WO2010060934A2 - Cnnm proteins and uses thereof - Google Patents
Cnnm proteins and uses thereof Download PDFInfo
- Publication number
- WO2010060934A2 WO2010060934A2 PCT/EP2009/065848 EP2009065848W WO2010060934A2 WO 2010060934 A2 WO2010060934 A2 WO 2010060934A2 EP 2009065848 W EP2009065848 W EP 2009065848W WO 2010060934 A2 WO2010060934 A2 WO 2010060934A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- cnnm4
- cnnm
- mutation
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4738—Cell cycle regulated proteins, e.g. cyclin, CDC, INK-CCR
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/06—Antiarrhythmics
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/16—Ophthalmology
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/18—Dental and oral disorders
Definitions
- the present invention relates proteins from the group consisting of CNNMl, CNNM2, CNNM3 and CNNM4 , its derivatives or fragments thereof for use as a medicament.
- Cone-rod dystrophies are inherited dystrophies of the retina characterized by the accumulation of deposits mainly localized to the cone-rich macular region of the eye. Dystrophy can be limited to the retina or be part of a syndrome.
- syndromic cone-rod dystrophies are genetically heterogeneous with mutations in genes encoding structural, cell adhesion and transporter proteins.
- CNNM4 conserved domain proteins 4 gene
- Cone-rod dystrophy is a generic term that designs a clinically and genetically heterogeneous group of diseases of the retina.
- the macula is characteristically affected first by typical decreased visual acuity and loss of sensitivity in the central visual field, in contrary to rod-cone dystrophy which is best represented by retinitis pigmentosa leading to loss of peripheral vision and night blindness.
- CRD can be non syndromic and due to mutations in genes implicated, among others, in photoreceptor development, synaptic transmission or structure; in retinoid metabolism or in opsin trafficking 1 .
- CRD also occurs in syndromic forms as in Bardet-Biedl 2 , thiamine responsive megaloblastic anemia (Rogers syndrome) 3 or spinocerebellar atexia type 7 4 . In rare instances, it has been associated with dysmorphic syndromes or metabolic dysfunctions 1 . Recently, a new autosomic recessive syndrome associating CRD and amelogene- sis imperfecta (AI) has been described 5 and mapped to human chromosome 2qll 6;7 (OMIM: 217080) . For the first time, we herein report on two additional families and show that mutations in the CNNM4 gene, a metal ion transporter encoding gene, cause this condition. Straight-forward applications of this finding are also discussed.
- the pedigree consisted of two families. Blood was collected from family members after informed consent and DNA was isolated from peripheral leukocytes with the Nucleon-Bacc2 (Am- ersham Biosciences) . The affected family members had a complete eye and dental evaluation, including best corrected Snellen visual acuity (BCVA) , slit lamp examination, funduscopy, Goldmann perimetry, electroretinography (ERG) , optical coherence tomography (OCT), fundus colour pictures and autofluorescence . Affected members were carefully assessed by a dentist. The parents and unaffected siblings had complete physical evaluation, including best vision and fundus evaluation and dental inspection. The protocol of the study adhered to the provisions of the Declaration of Helsinki.
- Genome scan Linkage analysis was performed at the University of Lausanne Affymetrix GeneChip platform applying the human mapping 5OK Xbal array according to the manufacturer's protocols on fam- ily A. Data were acquired with Affymetrix GCOS v.1.2 software. An in-house software was implemented in order to display continuous homozygosity regions among the affected individuals. Genes in the interval defined by the homozygous SNPs were identified in Ensembl and evaluated for potential implication based on expression and previous implication in inherited diseases.
- RT- PCR of mouse Cnnm4 was performed on RNA extracted from teeth of 2 -day old C57B1 / 6 mice us ing the fol low ⁇ ing primers : 5 ' - CTCTA GGAGG CACTC TTCTGC- 3 ' and 5 ' -ATCCT CAGCC AGCCA TGC- 3 ' .
- primers were designed for RT-PCR as well as real-time PCR and are described in Table 2. Genomic DNA contamination was checked as described 8 .
- cnnm4 MO ATTTT GCCAC TGTCC ACTCA CTGTA
- control-MO ct-MO
- ATaTT cCCAC TcTCC ACTgA CTcTA ATaTT cCCAC TcTCC ACTgA CTcTA
- Toluidine Blue-staining Embryos were fixed in 4% PFA overnight. Standard Technovit 8100 embedding protocol was used, embryos were sectioned on microtome (5 ⁇ m thick sections) and stained with toluidine blue. For cell count, sections including the optic nerve were used as well as one before and one after. The eyes from 6 wild type, cnnm4 MO- and ct-MO-injected embryos were screened. Zebrafish do not have buccal teeth, but instead have two sets of pharyngeal teeth.
- Embryos were evaluated at 5 dpf and the number of ganglion cells was counted on toluidine blue-stained sections containing the optic nerve. The number of GCL from wt embryo was set to 1 and the counts in the morphants and rescued embryos were compared.
- ARVO Association for Research in Vision and Ophthalmology
- the OCT device that was used is not sensitive enough to evaluate any ganglion cell loss. However, if present, such a loss would be associated with reduced night vision, a sign often present in rod cone dystrophies.
- Fullfield photopic ERGs performed according to protocols recommended by the International Society for Clinical Electrophysiol- ogy of Vision (ISCEV) was non recordable. Under scotopic conditions, b-wave amplitudes were markedly reduced in patient II.1 and severely reduced in patient II.4. A slightly delayed culmination time of the b-wave was observed in both patients. During the 7 years follow-up of patient II.1, the remaining scotopic bwave dropped by 40% of the lower limit for the age. At the same time, both children were followed by a dentist for AI (Fig. Ih) .
- patient II.4 had a mandibular cyst which contained the 2 lower incisives and 1 premolar.
- Family B is a 5-generation consanguineous family originating from Lebanon (Fig. Ib) .
- Two sisters and 1 cousin were affected with a disease very closely resembling patients from family A.
- a bilateral nystagmus was noted by the parents.
- their major complaints were the presence of photophobia and difficulties to see in darkness.
- the decidual and permanent teeth were yellow/brown showing no enamel layer with numerous carious lesions in the 2 sisters, consistent with a hypoplastic, hypomineralized AI.
- ERG examination of patient V.6 at 2 years according to ISCEV standards showed that the scotopic reponse was within normal while the photopic response was severely attenuated.
- Arginine 236 is located between the first and second transmembrane domains of the protein and is totally conserved among species as far as C. elegans . It is also fully conserved in human and mouse paralogs (Fig. 6) . Both these mutations were analyzed in ethnically matched control individuals and in 1248 index patients with various forms of retinal degeneration. The C heterozygous duplication was observed in one control individual coming from the same geographical region as family A. No mutation was observed in the screened cohort of patients .
- Cnnm4 was evaluated by immunohistology on postnatal day 2 (P2) and on 2-month-old (2M) C57B1/J6 mice. At 2M, strong expression was observed in the different parts of the eye (Fig. 2) .
- Cnnm4 expression is mainly observed in the epithelium surrounding the nuclei, in the keratocytes and in the endoderm.
- Cnnm4 expression was concentrated in the ganglion cell layers, the inner (IPL) and outer plexiform layers (OPL) and the inner and outer photoreceptor segments (Fig. 2) where it is mainly localized to the cytoplasm compartment, surrounding the nucleus.
- IPL and OPL consist mainly of connecting fibrils and dendrites from ganglion, bipolar, amacrine, Muller and horizontal cells and rod and cone photoreceptors.
- the nuclei of the inner and outer cell layers as well as the retinal pigment epithelium also expressed Cnnm4, but at a lower level. This expression is consistent with the observation that Cnnm4 is localized in dendrites and soma of cultured neurons 13 .
- AI describes a group of inherited disorders primarily affecting the formation of enamel, a tissue with low protein and high mineral content.
