WO2010059541A1 - Platelet-derived pf4 as efficacy marker for anti-angiogenic therapies - Google Patents
Platelet-derived pf4 as efficacy marker for anti-angiogenic therapies Download PDFInfo
- Publication number
- WO2010059541A1 WO2010059541A1 PCT/US2009/064517 US2009064517W WO2010059541A1 WO 2010059541 A1 WO2010059541 A1 WO 2010059541A1 US 2009064517 W US2009064517 W US 2009064517W WO 2010059541 A1 WO2010059541 A1 WO 2010059541A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- level
- tumor
- therapy
- angiogenic
- subject
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5758—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/52—Assays involving cytokines
- G01N2333/521—Chemokines
- G01N2333/522—Alpha-chemokines, e.g. NAP-2, ENA-78, GRO-alpha/MGSA/NAP-3, GRO-beta/MIP-2alpha, GRO-gamma/MIP-2beta, IP-10, GCP-2, MIG, PBSF, PF-4 or KC
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- PLATELET-DERIVED PF4 AS EFFICACY MARKER FOR ANTI- ANGIOGENIC
- Angiogenesis is an important process for forming new blood vessels. It is fundamental in many biological processes including development, reproduction and wound repair. Under these conditions, angiogenesis is a highly regulated process. Angiogenesis is regulated by the balance of inducers and inhibitors of endothelial cell proliferation.
- Pathological angiogenesis is now recognized as an essential feature of conditions such as rheumatoid arthritis, diabetic retinopathy and malignant neoplasia.
- Pathological angiogenesis has an important role in tumor development, tumor progression and the formation of metastases. Cancerous tumors require a constant supply of nutrients to sustain continual growth. A tumor achieves this by secreting its own factors and by recruiting host factors that promote angiogenesis.
- the new network of blood vessels provides the necessary nutrients for sustain tumor growth, the efficient removal of waste products from the tumor and also provides a conduit for the tumor to metastasize to other parts of the body. In the absence of an adequate vasculature, tumor cells become necrotic and/or apoptotic.
- bFGF basic fibroblast growth factor
- VEGF vascular endothelial growth factor
- the anti-angiogenic therapies have been successful in a great number of individuals, there are reports of failure of the therapy in others over time. For these individuals, the anti-angiogenic therapy appeared to be effective in the beginning, evidenced by a halt in tumor growth and/or shrinkage of the tumor. Sometimes, the entire tumor disappears completely and is not detectable by the most sensitive imaging technique. In some instances, however, after a period of effective anti-angiogenic therapy, there is observed acquired resistance to anti- angiogenic drugs, especially when used as monotherapies. In such instances, after a median of 6 to 12 months of receiving therapy, in the case of renal cell carcinoma using anti-VEGF therapy, the existing tumor can begin to start growing again and/or a new tumor may emerge where the former tumor has disappeared.
- Possible mechanisms for such acquired or induced resistance include: (i) bypassing the VEGF pathway through expression of additional angiogenic factors; (ii) redundancy of pro-angiogenic growth factors when the drug used targets a single such growth factor or its cognate endothelial cell-associated receptor tyrosine kinase; (iii) the anti- apoptotic/pro- survival function of growth factors such as VEGF, which, in high local concentrations, can antagonize the pro-apoptotic effects of various angiogenesis inhibitors; (iv) epigenetic, transient upregulation, or induction, of various anti-apoptotic effecter molecules in host-endothelial cells; and (v) heterogeneous vascular dependence of tumor cell populations. Multiple circulating pro-angiogenic factors are induced by sunitinib malate (SUTENT ® ) and the induction is tumor-independent and correlates with anti-tumor treatment efficacy.
- SUTENT ® sunitinib
- Anti-angiogenic cancer therapy targets the formation of new blood vessels used to support tumor growth.
- Current methods of determining the efficacy of the anti-angiogenic therapy involve monitoring the tumor size by imaging (MRI, CT, PET, MRA, 3T-MRI, and 3T- MRA), by monitoring the levels of biomarker(s) for the specific tumor type, and by monitoring the levels of circulating cytokines, and/or circulating endothelial cells (CEC) in the peripheral blood of patients.
- These methods can be expensive, time consuming (culturing of CECs and in vitro functional assays for cytokines), or only applicable to select tumors with known biomarkers.
- Embodiments of the present invention are based on the discovery that pro- angiogenic factors (e.g. VEGF) increase platelet-associated factor 4 (also known as platelet factor 4 or PF4) in platelets and megakaryocytes. Accordingly, an anti-angiogenic factor can inhibit this increase in platelet-derived PF4 in platelets that is induced by pro-angiogenic factors.
- PF4 can function as a biomarker for the level/ presence of pro-angiogenic factors in the body.
- relative changes of the platelet-derived PF4 in platelets can be indicators of changes in the presence or activity of pro-angiogenic factors, indicator of the efficacy of anti-tumor therapy or the effectiveness of an anti-angiogenic factor or therapy.
- the present invention provides a method of monitoring the efficacy of an anti-tumor therapy in a subject comprising: (a) determining a level of PF4 in a first sample taken from a subject prior to treatment with an anti-tumor therapy; (b) determining a level of PF4 in a second sample taken from the subject after commencing treatment with the anti-tumor therapy; and (c) comparing the levels of PF4 determined in the first and second samples, wherein an increase in PF4 level in the second sample over that in the first sample indicates that the anti-tumor therapy is ineffective.
- the levels of PF4 at both time points are determined by the same method.
- the present invention provides a method of monitoring the efficacy of an anti- tumor therapy in a subject comprising: (a) determining at a first time point a level of PF4 in a sample taken from a subject undergoing treatment with an anti- tumor therapy; (b) determining at a second time point, after the first time point, a level of PF4 in a sample taken from the subject undergoing the anti- tumor therapy; and (c) comparing the levels of PF4 determined at the first and second time points, wherein an increase in the PF4 level at the second time point over that at the first time point indicates that the anti- tumor therapy is losing efficacy.
- the levels of PF4 at both time points are determined by the same method.
- the anti- tumor therapy is an anti-angiogenic therapy.
- the anti-angiogenic therapy can be an agent that antagonizes VEGF or bFGF signaling.
- the agent is an antibody against VEGF.
- the present invention provides a method of monitoring the efficacy of an anti- angiogenic therapy in a subject comprising: (a) determining a level of PF4 in a first sample taken from a subject prior to treatment with an anti- angiogenic therapy; (b) determining a level of PF4 in a second sample taken from the subject after commencing treatment with the anti-angiogenic therapy; and (c) comparing the levels of PF4 determined in the first and second samples, wherein an increase in PF4 level in the second sample over that in the first sample indicates that the anti-angiogenic therapy is ineffective.
- the levels of PF4 at both time points are determined by the same method.
