute at 1000 rpm to allow beads to settle. Afterwards, radioactive counts were measured on a Perkin Elmer TopCount Scintillation plate reader.
  • the PCR product was used in a BP recombination reaction with pDONR221 to generate pENTR Thm-PDE10A2(S449-D789) which was DNA sequence verified and then used in an LR recombination reaction with a Gateway modified version of pETl la.
  • the resulting expression vector, placT7.2 H6-(gwl)-Thm-PDE10A2(S449-D789) was DNA sequence confirmed and transformed into E. coli strain BL21(DE3) pLysS and recombinant protein was produced in TB medium at 20 0 C by induction to a final IPTG concentration of 0.5mM at an optical density of 1.0 at 600nm for 20 hours.
  • the protein was purified using sequential chromatography on Ni-NTA and HiTrapQ/HiTrapS. After thrombin digest at room temperature a HiTrapChelating/HiTrap Benzamindin chromatography removed impurities, uncleaved protein and thrombin. Final purification of PDE10A2(S449-D789) was performed on a Superdex 75 size exclusion chromatography equilibrated with 25 mM HEPES pH 8.4, 0.15 M NaCl. The yield of pure protein was 2 mg/liter of culture volume is relatively low. The purity of the protein was >95%, monomeric and monodisperse as shown by SDS-PAGE, HPLC and analytical ultracentrifugation.
  • the compounds according to formula (I) preferably have an IC50 value below 10 ⁇ M, preferably below 5 ⁇ M, more preferably below 1 ⁇ M.
  • the IC50 values are above 0.0 InM.
  • the following table shows data for some examples.
  • the compounds of formula I and/or their pharmaceutically acceptable salts can be used as medicaments, e.g. in the form of pharmaceutical preparations for enteral, parenteral or topical administration. They can be administered, for example, pero rally, e.g. in the form of tablets, coated tablets, dragees, hard and soft gelatine capsules, solutions, emulsions or suspensions, rectally, e.g. in the form of suppositories, parenterally, e.g. in the form of injection solutions or suspensions or infusion solutions, or topically, e.g. in the form of ointments, creams or oils. Oral administration is preferred.
  • the production of the pharmaceutical preparations can be effected in a manner which will be familiar to any person skilled in the art by bringing the described compounds of formula I and/or their pharmaceutically acceptable salts, optionally in combination with other therapeutically valuable substances, into a galenical administration form together with suitable, non-toxic, inert, therapeutically compatible solid or liquid carrier materials and, if desired, usual pharmaceutical adjuvants.
  • Suitable carrier materials are not only inorganic carrier materials, but also organic carrier materials.
  • lactose, corn starch or derivatives thereof, talc, stearic acid or its salts can be used as carrier materials for tablets, coated tablets, dragees and hard gelatine capsules.
  • Suitable carrier materials for soft gelatine capsules are, for example, vegetable oils, waxes, fats and semi-solid and liquid polyols (depending on the nature of the active ingredient no carriers might, however, be required in the case of soft gelatine capsules).
  • Suitable carrier materials for the production of solutions and syrups are, for example, water, polyols, sucrose, invert sugar and the like.
  • Suitable carrier materials for injection solutions are, for example, water, alcohols, polyols, glycerol and vegetable oils.
  • Suitable carrier materials for suppositories are, for example, natural or hardened oils, waxes, fats and semi-liquid or liquid polyols.
  • Suitable carrier materials for topical preparations are glycerides, semi- synthetic and synthetic glycerides, hydrogenated oils, liquid waxes, liquid paraffins, liquid fatty alcohols, sterols, polyethylene glycols and cellulose derivatives.
  • Usual stabilizers, preservatives, wetting and emulsifying agents, consistency- improving agents, flavour-improving agents, salts for varying the osmotic pressure, buffer substances, solubilizers, colorants and masking agents and antioxidants come into consideration as pharmaceutical adjuvants.
  • the dosage of the compounds of formula I can vary within wide limits depending on the disease to be controlled, the age and the individual condition of the patient and the mode of administration, and will, of course, be fitted to the individual requirements in each particular case. For adult patients a daily dosage of about 0.1 to 2000 mg, especially about 1 to 500 mg, comes into consideration. Depending on severity of the disease and the precise pharmacokinetic profile the compound could be administered with one or several daily dosage units, e.g. in 1 to 3 dosage units.
  • the pharmaceutical preparations conveniently contain about 0.1-500 mg, preferably 1- 200 mg, of a compound of formula I.
  • A-I 3-((E)-3-Dimethylamino-acryloyl)-l-phen ⁇ l-lH-pyridazin-4-one
  • a solution of aniline (5.0 g, 54 mmol) in IN HCl (100 ml) is cooled to 0-5 0 C and reacted with a solution of sodium nitrite (3.89 g, 56 mmol) in H 2 O (sulfination flask with mechanic stirrer). Stirring is continued for 30 min at 0-5 0 C (suspension of diazonium salt).
  • a solution of 2,4-pentadione (6.7 g ; 67 mmol) in EtOH (15 ml) and water (250 ml) is prepared and cooled to 0-5 0 C.
  • the pentadione solution is added to the suspension of the diazonium salt while vigorously stirring.
  • A-2 3-((E)-3-Dimethylamino-acryloyl)-l-(4-methoxyl-phenyl)-lH-pyridazin-4-one
  • starting material A- 2 was prepared starting from p-anisidine and 2,4-pentadione in 83 % yield for the two-step synthesis as amorphous material.
  • A-3 3-((£)-3-Dimethylamino-acryloyl)-l-(3-trifluoroniethyl-phenyl)-lH-pyridazin-4-one
  • starting material A- 3 was prepared starting from 3-trifluoromethylaniline and 2,4-pentadione in 77 % yield for the two-step synthesis as amorphous material.
  • A-4 3-((E)-3-Dimethylamino-acryloyl)-l-(3-ethyl-phenyl)-lH-pyridazin-4-one
  • starting material A- 4 was prepared starting from 3-ethylaniline and 2,4-pentadione in 95 % yield for the two-step synthesis as amorphous material.
  • starting material A- 5 was prepared starting from m-anisidine and 2,4-pentadione in 85 % yield for the two-step synthesis as amorphous material.
  • A-6 3-((£)-3-Dimethylamino-acryloyl)-l-(3-trifluoroniethoxy-phenyl)-lH-pyridazin-4-one
  • starting material A- 6 was prepared starting from 3-trifluoromethoxyaniline and 2,4-pentadione in 72 % yield for the two-step synthesis as amorphous material.
  • A-7 3-((£)-3-Dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4-one
  • starting material A- 7 was prepared starting from 3-methansulfonylaniline and 2,4-pentadione in 44 % yield for the two-step synthesis as amorphous material.
  • A-8 3-((£)-3-Dimethylamino-acryloyl)-l-(4-trifluoroniethoxy-phenyl)-lH-pyridazin-4-one
  • starting material A- 8 was prepared starting from 4-trifluoromethoxyaniline and 2,4-pentadione in 90 % yield for the two-step synthesis as amorphous material.
  • A-IO l-(3-Difluoroniethoxy-phenyl)-3-((E)-3-diniethylaniino-acryloyl)-lH-pyridazin-4-one
  • starting material A- 10 was prepared from 3-difluromethoxy-phenylamine and 2,4-pentadione in 90 % yield for the two-step synthesis as brown solid.
  • starting material A- 11 was prepared from 2,2-difluoro-benzo[l,3]dioxol-5-ylamine and 2,4-pentadione in 50 % yield for the two-step synthesis as brown solid.
  • A- 12 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-N,N-dimethyl- benzenesulfonamide
  • starting material A- 12 was prepared from 3-amino-N,N-dimethyl-benzenesulfonamide and 2,4-pentadione as amorphous material.
  • A- 13 3-((E)-3-Dimethylamino-acryloyl)-l-(3-fluoro-phenyl)-lH-pyridazin-4-one
  • starting material A- 13 was prepared from 3-fluoroaniline and 2,4-pentadione as amorphous material.
  • A- 14 l-Benzo[l,3ldioxol-4-yl-3-((E)-3-dimethylamino-acryloyl)-lH-pyridazin-4-one
  • A- 15 l-(2,2-Difluoro-benzo[l,3ldioxol-4-yl)-3-((E)-3-dimethylamino-acryloyl)-lH-pyridazin- 4-one
  • starting material A- 15 was prepared from 2,2-difluoro-benzo[l,3]dioxol-4-ylamine and 2,4-pentadione as amorphous material.
  • A- 16 3-((£)-3-Dimethylamino-acryloyl)-l-(4-niethansulfonyl-phenyl)-lH-pyridazin-4-one
  • starting material A- 16 was prepared starting from 4-methansulfonylaniline and 2,4-pentadione as amorphous material.
  • A- 17 3-((E)-3-Dimethylamino-acryloyl)- l-(3-hydroxyphenyl)-lH-pyridazin-4-one
  • starting material A- 17 was prepared from 3-aminophenol and 2,4-pentadione as amorphous material.
  • A- 18 l-(3-Bromo-phenyl)-3-((£)-3-dimethylamino-acryloyl)-lH-pyridazin-4-one
  • starting material A- 18 was prepared from 3-bromoaniline and 2,4-pentadione as amorphous material.
  • A- 19 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-benzonitrile
  • starting material A- 19 was prepared from 3-aminobenzonitrile and 2,4-pentadione as amorphous material.
  • starting material A- 20 was prepared from 3-amino-N,N-dimethyl-benzamide and 2,4-pentadione as amorphous material.
  • A-21 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-N,N-diethyl- benzenesulfonamide
  • starting material A- 21 was prepared from 3-amino-N,N-diethyl-benzenesulfonamide and 2,4-pentadione as amorphous material.
  • A-22 3-((£)-3-Dimethylamino-acryloyl)-l-(4-trifluoromethyl-phenyl)-lH-pyridazin-4-one
  • starting material A- 22 was prepared starting from 4-trifluoromethylaniline and 2,4-pentadione as amorphous material.
  • A-23 l-(3-Chloro-phenyl)-3-((£)-3-dimethylamino-acryloyl)-lH-pyridazin-4-one
  • starting material A- 23 was prepared from 3-chloroaniline and 2,4-pentadione as amorphous material.
  • starting material A- 25 was prepared from 3-dimethylaminomethyl-phenylamine and 2,4-pentadione as amorphous material.
  • A-26 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(piperidine-l-sulfonyl)-phenyll-lH-pyridazin-4- one
  • starting material A- 26 was prepared from 3-(piperidine-l-sulfonyl)-phenylamine and 2,4-pentadione as amorphous material.
  • A-27 3-((£)-3-Dimethylamino-acryloyl)-l-(4-trifluoromethansulfonyl-phenyl)-lH-pyridazin- 4-one
  • starting material A- 27 was prepared starting from 4-trifluoromethansulfonyl-phenylamine and 2,4-pentadione as amorphous material.
  • A-28 3-((E)-3-Dimethylamino-acryloyl)-l-(4-dimethylaminomethyl-phenyl)-lH-pyridazin-4- one
  • starting material A- 28 was prepared from 4-dimethylaminomethyl-phenylamine and 2,4-pentadione as amorphous material.
  • A-29 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(pyrrolidine-l-sulfonyl)-phenyll-lH-pyridazin- 4-one
  • starting material A- 29 was prepared from 3-(pyrrolidine-l-sulfonyl)-phenylamine and 2,4-pentadione as amorphous material.
  • starting material A- 30 was prepared from 4-amino-N-methyl-benzenesulfonamide and 2,4-pentadione as amorphous material.
  • A-31 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-N-methyl- benzenesulfonamide
  • starting material A- 31 was prepared from 3-amino-N-methyl-benzenesulfonamide and 2,4-pentadione as amorphous material.
  • A-32 3-((E)-3-Dimethylamino-acryloyl)-l-[4-(2,2,2-trifluoro-ethoxy)-phenyll-lH-pyridazin-4- one
  • starting material A- 32 was prepared from 4-(2,2,2-trifluoro-ethoxy)-phenylamine and 2,4-pentadione as amorphous material.
  • A-33 3-((£)-3-Dimethylamino-acryloyl)-l-(3-trifluoromethansulfonyl-phenyl)-lH-pyridazin- 4-one
  • starting material A- 33 was prepared starting from 3-trifluoromethansulfonyl-phenylamine and 2,4-pentadione as amorphous material.
  • A-34 N- ⁇ 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-phenyl ⁇ -acetamide
  • starting material A- 34 was prepared from N-(3-amino-phenyl)-acetamide and 2,4-pentadione as amorphous material.
  • A-35 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-N-methyl-benzamide
  • starting material A- 35 was prepared from 3-amino-N-methyl-benzamide and 2,4-pentadione as amorphous material.
  • A-36 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(l-hydroxy-ethyl)-phenyll-lH-pyridazin-4-one
  • starting material A- 36 was prepared from l-(3-amino-phenyl)-ethanol and 2,4-pentadione as amorphous material.
  • 3,4-methylenedioxyphenylhydrazine (0.136 g; 0.89 mmol) are dissolved in a sealed tube in acetic acid (4 ml) and irradiated at 180 0 C for 10 min. The solvent of the reaction mixture is removed and the crude product is purified by preparative HPLC yielding 0.80 g (30 %) of the final product.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4-methoxyl- phenyl) -lH-pyridazin-4-one (A-2) and phenylhydrazine according to the method described for Example 1 in 81 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 2-methoxy-phenylhydrazine x HCl according to the method described for Example 1 in 61 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and o-tolylhydrazine x HCl according to the method described for Example 1 in 55 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 3-(trifluoromethyl)-phenylhydrazine according to the method described for Example 1 in 58 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and 2,5-difluorophenylhydrazine according to the method described for Example 1 in 32 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and o-trifluoromethyl-phenylhydrazine according to the method described for Example 1 in 46 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and 2,5-dimethyl-phenylhydrazine x HCl according to the method described for Example 1 in 88 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 2,5-difluorophenylhydrazine according to the method described for Example 1 in 24 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and o-trifluoromethyl-phenylhydrazine according to the method described for Example 1 in 34 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 2,5-dimethyl-phenylhydrazine x HCl according to the method described for Example 1 in 74 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 2,5-dichlorophenylhydrazine according to the method described for Example 1 in 23 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 2-hydrazinopyridine according to the method described for Example 1 in 64 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for Example 1 in 59 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 4-hydrazinopyridine according to the method described for Example 1 in 11 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for Example 1 in 55 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-ethyl-phenyl)- lH-pyridazin-4-one (A-4) and phenylhydrazine according to the method described for Example 1 in 87 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-methoxy- phenyl)-lH-pyridazin-4-one (A-5) and phenylhydrazine according to the method described for Example 1 in 71 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and phenylhydrazine according to the method described for Example 1 in 81 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 4-(methylsulfonyl)phenylhydrazine according to the method described for Example 1 in 12 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-ethyl-phenyl)- lH-pyridazin-4-one (A-4) and 4-(methylsulfonyl)phenylhydrazine according to the method described for Example 1 in 50 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-ethyl-phenyl)- lH-pyridazin-4-one (A-4) and 4-hydrazinopyridine according to the method described for Example 1 in 47 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 3-bromophenylhydrazine according to the method described for Example 1 in 80 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 4-hydrazino-2-methylpyridine according to the method described for Example 1 in 37 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 2-chloro-4-hydrazinopyridine according to the method described for Example 1 in 9 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and phenylhydrazine according to the method described for Example 1 in 64 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and 4-hydrazinopyridine according to the method described for Example 1 in 16 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and 2-fluoro-phenylhydrazine according to the method described for Example 1 in 69 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for Example 1 in 18 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and phenylhydrazine according to the method described for Example 1 in 47 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifiuoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and phenylhydrazine according to the method described for Example 1 in 64 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 2-fluoro-phenylhydrazine according to the method described for Example 1 in 65 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 4-hydrazinopyridine according to the method described for Example 1 in 32 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for Example 1 in 21 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and 2-fluoro-phenylhydrazine according to the method described for Example 1 in 57 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 4-chloro-phenylhydrazine x HCl according to the method described for Example 1 in 51 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and p-tolylhydrazine x HCl according to the method described for Example 1 in 67 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and phenylhydrazine according to the method described for Example 1 in 10 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and 4-methoxy-phenylhydrazine x HCl according to the method described for Example 1 in 10 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and 3-chloro-phenylhydrazine x HCl according to the method described for Example 1 in 51 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and benzo[l,3]dioxol-5-yl-hydrazine
  • the product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and benzo[l,3]dioxol-5-yl-hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for Example 91 in 16 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and 3-hydrazino-benzonitrile according to the method described for Example 91 in 61 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and [4-(2-fluoro-4-methoxy-phenyl)- thiazol-2-yl] -hydrazine according to the method described for Example 91 in 41 % yield.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and [4-(2-methoxy-phenyl)-thiazol-2-yl]- hydrazine according to the method described for Example 91 in 21 % yield.
  • the product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and (2,3-dihydro-benzo[l,4]dioxin-6-yl)- hydrazine according to the method described for Example 91 in 52 % yield.
  • the product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and (3-fluoro-phenyl) -hydrazine
  • the product was obtained starting from l-(4-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-9) and (2,3-dihydro-benzo[l,4]dioxin-6-yl)- hydrazine according to the method described for Example 91 in 33 % yield.
  • the product was obtained starting from l-(4-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-9) and and (3-fluoro-phenyl) -hydrazine
  • the product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-I l) and (2,3-dihydro-benzo[l,4]dioxin-6-yl)- hydrazine according to the method described for Example 91 in 22 % yield.
  • the product was obtained starting from 3- [3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzenesulfonamide (A-12) and 3-fluoro-phenylhydrazine according to the method described for example 91.
  • the product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-I l) and 3-fluoro-phenylhydrazine according to the method described for example 91.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and 3,4-difluoro-phenylhydrazine according to the method described for example 91.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and 2,4-difluoro-phenylhydrazine according to the method described for example 43.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and benzo[l,3]dioxol-4-yl-hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
  • the product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzenesulfonamide (A-12) and benzo[l,3]dioxol-5-yl-hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
  • the product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzenesulfonamide (A-12) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for example 91.
  • the product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-fluoro-phenyl)- lH-pyridazin-4-one (A-13) and benzo[l,3]dioxol-5-yl-hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Psychiatry (AREA)
  • Diabetes (AREA)
  • Psychology (AREA)
  • Endocrinology (AREA)
  • Obesity (AREA)
  • Emergency Medicine (AREA)
  • Hospice & Palliative Care (AREA)
  • Hematology (AREA)
  • Addiction (AREA)
  • Pain & Pain Management (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Heterocyclic Carbon Compounds Containing A Hetero Ring Having Oxygen Or Sulfur (AREA)

Abstract

The present invention is concerned with novel pyridazinone derivatives of formula (I) wherein R1, R2, R3 and R4 are as defined in the description and in the claims, as well as physiologically acceptable salts and esters thereof. These compounds inhibit PDE10A and can be used as medicaments.