- ameloblasts secrete the 4 major matrix proteins and proteases: amelogenin, ameloblastin, enamelin and enamelysin. While this part of tooth development is relatively well characterized, not much is known on the maturation of enamel, during which the protein content is slowly being reduced and the mineral content is increased in order to produce enamel, the strongest tissue of the body 14 ' '15 .
- CNNM4 is implicated in ion transport 13 ' '16 , possibly magnesium, the hypoplastic/ hypomineralised form of AI present in both families could result from aberrant mineralization of enamel.
- CNNM4 is characterized by an " Egyptian conserved domain" that is evolutionarily conserved in species ranging from bacteria to mammals 16 , including zebrafish.
- dpf day post fertilization
- dpf transient tachycardia was observed in most of the embryos treated with MO. This tachycardia was not observed anymore at 5 dpf.
- the eyes of the morphants showed a reduction of approximately 35% of the number of ganglion cells on toluidine blue- stained sections. This reduction was rescued by about 50% with injection of human CNNM4 mRNA (Fig. 4) .
- CNNM proteins are also known under the name of ACDPl to -4 and cyclin Ml to -4.
- CNNM4 is also sometimes referred to as FLJ42791 or KIAA1592.
- CNNM shall be construed as to comprise all these different denominations.
- the 775-amino acid CNNM4 protein has four transmembrane domains, a sequence motif present in cyclin box, a cNMP-binding domain (cyclic nucleotide- monophosphatebinding domain) , two cystathionine-beta-synthase (CBS) domains and a DUF21 domain 16 .
- CBS domains are small intracellular modules, usually found in two or four copies and whose function is still debated 17 .
- Proteins with CBS domains have been implicated as metabolic sensor (Cystathionine beta-synthase) , ATP binding (AMPactivated protein kinase) , nucleotide biosynthesis (inosine-5' -mono-phosphate dehydrogenase, IMPDH) and in intracellular trafficking and protein-protein interactions (CLC family) 17 .
- metabolic sensor Cystathionine beta-synthase
- AMPactivated protein kinase ATP binding
- IMPDH nucleotide biosynthesis
- IMPDH intracellular trafficking and protein-protein interactions
- CLC family protein-protein interactions
- CNNM4 is expressed in many tissues and recent studies on spinal cord dorsal horn neurons have shown that it is located on or close to the plasma membrane where it interacts with cytochrome oxydase 11 (COXIl) to regulate metal ion homeostasis 13 .
- COXIl cytochrome oxydase 11
- Metal ions are indispensable to many physiological processes, in particular to the visual cycle where, among other functions, magnesium is critical for adjusting the Ca 2+ sensitivity of the membrane guanylate cyclase 2d (GUCY2D) , an enzyme that produces cGMP in photoreceptor cells when stimulated by guanylyl cyclase- activating protein-1 (GCAPl) .
- GUI2D membrane guanylate cyclase 2d
- GCAPl guanylyl cyclase- activating protein-1
- GUCY2D Under physiological conditions, activation of photoreceptor GUCY2D is caused by Mg 2+ / Ca 2+ exchange in the EF-hands of GCAPl. Mutations in GUCY2D or GCAPl have been associated with rod-cone dystrophy 6 , Leber congenital amaurosis, a severe form of rod-cone dystrophy 21 and cone dystrophy, respectively 22 . Magnesium is also essential in enamel formation. It is found at high concentrations in enamel fluid surrounding the forming enamel crystals where it can compete with Ca ions for adsorption onto these crystals 23 .
- Releasing molecules and -devices useful in the context of the present invention are exhaustively known in the art, especially in ophthalmology, such as e.g. Vitrasert (FDA approved; Bausch and Lomb, Inc.), Retisert (FDA approved; Bausch and Lomb, Inc.), Medidur (FDA approved; Alimeira Sciences), Encapsulated Cell Technology (ECT, Neurotech) , Posurdex (Allergan, Inc.) .
- Vitrasert FDA approved; Bausch and Lomb, Inc.
- Retisert FDA approved; Bausch and Lomb, Inc.
- Medidur FDA approved; Alimeira Sciences
- Encapsulated Cell Technology ECT, Neurotech
- Posurdex Allergan, Inc.
- cell-penetrating peptides are described exhaustively and well known to the person of routine skill in the art, cf e.g. Bonny C, Oberson A, Negri S, Sauser C, Schorderet DF.
- Cell-permeable peptide inhibitors of JNK novel blockers of beta-cell death. Diabetes, 50:77-82, 2001.
- a suitable peptide is e.g. marketed by Xigen S. A. (Lausanne, Switzerland) under the tradename ICPTTM.
- NT 026970.9 (Sequence downloaded from Ensembl, Nov 23, 2008), Chromosome: NCBI36 : 2 : 96789766 : 96841955 : 1) SEQ ID #2: Human CNNM4 mRNA sequence (normal) , Accession # NM_020184.3; GI.94681045
- SEQ ID #4 Human CNNM4 mRNA sequence with dupC mutation
- SEQ ID #5 Human CNNM4 protein sequence with p.L438PfsX9 mutation; Duplication induces a frameshift mutation with a new putative stop codon (see SEQ ID # 17)
- SEQ ID #6 Human CNNM4 mRNA sequence with c.707G>A mutation
- SEQ ID #17 Mutated amino acids of SEQ ID #5; followed by STOP codon
- Figure 1 Pedigrees of family A (a) and B (b) . Filled symbols, affected individuals; open symbols, unaffected individuals, (c) Partial electropherograms of heterozygous (+/-) and homozygous
- OCT (patient II.4) showing decreased foveal and retinal thickness, loss of well defined retinal layers suggesting extensive loss of retinal cells and hyperreflectivity in the choroids due to the RPE and choriocapillaris atrophy, (h) Photograph of mouth
- FIG. 1 Cnnm4 immunostaining of cornea (a-c) and retina (d-f) of 2-month-old mouse retina.
- Cnnm4 is mainly expressed in the epithelium (epi) , surrounding the nuclei, in the keratocyte present in the stroma (st) and endothelium (en) .
- epi epithelium
- st stroma
- en endothelium
- immunostaining is mainly localized in the ganglion cell layer (arrow) , inner and outer plexi- form layers and the outer segments of the photoreceptors, (d) DAPI staining of the same slide, (f) negative control of immu- nostaining.
- epi epithelium
- st stroma
- en endothelium
- arrow ganglion cell layer
- asterisk inner cell layer
- filled triangle outer cell layer
- triangle retinal pigment epithelium.
- FIG. 3 Immunostaining of a lower incisive of a 2-day-old mouse. Cnnm4 is expressed in all tissues of the mandibula, including muscle and connective tissue (b) , DAPI staining of the same slide (a) , negative control of immunostaining (c) . At higher magnification (40Ox) , Cnnm4 is observed in the ameloblasts (filled triangle) and their cell body (open triangle) as well as in the odontoblasts (asterisk) (e) . (d) DAPI staining of the same slide, (f) negative control of hybridization .
- WT wild-type
- MO morpholino-treated embryos
- rescue mor- pholino-treated embryos injected with CNNM4 mRNA.
- Figure 5 Schematic representation of homozygous regions (black box) on human chromosomes.
- FIG. 7 Cnnm4 mRNA expression is at its highest levels in the mouse retina.
- Mouse Cnnml, -2, -3 and -4 mRNA expression was assessed by RT-PCR (panel A) and quantitative PCR (panel B) in mouse brain, retina, cornea, lens and rentinal pigment epithelium with attached choroids (RPE) samples. Pooled total RNA samples of 2 mice were used for each datapoint and quantitative results was performed on three samples in duplicate +/- SEM.
- RT-PCR For RT-PCR, amplified DNA fragments were analyzed on a 2% agarose gel and fragments of the expected size were detected, respectively 440 bp for Cnnml, 333 bp for Cnnm2, 195 bp for Cnnm3, 280 bp for Cnnm4 and 198 bp for the control gene RL8 (ribosomal protein L8), als indicated by the lkb Molecular Weight Marker (M; Roche, Basel, Switzerland) .