- the anti-angiogenic therapy is an agent that antagonizes VEGF or bFGF signaling, and the agent is an antibody against VEGF.
- the present invention provides a method of monitoring the efficacy of an anti-angiogenic therapy in a subject comprising: (a) determining at a first time point a level of PF4 in a sample taken from a subject undergoing treatment with an anti- angiogenic therapy; (b) determining at a second time point, after the first time point, a level of PF4 in a sample taken from the subject undergoing said anti-angiogenic therapy; and (c) comparing the levels of PF4 determined at the first and second time points, wherein an increase in the PF4 level at the second time point over that at the first time point indicates that the anti- angiogenic therapy is losing efficacy.
- the levels of PF4 at both time points are determined by the same method.
- the anti-angiogenic therapy is an agent that antagonizes VEGF or bFGF signaling, and the agent is an antibody against VEGF.
- the anti-angiogenic therapy is administered to treat a tumor.
- the anti-angiogenic therapy is administered to treat an angiogenic disease or disorder selected from the group consisting of: age-related macular degeneration; diabetic retinopathy; rheumatoid arthritis; Alzheimer's disease; obesity and endometriosis.
- the anti-angiogenic therapy can comprise an agent that antagonizes VEGF or bFGF signaling.
- the agent is an antibody against VEGF.
- the present invention provides a method of monitoring tumor status in a subject comprising: (a) determining at a first time point a level of PF4 in a sample taken from a subject who is in cancer remission; (b) determining at a second time point, after the first time point, a level of PF4 in a sample taken from the subject; and (c) comparing the levels of PF4 determined at the first and second time points, wherein an increase in the PF4 level at the
- the anti-angiogenic therapy is an agent that antagonizes VEGF or bFGF signaling, and the agent is an antibody against VEGF.
- the sample from which PF4 is determined is selected from the group consisting of whole blood, serum, plasma, platelets and megakaryocytes.
- the first and second samples used for PF4 determination and comparison are of the same type, for example, both samples are whole blood or both samples are isolated platelets.
- PF4 determination are 1, 2 or 3 months apart.
- the time spans between the first and second time points of PF4 determination can be 6 months, 1 year or 2 years apart.
- the anti-angiogenic therapy is an agent that antagonizes
- VEGF vascular endothelial growth factor
- bFGF vascular endothelial growth factor
- the agent is an antibody directed against VEGF.
- the level of PF4 is determined by an antibody-based moiety method, by quantitative RT-PCR or by mass spectrometry.
- Figure 1 is a block diagram showing an exemplary system for the monitoring efficacy of anti-tumor/anti-angiogenic therapy and/or monitoring tumor recurrence.
- Figure 2 is an exemplary set of instructions on a computer readable storage medium for use with the systems described herein.
- Figure 3 shows the platelet pro-angiogenic and anti-angiogenic factors profiles of human subject 1 and human subject 5 over time after surgery and during treatment.
- Figure 4 shows the platelet pro-angiogenic and anti-angiogenic factors profiles of human subject 10 and human subject 12 over time after surgery and during treatment.
- Figure 5 shows the platelet pro-angiogenic and anti-angiogenic factors profiles of human subject 15 and human subject 23 over time after surgery and during treatment.
- Figure 6 shows the platelet pro-angiogenic and anti-angiogenic factors profiles of human subject 26 and human subject 35 over time after surgery and during treatment.
- tumor means a mass of transformed cells that are characterized, at least in part, by containing angiogenic vasculature.
- the transformed cells are characterized by neoplastic uncontrolled cell multiplication which is rapid and continues even after the stimuli that initiated the new growth have ceased.
- the term “tumor” is used broadly to include the tumor parenchymal cells as well as the supporting stroma, and it includes the angiogenic blood vessels that infiltrate the tumor parenchymal cell mass.
- a tumor generally is a malignant tumor, i.e., a cancer having the ability to metastasize (i.e. a metastatic tumor)
- a tumor also can be nonmalignant (i.e. non-metastatic tumor).
- Tumors are hallmarks of cancer, a neoplastic disease the natural course of which is fatal. Cancer cells exhibit the properties of invasion and metastasis and are highly anaplastic.
- the term "metastases” or “metastatic tumor” refers to a secondary tumor that grows separately elsewhere in the body from the primary tumor and has arisen from detached, transported cells, wherein the primary tumor is a solid tumor.
- the primary tumor refers to a tumor that originated in the location or organ in which it is present and did not metastasize to that location from another location.
- a "malignant tumor” is one having the properties of invasion and metastasis and showing a high degree of anaplasia. Anaplasia is the reversion of cells to an immature or a less differentiated form, and it occurs in most malignant tumors.
- the term "recurrence" of a tumor refers to the enlargement of an existing tumor whose growth had stopped or reduced during an anti- angiogenic therapy, or the emergence of a tumor at the original (primary) site of tumor discovery after the original tumor had been excised.
- the recurrence of a tumor can also mean new tumor growth(s) of the same tumor type as the original tumor at a site different from the original site of tumor discovery.
- 12751790 2 can be an indication that the original primary tumor has spread to other locations, or the primary tumor has emerged as an anti-angiogenic resistant form.
- the term "resistance" of tumor to an anti-angiogenic therapy refers to tumor and cancer cells' ability to escape the killing effects of the therapy, thereby survive against the anti-angiogenic therapy and eventually continue to grow. When tumor growth is resumed, recurrence of a tumor or cancer can happen.
- antibody-based binding moiety or “antibody” includes immunoglobulin molecules and immunologically active determinants of immunoglobulin molecules, e.g., molecules that contain an antigen binding site which specifically binds (immunoreacts with) to PF4.
- antibody-based binding moiety is intended to include whole antibodies, e.g., of any isotype (IgG, IgA, IgM, IgE, etc), and includes fragments thereof which are also specifically reactive with PF4. Antibodies can be fragmented using conventional techniques.
- the term includes segments of proteolytically-cleaved or recombinantly- prepared portions of an antibody molecule that are capable of selectively reacting with PF4.
- proteolytic and/or recombinant fragments include Fab, F(ab')2, Fab' , Fv, dAbs and single chain antibodies (scFv) containing a VL and VH domain joined by a peptide linker.
- ScFv' s can be covalently or non-covalently linked to form antibodies having two or more binding sites.
- antibody-based binding moiety includes polyclonal, monoclonal, or other purified preparations of antibodies and recombinant antibodies.
- antibody-based binding moiety is further intended to include humanized antibodies, bispecific antibodies, and chimeric molecules having at least one antigen binding determinant derived from an antibody molecule.
- the antibody-based binding moiety is detectably labeled.