Description

PYRIDAZINONE DERIVATIVES
The invention is concerned with novel pyridazinone derivatives of formula (I)
Figure imgf000003_0001
wherein
R1 is aryl which can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of lower-alkyl, hydro xy-lower-alkyl, lower-alkoxy, fluoro- lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, halogen, lower-alkoxy- lower-alkyl, cyano, NO2, lower-alkyl-SO, morpholinyl, NH2-SO2,
N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, piperidinyl-SO2, pyrrolidinyl-SO2, hydroxy, COOH, COO-lower-alkyl, COO-fiuoro-lower-alkyl, lower-alkyl-C(O)O, CO-lower-alkyl, CONH2, CON(H,lower-alkyl), CON(Io wer-alkyl)2, lower-alkyl-CO-NH, lower-alkyl- CO-N(lower-alkyl), NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower-alkyl)-lower-alkyl, N(lower-alkyl)2-lower-alkyl, cycloalkyl, phenyloxy and phenyl, or wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower-alkylene, dioxo- fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower-alkylene, lower- alkylene-NH-lower-alkylene, lower-alkylene-N(lower alkyl)-lower-alkylene, NH-C(O)- lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower-alkylene-NH-C(O)-lower- alkylene, lower-alkylene-N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene, or C(O)-N(lower-alkyl)-lower-alkylene; R2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower- alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkinyl, lower-alkyl- SO2, fluoro-lower-alkyl-SO2, tri(lower-alkyl)silyl-loweralkinyl, COOH, CONH2, NH2- SO2, COO-Io wer-alkyl, 6-oxo-l,4,5,6-tetrahydropyridazinyl, lower-alkoxy- Io wer-alkyl,
CON(H,lower-alkyl), CON(lower-alkyl)2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, lower-alkenyl, hydroxy, NO2, morpholinyl, tetrahydropyridazinyl, piperidinyl, piperazinyl, (N-lower-alkyl)-piperazinyl, pyrrolidinyl, lower-alkyl-C(O)O, lower-alkyl- CO-NH, lower-alkyl-CO-N(lower-alkyl), imidazolyl, pyridinyl, CO-lower-alkyl, NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower-alkyl)-lower-alkyl,
N(lower-alkyl)2-lower-alkyl, cycloalkyl, phenyloxy and phenyl which is optionally substituted with 1 to 4 substituents independently selected from halogen, lower-alkoxy, Io wer-alkyl, fluoro-lower-alkyl, fluoro-lower-alkoxy, hydroxy and cyano, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower- alkylene, dioxo-fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower- alkylene, lower-alkylene-NH-lower-alkylene, lower-alkylene-N(lower alkyl)-lower- alkylene, NH-C(O)-lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower- alkylene-NH-C(O)-lower-alkylene, lower-alkylene -N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)-N(lower-alkyl)-lower-alkylene;
R3 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
R4 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
and pharmaceutically acceptable salts and esters thereof.
Further, the invention is concerned with a process for the manufacture of the above compounds, pharmaceutical preparations which contain such compounds as well as the use of these compounds for the production of pharmaceutical preparations. Schizophrenia is a progressive and devastating neurological disease characterized by episodic positive symptoms such as delusions, hallucinations, thought disorders and psychosis and persistent negative symptoms such as flattened affect, impaired attention and social withdrawal, and cognitive impairments (Lewis DA and Lieberman JA, Neuron, , 28:325-33, 2000). For decades research has focused on the "dopaminergic hyperactivity" hypothesis which has led to therapeutic interventions involving blockade of the dopaminergic system (Vandenberg RJ and Aubrey KR., Exp. Opin. Ther. Targets, 5(4): 507-518, 2001; Nakazato A and Okuyama S, et al, Exp. Opin. Ther. Patents, 10(1): 75-98, 2000). This pharmacological approach, besides ameliorating positive symptoms in schizophrenic patients, poorly addresses negative and cognitive symptoms which are the best predictors of functional outcome (Sharma T., BrJ. Psychiatry, 174(suppl. 28): 44-51, 1999). In addition, current antipsychotic treatment is associated with adverse effects like weight gain, extrapyramidal symptoms or effects on glucose and lipid metabolism, related to their unspecific pharmacology.
In conclusion there is still a need for developing new antipsychotics with improved efficacy and safety profile. A complementary model of schizophrenia was proposed in the mid- 1960' based upon the psychotomimetic action caused by the blockade of the glutamate system by compounds like phencyclidine (PCP) and related agents (ketamine) which are noncompetitive NMDA receptor antagonists. Interestingly, in healthy volunteers PCP-induced psychotomimetic action incorporates positive and negative symptoms as well as cognitive dysfunction, thus closely resembling schizophrenia in patients (Javitt DC et al., Biol. Psychiatry, 45: 668-679, 1999).
Cyclic nucleotides cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) are ubiquitous second messengers responsible for mediating the biological response of a variety of extracellular signals, including neurotransmitters, light and hormones. cAPM and cGMP regulate a variety of intracellular processes particularly in neurons of the central nervous system by activating cAMP- and cGMP-dependent kinases which then phosphorylate proteins involved in the regulation of synaptic transmission, neuronal differentiation and survival.
A crucial mechanism for controlling intracellular cyclic nucleotide levels and therefore cyclic nucleotide signaling is via hydrolysis of the 3',5'-phosphodiester bond by phosphodiesterases. Phosphodiesterases (PDEs) are a family of widely expressed enzymes encoded by 21 different genes in humans, with each gene encoding several splice variants (Beavo, J., Physiol. Rev. 1995, 75, 725-748; Conti, M., Jin, S.L., Prog. Nucleic Acid Res. MoI. Biol. 1999, 63, 1-38; Soderling, S.H., Beavo, J.A., Curr. Opin. Cell Biol. 2000,12, 174-179, Manallack, D.T. et al. J. Med.Chem. 2005, 48 (10), 3449-3462).
The PDE families differ in their substrate specificy for the cyclic nucleotides, their mechanism of regulation and their sensitivity to inhibitors. Moreover, they are differentially localized in the organism, among the cells of an organ and even within the cells. These differences lead to a differentiated involvement of the PDE families in the various physiological functions.
PDElOA is a dual substrate PDE encoded by a single gene as reported in 1999 by three separate research groups (Fujishige K., et al., Eur J Biochem (1999) 266(3):1118-1127, Soderling S.H., et al., ProcNatl Acad Sci USA (1999) 96(12):7071-7076, Loughney K., et al., Gene (1999) 234(1): 109-117). PDElOA is unique from other members of the multigene family with respect to amino acid sequence (779 aa), tissue-specific pattern of expression, affinity for cAMP and cGMP and the effect on PDE activity by specific and general inhibitors.
PDElOA has one of the most restricted distribution of any PDE family being primarily expressed in the brain particularly in the nucleus accumbens and the caudate putamen. Additionally thalamus, olfactory bulb, hippocampus and frontal cortex show moderate levels of PDElOA expression. All these brain areas have been suggested to be involved in the pathophysiology of schizophrenia and psychosis, suggesting a central role of PDElOA in this devastating mental illness. Outside the central nervous system PDElOA transcript expression is also observed in peripheral tissues like thyroid gland, pituitary gland, insulin secreting pancreatic cells and testes (Fujishige, K. et al., J. Biol. Chem. 1999, 274, 18438-18445, Sweet, L. (2005) WO 2005/012485). On the other hand expression of PDElOA protein has been observed only in enteric ganglia, in testis and epididdimal sperm (Coskran T. M, et al., J. Histochem. Cytochem. 2006, 54 (11), 1205-1213).
In the striatum both mRNA and protein are expressed only in the GABA (γ-aminobutyric acid)-containing medium spiny projection neurons making it an intriguing target for the treatment of diseases of the central nervous system (Fujishige, K. et al, Eur. J. Biochem. 1999, 266, 1118-1127; Seeger, T.F. et al., Brain Res. 2003, 985, 113-126). The striatal medium spiny neurons are the principal input site and first site for information integration in the basal ganglia circuit of the mammalian brain. The basal ganglia are a series of interconnected subcortical nuclei that integrate widespread cortical input with dopaminergic signaling to plan and execute relevant motor and cognitive patterns while suppressing unwanted or irrelevant patterns (Graybiel, A.M. Curr. Biol. 2000, 10, R509-R511 (2000).
Papaverine, a relatively specific PDElOA inhibitor, and PDElOA-knockout mice have been used to explore the physiology of this enzyme and the possible therapeutic utility of
PDElOA inhibition. Inhibition of this enzyme pharmacologically or through gene disruption causes a reduction in activity and a reduced response to psychomotor stimulants. Inhibition also reduces the conditioned avoidance response, a behavioural response that is predictive of clinical antipsychotic activity (Siuciak, J.A.; et al., Neuropharmacology 2006, 51 (2), 386-396; Siuciak, J.A.; et al., Neuropharmacology 2006, 57 (2), 374-385).
In addition PDElOA inhibition bears the potential to improve the negative and cognitive symptoms associated to schizophrenia. Indeed papaverine have been shown to attenuate the deficits in the extra-dimensional shift learning induced in rats by sub-chronic treatment with PCP, an animal paradigm of NMDA receptor hypofunction (Rodefer, J,S., et al., Eur. J. Neuroscience 2005, 2, : 1070- 1076). In addition increased social interaction in PDE10A2-deficient mice have been observed (Sano, H. J. Neurochem. 2008, 105, 546-556).
Diseases that can be treated with PDElOA inhibitors include, but are not limited to, diseases thought to be mediated in part by dysfunction of the basal ganglia, of other parts of the central nervous system and of other PDElOA expressing tissues. In particular, diseases can be treated, where inhibition of PDElOA can have therapeutic effects.
These diseases include, but are not limited to, certain psychotic disorders such as schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder or substance-induced psychotic disorder, anxiety disorders such as panic disorder, obsessive-compulsive disorder, acute stress disorder or generalized anxiety disorder, obsessive/compulsive disorders, drug addictions, movement disorders such as Parkinson's disease or restless leg syndrome, cognition deficiency disorders such as Alzheimer's disease or multi-infarct dementia, mood disorders such as depression or bipolar disorders, or neuropsychiatric conditions such as psychosis, attention-deficit/hyperactivity disorder (ADHD) or related attentional disorders.
The compounds of the present invention are also suitable for the treatment of diabetes and related disorders such as obesity by regulating the cAMP signaling system.
PDElOA inhibitors might also be useful in preventing neurons from undergoing apoptosis by raising cAMP and cGMP levels and, thus, might possess anti- inflammatory properties.
Neurodegenerative disorders treatable with PDElOA inhibitors include, but are not limited to, as
Alzheimer's disease, Huntington's disease, Parkinson's disease, multiple sclerosis, stroke or spinal cord injury.
The growth of cancer cells is inhibited by cAMP and cGMP. Thus by raising cAMP and cGMP, PDElOA inhibitors can also be used for the treatment of different solid tumors and hematological malignancies such as renal cell carcinoma or breast cancer.
Unless otherwise indicated, the following definitions are set forth to illustrate and define the meaning and scope of the various terms used to describe the invention herein.
In this specification the term "lower" is used to mean a group consisting of one to seven, preferably of one to four carbon atom(s).
The term "halogen" refers to fluorine, chlorine, bromine and iodine, with fluorine, chlorine and bromine being preferred.
The term "alkyl", alone or in combination with other groups, refers to a branched or straight-chain monovalent saturated aliphatic hydrocarbon radical of one to twenty carbon atoms, preferably one to sixteen carbon atoms, more preferably one to ten carbon atoms. Lower-alkyl groups as described below also are preferred alkyl groups. The term "lower-alkyl", alone or in combination with other groups, refers to a branched or straight-chain monovalent alkyl radical of one to seven carbon atoms, preferably one to four carbon atoms. This term is further exemplified by such radicals as methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, t-butyl and the like.
The term "alkenyl", alone or in combination with other groups, stands for a straight-chain or branched hydrocarbon residue comprising an olefinic bond and up to 20, preferably up to 16 carbon atoms. The term "lower-alkenyl" refers to a straight-chain or branched hydrocarbon residue comprising an olefinic bond and up to 7, preferably up to 4 carbon atoms, such as e.g. ethenyl or 2-propenyl.
The term "alkinyl", alone or in combination with other groups, stands for a straight-chain or branched hydrocarbon residue comprising a tripple bond and up to 20, preferably up to 16 carbon atoms. The term "lower-alkinyl" refers to a straight-chain or branched hydrocarbon residue comprising a tripple bond and up to 7, preferably up to 4 carbon atoms, such as e.g. ethinyl or 2-propinyl.
The term "lower-alkylene", alone or in combination with other groups, refers to a branched or straight chain divalent lower-alkyl radical. This term is further exemplified by such radicals as methylene, ethylene, propylene and the like. The term "dioxo- lower-alkylene" refers to the group -O-lower-alkylene-0-.
The term "fluoro-lower-alkylene", alone or in combination with other groups, refers to a branched or straight chain divalent fluoro-lower-alkyl radical. This term is further exemplified by such radicals as -CF2- and the like. The term "dioxo-fluoro-lower-alkylene" refers to the group -O-fluoro-lower-alkylene-O-.
The term "cycloalkyl" refers to a monovalent carbocyclic radical of 3 to 10 carbon atoms, preferably 3 to 6 carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.
The term "fluoro-lower-alkyl" refers to lower-alkyl groups which are mono- or multiply substituted with fluorine. Examples of fluoro-lower-alkyl groups are e.g. CFH2, CF2H, CF3, CF3CH2, CF3(CH2)2, (CF3)2CH and CF2H-CF2. The term "hydroxy-lower-alkyl" refers to a lower-alkyl group as defined above, which is substituted by 1 to 3 hydroxy groups. Examples of hydroxy-lower-alkyl groups are e.g. hydro xy- methyl, hydro xy-ethyl, hydroxy propyl, 3 -hydroxy-propyl, 2-hydroxy-propyl, 3-hydroxy-prop-2- yl, 2,3-dihydroxy-propyl and l,3-dihydroxy-prop-2-yl.
The term "alkoxy" refers to the group R'-O-, wherein R' is an alkyl. The term "lower- alkoxy" refers to the group R'-O-, wherein R' is a lower-alkyl.
The term "fluoro-lower-alkoxy" refers to the group R"-O-, wherein R" is fluoro-lower- alkyl. Examples of fluoro-lower-alkoxy groups are e.g. CFH2-O, CF2H-O, CF3-O, CF3CH2-O, CF3(CH2)2-O, (CFs)2CH-O, and CF2H-CF2-O.
The term "aryl", alone or in combination, relates to the phenyl or naphthyl group, preferably the phenyl group, which can optionally be substituted, unless specifically stated otherwise, by 1 to 5 , preferably 1 to 3, substituents, independently selected from the group consisting of halogen, hydroxy, amino, NO2, lower-alkyl, hydroxy-lower-alkyl, lower-alkoxy, carboxy, carboxy-lower-alkyl, H2NC(O), (H,lower-alkyl)NC(O), (lower-alkyl)2NC(O), fiuoro- lower-alkyl, lower-alkyl-SO2, lower-alkyl-SO2O, lower-alkyl-SO2-NH, lower-alkyl-SO2- N(lower-alkyl), H2NSO2, (H,lower-alkyl)NSO2, (lower-alkyl)2NSO2, cyano, heteroaryl, cycloalkyl, phenyl and phenyloxy. Preferred substituents can be halogen, lower-alkyl and lower- alkoxy. Furthermore, aryl groups can preferably be substituted as described in the description and claims below. Examples of aryl, wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo- lower-alkylene, dioxo-fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower-alkylene, lower-alkylene-NH-lower-alkylene, lower-alkylene-N(lower alkyl)-lower-alkylene, NH-C(O)- lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower-alkylene-NH-C(O)-lower-alkylene, lower-alkylene-N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)- N(lower-alkyl)-lower-alkylene are e.g. tetrahydronaphthaline, indane, benzocycloheptene, benzo[l,3]dioxole, 2,3-dihydro-benzo[l,4]dioxine, 3,4-dihydro-2H-benzo[b][l,4]dioxepine, 2,2- difluoro-benzo[l,3]dioxole, 2,3-dihydro-lH-indole, 2,3-dihydro-lH-isoindole, 1,3-dihydro- indol-2-one, l,3-dihydro-isoindol-2-one, 1,2,3,4-tetrahydroquinoline or 1,2,3,4- tetrahydroisoquinoline, preferably benzo[l,3]dioxole, 2,2-difluoro-benzo[l,3]dioxole or 2,3- dihydro-benzo[l,4]dioxine. The term "heteroaryl" refers to an aromatic 5 to 6 membered monocyclic ring or 9 to 10 membered bicyclic ring which can comprise 1, 2 or 3 atoms selected from nitrogen, oxygen and/or sulphur, such as furyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, thienyl, isoxazolyl, oxazolyl, oxadiazolyl, imidazolyl, pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, thiadiazolyl, benzo imidazolyl, indolyl, indazolyl, benzothiazolyl, benzo isothiazolyl, benzoxazolyl, benzoisoxazolyl, quinolinyl and isoquinolinyl. Preferred heteroaryl groups are thiazolyl, pyridinyl. Unless specifically stated otherwise, a heteroaryl group may optionally have a substitution pattern as described earlier in connection with the term "aryl". Furthermore, heteroaryl groups can preferably be substituted as described in the description and claims below. Preferred examples of heteroaryl, wherein two substituents at adjacent positions of the heteroaryl are bound together to form a ring are those wherein said two bound substituents are lower- alkylene, dioxo-lower-alkylene or dioxo-fluoro-lower-alyklene, e.g. 6,7-dihydro-5H- [2]pyrindine, 5,6,7,8-tetrahydroisoquinoline, 5,6,7,8-tetrahydroquinoline, [l,3]dioxolo[4,5- c]pyridine, 2,2-difluoro-[l,3]dioxolo[4,5-c]pyridine, 2,3-dihydro-[l,4]dioxino[2,3-c]pyridine, preferably 5,6,7,8-tetrahydroisoquinoline.
Compounds of formula (I) can form pharmaceutically acceptable acid addition salts. Examples of such pharmaceutically acceptable salts are salts of compounds of formula (I) with physiologically compatible mineral acids, such as hydrochloric acid, sulphuric acid, sulphurous acid or phosphoric acid; or with organic acids, such as methanesulphonic acid, p- toluenesulphonic acid, acetic acid, lactic acid, trifluoro acetic acid, citric acid, fumaric acid, maleic acid, tartaric acid, succinic acid or salicylic acid. The term "pharmaceutically acceptable salts" refers to such salts. Compounds of formula (I) which comprise an acidic group, such as e.g. a COOH group, can further form salts with bases. Examples of such salts are alkaline, earth- alkaline and ammonium salts such as e.g. Na-, K-, Ca- and trimethylammoniumsalt. The term "pharmaceutically acceptable salts" also refers to such salts. Salts obtained by the addition of an acid are preferred.
The term "pharmaceutically acceptable esters" embraces derivatives of the compounds of formula (I), in which a carboxy group has been converted to an ester. Lower-alkyl, hydroxy- lower-alkyl, lower-alkoxy-lower-alkyl, amino-lower-alkyl, mono- or di-lower-alkyl-amino- lower-alkyl, morpholino-lower-alkyl, pyrrolidino-lower-alkyl, piperidino-lower-alkyl, piperazino-lower-alkyl, lower-alkyl-piperazino-lower-alkyl and aralkyl esters are examples of suitable esters. The methyl, ethyl, propyl, butyl and benzyl esters are preferred esters. The term "pharmaceutically acceptable esters" furthermore embraces compounds of formula (I) in which hydroxy groups have been converted to the corresponding esters with inorganic or organic acids such as, nitric acid, sulphuric acid, phosphoric acid, citric acid, formic acid, maleic acid, acetic acid, succinic acid, tartaric acid, methanesulphonic acid, p-toluenesulphonic acid and the like, which are non toxic to living organisms.
In detail, the present invention relates to compounds of formula (I)
Figure imgf000013_0001
wherein
R1 is aryl which can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of lower-alkyl, hydro xy-lower-alkyl, lower-alkoxy, fluoro- lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, halogen, lower-alkoxy-lower-alkyl, cyano, NO2, lower-alkyl-SO, morpholinyl, NH2-SO2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, piperidinyl-SO2, pyrrolidinyl-SO2, hydroxy,
COOH, COO-lower-alkyl, COO-fiuoro-lower-alkyl, lower-alkyl-C(O)O, CO-lower-alkyl, CONH2, CON(H,lower-alkyl), CON(Io wer-alkyl)2, lower-alkyl-CO-NH, lower-alkyl- CO-N(lower-alkyl), NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower-alkyl)-lower-alkyl, N(lower-alkyl)2-lower-alkyl, cycloalkyl, phenyloxy and phenyl, or wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower-alkylene, dioxo- fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower-alkylene, lower- alkylene-NH-lower-alkylene, lower-alkylene-N(lower alkyl)-lower-alkylene, NH-C(O)- lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower-alkylene-NH-C(O)-lower- alkylene, lower-alkylene-N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)-N(lower-alkyl)-lower-alkylene;
R2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower- alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkinyl, lower-alkyl- SO2, fiuoro-lower-alkyl-SO2, tri(lower-alkyl)silyl-loweralkinyl, COOH, CONH2, NH2- SO2, COO-lower-alkyl, 6-oxo-l,4,5,6-tetrahydropyridazinyl, lower-alkoxy-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl)2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, lower-alkenyl, hydroxy, NO2, morpholinyl, tetrahydropyridazinyl, piperidinyl, piperazinyl, (N-lower-alkyl)-piperazinyl, pyrrolidinyl, lower-alkyl-C(O)O, lower-alkyl- CO-NH, lower-alkyl-CO-N(lower-alkyl), imidazolyl, pyridinyl, CO-lower-alkyl, NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower-alkyl)-lower-alkyl,
N(lower-alkyl)2-lower-alkyl, cycloalkyl, phenyloxy and phenyl which is optionally substituted with 1 to 4 substituents independently selected from halogen, lower-alkoxy, lower-alkyl, fluoro-lower-alkyl, fluoro-lower-alkoxy, hydroxy and cyano, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower- alkylene, dioxo-fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower- alkylene, lower-alkylene-NH-lower-alkylene, lower-alkylene-N(lower alkyl)-lower- alkylene, NH-C(O)-lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower- alkylene-NH-C(O)-lower-alkylene, lower-alkylene -N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-Io wer-alkylene or C(O)-N(Io wer-alkyl)-lower-alkylene;
R is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
R4 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
and pharmaceutically acceptable salts and esters thereof.
Compounds of formula (I) are individually preferred and physiologically acceptable salts thereof are individually preferred and pharmaceutically acceptable esters thereof are individually preferred, with the compounds of formula (I) being particularly preferred.
The compounds of formula (I) can have one or more asymmetric C atoms and can therefore exist as an enantiomeric mixture, mixture of stereoisomers or as optically pure compounds.
Preferred compounds of formula (I) as described above are those, wherein R1 is aryl which can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, halogen, lower-alkoxy-lower-alkyl, cyano, NO2, lower-alkyl-SO, morpholinyl, NH2-SO2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, hydroxy, COOH, COO-lower-alkyl, lower-alkyl-C(O)O, CO-lower-alkyl, CONH2, CON(H,lower-alkyl), CON(lower-alkyl)2, lower- alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl), NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2- lower-alkyl, N(H,lower-alkyl)-lower-alkyl, N(lower-alkyl)2-lower-alkyl, cycloalkyl, phenyloxy and phenyl, or wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower-alkylene, dioxo-fluoro-lower- alyklene, NH-lower-alkylene, N(lower alkyl)-lower-alkylene, lower-alkylene-NH-lower- alkylene, lower-alkylene-N(lower alkyl)-lower-alkylene, NH-C(O)-lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower-alkylene-NH-C(O)-lower-alkylene, lower-alkylene-N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)-N(lower-alkyl)-lower-alkylene; and
R2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO2, tri(lower-alkyl)silyl- loweralkinyl, COOH, CONH2, NH2-SO2, COO-lower-alkyl, 6-oxo-l,4,5,6-tetrahydropyridazinyl, lower-alkoxy-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl)2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, lower-alkenyl, hydroxy, NO2, morpholinyl, tetrahydropyridazinyl, piperidinyl, piperazinyl, (N-lower-alkyl)-piperazinyl, pyrrolidinyl, lower-alkyl-C(O)O, lower- alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl), imidazolyl, pyridinyl, CO-lower-alkyl, NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower-alkyl)-lower-alkyl, N(lower- alkyl)2-lower-alkyl, cycloalkyl, phenyloxy and phenyl which is optionally substituted with 1 to 4 substituents independently selected from halogen, lower-alkoxy, lower-alkyl, fluoro-lower-alkyl, fluoro-lower-alkoxy, hydroxy and cyano, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower-alkylene, dioxo- fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower-alkylene, lower-alkylene-NH- lower-alkylene, lower-alkylene-N(lower alkyl)-lower-alkylene, NH-C(O)-lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower-alkylene-NH-C(O)-lower-alkylene, lower-alkylene- N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)-N(lower-alkyl)-lower- alkylene.
A preferred embodiment of the present invention relates to compounds of formula (I) as described above, wherein R1 is phenyl which can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy and lower-alkyl-SO2, or wherein two substituents at adjacent positions of the phenyl are bound together to form a ring and said two bound substituents are dioxo-fluoro-lower-alyklene. Preferably, R1 is phenyl which can optionally be substituted with fluoro-lower-alkyl, fluoro-lower-alkoxy or lower-alkyl-SO2. More preferably, R1 is phenyl, 3-trifluoromethyl-phenyl, 3-trifluoromethoxy-phenyl, 3-methylsulfonyl-phenyl, 4- trifluoromethoxy-phenyl or 4-difluoromethyl-phenyl.
Further preferred compounds are those, wherein R1 is phenyl which can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of hydro xy- lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro- lower-alkyl-SO2, halogen, cyano, N(H,lower-alkyl)-Sθ2, N(lower-alkyl)2-SO2, piperidinyl-SO2, pyrrolidinyl-SO2, hydroxy, COO-lower-alkyl, COO-fluoro-lower-alkyl, CO-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl)2, lower-alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl) and N(lower-alkyl)2-lower-alkyl, or wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene or dioxo-fluoro-lower-alyklene. Preferably, R1 is phenyl which can optionally be substituted with hydroxy-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, cyano, hydroxy, COO-fluoro-lower-alkyl, CON(H,lower-alkyl), lower-alkyl-CO-NH or lower-alkyl- CO-N(Io wer-alkyl). More preferably, R1 is 3-trifluoromethoxy-phenyl, 3-methylsulfonyl-phenyl, 3-difluoromethoxy-phenyl, 4-trifluoromethoxy-phenyl, 3 -hydroxy-phenyl, 3-cyano-phenyl, 4- trifluoromethylsulfonyl-phenyl, 4-(2,2,2-trifluoroethoxy)-phenyl, 3-trifluoromethylsulfonyl- phenyl, 3-acetamide-phenyl, 3-(methylamide)-phenyl, 3-(N-methyl-acetamide)-phenyl, 3-(2- fluoro-ethoxycarbonyl)-phenyl or 3-(l -hydro xy-ethyl)-phenyl.
Other preferred compounds of the present invention are those, wherein R2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of pyridinyl and thiazolyl, which aryl or heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of halogen, cyano, lower- alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO2, tri(lower-alkyl)silyl- loweralkinyl, COOH, CONH2, NH2-SO2, COO-Io wer-alkyl, 6-oxo-l ,4,5,6-tetrahydropyridazinyl, and phenyl which is optionally substituted with 1 to 3 substituents independently selected from halogen and lower-alkoxy, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are lower-alkylene or dioxo-lower-alkylene. Preferably, R2 is aryl selected from the group consisting of phenyl and naphthyl or pyridinyl, which aryl or pyridinyl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, and lower-alkinyl, or wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene. More preferably, R2 is phenyl, 2,5-difluoro-phenyl, 3-cyano-phenyl, 3-ethinyl-phenyl, 3-chloro-phenyl, 4-fluoro-phenyl, naphthyl, 3 -fluoro -phenyl, pyridin-4-yl, 3-methyl-pyridin-4-yl or 2,3-dihydro- benzo[l,4]dioxin-6-yl.
Other preferred compounds of formula (I) as described above are those, wherein R2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of quinolinyl, thiazolyl, pyridinyl, isoquinolinyl and isothiazolyl, which aryl or heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower- alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, NH2-SO2, N(lower-alkyl)2-SO2, hydroxy and lower-alkyl-CO-NH, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene or dioxo-fluoro-lower-alyklene. Preferably, R2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of quinolinyl and pyridinyl, which aryl or heteroaryl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of halogen, cyano and lower-alkyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene. More preferably, R2 is 2,4-difluoro-phenyl, 3-cyano- phenyl, 2,5-difluoro-phenyl, phenyl, 2-fluoro-phenyl, 3-chloro-phenyl, naphthyl, 2,3-dihydro- benzo[l,4]dioxin-6-yl, 6-fluoro-quinolin-4-yl, 2-methyl-pyridin-4-yl or quinolin-4-yl. Another preferred embodiment of the present invention refers to compounds as defined above, wherein R3 is hydrogen or lower-alkyl, particularly wherein R3 is hydrogen. Other preferred compounds of the present invention are those, wherein R4 is hydrogen.
In particular, preferred compounds are the compounds of formula (I) described in the examples as individual compounds as well as pharmaceutically acceptable salts as well as pharmaceutically acceptable esters thereof. Furthermore, the substituents as found in the specific examples described below, individually constitute separate preferred embodiments of the present invention.
Preferred compounds of formula (I) are those selected from the group consisting of: 3-(2-Benzo[l,3]dio xo l-5-yl-2H-pyrazol-3-yl)-l -phenyl- lH-pyridazin-4-one, l-(4-Methoxy-phenyl)-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-[2-(2-Methoxy-phenyl)-2H-pyrazol-3-yl]-l -phenyl- lH-pyridazin-4-one, 1 -Phenyl-3-(2-o-tolyl-2H-pyrazol-3-yl)- lH-pyridazin-4-one,
1 -Phenyl-3 - [2-(3 -trifluoromethyl-phenyl)-2H-pyrazol-3 -yl] - 1 H-pyridazin-4-one,
3 - [2-(2,5 -Difluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethyl-phenyl)- 1 H-pyridazin-4-one,
1 -(3 -Trifluoromethyl-phenyl)-3 - [2-(2-trifluoromethyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 H-pyridazin-4- one, 3-[2-(2,5-Dimethyl-phenyl)-2H-pyrazol-3-yl]-l-(3-trifluoromethyl-phenyl)-lH-pyridazin-4-one, 3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]-l -phenyl- 1 H-pyridazin-4-one, l-Phenyl-3-[2-(2-trifluoromethyl-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3-[2-(2,5-Dimethyl-phenyl)-2H-pyrazol-3-yl]-l -phenyl- 1 H-pyridazin-4-one, 3 - [2-(2,5 -Dichloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -phenyl- 1 H-pyridazin-4-one, 1 -Phenyl-3 -(2-pyridin-2-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one,
3- {5-[4-Oxo- 1 -(3-trifluoromethyl-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
1 -Phenyl-3 -(2-pyridin-4-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one,
3-[5-(4-Oxo- 1 -phenyl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl] -benzonitrile, 1 -(3 -Ethyl-phenyl)-3-(2-phenyl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one,
1 -(3 -Methoxy-phenyl)-3 -(2 -phenyl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, l-Phenyl-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3 -[2-(4-Methanesulfonyl-phenyl)-2H-pyrazo 1-3 -yl]-l -phenyl- 1 H-pyridazin-4-one, l-(3-Ethyl-phenyl)-3-[2-(4-methanesulfonyl-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(3-Ethyl-phenyl)-3-(2-pyridin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-[2-(3-Bromo-phenyl)-2H-pyrazol-3-yl]-l -phenyl- lH-pyridazin-4-one, 3 - [2-(2-Methyl-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -phenyl- 1 H-pyridazin-4-one, 3-[2-(2-Chloro-pyridin-4-yl)-2H-pyrazol-3-yl]-l -phenyl- 1 H-pyridazin-4-one, 3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3 -(2-Pyridin-4-yl-2H-pyrazo 1-3 -yl)-l -(3 -trifluoromethoxy-phenyl)-l H-pyridazin-4-one, 3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, l-(3-Methanesulfonyl-phenyl)-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
1 -Phenyl-3 - [2-(3 -trimethylsilanylethynyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 H-pyridazin-4-one,
3-[2-(3-Ethynyl-phenyl)-2H-pyrazol-3-yl]-l -phenyl- 1 H-pyridazin-4-one,
3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3 -(2-Pyridin-4-yl-2H-pyrazo 1-3 -yl)-l -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3- {5-[4-Oxo- 1 -(4-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(3 -trifluoromethyl-phenyl)-l H-pyridazin-4-one, 3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yl]-l -phenyl- 1 H-pyridazin-4-one, l-Phenyl-3-(2-p-tolyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 3 - [2-(4-Methoxy-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(3-trifluoromethyl-phenyl)-lH-pyridazin-4-one, 3- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzamide, 3 -(2 -p-Tolyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
4- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -benzoic acid, 4- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzenesulfonamide,
3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yl]-l -(3-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l -(3-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3 - [2-(4-Fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3 - [2-(2,3 -Dimethyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one,
3 - [2-(3-Chloro-2-methyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one,
3 - [2-(2-Bromo-4-fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin- 4-one,
3 - [2-(3-Fluoro-2-methyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin- 4-one, 3 - [2-(3-Fluoro-4-methyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin- 4-one,
3- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -benzoic acid methyl ester, 3-[2-(5,6,7,8-Tetrahydro-isoquinolin- 1 -yl)-2H-pyrazol-3-yl]- 1 -(3-trifluoromethoxy-phenyl)- IH- pyridazin-4-one,
2- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - isonicotinic acid ethyl ester,
3 -(2-Pyridin-2-yl-2H-pyrazo 1-3 -yl)-l -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzamide, l-(3-Methanesulfonyl-phenyl)-3-(2-p-tolyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
4- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -benzoic acid,
4- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzenesulfonamide,
3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
2- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -benzoic acid, 3 -[2-(4-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(3 -methanesulfonyl-phenyl)-l H-pyridazin-4-one,
3-[2-(2,3-Dimethyl-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4- one,
3 - [2-(3-Chloro-2-methyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -methanesulfonyl-phenyl)- 1 H-pyridazin- 4-one,
3 - [2-(3-Fluoro-2-methyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -methanesulfonyl-phenyl)- 1 H-pyridazin-
4-one,
3 - [2-(3-Fluoro-4-methyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -methanesulfonyl-phenyl)- 1 H-pyridazin- 4-one,
3- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -benzoic acid methyl ester, l-(3-Methanesulfonyl-phenyl)-3-[2-(5,6,7,8-tetrahydro-isoquinolin-l-yl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one, 2- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -4,6- dimethyl-nicotinonitrile,
2- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - isonicotinic acid ethyl ester, l-(3-Methanesulfonyl-phenyl)-3-(2-pyridin-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 4- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3 - [2-(2,4-Difluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one,
3-{2-[4-(6-Oxo-l,4,5,6-tetrahydro-pyridazin-3-yl)-phenyl]-2H-pyrazol-3-yl}-l-(3- trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3 - [2-(2,3 -Dihydro-benzo [ 1 ,4] dioxin-6-yl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one,
3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)- 1 -(3-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l -(3-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]-l -(3-trifluoromethoxy-phenyl)- lH-pyridazin-4- one,
3 -[2-(4-Isopropyl-phenyl)-2H-pyrazo 1-3 -yl]-l -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH- pyridazin-4-one, 1 -(3-Methanesulfonyl-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
3 -[2-(4-Isopropyl-phenyl)-2H-pyrazo 1-3 -yl]-l -(3 -methanesulfonyl-phenyl)-! H-pyridazin-4-one, 3-(4-Ethyl-2-phenyl-2H-pyrazol-3-yl)-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
1 -(3 -Methanesulfonyl-phenyl)-3 - [2-(2-methyl-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 H-pyridazin-4- one, l-(3-Difluoromethoxy-phenyl)-3-(2-pyridin-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-(2-Benzo[l,3]dioxol-5-yl-2H-pyrazol-3-yl)-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4- one,
3 -(2-Benzo [ 1 ,3] dio xo 1-5 -yl-2H-pyrazo 1-3 -yl)- 1 -(3 -difluoromethoxy-phenyl)- 1 H-pyridazin-4- one,
3- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3- {2-[4-(2-Fluoro-4-methoxy-phenyl)-thiazol-2-yl]-2H-pyrazol-3-yl} - 1 -(3-methanesulfonyl- phenyl)- 1 H-pyridazin-4-one, l-(3-Methanesulfonyl-phenyl)-3-{2-[4-(2-methoxy-phenyl)-thiazol-2-yl]-2H-pyrazol-3-yl}-lH- pyridazin-4-one, l-(3-Difluoromethoxy-phenyl)-3-[2-(2,3-dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one, l-(3-Difluoromethoxy-phenyl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(4-Difluoromethoxy-phenyl)-3-[2-(2,3-dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one, l-(4-Difluoromethoxy-phenyl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, and l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(2,3-dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3- yl]-l H-pyridazin-4-one and pharmaceutically acceptable salts and esters thereof.
Particularly preferred compounds of formula (I) are those selected from the group consisting of:
3- {5-[4-Oxo- 1 -(3-trifluoromethyl-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, l-Phenyl-3-(2-pyridin-4-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one,