- M lkb Molecular Weight Marker
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Urology & Nephrology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Microbiology (AREA)
- Ophthalmology & Optometry (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention relates proteins from the group consisting of CNNM1, CNNM2, CNNM 3 and CNNM4, its derivatives or fragments thereof for use as a medicament, for treatment and or diagnostic purposes. The invention further relates to a human genomic DNA, cDNA or mRNA sequence encoding for a functional protein chosen from the group consisting of CNNM1, CNNM2, CNNM3 and CNNM4 and functional derivatives or fragments thereof.
Description
CNNM PROTEINS AND USES THEREOF
The present invention relates proteins from the group consisting of CNNMl, CNNM2, CNNM3 and CNNM4 , its derivatives or fragments thereof for use as a medicament.
SUMMARY
Cone-rod dystrophies are inherited dystrophies of the retina characterized by the accumulation of deposits mainly localized to the cone-rich macular region of the eye. Dystrophy can be limited to the retina or be part of a syndrome. As for pure cone-rod dystrophies, syndromic cone-rod dystrophies are genetically heterogeneous with mutations in genes encoding structural, cell adhesion and transporter proteins. Using a genome-wide SNP haplotype analysis to fine-map the locus and a gene candidate approach, we identified homozygous mutations in the ancient conserved domain proteins 4 gene (CNNM4) that either generate a truncated protein or that occur in a highly conserved region of the protein. As CNNM4 is implicated in metal ion transport, cone-rod dystrophy and amelogenesis imperfecta (Jalili syndrome) most likely originates from abnormal ion homeostasis. This has never been reported before.
INTRODUCTION
Cone-rod dystrophy (CRD) is a generic term that designs a clinically and genetically heterogeneous group of diseases of the retina. In CRD, the macula is characteristically affected first by typical decreased visual acuity and loss of sensitivity in the central visual field, in contrary to rod-cone dystrophy which is best represented by retinitis pigmentosa leading to loss of peripheral vision and night blindness. CRD can be non
syndromic and due to mutations in genes implicated, among others, in photoreceptor development, synaptic transmission or structure; in retinoid metabolism or in opsin trafficking1. CRD also occurs in syndromic forms as in Bardet-Biedl2, thiamine responsive megaloblastic anemia (Rogers syndrome)3 or spinocerebellar atexia type 74. In rare instances, it has been associated with dysmorphic syndromes or metabolic dysfunctions1. Recently, a new autosomic recessive syndrome associating CRD and amelogene- sis imperfecta (AI) has been described5 and mapped to human chromosome 2qll6;7 (OMIM: 217080) . For the first time, we herein report on two additional families and show that mutations in the CNNM4 gene, a metal ion transporter encoding gene, cause this condition. Straight-forward applications of this finding are also discussed.
SUBJECTS AND METHODS
Subjects. The pedigree consisted of two families. Blood was collected from family members after informed consent and DNA was isolated from peripheral leukocytes with the Nucleon-Bacc2 (Am- ersham Biosciences) . The affected family members had a complete eye and dental evaluation, including best corrected Snellen visual acuity (BCVA) , slit lamp examination, funduscopy, Goldmann perimetry, electroretinography (ERG) , optical coherence tomography (OCT), fundus colour pictures and autofluorescence . Affected members were carefully assessed by a dentist. The parents and unaffected siblings had complete physical evaluation, including best vision and fundus evaluation and dental inspection. The protocol of the study adhered to the provisions of the Declaration of Helsinki.
Genome scan. Linkage analysis was performed at the University of Lausanne Affymetrix GeneChip platform applying the human mapping 5OK Xbal array according to the manufacturer's protocols on fam-
ily A. Data were acquired with Affymetrix GCOS v.1.2 software. An in-house software was implemented in order to display continuous homozygosity regions among the affected individuals. Genes in the interval defined by the homozygous SNPs were identified in Ensembl and evaluated for potential implication based on expression and previous implication in inherited diseases.
Mutation detection. All exons and intron-exon junctions of the candidate genes were PCR amplified. After purification, the PCR templates were sequenced using ABI Dye Terminator, version 1 in a final reaction volume of 10 μl and run on a 3100 ABI genetic analyzer. The primers and conditions used to amplify the exons of CNNM4 are listed in Table 1. Heteroduplex analysis of the CNNM4 mutations was performed using an automated denaturing high performance liquid chromatrography (DHPLC) instrument (WAVE, Transgenomics) (see Table 1 for conditions) .
Table 1:
Primers and PCR conditions : human CNNM4
Exon Forward primer (5' -3') Reverse primer (5' -3') Annealing T
Ia CTGCTCCACCTTAAGCGACT TAGACAACCTCATCGGGTCC 6O0C + betaine
Ib TAATTACGGTGCTGCTGGTG GAACGATTTTGGAGCGGTAG 6O0C
2 + 3 CCCCATCCTGGTGACTTATG CATAGGACGAGGGCTGCAG 6O0C + betaine
4 CGGGAGTCGTCTGAGCAC CCCACTGTCCCTTGTTCCT 580C + betaine
5 GAGGTGCATGGCTTCCCT CGACACCAGAACTGAGCATG 6O0C + betaine
6 CTTCCATGGGATGAGGTGAG AAACCCGAGATGCCTTTTTC 580C
7 TGTAAGGGCTTCCAGAGACG GGGTAGCTGTGATCAGGGAC 6O0C + betaine dupC CTATACTCGCATCCCGGTGT GAACGATTTTGGAGCGGTAG 6O0C + betaine
R236Q CAACATCTCCAGCAACCTGA CTTCTCTGCTCGTTGCTCCT 6O0C + betaine
WAVE primers and conditions
Mutation Temperature %B buffer dupC 60 ° C 58% R236Q 62 . 90 C 60 . 5%B
Expression analysis . RT- PCR of mouse Cnnm4 was performed on RNA extracted from teeth of 2 -day old C57B1 / 6 mice us ing the fol low¬ ing primers : 5 ' - CTCTA GGAGG CACTC TTCTGC- 3 ' and 5 ' -ATCCT CAGCC AGCCA TGC- 3 ' . For expres s ion of Cnnml , Cnnm2 , Cnnm3 and Cnnm4 ,
primers were designed for RT-PCR as well as real-time PCR and are described in Table 2. Genomic DNA contamination was checked as described8.
Table 2:
Primers for reverse-transcription and real-time PCR of the mouse Cnnm genes
Gene Forward primer (5' -3' ) Reverse primer (5' -3' ) Annealing T
Cnnml GATCACACGACAACAGTACC TCAAGGTTCTCAGCAGCTTC 580C
Cnnm2 TCTCTGCCTTTAAGCAGACG CCATCACACCATAGTAGGAG 580C
Cnnm3 ACATCGTGGACATGCTCTAC CCTCATTGTTCACCTTCTGC 580C
Cnnm4 AGCAACCAGTTTGGCAGCTG GATCCTCGAGTCAGATGGTTTCCTCTTCGGAG 580C
Primers for reverse-transcription of mouse Cnnm4 in mandibula and teeth
Gene Forward primer (5' -3' ) Reverse primer (5' -3' ) Annealing T
Cnnm4 CTC T AGGAGGC AC TCTTCTGC ATCCTCAGCCAGCCATGC 6O0C
Immunohistochemistry . Eyes were enucleated from 2-month-old C57B1/6 mice and fixed in 4% paraf ormaldehyde-lxPBS for 2 h at 4°C. After cryoprotection by immersion in 30% sucrose-lxPBS overnight at 40C, eyes were embedded in freezing compound (30% albumin/3% gelatine in IxPBS) . For immunohistochemistry, 12-μm cryosections were collected on Superf rost®Plus glass slides
(Menzel, Braunschweig, Germany) . Sections were dried at room temperature for at least 1 h, quickly hydrated with IxPBS and blocked for 1 h in IxPBS containing 2% goat serum, 0.2 % Triton X-IOO. A rabbit polyclonal antibody raised against amino acids 21-200 of human Cyclin M4 (ACDP4) was obtained from Santa Cruz Biotechnology. The serum was diluted at 1:200 in blocking solu¬ tion and incubated overnight at 4°C. Sections were then briefly rinsed twice with blocking solution and washed once for 5 min. Secondary antibodies conjugated to Alexa Fluor 594 (Molecular Probes, Invitrogen) were diluted at 1:1000 and incubated for 1 h at room temperature in the dark. Sections were rinsed briefly twice in IxPBS, stained with DAPI to visualize nuclei, washed three times for 5 min in IxPBS, before mounting in Cityfluor
(Cityfluor Ltd, UK) .