- Labeled antibody includes antibodies that are labeled by a detectable means and include, but are not limited to, antibodies that are enzymatically, radioactively, fluorescently, or chemiluminescently labeled. Antibodies can also be labeled with a detectable tag, such as c-Myc, HA, VSV-G, HSV, FLAG, V5, or HIS. The detection and quantification of PF4 present in the samples correlate with the intensity of the signal emitted from the detectably labeled antibody.
- a detectable tag such as c-Myc, HA, VSV-G, HSV, FLAG, V5, or HIS.
- anti-angiogenic refers to reducing the growth of new blood vessels or angio genesis.
- anti-angiogenesis refers to the prevention or inhibition of the growth of new blood vessels.
- the terms “treat” and “treatment” refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow the development or spread of cancer.
- Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
- Treatment can also mean prolonging survival as compared to expected survival if not receiving treatment.
- Those in need of treatment include those already diagnosed with cancer as well as those likely to develop secondary tumors due to metastasis.
- anti-angiogenic therapy or "anti- angiogenic treatment” refers to the use of drugs or other substances to stop cancerous tumors from developing new blood vessels, to thereby prevent continued growth of the tumor.
- Anti-angiogenic therapy also refers to the use of drugs or other substances to stop the development of aberrant new blood vessels in conditions such as rheumatoid arthritis and diabetic retinopathy.
- angiogenesis refers to the sprouting of new blood vessels from pre-existing blood vessels, characterized by endothelial cell proliferation and migration triggered by pro-angiogenic factors.
- Angiogenesis can be a good and necessary process, for example, in wound healing, or it can be an aberrant and undesired process with detrimental consequences, such as the growth of solid tumors and metastasis, and hemangiomas.
- Aberrant angiogenesis can lead to certain pathological conditions such as death, blindness, and disfigurement.
- pro-angiogenic factors refers to factors that directly or indirectly promote new blood vessels formation. These factors can be expressed and secreted by normal and tumor cells.
- the pro-angiogenic factors include, but are not limited to EGF, E-cadherin, VEGF, angiogenin, angiopoietin-1, fibroblast growth factors: acidic (aFGF) and basic (bFGF), fibrinogen, fibronectin, heparanase, hepatocyte growth factor (HGF), insulin-like growth factor- 1 (IGF-I), IGF, BP-3, PDGF, VEGF-A VEGF-C, pigment epithelium-derived factor (PEDF), vitronection, leptin, trefoil peptides (TFFs), CYR61 (CCNl) and NOV (CCN3), leptin, midkine, placental growth factor platelet-derived endothelial cell growth factor
- TGF-alpha transforming growth factor-alpha
- TGF-beta tumor necrosis factor-alpha
- TNF-alpha tumor necrosis factor-alpha
- c-Myc granulocyte colony- stimulating factor
- G-CSF granulocyte colony- stimulating factor
- SDF-I stromal derived factor 1
- SCF stem cell factor
- MMPs matrix metalloproteinases
- TSP-I thrombospondin-1
- inflammatory cytokines and chemokines that are inducers of angiogenesis and increased vascularity, eg. CCL2 (MCP-I), interleukin-8 (IL-8) and CCL5 (RANTES).
- angiogenesis-dependent disease or disorder refers to diseases or disorders that are dependent on a rich blood supply and blood vessel proliferation for the diseases' pathological progression (e.g. metastatic tumors) or diseases or disorders that are the direct result of aberrant blood vessel proliferation (e.g. diabetic retinopathy and hemangiomas).
- Examples include abnormal vascular proliferation, ascites formation, psoriasis, age-related macular degeneration, thyroid hyperplasia, preeclampsia, rheumatoid arthritis and osteoarthritis, Alzheimer's disease, obesity, pleural effusion, atherosclerosis, endometriosis, diabetic/other retinopathies, ocular neovascularizations such as neovascular glaucoma and corneal neovascularization.
- VEGF inhibitors refers to any compound or agent that produces a direct or indirect effect on the VEGF signaling pathways that promote growth, proliferation and survival of a cell by inhibiting the function of the VEGF protein, including inhibiting the function of VEGF receptor proteins.
- agent or “compound” as used herein means any organic or inorganic molecule, including but not limited to modified and unmodified nucleic acids such as antisense nucleic acids, RNAi agents such as siRNA or shRNA, peptides, peptidomimetics, receptors, ligands, and antibodies.
- the siRNAs are targeted at components of the VEGF pathways and can inhibit the VEGF pathway.
- VEGF inhibitors include for example, AVASTIN ® (bevacizumab), an anti-VEGF monoclonal antibody of Genentech, Inc. of South San Francisco, CA, VEGF Trap (Regeneron / Aventis).
- Additional VEGF inhibitors include CP-547,632 (3-(4-Bromo-2,6-difluoro- benzyloxy)-5-[3-(4-pyrrolidin 1-yl- butyl)-ureido]-isothiazole-4- carboxylic acid amide hydrochloride; Pfizer Inc.
- IM862 glufanide disodium, Cytran Inc. of Kirkland, Washington, USA
- VEGFR2- selective monoclonal antibody DClOl ImClone Systems, Inc.
- angiozyme a synthetic ribozyme from Ribozyme (Boulder, Colorado) and Chiron (Emeryville, California)
- Sirna-027 an siRNA-based VEGFRl inhibitor, Sirna Therapeutics, San Francisco, CA
- soluble ectodomains of the VEGF receptors Neovastat (Sterna Zentaris Inc; Quebec City, CA), ZM323881 (CalBiochem. CA, USA), pegaptanib (MACUGEN ® ) (Eyetech Pharmaceuticals), an anti-VEGF aptamer and combinations thereof.
- an increase in platelet-derived PF4 refers to an increase of at least two fold and preferably an increase of at least two to ten fold or more of platelet- derived PF4 in a second sample compared to the platelet-derived PF4 level obtained in a first sample.
- the first sample is taken preceding the second sample, and the times at which the first and second samples are taken are separated by a span of time.
- the span of time can be 1 month, 2 months, 3 months, 6 months or 1 year or more.
- a decrease in platelet-derived PF4 refers to a decrease of at least 25% and preferably a decrease of at least 35%, 45%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or even 100% (no PF4 present) of platelet-derived PF4 in a second sample compared to the platelet-derived PF4 level obtained in a first sample.
- the first sample is taken preceding the second sample, and time at which the first and second samples were taken is separated by a span of time.
- the span of time can be 1 month, 2 months, 3 months, 6 months or 1 year or more.
- a change in platelet-derived PF4 refers to an increase of at least two-fold or a decrease of at least 25% and preferably an increase of at least two to ten fold or more, or a decrease of at least 35%, 45%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or even 100% of platelet-derived PF4 in a second sample compared to the platelet-derived PF4 level obtained in a first sample.
- the first sample is taken preceding the second sample, and time at which the first and second samples were taken is separated by a span of time.
- the span of time can be 1 month, 2 months, 3 months, 6 months or 1 year or more.