3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3 -(2-Pyridin-4-yl-2H-pyrazo 1-3 -yl)-l -(3 -trifluoromethoxy-phenyl)-l H-pyridazin-4-one, l-(3-Methanesulfonyl-phenyl)-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-[2-(3-Ethynyl-phenyl)-2H-pyrazol-3-yl]-l -phenyl- lH-pyridazin-4-one, 3 -(2-Pyridin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3- {5-[4-Oxo- 1 -(4-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, 3 -[2-(4-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(3 -trifluoromethoxy-phenyl)-l H-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one, 3 - [2-(2,3 -Dihydro-benzo [ 1 ,4] dioxin-6-yl)-2H-pyrazol-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one, 3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 1 -(3-Methanesulfonyl-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one, 3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one, l-(3-Methanesulfonyl-phenyl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4- one, 3- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, l-(4-Difluoromethoxy-phenyl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, and pharmaceutically acceptable salts and esters thereof.
Other preferred compounds of formula (I) as described above are those selected from the group consisting of
3- {3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N,N-dimethyl- benzenesulfonamide, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(3-fiuoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin- 4-one,
3-[2-(3,4-Difluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
3-[2-(2,4-Difluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
3-(2-Benzo[l,3]dioxol-4-yl-2H-pyrazol-3-yl)-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
3-[3-(2-Benzo[l,3]dioxol-5-yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin-l-yl]-N,N-dimethyl- benzenesulfonamide,
3- {3-[2-(3-Cyano-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N,N-dimethyl- benzenesulfonamide,
3-(2-Benzo[l,3]dioxol-5-yl-2H-pyrazol-3-yl)-l-(3-fluoro-phenyl)-lH-pyridazin-4-one, l-(3-Fluoro-phenyl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one,
3- {5-[ 1 -(3-Fluoro-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -benzonitrile, l-Benzo[l,3]dioxol-4-yl-3-(2-benzo[l,3]dioxol-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, l-Benzo[l,3]dioxol-4-yl-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3-[5-(l-Benzo[l,3]dioxol-4-yl-4-oxo-l,4-dihydro-pyridazin-3-yl)-pyrazol-l-yl]-benzonitrile,
3-[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4- one, l-(3-Difluoromethoxy-phenyl)-3-[2-(2,5-difluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(2,5-difluoro-phenyl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one,
3- {3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N,N-dimethyl- benzenesulfonamide,
3- {5-[ 1 -(2,2-Difluoro-benzo[ 1 ,3]dioxol-5-yl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, 3-[2-(2,2-Difluoro-benzo[ 1 ,3]dioxol-4-yl)-2H-pyrazol-3-yl]- 1 -(3-methanesulfonyl-phenyl)- IH- pyridazin-4-one, l-(3-Methanesulfonyl-phenyl)-3-(2-thiazol-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
1 -(3 -Methanesulfonyl-phenyl)-3 - [2-(3 -trifluoromethoxy-phenyl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one, 3-[2-(2,3-Dihydro-benzo[l,4]dioxin-5-yl)-2H-pyrazol-3-yl]-l -(3-methanesulfonyl-phenyl)- IH- pyridazin-4-one,
3 - [2-(2-Methyl-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one,
3 -(4-Ethyl-2-phenyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3-[2-(3-Methanesulfonyl-phenyl)-2H-pyrazol-3-yl]-l-(3-trifluoromethoxy-phenyl)-lH- pyridazin-4-one, l-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-
4-one, l-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-3-[2-(2,5-difiuoro-phenyl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one,
3- {5-[ 1 -(2,2-Difluoro-benzo[ 1 ,3]dioxol-4-yl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, l-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one,
3 - [2-(2-Methyl-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one,
N,N-Dimethyl-3- {3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} - benzenesulfonamide, l-(3-Fluoro-phenyl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l -(4-trifluoromethoxy-phenyl)- lH-pyridazin-4-one, 3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]- 1 -(4-trifluoromethoxy-phenyl)- lH-pyridazin-4-one,
3 - [2-(6-Fluoro-quino lin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one,
3 -[2-(4-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(4-trifluoromethoxy-phenyl)- lH-pyridazin-4-one,
4- {5-[4-Oxo- 1 -(4-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3 -(2-Pyridin-3-yl-2H-pyrazo 1-3 -yl)-l -(4-trifluoromethoxy-phenyl)- lH-pyridazin-4-one,
3 - [2-(3-Methanesulfonyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one,
1 -(4-Trifluoromethoxy-phenyl)-3 - [2-(3 -trifluoromethoxy-phenyl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one,
N,N-Dimethyl-3- {5-[4-oxo- 1 -(4-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol-
1 -yl} -benzenesulfonamide,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l -(4-trifluoromethoxy-phenyl)- lH-pyridazin-4-one,
3-[2-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-2H-pyrazol-3-yl]-l-(4-trifluoromethoxy-phenyl)-lH- pyridazin-4-one,
3-[2-(2,2-Difluoro-benzo[l,3]dio xo l-5-yl)-2H-pyrazol-3-yl]-l -(4-trifluoromethoxy-phenyl)- IH- pyridazin-4-one,
3 - [2-(3-Trifluoromethanesulfonyl-phenyl)-2H-pyrazol-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one, 3-[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4- one, l-(4-Difluoromethoxy-phenyl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4- one, 1 -(3 -Difluoromethoxy-phenyl)-3 - [2-(6-fluoro-quinolin-4-yl)-2H-pyrazo 1-3 -yl] - 1 H-pyridazin-4- one, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one, l-(4-Methanesulfonyl-phenyl)-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-[2-(4-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(4-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(4-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
4- {5-[ 1 -(4-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, 3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yl]- 1 -(4-methanesulfonyl-phenyl)- lH-pyridazin-4-one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(4-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
1 -(4-Methanesulfonyl-phenyl)-3 - [2-(4-trifluoromethoxy-phenyl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one,
1 -(3 -Trifluoromethoxy-phenyl)-3 - [2-(3 -trifluoromethoxy-phenyl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one,
N,N-Dimethyl-3- {5-[4-oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol-
1 -yl} -benzenesulfonamide,
3-[2-(2,2-Difluoro-benzo[l,3]dio xo l-4-yl)-2H-pyrazol-3-yl]-l -(3-trifluoromethoxy-phenyl)- IH- pyridazin-4-one, 3-[2-(2,2-Difluoro-benzo[l,3]dio xo l-5-yl)-2H-pyrazol-3-yl]-l -(3-trifluoromethoxy-phenyl)- IH- pyridazin-4-one,
3 - [2-(3-Trifluoromethanesulfonyl-phenyl)-2H-pyrazol-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one, l-(4-Difluoromethoxy-phenyl)-3-[2-(3-methanesulfonyl-phenyl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one,
1 -(4-Difluoromethoxy-phenyl)-3 - [2-(3 -trifluoromethoxy-phenyl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one,
3-[2-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-2H-pyrazol-3-yl]-l-(4-difluoromethoxy-phenyl)-lH- pyridazin-4-one, l-(4-Difluoromethoxy-phenyl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one,
1 -(3 -Difluoromethoxy-phenyl)-3 - [2-(3 -methanesulfonyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one,
1 -(3 -Difluoromethoxy-phenyl)-3 - [2-(3 -trifluoromethoxy-phenyl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one,
3-[2-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-2H-pyrazol-3-yl]-l-(3-difluoromethoxy-phenyl)-lH- pyridazin-4-one, l-(3-Difluoromethoxy-phenyl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(3-methanesulfonyl-phenyl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(2,2-difluoro-benzo[l,3]dioxol-4-yl)-2H-pyrazol-3- yl]-lH-pyridazin-4-one, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin- 4-one,
3 -[2-(4-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(3 -hydroxy-phenyl)- lH-pyridazin-4-one,
N-(3- {5-[4-Oxo- l-(4-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - phenyl)-acetamide,
3 - [2-(6-Fluoro-2-methyl-quino lin-4-yl)-2H-pyrazol-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one,
3 -(2-Quino lin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
N-(3- {5-[4-Oxo- 1 -(3 -trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - phenyl)-acetamide,
N-(3- {5-[ 1 -(3-Dimethylsulfamoyl-phenyl)-4-oxo-l ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - phenyl)-acetamide,
3 -[2-(4-Hydroxy-phenyl)-2H-pyrazo 1-3 -yl]-l -(3 -methanesulfonyl-phenyl)-l H-pyridazin-4-one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l -phenyl- 1 H-pyridazin-4-one,
3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -phenyl- 1 H-pyridazin-4-one,
3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)- 1 -phenyl- 1 H-pyridazin-4-one, 4- {5-[4-Oxo- 1 -(4-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzenesulfonamide,
3 -(2-Quino lin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3 -[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazo 1-3 -yl]-l -phenyl- 1 H-pyridazin-4-one,
3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)- 1 -(3 -trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 3 -[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazo 1-3 -yl]-l -(3 -trifluoromethyl-phenyl)- lH-pyridazin-4- one,
1 -(3-Bromo-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazol-3-yl)- 1 H-pyridazin-4-one, l-(4-Methanesulfonyl-phenyl)-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)-l-(4-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
3 - [2-(2-Chloro-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one,
3 - [2-(6-Fluoro-2-methyl-quino lin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one,
3- {3-[2-(6-Fluoro-2-methyl-quinolin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N ,N- dimethyl-benzenesulfonamide,
N,N-Dimethyl-3-[4-oxo-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-4H-pyridazin-l-yl]- benzenesulfonamide, l-(3-Methoxy-phenyl)-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-(3-methoxy-phenyl)-lH-pyridazin-4-one,
3-[2-(6-Fluoro-2-methyl-quinolin-4-yl)-2H-pyrazol-3-yl]-l-(3-methoxy-phenyl)-lH-pyridazin-4- one,
3 - [2-(2-Ethoxy-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one,
1 -(3-Methoxy-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazol-3-yl)- lH-pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(3-methoxy-phenyl)-lH- pyridazin-4-one,
3 -(2-Quino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 1 -(3 -Difluoromethoxy-phenyl)-3-(2-quino lin-5 -yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one,
3-[2-(2-Chloro-pyridin-4-yl)-2H-pyrazol-3-yl]-l-(3-difluoromethoxy-phenyl)-lH-pyridazin-4- one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(3-difluoromethoxy-phenyl)-lH-pyridazin-4-one,
3-[4-Oxo-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-4H-pyridazin-l-yl]-benzonitrile, 3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N,N-dimethyl- benzamide,
3- {3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N,N-dimethyl- benzamide,
N,N-Diethyl-3- {3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} - benzenesulfonamide,
3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethyl-phenyl)- 1 H-pyridazin-4-one,
3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l-(4-trifluoromethyl-phenyl)-l H-pyridazin-4-one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l -(4-trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 3 -(2-Quino lin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 3 -(2-Quino lin-8-yl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3-(2-o-Tolyl-2H-pyrazol-3-yl)-l-(4-trifluoromethyl-phenyl)-lH-pyridazin-4-one, 3- {5-[4-Oxo- 1 -(4-trifluoromethyl-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, l-(3-Chloro-phenyl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 1 -(3 -Chloro-phenyl)-3-[2-(3-chloro-phenyl)-2H-pyrazo 1-3 -yl]-l H-pyridazin-4-one, 3 - [2-(3-Methyl-isothiazo 1-5 -yl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin- 4-one, 1 -(3-Chloro-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one,
3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)- 1 -(4-trifluoromethyl-phenyl)- 1 H-pyridazin-4-one,
1 -(4-Chloro-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one,
3 - [2-(6-Chloro-quino lin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one, 3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3 -(2-Isoquino lin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3 -(2-Quino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, l-(4-Chloro-phenyl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(4-Chloro-phenyl)-3-[2-(3-chloro-phenyl)-2H-pyrazo 1-3 -yl]-l H-pyridazin-4-one, l-(3-Dimethylaminomethyl-phenyl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4- one,
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -[3-(piperidine- 1 -sulfonyl)-phenyl]- lH-pyridazin-4- one, 3 - [2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4- one,
1 -(4-Dimethylaminomethyl-phenyl)-3 - [2-(2-fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 H-pyridazin-4- one,
3 -(2-Isoquino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4- one, 3 -(2-Quino lin-5 -yl-2H-pyrazo 1-3 -yl)-l-(4-trifluoromethanesulfonyl-phenyl)-l H-pyridazin-4-one, 3-[2-(4-Chloro-naphthalen- 1 -yl)-2H-pyrazol-3-yl]- 1 -phenyl- 1 H-pyridazin-4-one, 3-[2-(4-Chloro-naphthalen- 1 -yl)-2H-pyrazol-3-yl]- 1 -(4-trifluoromethyl-phenyl)- lH-pyridazin-4- one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -[3 -(pyrrolidine- 1 -sulfonyl)-phenyl]- lH-pyridazin-4- one,
4- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N-methyl- benzenesulfonamide, 3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-(4-trifluoromethoxy-phenyl)-lH-pyridazin-4- one,
N,N-Diethyl-3-[4-oxo-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-4H-pyridazin-l-yl]- benzenesulfonamide,
3 -(2-Quino lin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4-one, 3-[2-(4-Chloro-naphthalen- 1 -yl)-2H-pyrazol-3-yl]- 1 -(4-chloro-phenyl)- 1 H-pyridazin-4-one,
3-[2-(4-Chloro-naphthalen- 1 -yl)-2H-pyrazol-3-yl]- 1 -(3 -chloro-phenyl)- 1 H-pyridazin-4-one,
N,N-Diethyl-3-[3-(2-isoquinolin-5-yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin-l-yl]- benzenesulfonamide,
3-(2-Isoquinolin-8-yl-2H-pyrazol-3-yl)-l-(4-trifluoromethoxy-phenyl)-lH-pyridazin-4-one, l-(4-Trifluoromethoxy-phenyl)-3-[2-(2-trifluoromethyl-pyridin-4-yl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one,
3-[3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin-l-yl]-benzonitrile,
3-{3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin-l-yl}-benzonitrile,
1 -[3 -(Pyrrolidine- 1 -sulfo nyl)-phenyl] -3 -(2-quinolin-5-yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one, 3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]- 1 -[3 -(pyrrolidine- 1 - sulfo nyl)-phenyl]- IH- pyridazin-4-one,
3-{3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin-l-yl}-N,N-diethyl- benzenesulfonamide,
3-{3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin-l-yl}-N-methyl- benzenesulfonamide,
3-[3-(2-Isoquinolin-8-yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin-l-yl]-N,N-dimethyl- benzenesulfonamide,
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4- one, 3-(2-Phenyl-2H-pyrazol-3-yl)-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4-one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4- one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4- one, 3-(2-Quinolin-4-yl-2H-pyrazol-3-yl)-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4-one,
3- {3-[2-(2-Methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -benzonitrile, 3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)- 1 -[3-(pyrrolidine- 1 -sulfonyl)-phenyl]- lH-pyridazin-4- one,
N-Methyl-3- {3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} - benzenesulfonamide,
3 - [3 -(2-Isoquino lin-5 -yl-2H-pyrazol-3 -yl)-4-oxo-4H-pyridazin- 1 -yl] -N-methyl- benzenesulfonamide, 3-[2-(6-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]- 1 -[3 -(pyrrolidine- 1 -sulfonyl)-phenyl]- IH- pyridazin-4-one,
1 -[3-(Piperidine- 1 -sulfonyl)-phenyl]-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)- lH-pyridazin-4-one,
3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)- 1 -[3-(piperidine- 1 -sulfonyl)-phenyl]- lH-pyridazin-4-one,
3-[2-(6-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]- 1 -[3-(piperidine- 1 -sulfonyl)-phenyl]- IH- pyridazin-4-one,
3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]- 1 -[3-(piperidine- 1 -sulfonyl)-phenyl]- IH- pyridazin-4-one,
N,N-Diethyl-3- {3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} - benzenesulfonamide, 3- {3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin-l-yl} -benzonitrile,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -[3-(pyrrolidine- 1 -sulfonyl)-phenyl]- lH-pyridazin-4- one,
4- {3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N-methyl- benzenesulfonamide, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -[3-(piperidine- 1 -sulfonyl)-phenyl]- lH-pyridazin-4- one,
3- {3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -benzonitrile,
3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]- 1 -[3-(pyrrolidine- 1 -sulfonyl)-phenyl]- IH- pyridazin-4-one, 1 -(3-Hydroxy-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazol-3-yl)- lH-pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(3-hydroxy-phenyl)-lH-pyridazin-
4-one,
3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4-one, 3 - [2-(3-Chloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-
4-one,
3 - [2-(2,3 -Dichloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H- pyridazin-4-one, 3-(2-Phenyl-2H-pyrazol-3-yl)-l-(3-trifluoromethanesulfonyl-phenyl)-lH-pyridazin-4-one,
3 - [2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4- one,
3 - [2-(3-Chloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-
4-one, 3- {5-[4-Oxo- 1 -(3-trifluoromethanesulfonyl-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3 - [2-(2,3 -Dichloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethanesulfonyl-phenyl)- 1 H- pyridazin-4-one,
3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -benzonitrile, 3 - {3 - [2-(3 -Chloro-phenyl)-2H-pyrazol-3 -yl] -4-oxo-4H-pyridazin- 1 -yl} -benzonitrile,
3 - [2-(3-Chloro-2-fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H- pyridazin-4-one,
3 - [2-(3-Chloro-2-fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethanesulfonyl-phenyl)- 1 H- pyridazin-4-one, 3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(3-fluoromethoxy-phenyl)-lH- pyridazin-4-one,
1 -(3-Fluoromethoxy-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazol-3-yl)- lH-pyridazin-4-one,
N-(3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -phenyl)-acetamide,
3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N-methyl-benzamide, N-(3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -phenyl)-N-methyl- acetamide,
3-[3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin- 1 -yl]-benzoic acid 2-fluoro-ethyl ester,
3-[3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin- 1 -yl]-benzoic acid 3-fluoro- propyl ester,
3-[3-(2-Naphthalen-l-yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin-l-yl]-benzoic acid methyl ester,
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l -[3-(I -hydro xy-ethyl)-phenyl]-lH-pyridazin-4-one, and l-(3-Acetyl-phenyl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, and pharmaceutically acceptable salts and esters thereof.
Other particularly preferred compounds of formula (I) as described above are those selected from the group consisting of
3-[2-(2,4-Difluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one, l-(3-Difluoromethoxy-phenyl)-3-[2-(2,5-difluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one,
3 - [2-(2-Methyl-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one, l-(3-Difluoromethoxy-phenyl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4- one,
3 -(2-Quino lin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(3-difluoromethoxy-phenyl)-lH-pyridazin-4-one,
3-[4-Oxo-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-4H-pyridazin-l-yl]-benzonitrile, 3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l-(4-trifluoromethanesulfonyl-phenyl)-l H-pyridazin-4- one,
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4- one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4- one,
3-(2-Quinolin-4-yl-2H-pyrazol-3-yl)-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(3-hydroxy-phenyl)-lH-pyridazin-
4-one,
3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4-one, 3- {5-[4-Oxo- 1 -(3-trifluoromethanesulfonyl-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3 - {3 - [2-(3 -Chloro-phenyl)-2H-pyrazol-3 -yl] -4-oxo-4H-pyridazin- 1 -yl} -benzonitrile,
N-(3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -phenyl)-acetamide,
3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N-methyl-benzamide, N-(3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -phenyl)-N-methyl- acetamide,
3-[3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin- 1 -yl]-benzoic acid 2-fluoro-ethyl ester, and 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l -[3-(I -hydro xy-ethyl)-phenyl]-lH-pyridazin-4-one, and pharmaceutically acceptable salts and esters thereof.
In one embodiment, the compounds of formula (I) as described above do not comprise compounds selected from the group consisting of
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-trifluoromethyl-phenyl)-lH-pyridazin-4-one, 3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yl]-l -phenyl- lH-pyridazin-4-one, l-Phenyl-3-(2-p-tolyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 3-[2-(4-Methoxy-phenyl)-2H-pyrazol-3-yl]- 1 -(3 -trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, and 3 - [2-(3-Chloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethyl-phenyl)- 1 H-pyridazin-4-one.
It will be appreciated that the compounds of general formula (I) in this invention may be derivatised at functional groups to provide derivatives which are capable of conversion back to the parent compound in vivo.
The invention further relates to a process for the manufacture of compounds of formula (I) as defined above, which process comprises reacting a compound of formula (II)
Figure imgf000035_0001
with a compound of the formula R2 -NH-NH2, wherein R1, R2, R3 and R4 are as defined above.
The reaction of a compound of formula (II) with a compound of the formula R2 -NH-NH2 can be carried out under conditions as described in the examples or under conditions well known to the person skilled in the art. For example, the reaction can be performed in solvents like DMF, acetic acid, ethanol, water, a mixture of ethanol with hydrochloric acid and the like at elevated temperatures e.g. at 100-2000C, at atmospheric pressure or elevated pressure. The reaction can be performed at the reflux temperature of the respective solvent, or it can be performed at temperatures above boiling point by applying sealed tubes and using microwave irradiation conditions.
The present invention also relates to compounds of formula (I) as defined above, when prepared by a process as described above.
The compounds of formula (II) and R2 -NH-NH2, can be prepared by methods known in the art or as described below or in analogy thereto. Unless otherwise indicated, R1, R2, R3, and R4 are as described above.
The pyridazinones of the general formula I of the present invention can be prepared starting from anilines of formula 2 (see scheme 1 below). Anilines 2 are either commercially available or can be prepared from commercial precursors as e.g. from their corresponding nitro compounds by reductive methods. Another option is to convert commercial anilines into the desired anilines 2 by standard methods known in the art. Conversion of anilines 2 into their corresponding diazonium salts of general formula 3 can be done using standard methods known to those skilled in the art as e.g. treatment of the aniline in a mineral acid as e.g. hydrochloric acid, sulfuric acid or phosphoric acid with sodium nitrite. The formed diazonium salts 3 can be used without any further purification for the condensation with suitable 1,3-diketones 4 resulting in diazo compounds of general formula 5. This reaction is preferentially performed in an alcohol/water mixture at low temperatures (0-5 0C) at almost neutral pH value (pH 5-6) which can be achieved by adding suitable basic salts like e.g. ammonium acetate. The diazo compounds of formula 5 can tautomerize to the corresponding hydrazones.
The pyridazin-4-one ring can be formed by reacting the intermediate diazo compounds of formula 5 with Ci -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N5N- dimethylformamide dimethyl acetal. The reaction with N,N-dimethylformamide dimethyl acetal affords the pyridazinone intermediates of general formula 6 bearing a 1,3-diketone equivalent as side chain.
The side chain 1,3-diketone equivalent of pyridazinones 6 is used to form the final products of general formula I by condensing pyridazinones 6 with suitable hydrazines of general formula 7. This reaction is usually performed in solvents like DMF, acetic acid, ethanol, water, a mixture of ethanol with hydrochloric acid and the like at elevated temperatures. The reaction can be performed at the reflux temperature of the respective solvent, or it can be performed at temperatures above boiling point by applying sealed tubes and using microwave irradiation conditions.
Hydrazines of general formula 7 are commercially available or can be prepared by methods known to those skilled in the art. Straightforward synthetic methods starting from commercial precursors include the conversion of the corresponding anilines with sodium nitrite and tin-(II)-chloride and the treatment of hydrazine hydrate with aromatic/hetero aromatic halides.
Figure imgf000037_0001
Scheme 1
The pyridazinones of the general formula I can also be prepared starting from anilines of formula 2 according to scheme 2 (see below).
Figure imgf000037_0002
Scheme 2
Conversion of anilines 2 into their corresponding diazonium salts of general formula 3 can be done as described above. The formed diazonium salts 3 can be used without any further purification for the condensation with suitable ketoesters 8 resulting in diazo compounds of general formula 9. This reaction is preferentially performed in an alcohol/water mixture at low temperatures (0-5 0C) at almost neutral pH value (pH 5-6) which can be achieved by adding suitable basic salts like e.g. ammonium acetate. The diazo compounds of formula 9 can tautomerize to the corresponding hydrazones.
The pyridazin-4-one ring can be formed by reacting the intermediate diazo compounds of formula 9 with Ci -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N5N- dimethylformamide dimethyl acetal. The reaction with N,N-dimethylformamide dimethyl acetal affords the pyridazinone intermediates of general formula 10 bearing an ester equivalent as side chain. The ester side chain equivalent of pyridazinones 10 can be converted into a ketone most conveniently by functionalisation into a suitable activated species such as a Weinreb amide 11 therefore disposed towards displacement with an organometalic species, most commonly a Grignard reagent of general formula 12 in e.g. a non protic solvent such as THF or hexane to give the corresponding ketone 13. This can be again reacted with Ci -equivalents like e.g. formaldehyde, N,N-dimethylformamide or N,N-dimethylformamide dimethyl acetal. The reaction with N,N-dimethylformamide dimethyl acetal affords the diketone equivalent of general formula 14 which is used to form the final products of general formula I by condensing with suitable hydrazines of general formula 7. This reaction is usually performed in solvents like DMF, acetic acid, ethanol, water, a mixture of ethanol with hydrochloric acid and the like at elevated temperatures. The reaction can be performed at the reflux temperature of the respective solvent, or it can be performed at temperatures above boiling point by applying sealed tubes and using microwave irradiation conditions.
Hydrazines of general formula 7 are commercially available or can be prepared by methods known to those skilled in the art. Straightforward synthetic methods starting from commercial precursors include the conversion of the corresponding anilines with sodium nitrite and tin-(II)-chloride and the treatment of hydrazine hydrate with aromatic/hetero aromatic halides.
Certain substituents on the groups R1, R2, R3, and R4 may not be inert to the conditions of the synthesis sequences described above and may require protection by standard protecting groups known in the art. For instance, an amino or hydroxyl group may be protected as an acetyl or tert.-butoxycarbonyl derivative. Alternatively, some substituents may be derived from others at the end of the reaction sequence. For instance, a compound of formula I may be synthesized bearing a nitro-, an ethoxycarbonyl, an ether, a sulfonic acid substituent on the groups R1, R2, R3, and R4, which substituents are finally converted to an amino- (e.g. by reduction of a nitro group or cleavage of a suitable amino protective group (e.g. removal of a Boc group with TFA)), alkylamino- (e.g. by reductive amination of an amino group), dialkylamino- (e.g. by alkylation of an amino group, reduction of an appropriate acylamino group with lithium aluminum hydride or Eschweiler-Clarke reaction with an appropriate amino or alkylamino group), acylamino- (by amide formation from an amino group e.g. with appropriate acyl halides or with appropriate carboxylic acids after their activation with CDI, EDC etc.), alkylsulfonylamino (e.g. by reaction of an amino group with sulfonyl chlorides), arylsulfonylamino substituent (e.g. by reaction of an amino group with sulfonyl chlorides), hydroxyl- (by cleavage of a suitable hydroxy protective group (e.g. hydro geno lytic removal of a benzyl ether or oxidative cleavage of a p-methoxy benzyl ether), ether- (e.g. by Williamson's ether synthesis from a hydroxyl group) or to a carboxamide substituent (e.g. by amide formation from a carboxylic acid group with appropriate amines after activation of the carboxylic acid group with CDI, EDC etc. or conversion to an acyl chloride), or to a sulfonamide substituent by standard procedures.
The corresponding salts with acids can be obtained by standard methods known to the person skilled in the art, e.g. by dissolving the compound of formula(I) in a suitable solvent such as e.g. dioxan or THF and adding an appropriate amount of the corresponding acid. The products can usually be isolated by filtration or by chromatography. The conversion of a compound of formula (I) into a pharmaceutically acceptable salt with a base can be carried out by treatment of such a compound with such a base. One possible method to form such a salt is e.g. by addition of 1/n equivalents of a basic salt such as e.g. M(OH)n, wherein M = metal or ammonium cation and n = number of hydroxide anions, to a solution of the compound in a suitable solvent (e.g. ethanol, ethanol-water mixture, tetrahydrofuran- water mixture) and to remove the solvent by evaporation or lyophilisation.
The conversion of compounds of formula (I) into pharmaceutically acceptable esters can be carried out e.g. by treatment of a suitable carboxy group present in the molecule with a suitable alcohol using e.g. a condensating reagent such as benzotriazol-1- yloxytris(dimethylamino)phosphonium hexafluorophosphate (BOP), N5N- dicylohexylcarbodiimide (DCC), N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC) or O-(l,2-dihydro-2-oxo-l-pyridyl)-N,N,N',N'- tetramethyluroniumtetrafluoroborate (TPTU), or by direct reaction with a suitable alcohol under acidic conditions, as for example in the presence of a strong mineral acid like hydrochloric acid, sulfuric acid and the like. Compounds having a hydroxyl group can be converted to esters with suitable acids by analogous methods.
Insofar as their preparation is not described in the examples, the compounds of formula (I) as well as all intermediate products can be prepared according to analogous methods or according to the methods set forth above. Starting materials are commercially available, known in the art or can be prepared by methods known in the art or in analogy thereto. As described above, the novel compounds of the present invention have been found to inhibit PDElOA activity. The compounds of the present invention can therefore be used, either alone or in combination with other drugs, for the treatment and/or prophylaxis of diseases which are modulated by PDElOA inhibitors. These diseases include, but are not limited to, certain psychotic disorders such as schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder or substance-induced psychotic disorder, anxiety disorders such as panic disorder, obsessive/compulsive disorders, acute stress disorder or generalized anxiety disorder, drug addictions, movement disorders such as Parkinson's disease or restless leg syndrome, cognition deficiency disorders such as Alzheimer's disease or multi- infarct dementia, mood disorders such as depression or bipolar disorders, or neuropsychiatric conditions such as psychosis, attention-defϊcit/hyperactivity disorder (ADHD) or related attentional disorders. Other disorders are diabetes and related disorders, such as type 2 diabetes mellitus, neurodegenerative disorders such as Alzheimer's disease, Huntington's disease, Parkinson's disease, multiple sclerosis, stroke or spinal cord injury, solid tumors and hematological malignancies such as renal cell carcinoma or breast cancer.
The invention therefore also relates to pharmaceutical compositions comprising a compound as defined above and a pharmaceutically acceptable carrier and/or adjuvant.
The invention likewise embraces compounds as described above for use as therapeutically active substances, especially as therapeutically active substances for the treatment and/or prophylaxis of diseases which are modulated by PDElOA inhibitors, particularly as therapeutically active substances for the treatment and/or prophylaxis of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-defϊcit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer. In another preferred embodiment, the invention relates to a method for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-defϊcit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer, which method comprises administering a compound as defined above to a human being or animal.
The invention also embraces the use of compounds as defined above for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-defϊcit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer.
The invention also relates to the use of compounds as described above for the preparation of medicaments for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention- deficit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer. Such medicaments comprise a compound as described above.
Prevention and/or treatment of schizophrenia is a preferred indication. Furthermore, prevention and/or treatment of positive, negative and/or cognitive symptoms associated with schizophrenia is preferred.
The following tests were carried out in order to determine the activity of the compounds of the present invention. PDElO activity of the compounds of the present invention is determined using a Scintillation Proximity Assay (SPA) -based method similar to the one previously described (Fawcett, L. et al., ProcNatl Acad Sci USA (2000) 97(7):3702-3707).
PDElOAl and PDE10A2 are two splice variants of PDElOA. There are these 2 splice variants known, which differ in the N-terminal part of the protein. The catalytic domains of PDElOAl and PDE10A2 are identical. The assay for PDE10A2 described below is therefore also representative for PDElOAl and also for PDElOA in general.
The PDE10A2 assay was performed in a two step procedure in 96-well micro titer plates. The reaction mixture of 80 μl contained 20 mM HEPES/ 10 mM MgCl2/0.05 mg/ml buffer (pH 7.5), 50 nM cGMP (Sigma) and 50 nM [3H] -cGMP (GE Healthcare), 0.25 nM PDE10A2 with or without a specific test compound. A range of concentrations of the potential inhibitor was used to generate data for calculating the concentration of inhibitor resulting in 50% of the effect (e.g. IC5O, the concentration of the competitor inhibiting PDE10A2 activity 50%). Non-specific activity was tested without the enzyme. The reaction was initiated by addition of the substrate solution (cGMP and [3H] -cGMP) and allowed to progress for 30 minutes at room temperature. The reaction was terminated by transferring 50 μl of the reaction mixture into an OptiPlate (Perkin Elmer) containing 25 μl of YSi-SPA scintillation beads (GE Healthcare) in 18 mM zinc sulphate solution (stop reagent). After 1 h under shaking, the plate was centrifuged one minute at 1000 rpm to allow beads to settle. Afterwards, radioactive counts were measured on a Perkin Elmer TopCount Scintillation plate reader.
The catalytic domain of human PDE10A2, residues serine 449 to aspartate 789, was amplified by PCR using cDNA (Origene) and the oligonucleotides 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGTΛCCTΛGΛGGΛTCΛAGCATTTGTACTT CAGAAG-3' (with AttBl recombination site in bold and thrombin protease cleavage site in italics) and 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCAATCTTCAGATGCAGCTG- 3' (with AttBl recombination site in bold) which conferred Gateway recombination sites. The PCR product was used in a BP recombination reaction with pDONR221 to generate pENTR Thm-PDE10A2(S449-D789) which was DNA sequence verified and then used in an LR recombination reaction with a Gateway modified version of pETl la. The resulting expression vector, placT7.2 H6-(gwl)-Thm-PDE10A2(S449-D789) was DNA sequence confirmed and transformed into E. coli strain BL21(DE3) pLysS and recombinant protein was produced in TB medium at 200C by induction to a final IPTG concentration of 0.5mM at an optical density of 1.0 at 600nm for 20 hours. About 30% of the protein was in the soluble fraction of the cell homogenate. The protein was purified using sequential chromatography on Ni-NTA and HiTrapQ/HiTrapS. After thrombin digest at room temperature a HiTrapChelating/HiTrap Benzamindin chromatography removed impurities, uncleaved protein and thrombin. Final purification of PDE10A2(S449-D789) was performed on a Superdex 75 size exclusion chromatography equilibrated with 25 mM HEPES pH 8.4, 0.15 M NaCl. The yield of pure protein was 2 mg/liter of culture volume is relatively low. The purity of the protein was >95%, monomeric and monodisperse as shown by SDS-PAGE, HPLC and analytical ultracentrifugation.
The compounds according to formula (I) preferably have an IC50 value below 10 μM, preferably below 5 μM, more preferably below 1 μM. Preferably, the IC50 values are above 0.0 InM. The following table shows data for some examples.
Figure imgf000044_0001
Figure imgf000045_0001
Figure imgf000046_0001
Figure imgf000047_0001