Zebrafish and morpholino experiments. Fish maintenance and breeding was described previously9. Characterization of pip5k3 fleck corneal dystrophy-linked gene in zebrafish. Gene Expr . Patterns . 8:404-410) . Danio rerio cnnm4 sequence was obtained from NCBI. Morpholinos (MO) were designed and synthesized by GeneTools (Philomath, OR, USA) to target exon 2 - intron 2 splice site. One hundred micromolar solutions of either cnnm4 MO (ATTTT GCCAC TGTCC ACTCA CTGTA) or control-MO (ct-MO) (ATaTT cCCAC TcTCC ACTgA CTcTA) were injected into the eggs at the 1-2- cell stage. The injected amount was 6-8 nl per zygote. Standard protocols for in situ hybridization were followed and one-colour whole mount in situ hybridization was performed10''11.
Toluidine Blue-staining. Embryos were fixed in 4% PFA overnight. Standard Technovit 8100 embedding protocol was used, embryos were sectioned on microtome (5 μm thick sections) and stained with toluidine blue. For cell count, sections including the optic nerve were used as well as one before and one after. The eyes from 6 wild type, cnnm4 MO- and ct-MO-injected embryos were screened. Zebrafish do not have buccal teeth, but instead have two sets of pharyngeal teeth. Tooth initiation in zebrafish occurs around 36 to 48 hpf and the first two germs (Ii and I2) become mineralized by 3 and 5 dpf, respectively12, at a time when morpholinos reach their limit of action. Teeth were therefore not examined. In rescue experiments, the human CNNM4 full-length cDNA obtained from OpenBiosystems (Huntsville, USA, www.openbiosystems.com) was subcloned into pCDNA3.1- and transcribed from the T7 promoter. Forty pg of mRNA were injected in eggs together with the morpholino. Embryos were evaluated at 5 dpf and the number of ganglion cells was counted on toluidine blue-stained sections containing the optic nerve. The number of GCL from wt embryo was set to 1 and the counts in the morphants and rescued embryos were compared.
These studies adhered to the Association for Research in Vision and Ophthalmology (ARVO) statement for the use of animals in ophthalmology and vision research and were approved by the Veterinary service of the State of Valais (Switzerland) .
Family A, originating from Kosovo, is a two-generation family with no history of consanguinity assessed at the Jules-Gonin Eye Hospital because 2 of the 5 siblings showed poor vision (Fig. Ia) . The children were first seen in our hospital when they were 14 (11:1) and 7 years of age (11:4), respectively. Both patients complained of photophobia and showed pendular nystagmus. They were highly hypermetropic and had a low visual acuity (II:1:RE: 20/200, LE: 20/100; 11:4 BE: 20/320) . Both patients' fundi showed optic disk pallor, narrow vessels, macular atrophy with pigment mottling and peripheral deep white dot deposits mainly in the lower and nasal retina. Patient II.1 who is functionally less affected did present peripheral bone spicules (Fig. Ie) concomitant with a superior and temporal scotoma on static perimetry. Fundus autofluorescence in the same patient showed a marked decreased macular autofluorescence due to atrophy as well as severe retinal pigment epithelium changes in the inferior and nasal peripheral retina with levels of increased and decreased autofluorescence (Fig. If) . Optical coherence tomography (OCT) showed decreased foveal and retinal thickness, loss of well defined retinal layers suggesting extensive loss of retinal cells and hyperreflectivity in the choroids due to RPE and chorio- capillaris atrophy (Fig. Ig) . The OCT device that was used is not sensitive enough to evaluate any ganglion cell loss. However, if present, such a loss would be associated with reduced night vision, a sign often present in rod cone dystrophies. Fullfield photopic ERGs performed according to protocols recommended by the International Society for Clinical Electrophysiol- ogy of Vision (ISCEV) was non recordable. Under scotopic conditions, b-wave amplitudes were markedly reduced in patient II.1
and severely reduced in patient II.4. A slightly delayed culmination time of the b-wave was observed in both patients. During the 7 years follow-up of patient II.1, the remaining scotopic bwave dropped by 40% of the lower limit for the age. At the same time, both children were followed by a dentist for AI (Fig. Ih) . In both children, the decidual and permanent teeth were affected. The teeth were dysplastic, yellow/brown in color, showing no enamel layer and numerous carious lesions. In addition, patient II.4 had a mandibular cyst which contained the 2 lower incisives and 1 premolar.
Family B is a 5-generation consanguineous family originating from Lebanon (Fig. Ib) . Two sisters and 1 cousin were affected with a disease very closely resembling patients from family A. At age 2 months a bilateral nystagmus was noted by the parents. At age 2 years, their major complaints were the presence of photophobia and difficulties to see in darkness. The decidual and permanent teeth were yellow/brown showing no enamel layer with numerous carious lesions in the 2 sisters, consistent with a hypoplastic, hypomineralized AI. ERG examination of patient V.6 at 2 years according to ISCEV standards showed that the scotopic reponse was within normal while the photopic response was severely attenuated. Ophthalmological examination of both affected sisters at age 12 and 6 respectively revealed bilateral rapid clockwise nystagmus, deep amblyopia, and decreased visual acuity. Fullfield photoscopic ERG performed was non recordable. Under scotopic conditions, ERG responses showed markedly reduced b-wave amplitudes. Neurological and cognitive examination was normal for all patients in both families.
Whole-genome linkage analysis was performed using the Affymetrix 5OK Xbal array and regions of homozygosity were identified in family A. When present, these regions included adjacent non informative homozygous SNP. Eight homozygous regions larger than 3 Mb were observed (Fig. 5) . The largest one was located in the
centromeric region of chromosome 16, thus reducing the effective gene containing homozygous region by about 10 Mb to 5 Mb. The second largest region spanned the centromere of chromosome 2 leaving an effective homozygous region of about 6 Mb that overlapped the previously reported linked region for this disease6. We therefore focused our attention on the genes in this region. Several candidate genes were identified based on homology to genes previously implicated in eye diseases, but none showed sequence variants that could be responsible for the observed phe- notype. We then looked for genes coding for transcription factors and transporters expressed in eyes and teeth. Sequencing the coding regions of exon 1 of ancient conserved domain protein 4, a metal transporter (CNNM4) showed a homozygous 1-base pair duplication (c .1312dupC; +1 being the A of ATG translation start) . This duplication creates a frameshift and a new putative stop codon 9 codons downstream (p . L438Pfs9X) (Fig. Ic) . In family B, sequencing the same exon identified a homozygous C.707OA transition inducing the modification of arginine 236 into a glutamine (R236Q) (Fig. Id) . Arginine 236 is located between the first and second transmembrane domains of the protein and is totally conserved among species as far as C. elegans . It is also fully conserved in human and mouse paralogs (Fig. 6) . Both these mutations were analyzed in ethnically matched control individuals and in 1248 index patients with various forms of retinal degeneration. The C heterozygous duplication was observed in one control individual coming from the same geographical region as family A. No mutation was observed in the screened cohort of patients .