- Embodiments of the present invention are based on the discovery that pro- angiogenic factors (e.g. VEGF) increase platelet-associated factor 4 (also known as platelet factor 4 or PF4) in platelets. Accordingly, an anti-angiogenic factor can inhibit this increase in platelet-derived PF4 in platelets that is a result of pro-angiogenic factors. Accordingly, relative changes of the platelet-derived PF4 in platelets can be indicators of changes in the presence or activity of pro-angiogenic factors. In other words, PF4 can function as a biomarker for the level/ presence of pro-angiogenic factors in the body.
- pro- angiogenic factors e.g. VEGF
- platelet-associated factor 4 also known as platelet factor 4 or PF4
- an increase in platelet-derived PF4 can indicate an increased amount of angiogenic factor(s).
- a drop in platelet-derived PF4 can indicate a drop in the amount of angiogenic factor(s) and /or a drop in the signaling derived from the pro-angiogenic pathway(s) as inhibited by anti-angiogenic factor(s).
- platelet-derived PF4 up-regulation correlates with the presence of microscopic tumors in vivo. For example, after xerografts of human liposarcoma, mammary adenocarcinoma, and oestosarcoma were implanted in mice, there was a time-dependent increase in the amount of platelet-derived PF4 due to the induction of angiogenic factors by and from these tumors.
- the platelet-derived PF4 when a tumor gradually develops resistance to the anti-angiogenic therapy, for example, via bypassing the VEGF pathway through the expression of additional angiogenic factors, the platelet-derived PF4 will increase.
- anti-angiogenic therapy such as anti-VEGF, bevacizumab (AVASTIN ® ) anti-angiogenic therapy develops, the platelet-derived PF4 will increase.
- platelet-derived PF4 increase is dependent on the presence of angiogenic factors and not on any specific type of tumor
- monitoring platelet-derived PF4 fluxes in platelets and megakaryocytes can be used globally for determining the efficacy of the anti-angiogenic therapy in all cancer and tumor types.
- platelet-derived PF4 fluxes in platelets and megakaryocytes over time can be used as an indicator, for monitoring the efficacy of an anti-angiogenic therapy in cancer treatment.
- Measurement of platelet-derived PF4 fluxes can also be used for surveillance of the development of resistance to anti-angiogenic therapy.
- Platelets are cellular fragments that have budded off from the much larger megakaryocytes and comprise many cellular components except a nucleus. Platelets are characterized by alpha granules containing growth factors which are released when the platelets are activated.
- Platelet-derived PF4 is a 70-amino acid protein that is released from the alpha- granules of activated platelets and binds with high affinity to heparin.
- Platelet factor-4 is also known by the terms platelet factor-4, CXCL4, PF-4, PF4, Iroplact, Onco statin- A, SCYB4, and MGC138298. Its major physiologic role appears to be neutralization of heparin-like molecules on the endothelial surface of blood vessels, thereby inhibiting local antithrombin III activity and promoting coagulation. As a strong chemoattractant for neutrophils and fibroblasts, PF4 probably has a role in inflammation and wound repair.
- Oncostatin-A is a member of the CXC chemokine family.
- Human PF4 is used to differentiate heparin-induced thrombocytopenia.
- the Entrez Gene symbol is PF4, the Entrez Gene official full name is "platelet factor 4 (chemokine (C-X-C motif) ligand 4)"; the Genbank Accession number for the human platelet factor-4 is NM_002619 and the protein ID is NP_002610.
- the determination of the efficacy of an anti-angiogenic therapy in the treatment of a pathological angiogenic disease or disorder can be achieved by monitoring the platelet-derived PF4 in platelets before and after initiation of the therapy as well as throughout the time course of the therapy. Comparison of platelet-derived PF4 in platelets obtained at different time periods with platelet-derived PF4 in platelets from one or more earlier time periods can be made. In the course of an effective anti-angiogenic therapy, the platelet- derived PF4 level should continue to decrease over time as the therapy progresses. This platelet- derived PF4 decrease is taken as an indication that the anti-angiogenic therapy is effective in inhibiting angiogenesis, e.g.
- pro-angiogenic factors can include an increase in the expression of the pro-angiogenic factors other than the target of the prescribed anti-angiogenic therapy.
- the prescribed angiogenic therapy comprises the anti-VEGF, bevacizumab (AVASTIN ® ) which targets the ligand VEGF.
- a resurgence of pro-angiogenic factors can include the increase in expression of bFGF and PDGF
- a method of monitoring the efficacy of an anti- angiogenic therapy in a subject comprising: (a) determining a level of platelet-derived PF4 in a first sample taken from a subject prior to treatment with an anti- angiogenic therapy; (b) determining a level of platelet-derived PF4 in a second sample taken from the subject after commencing treatment with the anti-angiogenic therapy; and (c) comparing the levels of platelet-derived PF4 determined in the first and second samples, wherein an increase in platelet- derived PF4 level in the second sample over that in the first sample indicates that the anti- angiogenic therapy is ineffective.
- the subject has been diagnosed to have at least a tumor in the body but has not received any anti-angiogenic therapy.
- the methods of confirming presence of a tumor include but are not limited to imaging, tissue biopsy, histology, measurements of tumor-related biomarkers and combinations thereof.
- the first sample becomes a reference sample to which all subsequent samples' platelet-derived PF4 level from the same subject can be compared.
- the increase in platelet-derived PF4 level in the second sample taken from a subject after commencing treatment with the anti-angiogenic therapy is at least two or more fold over the platelet-derived PF4 level in the first sample taken from a subject prior to treatment with an anti-angiogenic therapy, that is the platelet-derived PF4 can be at least
- the methods disclosed herein are also applicable to situations where an angiogenic therapy has been initiated. One would still expect the platelet-derived PF4 levels to reflect the levels of pro-angiogenic factors. Thus an increase in platelet-derived PF4 at any time during the anti-angiogenic therapy would indicate an adverse change of angiogenic state, a recurrence of tumor growth and a likely emergence of a resistant tumor phenotype.
- a method of monitoring the efficacy of an anti-angiogenic therapy in a subject comprising: (a) determining at a first time point a level of platelet-derived PF4 in a sample taken from a subject undergoing treatment with an anti- angiogenic therapy; (b) determining at a second time point, after the first time point, a level of
- 12751790 2 14 platelet-derived PF4 in a sample taken from the subject undergoing the anti-angiogenic therapy; and (c) comparing the levels of platelet-derived PF4 determined at the first and second time points, wherein an increase in the platelet-derived PF4 level at the second time point over that at the first time point indicates that the anti-angiogenic therapy is losing efficacy.
- the subject has been diagnosed to have at least a tumor in the body and has received anti- angiogenic therapy for at least one month.
- This first sample becomes a reference sample to which all subsequent samples' platelet-derived PF4 level from the same subject can be compared.