The compounds of formula I and/or their pharmaceutically acceptable salts can be used as medicaments, e.g. in the form of pharmaceutical preparations for enteral, parenteral or topical administration. They can be administered, for example, pero rally, e.g. in the form of tablets, coated tablets, dragees, hard and soft gelatine capsules, solutions, emulsions or suspensions, rectally, e.g. in the form of suppositories, parenterally, e.g. in the form of injection solutions or suspensions or infusion solutions, or topically, e.g. in the form of ointments, creams or oils. Oral administration is preferred.
The production of the pharmaceutical preparations can be effected in a manner which will be familiar to any person skilled in the art by bringing the described compounds of formula I and/or their pharmaceutically acceptable salts, optionally in combination with other therapeutically valuable substances, into a galenical administration form together with suitable, non-toxic, inert, therapeutically compatible solid or liquid carrier materials and, if desired, usual pharmaceutical adjuvants.
Suitable carrier materials are not only inorganic carrier materials, but also organic carrier materials. Thus, for example, lactose, corn starch or derivatives thereof, talc, stearic acid or its salts can be used as carrier materials for tablets, coated tablets, dragees and hard gelatine capsules. Suitable carrier materials for soft gelatine capsules are, for example, vegetable oils, waxes, fats and semi-solid and liquid polyols (depending on the nature of the active ingredient no carriers might, however, be required in the case of soft gelatine capsules). Suitable carrier materials for the production of solutions and syrups are, for example, water, polyols, sucrose, invert sugar and the like. Suitable carrier materials for injection solutions are, for example, water, alcohols, polyols, glycerol and vegetable oils. Suitable carrier materials for suppositories are, for example, natural or hardened oils, waxes, fats and semi-liquid or liquid polyols. Suitable carrier materials for topical preparations are glycerides, semi- synthetic and synthetic glycerides, hydrogenated oils, liquid waxes, liquid paraffins, liquid fatty alcohols, sterols, polyethylene glycols and cellulose derivatives.
Usual stabilizers, preservatives, wetting and emulsifying agents, consistency- improving agents, flavour-improving agents, salts for varying the osmotic pressure, buffer substances, solubilizers, colorants and masking agents and antioxidants come into consideration as pharmaceutical adjuvants. The dosage of the compounds of formula I can vary within wide limits depending on the disease to be controlled, the age and the individual condition of the patient and the mode of administration, and will, of course, be fitted to the individual requirements in each particular case. For adult patients a daily dosage of about 0.1 to 2000 mg, especially about 1 to 500 mg, comes into consideration. Depending on severity of the disease and the precise pharmacokinetic profile the compound could be administered with one or several daily dosage units, e.g. in 1 to 3 dosage units.
The pharmaceutical preparations conveniently contain about 0.1-500 mg, preferably 1- 200 mg, of a compound of formula I.
The following examples serve to illustrate the present invention in more detail. They are, however, not intended to limit its scope in any manner.
Examples A. Starting materials:
A-I: 3-((E)-3-Dimethylamino-acryloyl)-l-phenγl-lH-pyridazin-4-one
Figure imgf000050_0001
a) 3-Phenylazo-pentane-2,4-dione
A solution of aniline (5.0 g, 54 mmol) in IN HCl (100 ml) is cooled to 0-5 0C and reacted with a solution of sodium nitrite (3.89 g, 56 mmol) in H2O (sulfination flask with mechanic stirrer). Stirring is continued for 30 min at 0-5 0C (suspension of diazonium salt). In parallel, a solution of 2,4-pentadione (6.7 g ; 67 mmol) in EtOH (15 ml) and water (250 ml) is prepared and cooled to 0-5 0C. The pentadione solution is added to the suspension of the diazonium salt while vigorously stirring. After completion, NH4OAc is added until the pH reaches 5-6. The creamy yellow suspension is stirred for another 3 h at the same temperature. The solid material is filtered, washed with water, transferred into a flask and dried. Residual water can be removed with either ethyl acetate or acetone (in this case better) yielding 10.4 g (95 %) of the desired product.
DC: Rf = 0.4 (EE/heptane = 1:3)
b) 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH-pyridazin-4-one
3-Phenylazo-pentane-2,4-dione (10.4 g; 51 mmol) is dissolved in N,N-dimethylformamide dimethyl acetal (50 ml) and heated at 110 0C for 30 min. The reaction progress is monitored by e.g. TLC. Residual solvent of dark solution formed is removed after checking the reaction progress. The product is purified by flash chromatography on silica gel (eluent: dichloromethane with 5 % IM NH3 in MeOH) yielding 11.9 g (86 %) of an amorphous material.
MS: M = 270.4 (M+H)+
A-2: 3-((E)-3-Dimethylamino-acryloyl)-l-(4-methoxyl-phenyl)-lH-pyridazin-4-one
Figure imgf000051_0001
According to the method described for the synthesis of starting material A-I, starting material A- 2 was prepared starting from p-anisidine and 2,4-pentadione in 83 % yield for the two-step synthesis as amorphous material.
MS: M = 300.0 (M+H)+
A-3: 3-((£)-3-Dimethylamino-acryloyl)-l-(3-trifluoroniethyl-phenyl)-lH-pyridazin-4-one
Figure imgf000051_0002
According to the method described for the synthesis of starting material A-I, starting material A- 3 was prepared starting from 3-trifluoromethylaniline and 2,4-pentadione in 77 % yield for the two-step synthesis as amorphous material.
MS: M = 338.0 (M+HV
A-4: 3-((E)-3-Dimethylamino-acryloyl)-l-(3-ethyl-phenyl)-lH-pyridazin-4-one
Figure imgf000051_0003
According to the method described for the synthesis of starting material A-I, starting material A- 4 was prepared starting from 3-ethylaniline and 2,4-pentadione in 95 % yield for the two-step synthesis as amorphous material.
MS: M = 298.3 (M+H)+
A-5: 3-((E)-3-Dimethylamino-acryloyl)-l-(3-methoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000052_0001
According to the method described for the synthesis of starting material A-I, starting material A- 5 was prepared starting from m-anisidine and 2,4-pentadione in 85 % yield for the two-step synthesis as amorphous material.
MS: M = 300.1 (M+H)+
A-6: 3-((£)-3-Dimethylamino-acryloyl)-l-(3-trifluoroniethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000052_0002
According to the method described for the synthesis of starting material A-I, starting material A- 6 was prepared starting from 3-trifluoromethoxyaniline and 2,4-pentadione in 72 % yield for the two-step synthesis as amorphous material.
MS: M = 354.1 (M+H)+
A-7: 3-((£)-3-Dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4-one
Figure imgf000053_0001
According to the method described for the synthesis of starting material A-I, starting material A- 7 was prepared starting from 3-methansulfonylaniline and 2,4-pentadione in 44 % yield for the two-step synthesis as amorphous material.
MS: M = 348.2 (M+H)+
A-8: 3-((£)-3-Dimethylamino-acryloyl)-l-(4-trifluoroniethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000053_0002
According to the method described for the synthesis of starting material A-I, starting material A- 8 was prepared starting from 4-trifluoromethoxyaniline and 2,4-pentadione in 90 % yield for the two-step synthesis as amorphous material.
MS: M = 354.2 (M+H)+
A-9: l-(4-Difluoromethoxy-phenyl)-3-((E)-3-dimethylamino-acryloyl)-lH-pyridazin-4-one
Figure imgf000054_0001
a) 3-(4-Difluoromethoxy-phenylazo)-pentane-2,4-dione
A solution of 4-difluromethoxy-phenylamine (2 g, 13 mmol) was cooled at -6°C and phosphoric acid (85%, 13 mL) followed by nitric acid (65%, 9 mL) very slowly. When the mixture reached the room temperature it was stirred 15 minutes for complete dissolution. The solution was cooled again to -6°C and solid sodium nitrite (0.954 g, 13.8 mmol) was added during 5 minutes followed by crushed ice. The reaction mixture was added into a suspension of pentane-2,4-dione (1.32g, 13.2 mmol) and potassium acetate (24.1g, 251 mmol) in ethanol ( 130 mL) at 00C. Stirring is continued for 15 min at 0-5 0C and an aqueous solution 2M of sodium carbonate is added until the pH is 9-10. The solution is extracted with dichloromethane (4 x 200 mL). The combined organic layers were washed with water, dried with magnesium sulphate, filtrated and the solvent was removed in the vacuum to obtain 3.6 g (100%) of the final product that was used as a crude on the next step.
MS: M = 269.1 (M-H)+
b) l-(4-Difluoromethoxy-phenyl)-3-((E)-3-dimethylamino-acryloyl)-lH-pyridazin-4-one
3-(4-Difluoromethoxy-phenylazo)-pentane-2,4-dione (3.2 g; 12 mmol) is dissolved in N,N- dimethylformamide dimethyl acetal (20 ml) and heated at 110 0C for 60 min. The N,N- dimethylformamide dimethyl acetal is evaporated and the product is purified by flash chromatography on silica gel (eluent: dichloromethane-methanol 1/0 to 9/1) to yield 3.34 g (84 %) of an amorphous yellow material.
MS: M = 336.3 (M+H)+
A-IO: l-(3-Difluoroniethoxy-phenyl)-3-((E)-3-diniethylaniino-acryloyl)-lH-pyridazin-4-one
Figure imgf000055_0001
According to the method described for the synthesis of starting material A-9, starting material A- 10 was prepared from 3-difluromethoxy-phenylamine and 2,4-pentadione in 90 % yield for the two-step synthesis as brown solid.
MS: M = 336.3 (M+H)+
A-Il: l-(2,2-Difluoro-benzo[l,3ldioxol-5-yl)-3-((E)-3-dimethylamino-acryloyl)-lH-pyridazin- 4-one
Figure imgf000055_0002
According to the method described for the synthesis of starting material A-9, starting material A- 11 was prepared from 2,2-difluoro-benzo[l,3]dioxol-5-ylamine and 2,4-pentadione in 50 % yield for the two-step synthesis as brown solid.
MS: M = 350.2 (M+H)+
A- 12: 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-N,N-dimethyl- benzenesulfonamide
Figure imgf000056_0001
According to the method described for the synthesis of starting material A-9, starting material A- 12 was prepared from 3-amino-N,N-dimethyl-benzenesulfonamide and 2,4-pentadione as amorphous material.
MS: M = 377.2 (M+H)+
A- 13: 3-((E)-3-Dimethylamino-acryloyl)-l-(3-fluoro-phenyl)-lH-pyridazin-4-one
Figure imgf000056_0002
According to the method described for the synthesis of starting material A-I, starting material A- 13 was prepared from 3-fluoroaniline and 2,4-pentadione as amorphous material.
MS: M = 288.1 (M+H)+
A- 14: l-Benzo[l,3ldioxol-4-yl-3-((E)-3-dimethylamino-acryloyl)-lH-pyridazin-4-one
Figure imgf000056_0003
According to the method described for the synthesis of starting material A-9, starting material A- 14 was prepared from benzo[l,3]dioxol-4-ylamine and 2,4-pentadione as amorphous material. MS: M = 314.2 (M+H)+
A- 15: l-(2,2-Difluoro-benzo[l,3ldioxol-4-yl)-3-((E)-3-dimethylamino-acryloyl)-lH-pyridazin- 4-one
Figure imgf000057_0001
According to the method described for the synthesis of starting material A-9, starting material A- 15 was prepared from 2,2-difluoro-benzo[l,3]dioxol-4-ylamine and 2,4-pentadione as amorphous material.
MS: M = 350.2 (M+H)+
A- 16: 3-((£)-3-Dimethylamino-acryloyl)-l-(4-niethansulfonyl-phenyl)-lH-pyridazin-4-one
Figure imgf000057_0002
According to the method described for the synthesis of starting material A-9, starting material A- 16 was prepared starting from 4-methansulfonylaniline and 2,4-pentadione as amorphous material.
MS: M = 348.2 (M+H)+
A- 17: 3-((E)-3-Dimethylamino-acryloyl)- l-(3-hydroxyphenyl)-lH-pyridazin-4-one
Figure imgf000058_0001
According to the method described for the synthesis of starting material A-9, starting material A- 17 was prepared from 3-aminophenol and 2,4-pentadione as amorphous material.
MS: M = 286.1 (M+H)+
A- 18: l-(3-Bromo-phenyl)-3-((£)-3-dimethylamino-acryloyl)-lH-pyridazin-4-one
Figure imgf000058_0002
According to the method described for the synthesis of starting material A-I, starting material A- 18 was prepared from 3-bromoaniline and 2,4-pentadione as amorphous material.
MS: M = 348.0 (M+H)+
A- 19: 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-benzonitrile
Figure imgf000058_0003
According to the method described for the synthesis of starting material A-9, starting material A- 19 was prepared from 3-aminobenzonitrile and 2,4-pentadione as amorphous material.
MS: M = 295.3 (M+H)+ A-20: 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-N,N-dimethyl- benzamide
Figure imgf000059_0001
According to the method described for the synthesis of starting material A-9, starting material A- 20 was prepared from 3-amino-N,N-dimethyl-benzamide and 2,4-pentadione as amorphous material.
MS: M = 341.2 (M+H)+
A-21: 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-N,N-diethyl- benzenesulfonamide
Figure imgf000059_0002
According to the method described for the synthesis of starting material A-9, starting material A- 21 was prepared from 3-amino-N,N-diethyl-benzenesulfonamide and 2,4-pentadione as amorphous material.
MS: M = 405.4 (M+H)+
A-22: 3-((£)-3-Dimethylamino-acryloyl)-l-(4-trifluoromethyl-phenyl)-lH-pyridazin-4-one
Figure imgf000060_0001
According to the method described for the synthesis of starting material A-I, starting material A- 22 was prepared starting from 4-trifluoromethylaniline and 2,4-pentadione as amorphous material.
MS: M = 338.1 (M+H)+
A-23: l-(3-Chloro-phenyl)-3-((£)-3-dimethylamino-acryloyl)-lH-pyridazin-4-one
Figure imgf000060_0002
According to the method described for the synthesis of starting material A-I, starting material A- 23 was prepared from 3-chloroaniline and 2,4-pentadione as amorphous material.
MS: M = 304.1 (M+H)+
A-24: l-(4-Chloro-phenyl)-3-((£)-3-dimethylamino-acryloyl)-lH-pyridazin-4-one
Figure imgf000060_0003
According to the method described for the synthesis of starting material A-I, starting material A- 24 was prepared from 4-chloroaniline and 2,4-pentadione as amorphous material. MS: M = 304.1 (M+H)+
A-25: 3-((E)-3-Dimethylamino-acryloyl)-l-(3-diniethylaniinoniethyl-phenyl)-lH-pyridazin-4- one
Figure imgf000061_0001
According to the method described for the synthesis of starting material A-9, starting material A- 25 was prepared from 3-dimethylaminomethyl-phenylamine and 2,4-pentadione as amorphous material.
MS: M = 327.3 (M+H)+
A-26: 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(piperidine-l-sulfonyl)-phenyll-lH-pyridazin-4- one
Figure imgf000061_0002
According to the method described for the synthesis of starting material A-9, starting material A- 26 was prepared from 3-(piperidine-l-sulfonyl)-phenylamine and 2,4-pentadione as amorphous material.
MS: M = 417.2 (M+H)+
A-27: 3-((£)-3-Dimethylamino-acryloyl)-l-(4-trifluoromethansulfonyl-phenyl)-lH-pyridazin- 4-one
Figure imgf000062_0001
According to the method described for the synthesis of starting material A-9, starting material A- 27 was prepared starting from 4-trifluoromethansulfonyl-phenylamine and 2,4-pentadione as amorphous material.
MS: M = 402.2 (M+H)+
A-28: 3-((E)-3-Dimethylamino-acryloyl)-l-(4-dimethylaminomethyl-phenyl)-lH-pyridazin-4- one
Figure imgf000062_0002
According to the method described for the synthesis of starting material A-9, starting material A- 28 was prepared from 4-dimethylaminomethyl-phenylamine and 2,4-pentadione as amorphous material.
MS: M = 327.3 (M+H)+
A-29: 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(pyrrolidine-l-sulfonyl)-phenyll-lH-pyridazin- 4-one
Figure imgf000063_0001
According to the method described for the synthesis of starting material A-9, starting material A- 29 was prepared from 3-(pyrrolidine-l-sulfonyl)-phenylamine and 2,4-pentadione as amorphous material.
MS: M = 403.2 (M+H)+
A-30: 4-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-N-methyl- benzenesulfonamide
Figure imgf000063_0002
According to the method described for the synthesis of starting material A-9, starting material A- 30 was prepared from 4-amino-N-methyl-benzenesulfonamide and 2,4-pentadione as amorphous material.
MS: M = 363.1 (M+H)+
A-31: 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-N-methyl- benzenesulfonamide
Figure imgf000064_0001
According to the method described for the synthesis of starting material A-9, starting material A- 31 was prepared from 3-amino-N-methyl-benzenesulfonamide and 2,4-pentadione as amorphous material.
MS: M = 363.2 (M+H)+
A-32: 3-((E)-3-Dimethylamino-acryloyl)-l-[4-(2,2,2-trifluoro-ethoxy)-phenyll-lH-pyridazin-4- one
Figure imgf000064_0002
According to the method described for the synthesis of starting material A-9, starting material A- 32 was prepared from 4-(2,2,2-trifluoro-ethoxy)-phenylamine and 2,4-pentadione as amorphous material.
MS: M = 368.1 (M+H)+
A-33: 3-((£)-3-Dimethylamino-acryloyl)-l-(3-trifluoromethansulfonyl-phenyl)-lH-pyridazin- 4-one
Figure imgf000065_0001
According to the method described for the synthesis of starting material A-9, starting material A- 33 was prepared starting from 3-trifluoromethansulfonyl-phenylamine and 2,4-pentadione as amorphous material.
MS: M = 402.2 (M+H)+
A-34: N-{3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-phenyl}-acetamide
Figure imgf000065_0002
According to the method described for the synthesis of starting material A-I, starting material A- 34 was prepared from N-(3-amino-phenyl)-acetamide and 2,4-pentadione as amorphous material.
MS: M = 327.2 (M+H)+
A-35: 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H-pyridazin-l-yll-N-methyl-benzamide
Figure imgf000065_0003
According to the method described for the synthesis of starting material A-I, starting material A- 35 was prepared from 3-amino-N-methyl-benzamide and 2,4-pentadione as amorphous material.
MS: M = 327.2 (M+H)+
A-36: 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(l-hydroxy-ethyl)-phenyll-lH-pyridazin-4-one
Figure imgf000066_0001
According to the method described for the synthesis of starting material A-9, starting material A- 36 was prepared from l-(3-amino-phenyl)-ethanol and 2,4-pentadione as amorphous material.
MS: M = 314.2 (M+H)+
B. Final Products:
Example 1
3-(2-Benzo[l,3ldioxol-5-γl-2H-pyrazol-3-γl)-l-phenγl-lH-pyridazin-4-one
Figure imgf000066_0002
3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH-pyridazin-4-one (A-I) (0.2 g; 0.74 mmol) and
3,4-methylenedioxyphenylhydrazine (0.136 g; 0.89 mmol) are dissolved in a sealed tube in acetic acid (4 ml) and irradiated at 1800C for 10 min. The solvent of the reaction mixture is removed and the crude product is purified by preparative HPLC yielding 0.80 g (30 %) of the final product.
MS: M = 359.0 (M+H)+ Example 2
l-(4-Methoxy-phenγl)-3-(2-phenγl-2H-pyrazol-3-γl)-lH-pyridazin-4-one
Figure imgf000067_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4-methoxyl- phenyl) -lH-pyridazin-4-one (A-2) and phenylhydrazine according to the method described for Example 1 in 81 % yield.
MS: M = 345.0 (M+H)+
Example 3
3-[2-(2-Methoxy-phenyl)-2H-pyrazol-3-yll-l-phenyl-lH-pyridazin-4-one
Figure imgf000067_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 2-methoxy-phenylhydrazine x HCl according to the method described for Example 1 in 61 % yield.
MS: M = 345.1 (M+H)+
Example 4
l-Phenyl-3-(2-o-tolyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
Figure imgf000068_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and o-tolylhydrazine x HCl according to the method described for Example 1 in 55 % yield.
MS: M = 329.1 (M+H)+
Example 5
l-Phenyl-3-[2-(3-trifluoromethyl-phenyl)-2H-pyrazol-3-yll-lH-pyridazin-4-one
Figure imgf000068_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 3-(trifluoromethyl)-phenylhydrazine according to the method described for Example 1 in 58 % yield.
MS: M = 383.0 (M+H)+
Example 6
3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethyl-phenyl)-lH-pyridazin-4-one
Figure imgf000069_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and 2,5-difluorophenylhydrazine according to the method described for Example 1 in 32 % yield.
MS: M = 419.1 (M+H)+
Example 7
l-(3-Trifluoromethyl-phenyl)-3-[2-(2-trifluoromethyl-phenyl)-2H-pyrazol-3-yll-lH-pyridazin- 4-one
Figure imgf000069_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and o-trifluoromethyl-phenylhydrazine according to the method described for Example 1 in 46 % yield.
MS: M = 451.1 (M+H)+
Example 8
3-[2-(2,5-Dimethyl-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethyl-phenyl)-lH-pyridazin-4- one
Figure imgf000070_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and 2,5-dimethyl-phenylhydrazine x HCl according to the method described for Example 1 in 88 % yield.
MS: M = 411.1 (M+H)+
Example 9
3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yll-l-phenyl-lH-pyridazin-4-one
Figure imgf000070_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 2,5-difluorophenylhydrazine according to the method described for Example 1 in 24 % yield.
MS: M = 351.1 (M+H)+
Example 10
l-Phenyl-3-[2-(2-trifluoromethyl-phenyl)-2H-pyrazol-3-yll-lH-pyridazin-4-one
Figure imgf000071_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and o-trifluoromethyl-phenylhydrazine according to the method described for Example 1 in 34 % yield.
MS: M = 383.0 (M+H)+
Example 11
3-[2-(2,5-Dimethyl-phenyl)-2H-pyrazol-3-yll-l-phenyl-lH-pyridazin-4-one
Figure imgf000071_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 2,5-dimethyl-phenylhydrazine x HCl according to the method described for Example 1 in 74 % yield.
MS: M = 343.2 (M+H)+
Example 12
3-[2-(2,5-Dichloro-phenyl)-2H-pyrazol-3-yll-l-phenyl-lH-pyridazin-4-one
Figure imgf000072_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 2,5-dichlorophenylhydrazine according to the method described for Example 1 in 23 % yield.
MS: M = 383.0 (M+H)+
Example 13
l-Phenγl-3-(2-pyridin-2-yl-2H-pyrazol-3-γl)-lH-pyridazin-4-one
Figure imgf000072_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 2-hydrazinopyridine according to the method described for Example 1 in 64 % yield.
MS: M = 316.1 (M+H)+
Example 14
3-{5-[4-Oxo-l-(3-trifluoromethyl-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzonitrile
Figure imgf000073_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for Example 1 in 59 % yield.
MS: M = 408.1 (M+H)+
Example 15
l-Phenγl-3-(2-pyridin-4-yl-2H-pyrazol-3-γl)-lH-pyridazin-4-one
Figure imgf000073_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 4-hydrazinopyridine according to the method described for Example 1 in 11 % yield.
MS: M = 316.1 (M+H)+
Example 16
3-[5-(4-Oxo-l-phenyl-l,4-dihydro-pyridazin-3-yl)-pyrazol-l-yll-benzonitrile
Figure imgf000074_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for Example 1 in 55 % yield.
MS: M = 340.1 (M+H)+
Example 17
l-(3-Ethyl-phenγl)-3-(2-phenγl-2H-pyrazol-3-γl)-lH-pyridazin-4-one
Figure imgf000074_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-ethyl-phenyl)- lH-pyridazin-4-one (A-4) and phenylhydrazine according to the method described for Example 1 in 87 % yield.
MS: M = 343.1 (M+H)+
Example 18
l-(3-Methoxy-phenyl)-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
Figure imgf000075_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-methoxy- phenyl)-lH-pyridazin-4-one (A-5) and phenylhydrazine according to the method described for Example 1 in 71 % yield.
MS: M = 345.1 (M+H)+
Example 19
l-Phenγl-3-(2-phenγl-2H-pyrazol-3-γl)-lH-pyridazin-4-one
Figure imgf000075_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and phenylhydrazine according to the method described for Example 1 in 81 % yield.
MS: M = 315.1 (M+H)+
Example 20
3-[2-(4-Methanesulfonyl-phenyl)-2H-pyrazol-3-yll-l-phenyl-lH-pyridazin-4-one
Figure imgf000076_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 4-(methylsulfonyl)phenylhydrazine according to the method described for Example 1 in 12 % yield.
MS: M = 392.9 (M+H)+
Example 21
l-(3-Ethyl-phenyl)-3-[2-(4-methanesulfonyl-phenyl)-2H-pyrazol-3-yll-lH-pyridazin-4-one
Figure imgf000076_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-ethyl-phenyl)- lH-pyridazin-4-one (A-4) and 4-(methylsulfonyl)phenylhydrazine according to the method described for Example 1 in 50 % yield.
MS: M = 421.1 (M+H)+
Example 22
l-(3-Ethyl-phenγl)-3-(2-pyridin-4-yl-2H-pyrazol-3-γl)-lH-pyridazin-4-one
Figure imgf000077_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-ethyl-phenyl)- lH-pyridazin-4-one (A-4) and 4-hydrazinopyridine according to the method described for Example 1 in 47 % yield.
MS: M = 344.1 (M+H)+
Example 23
3-[2-(3-Bromo-phenyl)-2H-pyrazol-3-yll-l-phenyl-lH-pyridazin-4-one
Figure imgf000077_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 3-bromophenylhydrazine according to the method described for Example 1 in 80 % yield.
MS: M = 392.8 (M+H)+
Example 24
3-[2-(2-Methyl-pyridin-4-yl)-2H-pyrazol-3-yll-l-phenyl-lH-pyridazin-4-one
Figure imgf000078_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 4-hydrazino-2-methylpyridine according to the method described for Example 1 in 37 % yield.
MS: M = 330.1 (M+H)+
Example 25
3-[2-(2-Chloro-pyridin-4-yl)-2H-pyrazol-3-γll-l-phenγl-lH-pyridazin-4-one
Figure imgf000078_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 2-chloro-4-hydrazinopyridine according to the method described for Example 1 in 9 % yield.
MS: M = 350.1 (M+H)+
Example 26
3-(2-Phenyl-2H-pyrazol-3-yl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000079_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and phenylhydrazine according to the method described for Example 1 in 64 % yield.
MS: M = 399.1 (M+H)+
Example 27
3-(2-Pyridin-4-yl-2H-pyrazol-3-yl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000079_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and 4-hydrazinopyridine according to the method described for Example 1 in 16 % yield.
MS: M = 400.2 (M+H)+
Example 28
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000080_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and 2-fluoro-phenylhydrazine according to the method described for Example 1 in 69 % yield.
MS: M = 417.0 (M+H)+
Example 29
3-{5-[4-Oxo-l-(3-trifluoromethoxy-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzonitrile
Figure imgf000080_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for Example 1 in 18 % yield.
MS: M = 424.1 (M+H)+
Example 30
l-(3-Methanesulfonyl-phenyl)-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
Figure imgf000081_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and phenylhydrazine according to the method described for Example 1 in 47 % yield.
MS: M = 393.0 (M+H)+
Example 31
l-Phenyl-3-[2-(3-trimethylsilanylethvnyl-phenyl)-2H-pyrazol-3-yll-lH-pyridazin-4-one
Figure imgf000081_0002
A mixture of 3-[2-(3-bromo-phenyl)-2H-pyrazol-3-yl]-l-phenyl-lH-pyridazin-4-one (example 23, 87 mg, 0.22 mmol), ethynyltrimethylsilane (47 ul, 0.33 mmol), CuI (3 mg, 0.01 mmol), (PPhS)2PdCl2 (10 mg, 0.01 mmol), PPh3 (122 mg, 0.44 mmol) and dimethylamine (596 ul, 3.3 mmol of a solution in ethanol) in DMF (0.9 ml) is heated at 120 0C for 20 minutes under microwave irradiation. After purification of the crude product by preparative HPLC 50 mg (55 % yield) of the product is obtained as solid material.
MS: M = 411.2 (M+H)+
Example 32
3-[2-(3-Ethynyl-phenγl)-2H-pyrazol-3-γll-l-phenγl-lH-pyridazin-4-one
Figure imgf000082_0001
A mixture of l-phenyl-3-[2-(3-trimethylsilanylethynyl-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin- 4-one (example 31, 50 mg, 0.12 mmol) is dissolved in THF (2 ml). Tetrabutylammoniumfiuoride trihydrate (77 mg, 0.24 mmol) is added at 0 0C and the reaction mixture is allowed to warm up to ambient temperature within 15 minutes. Stirring is continued for another 2 hours. The reaction mixture is quenched with water and extracted with ethyl acetate. The solvent is removed and the obtained crude product is triturated with diethyl ether. The solid material is filtrated and dried to obtain 39 mg (94 % yield) of the product.
MS: M = 339.3 (M+H)+
Example 33
3-(2-Phenyl-2H-pyrazol-3-yl)-l-(4-trifluoroniethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000082_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifiuoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and phenylhydrazine according to the method described for Example 1 in 64 % yield.
MS: M = 399.1 (M+H)+
Example 34
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000083_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 2-fluoro-phenylhydrazine according to the method described for Example 1 in 65 % yield.
MS: M = 417.0 (M+H)+
Example 35
3-(2-Pyridin-4-yl-2H-pyrazol-3-yl)-l-(4-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000083_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 4-hydrazinopyridine according to the method described for Example 1 in 32 % yield.
MS: M = 400.2 (M+H)+
Example 36
3-{5-[4-Oxo-l-(4-trifluoromethoxy-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzonitrile
Figure imgf000084_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for Example 1 in 21 % yield.
MS: M = 424.1 (M+H)+
Example 37
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethyl-phenyl)-lH-pyridazin-4-one
Figure imgf000084_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and 2-fluoro-phenylhydrazine according to the method described for Example 1 in 57 % yield.
MS: M = 401.0 (M+H)+
Example 38
3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yll-l-phenyl-lH-pyridazin-4-one
Figure imgf000085_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 4-chloro-phenylhydrazine x HCl according to the method described for Example 1 in 51 % yield.
MS: M = 349.2 (M+H)+
Example 39
l-Phenγl-3-(2-p-tolγl-2H-pγrazol-3-γl)-lH-pγridazin-4-one
Figure imgf000085_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and p-tolylhydrazine x HCl according to the method described for Example 1 in 67 % yield.
MS: M = 329.1 (M+H)+
Example 40
3-(2-Phenγl-2H-pγrazol-3-γl)-l-(3-trifluoromethγl-phenγl)-lH-pγridazin-4-one
Figure imgf000086_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and phenylhydrazine according to the method described for Example 1 in 10 % yield.
MS: M = 383.4 (M+H)+
Example 41
3-[2-(4-Methoxy-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethyl-phenyl)-lH-pyridazin-4-one
Figure imgf000086_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and 4-methoxy-phenylhydrazine x HCl according to the method described for Example 1 in 10 % yield.
MS: M = 413.5 (M+H)+
Example 42
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethyl-phenyl)-lH-pyridazin-4-one
Figure imgf000087_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and 3-chloro-phenylhydrazine x HCl according to the method described for Example 1 in 51 % yield.
MS: M = 417.4 (M+H)+
Example 43
3-{5-[4-Oxo-l-(3-trifluoromethoxy-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzamide
Figure imgf000087_0002
3-((E)-3-Dimethylamino-acryloyl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and 3-hydrazino-benzamide (2 eq) were dissolved in a sealed tube in acetic acid and irradiated in MW at 1200C for 15 min. The solvent of the reaction mixture was removed and the crude product was purified by preparative HPLC yielding the desired product.
MS: M = 442.9 (M+H) +
Example 44
3-(2-p-Tolyl-2H-pyrazol-3-yl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000088_0001
Reaction of 3-((E)-3-Dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and p-tolyl-hydrazine according to example 43 gave the desired product.
MS: M = 413.3 (M+H)+
Example 45
4-{5-[4-Oxo-l-(3-trifluoromethoxy-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}-benzoic acid
Figure imgf000088_0002
Reaction of 3-((E)-3-Dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and 4-hydrazino-benzoic acid according to example 43 gave the desired product.
MS: M = 442.9 (M)+
Example 46
4-{5-[4-Oxo-l-(3-trifluoromethoxy-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzenesulfonamide
Figure imgf000089_0001
Reaction of 3-((E)-3-Dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and 4-hydrazino-benzenesulfonamide according to example 43 gave the desired product.
MS: M = 478.0 (M+H)+
Example 47
3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000089_0002
Reaction of 3-((E)-3-Dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (4-chloro-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 432.9 (M+H)+
Example 48
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000089_0003
Reaction of 3-((E)-3-Dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (3-chloro-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 433.2 (M+H)+
Example 49
3-[2-(4-Fluoro-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000090_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (4-fiuoro-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 416.9 (M+H)+
Example 50
3-[2-(2,3-Dimethyl-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4- one
Figure imgf000090_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (2,3-dimethyl-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 425.8 (M)+
Example 51 3-[2-(3-Chloro-2-methyl-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lH- pγridazin-4-one
Figure imgf000091_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (3-chloro-2-methyl-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 447.3 (M+H)+
Example 52
3-[2-(2-Bromo-4-fluoro-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lH- pyridazin-4-one
Figure imgf000091_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (2-bromo-4-fluoro-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 496.9 (M+H)+
Example 53
3-[2-(3-Fluoro-2-methyl-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lH- pγridazin-4-one
Figure imgf000092_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (3-fiuoro-2-methyl-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 431.3 (M+H)+
Example 54
3-[2-(3-Fluoro-4-methyl-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lH- pyridazin-4-one
Figure imgf000092_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (3-fiuoro-4-methyl-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 431.0 (M+H)+
Example 55
3-{5-[4-Oxo-l-(3-trifluoromethoxy-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}-benzoic acid methyl ester
Figure imgf000093_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and 3-hydrazino-benzoic acid methyl ester according to example 43 gave the desired product.
MS: M = 456.9 (M+H)+
Example 56
2-{5-[4-Oxo-l-(3-trifluoromethoxy-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- isonicotinic acid ethyl ester
Figure imgf000093_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and 2-hydrazino-isonicotinic acid ethyl ester (described in Anales Real Soc. Espan. Fis. Quire. (Madrid) Ser. B (1963), 59(3), 179-84) according to example 43 gave the desired product.
MS: M = 454.0 (M+H)+
Example 57
3-(2-Pyridin-2-yl-2H-pyrazol-3-yl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000094_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and pyridin-2-yl-hydrazine according to example 43 gave the desired product.
MS: M = 472.0 (M+H)+
Example 58
3-[2-(5,6,7,8-Tetrahydro-isoquinolin-l-yl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)- lH-pyridazin-4-one
Figure imgf000094_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (5,6,7,8-tetrahydro-isoquinolin-l-yl)-hydrazine (prepared from the commercial 5,6,7,8-tetrahydro-isoquinolin-l-ylamine using sodium nitrite and tin(II) chloride in analogy to that described in J. Med. Chem. 2003, 46, 4676-4686) according to example 43 gave the desired product.
MS: M = 400.0 (M+H)+.
Example 59
3-{5-[l-(3-Methanesulfonyl-phenyl)-4-oxo-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzamide
Figure imgf000095_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and 3-hydrazino-benzamide according to example 43 gave the desired product.
MS: M = 436.7 (M+H)+
Example 60
l-(3-Methanesulfonγl-phenγl)-3-(2-p-tolγl-2H-pyrazol-3-γl)-lH-pyridazin-4-one
Figure imgf000095_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and p-tolyl-hydrazine according to example 43 gave the desired product.
MS: M = 407.3 (M+H)+
Example 61
4-{5-[l-(3-Methanesulfonyl-phenyl)-4-oxo-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}-benzoic acid
O
Figure imgf000095_0003
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and 4-hydrazino-benzoic acid according to example 43 gave the desired product.
MS: M = 437.0 (M+H)+
Example 62
4-{5-[l-(3-Methanesulfonyl-phenyl)-4-oxo-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzenesulfonamide
Figure imgf000096_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and 4-hydrazino-benzenesulfonamide according to example 43 gave the desired product.
MS: M = 471.9 (M+H)+
Example 63
3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one
Figure imgf000096_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and (4-chloro-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 426.6 (M+H)+
Example 64 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one
Figure imgf000097_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and (3-chloro-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 427.1 (M+H)+
Example 65
2-{5-[l-(3-Methanesulfonyl-phenyl)-4-oxo-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}-benzoic acid
Figure imgf000097_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and 2-hydrazino-benzoic acid according to example 43 gave the desired product.
MS: M = 437.0 (M+H)+
Example 66
3-[2-(4-Fluoro-phenyl)-2H-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one
Figure imgf000098_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and (4-fiuoro-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 411.2 (M+H)+
Example 67
3-[2-(2,3-Dimethyl-phenyl)-2H-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4- one
Figure imgf000098_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and (2,3-dimethyl-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 421.3 (M+H)+
Example 68
3-[2-(3-Chloro-2-methyl-phenyl)-2H-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lH- pyridazin-4-one
Figure imgf000099_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and (3-chloro-2-methyl-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 441.0 (M)+
Example 69
3-[2-(3-Fluoro-2-methyl-phenyl)-2H-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lH- pγridazin-4-one
Figure imgf000099_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and (3-fiuoro-2-methyl-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 425.2 (M+H)+
Example 70
3-[2-(3-Fluoro-4-methyl-phenyl)-2H-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lH- pγridazin-4-one
Figure imgf000100_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and (3-fiuoro-4-methyl-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 425.3 (M+H)+
Example 71
3-{5-[l-(3-Methanesulfonyl-phenyl)-4-oxo-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}-benzoic acid methyl ester
Figure imgf000100_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and 3-hydrazino-benzoic acid methyl ester according to example 43 gave the desired product.
MS: M = 451.0 (M+H)+
Example 72
l-(3-Methanesulfonyl-phenyl)-3-[2-(5,6,7,8-tetrahvdro-isoquinolin-l-yl)-2H-pyrazol-3-yll-lH- pγridazin-4-one
Figure imgf000101_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and (5,6,7,8-tetrahydro-isoquinolin-l-yl)-hydrazine (prepared from the commercial 5,6,7,8-tetrahydro-isoquinolin-l-ylamine using sodium nitrite and tin(II) chloride in analogy to that described in J. Med. Chem. 2003, 46, 4676-4686) according to example 43 gave the desired product.
MS: M = 448.0 (M+H)+
Example 73