Expression of Cnnm4 was evaluated by immunohistology on postnatal day 2 (P2) and on 2-month-old (2M) C57B1/J6 mice. At 2M, strong expression was observed in the different parts of the eye (Fig. 2) . In the cornea, Cnnm4 expression is mainly observed in the epithelium surrounding the nuclei, in the keratocytes and in
the endoderm. In the retina, Cnnm4 expression was concentrated in the ganglion cell layers, the inner (IPL) and outer plexiform layers (OPL) and the inner and outer photoreceptor segments (Fig. 2) where it is mainly localized to the cytoplasm compartment, surrounding the nucleus. IPL and OPL consist mainly of connecting fibrils and dendrites from ganglion, bipolar, amacrine, Muller and horizontal cells and rod and cone photoreceptors. The nuclei of the inner and outer cell layers as well as the retinal pigment epithelium also expressed Cnnm4, but at a lower level. This expression is consistent with the observation that Cnnm4 is localized in dendrites and soma of cultured neurons13.
AI describes a group of inherited disorders primarily affecting the formation of enamel, a tissue with low protein and high mineral content. During tooth formation, ameloblasts secrete the 4 major matrix proteins and proteases: amelogenin, ameloblastin, enamelin and enamelysin. While this part of tooth development is relatively well characterized, not much is known on the maturation of enamel, during which the protein content is slowly being reduced and the mineral content is increased in order to produce enamel, the strongest tissue of the body14''15. As CNNM4 is implicated in ion transport13''16, possibly magnesium, the hypoplastic/ hypomineralised form of AI present in both families could result from aberrant mineralization of enamel. We therefore investigated the expression of Cnnm4 in teeth at postnatal day 2 (P2) mice by immunohistology . Staining was observed ubiquitously in the tooth and was strongest in the cell body of the ameloblasts (Fig. 3) . Transcription of Cnnm4 in the various parts of the eye and teeth was confirmed by RT-PCR (Fig. 7) . In addition, we evaluated by quantitative PCR the relative levels of expression between the four members of the CNNM family in brain and eye. Notably, Cnnm4 was at its highest expression levels in the ret-
ina, whereas Cnnml , -2 and -3 mRNA expression was markedly higher in brain than in retina (Fig. 7) .
CNNM4 is characterized by an "ancient conserved domain" that is evolutionarily conserved in species ranging from bacteria to mammals16, including zebrafish. We therefore evaluated the effect of a morpholino-based knockdown expression of cnnm4 in zebrafish that potentially mimicked the loss-of-function mutation observed in family A. From day post fertilization (dpf) 1 to 3, transient tachycardia was observed in most of the embryos treated with MO. This tachycardia was not observed anymore at 5 dpf. At that stage, the eyes of the morphants showed a reduction of approximately 35% of the number of ganglion cells on toluidine blue- stained sections. This reduction was rescued by about 50% with injection of human CNNM4 mRNA (Fig. 4) .
CNNM proteins are also known under the name of ACDPl to -4 and cyclin Ml to -4. CNNM4 is also sometimes referred to as FLJ42791 or KIAA1592. CNNM, as used herein, shall be construed as to comprise all these different denominations. The 775-amino acid CNNM4 protein has four transmembrane domains, a sequence motif present in cyclin box, a cNMP-binding domain (cyclic nucleotide- monophosphatebinding domain) , two cystathionine-beta-synthase (CBS) domains and a DUF21 domain16. CBS domains are small intracellular modules, usually found in two or four copies and whose function is still debated17. Proteins with CBS domains have been implicated as metabolic sensor (Cystathionine beta-synthase) , ATP binding (AMPactivated protein kinase) , nucleotide biosynthesis (inosine-5' -mono-phosphate dehydrogenase, IMPDH) and in intracellular trafficking and protein-protein interactions (CLC family)17. Interestingly, mutations in IMPDHl and in the gamma-2 regulatory subunit of AMP-activated protein kinase cause retinitis pigmentosa (RPlO)18 and familial hypertrophic cardiomyopathy with Wolff-Parkinson-White syndrome19, respectively.
Although the exact function of CNNM4 is still unknown, several members of this family have been investigated and potential consequences of malfunctions of CNNM proteins are disclosed herein for the first time. In bacteria, CorC formed by the highly conserved core protein region of all CNNM, is involved in magnesium and cobalt efflux16 while in Saccharamyces cerevisiae, Mam3p, an ortholog of CNNM4, is implicated in manganese toxicity20. CNNM4 is expressed in many tissues and recent studies on spinal cord dorsal horn neurons have shown that it is located on or close to the plasma membrane where it interacts with cytochrome oxydase 11 (COXIl) to regulate metal ion homeostasis13. Physical interaction and functional coupling between ACDP4 and the intracellular ion chaperone COXIl, an implication of the role of ACDP4 in essential metal ion transport and homeostasis. MoI. Pain 1:15) . Metal ions are indispensable to many physiological processes, in particular to the visual cycle where, among other functions, magnesium is critical for adjusting the Ca2+ sensitivity of the membrane guanylate cyclase 2d (GUCY2D) , an enzyme that produces cGMP in photoreceptor cells when stimulated by guanylyl cyclase- activating protein-1 (GCAPl) . Under physiological conditions, activation of photoreceptor GUCY2D is caused by Mg2+ / Ca2+ exchange in the EF-hands of GCAPl. Mutations in GUCY2D or GCAPl have been associated with rod-cone dystrophy6, Leber congenital amaurosis, a severe form of rod-cone dystrophy21 and cone dystrophy, respectively22. Magnesium is also essential in enamel formation. It is found at high concentrations in enamel fluid surrounding the forming enamel crystals where it can compete with Ca ions for adsorption onto these crystals23.
This study identifies mutations especially in the CNNM4 gene that result in the autosomal recessive cone-rod dystrophy with amelogenesis imperfecta (Jalili syndrome) . The nature of the mutations suggests a loss-of-function mechanism and paves the way straight-forward to a new therapeutic approach by viral-mediated
gene replacement. It also for the first time highlights a further gene involved in the maturation of amelogenin which is of importance in understanding the development of and the treatment and/or prophylaxis of caries.
This study also shows for the first time that Cnnm4 is involved in heart and retinal ganglion cells development: Experiments leading to the reduction of cnnm4 expression by the technique of morpholino injection resulted in tachycardia and the loss of retinal ganglion cells. In rescue experiments, treatment of these morphants with the injection of wild-type cnnm4 restored a normal heart frequency and a normal number of retinal ganglion cells .
Releasing molecules and -devices useful in the context of the present invention are exhaustively known in the art, especially in ophthalmology, such as e.g. Vitrasert (FDA approved; Bausch and Lomb, Inc.), Retisert (FDA approved; Bausch and Lomb, Inc.), Medidur (FDA approved; Alimeira Sciences), Encapsulated Cell Technology (ECT, Neurotech) , Posurdex (Allergan, Inc.) . A detailed discussion of the aforementioned can be found at: http : //www. ophthalmologyweb . com/Spotlight . aspx?spid=23&aid=253
Additionally, cell-penetrating peptides are described exhaustively and well known to the person of routine skill in the art, cf e.g. Bonny C, Oberson A, Negri S, Sauser C, Schorderet DF. Cell-permeable peptide inhibitors of JNK: novel blockers of beta-cell death. Diabetes, 50:77-82, 2001. A suitable peptide is e.g. marketed by Xigen S. A. (Lausanne, Switzerland) under the tradename ICPT™.