- the increase in platelet-derived PF4 level in a second sample taken from a subject undergoing treatment with an anti-angiogenic therapy is at least two or more fold over the platelet-derived PF4 level in the first sample taken from the same subject undergoing treatment with the anti-angiogenic therapy, that is the platelet-derived PF4 can be
- changes in the level of platelet-derived PF4 can also be used to monitor the recurrence of cancerous tumor cells in a patient who is in remission after completion of an anti-angiogenic therapy and/or other anti-cancer therapies or combinations thereof. Determination of recurrence of a tumor or cancer is mostly done at present by imaging and/or by surveillance of the respective biomarkers. Changes in the level of platelet-derived PF4 can indicate a recurrence of a tumor before the tumor has grown large enough to be detected by routine imaging and in tumor types where there are no specific biomarkers.
- a method of assessing the recurrence of a tumor in subject comprising: (a) determining at a first time point a level of platelet-derived PF4 in a sample taken from a subject who is in cancer remission; (b) determining at a second time point, after the first time point, a level of platelet-derived PF4 in a sample taken from the subject who is in cancer remission; and (c) comparing the levels of platelet-derived PF4 determined at the first and second time points, wherein an increase in the platelet-derived PF4 level at the second time point over that at the first time point indicates that a tumor has recurred.
- the subject had previously been diagnosed to have at least a tumor in the body, had received at least one anti- angiogenesis therapy, and the tumors have regressed or surgically removed such that no tumor is undetectable by standard methods and tests, e.g. biomarkers screening, scans and x-rays.
- This first sample becomes a reference sample to which all subsequent samples' platelet-derived PF4
- 12751790 2 15 level from the same subject can be compared, for example, with samples after commencing the second or subsequent anti-angiogenic therapy.
- the increase in platelet-derived PF4 level in the second sample taken from a subject who is in remission is at least two or more fold over the platelet- derived PF4 level in the first sample taken from the same subject in remission, that is the PF4 can be 2X, 3X, 4X, 5X, 1OX or more over the platelet-derived PF4 level in the first sample.
- Such levels are indicative of the recurrence of a tumor.
- the subject that is about to commence an anti-angiogenic therapy is a mammal, such as a dog, a cat, a horse, or a human, preferably a human.
- the subject that is undergoing treatment with an anti-angiogenic therapy is a mammal, preferably a human.
- the subject that is in remission after undergoing treatment with an anti-angiogenic therapy is a mammal, preferably a human.
- subject and “patient” are used interchangeably herein to refer to the same thing.
- the samples taken from a subject for the determination of platelet-derived PF4 levels are selected from the group consisting of whole blood, serum, plasma, platelets and megakaryocytes. Collections of samples can be performed by methods well known to those skilled in the art.
- the first and second samples must be from the same group, for example, the first and second samples collected are plasma, and platelet-derived PF4 levels are determined from these plasma samples.
- the first and second time points are about 1, 2 or 3 months apart. In another embodiment, the first and second time points can be about 6 months, 1 year or 2 years apart.
- the level of PF4 is determined by an antibody-based method wherein the sample containing PF4 to be measured is contacted with an anti-PF4 antibody-based moiety, wherein an antibody-PF4 complex in formed and wherein the complex in then detected.
- antibody-based methods include but are not limited to ELISA and Western blots.
- the level of PF4 is determined by quantitative RT-PCR wherein the expression level of PF4, mRNA is measured. Specifically, the amount of PF4 mRNA is quantitatively amplified by PCR.
- the level of PF4 is determined by mass spectrometry.
- the patient' s blood can be drawn directly into anti-coagulants containing citrate,
- the whole blood should be separated into the plasma portion, the cells, and platelets portion by refrigerated centrifugation at 3500 g, 2 minutes. Since platelets have a tendency to adhere to glass, it is preferred that the collection tube be siliconized. After centrifugation, the supernatant is the plasma. The plasma is filtered though a 0.2 ⁇ m filter to remove residual platelets and is kept at - 2O 0 C before the plasma PF4 concentration is measured.
- the serum can be collected from the whole blood. Collect the blood in a hard plastic or glass tube; blood will not clot in soft plastic. Draw 15 mL of whole blood for 6 mL of serum. The whole blood is allowed to stand at room temperature for 30 minutes to 2 hours until a clot has formed. Carefully separate clot from the sides of the container using a glass rod or wooden applicator stick and leave overnight at 4 0 C. After which, decant serum, centrifuge, and/or using a Pasteur pipette, remove serum into a clean tube. Clarify the serum by centrifugation at 2000-3000 rpm for 10 minutes. The serum is stored at -20° or -8O 0 C before the PF4 concentration is measured. Detailed described of obtaining serum using collection tubes can be found in U. S. Patent No. 3,837,376 and is incorporated by reference. Blood collection tubes can also be purchased from BD Diagnostic Systems, Greiner Bio-One, and Kendall Company.
- platelets can be separated from whole blood and the PF4
- red blood cells red blood cells
- white blood cells and platelets
- the red blood cells are denser and will be the first to move to the bottom of the collection/centrifugation tube, followed by the smaller white blood cells, and finally the platelets.
- the plasma fraction is the least dense and is found on top of the pellet.
- the "buffy coat" which contains the majority of
- platelets can be separated from blood according to methods described in United States Patent No. 4,656,035 using lectin to agglutinate the platelets in whole blood.
- the methods and apparatus described in United States Patent No. 7,223,346 can be used involving a platelet collection device comprising a centrifugal spin- separator container with a cavity having a longitudinal inner surface in order to collect the "buffy coat" enriched with platelets after centrifugation.
- the methods and apparatus as described in WO/2001/066172 can be used. Each of these is incorporated by reference herein in their entirety.
- platelets can be isolated by the two methods described in
- the whole blood can be first separated into platelet-rich plasma and cells (white and red blood cells).
- Platelet rich plasma (PRP) can be isolated from the blood centrifugation of citrated whole blood at 200 g for 20 minutes.
- the platelet rich plasma is then transferred to a fresh polyethylene tube.
- This PRP is then centrifuged at 800 g to pellet the platelets and the supernatant (platelet poor plasma [PPP]) can be saved for analysis by ELIZA at a later stage. Platelets can be then gently re-suspended in a buffer such as Tyrodes buffer containing lU/ml PGE2 and pelleted by centrifugation again.
- the wash can be repeated twice in this manner before removing the membrane fraction of platelets by centrifugation with Triton X, and lysing the pellet of platelet for platelet-derived PF4 analyses.
- Platelets can be lysed using 50 mM Tris HCL, 100-120 mM NaCl, 5 mM EDTA, 1% Igepal and Protease Inhibitor Tablet (complete TM mixture, Boehringer Manheim, Indianopolis, IN).
- the pellet of platelets can be dissolved in TRIZOL ® immediately after separation from the plasma.