2-{5-[l-(3-Methanesulfonyl-phenyl)-4-oxo-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}-4,6- dimethyl- nicotinonitrile
Figure imgf000101_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and 2-hydrazino-4,6-dimethyl-nicotinonitrile according to example 43 gave the desired product.
MS: M = 447.0 (M+H)+
Example 74
2-{5-[l-(3-Methanesulfonyl-phenyl)-4-oxo-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- isonicotinic acid ethyl ester
Figure imgf000102_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and 2-hydrazino-isonicotinic acid ethyl ester according to example 43 gave the desired product.
MS: M = 466.0 (M+H)+
Example 75
l-(3-Methanesulfonyl-phenyl)-3-(2-pyridin-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
Figure imgf000102_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and pyridin-2-yl-hydrazine according to example 43 gave the desired product.
MS: M = 393.9 (M+H)+
Example 76
4-{5-[4-Oxo-l-(3-trifluoromethoxy-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzonitrile
Figure imgf000102_0003
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and 4-hydrazino-benzonitrile according to example 43 gave the desired product.
MS: M = 424.2 (M+H)+
Example 77
3-[2-(2,4-Difluoro-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4- one
Figure imgf000103_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (2,4-difiuoro-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 435.1 (M+H)+
Example 78
3-{2-[4-(6-Oxo-l,4,5,6-tetrahvdro-pyridazin-3-yl)-phenyll-2H-pyrazol-3-yl}-l-(3- trifluoromethoxy-phenγl)-lH-pyridazin-4-one
Figure imgf000103_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and 6-(4-hydrazino-phenyl)-4,5-dihydro-2H-pyridazin-3-one (described in Journal of Medicinal Chemistry (1990), 33(10), 2870-5) according to example 43 gave the desired product. MS: M = 495.0 (M+H)+
Example 79
3-[2-(2,3-Dihydro-benzo[l,4ldioxin-6-yl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)- lH-pyridazin-4-one
Figure imgf000104_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (2,3-dihydro-benzo[l,4]dioxin-6-yl)-hydrazine according to example 43 gave the desired product.
MS: M = 456.9 (M+H)+
Example 80
3-(2-Naphthalen-l-yl-2H-pyrazol-3-yl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000104_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and naphthalen-1-yl-hydrazine according to example 43 gave the desired product.
MS: M = 449.0 (M+H)+
Example 81 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000105_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (3-fluoro-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 416.9 (M+H)+
Example 82
3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4- one
Figure imgf000105_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (2,5-difluoro-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 435.0 (M+H)+
Example 83
3-[2-(4-Isopropyl-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4- one
Figure imgf000106_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-trifiuoromethoxy-phenyl)-lH-pyridazin-4- one (A-6) and (4-isopropyl-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 441.0 (M+H)+
Example 84
3-[2-(2,3-Dihydro-benzo[l,4ldioxin-6-yl)-2H-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lH- pyridazin-4-one
Figure imgf000106_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and (2,3-dihydro-benzo[l,4]dioxin-6-yl)-hydrazine according to example 43 gave the desired product.
MS: M = 451 (M+H)+
Example 85
l-(3-Methanesulfonyl-phenyl)-3-(2-naphthalen-l-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
Figure imgf000107_0001
3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and naphthalen-1-yl-hydrazine (2 eq) were dissolved in a sealed tube in DMF with 2 drops acetic acid and irradiated in MW at 1200C for 15 min. The solvent of the reaction mixture was removed and the crude product was purified by preparative HPLC yielding the desired product.
MS: M = 442.9 (M+H) +
Example 86
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one
Figure imgf000107_0002
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and (3-fluoro-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 410.6 (M+H)+
Example 87
3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4- one
Figure imgf000107_0003
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and (2,5-difiuoro-phenyl) -hydrazine according to example 43 gave the desired product.
MS: M = 428.6 (M+H)+
Example 88
3-[2-(4-Isopropyl-phenyl)-2H-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one
Figure imgf000108_0001
Reaction of 3-((E)-3-dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4- one (A-7) and (4-isopropyl-phenyl) -hydrazine according to example 85 gave the desired product.
MS: M = 435.3 (M+H)+
Example 89
3-(4-Ethyl-2-phenyl-2H-pyrazol-3-yl)-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one
Figure imgf000108_0002
a) Preparation of 2-(3-methanesulfonyl-phenylazo)-3-oxo-butyric acid ethyl ester
A solution of sodium nitrite (1.22 g, 1.05 eq.) in water (6ml) was added dropwise to a solution of 3-methylsulphonylaniline hydrochloride in IN HCl (60ml) at 0° and stirred at this temperature for 30 mins. A solution of ethylacetoacetate (2.74g, 2.66ml) in ethanolic (6ml) water (100ml) was then added at this temperature, followed by ammonium acetate to pH 6 and stirring at this temperature for 3h. Dilution with EtOAc, separation of phases and concentration of the organic phase gave the crude product (5.33g) which was directly used for the next stage. MS: M = 313.1
(M+H)+
b) l-(3-Methanesulfonyl-phenyl)-4-oxo-l,4-dihydro-pyridazine-3-carboxylic acid ethyl ester
A solution of 2-(3-methanesulfonyl-phenylazo)-3-oxo-butyric acid ethyl ester (5g) in dry DMF was treated with N,N-dimethylformamide-dimethyl acetal (2.098g, l.leq) and the mixture stirred at 90° for 2h. Further addition of N,N-dimethylformamide-dimethyl acetal (0.3eq) and stirring at 90° for Ih followed by concentration and purification by silica gel chromatography (gradient elution: heptane/ ethyl acetate, then dichloromethane/methanol) gave 2.4g (47%) of the title compound. MS: M = 323.0 (M+H)+
c) l-(3-Methanesulfonyl-phenyl)-4-oxo-l,4-dihydro-pyridazine-3-carboxylic acid methoxy- methyl-amide
To a solution of N,O-dimethylhydroxylamine hydrochloride (3eq, 1.725g) in dry dichloromethane (60ml) at -5°, was slowly added MesAl (2M solution in toluene, 3eq) and the mixturestirred at room temperature for 30min, then cooled to -5° followed by the slow addition of a solution of l-(3-methanesulfonyl-phenyl)-4-oxo-l,4-dihydro-pyridazine-3-carboxylic acid ethyl ester (1.9g) in dry dichloromethane (30ml). The mixture was warmed and stirred at room temperature for Ih then portioned between dichoromethane and IN NOH and after layer separation and concentration, purified by silica gel chromatography using dichloromethane/methanol to give the product (0.92g, 46%). MS: M = 338.1 (M+H)+
d) 3-Butyryl-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one
To a solution of l-(3-methanesulfonyl-phenyl)-4-oxo-l,4-dihydro-pyridazine-3-carboxylic acid methoxy-methyl-amide (0.35g) in dry THF at -10°, was added n-propyl magnesium bromide (2.0M in THF, l.leq.) and after Ih at this temperature the mixture was partitioned between EtOAc and water, the organic phase evaporated and partially purified by silica gel chromatography (dichloromethane/methanol) and used directly for the next step (0.115g).
MS: M = 321.1 (M+H)+
e) 3-{2-[l-Dimethylamino-meth-(E)-ylidene]-butyryl}-l-(3-methanesulfonyl-phenyl)-lH- pyridazin-4-one A solution of 3-butyryl-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one (0.96g) in dry DMF (3ml) was treated with N,N-dimethylformamide-dimethyl acetal (l.leq) and the mixture stirred at 120° for 16h. Concentration to 1.5ml and further addition of N,N-dimethylformamide- dimethyl acetal (1.35eq) and stirring at 120° for 15h followed by concentration and purification by silica gel chromatography (dichloromethane/methanol) gave the crude product (0.37mg) which was used directly for the next stage.
MS: M = 376.2 (M+H)+
(f) 3-(4-Ethyl-2-phenyl-2H-pyrazol-3-yl)-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one
3-{2-[l-Dimethylamino-meth-(E)-ylidene]-butyryl}-l-(3-methanesulfonyl-phenyl)-lH- pyridazin-4-one and phenyl hydrazine (1.5 eq) were dissolved in a sealed tube in DMF with 2 drops acetic acid and irradiated in MW at 1200C for 15 min. The solvent of the reaction mixture was removed and the crude product was purified by preparative HPLC yielding the desired product.
MS: M = 421.2 (M+H)+
Example 90
l-(3-Methanesulfonyl-phenyl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yll-lH-pyridazin-4- one
Figure imgf000110_0001
3-((E)-3-Dimethylamino-acryloyl)-l-(3-methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) (0.05g; 0.144mmol) and 4-hydrazino-2-methylpyridine (0.03g; 0.187mmol) are dissolved in a sealed tube in dimethylformamide (0.6 ml) and irradiated at 1800C for 10 min. The solvent of the reaction mixture is removed and the crude product is purified by preparative HPLC yielding 0.02 g (34.1 %) of the final product
MS: M = 408.4 (M+H)+ Example 91
l-(3-Difluoromethoxy-phenyl)-3-(2-pyridin-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one
Figure imgf000111_0001
l-(3-Difluoromethoxy-phenyl)-3-((E)-3-dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) (0.05 g; 0.149mmol) and 2-hydrazinopyridine (0.021g; 0.194mmol) are dissolved in a sealed tube in ethanol (0.6 ml) with catalytic amounts of HCl and irradiated at 1600C for 5 min. The solvent of the reaction mixture is removed and the crude product is purified by preparative HPLC yielding 0.023 g (40.5 %) of the final product.
MS: M = 382.2 (M+H)+
Example 92
3-(2-Benzo[l,3ldioxol-5-yl-2H-pyrazol-3-yl)-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4- one
Figure imgf000111_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and benzo[l,3]dioxol-5-yl-hydrazine
(prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for Example 91 in 10 % yield.
MS: M = 437.3 (M+H)+ Example 93
3-(2-Benzo[l,3ldioxol-5-yl-2H-pyrazol-3-yl)-l-(3-difluoromethoxy-phenyl)-lH-pyridazin-4- one
Figure imgf000112_0001
The product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and benzo[l,3]dioxol-5-yl-hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for Example 91 in 16 % yield.
MS: M = 425.2 (M+H)+
Example 94
3-{5-[l-(3-Methanesulfonyl-phenyl)-4-oxo-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzonitrile
Figure imgf000112_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and 3-hydrazino-benzonitrile according to the method described for Example 91 in 61 % yield.
MS: M = 418.3 (M+H)+ Example 95
3-{2-[4-(2-Fluoro-4-methoxy-phenyl)-thiazol-2-yll-2H-pyrazol-3-yl}-l-(3-methanesulfonyl- phenyl)- lH-pyridazin-4-one
Figure imgf000113_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and [4-(2-fluoro-4-methoxy-phenyl)- thiazol-2-yl] -hydrazine according to the method described for Example 91 in 41 % yield.
MS: M = 524.13 (M+H)+
Example 96
l-(3-Methanesulfonyl-phenyl)-3-{2-[4-(2-methoxy-phenyl)-thiazol-2-yll-2H-pyrazol-3-yl}-lH- pyridazin-4-one
Figure imgf000113_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and [4-(2-methoxy-phenyl)-thiazol-2-yl]- hydrazine according to the method described for Example 91 in 21 % yield.
MS: M = 506.2.13 (M+H)+
Example 97
l-(3-Difluoromethoxy-phenyl)-3-[2-(2,3-dihydro-benzo [1,41 dioxin-6-yl)-2H-pyrazol-3-yll- IH- pyridazin-4-one
Figure imgf000114_0001
The product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and (2,3-dihydro-benzo[l,4]dioxin-6-yl)- hydrazine according to the method described for Example 91 in 52 % yield.
MS: M = 439.1 (M+H)+
Example 98
l-(3-Difluoromethoxy-phenyl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yll-lH-pyridazin-4-one
Figure imgf000114_0002
The product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and (3-fluoro-phenyl) -hydrazine
(prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for Example 91 in 37 % yield.
MS: M = 399.1 (M+H)+
Example 99
l-(4-Difluoromethoxy-phenyl)-3-[2-(2,3-dihydro-benzo[ 1,41 dioxin-6-yl)-2H-pyrazol-3-yll- IH- pγridazin-4-one
Figure imgf000115_0001
The product was obtained starting from l-(4-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-9) and (2,3-dihydro-benzo[l,4]dioxin-6-yl)- hydrazine according to the method described for Example 91 in 33 % yield.
MS: M = 439.1 (M+H)+
Example 100
l-(4-Difluoromethoxy-phenyl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yll-lH-pyridazin-4-one
Figure imgf000115_0002
The product was obtained starting from l-(4-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-9) and and (3-fluoro-phenyl) -hydrazine
(prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for Example 91 in 62 % yield.
MS: M = 399.1 (M+H)+
Example 101
l-(2,2-Difluoro-benzo[ 1,31 dioxol-5-yl)-3-[2-(2,3-dihydro-benzo[ 1,41 dioxin-6-yl)-2H-pyrazol- 3-γll - lH-pyridazin-4-one
Figure imgf000116_0001
The product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-I l) and (2,3-dihydro-benzo[l,4]dioxin-6-yl)- hydrazine according to the method described for Example 91 in 22 % yield.
MS: M = 453.2 (M+H)+
Example 102
3-{3-[2-(3-Fluoro-phenyl)-2ff-pyrazol-3-yll-4-oxo-4ff-pyridazin-l-yl}-Λr,Λr-dimethyl- benzenesulfonamide
Figure imgf000116_0002
The product was obtained starting from 3- [3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzenesulfonamide (A-12) and 3-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 440.2 (M+H)+
Example 103
l-(2,2-Difluoro-benzo[l,3ldioxol-5-yl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yll-lH-pyridazin- 4-one
Figure imgf000117_0001
The product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-I l) and 3-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 413.2 (M+H)+
Example 104
3-[2-(3,4-Difluoro-phenyl)-2ff-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lff-pyridazin-4- one
Figure imgf000117_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and 3,4-difluoro-phenylhydrazine according to the method described for example 91.
MS: M = 429.2 (M+H)+
Example 105
3-[2-(2,4-Difluoro-phenyl)-2ff-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lff-pyridazin-4- one
Figure imgf000118_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and 2,4-difluoro-phenylhydrazine according to the method described for example 43.
MS: M = 429.1 (M+H)+
Example 106
3-(2-Benzo[l,3ldioxol-4-yl-2ff-pyrazol-3-yl)-l-(3-methanesulfonyl-phenyl)-lff-pyridazin-4- one
Figure imgf000118_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and benzo[l,3]dioxol-4-yl-hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
MS: M = 437.3 (M+H)+
Example 107
3- [3-(2-Benzo [ 1,31 dioxol-5-yl-2ff-pyrazol-3-yl)-4-oxo-4ff-pyridazin- 1-yll -ATJV-dimethyl- benzenesulfonamide
Figure imgf000119_0001
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzenesulfonamide (A-12) and benzo[l,3]dioxol-5-yl-hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
MS: M = 466.2 (M+H)+
Example 108
3-{3-[2-(3-Cyano-phenyl)-2ff-pyrazol-3-yll-4-oxo-4ff-pyridazin-l-yl}-Λr,Λr-dimethyl- benzenesulfonamide
Figure imgf000119_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzenesulfonamide (A-12) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for example 91.
MS: M = 447.3 (M+H)+
Example 109
3-(2-Benzo[l,3ldioxol-5-γl-2H-pγrazol-3-γl)-l-(3-fluoro-phenγl)-lH-pγridazin-4-one
Figure imgf000120_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-fluoro-phenyl)- lH-pyridazin-4-one (A-13) and benzo[l,3]dioxol-5-yl-hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
MS: M = 377.2 (M+H)+
Example 110
l-(3-Fluoro-phenyl)-3-[2-(3-fluoro-phenyl)-2ff-pyrazol-3-yll-lff-pyridazin-4-one
Figure imgf000120_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-fluoro-phenyl)- lH-pyridazin-4-one (A-13) and 3-fiuoro-phenylhydrazine according to the method described for example 91.
MS: M = 351.3 (M+H)+
Example 111
3-{5-[l-(3-Fluoro-phenyl)-4-oxo-l,4-dihvdro-pyridazin-3-yll-pyrazol-l-yl}-benzonitrile
Figure imgf000121_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-fluoro-phenyl)- lH-pyridazin-4-one (A- 13) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for example 91.
MS: M = 358.1 (M+H)+
Example 112
1-Benzo[ 1,31 dioxol-4-yl-3-(2-benzo[ 1,31 dioxol-5-γl-2ff-pyrazol-3-γl)-lff-pγridazin-4-one
Figure imgf000121_0002
The product was obtained starting from l-Benzo[l,3]dioxol-4-yl-3-((E)-3-dimethylamino- acryloyl)-lH-pyridazin-4-one (A- 14) and benzo[l,3]dioxol-5-yl-hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
MS: M = 403.2 (M+H)+
Example 113
l-Benzo[l,3ldioxol-4-yl-3-[2-(3-fluoro-phenyl)-2ff-pyrazol-3-yll-lff-pyridazin-4-one
Figure imgf000122_0001
The product was obtained starting from l-Benzo[l,3]dioxol-4-yl-3-((E)-3-dimethylamino- acryloyl)-lH-pyridazin-4-one (A- 14) and 3-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 377.2 (M+H)+
Example 114
3- [5-( 1-Benzo [ 1,31 dioxol-4-yl-4-oxo- l,4-dihydro-pyridazin-3-γl)-pγrazol- 1-yll -benzonitrile
Figure imgf000122_0002
The product was obtained starting from l-Benzo[l,3]dioxol-4-yl-3-((E)-3-dimethylamino- acryloyl)-lH-pyridazin-4-one (A- 14) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for example 91.
MS: M = 384.2 (M+H)+
Example 115
3-[2-(6-Fluoro-quinolin-4-yl)-2ff-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lff-pyridazin-4- one
Figure imgf000123_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and (6-fluoro-quinolin-4-yl)-hydrazine according to the method described for example 91.
MS: M = 462.3 (M+H)+
Example 116
l-(3-Difluoromethoxy-phenyl)-3-[2-(2,5-difluoro-phenyl)-2ff-pyrazol-3-yll-lff-pyridazin-4- one
Figure imgf000123_0002
The product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and 2,5-difluoro-phenylhydrazine according to the method described for example 91.
MS: M = 417.2 (M+H)+
Example 117
l-(2,2-Difluoro-benzo[l,3ldioxol-5-yl)-3-[2-(2,5-difluoro-phenyl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000124_0001
The product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-I l) and 2,5-difluoro-phenylhydrazine according to the method described for example 91.
MS: M = 431.2 (M+H)+
Example 118
3-{3-[2-(2,5-Difluoro-phenyl)-2ff-pyrazol-3-yll-4-oxo-4ff-pyridazin-l-yl}-Λr,Λr-dimethyl- benzenesulfonamide
Figure imgf000124_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzenesulfonamide (A-12) and 2,5-difluoro-phenylhydrazine according to the method described for example 91.
MS: M = 458.2 (M+H)+
Example 119
3-{5-[l-(2,2-Difluoro-benzo[l,3ldioxol-5-yl)-4-oxo-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzonitrile
Figure imgf000125_0001
The product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-I l) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for example 91.
MS: M = 420.2 (M+H)+
Example 120
3-[2-(2,2-Difluoro-benzo[l,3ldioxol-4-yl)-2ff-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lff- pγridazin-4-one
Figure imgf000125_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and 2,2-difluoro- benzo[l,3]dioxol-4-yl- hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
MS: M = 473.2 (M+H)+
Example 121
l-(3-Methanesulfonγl-phenγl)-3-(2-thiazol-2-yl-2ff-pyrazol-3-γl)-lff-pγridazin-4-one
Figure imgf000126_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and thiazol-2-yl-hydrazine according to the method described for example 91.
MS: M = 400.1 (M+H)+
Example 122
l-(3-Methanesulfonyl-phenyl)-3-[2-(3-trifluoromethoxy-phenyl)-2ff-pyrazol-3-yll-lff- pγridazin-4-one
Figure imgf000126_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and 3-trifluoromethoxy-phenylhydrazine according to the method described for example 43.
MS: M = 477.2 (M+H)+
Example 123
3-[2-(2,3-Dihvdro-benzo[l,4ldioxin-5-yl)-2H-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lH- pyridazin-4-one
Figure imgf000127_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and (2,3-dihydro-benzo[l,4]dioxin-5-yl)- hydrazine according to the method described for example 43.
MS: M = 451.2 (M+H)+
Example 124
3-[2-(2-Methyl-pyridin-4-yl)-2ff-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lff-pyridazin-4- one
Figure imgf000127_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and 4-hydrazino-2-methylpyridine according to the method described for example 43.
MS: M = 414.2 (M+H)+
Example 125
3-(4-Ethyl-2-phenyl-2ff-pyrazol-3-yl)-l-(3-trifluoromethoxy-phenyl)-lff-pyridazin-4-one
Figure imgf000128_0001
The product was obtained starting from 3-trifluoromethoxyaniline instead of 3- methylsulphonylaniline applying the synthesis sequence described for example 89.
MS: M = 427.2 (M+H)+
Example 126
3-[2-(3-Methanesulfonyl-phenyl)-2ff-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)-lff- pγridazin-4-one
Figure imgf000128_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and (3-methanesulfonyl-phenyl)- hydrazine according to the method described for example 43.
MS: M = 477.2 (M+H)+
Example 127
l-(2,2-Difluoro-benzo[l,3ldioxol-4-yl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yll-lH-pyridazin- 4-one
Figure imgf000129_0001
The product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-15) and 3-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 413.2 (M+H)+
Example 128
l-(2,2-Difluoro-benzo[l,3ldioxol-4-yl)-3-[2-(2,5-difluoro-phenyl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000129_0002
The product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-15) and 2,5-difluoro-phenylhydrazine according to the method described for example 91.
MS: M = 431.2 (M+H)+
Example 129
3-{5-[l-(2,2-Difluoro-benzo[l,3ldioxol-4-yl)-4-oxo-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzonitrile
Figure imgf000130_0001
The product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-15) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for example 91.
MS: M = 420.2 (M+H)+
Example 130
l-(2,2-Difluoro-benzo[l,3ldioxol-4-yl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yll-lH- pγridazin-4-one
Figure imgf000130_0002
The product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-15) and 4-hydrazino-2-methylpyridine according to the method described for example 91.
MS: M = 410.3 (M+H)+
Example 131
3-[2-(2-Methyl-pyridin-4-yl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin-4- one
Figure imgf000131_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 4-hydrazino-2-methylpyridine according to the method described for example 91.
MS: M = 414.2 (M+H)+
Example 132
l-(2,2-Difluoro-benzo[l,3ldioxol-5-yl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000131_0002
The product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-I l) and 4-hydrazino-2-methylpyridine according to the method described for example 91.
MS: M = 410.2 (M+H)+
Example 133
Λr,Λr-Dimethyl-3-{3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yll-4-oxo-4H-pyridazin-l-yl}- benzenesulfonamide
Figure imgf000132_0001
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzenesulfonamide (A- 12) and 4-hydrazino-2-methylpyridine according to the method described for example 91.
MS: M = 437.2 (M+H)+
Example 134
l-(3-Fluoro-phenyl)-3-[2-(2-methyl-pyridin-4-yl)-2ff-pyrazol-3-yll-lff-pyridazin-4-one
Figure imgf000132_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-fluoro-phenyl)- lH-pyridazin-4-one (A-13) and 4-hydrazino-2-methylpyridine according to the method described for example 91.
MS: M = 348.2 (M+H)+
Example 135
3-[2-(3-Fluoro-phenyl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin-4-one
Figure imgf000133_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 3-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 417.2 (M+H)+
Example 136
3-[2-(2,5-Difluoro-phenyl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin-4- one
Figure imgf000133_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 2,5-difluoro-phenylhydrazine according to the method described for example 91.
MS: M = 435.3 (M+H)+
Example 137
3-[2-(6-Fluoro-quinolin-4-yl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin- 4-one
Figure imgf000134_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and (6-fluoro-quinolin-4-yl)-hydrazine according to the method described for example 91.
MS: M = 468.2 (M+H)+
Example 138
3-[2-(4-Fluoro-phenyl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin-4-one
Figure imgf000134_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 4-fluoro-phenylhydrazine according to the method described for example 43.
MS: M = 417.1 (M+H)+
Example 139
4-{5-[4-Oxo-l-(4-trifluoromethoxy-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzonitrile
Figure imgf000135_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 4-hydrazino-benzonitrile in ethanol as solvent according to the method described for example 43.
MS: M = 424.1 (M+H)+
Example 140
3-(2-Pyridin-3-yl-2ff-pyrazol-3-yl)-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin-4-one
Figure imgf000135_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and pyridine-3-yl-hydrazine according to the method described for example 43.
MS: M = 400.1 (M+H)+
Example 141
3-[2-(3-Methanesulfonyl-phenyl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lff- pγridazin-4-one
Figure imgf000136_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and (3-methanesulfonyl-phenyl)- hydrazine according to the method described for example 91.
MS: M = 477.0 (M+H)+
Example 142
l-(4-Trifluoromethoxy-phenyl)-3-[2-(3-trifluoromethoxy-phenyl)-2ff-pyrazol-3-yll-lff- pγridazin-4-one
Figure imgf000136_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 3-trifluoromethoxy-phenylhydrazine according to the method described for example 91.
MS: M = 483.2 (M+H)+
Example 143
Λr,Λr-Dimethyl-3-{5-[4-oxo-l-(4-trifluoromethoxy-phenyl)-l,4-dihydro-pyridazin-3-yll- pyrazol- 1 - γl| -benzenesulfonamide
Figure imgf000137_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 3-hydrazino-N,N-dimethyl- benzenesulfonamide according to the method described for example 91.
MS: M = 506.1 (M+H)+
Example 144
3-[2-(3-Chloro-phenyl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin-4-one
Figure imgf000137_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 3-chloro-phenylhydrazine according to the method described for example 91.
MS: M = 433.3 (M+H)+
Example 145
3-[2-(2,2-Difluoro-benzo[l,3ldioxol-4-yl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)- lff-pγridazin-4-one
Figure imgf000138_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 2,2-difluoro- benzo[l,3]dioxol-4-yl- hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
MS: M = 479.0 (M+H)+
Example 146
3-[2-(2,2-Difluoro-benzo[l,3ldioxol-5-yl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)- lff-pγridazin-4-one
Figure imgf000138_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 2,2-difluoro- benzo[l,3]dioxol-5-yl- hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
MS: M = 479.0 (M+H)+ Example 147
3-[2-(3-Trifluoromethanesulfonyl-phenyl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)- lff-pyridazin-4-one
Figure imgf000139_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and (3-trifluoromethanesulfonyl-phenyl)- hydrazine according to the method described for example 91.
MS: M = 531.1 (M+H)+
Example 148
3- [2-(6-Fluoro-quinolin-4-yl)-2ff-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)- lff-pyridazin- 4-one
Figure imgf000139_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and (6-fluoro-quinolin-4-yl)-hydrazine according to the method described for example 91.
MS: M = 468.2 (M+H)+ Example 149
l-(4-Difluoromethoxy-phenyl)-3-[2-(6-fluoro-quinolin-4-yl)-2ff-pyrazol-3-yll-lff-pyridazin-4- one
Figure imgf000140_0001
The product was obtained starting from l-(4-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-9) and (6-fluoro-quinolin-4-yl)-hydrazine according to the method described for example 91.
MS: M = 450.1 (M+H)+
Example 150
l-(3-Difluoromethoxy-phenyl)-3-[2-(6-fluoro-quinolin-4-yl)-2ff-pyrazol-3-yll-lff-pyridazin-4- one
Figure imgf000140_0002
The product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and (6-fluoro-quinolin-4-yl)-hydrazine according to the method described for example 91.
MS: M = 450.1 (M+H)+ Example 151
l-(2,2-Difluoro-benzo[l,3ldioxol-5-yl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000141_0001
The product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-I l) and (6-fluoro-quinolin-4-yl)-hydrazine according to the method described for example 91.
MS: M = 464.1 (M+H)+
Example 152
l-(4-Methanesulfonyl-phenyl)-3-(2-phenyl-2ff-pyrazol-3-yl)-lff-pyridazin-4-one
Figure imgf000141_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-16) and phenylhydrazine according to the method described for example 43.
MS: M = 393.1 (M+H)+
Example 153 3-[2-(4-Fluoro-phenγl)-2H-pyrazol-3-γl1-l-(4-methanesulfonγl-phenγl)-lH-pγridazin-4-one
Figure imgf000142_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-16) and 4-fluoro-phenylhydrazine according to the method described for example 43.
MS: M = 411.1 (M+H)+
Example 154
3-[2-(3-Fluoro-phenγl)-2H-pγrazol-3-γl1-l-(4-methanesulfonγl-phenγl)-lff-pγridazin-4-one
Figure imgf000142_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-16) and 3-fluoro-phenylhydrazine according to the method described for example 43.
MS: M = 411.1 (M+H)+
Example 155
4-{5-[l-(4-Methanesulfonγl-phenγl)-4-oxo-l,4-dihγdro-pγridazin-3-γll-pγrazol-l-γl}- benzonitrile
Figure imgf000143_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-16) and 4-hydrazino-benzonitrile in ethanol as solvent according to the method described for example 43.
MS: M = 418.1 (M+H)+
Example 156
3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yll-l-(4-methanesulfonyl-phenyl)-lff-pyridazin-4-one
Figure imgf000143_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-16) and 4-chloro-phenylhydrazine according to the method described for example 43.
MS: M = 427.1 (M+H)+
Example 157
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yll-l-(4-methanesulfonyl-phenyl)-lff-pyridazin-4-one
Figure imgf000144_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- methansulfonyl-phenyl)-lH-pyridazin-4-one (A- 16) and 3-chloro-phenylhydrazine according to the method described for example 43.
MS: M = 427.1 (M+H)+
Example 158
l-(4-Methanesulfonyl-phenyl)-3-[2-(4-trifluoromethoxy-phenyl)-2ff-pyrazol-3-yll-lff- pγridazin-4-one
Figure imgf000144_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-16) and 4-trifluoromethoxy-phenylhydrazine according to the method described for example 43.
MS: M = 477.1 (M+H)+
Example 159
l-(3-Trifluoromethoxy-phenyl)-3-[2-(3-trifluoromethoxy-phenyl)-2ff-pyrazol-3-yll-lff- pyridazin-4-one
Figure imgf000145_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and 3-trifluoromethoxy-phenylhydrazine according to the method described for example 91.
MS: M = 483.2 (M+H)+
Example 160
Λr,Λr-Dimethyl-3-{5-[4-oxo-l-(3-trifluoromethoxy-phenyl)-l,4-dihydro-pyridazin-3-yll- pyrazol- 1 - yl| -benzenesulfonamide
Figure imgf000145_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and 3-hydrazino-N,N-dimethyl- benzenesulfonamide according to the method described for example 91.
MS: M = 506.1 (M+H)+
Example 161
3-[2-(2,2-Difluoro-benzo[l,3ldioxol-4-yl)-2tf-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)- lff-pyridazin-4-one
Figure imgf000146_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and 2,2-difluoro- benzo[l,3]dioxol-4-yl- hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
MS: M = 479.1 (M+H)+
Example 162
3-[2-(2,2-Difluoro-benzo[l,3ldioxol-5-yl)-2ff-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)- lff-pγridazin-4-one
Figure imgf000146_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and 2,2-difluoro- benzo[l,3]dioxol-5-yl- hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
MS: M = 479.1 (M+H)+
Example 163 3-[2-(3-Trifluoromethanesulfonyl-phenyl)-2ff-pyrazol-3-yll-l-(3-trifluoromethoxy-phenyl)- lff-pyridazin-4-one
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and (3-trifluoromethanesulfonyl-phenyl)- hydrazine according to the method described for example 91.
MS: M = 531.1 (M+H)+
Example 164
l-(4-Difluoromethoxy-phenyl)-3-[2-(3-methanesulfonyl-phenyl)-2H-pyrazol-3-yll-lff- pyridazin-4-one
Figure imgf000147_0002
The product was obtained starting from l-(4-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-9) and ( 3 -methanesulfonyl-phenyl) -hydrazine according to the method described for example 91.
MS: M = 459.3 (M+H)+
Example 165 l-(4-Difluoromethoxy-phenyl)-3-[2-(3-trifluoroniethoxy-phenyl)-2ff-pyrazol-3-yll-lff- pγridazin-4-one
Figure imgf000148_0001
The product was obtained starting from l-(4-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-9) and 3-trifluoromethoxy-phenylhydrazine according to the method described for example 91.
MS: M = 465.2 (M+H)+
Example 166
3-[2-(2,2-Difluoro-benzo[l,3ldioxol-4-yl)-2H-pyrazol-3-yll-l-(4-difluoromethoxy-phenyl)-lff- pyridazin-4-one
Figure imgf000148_0002
The product was obtained starting from l-(4-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-9) and 2,2-difluoro- benzo[l,3]dioxol-4-yl- hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
MS: M = 461.3 (M+H)+ Example 167
l-(4-Difluoromethoxy-phenyl)-3-[2-(2-fluoro-phenyl)-2ff-pyrazol-3-yll-lff-pyridazin-4-one
Figure imgf000149_0001
The product was obtained starting from l-(4-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-9) and 2-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 399.1 (M+H)+
Example 168
l-(3-Difluoromethoxy-phenyl)-3-[2-(3-methanesulfonyl-phenyl)-2ff-pyrazol-3-yll-lff- pyridazin-4-one
Figure imgf000149_0002
The product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and (3-methanesulfonyl-phenyl)- hydrazine according to the method described for example 91.
MS: M = 459.3 (M+H)+
Example 169 l-(3-Difluoromethoxy-phenyl)-3-[2-(3-trifluoroniethoxy-phenyl)-2ff-pyrazol-3-yll-lff- pγridazin-4-one
Figure imgf000150_0001
The product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and 3-trifluoromethoxy-phenylhydrazine according to the method described for example 91.
MS: M = 465.1 (M+H)+
Example 170
3-[2-(2,2-Difluoro-benzo[l,3ldioxol-4-yl)-2H-pyrazol-3-yll-l-(3-difluoromethoxy-phenyl)-lH- pyridazin-4-one
Figure imgf000150_0002
The product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and 2,2-difluoro- benzo[l,3]dioxol-4-yl- hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
MS: M = 461.3 (M+H)+
Example 171 l-(3-Difluoromethoxy-phenyl)-3-[2-(2-fluoro-phenyl)-2ff-pyrazol-3-yll-lff-pyridazin-4-one
Figure imgf000151_0001
The product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and 2-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 399.1 (M+H)+
Example 172
l-(2,2-Difluoro-benzo[l,3ldioxol-5-yl)-3-[2-(3-methanesulfonyl-phenyl)-2H-pyrazol-3-yll-lH- pyridazin-4-one
Figure imgf000151_0002
The product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-I l) and (3-methanesulfonyl-phenyl)- hydrazine according to the method described for example 91.
MS: M = 473.2 (M+H)+
Example 173 l-(2,2-Difluoro-benzo[l,3ldioxol-5-yl)-3-[2-(2,2-difluoro-benzo[l,3ldioxol-4-yl)-2H-pyrazol- 3-yll - lff-pyridazin-4-one
Figure imgf000152_0001
The product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-I l) and 2,2-difluoro- benzo[l,3]dioxol-4-yl- hydrazine (prepared from the corresponding amino derivative using sodium nitrite and tin(II) chloride as described in J. Med. Chem. 2003, 46, 4676-4686) according to the method described for example 91.
MS: M = 475.0 (M+H)+
Example 174
l-(2,2-Difluoro-benzo[l,3ldioxol-5-yl)-3-[2-(2-fluoro-phenyl)-2ff-pyrazol-3-yll-lff-pyridazin- 4-one
Figure imgf000152_0002
The product was obtained starting from l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-I l) and 2-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 413.2 (M+H)+ Example 175
3-[2-(4-Fluoro-phenyl)-2H-pyrazol-3-yll-l-(3-hydroxy-phenyl)-lff-pyridazin-4-one
Figure imgf000153_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)- l-(3- hydroxyphenyl)-lH-pyridazin-4-one (A- 17) and 4-fluoro-phenylhydrazine according to the method described for example 43.
MS: M = 349.1 (M+H)+
Example 176
Λr-(3-{5-[4-Oxo-l-(4-trifluoromethoxy-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- phenyl) - acetamide
Figure imgf000153_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and N-(3-hydrazino-phenyl)-acetamide according to the method described for example 91.
MS: M = 456.2 (M+H)+
Example 177 3-[2-(6-Fluoro-2-methyl-quinolin-4-yl)-2ff-pyrazol-3-yll-l-(3-trifluoroniethoxy-phenyl)-lff- pγridazin-4-one
Figure imgf000154_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and (6-fluoro-2-methyl-quinolin-4-yl)- hydrazine according to the method described for example 91.
MS: M = 482.2 (M+H)+
Example 178
3-(2-Quinolin-4-yl-2H-pyrazol-3-yl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000154_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and quinolin-4-yl-hydrazine according to the method described for example 91.
MS: M = 450.2 (M+H)+
Example 179
Λr-(3-{5-[4-Oxo-l-(3-trifluoromethoxy-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- phenyl) - acetamide
Figure imgf000155_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and N-(3-hydrazino-phenyl)-acetamide according to the method described for example 91.
MS: M = 456.2 (M+H)+
Example 180
Λr-(3-{5-[l-(3-Dimethylsulfamoyl-phenyl)-4-oxo-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- phenyl) - acetamide
Figure imgf000155_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzenesulfonamide (A-12) and N-(3-hydrazino-phenyl)- acetamide according to the method described for example 91.
MS: M = 479.1 (M+H)+
Example 181
3-[2-(4-Hydroxy-phenyl)-2H-pyrazol-3-yll-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one
Figure imgf000156_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-7) and 4-hydroxy-phenylhydrazine according to the method described for example 43.
MS: M = 409.1 (M+H)+
Example 182
3-[2-(3-Chloro-phenyl)-2ff-pyrazol-3-yll-l-phenyl-lff-pyridazin-4-one
Figure imgf000156_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 3-chloro-phenylhydrazine according to the method described for example 1.
MS: M = 349.2 (M+H)+
Example 183
3-[2-(2-Fluoro-phenyl)-2ff-pyrazol-3-yll-l-phenyl-lff-pyridazin-4-one
Figure imgf000156_0003
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and 2-fluoro-phenylhydrazine according to the method described for example 1.
MS: M = 333.2 (M+H)+
Example 184
3-(2-Naphthalen-l-γl-2ff-pγrazol-3-γl)-l-phenγl-lff-pγridazin-4-one
Figure imgf000157_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and naphthalen-1-yl-hydrazine according to the method described for example 1.
MS: M = 365.1 (M+H)+
Example 185
4-{5-[4-Oxo-l-(4-trifluoromethoxγ-phenγl)-l,4-dihγdro-pγridazin-3-γll-pγrazol-l-γl}- benzenesulfonamide
Figure imgf000157_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 4-hydrazino-benzenesulfonamide according to the method described for example 43. MS: M = 478.1 (M+H)H
Example 186
3-(2-Quinolin-4-yl-2H-pyrazol-3-yl)-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin-4-one
Figure imgf000158_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and quinolin-4-yl-hydrazine according to the method described for example 43.
MS: M = 450.1 (M+H)+
Example 187
3-[2-(6-Fluoro-quinolin-4-yl)-2ff-pyrazol-3-yll-l-phenyl-lff-pyridazin-4-one
Figure imgf000158_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and (6-fluoro-quinolin-4-yl) -hydrazine according to the method described for example 1.
MS: M = 384.1 (M+H)+
Example 188
3-(2-Naphthalen-l-yl-2ff-pyrazol-3-yl)-l-(3-trifluoromethyl-phenyl)-lff-pyridazin-4-one