SEQ ID #1 : Human CNNM4 gene sequence (normal), Accession #
NT 026970.9 (Sequence downloaded from Ensembl, Nov 23, 2008), Chromosome: NCBI36 : 2 : 96789766 : 96841955 : 1)
SEQ ID #2: Human CNNM4 mRNA sequence (normal) , Accession # NM_020184.3; GI.94681045
SEQ ID #3: Human CNNM4 protein sequence (normal) , Accession # NP_064569
SEQ ID #4: Human CNNM4 mRNA sequence with dupC mutation
(c.l312dupC) , ORIGIN (a of ATG 99, 100, 101 = +1) , Mutated base at 1411
SEQ ID #5: Human CNNM4 protein sequence with p.L438PfsX9 mutation; Duplication induces a frameshift mutation with a new putative stop codon (see SEQ ID # 17)
SEQ ID #6: Human CNNM4 mRNA sequence with c.707G>A mutation
(p.R236Q), ORIGIN (a of ATG 99, 100, 101 = +1) , Mutated base at 805
SEQ ID #7; Human CNNM4 protein sequence with R236Q mutation, Mutation at 236
SEQ ID #8: Human CNNM4 mRNA sequence with c.971T>C (p.L324P); ORIGIN (a of ATG 99, 100, 101 = +1) , Mutated base at 1069
SEQ ID #9: Human CNNM4 protein sequence with p.L324P mutation, Mutated amino acid at 324
SEQ ID #10: Exon on SEQ ID #1
SEQ ID #11: Exon on SEQ ID #1
SEQ ID #12: Exon on SEQ ID #1
SEQ ID #13: Exon on SEQ ID #1
SEQ ID #14: Exon on SEQ ID #1
SEQ ID §15: Exon on SEQ ID #1
SEQ ID #16: Exon on SEQ ID #1
SEQ ID #17: Mutated amino acids of SEQ ID #5; followed by STOP codon
Figure 1. Pedigrees of family A (a) and B (b) . Filled symbols, affected individuals; open symbols, unaffected individuals, (c) Partial electropherograms of heterozygous (+/-) and homozygous
(-/-) patients from family A showing the C duplication (c) and family B showing the R236Q mutation (CGOCAG) in the Cnnm4 gene.
(e) Fundus photograph (patient II.1) showing optic disk pallor, narrow vessels, macular atrophy with pigment mottling and peripheral spicules. (f) . Fundus autofluorescence (patient II.1) showing marked decreased macular autofluorescence due to atrophy as well as severe retinal pigment epithelium changes in the inferior and nasal peripheral retina with levels of increased and decreased autofluorescence . (g) Optical coherence tomography
(OCT) (patient II.4) showing decreased foveal and retinal thickness, loss of well defined retinal layers suggesting extensive loss of retinal cells and hyperreflectivity in the choroids due to the RPE and choriocapillaris atrophy, (h) Photograph of mouth
(patient II.1) showing dysplastic teeth with yellow/brown discoloration characteristics of amelogenesis imperfecta. Upper incisive has been accidentally removed.
Figure 2. Cnnm4 immunostaining of cornea (a-c) and retina (d-f) of 2-month-old mouse retina. In the cornea (b) , Cnnm4 is mainly expressed in the epithelium (epi) , surrounding the nuclei, in the keratocyte present in the stroma (st) and endothelium (en) . (a) DAPI staining of the same slide, (c) negative control of immunostaining. In the retina (e) , immunostaining is mainly localized in the ganglion cell layer (arrow) , inner and outer plexi- form layers and the outer segments of the photoreceptors, (d)
DAPI staining of the same slide, (f) negative control of immu- nostaining. epi : epithelium, st: stroma, en: endothelium, arrow: ganglion cell layer, asterisk: inner cell layer, filled triangle: outer cell layer, triangle: retinal pigment epithelium.
Figure 3. Immunostaining of a lower incisive of a 2-day-old mouse. Cnnm4 is expressed in all tissues of the mandibula, including muscle and connective tissue (b) , DAPI staining of the same slide (a) , negative control of immunostaining (c) . At higher magnification (40Ox) , Cnnm4 is observed in the ameloblasts (filled triangle) and their cell body (open triangle) as well as in the odontoblasts (asterisk) (e) . (d) DAPI staining of the same slide, (f) negative control of hybridization .
Figure 4. Toluidine blue-stained sections of 5 dpf zebrafish embryos, a: wild-type, b: morphant, c: rescued embryos, d: ganglion cell number was quantified in the indicated zebrafish eye and then compared to wt set to 1 (N = 12 eyes in each category) . WT: wild-type, MO: morpholino-treated embryos, rescue: mor- pholino-treated embryos injected with CNNM4 mRNA.
Figure 5. Schematic representation of homozygous regions (black box) on human chromosomes.
Figure 6. Cross-species alignment of CNNM4 (A) and paralog comparison (B) . h: human, m: mouse. * denotes identity. TM: begin of transmembrane domain.
Figure 7. Cnnm4 mRNA expression is at its highest levels in the mouse retina. Mouse Cnnml, -2, -3 and -4 mRNA expression was assessed by RT-PCR (panel A) and quantitative PCR (panel B) in mouse brain, retina, cornea, lens and rentinal pigment epithelium with attached choroids (RPE) samples. Pooled total RNA samples of 2 mice were used for each datapoint and quantitative results was performed on three samples in duplicate +/- SEM. For RT-PCR, amplified DNA fragments were analyzed on a 2% agarose
gel and fragments of the expected size were detected, respectively 440 bp for Cnnml, 333 bp for Cnnm2, 195 bp for Cnnm3, 280 bp for Cnnm4 and 198 bp for the control gene RL8 (ribosomal protein L8), als indicated by the lkb Molecular Weight Marker (M; Roche, Basel, Switzerland) . For quantitative PCR, all CNNM mRNA expression levels were normalized to RL8 expression. Panel C; RT-PCR analysis of mouse Cnnm4 from RNA extracted from man- dibula, upper and lower incisive.
Accession codes Genbank. Human CNNM4 mRNA: NM_020184, human CNNMl: NP_065081.2, human CNNM2 : NP_951058.1, human CNNM3 : NP_060093.3, mouse Cnnm4 mRNA: NM_033570, mouse Cnnml mRNA: NM_031396.2, mouse Cnnm2 mRNA: NM_033569.3; mouse Cnnm3 mRNA: NM_053186.2; danio rerio cnnm4 mRNA: XM_682341.2; CNNMl gene: NM_020348.2; CNNM2 gene: NM_017649.3; CNNM3 gene: NM_017623.4.
References
1. Hamel, CP. (2007) . Cone rod dystrophies. Orphanet . J. Rare . Dis . 2:1.
2. Adams, N. A., Awadein, A., and Toma, H. S. (2007) . The retinal ciliopathies . Ophthalmic Genet. 28:113-125.
3. Fleming. J. C, Tartaglini, E., Steinkamp, M. P., Schorderet, D. F., Cohen, N., and Neufeld, E.J. (1999) . The gene mutated in thiamine-responsive anaemia with diabetes and deafness (TRMA) encodes a functional thiamine transporter. Nat. Genet. 22:305-308.
4. Aleman, T. S., Cideciyan, A. V., Volpe, N.J., Stevanin, G., Brice, A., and Jacobson, S. G. (2002) . Spinocerebellar ataxia type 7 (SCA7) shows a cone-rod dystrophy phenotype . Exp. Eye Res. 74:737-745.
Jalili, I. K. and Smith, N.J. (1988) . A progressive cone-rod dystrophy and amelogenesis imperfecta: a new syndrome. J. Med. Genet. 25:738-740.
Downey, L. M., Keen, T.J., Jalili, I. K., McHaIe, J., Aldred, M.J., Robertson, S. P., Mighell, A., Fayle, S., Wissinger, B., and Inglehearn, CF. (2002) . Identification of a locus on chromosome 2qll at which re-
cessive amelogenesis imperfecta and cone-rod dystrophy cosegregate. Eur. J. Hum. Genet. 20:865-869.
7. Michaelides, M., Bloch-Zupan, A., Holder, G. E., Hunt, D. M., Moore, A. T.
(2004) . An autosomal recessive cone-rod dystrophy associated with amelogenesis imperfecta. J. Med. Genet. 41: 468-473.