- the whole blood and/or pelleted cells or platelets can be processed for mRNA analysis using TRIZOL ® extraction (Gibco BRL Cat# 15596-026) with methods known in one skilled in the art. Methods for isolating RNA are described in detail in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring
- the platelets and plasma are prepared according to Cervi, D. et al., 2008, Blood, 111:1201-7, which is herein incorporated by reference in its entirety.
- the levels of the PF4 protein can be measured by contacting the PF4-containing sample with an antibody-based binding moiety that specifically binds to PF4. Formation of the antibody-PF4 complex is then detected by a variety of methods known in the art.
- the antibody-based binding moiety is detectably labeled by linking the antibody to an enzyme.
- the enzyme when exposed to its substrate, will react with the substrate in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorometric or by visual means.
- Enzymes which can be used to detectably label the antibodies that specifically binds PF4 include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-V-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose- VI-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.
- Detection can also be accomplished using any of a variety of other immunoassays.
- radioactively labeling an antibody it is possible to detect the antibody through the use of radioimmune assays.
- the radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by audioradiography.
- Isotopes which are particularly useful for the purpose of the present invention are 3 H, 131 I, 35 S, 14 C, and preferably 125 I.
- fluorescent labeling compounds When the fluorescently labeled antibody is exposed to light of the proper wavelength, its presence can then be detected due to fluorescence.
- fluorescent labeling compounds are CYE dyes, fluorescein isothiocyanate, rhodamine, phycoerytherin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.
- An antibody can also be detectably labeled using fluorescence emitting metals such as 152 Eu, or others of the lanthanide series. These metals can be attached to the antibody using such metal chelating groups as diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
- DTPA diethylenetriaminepentaacetic acid
- EDTA ethylenediaminetetraacetic acid
- An antibody also can be detectably labeled by coupling it to a chemiluminescent compound. The presence of the chemiluminescent-antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction.
- chemiluminescent labeling compounds are luminol, luciferin, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
- the level of PF4 can be detected by immunoassays, such as enzyme linked immunoabsorbent assay (ELISA), radioimmunoassay (RIA), immunoradiometric assay (IRMA), Western blotting, immunocytochemistry or immunohistochemistry, each of which are described in more detail below.
- Immunoassays such as ELISA or RIA, which can be extremely rapid, are more generally preferred.
- Antibody arrays or protein chips can also be employed, see for example U.S. Patent Application Nos: 20030013208 Al; 20020155493A1; 20030017515 and U.S. Patent Nos: 6,329,209; 6,365,418, which are herein incorporated by reference in their entirety.
- ELISA Assay
- a labeled antibody e.g. enzyme linked
- a labeled antibody is then bound to the bound-antigen (if present) forming an antibody- antigen- antibody sandwich.
- enzymes that can be linked to the antibody are alkaline phosphatase, horseradish peroxidase, luciferase, urease, and B-galactosidase.
- the enzyme linked antibody reacts with a substrate to generate a colored reaction product that can be measured.
- antibody is incubated with a sample containing antigen (e.g. PF4).
- the antigen- antibody mixture is then contacted with a solid phase (e.g. a microtiter plate) that is coated with antigen (e.g., PF4).
- a solid phase e.g. a microtiter plate
- antigen e.g., PF4
- a labeled (e.g., enzyme linked) secondary antibody is then added to the solid phase to determine the amount of primary antibody bound to the solid phase.
- an "immunohistochemistry assay” a section of tissue is tested for specific proteins by exposing the tissue to antibodies that are specific for the protein that is being assayed.
- the antibodies are then visualized by any of a number of methods to determine the presence and amount of the protein present. Examples of methods used to visualize antibodies are, for example, through enzymes linked to the antibodies (e.g., luciferase, alkaline phosphatase, horseradish peroxidase, or beta-galactosidase), or chemical methods (e.g., DAB/Substrate chromagen).
- the sample is then analysed microscopically, most preferably by light microscopy of a sample stained with a stain that is detected in the visible spectrum, using any of a variety of such staining methods and reagents known to those skilled in the art.
- Radioimmunoassays can be employed.
- a radioimmunoassay is a technique for detecting and measuring the concentration of an antigen using a labeled (e.g.. radioactively or fluorescently labeled) form of the antigen.
- radioactive labels for antigens include 3 H, 14 C, and 125 I.
- the concentration of an antigen (e.g. PF4) in a biological sample is measured by having the antigen (e.g. PF4) in the biological sample compete with the labeled (e.g. radioactively) antigen (e.g. labeled PF4) for binding of an antibody to the antigen.
- An "Immunoradiometric assay” is an immunoassay in which the antibody reagent is radioactively labeled.
- An IRMA requires the production of a multivalent antigen conjugate by techniques such as conjugation to a protein e.g., rabbit serum albumin (RSA).
- the multivalent antigen conjugate must have at least 2 antigen residues per molecule and the antigen residues must be of sufficient distance apart to allow binding by at least two antibodies to the antigen.
- the multivalent antigen conjugate can be attached to a solid surface such as a plastic sphere.
- the level of PF4 can be assayed with commercial radio-immuno assay (RIA) and ELISA that has a sensitivity of ⁇ 2ng/ml. These assays take on average about 2-3 hours.
- RIA radio-immuno assay
- ELISA ELISA kits for determining the amount of plasma PF4 can be found at R&D
- the method provides a sensitive, cost-effective, sandwich enzyme-linked immunosorbent assay (ELISA) developed with commercially available antibodies to human PF4.
- ELISA sandwich enzyme-linked immunosorbent assay
- the method can be used for measuring PF4 from whole human platelets or secreted from activated platelets. This method has a maximal sensitivity of 10 pg and a dynamic quantitative range from 100 to 2500
- Laser energy is directed to the substrate surface where it desorbs and ionizes the biological molecules without significantly fragmenting them. See, e.g., U.S. Pat. No. 5,118,937 (Hillenkamp et al.), and U.S. Pat. No. 5,045,694 (Beavis & Chait).
- the probe hybridizes to a PCR product, but cannot itself be extended due to a blocking agent at the 3' end.
- the 5' nuclease activity of the polymerase for example, AmpliTaq
- PCR primers for amplifying the mRNA of PF4 should be about 15 -20 base-pairs long and anneal or complementary base-pair with the sequence of the human PF4 mRNA in found in Genbank Accession No.: NM_002619; 5'-
- GATATTTGTGTTATCCTTATGATTTTAAATAAACAAAATAAATC-S' (SEQ. ID. NO. 1).
- An example of a forward primer is 5'-AAGATGGGGACCTGCAGTGC-S'
- RNA transcripts of PF4 in platelets can be achieved by Northern blotting, wherein a preparation of RNA is run on a denaturing agarose gel, and transferred to a suitable support, such as activated cellulose, nitrocellulose or glass or
- Labeled (e.g., radiolabeled) cDNA or RNA is then hybridized to the preparation, washed and analyzed by methods such as autoradiography.