Figure imgf000159_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and naphthalen-1-yl-hydrazine according to the method described for example 1.
MS: M = 433.2 (M+H)+
Example 189
3-[2-(6-Fluoro-quinolin-4-yl)-2ff-pyrazol-3-yll-l-(3-trifluoromethyl-phenyl)-lff-pyridazin-4- one
Figure imgf000159_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and (6-fluoro-quinolin-4-yl)-hydrazine according to the method described for example 1.
MS: M = 452.1 (M+H)+
Example 190
l-(3-Bromo-phenyl)-3-(2-naphthalen-l-yl-2ff-pyrazol-3-yl)-lff-pyridazin-4-one
Figure imgf000160_0001
The product was obtained starting from l-(3-Bromo-phenyl)-3-((E)-3-dimethylamino- acryloyl)-lH-pyridazin-4-one (A- 18) and naphthalen-1-yl-hydrazine according to the method described for example 1.
MS: M = 443.2 (M+H)+
Example 191
l-(4-Methanesulfonγl-phenγl)-3-(2-quinolin-4-yl-2H-pyrazol-3-γl)-lff-pγridazin-4-one
Figure imgf000160_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-16) and quinolin-4-yl-hydrazine according to the method described for example 43.
MS: M = 444.3 (M+H)+
Example 192
3-(2-Isoquinolin-5-yl-2ff-pyrazol-3-yl)-l-(4-methanesulfonyl-phenyl)-lff-pyridazin-4-one
Figure imgf000161_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- methansulfonyl-phenyl)-lH-pyridazin-4-one (A-16) and isoquinolin-5-yl-hydrazine according to the method described for example 43.
MS: M = 444.5 (M+H)+
Example 193
3-[2-(2-Chloro-pyridin-4-yl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin-4- one
Figure imgf000161_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 4-hydrazino-2-chloropyridine according to the method described for example 43.
MS: M = 434.0 (M+H)+
Example 194
3-[2-(6-Fluoro-2-methyl-quinolin-4-yl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lff- pyridazin-4-one
Figure imgf000162_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and (6-fluoro-2-methyl-quinolin-4-yl)- hydrazine according to the method described for example 91.
MS: M = 482.2 (M+H)+
Example 195
3-{3-[2-(6-Fluoro-2-methyl-quinolin-4-yl)-2ff-pyrazol-3-yll-4-oxo-4ff-pyridazin-l-yl}-Λr,Λr- dimethyl-benzenesulfonamide
Figure imgf000162_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzenesulfonamide (A-12) and (6-fluoro-2-methyl-quinolin-4- yl) -hydrazine according to the method described for example 91.
MS: M = 505.1 (M+H)+
Example 196
Λr,Λr-Dimethyl-3-[4-oxo-3-(2-quinolin-4-yl-2ff-pyrazol-3-yl)-4ff-pyridazin-l-yll- benzenesulfonamide
Figure imgf000163_0001
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzenesulfonamide (A- 12) and quinolin-4-yl-hydrazine according to the method described for example 91.
MS: M = 473.3 (M+H)+
Example 197
l-(3-Methoxy-phenyl)-3-(2-quinolin-4-yl-2ff-pyrazol-3-yl)-lff-pyridazin-4-one
Figure imgf000163_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-methoxy- phenyl) -lH-pyridazin-4-one (A-5) and quinolin-4-yl-hydrazine according to the method described for example 91.
MS: M = 396.0 (M+H)+
Example 198
3-[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazol-3-yll-l-(3-methoxy-phenyl)-lff-pyridazin-4-one
Figure imgf000163_0003
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-methoxy- phenyl)-lH-pyridazin-4-one (A-5) and (6-fluoro-quinolin-4-yl)-hydrazine according to the method described for example 91.
MS: M = 414.3 (M+H)+
Example 199
3-[2-(6-Fluoro-2-methyl-quinolin-4-yl)-2ff-pyrazol-3-yll-l-(3-methoxy-phenyl)-lff-pyridazin- 4-one
Figure imgf000164_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-methoxy- phenyl) -lH-pyridazin-4-one (A-5) and (6-fluoro-2-methyl-quinolin-4-yl)-hydrazine according to the method described for example 91.
MS: M = 428.2 (M+H)+
Example 200
3-[2-(2-Ethoxy-pyridin-4-yl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin-4- one
Figure imgf000164_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 4-hydrazino-2-ethoxypyridine according to the method described for example 43.
MS: M = 444.2 (M+H)+
Example 201
l-(3-Methoxy-phenγl)-3-(2-naphthalen-l-γl-2ff-pyrazol-3-γl)-lff-pγridazin-4-one
Figure imgf000165_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-methoxy- phenyl)-lH-pyridazin-4-one (A-5) and naphthalen-1-yl-hydrazine according to the method described for example 91.
MS: M = 395.1 (M+H)+
Example 202
3-[2-(2,3-Dihvdro-benzo[l,4ldioxin-6-yl)-2H-pyrazol-3-yll-l-(3-methoxy-phenyl)-lH- pyridazin-4-one
Figure imgf000165_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3-methoxy- phenyl)-lH-pyridazin-4-one (A-5) and (2,3-dihydro-benzo[l,4]dioxin-6-yl)-hydrazine according to the method described for example 91.
MS: M = 403.4 (M+H)+ Example 203
3-(2-Quinolin-5-yl-2H-pyrazol-3-yl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000166_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-6) and quinolin-5-yl-hydrazine according to the method described for example 91.
MS: M = 450.1 (M+H)+
Example 204
l-(3-Difluoromethoxy-phenyl)-3-(2-quinolin-5-yl-2ff-pyrazol-3-yl)-lff-pyridazin-4-one
Figure imgf000166_0002
The product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and quinolin-5-yl-hydrazine according to the method described for example 91.
MS: M = 432.2(M+H)+
Example 205
3-[2-(2-Chloro-pyridin-4-yl)-2ff-pyrazol-3-yll-l-(3-difluoromethoxy-phenyl)-lff-pyridazin-4- one
Figure imgf000167_0001
The product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and 4-hydrazino-2-chloropyridine according to the method described for example 91.
MS: M = 416.1 (M+H)+
Example 206
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yll-l-(3-difluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000167_0002
The product was obtained starting from l-(3-Difluoromethoxy-phenyl)-3-((E)-3- dimethylamino-acryloyl)-lH-pyridazin-4-one (A-IO) and 3-chloro-phenylhydrazine according to the method described for example 91.
MS: M = 415.2 (M+H)+
Example 207
3-[4-Oxo-3-(2-quinolin-4-yl-2ff-pyrazol-3-yl)-4ff-pyridazin-l-yll-benzonitrile
Figure imgf000168_0001
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-benzonitrile (A- 19) and quinolin-4-yl-hydrazine according to the method described for example 91.
MS: M = 391.1 (M+H)+
Example 208
3-{3-[2-(2-Fluoro-phenyl)-2ff-pyrazol-3-yll-4-oxo-4ff-pyridazin-l-yl}-Λr,Λr-dimethyl- benzamide
Figure imgf000168_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzamide (A-20) and 2-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 404.3 (M+H)+
Example 209
3-{3-[2-(3-Chloro-phenyl)-2ff-pyrazol-3-yll-4-oxo-4ff-pyridazin-l-yl}-Λr,Λr-dimethyl- benzamide
Figure imgf000169_0001
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzamide (A-20) and 3-chloro-phenylhydrazine according to the method described for example 91.
MS: M = 420.2 (M+H)+
Example 210
Λr,Λr-Diethyl-3-{3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yll-4-oxo-4H-pyridazin-l-yl}- benzenesulfonamide
Figure imgf000169_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-diethyl-benzenesulfonamide (A-21) and 3-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 468.2 (M+H)+
Example 211
3-(2-Phenγl-2H-pyrazol-3-γl)-l-(4-trifluoromethγl-phenγl)-lH-pγridazin-4-one
Figure imgf000170_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-22) and phenylhydrazine according to the method described for example 1.
MS: M = 383.2 (M+H)+
Example 212
3-[2-(2-Fluoro-phenyl)-2ff-pyrazol-3-yll-l-(4-trifluoromethyl-phenyl)-lff-pyridazin-4-one
Figure imgf000170_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-22) and 2-fluoro-phenylhydrazine according to the method described for example 1.
MS: M = 401.1 (M+H)+
Example 213
3-[2-(3-Chloro-phenyl)-2ff-pyrazol-3-yll-l-(4-trifluoromethyl-phenyl)-lff-pyridazin-4-one
Figure imgf000171_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-22) and 3-chloro-phenylhydrazine according to the method described for example 1.
MS: M = 417.2 (M+H)+
Example 214
3-(2-Ouinolin-4-yl-2ff-pyrazol-3-yl)-l-(3-trifluoromethyl-phenyl)-lff-pyridazin-4-one
Figure imgf000171_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-3) and quinolin-4-yl-hydrazine according to the method described for example 91.
MS: M = 434.3 (M+H)+
Example 215
3-(2-Ouinolin-8-yl-2ff-pyrazol-3-yl)-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin-4-one
Figure imgf000172_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and quinolin-8-yl-hydrazine according to the method described for example 43.
MS: M = 450.2 (M+H)+
Example 216
3-(2-o-Tolyl-2H-pyrazol-3-γl)-l-(4-trifluoromethγl-phenγl)-lH-pγridazin-4-one
Figure imgf000172_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-22) and o-tolylhydrazine according to the method described for example 1.
MS: M = 397.1 (M+H)+
Example 217
3-{5-[4-Oxo-l-(4-trifluoromethyl-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzonitrile
Figure imgf000173_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-22) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for example 1.
MS: M = 408.2 (M+H)+
Example 218
l-(3-Chloro-phenyl)-3-[2-(2-fluoro-phenyl)-2ff-pyrazol-3-yll-lff-pyridazin-4-one
Figure imgf000173_0002
The product was obtained starting from l-(3-Chloro-phenyl)-3-((E)-3-dimethylamino- acryloyl)-lH-pyridazin-4-one (A-23) and 2-fluoro-phenylhydrazine according to the method described for example 1.
MS: M = 367.0 (M+H)+
Example 219
l-(3-Chloro-phenyl)-3-[2-(3-chloro-phenyl)-2ff-pyrazol-3-yll-lff-pyridazin-4-one
Figure imgf000174_0001
The product was obtained starting from l-(3-Chloro-phenyl)-3-((E)-3-dimethylamino- acryloyl)-lH-pyridazin-4-one (A-23) and 3-chloro-phenylhydrazine according to the method described for example 1.
MS: M = 383.0 (M+H)+
Example 220
3-[2-(3-Methyl-isothiazol-5-yl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin- 4-one
Figure imgf000174_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and (3-methyl-isothiazol-5-yl)-hydrazine according to the method described for example 43.
MS: M = 420.0 (M+H)+
Example 221
l-(3-Chloro-phenγl)-3-(2-naphthalen-l-γl-2H-pyrazol-3-γl)-lH-pγridazin-4-one
Figure imgf000175_0001
The product was obtained starting from l-(3-Chloro-phenyl)-3-((E)-3-dimethylamino- acryloyl)-lH-pyridazin-4-one (A-23) and naphthalen-1-yl-hydrazine according to the method described for example 1.
MS: M = 399.1 (M+H)+
Example 222
3-(2-Naphthalen-l-yl-2ff-pyrazol-3-yl)-l-(4-trifluoromethyl-phenyl)-lff-pyridazin-4-one
Figure imgf000175_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-22) and naphthalen-1-yl-hydrazine according to the method described for example 1.
MS: M = 433.2 (M+H)+
Example 223
l-(4-Chloro-phenγl)-3-(2-naphthalen-l-γl-2H-pyrazol-3-γl)-lH-pγridazin-4-one
Figure imgf000176_0001
The product was obtained starting from l-(4-Chloro-phenyl)-3-((E)-3-dimethylamino- acryloyl)-lH-pyridazin-4-one (A- 24) and naphthalen-1-yl-hydrazine according to the method described for example 1.
MS: M = 399.1 (M+H)+
Example 224
3-[2-(6-Chloro-quinolin-4-yl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin- 4-one
Figure imgf000176_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and (6-chloro-quinolin-4-yl)-hydrazine according to the method described for example 91.
MS: M = 484.1 (M+H)+
Example 225
3-(2-Isoquinolin-5-yl-2ff-pyrazol-3-yl)-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin-4-one
Figure imgf000177_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and isoquinolin-5-yl-hydrazine according to the method described for example 91.
MS: M = 450.1 (M+H)+
Example 226
3-(2-Isoquinolin-4-yl-2ff-pyrazol-3-yl)-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin-4-one
Figure imgf000177_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and isoquinolin-4-yl-hydrazine according to the method described for example 91.
MS: M = 450.1 (M+H)+
Example 227
3-(2-Ouinolin-5-yl-2ff-pyrazol-3-yl)-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin-4-one
Figure imgf000178_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and quinolin-5-yl-hydrazine according to the method described for example 91.
MS: M = 450.1 (M+H)+
Example 228
l-(4-Chloro-phenyl)-3-[2-(2-fluoro-phenyl)-2ff-pyrazol-3-yll-lff-pyridazin-4-one
Figure imgf000178_0002
The product was obtained starting from l-(4-Chloro-phenyl)-3-((E)-3-dimethylamino- acryloyl)-lH-pyridazin-4-one (A- 24) and 2-fluoro-phenylhydrazine according to the method described for example 1.
MS: M = 367.1 (M+H)+
Example 229
l-(4-Chloro-phenyl)-3-[2-(3-chloro-phenyl)-2ff-pyrazol-3-yll-lff-pyridazin-4-one
Figure imgf000179_0001
The product was obtained starting from l-(4-Chloro-phenyl)-3-((E)-3-dimethylamino- acryloyl)-lH-pyridazin-4-one (A-24) and 3-chloro-phenylhydrazine according to the method described for example 1.
MS: M = 383.0 (M+H)+
Example 230
l-(3-Dimethylaminomethyl-phenyl)-3-[2-(2-fluoro-phenyl)-2ff-pyrazol-3-yll-lff-pyridazin-4- one
Figure imgf000179_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- dimethylaminomethyl-phenyl)-lH-pyridazin-4-one (A-25) and 2-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 390.1 (M+H)+
Example 231
3-[2-(2-Fluoro-phenyl)-2ff-pyrazol-3-yll-l-[3-(piperidine-l-sulfonyl)-phenyll-lff-pyridazin-4- one
Figure imgf000180_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(piperidine-l- sulfonyl)-phenyl]-lH-pyridazin-4-one (A-26) and 2-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 480.1 (M+H)+
Example 232
3-[2-(2-Fluoro-phenyl)-2ff-pyrazol-3-yll-l-(4-trifluoromethanesulfonyl-phenyl)-lff-pyridazin- 4-one
Figure imgf000180_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-27) and 2-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 465.1 (M+H)+
Example 233
l-(4-Dimethylaminomethyl-phenyl)-3-[2-(2-fluoro-phenyl)-2ff-pyrazol-3-yll-lff-pyridazin-4- one
Figure imgf000181_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- dimethylaminomethyl-phenyl)-lH-pyridazin-4-one (A-28) and 2-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 390.1 (M+H)+
Example 234
3-(2-Isoquinolin-5-yl-2ff-pyrazol-3-yl)-l-(4-trifluoromethanesulfonyl-phenyl)-lff-pyridazin-4- one
Figure imgf000181_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-27) and isoquinolin-5-yl-hydrazine according to the method described for example 43.
MS: M = 498.0 (M+H)+
Example 235
3-(2-Ouinolin-5-yl-2ff-pyrazol-3-yl)-l-(4-trifluoromethanesulfonyl-phenyl)-lff-pyridazin-4- one
Figure imgf000182_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-27) and quinolin-5-yl-hydrazine according to the method described for example 43.
MS: M = 498.1 (M+H)+
Example 236
3-[2-(4-Chloro-naphthalen-l-γl)-2ff-pγrazol-3-γl1-l-phenγl-lff-pγridazin-4-one
Figure imgf000182_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-phenyl-lH- pyridazin-4-one (A-I) and (4-chloro-naphthalen-l-yl) -hydrazine according to the method described for example 1.
MS: M = 399.1 (M+H)+
Example 237
3-[2-(4-Chloro-naphthalen-l-γl)-2ff-pγrazol-3-γll-l-(4-trifluoromethγl-phenγl)-lff-pγridazin- 4-one
Figure imgf000183_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethyl-phenyl)-lH-pyridazin-4-one (A-22) and (4-chloro-naphthalen-l-yl) -hydrazine according to the method described for example 1.
MS: M = 467.2 (M+H)+
Example 238
3-[2-(2-Fluoro-phenyl)-2ff-pyrazol-3-yll-l-[3-(pyrrolidine-l-sulfonyl)-phenyll-lff-pyridazin-
4-one
Figure imgf000183_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(pyrrolidine-l- sulfonyl)-phenyl]-lH-pyridazin-4-one (A-29) and 2-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 466.1 (M+H)+
Example 239
4-{3-[2-(2-Fluoro-phenyl)-2ff-pyrazol-3-yll-4-oxo-4ff-pyridazin-l-yl}-Λr-methyl- benzenesulfonamide
Figure imgf000184_0001
The product was obtained starting from 4-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N-methyl-benzenesulfonamide (A-30) and 2-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 426.1 (M+H)+
Example 240
3-[2-(7-Chloro-quinolin-4-yl)-2ff-pyrazol-3-yll-l-(4-trifluoromethoxy-phenyl)-lff-pyridazin- 4-one
Figure imgf000184_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and (7-chloro-quinolin-4-yl) -hydrazine according to the method described for example 91.
MS: M = 484.1 (M+H)+
Example 241
Λr,Λr-Diethyl-3-[4-oxo-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-4H-pyridazin-l-yll- benzenesulfonamide
Figure imgf000185_0001
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-diethyl-benzenesulfonamide (A-21) and quinolin-5-yl-hydrazine according to the method described for example 91.
MS: M = 501.2 (M+H)+
Example 242
3-(2-Ouinolin-4-yl-2ff-pyrazol-3-yl)-l-(4-trifluoromethanesulfonyl-phenyl)-lff-pyridazin-4- one
Figure imgf000185_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-27) and quinolin-4-yl-hydrazine according to the method described for example 43.
MS: M = 498.1 (M+H)+
Example 243
3-[2-(4-Chloro-naphthalen-l-yl)-2ff-pyrazol-3-yll-l-(4-chloro-phenyl)-lff-pyridazin-4-one
Figure imgf000186_0001
The product was obtained starting from l-(4-Chloro-phenyl)-3-((E)-3-dimethylamino- acryloyl)-lH-pyridazin-4-one (A- 24) and (4-chloro-naphthalen-l-yl) -hydrazine according to the method described for example 1.
MS: M = 433.1 (M+H)+
Example 244
3-[2-(4-Chloro-naphthalen-l-yl)-2ff-pyrazol-3-yll-l-(3-chloro-phenyl)-lff-pyridazin-4-one
Figure imgf000186_0002
The product was obtained starting from l-(3-Chloro-phenyl)-3-((E)-3-dimethylamino- acryloyl)-lH-pyridazin-4-one (A-23) and (4-chloro-naphthalen-l-yl) -hydrazine according to the method described for example 1.
MS: M = 433.1 (M+H)+
Example 245
Λr,Λr-Diethyl-3-[3-(2-isoquinolin-5-yl-2ff-pyrazol-3-yl)-4-oxo-4ff-pyridazin-l-yll- benzenesulfonamide
Figure imgf000187_0001
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-diethyl-benzenesulfonamide (A-21) and isoquinolin-5-yl-hydrazine according to the method described for example 91.
MS: M = 501.2 (M+H)+
Example 246
3-(2-Isoquinolin-8-yl-2H-pyrazol-3-yl)-l-(4-trifluoromethoxy-phenyl)-lH-pyridazin-4-one
Figure imgf000187_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and isoquinolin-8-yl-hydrazine according to the method described for example 91.
MS: M = 450.1 (M+H)+
Example 247
l-(4-Trifluoromethoxy-phenyl)-3-[2-(2-trifluoromethyl-pyridin-4-yl)-2ff-pyrazol-3-yll-lff- pyridazin-4-one
Figure imgf000188_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethoxy-phenyl)-lH-pyridazin-4-one (A-8) and 4-hydrazino-2- trifluoromethylpyridine according to the method described for example 91.
MS: M = 468.1 (M+H)+
Example 248
3-[3-(2-Isoquinolin-5-γl-2ff-pyrazol-3-γl)-4-oxo-4ff-pyridazin-l-yll-benzonitrile
Figure imgf000188_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-benzonitrile (A-19) and isoquinolin-5-yl-hydrazine according to the method described for example 91.
MS: M = 391.2 (M+H)+
Example 249
3-{3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-γl1-4-oxo-4H-pyridazin-l-yl}-benzonitrile
Figure imgf000189_0001
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-benzonitrile (A- 19) and (7-chloro -quinolin-4-yl) -hydrazine according to the method described for example 91.
MS: M = 425.1 (M+H)+
Example 250
l-[3-(Pγrrolidine-l-sulfonγl)-phenγl1-3-(2-quinolin-5-γl-2H-pyrazol-3-γl)-lH-pγridazin-4-one
Figure imgf000189_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(pyrrolidine-l- sulfonyl)-phenyl]-lH-pyridazin-4-one (A-29) and quinolin-5-yl-hydrazine according to the method described for example 91.
MS: M = 499.2 (M+H)+
Example 251
3-[2-(7-Chloro-quinolin-4-yl)-2ff-pyrazol-3-yll-l-[3-(pyrrolidine-l-sulfonyl)-phenyll-lff- pyridazin-4-one
Figure imgf000190_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(pyrrolidine-l- sulfonyl)-phenyl]-lH-pyridazin-4-one (A-29) and (7-chloro-quinolin-4-yl) -hydrazine according to the method described for example 91.
MS: M = 533.1 (M+H)+
Example 252
3-{3-[2-(7-Chloro-quinolin-4-yl)-2ff-pyrazol-3-yll-4-oxo-4ff-pyridazin-l-yl}-Λr,Λr-diethyl- benzenesulfonamide
Figure imgf000190_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-diethyl-benzenesulfonamide (A-21) and (7-chloro-quinolin-4-yl)- hydrazine according to the method described for example 91.
MS: M = 533.1 (M+H)+
Example 253
3-{3-[2-(7-Chloro-quinolin-4-yl)-2ff-pyrazol-3-yll-4-oxo-4ff-pyridazin-l-yl}-Λr-methyl- benzenesulfonamide
Figure imgf000191_0001
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N-methyl-benzenesulfonamide (A-31) and (7-chloro-quinolin-4-yl) -hydrazine according to the method described for example 91.
MS: M = 499.1 (M+H)+
Example 254
3-[3-(2-Isoquinolin-8-yl-2ff-pyrazol-3-yl)-4-oxo-4ff-pyridazin-l-yll-Λr,Λr-dimethyl- benzenesulfonamide
Figure imgf000191_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-dimethyl-benzenesulfonamide (A- 12) and isoquinolin-8-yl-hydrazine according to the method described for example 91.
MS: M = 473.3 (M+H)+
Example 255
3-[2-(2-Fluoro-phenyl)-2ff-pyrazol-3-yll-l-[4-(2,2,2-trifluoro-ethoxy)-phenyll-lff-pyridazin- 4-one
Figure imgf000192_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[4-(2,2,2- trifluoro-ethoxy) -phenyl] -lH-pyridazin-4-one (A-32) and 2-fluoro-phenylhydrazine according to the method described for example 43.
MS: M = 431.1 (M+H)+
Example 256
3-(2-Phenyl-2H-pyrazol-3-yl)-l-[4-(2,2,2-trifluoro-ethoxy)-phenyll-lff-pyridazin-4-one
Figure imgf000192_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[4-(2,2,2- trifluoro-ethoxy) -phenyl] -lH-pyridazin-4-one (A-32) and phenylhydrazine according to the method described for example 43.
MS: M = 413.1 (M+H)+
Example 257
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl1-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl1-lH-pyridazin- 4-one
Figure imgf000193_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[4-(2,2,2- trifluoro-ethoxy) -phenyl] -lH-pyridazin-4-one (A-32) and 3-chloro-phenylhydrazine according to the method described for example 43.
MS: M = 447.1 (M+H)+
Example 258
3-[2-(3-Fluoro-phenyl)-2ff-pyrazol-3-yll-l-[4-(2,2,2-trifluoro-ethoxy)-phenyll-lff-pyridazin- 4-one
Figure imgf000193_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[4-(2,2,2- trifluoro-ethoxy) -phenyl] -lH-pyridazin-4-one (A-32) and 3-fluoro-phenylhydrazine according to the method described for example 43.
MS: M = 431.1 (M+H)+
Example 259
3-(2-Ouinolin-4-yl-2ff-pyrazol-3-yl)-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lff-pyridazin-4-one
Figure imgf000194_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[4-(2,2,2- trifluoro-ethoxy) -phenyl] -lH-pyridazin-4-one (A-32) and quinolin-4-yl-hydrazine according to the method described for example 43.
MS: M = 464.2 (M+H)+
Example 260
3-{3-[2-(2-Methγl-pγridin-4-yl)-2H-pyrazol-3-γl1-4-oxo-4H-pyridazin-l-yl}-benzonitrile
Figure imgf000194_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-benzonitrile (A- 19) and 4-hydrazino-2-methylpyridine according to the method described for example 91.
MS: M = 355.2 (M+H)+
Example 261
3-(2-Isoquinolin-5-yl-2ff-pyrazol-3-yl)-l-[3-(pyrrolidine-l-sulfonyl)-phenyll-lff-pyridazin-4- one
Figure imgf000195_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(pyrrolidine-l- sulfonyl)-phenyl]-lH-pyridazin-4-one (A-29) and isoquinolin-5-yl-hydrazine according to the method described for example 91.
MS: M = 499.3 (M+H)+
Example 262
Λr-Methyl-3-{3-[2-(2-methyl-pyridin-4-yl)-2ff-pyrazol-3-yll-4-oxo-4ff-pyridazin-l-yl}- benzenesulfonamide
Figure imgf000195_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N-methyl-benzenesulfonamide (A-31) and 4-hydrazino-2-methylpyridine according to the method described for example 91.
MS: M = 423.1 (M+H)+
Example 263
3-[3-(2-Isoquinolin-5-yl-2ff-pyrazol-3-yl)-4-oxo-4ff-pyridazin-l-yll-Λr-methyl- benzenesulfonamide
Figure imgf000196_0001
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N-methyl-benzenesulfonamide (A-31) and isoquinolin-5-yl-hydrazine according to the method described for example 91.
MS: M = 459.3 (M+H)+
Example 264
3-[2-(6-Chloro-quinolin-4-yl)-2ff-pyrazol-3-yll-l-[3-(pyrrolidine-l-sulfonyl)-phenyll-lff- pyridazin-4-one
Figure imgf000196_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(pyrrolidine-l- sulfonyl)-phenyl]-lH-pyridazin-4-one (A-29) and (6-chloro-quinolin-4-yl)-hydrazine according to the method described for example 91.
MS: M = 533.1 (M+H)+
Example 265
l-[3-(Piperidine-l-sulfonγl)-phenγl1-3-(2-quinoUn-5-γl-2H-pyrazol-3-γl)-lH-pγridazin-4-one
Figure imgf000197_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(piperidine-l- sulfonyl)-phenyl]-lH-pyridazin-4-one (A-26) and quinolin-5-yl-hydrazine according to the method described for example 91.
MS: M = 513.4 (M+H)+
Example 266
3-(2-Isoquinolin-5-yl-2ff-pyrazol-3-yl)-l-[3-(piperidine-l-sulfonyl)-phenyll-lff-pyridazin-4- one
Figure imgf000197_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(piperidine-l- sulfonyl)-phenyl]-lH-pyridazin-4-one (A-26) and isoquinolin-5-yl-hydrazine according to the method described for example 91.
MS: M = 513.4 (M+H)+
Example 267
3-[2-(6-Chloro-quinolin-4-yl)-2ff-pyrazol-3-yll-l-[3-(piperidine-l-sulfonyl)-phenyll-lff- pyridazin-4-one
Figure imgf000198_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(piperidine-l- sulfonyl)-phenyl]-lH-pyridazin-4-one (A-26) and (6-chloro-quinolin-4-yl)-hydrazine according to the method described for example 91.
MS: M = 547.2 (M+H)+
Example 268
3-[2-(7-Chloro-quinolin-4-yl)-2ff-pyrazol-3-yll-l-[3-(piperidine-l-sulfonyl)-phenyll-lff- pyridazin-4-one
Figure imgf000198_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(piperidine-l- sulfonyl)-phenyl]-lH-pyridazin-4-one (A-26) and (7-chloro-quinolin-4-yl) -hydrazine according to the method described for example 91.
MS: M = 547.2 (M+H)+
Example 269
Λr,Λr-Diethyl-3-{3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yll-4-oxo-4H-pyridazin-l-yl}- benzenesulfonamide
Figure imgf000199_0001
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N,N-diethyl-benzenesulfonamide (A-21) and 2-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 468.2 (M+H)+
Example 270
3-{3-[2-(3-Fluoro-phenγl)-2H-pyrazol-3-γl1-4-oxo-4ff-pyridazin-l-yl}-benzonitrile
Figure imgf000199_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-benzonitrile (A-19) and 3-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 358.1 (M+H)+
Example 271
3-[2-(3-Fluoro-phenyl)-2ff-pyrazol-3-yll-l-[3-(pyrrolidine-l-sulfonyl)-phenyll-lff-pyridazin- 4-one
Figure imgf000200_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(pyrrolidine-l- sulfonyl)-phenyl]-lH-pyridazin-4-one (A-29) and 3-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 466.2 (M+H)+
Example 272
4-{3-[2-(3-Fluoro-phenyl)-2ff-pyrazol-3-yll-4-oxo-4ff-pyridazin-l-yl}-Λr-methyl- benzenesulfonamide
Figure imgf000200_0002
The product was obtained starting from 4-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N-methyl-benzenesulfonamide (A-30) and 3-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 426.1 (M+H)+
Example 273
3-[2-(3-Fluoro-phenyl)-2ff-pyrazol-3-yll-l-[3-(piperidine-l-sulfonyl)-phenyll-lff-pyridazin-4- one
Figure imgf000201_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(piperidine-l- sulfonyl)-phenyl]-lH-pyridazin-4-one (A-26) and 3-fluoro-phenylhydrazine according to the method described for example 91.
MS: M = 480.1 (M+H)+
Example 274
3-{3-[2-(2,5-Difluoro-phenγl)-2H-pγrazol-3-γl1-4-oxo-4H-pγridazin-l-γl}-benzonitrile
Figure imgf000201_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-benzonitrile (A-19) and 2,5-difluoro-phenylhydrazine according to the method described for example 91.
MS: M = 376.2 (M+H)+
Example 275
3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yll-l-[3-(pyrrolidine-l-sulfonyl)-phenyll-lH- pyridazin-4-one
Figure imgf000202_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(pyrrolidine-l- sulfonyl)-phenyl]-lH-pyridazin-4-one (A-29) and 2,5-difluoro-phenylhydrazine according to the method described for example 91.
MS: M = 484.1 (M+H)+
Example 276
l-(3-Hydroxy-phenγl)-3-(2-naphthalen-l-γl-2ff-pyrazol-3-γl)-lff-pγridazin-4-one
Figure imgf000202_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)- l-(3- hydroxyphenyl)-lH-pyridazin-4-one (A- 17) and naphthalen-1-yl-hydrazine according to the method described for example 91.
MS: M = 381.1 (M+H)+
Example 277
3-[2-(2,3-Dihvdro-benzo[l,4ldioxin-6-yl)-2H-pyrazol-3-yll-l-(3-hvdroxy-phenyl)-lH- pγridazin-4-one
Figure imgf000203_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)- l-(3- hydroxyphenyl)-lH-pyridazin-4-one (A- 17) and (2,3-dihydro-benzo[l,4]dioxin-6-yl)-hydrazine according to the method described for example 91.
MS: M = 389.1 (M+H)+
Example 278
3-(2-Phenyl-2ff-pyrazol-3-yl)-l-(4-trifluoromethanesulfonyl-phenyl)-lff-pyridazin-4-one
Figure imgf000203_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-27) and phenylhydrazine according to the method described for example 1.
MS: M = 447.0 (M+H)+
Example 279
3-[2-(3-Chloro-phenyl)-2ff-pyrazol-3-yll-l-(4-trifluoromethanesulfonyl-phenyl)-lff- pγridazin-4-one
Figure imgf000204_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-27) and 3-chloro-phenylhydrazine according to the method described for example 1.
MS: M = 481.1 (M+H)+
Example 280
3-[2-(2,3-Dichloro-phenyl)-2ff-pyrazol-3-yll-l-(4-trifluoromethanesulfonyl-phenyl)-lff- pγridazin-4-one
Figure imgf000204_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-27) and 2,3-dichloro-phenylhydrazine according to the method described for example 1.
MS: M = 515.0 (M+H)+
Example 281
3-(2-Phenyl-2ff-pyrazol-3-yl)-l-(3-trifluoromethanesulfonyl-phenyl)-lff-pyridazin-4-one
Figure imgf000205_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-33) and phenylhydrazine according to the method described for example 1.
MS: M = 447.1 (M+H)+
Example 282
3-[2-(2-Fluoro-phenyl)-2ff-pyrazol-3-yll-l-(3-trifluoromethanesulfonyl-phenyl)-lff-pyridazin- 4-one
Figure imgf000205_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-33) and 2-fluoro-phenylhydrazine according to the method described for example 1.
MS: M = 465.1 (M+H)+
Example 283
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yll-l-(3-trifluoromethanesulfonyl-phenyl)-lH- pyridazin-4-one
Figure imgf000206_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-33) and 3-chloro-phenylhydrazine according to the method described for example 1.
MS: M = 481.0 (M+H)+
Example 284
3-{5-[4-Oxo-l-(3-trifluoromethanesulfonyl-phenyl)-l,4-dihydro-pyridazin-3-yll-pyrazol-l-yl}- benzonitrile
Figure imgf000206_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-33) and 3-hydrazino-benzonitrile in ethanol as solvent according to the method described for example 1.
MS: M = 472.1 (M+H)+
Example 285
3-[2-(2,3-Dichloro-phenyl)-2ff-pyrazol-3-yll-l-(3-trifluoromethanesulfonyl-phenyl)-lff- pyridazin-4-one
Figure imgf000207_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-33) and 2,3-dichloro-phenylhydrazine according to the method described for example 1.
MS: M = 515.0 (M+H)+
Example 286
3-{3-[2-(2-Fluoro-phenγl)-2H-pyrazol-3-γl1-4-oxo-4ff-pyridazin-l-yl}-benzonitrile
Figure imgf000207_0002
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-benzonitrile (A- 19) and 2-fluoro-phenylhydrazine according to the method described for example 1.
MSl M = 358.1 (M+H)+
Example 287
3-{3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl1-4-oxo-4ff-pyridazin-l-yl}-benzonitrile
Figure imgf000208_0001
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-benzonitrile (A-19) and 3-chloro-phenylhydrazine according to the method described for example 1.
MS: M = 374.1 (M+H)+
Example 288
3-[2-(3-Chloro-2-fluoro-phenyl)-2ff-pyrazol-3-yll-l-(4-trifluoromethanesulfonyl-phenyl)-lff- pyridazin-4-one
Figure imgf000208_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(4- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-27) and 3-chloro-2-fluoro- phenylhydrazine according to the method described for example 1.
MS: M = 499.0 (M+H)+
Example 289
3-[2-(3-Chloro-2-fluoro-phenyl)-2ff-pyrazol-3-yll-l-(3-trifluoromethanesulfonyl-phenyl)-lff- pγridazin-4-one
Figure imgf000209_0001
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-(3- trifluoromethansulfonyl-phenyl)-lH-pyridazin-4-one (A-33) and 3-chloro-2-fluoro- phenylhydrazine according to the method described for example 1.
MS: M = 499.0 (M+H)+
Example 290
3-[2-(2,3-Dihydro-benzo[l,4ldioxin-6-yl)-2ff-pyrazol-3-yll-l-(3-fluoromethoxy-phenyl)-lff- pγridazin-4-one
Figure imgf000209_0002
To a solution of 3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(3-hydroxy- phenyl)-lH-pyridazin-4-one (example 277) (50 mg, 0.13 mmol) in DMF (0.5 ml) were added CsCO3 (80 mg, 0.25 mmol) and a solution of fluoromethyl tosylate (38 mg, 0.18 mmol; R. Iwata et al., J Label Compd Radiopharm 2003, 46, 555-566) in DMF (0.5 ml). The reaction mixture was heated under stirring in a sealed tube 2 h at 70 0C. After cooling H2O was added and the product was extracted with EtOAc. The organic layer was dried (Na2SO4) and the solvent was evaporated. Chromatography (5 g SiO2, CH2Cl2/MeOH 95:5) afforded the product as a light brown foam (52 mg, 97%).
MS: M = 421.1 (M+H)+
Example 291 l-(3-Fluoromethoxy-phenγl)-3-(2-naphthalen-l-γl-2H-pyrazol-3-γl)-lH-pγridazin-4-one
Figure imgf000210_0001
The product was obtained starting from l-(3-Hydroxy-phenyl)-3-(2-naphthalen-l-yl-2H- pyrazol-3-yl)-lH-pyridazin-4-one (example 276) and fluoromethyl tosylate according to the method described in example 290.
MS: M = 413.1 (M+H)+
Example 292
Λr-(3-{3-[2-(2-Fluoro-phenyl)-2ff-pyrazol-3-yll-4-oxo-4ff-pyridazin-l-yl}-phenyl)-acetamide
Figure imgf000210_0002
The product was obtained starting from N-{3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-1-yl] -phenyl} -acetamide (A-34) and 2-fluoro-phenylhydrazine according to the method described for example 1.
MS: M = 390.1 (M+H)+
Example 293
3-{3-[2-(2-Fluoro-phenγl)-2H-pγrazol-3-γl1-4-oxo-4H-pγridazin-l-γl}-N-methγl-benzamide
Figure imgf000211_0001
The product was obtained starting from 3-[3-((E)-3-Dimethylamino-acryloyl)-4-oxo-4H- pyridazin-l-yl]-N-methyl-benzamide (A-35) and 2-fluoro-phenylhydrazine according to the method described for example 1.
MS: M = 390.1 (M+H)+
Example 294
Λr-(3-{3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yll-4-oxo-4H-pyridazin-l-yl}-phenyl)-Λr-methyl- acetamide
Figure imgf000211_0002
The product was obtained starting from N-(3-{3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo- 4H-pyridazin-l-yl} -phenyl) -acetamide (example 292) and methyl iodide in presence of sodium hydride in DMF at room temperature over night.
MS: M = 404.4 (M+H)+
Example 295
3-[3-(2-Naphthalen-l-yl-2ff-pyrazol-3-yl)-4-oxo-4ff-pyridazin-l-yll-benzoic acid 2-fluoro- ethyl ester
Figure imgf000212_0001
l-(3-Bromo-phenyl)-3-(2-naphthalen-l-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one (example 190) (100 mg, 0.23 mmol) was dissolved in EtOAc (3 ml) and the solution was placed in the reaction vessel. [PdCl2(dppf)] (10 mg) was added followed by 2-fluoroethanol (97 mg, 1.5 mmol) and Et3N (0.05 ml). The reactor was closed and the mixture was stirred 20 h under 70 bar carbon monoxide at 110 0C. After evaporation of the solvents the residue was purified by chromatography (1O g Siθ2, Hept to Hept/EtOAc 1:1). The product was isolated as an off- white solid (69 mg, 67%).
MS: M = 455.1 (M+H)+
Example 296
3- [3-(2-Naphthalen-l-yl-2ff-pyrazol-3-yl)-4-oxo-4ff-pyridazin-l-yll -benzoic acid 3-fluoro- propyl ester
Figure imgf000212_0002
The product was obtained starting from l-(3-Bromo-phenyl)-3-(2-naphthalen-l-yl-2H-pyrazol- 3-yl)-lH-pyridazin-4-one (example 190) and 3-fluoropropan-l-ol according to the method described in example 295.
MS: M = 469.2 (M+H)+
Example 297 3-[3-(2-Naphthalen-l-yl-2ff-pyrazol-3-yl)-4-oxo-4ff-pyridazin-l-yll-benzoic acid methyl ester
Figure imgf000213_0001
The product was obtained starting from l-(3-Bromo-phenyl)-3-(2-naphthalen-l-yl-2H-pyrazol- 3-yl)-lH-pyridazin-4-one (example 190) and methanol according to the method described in example 295.
MS: M = 423.1 (M+H)+
Example 298
3-[2-(2-Fluoro-phenyl)-2ff-pyrazol-3-yll-l-[3-(l-hydroxy-ethyl)-phenyll-lff-pyridazin-4-one
Figure imgf000213_0002
The product was obtained starting from 3-((E)-3-Dimethylamino-acryloyl)-l-[3-(l-hydroxy- ethyl)-phenyl]-lH-pyridazin-4-one (A-36) and 2-fluoro-phenylhydrazine according to the method described for example 1.
MS: M = 377.1 (M+H)+
Example 299
l-(3-Acetyl-phenyl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yll-lH-pyridazin-4-one
Figure imgf000214_0001
The product was obtained starting from 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-[3-(l- hydroxy-ethyl) -phenyl] -lH-pyridazin-4-one (example 298) by treatment with manganese dioxide in dichloromethane at room temperature for 6 h.
MS: M = 375.1 (M+H)+
Example A
Film coated tablets containing the following ingredients can be manufactured in a conventional manner:
Ingredients Per tablet
Kernel:
Compound of formula (I) 10.0 mg 200.0 mg
Micro crystalline cellulose 23.5 mg 43.5 mg
Lactose hydrous 60.0 mg 70.0 mg
Povidone K30 12.5 mg 15.0 mg
Sodium starch glycolate 12.5 mg 17.0 mg
Magnesium stearate 1.5 mg 4.5 mg
(Kernel Weight) 120.0 mg 350.0 mg Film Coat:
Hydro xypropyl methyl cellulose 3.5 mg 7.0 mg
Polyethylene glycol 6000 0.8 mg 1.6 mg
Talc 1.3 mg 2.6 mg
Iron oxyde (yellow) 0.8 mg 1.6 mg
Titan dioxide 0.8 mg 1.6 mg
The active ingredient is sieved and mixed with micro cristalline cellulose and the mixture is granulated with a solution of polyvinylpyrrolidon in water. The granulate is mixed with sodium starch glycolate and magesiumstearate and compressed to yield kernels of 120 or 350 mg respectively. The kernels are lacquered with an aqueous solution / suspension of the above mentioned film coat.
Example B
Capsules containing the following ingredients can be manufactured in a conventional manner:
Ingredients Per capsule
Compound of formula (I) 25.0 mg
Lactose 150.0 mg
Maize starch 20.0 mg
Talc 5.0 mg
The components are sieved and mixed and filled into capsules of size 2.
Example C
Injection solutions can have the following composition:
Compound of formula (I) 3.0 mg
Polyethylene Glycol 400 150.0 mg
Acetic Acid q.s. ad pH 5.0
Water for injection solutions ad 1.0 mL
The active ingredient is dissolved in a mixture of Polyethylene Glycol 400 and water for injection (part). The pH is adjusted to 5.0 by Acetic Acid. The volume is adjusted to 1.0 mL by addition of the residual amount of water. The solution is filtered, filled into vials using an appropriate overage and sterilized.
Example D
Soft gelatin capsules containing the following ingredients can be manufactured in a conventional manner:
Capsule contents
Compound of formula (I) 5.0 mg
Yellow wax 8.0 mg
Hydrogenated Soya bean oil 8.0 mg
Partially hydrogenated plant oils 34.0 mg
Soya bean oil HO.O mg
Weight of capsule contents 165.0 mg Gelatin capsule
Gelatin 75.0 mg
Glycerol 85 % 32.0 mg
Karion 83 8.0 mg (dry matter)
Titan dioxide 0.4 mg
Iron oxide yellow 1.1 mg
The active ingredient is dissolved in a warm melting of the other ingredients and the mixture is filled into soft gelatin capsules of appropriate size. The filled soft gelatin capsules are treated according to the usual procedures.
Example E
Sachets containing the following ingredients can be manufactured in a conventional manner:
Compound of formula (I) 50.0 mg
Lactose, fine powder 1015.0 mg
Microcristalline cellulose (AVICEL PH 102) 1400.0 mg
Sodium carboxymethyl cellulose 14.0 mg
Po lyvinylpyrro lidon K 30 10.0 mg
Magnesiumstearate 10.0 mg
Flavoring additives 1.0 mg
The active ingredient is mixed with lactose, microcristalline cellulose and sodium carboxymethyl cellulose and granulated with a mixture of po lyvinylpyrro lidon in water. The granulate is mixed with magnesiumstearate and the flavouring additives and filled into sachets.