8. Escher, P., Lacazette, E., Courtet, M., Blindenbacher, A., Landmann, L., Bezakova, G., Lloyd, K. C, Mueller, U., and Brenner, H. R. (2005) . Synapses form in skeletal muscles lacking neuregulin receptors . Science 308:1920-1923.
9. Boisset, G., Polok, B. K., Schorderet, D. F. (2008) . Characterization of pip5k3 fleck corneal dystrophy-linked gene in zebrafish. Gene Expr .Patterns . 8:404-410.
10. Hauptmann, G. and Gerster, T. (1994), Two-color whole-mount in situ hybridization to vertebrate and Drosophila embryos. Trends Genet. 20:266.
11. Hauptmann, G. and Gerster, T. (2000) . Multicolor whole-mount in situ hybridization. Methods MoI. Biol. 237:139-148.
12. Huysseune, A., Van der Heyden, C, and Sire, J. Y. (1998) . Early development of the zebrafish (Danio rerio) pharyngeal dentition (Teleostei, Cy- prinidae) . Anat .Embryol . (Berl) 238:289-305.
13. Guo, D., Ling, J., Wang, M. H., She, J. X., Gu, J., and Wang, CY. (2005) . Physical interaction and functional coupling between ACDP4 and the intracellular ion chaperone COXIl, an implication of the role of ACDP4 in essential metal ion transport and homeostasis. MoI. Pain 2:15.
14. Crawford, P.J., Aldred, M., and Bloch-Zupan, A. (2007) . Amelogenesis imperfecta. Orphanet . J. Rare . Dis . 2:17.
15. Hu, J. C, Chun, Y. H., Al, H. T., and Simmer, J. P. (2007) . Enamel formation and amelogenesis imperfecta. Cells Tissues .Organs 286":78-85.
16. Wang, CY. , Shi, J. D., Yang, P., Kumar, P. G., Li, Q. Z., Run, Q. G., Su, Y. C, Scott, H. S., Kao, K.J., and She, J. X. (2003) . Molecular cloning and characterization of a novel gene family of four ancient conserved domain proteins (ACDP) . Gene 306: 37-44.
17. Ignoul, S. and Eggermont, J. (2005) . CBS domains: structure, function, and pathology in human proteins. Am. J. Physiol . Cell Physiol. 289:C1369- C1378.
18. Bowne, S.J., Sullivan, L. S., Blanton, S. H., Cepko, CL. , Blackshaw, S., Birch, D. G., Hughbanks-Wheaton, D., Heckenlively, J. R., and Daiger, S. P. (2002) . Mutations in the inosine monophosphate dehydrogenase 1 gene (IMPDHl) cause the RPlO form of autosomal dominant retinitis pigmentosa. Hum. MoI. Genet. 22:559-568.
19. Gollob, M. H., Seger, J.J., Gollob, T.N., Tapscott, T., Gonzales, 0., Bachinski, L., and Roberts, R. (2001) . Novel PRKAG2 mutation responsible for the genetic syndrome of ventricular preexcitation and conduction system disease with childhood onset and absence of cardiac hypertrophy. Circulation 204:3030-3033.
20. Yang, M., Jensen, L. T., Gardner, A.J., and Culotta, V. C. (2005) . Manganese toxicity and Saccharomyces cerevisiae Mam3p, a member of the ACDP (ancient conserved domain protein) family. Biochem.J. 386: 479-487.
21. Perrault, I., Rozet, J. M., Calvas, P., Gerber, S., Camuzat, A., Dollfus, H., Chatelin, S., Souied, E., Ghazi, I., Leowski, C., Bonnemaison, M., Le Paslier, D., Frezal, J., Dufier, J. L., Pittler, S., Munnich, A., and Kaplan, J. (1996) . Retinal-specific guanylate cyclase gene mutations in Leber's congenital amaurosis. Nat. Genet. 14: 461-464.
22. Payne, A.M., Downes, S. M., Bessant, D. A., Taylor, R., Holder, G. E., Warren, M.J., Bird, A. C, and Bhattacharya, S. S. (1998) . A mutation in guanylate cyclase activator IA (GUCAlA) in an autosomal dominant cone dystrophy pedigree mapping to a new locus on chromosome 6p21.1. Hum. MoI .Genet . 7:273-277.
23. Aoba, T. (1996) . Recent observations on enamel crystal formation during mammalian amelogenesis . Anat.Rec. 245:208-218.
Claims
1. A protein chosen from the group consisting of CNNMl, CNNM2, CNNM3 and CNNM4 and functional derivatives or fragments thereof for use as a medicament.
2. A protein according to claim 1 for use in the treatment and/or prophylaxis of cone-rod dystrophy and/or other ophthalmic diseases due to (a) mutation (s) in a CNNM gene, especially the CNNM4 gene, or associated to a CNNM gene, especially the CNNM4 gene.
3. A protein according to claim 1 for use in the treatment and/or prophylaxis of amelogenesis imperfecta (Jalili syndrome, MIM # 217080) and/or caries and/or other dental diseases due to (a) mutation (s) in a CNNM gene, especially the CNNM4 gene, or associated to a CNNM gene, especially the CNNM4 gene.
4. A protein according to claim 1 for use in the treatment and/or prophylaxis of cardiac arrhythmia and/or other cardiac diseases due to (a) mutation (s) in a CNNM gene, especially the CNNM4 gene, or associated to a CNNM gene, especially the CNNM4 gene.
5. A protein according to one of claims 1 to 4, chosen from the group consisting of SEQ ID #3, Genbank Accession Code NP_065081.2, Genbank Accession Code NP_951058.1, Genbank Accession Code NP_060093.3, and functional derivatives or fragments thereof.
6. A protein according to one of claims 1 to 5, coupled to a cell-penetrating peptide or other releasing molecules or devices .
7. The human genomic DNA, cDNA or mRNA sequence encoding for a functional protein chosen from the group consisting of CNNMl, CNNM2, CNNM3, CNNM4 and functional derivatives or fragments thereof for use as a medicament.
8. The human genomic DNA, cDNA or mRNA sequence encoding for a functional protein chosen from the group consisting of CNNMl, CNNM2, CNNM3, CNNM4 and functional derivatives or fragments thereof for use in the treatment and/or prophylaxis of cone-rod dystrophy and/or other ophthalmic diseases due to (a) mutation (s) in a CNNM gene, especially the CNNM4 gene, or associated to a CNNM gene, especially the CNNM4 gene.
9. The human genomic DNA, cDNA or mRNA sequence encoding for a functional protein chosen from the group consisting of CNNMl, CNNM2, CNNM3, CNNM4 and functional derivatives or fragments thereof for use in the treatment and/or prophylaxis of amelogenesis imperfecta (Jalili syndrome, MIM # 217080) and/or caries and/or other dental diseases due to (a) mutation (s) in a CNNM gene, especially the CNNM4 gene, or associated to a CNNM gene, especially the CNNM4 gene.
10. The human genomic DNA, cDNA or mRNA sequence encoding for a functional protein chosen from the group consisting of CNNMl, CNNM2, CNNM3, CNNM4 and functional derivatives or fragments thereof for use in the treatment and/or prophylaxis of cardiac arrhythmia and/or other cardiac diseases due to (a) mutation (s) in a CNNM gene, especially the CNNM4 gene, or associated to a CNNM gene, especially the CNNM4 gene .
11. A DNA sequence in particular according to one of claims 7 to 10, chosen from the group consisting of a. SEQ ID #1, SEQ ID #2, Genbank Accession Code NM_020348.2, Genbank Accession Code NM_017649.3, Genbank Accession Code NM_017623.4 and sequences encoding for functional derivatives or fragments of CNNMl, CNNM2, CNNM3 and CNNM4 ; b. sequences which hybridize to a sequence under lit. a. under stringent conditions and which encode for a protein chosen from the group consisting of CNNMl, CNNM2, CNNM3 and CNNM4 or a functional derivative or fragment thereof; c. sequences which are degenerate as a result of the genetic code to the sequences defined in lit. a. and b. and which encode for a protein chosen from the group consisting of CNNMl, CNNM2, CNNM3 and CNNM4 or a functional derivative or fragment thereof.