- RNA transcripts of PF4 in platelets can further be accomplished using known amplification methods.
- RT-PCR polymerase chain reaction
- RT-PCR polymerase chain reaction
- RT-AGLCR symmetric gap lipase chain reaction
- RNA transcripts of PF4 in platelets can be achieved with other known amplification methods which include but are not limited to the so- called "NASBA” or “3SR” technique described in PNAS USA 87: 1874-1878 (1990) and also described in Nature 350: 91-92 (1991); Q-beta amplification as described in published European Patent Application (EPA) No. 4544610; strand displacement amplification (as described in G. T. Walker et al., Clin. Chem. 42: 9-13 (1996) and European Patent Application No. 684315; and target mediated amplification, as described by PCT Publication WO 9322461.
- NASBA so- called "NASBA” or "3SR” technique described in PNAS USA 87: 1874-1878 (1990) and also described in Nature 350: 91-92 (1991)
- Q-beta amplification as described in published European Patent Application (EPA) No. 4544610
- strand displacement amplification as described in G. T. Walker et al.
- in situ hybridization visualization for the detection of PF4 RNA transcripts in platelets.
- a radioactively labeled antisense RNA probe is hybridized with a thin smear of platelets, after which the smear of platelets is washed, cleaved with RNase, and exposed to a sensitive emulsion for autoradiography.
- the samples can be stained with haematoxylin to demonstrate the histological composition of the sample, and dark field imaging with a suitable light filter shows the developed emulsion.
- Non-radioactive labels such as digoxigenin can also be used.
- mRNA expression can be detected on a DNA array, chip or a microarray.
- Oligonucleotides corresponding to PF4 are immobilized on a chip which is then hybridized with labeled nucleic acids of a sample of platelets obtained from a patient. Positive hybridization signal is obtained with the sample containing PF4 transcripts.
- Methods of preparing DNA arrays and their use are well known in the art. (See, for example U.S. Patent Nos: 6,618,6796; 6,379,897; 6,664,377; 6,451,536; 548,257; U.S. 20030157485 and Schena et al. 1995 Science 20:467-470; Gerhold et al. 1999 Trends in Biochem. Sci. 24, 168-173; and
- mRNA is extracted from the platelet sample to be tested, reverse transcribed, and fluorescent-labeled cDNA probes are generated.
- the microarrays capable of hybridizing to PF4 cDNA are then probed with the labeled cDNA probes, the slides scanned and fluorescence intensity measured. This intensity correlates with the hybridization intensity and expression levels.
- Antibodies for use in the methods described herein can be produced using standard methods to produce antibodies, for example, by monoclonal antibody production (Campbell, A.M., Monoclonal Antibodies Technology: Laboratory Techniques in Biochemistry and Molecular Biology, Elsevier Science Publishers, Amsterdam, the Netherlands (1984); St. Groth et al., J. Immunology, (1990) 35: 1-21; and Kozbor et al., Immunology Today (1983) 4:72).
- Antibodies can also be readily obtained by using antigenic portions of the protein to screen an antibody library, such as a phage display library by methods well known in the art.
- U.S. patent 5,702,892 U.S.A. Health & Human Services
- WO 01/18058 Novopharm Biotech Inc.
- 12751790 2 28 fluorescent label, a hapten label such as biotin, or an enzyme such as horse radish peroxidase or alkaline phosphatase.
- unlabeled primary antibody is used in conjunction with labeled secondary antibody, comprising antisera, polyclonal antisera or a monoclonal antibody specific for the primary antibody.
- the primary antibody or antisera is unlabeled
- the secondary antisera or antibody is conjugated with biotin and enzyme-linked strepavidin is used to produce visible staining for histochemical analysis.
- the present invention provides a method of monitoring the efficacy of an anti-tumor therapy in a subject comprising: (a) determining at a first time point a level of PF4 in a sample taken from a subject undergoing treatment with an anti-tumor therapy; (b) determining at a second time point, after the first time point, a level of PF4 in a sample taken from the subject-undergoing the anti-tumor therapy; and (c) comparing the levels of PF4 determined at the first and second time points, wherein an increase in the PF4 level at the second time point over that at the first time point indicates that the anti-tumor therapy is losing efficacy.
- 12751790 2 29 There is the use of endoscopic ultrasound to kill tumors and also to deliver chemotherapy drugs directly to the tumor cells.
- drugs and chemicals for chemotherapy where the drugs and chemicals inhibit/the expressions of various enzymes or proteins, e.g. p21 cyclin- dependent kinase; transcription factors, e. g. p53; and proteins involve in mitosis and cell division, e. g. taxol.
- Other anti-tumor therapies include radiation therapy, e. g. radioactive iodine treatment for thyroid cancer.
- anti-tumor therapies are non traditional therapies such as holistic medicine and homeopathic medicine. These anti-tumor therapies are non-conventional western medicines and can involve dietary supplements, e. g. UMI NO SHIZUKU, a dietary supplement made from "Fucoidan” a natural complex extracted from Okinawa Mozuku (Nemacystus decipiens) and Wakame (Undaria pinnatifida), which can boost the immune system, increase Natural killer cell activity as well as improve activation of macrophage, T- cells and B-cells. Mushroom such as Shiitake, Krestin, Reishi, and Maitake have been reported to have anti-tumor activity.
- UMI NO SHIZUKU a dietary supplement made from "Fucoidan” a natural complex extracted from Okinawa Mozuku (Nemacystus decipiens) and Wakame (Undaria pinnatifida)
- the anti-angiogenic therapies include but are not limited to administration of small molecule tyrosine kinase inhibitors (TKIs) of multiple pro-angiogenic growth factor receptors.
- TKIs small molecule tyrosine kinase inhibitors
- the three TKIs that are currently approved as anti-cancer therapies are erlotinib (TARCEVA ® ), sorafenib (NEXA VAR ® ), and sunitinib (SUTENT ® ).
- VEGF/VPF protein As the VEGF/VPF protein interacts with the VEGFRs, inhibition of either the ligand VEGF, e.g. by reducing the amount that is available to interact with the receptor; or inhibition of the receptor's intrinsic tyrosine kinase activity, blocks the function of this pathway. This pathway controls endothelial cell growth, as well as permeability, and these functions are mediated through the VEGFRs.
- VEGF inhibitors include any compound or agent that produces a direct or indirect effect on the signaling pathways that promote growth, proliferation and survival of a cell by inhibiting the function of the VEGF protein, including inhibiting the function of VEGF receptor proteins.