Claims

Claims
1. Compounds of formula (I)
Figure imgf000219_0001
wherein
R1 is aryl which can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of lower-alkyl, hydro xy-lower-alkyl, lower-alkoxy, fluoro- lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, halogen, lower-alkoxy-lower-alkyl, cyano, NO2, lower-alkyl-SO, morpholinyl, NH2-SO2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, piperidinyl-SO2, pyrrolidinyl-SO2, hydroxy, COOH, COO-lower-alkyl, COO-fiuoro-lower-alkyl, lower-alkyl-C(O)O, CO-lower-alkyl, CONH2, CON(H,lower-alkyl), CON(Io wer-alkyl)2, lower-alkyl-CO-NH, lower-alkyl- CO-N(Io wer-alkyl), NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-Io wer-alkyl,
N(H,lower-alkyl)-lower-alkyl, N(lower-alkyl)2-lower-alkyl, cycloalkyl, phenyloxy and phenyl, or wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower-alkylene, dioxo- fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower-alkylene, lower- alkylene-NH-lower-alkylene, lower-alkylene-N(lower alkyl)-lower-alkylene, NH-C(O)- lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower-alkylene-NH-C(O)-lower- alkylene, lower-alkylene-N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)-N(lower-alkyl)-lower-alkylene;
R2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower- alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkinyl, lower-alkyl- SO2, fluoro-lower-alkyl-SO2, tri(lower-alkyl)silyl-loweralkinyl, COOH, CONH2, NH2- SO2, COO-Io wer-alkyl, 6-oxo-l,4,5,6-tetrahydropyridazinyl, lower-alkoxy-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl)2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, lower-alkenyl, hydroxy, NO2, morpholinyl, tetrahydropyridazinyl, piperidinyl, piperazinyl, (N-lower-alkyl)-piperazinyl, pyrrolidinyl, lower-alkyl-C(O)O, lower-alkyl-
CO-NH, lower-alkyl-CO-N(lower-alkyl), imidazolyl, pyridinyl, CO-lower-alkyl, NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower-alkyl)-lower-alkyl, N(lower-alkyl)2-lower-alkyl, cycloalkyl, phenyloxy and phenyl which is optionally substituted with 1 to 4 substituents independently selected from halogen, lower-alkoxy, Io wer-alkyl, fluoro-lo wer-alkyl, fluoro-lower-alkoxy, hydroxy and cyano, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower- alkylene, dioxo-fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower- alkylene, lower-alkylene-NH-lower-alkylene, lower-alkylene-N(lower alkyl)-lower- alkylene, NH-C(O)-Io wer-alkylene, N(Io wer alkyl)-C(O)-lower-alkylene, lower- alkylene-NH-C(O)-lower-alkylene, lower-alkylene -N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)-N(lower-alkyl)-lower-alkylene;
R is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
R4 is hydrogen, lower-alkyl, fluoro-lower-alkyl, lower-alkoxy, fluoro-lower-alkoxy, halogen, hydroxy or phenyl;
and pharmaceutically acceptable salts and esters thereof.
2. Compounds according to claim 1, wherein
R1 is aryl which can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, halogen, lower-alkoxy-lower-alkyl, cyano, NO2, lower-alkyl-SO, morpholinyl, NH2-SO2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, hydroxy, COOH, COO-lower-alkyl, lower-alkyl-C(O)O, CO-lower-alkyl, CONH2, CON(H,lower-alkyl), CON(lower-alkyl)2, lower- alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl), NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2- lower-alkyl, N(H,lower-alkyl)-lower-alkyl, N(lower-alkyl)2-lower-alkyl, cycloalkyl, phenyloxy and phenyl, or wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower-alkylene, dioxo-fluoro-lower- alyklene, NH-lower-alkylene, N(lower alkyl)-lower-alkylene, lower-alkylene-NH-lower- alkylene, lower-alkylene-N(lower alkyl)-lower-alkylene, NH-C(O)-lower-alkylene, N(lower alkyl)-C(O)-lower-alkylene, lower-alkylene-NH-C(O)-lower-alkylene, lower-alkylene-N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)-N(lower-alkyl)-lower-alkylene; and R2 is aryl or heteroaryl, which aryl or heteroaryl can optionally be substituted with 1 to 4 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO2, tri(lower-alkyl)silyl- loweralkinyl, COOH, CONH2, NH2-SO2, COO-Io wer-alkyl, 6-oxo-l ,4,5,6-tetrahydropyridazinyl, lower-alkoxy-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl)2, N(H,lower-alkyl)-SO2, N(lower-alkyl)2-SO2, lower-alkenyl, hydroxy, NO2, morpholinyl, tetrahydropyridazinyl, piperidinyl, piperazinyl, (N-lower-alkyl)-piperazinyl, pyrrolidinyl, lower-alkyl-C(O)O, lower- alkyl-CO-NH, lower-alkyl-CO-N(lower-alkyl), imidazolyl, pyridinyl, CO-lower-alkyl, NH2, N(H,lower-alkyl), N(lower-alkyl)2, NH2-lower-alkyl, N(H,lower-alkyl)-lower-alkyl, N(lower- alkyl)2-lower-alkyl, cycloalkyl, phenyloxy and phenyl which is optionally substituted with 1 to 4 substituents independently selected from halogen, lower-alkoxy, lower-alkyl, fluoro-lower-alkyl, fluoro-lower-alkoxy, hydroxy and cyano, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are lower-alkylene, dioxo-lower-alkylene, dioxo- fluoro-lower-alyklene, NH-lower-alkylene, N(lower alkyl)-lower-alkylene, lower-alkylene-NH- lower-alkylene, lower-alkylene-N(lower alkyl)-lower-alkylene, NH-C(O)-lower-alkylene,
N(lower alkyl)-C(O)-lower-alkylene, lower-alkylene-NH-C(O)-lower-alkylene, lower-alkylene- N(lower alkyl)-C(O)-lower-alkylene, C(O)-NH-lower-alkylene or C(O)-N(lower-alkyl)-lower- alkylene.
3. Compounds according to any of claims 1 - 2, wherein R1 is phenyl which can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy and lower- alkyl-SO2, or wherein two substituents at adjacent positions of the phenyl are bound together to form a ring and said two bound substituents are dioxo-fluoro-lower-alyklene.
4. Compounds according to any of claims 1 - 3, wherein R1 is phenyl which can optionally be substituted with fluoro-lower-alkyl, fluoro-lower-alkoxy or lower-alkyl-SO2.
5. Compounds according to any of claims 1 - 4, wherein R1 is phenyl, 3- trifluoromethyl-phenyl, 3-trifluoromethoxy-phenyl, 3-methylsulfonyl-phenyl, 4- trifluoromethoxy-phenyl or 4-difluoromethyl-phenyl.
6. Compounds according to any of claims 1 - 2, wherein R1 is phenyl which can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of hydroxy- Io wer-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, halogen, cyano, N(H,lower-alkyl)-Sθ2, N(lower- alkyl)2-Sθ2, piperidinyl-SO2, pyrrolidinyl-SO2, hydroxy, COO-Io wer-alkyl, COO-fluoro-lo wer- alkyl, CO-lower-alkyl, CON(H,lower-alkyl), CON(lower-alkyl)2, lower-alkyl-CO-NH, lower- alkyl-CO-N(lower-alkyl) and N(lower-alkyl)2-lower-alkyl, or wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene or dioxo-fluoro-lower-alyklene.
7. Compounds according to any of claims 1 - 2, wherein R1 is phenyl which can optionally be substituted with hydroxy-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, cyano, hydroxy, COO-fluoro-lower-alkyl, CON(H,lower-alkyl), lower- alkyl-CO-NH or lower-alkyl-CO-N(lower-alkyl).
8. Compounds according to any of claims 1 - 2, wherein R1 is 3-trifluoromethoxy- phenyl, 3-methylsulfonyl-phenyl, 3-difluoromethoxy-phenyl, 4-trifluoromethoxy-phenyl, 3- hydroxy-phenyl, 3-cyano-phenyl, 4-trifluoromethylsulfonyl-phenyl, 4-(2,2,2-trifluoroethoxy)- phenyl, 3-trifluoromethylsulfonyl-phenyl, 3-acetamide-phenyl, 3-(methylamide)-phenyl, 3-(N- methyl-acetamide)-phenyl, 3-(2-fluoro-ethoxycarbonyl)-phenyl or 3-(l-hydroxy-ethyl)-phenyl.
9. Compounds according to any of claims 1 - 8, wherein R2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of pyridinyl and thiazolyl, which aryl or heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, lower-alkinyl, lower-alkyl-SO2, tri(lower-alkyl)silyl- loweralkinyl, COOH, CONH2, NH2-SO2, COO-Io wer-alkyl, 6-oxo-l,4,5,6-tetrahydropyridazinyl, and phenyl which is optionally substituted with 1 to 3 substituents independently selected from halogen and lower-alkoxy, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are lower-alkylene or dioxo-lower-alkylene.
10. Compounds according to any of claims 1 - 9, wherein R2 is aryl selected from the group consisting of phenyl and naphthyl or pyridinyl, which aryl or pyridinyl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, and lower-alkinyl, or wherein two substituents at adjacent positions of the aryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene.
11. Compounds according to any of claims 1 - 10, wherein R2 is phenyl, 2,5-difluoro- phenyl, 3-cyano-phenyl, 3-ethinyl-phenyl, 3-chloro-phenyl, 4-fluoro-phenyl, naphthyl, 3-fluoro- phenyl, pyridin-4-yl, 3-methyl-pyridin-4-yl or 2,3-dihydro-benzo[l,4]dioxin-6-yl.
12. Compounds according to any of claims 1 - 8, wherein R2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of quinolinyl, thiazolyl, pyridinyl, isoquinolinyl and isothiazolyl, which aryl or heteroaryl can optionally be substituted with 1 to 3 substituents independently selected from the group consisting of halogen, cyano, lower-alkyl, lower-alkoxy, fluoro-lower-alkyl, fluoro-lower-alkoxy, lower-alkyl-SO2, fluoro-lower-alkyl-SO2, NH2-SO2, N(lower-alkyl)2-SO2, hydroxy and lower- alkyl-CO-NH, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene or dioxo-fluoro-lower- alyklene.
13. Compounds according to any of claims 1 - 8, wherein R2 is aryl selected from the group consisting of phenyl and naphthyl or heteroaryl selected from the group consisting of quinolinyl and pyridinyl, which aryl or heteroaryl can optionally be substituted with 1 to 2 substituents independently selected from the group consisting of halogen, cyano and lower-alkyl, or wherein two substituents at adjacent positions of the aryl or heteroaryl are bound together to form a ring and said two bound substituents are dioxo-lower-alkylene.
14. Compounds according to any of claims 1 - 8, wherein R2 is 2,4-difluoro-phenyl, 3-cyano-phenyl, 2,5-difluoro-phenyl, phenyl, 2-fluoro-phenyl, 3-chloro-phenyl, naphthyl, 2,3- dihydro-benzo[l,4]dioxin-6-yl, 6-fluoro-quinolin-4-yl, 2-methyl-pyridin-4-yl or quinolin-4-yl.
15. Compounds according to any of claims 1 - 14, wherein R is hydrogen or lower- alkyl.
16. Compounds according to any of claims 1 - 15, wherein R3 is hydrogen.
17. Compounds according to any of claims 1 - 16, wherein R4 is hydrogen.
18. Compounds according to any of claims 1 - 17, selected from the group consisting of 3-(2-Benzo[l,3]dio xo l-5-yl-2H-pyrazol-3-yl)-l -phenyl- lH-pyridazin-4-one, l-(4-Methoxy-phenyl)-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-[2-(2-Methoxy-phenyl)-2H-pyrazol-3-yl]-l -phenyl- lH-pyridazin-4-one, l-Phenyl-3-(2-o-tolyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 1 -Phenyl-3 - [2-(3 -trifluoromethyl-phenyl)-2H-pyrazol-3 -yl] - 1 H-pyridazin-4-one, 3 - [2-(2,5 -Difluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 1 -(3 -Trifluoromethyl-phenyl)-3 - [2-(2-trifluoromethyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 H-pyridazin-4- one,
3 - [2-(2,5 -Dimethyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]-l -phenyl- 1 H-pyridazin-4-one, l-Phenyl-3-[2-(2-trifluoromethyl-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3 - [2-(2,5 -Dimethyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -phenyl- 1 H-pyridazin-4-one, 3 - [2-(2,5 -Dichloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -phenyl- 1 H-pyridazin-4-one, 1 -Phenyl-3 -(2-pyridin-2-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, 3- {5-[4-Oxo- 1 -(3-trifluoromethyl-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, l-Phenyl-3-(2-pyridin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-[5-(4-Oxo- 1 -phenyl- 1 ,4-dihydro-pyridazin-3-yl)-pyrazol- 1 -yl]-benzonitrile, l-(3-Ethyl-phenyl)-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, l-(3-Methoxy-phenyl)-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, l-Phenyl-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3 -[2-(4-Methanesulfonyl-phenyl)-2H-pyrazo 1-3 -yl]-l -phenyl- lH-pyridazin-4-one, l-(3-Ethyl-phenyl)-3-[2-(4-methanesulfonyl-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(3-Ethyl-phenyl)-3-(2-pyridin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-[2-(3-Bromo-phenyl)-2H-pyrazol-3-yl]- 1 -phenyl- lH-pyridazin-4-one,
3 - [2-(2-Methyl-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -phenyl- 1 H-pyridazin-4-one,
3-[2-(2-Chloro-pyridin-4-yl)-2H-pyrazol-3-yl]-l -phenyl- lH-pyridazin-4-one,
3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3 -(2-Pyridin-4-yl-2H-pyrazo 1-3 -yl)-l -(3 -trifluoromethoxy-phenyl)-l H-pyridazin-4-one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, l-(3-Methanesulfonyl-phenyl)-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 1 -Phenyl-3 - [2-(3 -trimethylsilanylethynyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 H-pyridazin-4-one, 3-[2-(3-Ethynyl-phenyl)-2H-pyrazol-3-yl]-l -phenyl- 1 H-pyridazin-4-one,
3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l-(4-trifluoromethoxy-phenyl)-l H-pyridazin-4-one, 3 -(2-Pyridin-4-yl-2H-pyrazo 1-3 -yl)-l -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3- {5-[4-Oxo- 1 -(4-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(3 -trifluoromethyl-phenyl)-l H-pyridazin-4-one,
3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yl]-l -phenyl- 1 H-pyridazin-4-one, l-Phenyl-3-(2-p-tolyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 3-[2-(4-Methoxy-phenyl)-2H-pyrazol-3-yl]-l-(3-trifluoromethyl-phenyl)-lH-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(3-trifluoromethyl-phenyl)-lH-pyridazin-4-one, 3- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzamide, 3 -(2-p-Tolyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 4- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -benzoic acid,
4- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzenesulfonamide,
3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yl]-l -(3-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l -(3-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3 -[2-(4-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3 - [2-(2,3 -Dimethyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one,
3 - [2-(3-Chloro-2-methyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one,
3 - [2-(2-Bromo-4-fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin- 4-one, 3 - [2-(3-Fluoro-2-methyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin- 4-one,
3 - [2-(3-Fluoro-4-methyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin- 4-one, 3- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -benzoic acid methyl ester,
3-[2-(5,6,7,8-Tetrahydro-isoquinolin- 1 -yl)-2H-pyrazol-3-yl]- 1 -(3-trifluoromethoxy-phenyl)- IH- pyridazin-4-one,
2- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - isonicotinic acid ethyl ester, 3 -(2-Pyridin-2-yl-2H-pyrazo 1-3 -yl)-l -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzamide, l-(3-Methanesulfonyl-phenyl)-3-(2-p-tolyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
4- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -benzoic acid,
4- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzenesulfonamide,
3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
2- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -benzoic acid, 3-[2-(4-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one, 3-[2-(2,3-Dimethyl-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4- one,
3 - [2-(3-Chloro-2-methyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -methanesulfonyl-phenyl)- 1 H-pyridazin- 4-one,
3 - [2-(3-Fluoro-2-methyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -methanesulfonyl-phenyl)- 1 H-pyridazin- 4-one,
3-[2-(3-Fluoro-4-methyl-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin- 4-one,
3- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -benzoic acid methyl ester, l-(3-Methanesulfonyl-phenyl)-3-[2-(5,6,7,8-tetrahydro-isoquinolin-l-yl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one,
2- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -4,6- dimethyl-nicotinonitrile,
2- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - isonicotinic acid ethyl ester, l-(3-Methanesulfonyl-phenyl)-3-(2-pyridin-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
4- {5-[4-Oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3 - [2-(2,4-Difluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one,
3-{2-[4-(6-Oxo-l,4,5,6-tetrahydro-pyridazin-3-yl)-phenyl]-2H-pyrazol-3-yl}-l-(3- trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3 - [2-(2,3 -Dihydro-benzo [ 1 ,4] dioxin-6-yl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one, 3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)- 1 -(3-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l -(3-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3 - [2-(2,5 -Difluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one, 3-[2-(4-Isopropyl-phenyl)-2H-pyrazol-3-yl]-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH- pyridazin-4-one,
1 -(3-Methanesulfonyl-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazol-3-yl)- lH-pyridazin-4-one, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
3-[2-(4-Isopropyl-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
3-(4-Ethyl-2-phenyl-2H-pyrazol-3-yl)-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one,
1 -(3 -Methanesulfonyl-phenyl)-3 - [2-(2-methyl-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 H-pyridazin-4- one, l-(3-Difluoromethoxy-phenyl)-3-(2-pyridin-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-(2-Benzo[l,3]dioxol-5-yl-2H-pyrazol-3-yl)-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4- one,
3 -(2-Benzo [ 1 ,3] dio xo 1-5 -yl-2H-pyrazo 1-3 -yl)- 1 -(3 -difluoromethoxy-phenyl)- 1 H-pyridazin-4- one,
3- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3- {2-[4-(2-Fluoro-4-methoxy-phenyl)-thiazol-2-yl]-2H-pyrazol-3-yl} - 1 -(3-methanesulfonyl- phenyl)- 1 H-pyridazin-4-one, l-(3-Methanesulfonyl-phenyl)-3-{2-[4-(2-methoxy-phenyl)-thiazol-2-yl]-2H-pyrazol-3-yl}-lH- pyridazin-4-one, l-(3-Difluoromethoxy-phenyl)-3-[2-(2,3-dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one, l-(3-Difluoromethoxy-phenyl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(4-Difluoromethoxy-phenyl)-3-[2-(2,3-dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one, l-(4-Difluoromethoxy-phenyl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, and l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(2,3-dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3- yl]-l H-pyridazin-4-one and pharmaceutically acceptable salts and esters thereof.
19. Compounds according to any of claims 1 - 18, selected from the group consisting of
3- {5-[4-Oxo- 1 -(3-trifluoromethyl-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, l-Phenyl-3-(2-pyridin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3-(2-Pyridin-4-yl-2H-pyrazol-3-yl)-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4-one, l-(3-Methanesulfonyl-phenyl)-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-[2-(3-Ethynyl-phenyl)-2H-pyrazol-3-yl]-l -phenyl- 1 H-pyridazin-4-one, 3-(2-Pyridin-4-yl-2H-pyrazol-3-yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3- {5-[4-Oxo- 1 -(4-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3 -[2-(4-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one, 3-[2-(2,3-Dihydro-benzo[ 1 ,4]dioxin-6-yl)-2H-pyrazol-3-yl]- 1 -(3 -trifluoromethoxy-phenyl)- IH- pyridazin-4-one,
3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
1 -(3-Methanesulfonyl-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one, 3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one, l-(3-Methanesulfonyl-phenyl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4- one,
3- {5-[ 1 -(3-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, l-(4-Difluoromethoxy-phenyl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, and pharmaceutically acceptable salts and esters thereof.
20. Compounds according to any of claims 1 - 17, selected from the group consisting of 3-{3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin-l-yl}-N,N-dimethyl- benzenesulfonamide, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(3-fiuoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin- 4-one, 3-[2-(3,4-Difluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one, 3-[2-(2,4-Difluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one, 3-(2-Benzo[l,3]dioxol-4-yl-2H-pyrazol-3-yl)-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one, 3-[3-(2-Benzo[l,3]dioxol-5-yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin-l-yl]-N,N-dimethyl- benzenesulfonamide,
3- {3-[2-(3-Cyano-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N,N-dimethyl- benzenesulfonamide,
3-(2-Benzo[l,3]dioxol-5-yl-2H-pyrazol-3-yl)-l-(3-fluoro-phenyl)-lH-pyridazin-4-one, l-(3-Fluoro-phenyl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3- {5-[ 1 -(3-Fluoro-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} -benzonitrile, l-Benzo[l,3]dioxol-4-yl-3-(2-benzo[l,3]dioxol-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, l-Benzo[l,3]dioxol-4-yl-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3-[5-(l-Benzo[l,3]dioxol-4-yl-4-oxo-l,4-dihydro-pyridazin-3-yl)-pyrazol-l-yl]-benzonitrile, 3-[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4- one, l-(3-Difluoromethoxy-phenyl)-3-[2-(2,5-difluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(2,5-difluoro-phenyl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one,
3- {3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N,N-dimethyl- benzenesulfonamide,
3- {5-[ 1 -(2,2-Difluoro-benzo[ 1 ,3]dioxol-5-yl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3-[2-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH- pyridazin-4-one, l-(3-Methanesulfonyl-phenyl)-3-(2-thiazol-2-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 1 -(3 -Methanesulfonyl-phenyl)-3 - [2-(3 -trifluoromethoxy-phenyl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-5-yl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH- pyridazin-4-one, 3-[2-(2-Methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4- one,
3 -(4-Ethyl-2-phenyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3 - [2-(3-Methanesulfonyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3-trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one, l-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin- 4-one, l-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-3-[2-(2,5-difluoro-phenyl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one,
3- {5-[ 1 -(2,2-Difluoro-benzo[ 1 ,3]dioxol-4-yl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, l-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one, 3-[2-(2-Methyl-pyridin-4-yl)-2H-pyrazol-3-yl]- 1 -(4-trifluoromethoxy-phenyl)- lH-pyridazin-4- one, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one, N,N-Dimethyl-3- {3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} - benzenesulfonamide, l-(3-Fluoro-phenyl)-3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l -(4-trifluoromethoxy-phenyl)- lH-pyridazin-4-one, 3 - [2-(2,5 -Difluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3 - [2-(6-Fluoro-quino lin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one,
3 -[2-(4-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
4- {5-[4-Oxo- 1 -(4-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3 -(2-Pyridin-3-yl-2H-pyrazo 1-3 -yl)-l -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3-[2-(3-Methanesulfonyl-phenyl)-2H-pyrazol-3-yl]-l -(4-trifluoromethoxy-phenyl)- IH- pyridazin-4-one,
1 -(4-Trifluoromethoxy-phenyl)-3 - [2-(3 -trifluoromethoxy-phenyl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one,
N,N-Dimethyl-3- {5-[4-oxo- 1 -(4-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1-yl} -benzenesulfonamide,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3-[2-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-2H-pyrazol-3-yl]-l-(4-trifluoromethoxy-phenyl)-lH- pyridazin-4-one, 3-[2-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-2H-pyrazol-3-yl]-l-(4-trifluoromethoxy-phenyl)-lH- pyridazin-4-one,
3 - [2-(3-Trifluoromethanesulfonyl-phenyl)-2H-pyrazol-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one, 3-[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-l-(3-trifluoromethoxy-phenyl)-lH-pyridazin-4- one, l-(4-Difluoromethoxy-phenyl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4- one,
1 -(3 -Difluoromethoxy-phenyl)-3 - [2-(6-fluoro-quinolin-4-yl)-2H-pyrazo 1-3 -yl] - 1 H-pyridazin-4- one, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one, l-(4-Methanesulfonyl-phenyl)-3-(2-phenyl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-[2-(4-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(4-methanesulfonyl-phenyl)-lH-pyridazin-4-one, 3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -(4-methanesulfonyl-phenyl)- lH-pyridazin-4-one,
4- {5-[ 1 -(4-Methanesulfonyl-phenyl)-4-oxo- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3-[2-(4-Chloro-phenyl)-2H-pyrazol-3-yl]-l -(4-methanesulfonyl-phenyl)- lH-pyridazin-4-one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l -(4-methanesulfonyl-phenyl)- lH-pyridazin-4-one, l-(4-Methanesulfonyl-phenyl)-3-[2-(4-trifluoromethoxy-phenyl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one,
1 -(3 -Trifluoromethoxy-phenyl)-3 - [2-(3 -trifluoromethoxy-phenyl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one,
N,N-Dimethyl-3- {5-[4-oxo- 1 -(3-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- l-yl}-benzenesulfonamide,
3-[2-(2,2-Difluoro-benzo[l,3]dio xo l-4-yl)-2H-pyrazol-3-yl]-l -(3-trifluoromethoxy-phenyl)- IH- pyridazin-4-one,
3 - [2-(2,2-Difluoro-benzo [ 1 ,3 ] dioxol-5 -yl)-2H-pyrazol-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one, 3 - [2-(3-Trifluoromethanesulfonyl-phenyl)-2H-pyrazol-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one, l-(4-Difluoromethoxy-phenyl)-3-[2-(3-methanesulfonyl-phenyl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one, 1 -(4-Difluoromethoxy-phenyl)-3 - [2-(3 -trifluoromethoxy-phenyl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one,
3-[2-(2,2-Difluoro-benzo[l,3]dioxol-4-yl)-2H-pyrazol-3-yl]-l-(4-difluoromethoxy-phenyl)-lH- pyridazin-4-one, l-(4-Difluoromethoxy-phenyl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one,
1 -(3 -Difluoromethoxy-phenyl)-3 - [2-(3 -methanesulfonyl-phenyl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one,
1 -(3 -Difluoromethoxy-phenyl)-3 - [2-(3 -trifluoromethoxy-phenyl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one, 3-[2-(2,2-Difluoro-benzo[ 1 ,3]dioxol-4-yl)-2H-pyrazol-3-yl]- 1 -(3-difluoromethoxy-phenyl)- IH- pyridazin-4-one, l-(3-Difluoromethoxy-phenyl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(3-methanesulfonyl-phenyl)-2H-pyrazol-3-yl]-lH- pyridazin-4-one, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(2,2-difluoro-benzo[l,3]dioxol-4-yl)-2H-pyrazol-3- yl]-lH-pyridazin-4-one, l-(2,2-Difluoro-benzo[l,3]dioxol-5-yl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-
4-one,
3 -[2-(4-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -(3 -hydroxy-phenyl)- lH-pyridazin-4-one, N-(3- {5-[4-Oxo- l-(4-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - phenyl)-acetamide,
3 - [2-(6-Fluoro-2-methyl-quino lin-4-yl)-2H-pyrazol-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one,
3 -(2-Quino lin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, N-(3- {5-[4-Oxo- 1 -(3 -trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - phenyl)-acetamide,
N-(3- {5-[ 1 -(3-Dimethylsulfamoyl-phenyl)-4-oxo-l ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - phenyl)-acetamide,
3 -[2-(4-Hydroxy-phenyl)-2H-pyrazo 1-3 -yl]-l -(3 -methanesulfonyl-phenyl)-l H-pyridazin-4-one, 3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l -phenyl- 1 H-pyridazin-4-one,
3 -[2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl]-l -phenyl- 1 H-pyridazin-4-one,
3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)- 1 -phenyl- 1 H-pyridazin-4-one,
4- {5-[4-Oxo- 1 -(4-trifluoromethoxy-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzenesulfonamide,
3 -(2-Quino lin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3 -[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazo 1-3 -yl]-l -phenyl- lH-pyridazin-4-one, 3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)- 1 -(3 -trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 3 -[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazo 1-3 -yl]-l -(3 -trifluoromethyl-phenyl)- lH-pyridazin-4- one,
1 -(3-Bromo-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazol-3-yl)- 1 H-pyridazin-4-one, l-(4-Methanesulfonyl-phenyl)-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one, 3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)-l-(4-methanesulfonyl-phenyl)-lH-pyridazin-4-one, 3-[2-(2-Chloro-pyridin-4-yl)-2H-pyrazol-3-yl]- 1 -(4-trifluoromethoxy-phenyl)- lH-pyridazin-4- one,
3 - [2-(6-Fluoro-2-methyl-quino lin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H- pyridazin-4-one, 3- {3-[2-(6-Fluoro-2-methyl-quinolin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N ,N- dimethyl-benzenesulfonamide,
N,N-Dimethyl-3-[4-oxo-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-4H-pyridazin-l-yl]- benzenesulfonamide, l-(3-Methoxy-phenyl)-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3 -[2-(6-Fluoro-quinolin-4-yl)-2H-pyrazo 1-3 -yl]-l -(3 -methoxy-phenyl)-l H-pyridazin-4-one, 3-[2-(6-Fluoro-2-methyl-quinolin-4-yl)-2H-pyrazol-3-yl]-l-(3-methoxy-phenyl)-lH-pyridazin-4- one,
3 - [2-(2-Ethoxy-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one, 1 -(3-Methoxy-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one, 3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(3-methoxy-phenyl)-lH- pyridazin-4-one,
3 -(2-Quino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 1 -(3 -Difluoromethoxy-phenyl)-3-(2-quinolin-5-yl-2H-pyrazo 1-3 -yl)-l H-pyridazin-4-one, 3-[2-(2-Chloro-pyridin-4-yl)-2H-pyrazol-3-yl]-l-(3-difluoromethoxy-phenyl)-lH-pyridazin-4- one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(3-difluoromethoxy-phenyl)-lH-pyridazin-4-one,
3-[4-Oxo-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-4H-pyridazin-l-yl]-benzonitrile,
3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N,N-dimethyl- benzamide,
3- {3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N,N-dimethyl- benzamide,
N,N-Diethyl-3- {3-[2-(3-fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} - benzenesulfonamide,
3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-(4-trifluoromethyl-phenyl)-lH-pyridazin-4-one, 3 - [2-(3-Chloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 3 -(2-Quino lin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 3-(2-Quinolin-8-yl-2H-pyrazol-3-yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3-(2-o-Tolyl-2H-pyrazol-3-yl)-l -(4-trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 3- {5-[4-Oxo- 1 -(4-trifluoromethyl-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, l-(3-Chloro-phenyl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, 1 -(3 -Chloro-phenyl)-3-[2-(3-chloro-phenyl)-2H-pyrazo 1-3 -yl]-l H-pyridazin-4-one,
3 - [2-(3-Methyl-isothiazo 1-5 -yl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin- 4-one,
1 -(3-Chloro-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one, 3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)- 1 -(4-trifluoromethyl-phenyl)- 1 H-pyridazin-4-one, 1 -(4-Chloro-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one,
3 - [2-(6-Chloro-quino lin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one,
3 -(2-Isoquino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
3 -(2-Isoquino lin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, 3 -(2-Quino lin-5 -yl-2H-pyrazo 1-3 -yl)-l -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one, l-(4-Chloro-phenyl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, l-(4-Chloro-phenyl)-3-[2-(3-chloro-phenyl)-2H-pyrazo 1-3 -yl]-l H-pyridazin-4-one, 1 -(3 -Dimethylaminomethyl-phenyl)-3 - [2-(2-fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 H-pyridazin-4- one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -[3-(piperidine- 1 -sulfonyl)-phenyl]- lH-pyridazin-4- one,
3 - [2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4- one, 1 -(4-Dimethylaminomethyl-phenyl)-3 - [2-(2-fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 H-pyridazin-4- one,
3 -(2-Isoquino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4- one, 3-(2-Quinolin-5-yl-2H-pyrazol-3-yl)-l-(4-trifluoromethanesulfonyl-phenyl)-lH-pyridazin-4-one,
3-[2-(4-Chloro-naphthalen- 1 -yl)-2H-pyrazol-3-yl]- 1 -phenyl- lH-pyridazin-4-one,
3-[2-(4-Chloro-naphthalen- 1 -yl)-2H-pyrazol-3-yl]- 1 -(4-trifluoromethyl-phenyl)- lH-pyridazin-4- one,
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -[3 -(pyrrolidine- 1 -sulfonyl)-phenyl]- lH-pyridazin-4- one,
4- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N-methyl- benzenesulfonamide,
3 - [2-(7-Chloro-quino lin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one, N,N-Diethyl-3-[4-oxo-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-4H-pyridazin-l-yl]- benzenesulfonamide,
3 -(2-Quino lin-4-yl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4-one,
3-[2-(4-Chloro-naphthalen- 1 -yl)-2H-pyrazol-3-yl]- 1 -(4-chloro-phenyl)- 1 H-pyridazin-4-one,
3-[2-(4-Chloro-naphthalen- 1 -yl)-2H-pyrazol-3-yl]- 1 -(3 -chloro-phenyl)- 1 H-pyridazin-4-one, N,N-Diethyl-3-[3-(2-isoquinolin-5-yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin-l-yl]- benzenesulfonamide,
3-(2-Isoquinolin-8-yl-2H-pyrazol-3-yl)-l -(4-trifluoromethoxy-phenyl)- 1 H-pyridazin-4-one,
1 -(4-Trifluoromethoxy-phenyl)-3 - [2-(2-trifluoromethyl-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 H- pyridazin-4-one, 3-[3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin-l-yl]-benzonitrile,
3-{3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin-l-yl}-benzonitrile,
1 -[3 -(Pyrrolidine- 1 -sulfo nyl)-phenyl] -3 -(2-quino lin-5 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one,
3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]- 1 -[3 -(pyrrolidine- 1 - sulfo nyl)-phenyl]- IH- pyridazin-4-one, 3-{3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin-l-yl}-N,N-diethyl- benzenesulfonamide,
3-{3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin-l-yl}-N-methyl- benzenesulfonamide, 3-[3-(2-Isoquinolin-8-yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin-l-yl]-N,N-dimethyl- benzenesulfonamide,
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4- one, 3-(2-Phenyl-2H-pyrazol-3-yl)-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4-one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4- one,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4- one, 3-(2-Quinolin-4-yl-2H-pyrazol-3-yl)- 1 -[4-(2,2,2-trifluoro-ethoxy)-phenyl]- lH-pyridazin-4-one,
3- {3-[2-(2-Methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -benzonitrile, 3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)- 1 -[3-(pyrrolidine- 1 -sulfonyl)-phenyl]- lH-pyridazin-4- one,
N-Methyl-3- {3-[2-(2-methyl-pyridin-4-yl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} - benzenesulfonamide,
3 - [3 -(2-Isoquino lin-5 -yl-2H-pyrazol-3 -yl)-4-oxo-4H-pyridazin- 1 -yl] -N-methyl- benzenesulfonamide,
3-[2-(6-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]- 1 -[3 -(pyrrolidine- 1 -sulfonyl)-phenyl]- IH- pyridazin-4-one, l-[3-(Piperidine-l-sulfonyl)-phenyl]-3-(2-quinolin-5-yl-2H-pyrazol-3-yl)-lH-pyridazin-4-one,
3-(2-Isoquinolin-5-yl-2H-pyrazol-3-yl)- 1 -[3-(piperidine- 1 -sulfonyl)-phenyl]- lH-pyridazin-4-one,
3-[2-(6-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]- 1 -[3-(piperidine- 1 -sulfonyl)-phenyl]- IH- pyridazin-4-one,
3-[2-(7-Chloro-quinolin-4-yl)-2H-pyrazol-3-yl]- 1 -[3-(piperidine- 1 -sulfonyl)-phenyl]- IH- pyridazin-4-one,
N,N-Diethyl-3- {3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} - benzenesulfonamide,
3 - {3 - [2-(3 -Fluoro-phenyl)-2H-pyrazo 1-3 -yl] -4-oxo-4H-pyridazin- 1 -yl} -benzonitrile,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -[3-(pyrrolidine- 1 -sulfonyl)-phenyl]- lH-pyridazin-4- one,
4- {3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N-methyl- benzenesulfonamide,
3-[2-(3-Fluoro-phenyl)-2H-pyrazol-3-yl]- 1 -[3-(piperidine- 1 -sulfonyl)-phenyl]- lH-pyridazin-4- one,
3- {3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -benzonitrile, 3-[2-(2,5-Difluoro-phenyl)-2H-pyrazol-3-yl]- 1 -[3-(pyrrolidine- 1 -sulfonyl)-phenyl]- IH- pyridazin-4-one, 1 -(3-Hydroxy-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazol-3-yl)- lH-pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(3-hydroxy-phenyl)-lH-pyridazin-
4-one,
3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4-one,
3 - [2-(3-Chloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin- 4-one,
3 - [2-(2,3 -Dichloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H- pyridazin-4-one,
3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4-one,
3 - [2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4- one,
3 - [2-(3-Chloro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin- 4-one,
3- {5-[4-Oxo- 1 -(3-trifluoromethanesulfonyl-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile, 3-[2-(2,3-Dichloro-phenyl)-2H-pyrazol-3-yl]-l-(3-trifluoromethanesulfonyl-phenyl)-lH- pyridazin-4-one,
3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -benzonitrile, 3 - {3 - [2-(3 -Chloro-phenyl)-2H-pyrazol-3 -yl] -4-oxo-4H-pyridazin- 1 -yl} -benzonitrile, 3 - [2-(3-Chloro-2-fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H- pyridazin-4-one,
3 - [2-(3-Chloro-2-fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethanesulfonyl-phenyl)- 1 H- pyridazin-4-one,
3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(3-fluoromethoxy-phenyl)-lH- pyridazin-4-one, 1 -(3-Fluoromethoxy-phenyl)-3-(2-naphthalen- 1 -yl-2H-pyrazo 1-3 -yl)- 1 H-pyridazin-4-one,
N-(3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -phenyl)-acetamide, 3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N-methyl-benzamide, N-(3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -phenyl)-N-methyl- acetamide,
3-[3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin- 1 -yl]-benzoic acid 2-fluoro-ethyl ester,
3-[3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin- 1 -yl]-benzoic acid 3-fluoro- propyl ester,
3-[3-(2-Naphthalen-l-yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin-l-yl]-benzoic acid methyl ester, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l -[3-(I -hydro xy-ethyl)-phenyl]-lH-pyridazin-4-one, and l-(3-Acetyl-phenyl)-3-[2-(2-fluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one, and pharmaceutically acceptable salts and esters thereof.
21. Compounds according to any of claims 1 - 17, selected from the group consisting of
3-[2-(2,4-Difluoro-phenyl)-2H-pyrazol-3-yl]-l-(3-methanesulfonyl-phenyl)-lH-pyridazin-4-one, l-(3-Difluoromethoxy-phenyl)-3-[2-(2,5-difluoro-phenyl)-2H-pyrazol-3-yl]-lH-pyridazin-4-one,
3 - [2-(2-Methyl-pyridin-4-yl)-2H-pyrazo 1-3 -yl] - 1 -(3 -trifluoromethoxy-phenyl)- 1 H-pyridazin-4- one, l-(3-Difluoromethoxy-phenyl)-3-[2-(6-fluoro-quinolin-4-yl)-2H-pyrazol-3-yl]-lH-pyridazin-4- one, 3-(2-Quinolin-4-yl-2H-pyrazol-3-yl)-l-(4-trifluoromethoxy-phenyl)-lH-pyridazin-4-one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-(3-difluoromethoxy-phenyl)-lH-pyridazin-4-one,
3-[4-Oxo-3-(2-quinolin-4-yl-2H-pyrazol-3-yl)-4H-pyridazin-l-yl]-benzonitrile,
3 - [2-(2-Fluoro-phenyl)-2H-pyrazo 1-3 -yl] - 1 -(4-trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4- one, 3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4- one,
3-[2-(3-Chloro-phenyl)-2H-pyrazol-3-yl]-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4- one,
3-(2-Quinolin-4-yl-2H-pyrazol-3-yl)-l-[4-(2,2,2-trifluoro-ethoxy)-phenyl]-lH-pyridazin-4-one, 3-[2-(2,3-Dihydro-benzo[l,4]dioxin-6-yl)-2H-pyrazol-3-yl]-l-(3-hydroxy-phenyl)-lH-pyridazin-
4-one,
3 -(2-Phenyl-2H-pyrazo 1-3 -yl)- 1 -(3 -trifluoromethanesulfonyl-phenyl)- 1 H-pyridazin-4-one,
3- {5-[4-Oxo- 1 -(3-trifluoromethanesulfonyl-phenyl)- 1 ,4-dihydro-pyridazin-3-yl]-pyrazol- 1 -yl} - benzonitrile,
3 - {3 - [2-(3 -Chloro-phenyl)-2H-pyrazol-3 -yl] -4-oxo-4H-pyridazin- 1 -yl} -benzonitrile, N-(3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -phenyl)-acetamide, 3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -N-methyl-benzamide, N-(3- {3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-4-oxo-4H-pyridazin- 1 -yl} -phenyl)-N-methyl- acetamide,
3-[3-(2-Naphthalen- 1 -yl-2H-pyrazol-3-yl)-4-oxo-4H-pyridazin- 1 -yl]-benzoic acid 2-fluoro-ethyl ester, and
3-[2-(2-Fluoro-phenyl)-2H-pyrazol-3-yl]-l -[3-(I -hydro xy-ethyl)-phenyl]-lH-pyridazin-4-one, and pharmaceutically acceptable salts and esters thereof.
22. A process for the manufacture of compounds of formula (I) as defined in any of claims 1 - 21, which process comprises reacting a compound of formula (II)
Figure imgf000240_0001
with a compound of the formula R2 -NH-NH2, wherein R1, R2, R3 and R4 are as defined in any of claims 1 - 21.
23. Compounds according to any of claims 1 - 21, when manufactured by a process according to claim 22.
24. Pharmaceutical compositions comprising a compound according to any of claims 1 - 21 and a pharmaceutically acceptable carrier and/or adjuvant.
25. Compounds according to any of claims 1 - 21 for use as therapeutic active substances.
26. Compounds according to any of claims 1 - 21 for use as therapeutic active substances for the treatment and/or prophylaxis of diseases which are modulated by PDElOA inhibitors.
27. A method for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors, particularly for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention- defϊcit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer, which method comprises administering a compound according to any of claims 1 - 21 to a human being or animal.
28. The use of compounds according to any of claims 1 - 21 for the therapeutic and/or prophylactic treatment of diseases which are modulated PDElOA inhibitors.
29. The use of compounds according to any of claims 1 - 21 for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention- defϊcit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer.
30. The use of compounds according to any of claims 1 - 21 for the preparation of medicaments for the therapeutic and/or prophylactic treatment of diseases which are modulated by PDElOA inhibitors.
31. The use of compounds according to any of claims 1 - 21 for the preparation of medicaments for the therapeutic and/or prophylactic treatment of psychotic disorders, schizophrenia, positive, negative and/or cognitive symptoms associated with schizophrenia, delusional disorder, substance-induced psychotic disorder, anxiety disorders, panic disorder, obsessive/compulsive disorders, acute stress disorder, generalized anxiety disorder, drug addictions, movement disorders, Parkinson's disease, restless leg syndrome, cognition deficiency disorders, Alzheimer's disease, multi-infarct dementia, mood disorders, depression, bipolar disorders, neuropsychiatric conditions, psychosis, attention-defϊcit/hyperactivity disorder, attentional disorders, diabetes and related disorders, type 2 diabetes mellitus, neurodegenerative disorders, Huntington's disease, multiple sclerosis, stroke, spinal cord injury, solid tumors, hematological malignancies, renal cell carcinoma and breast cancer.
32. The invention as hereinbefore defined.
PCT/EP2009/065692 2008-12-04 2009-11-24 Pyridazinone derivatives Ceased WO2010063610A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
CN200980148519.1A CN102239162B (en) 2008-12-04 2009-11-24 Pyridazinone Derivatives
AU2009321601A AU2009321601B2 (en) 2008-12-04 2009-11-24 Pyridazinone derivatives
MX2011005449A MX2011005449A (en) 2008-12-04 2009-11-24 Pyridazinone derivatives.
SG2011040714A SG171954A1 (en) 2008-12-04 2009-11-24 Pyridazinone derivatives
EP09756503A EP2373641B1 (en) 2008-12-04 2009-11-24 Pyridazinone derivatives
ES09756503T ES2401670T3 (en) 2008-12-04 2009-11-24 Pyridazinone derivatives
JP2011538950A JP5502890B2 (en) 2008-12-04 2009-11-24 Pyridazinone derivatives
KR1020117015172A KR101371881B1 (en) 2008-12-04 2009-11-24 Pyridazinone derivatives
CA2744489A CA2744489C (en) 2008-12-04 2009-11-24 Pyridazinone derivatives
IL212636A IL212636A0 (en) 2008-12-04 2011-05-02 Pyridazinone derivatives