12. A recombinant plasmid exhibiting the following features: a. suitable for transformation to a host chosen from the group of bacterial hosts, eukaryotic hosts and mammals; b. comprising a homologous regulon; c. comprising one or more termination codons; d. comprising heterologous DNA da. encoding for a functional heterologous polypeptide or protein or intermediate thereof which is not degraded by endogenous proteolytic enzymes; db . Being positioned in a proper reading frame with said homologous regulon between said regulon and the termination codon(s); dc . whereby on translation of the transcription product of the heterologous DNA in the respective host, the resulting expression product is a protein of one of claims 1-6.
13. A gene transfer vector for treatment of a mammal, comprising a sequence according to one of claims 7 to 11 in a functional manner as to allow for gene transfer to and expression of the said sequence in the nucleus of a mammalian cell.
14. A gene transfer vector according to claim 13, wherein the vector is of viral origin.
15. A method for diagnosis of a. cone-rod dystrophy and/or amelogenesis imperfecta (Jalili syndrome, MIM # 217080) and/or other ophthalmic diseases due to (a) mutation (s) in a CNNM gene, especially the CNNM4 gene, or associated to a CNNM gene, especially the CNNM4 gene; and/or b. amelogenesis imperfecta and/or other dental diseases due to (a) mutation (s) in a CNNM gene, especially the CNNM4 gene, or associated to a CNNM gene, especially the CNNM4 gene; and/or c. cardiac arrhythmia and/or other cardiac diseases due to (a) mutation (s) in a CNNM gene, especially the
CNNM4 gene, or associated to a CNNM gene, especially the CNNM4 gene, comprising the step of identifying (a) mutation (s) in genomic DNA, cDNA or mRNA sequence encoding for a protein chosen from the group consisting of CNNMl, CNNM2, CNNM3 and CNNM4 of a patient.
16. A method for treatment and/or prophylaxis of a. cone-rod dystrophy and/or amelogenesis imperfecta (Jalili syndrome, MIM # 217080) and/or other ophthalmic diseases due to (a) mutation (s) in a CNNM gene, especially the CNNM4 gene, or associated to a CNNM gene, especially the CNNM4 gene; and/or b. cellular loss due to an ophthalmic disease, in particular loss of ganglion cells, photoreceptors and cells of the retinal pigment epithelium; and/or c. amelogenesis imperfecta, loss of enamel in teeth and/or other dental diseases due to (a) mutation (s) in a CNNM gene, especially the CNNM4 gene, or associated to a CNNM gene, especially the CNNM4 gene; and/or d. cardiac arrhythmia and/or other cardiac diseases due to (a) mutation (s) in a CNNM gene, especially the CNNM4 gene, or associated to a CNNM gene, especially the CNNM4 gene, comprising the step(s) of i. administering or applying an effective amount of a protein according to any one of claims 1-6 to a patient; and/or ii. administering or applying a sequence according to any one of claims 7 to 14, in particular a gene transfer vector according to one of claims 13 or 14.
17. Cosmetic or therapeutic dental care composition, comprising a protein according to one of claims 1-6 and/or a sequence according to one of claims 7-14.
Use of a protein according to one of claims 1-6 and/or a sequence according to one of claims 7-14 for strengthening tooth enamel.
19. A cosmetic or therapeutic method of strengthening the enamel, comprising a step of administering or applying a protein according to one of claims 1-6 and/or a sequence according to one of claims 7-14 to teeth.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US11775008P | 2008-11-25 | 2008-11-25 | |
| US61/117,750 | 2008-11-25 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2010060934A2 true WO2010060934A2 (en) | 2010-06-03 |
| WO2010060934A3 WO2010060934A3 (en) | 2010-07-29 |
Family
ID=42123173
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2009/065848 Ceased WO2010060934A2 (en) | 2008-11-25 | 2009-11-25 | Cnnm proteins and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2010060934A2 (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003008557A2 (en) * | 2001-07-19 | 2003-01-30 | University Of Florida | Activators of cyclin-dependent kinases |
| WO2007130423A2 (en) * | 2006-05-01 | 2007-11-15 | New York Society For The Ruptured And Crippled Maintaining The Hospital For Special Surgery | Biological markers of chronic wound tissue and methods of using for criteria in surgical debridement |
-
2009
- 2009-11-25 WO PCT/EP2009/065848 patent/WO2010060934A2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| WO2010060934A3 (en) | 2010-07-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Polok et al. | Mutations in CNNM4 cause recessive cone-rod dystrophy with amelogenesis imperfecta | |
| Roosing et al. | Mutations in MFSD8, encoding a lysosomal membrane protein, are associated with nonsyndromic autosomal recessive macular dystrophy | |
| Martínez-Gimeno et al. | Mutations in the pre-mRNA splicing-factor genes PRPF3, PRPF8, and PRPF31 in Spanish families with autosomal dominant retinitis pigmentosa | |
| Liu et al. | Identification of a CRYAB mutation associated with autosomal dominant posterior polar cataract in a Chinese family | |
| Santhiya et al. | Identification of a novel, putative cataract-causing allele in CRYAA (G98R) in an Indian family | |
| Littink et al. | Mutations in the EYS gene account for approximately 5% of autosomal recessive retinitis pigmentosa and cause a fairly homogeneous phenotype | |
| Collin et al. | High-resolution homozygosity mapping is a powerful tool to detect novel mutations causative of autosomal recessive RP in the Dutch population | |
| Jalkanen et al. | A novel CACNA1F gene mutation causes Aland Island eye disease | |
| Pierrache et al. | Whole-exome sequencing identifies biallelic IDH3A variants as a cause of retinitis pigmentosa accompanied by pseudocoloboma | |
| Gu et al. | A novel mutation in AlphaA‐crystallin (CRYAA) caused autosomal dominant congenital cataract in a large Chinese family | |
| Shan et al. | Novel mutations in the CYP4V2 gene associated with Bietti crystalline corneoretinal dystrophy | |
| Biousse et al. | Neuro-ophthalmology of mitochondrial diseases | |
| Friedman et al. | Protein localization in the human eye and genetic screen of opticin | |
| Zhang et al. | Clinical description and genome wide linkage study of Y-sutural cataract and myopia in a Chinese family | |
| Reddy et al. | A clinical and molecular genetic study of a rare dominantly inherited syndrome (MRCS) comprising of microcornea, rod-cone dystrophy, cataract, and posterior staphyloma | |
| Christensen et al. | Brittle cornea syndrome associated with a missense mutation in the zinc-finger 469 gene | |
| Milam et al. | Clinicopathologic effects of mutant GUCY2D in Leber congenital amaurosis | |
| Towns et al. | Prognosis for splicing factor PRPF8 retinitis pigmentosa, novel mutations and correlation between human and yeast phenotypes | |
| Su et al. | A novel mutation in CRYAA is associated with autosomal dominant suture cataracts in a Chinese family | |
| Mukhopadhyay et al. | A detailed phenotypic assessment of individuals affected by MFRP-related oculopathy | |
| Tian et al. | Novel mutation (V505D) of the TGFBI gene found in a Chinese family with lattice corneal dystrophy, type I | |
| Mizrahi-Meissonnier et al. | Variable retinal phenotypes caused by mutations in the X-linked photopigment gene array | |
| Zhang et al. | A novel deletion variant of gammaD-crystallin responsible for congenital nuclear cataract | |
| Valleix et al. | H244R VSX1 is associated with selective cone ON bipolar cell dysfunction and macular degeneration in a PPCD family | |
| Votruba et al. | A review of primary hereditary optic neuropathies |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09756752 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 09756752 Country of ref document: EP Kind code of ref document: A2 |