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP08170716 2008-12-04
EP08170716.8 2008-12-04

Publications (1)

Publication Number Publication Date
WO2010063610A1 true WO2010063610A1 (en) 2010-06-10

Family

ID=41728862

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2009/065692 Ceased WO2010063610A1 (en) 2008-12-04 2009-11-24 Pyridazinone derivatives

Country Status (12)

Country Link
US (1) US8178538B2 (en)
EP (1) EP2373641B1 (en)
JP (1) JP5502890B2 (en)
KR (1) KR101371881B1 (en)
CN (1) CN102239162B (en)
AU (1) AU2009321601B2 (en)
CA (1) CA2744489C (en)
ES (1) ES2401670T3 (en)
IL (1) IL212636A0 (en)
MX (1) MX2011005449A (en)
SG (1) SG171954A1 (en)
WO (1) WO2010063610A1 (en)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100197651A1 (en) * 2009-02-05 2010-08-05 Takahiko Taniguchi Pyridazinone compounds
WO2012018058A1 (en) 2010-08-04 2012-02-09 武田薬品工業株式会社 Fused heterocyclic ring compound
WO2012018059A1 (en) 2010-08-04 2012-02-09 武田薬品工業株式会社 Heterocyclic compound
WO2012018909A1 (en) 2010-08-04 2012-02-09 Takeda Pharmaceutical Company Limited Fused heterocyclic compounds
WO2012020780A1 (en) 2010-08-10 2012-02-16 武田薬品工業株式会社 Heterocyclic compound and use thereof
WO2012029326A1 (en) * 2010-09-03 2012-03-08 大正製薬株式会社 3-pyrazolyl-2-pyridone derivative
WO2012112946A1 (en) 2011-02-18 2012-08-23 Allergan, Inc. Substituted 6,7-dialkoxy-3-isoquinolinol derivatives as inhibitors of phosphodiesterase 10 (pde10a)
WO2014071044A1 (en) 2012-11-01 2014-05-08 Allergan, Inc. Substituted 6,7-dialkoxy-3-isoquinoline derivatives as inhibitors of phosphodiesterase 10 (pde10a)
WO2014139150A1 (en) * 2013-03-15 2014-09-18 Merck Sharp & Dohme Corp. Substituted pyridizinone derivatives as pde10 inhibitors
US9029388B2 (en) 2011-03-16 2015-05-12 Takeda Pharmaceutical Company Limited Condensed heterocyclic compound
US9187455B2 (en) 2009-02-23 2015-11-17 Hoffmann-La Roche Inc. Substituted pyridazines as PDE10A inhibitors
US9200016B2 (en) 2013-12-05 2015-12-01 Allergan, Inc. Substituted 6, 7-dialkoxy-3-isoquinoline derivatives as inhibitors of phosphodiesterase 10 (PDE 10A)
US9579407B2 (en) 2011-08-22 2017-02-28 Takeda Pharmaceutical Company Limited Radiolabeled compounds and their use as radiotracers for quantitative imaging of phosphodiesterase (PDE10A) in mammals
US10174004B2 (en) 2013-02-21 2019-01-08 Takeda Pharmaceutical Company Limited Production method of pyridazinone compounds
WO2020094592A1 (en) 2018-11-06 2020-05-14 H. Lundbeck A/S Compounds for treating negative symptoms and cognitive impairments
WO2020094591A1 (en) 2018-11-06 2020-05-14 H. Lundbeck A/S Pde10a inhibitors for treating negative symptoms and cognitive impairments in a patient suffering from schizophrenia
EP3763367A1 (en) * 2012-12-06 2021-01-13 Celgene Quanticel Research, Inc. Pyridine-pyrazole derivatives as histone demethylase inhibitors

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015006689A1 (en) 2013-07-12 2015-01-15 University Of South Alabama Treatment and diagnosis of cancer and precancerous conditions using pde10a inhibitors and methods to measure pde10a expression
DK3240785T3 (en) 2014-12-29 2021-09-27 Us Health SMALL MOLECULATE INHIBITORIES OF LACTASE DEHYDROGENASIS AND PROCEDURES FOR USE
WO2016145614A1 (en) * 2015-03-17 2016-09-22 Merck Sharp & Dohme Corp. Triazolyl pyrimidinone compounds as pde2 inhibitors
WO2020113094A1 (en) 2018-11-30 2020-06-04 Nuvation Bio Inc. Pyrrole and pyrazole compounds and methods of use thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1553096A1 (en) * 2002-09-25 2005-07-13 Ube Industries, Ltd. Pyrazole compounds
WO2007129183A2 (en) * 2006-05-02 2007-11-15 Pfizer Products Inc. Bicyclic heteroaryl compounds as pde10 inhibitors
WO2009053799A1 (en) * 2007-10-24 2009-04-30 Glenmark Pharmaceuticals, S.A. Novel cannabinoid receptor ligands, pharmaceutical compositions containing them, and process for their preparation

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2296910T3 (en) * 2001-01-22 2008-05-01 Sankyo Company, Limited SUBSTITUTED COMPOUNDS WITH AMINO BICICLIC GROUP.
EP1651251A4 (en) 2003-07-31 2008-06-18 Bayer Pharmaceuticals Corp Methods for treating diabetes and related disorders using pde10a inhibitors
EP1749825A1 (en) 2005-07-28 2007-02-07 Galderma S.A. Process of producing amorolfine

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1553096A1 (en) * 2002-09-25 2005-07-13 Ube Industries, Ltd. Pyrazole compounds
WO2007129183A2 (en) * 2006-05-02 2007-11-15 Pfizer Products Inc. Bicyclic heteroaryl compounds as pde10 inhibitors
WO2009053799A1 (en) * 2007-10-24 2009-04-30 Glenmark Pharmaceuticals, S.A. Novel cannabinoid receptor ligands, pharmaceutical compositions containing them, and process for their preparation

Cited By (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8513251B2 (en) 2009-02-05 2013-08-20 Takeda Pharmaceutical Company Limited Pyridazinone compounds
US20120028951A1 (en) * 2009-02-05 2012-02-02 Takeda Pharmaceutical Company Limited Pyridazinone compounds
US9550756B2 (en) 2009-02-05 2017-01-24 Takeda Pharmaceutical Company Limited Pyridazinone compounds as phosphodiesterase inhibitors and methods of treating disorders
AU2010211050B2 (en) * 2009-02-05 2016-05-12 Takeda Pharmaceutical Company Limited Pyridazinone compounds
US20100197651A1 (en) * 2009-02-05 2010-08-05 Takahiko Taniguchi Pyridazinone compounds
US8916566B2 (en) 2009-02-05 2014-12-23 Takeda Pharmaceutical Company Limited Pyridazinone compounds as phosphodiesterase inhibitors and methods of treating disorders
EP2393360A4 (en) * 2009-02-05 2012-08-15 Takeda Pharmaceutical PYRIDAZINONE COMPOUNDS
US8778944B2 (en) 2009-02-05 2014-07-15 Takeda Pharmaceutical Company Limited Pyridazinone compounds
US8354411B2 (en) 2009-02-05 2013-01-15 Takeda Pharmaceutical Company Limited 1-phenyl-3-pyrazolylpyridazin-4(1H)-one compound
US8435995B2 (en) 2009-02-05 2013-05-07 Takeda Pharmaceutical Company Limited Pyridazinone compounds
US9187455B2 (en) 2009-02-23 2015-11-17 Hoffmann-La Roche Inc. Substituted pyridazines as PDE10A inhibitors
US9029536B2 (en) 2010-08-04 2015-05-12 Takeda Pharmaceutical Company Limited Fused heterocyclic compounds
US9090586B2 (en) 2010-08-04 2015-07-28 Takeda Pharmaceutical Company Limited Heterocyclic compound
WO2012018058A1 (en) 2010-08-04 2012-02-09 武田薬品工業株式会社 Fused heterocyclic ring compound
WO2012018059A1 (en) 2010-08-04 2012-02-09 武田薬品工業株式会社 Heterocyclic compound
WO2012018909A1 (en) 2010-08-04 2012-02-09 Takeda Pharmaceutical Company Limited Fused heterocyclic compounds
US8883788B2 (en) 2010-08-04 2014-11-11 Takeda Pharmaceutical Company Limited Fused heterocyclic ring compound
JP5800813B2 (en) * 2010-08-04 2015-10-28 武田薬品工業株式会社 Heterocyclic compounds
WO2012020780A1 (en) 2010-08-10 2012-02-16 武田薬品工業株式会社 Heterocyclic compound and use thereof
US9150588B2 (en) 2010-08-10 2015-10-06 Takeda Pharmaceutical Company Limited Substituted pyridazin-4(1H)-ones as phosphodiesterase 10A inhibitors
JP5800814B2 (en) * 2010-08-10 2015-10-28 武田薬品工業株式会社 Heterocyclic compounds and uses thereof
WO2012029326A1 (en) * 2010-09-03 2012-03-08 大正製薬株式会社 3-pyrazolyl-2-pyridone derivative
US9670181B2 (en) 2011-02-18 2017-06-06 Allergan, Inc. Substituted 6,7-dialkoxy-3-isoquinolinol derivatives as inhibitors of phosphodiesterase 10 (PDE 10A)
WO2012112946A1 (en) 2011-02-18 2012-08-23 Allergan, Inc. Substituted 6,7-dialkoxy-3-isoquinolinol derivatives as inhibitors of phosphodiesterase 10 (pde10a)
US8772316B2 (en) 2011-02-18 2014-07-08 Allergan, Inc. Substituted 6,7-dialkoxy-3-isoquinolinol derivatives as inhibitors of phosphodiesterase 10 (PDE10A)
US9029388B2 (en) 2011-03-16 2015-05-12 Takeda Pharmaceutical Company Limited Condensed heterocyclic compound
US9579407B2 (en) 2011-08-22 2017-02-28 Takeda Pharmaceutical Company Limited Radiolabeled compounds and their use as radiotracers for quantitative imaging of phosphodiesterase (PDE10A) in mammals
WO2014071044A1 (en) 2012-11-01 2014-05-08 Allergan, Inc. Substituted 6,7-dialkoxy-3-isoquinoline derivatives as inhibitors of phosphodiesterase 10 (pde10a)
EP3763367A1 (en) * 2012-12-06 2021-01-13 Celgene Quanticel Research, Inc. Pyridine-pyrazole derivatives as histone demethylase inhibitors
US10174004B2 (en) 2013-02-21 2019-01-08 Takeda Pharmaceutical Company Limited Production method of pyridazinone compounds
US9353104B2 (en) 2013-03-15 2016-05-31 Merck Sharp & Dohme Corp. Substituted pyridizinone derivatives as PDE10 inhibitors
WO2014139150A1 (en) * 2013-03-15 2014-09-18 Merck Sharp & Dohme Corp. Substituted pyridizinone derivatives as pde10 inhibitors
US9902710B2 (en) 2013-12-05 2018-02-27 Exonhit Therapeutics, Sa Substituted 6, 7-dialkoxy-3-isoquinoline derivatives as inhibitors of phosphodiesterase 10 (PDE 10A)
US9200016B2 (en) 2013-12-05 2015-12-01 Allergan, Inc. Substituted 6, 7-dialkoxy-3-isoquinoline derivatives as inhibitors of phosphodiesterase 10 (PDE 10A)
WO2020094592A1 (en) 2018-11-06 2020-05-14 H. Lundbeck A/S Compounds for treating negative symptoms and cognitive impairments
WO2020094591A1 (en) 2018-11-06 2020-05-14 H. Lundbeck A/S Pde10a inhibitors for treating negative symptoms and cognitive impairments in a patient suffering from schizophrenia

Also Published As

Publication number Publication date
KR20110091889A (en) 2011-08-16
US8178538B2 (en) 2012-05-15
CN102239162A (en) 2011-11-09
ES2401670T3 (en) 2013-04-23
CA2744489C (en) 2015-06-23
CN102239162B (en) 2014-05-28
KR101371881B1 (en) 2014-03-07
JP2012510969A (en) 2012-05-17
US20100152193A1 (en) 2010-06-17
JP5502890B2 (en) 2014-05-28
AU2009321601B2 (en) 2012-11-01
AU2009321601A1 (en) 2010-06-10
EP2373641A1 (en) 2011-10-12
IL212636A0 (en) 2011-07-31
MX2011005449A (en) 2011-06-09
SG171954A1 (en) 2011-07-28
EP2373641B1 (en) 2012-12-19
CA2744489A1 (en) 2010-06-10

Similar Documents

Publication Publication Date Title
EP2373641B1 (en) Pyridazinone derivatives
EP2398795B1 (en) Heteroaryl substituted pyridazinone derivatives
JP5179509B2 (en) Substituted pyrimidines and their use as JNK modulators
CA2770087C (en) Imidazopyridine or imidazopyrimidine derivatives as phosphodiesterase 1oa inhibitors
US8470820B2 (en) Nitrogen-containing heteroaryl derivatives
EP2855455B1 (en) Triazolo compounds as pde10 inhibitors
MXPA06004438A (en) Indolinone derivatives and their use in treating disease-states such as cancer.
JP2001510480A (en) Phenylbenzimidazole derivatives as ligands for GABA receptors
US20050124620A1 (en) Pharmaceutical compounds
KR20080063833A (en) Tricyclic Lactam Derivatives, Preparations thereof, and Uses as Pharmaceutical Agents

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200980148519.1

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09756503

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 212636

Country of ref document: IL

Ref document number: 2009756503

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2009321601

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: MX/A/2011/005449

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2744489

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2011538950

Country of ref document: JP

Ref document number: 3883/CHENP/2011

Country of ref document: IN

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2009321601

Country of ref document: AU

Date of ref document: 20091124

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20117015172

Country of ref document: KR

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: PI0922940

Country of ref document: BR

Free format text: VIDE PARECER

ENPW Started to enter national phase and was withdrawn or failed for other reasons

Ref document number: PI0922940

Country of ref document: BR

Free format text: PEDIDO RETIRADO EM RELACAO AO BRASIL POR NAO ATENDER AS DETERMINACOES REFERENTES A ENTRADA DO PEDIDO NA FASE NACIONAL E POR NAO CUMPRIMENTO DA EXIGENCIA FORMULADA NA RPI NO 2588 DE 11/08/2020.