- VEGF receptor proteins include any organic or inorganic molecule, including, but not limited to modified and unmodified nucleic acids such as antisense nucleic acids, RNAi agents such as siRNA or shRNA, peptides, peptidomimetics, receptors, ligands, and antibodies that inhibit the VEGF signaling pathway.
- the siRNAs are targeted at components of the VEGF pathways and can inhibit the VEGF pathway.
- VEGF inhibitors include for example, AVASTIN ® (bevacizumab), an anti-VEGF monoclonal antibody of Genentech, Inc. of South San Francisco, CA, VEGF Trap (Regeneron / Aventis).
- Additional VEGF inhibitors include CP-547,632 (3-(4- Bromo-2,6-difluoro- benzyloxy)-5-[3-(4-pyrrolidin 1-yl- butyl)-ureido]-isothiazole-4- carboxylic acid amide hydrochloride; Pfizer Inc.
- VEGFR2-selective monoclonal antibody DClOl ImClone Systems, Inc.
- angiozyme a synthetic ribozyme from Ribozyme (Boulder, Colorado) and Chiron (Emeryville, California)
- Sirna-027 an siRNA-based VEGFRl inhibitor, Sirna Therapeutics, San Francisco, CA
- Caplostatin soluble ectodomains of the VEGF
- VEGF inhibitors are also disclosed in US Patent No. 6,534,524 and 6,235,764, both of which are incorporated in their entirety. Additional VEGF inhibitors are described in, for example in WO 99/24440 (published May 20, 1999), International Application PCT/IB99/00797 (filed May 3, 1999), in WO 95/21613 (published August 17, 1995), WO 99/61422 (published December 2, 1999), U.S. Pat. Publ. No. 20060094032 "siRNA agents targeting VEGF", U.S. Patent 6, 534,524 (discloses AG13736), U.S. Patent 5,834,504 (issued November 10, 1998), WO 98/50356 (published November 12, 1998), U.S.
- Patent 5, 883,113 (issued March 16, 1999), U.S. Patent 5, 886,020 (issued March 23, 1999), U.S. Patent 5,792,783 (issued August 11, 1998), U.S. Patent No. US 6,653,308 (issued November 25, 2003), WO 99/10349 (published March 4, 1999), WO 97/32856 (published September 12, 1997), WO 97/22596 (published June 26, 1997), WO 98/54093 (published December 3, 1998), WO 98/02438 (published January 22, 1998), WO 99/16755 (published April 8, 1999), and WO 98/02437 (published January 22, 1998), WO 01/02369 (published January 11, 2001); U.S. Provisional Application No.
- VEGF inhibitors are disclosed in International Patent Publications WO 99/62890 published December 9, 1999, WO 01/95353 published December 13, 2001 and WO 02/44158 published June 6, 2002.
- the anti- angiogenic therapy includes, but is not limited to the use of VEGF inhibitors.
- the anti- angiogenic therapy includes, but is not limited to the use of anti-angiogenic factors such as alpha-2 antiplasmin (fragment), angiostatin (plasminogen fragment), antiangiogenic antithrombin III, cartilage-derived inhibitor (CDI), CD59 complement fragment, endostatin (collagen XVIII fragment), fibronectin fragment, gro- beta ( a C-X-C chemokine), heparinases heparin hexasaccharide fragment, human chorionic gonadotropin (hCG), interferon alpha/beta/gamma, interferon inducible protein (IP-10), interleukin-12, kringle 5 (plasminogen fragment), beta-thromboglobulin, EGF (fragment), VEGF inhibitor, endostatin, fibronection (45 kD fragment), high molecular weight kininogen (domain 5), NKl, NK2, NK3 fragments of HGF, PF-4
- 12751790 2 32 Methoxyestradiol, placental ribonuclease inhibitor, plasminogen activator inhibitor, prolactin 16kD fragment, proliferin-related protein (PRP), retinoids, tetrahydrocortisol-S transforming growth factor-beta (TGF-b), vasculostatin, and vasostatin (calreticulin fragment), pamidronate thalidomide, TNP470, the bisphosphonate family such as amino-bisphosphonate zoledronic acid, bombesin/gastrin-releasing peptide (GRP) antagonists such as RC-3095 and RC-3940-II (Bajol AM, et.
- GRP bombesin/gastrin-releasing peptide
- the anti-angiogenic therapy disclosed herein is directed at angiogenic diseases and disorders.
- angiogenesis occurs at inappropriate locations, is aberrant, and/or uncontrolled and results in undesirable effects, then that angiogenesis pathological.
- the pathological angiogenic diseases and disorders include but are not limited to cancer, ascites formation, psoriasis, age-related macular degeneration, thyroid hyperplasia, preeclampsia, rheumatoid arthritis and osteoarthritis, Alzheimer's disease, obesity, pleura effusion, atherosclerosis, endometriosis, diabetic/other retinopathies, neovascular glauocoma, age-related macular degeneration, hemangiomas, and corneal neovascularization.
- the pathological angiogenic disease or disorder is cancer, where the rapidly dividing neoplastic cancer cells require an efficient blood supply to sustain their continual growth of the tumor.
- cancer refers to any of various malignant neoplasms characterized by the proliferation of anaplastic cells that tend to invade surrounding tissue and metastasize to new body sites and also refers to the pathological condition characterized by such malignant neoplastic growths.
- the blood vessels provide conduits to metastasize and spread elsewhere in the body.
- the cancer cells Upon arrival at the metastatic site, the cancer cells then work on establishing a new blood supply network. Inhibition of angiogenesis at the primary tumor site and secondary tumor site serve to prevent and limit the progression of the disease.
- carcinomas and sarcomas such as those found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon/rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovaries, pancreas, penis, prostate, skin, small intestine, stomach, spinal marrow, tailbone, testicles, thyroid and uterus.
- carcinomas and sarcomas such as those found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon/rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovaries, pancreas, penis, prostate, skin, small intestine, stomach, spinal marrow, tailbone, testicles, thyroid and uterus.
- sarcomas include soft tissue sarcoma such as alveolar soft part sarcoma, angiosarcoma, dermatofibro sarcoma, desmoid tumor, desmoplastic small round cell tumor, extraskeletal chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, hemangiopericytoma, hemangiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangio sarcoma, lymphosarcoma, malignant fibrous histiocytoma, neurofibrosarcoma, rhabdomyosarcoma, synovial sarcoma, and Askin's tumor, Ewing's sarcoma (primitive neuroectodermal tumor), malignant hemangioendothelioma, malignant schwannoma, osteosarcoma, and chondrosarcoma.
- pathological angiogenesis occurs in diabetic retinopathy where abnormal blood vessel growth is associated with diabetic eye diseasesand diabetic macular edema.
- VEGF inhibitors can block and/or reduce the activity of VEGF and pathologic
- 12751790 2 34 angiogenesis Released by the retina (light-sensitive tissue in back of the eye) when normal blood vessels are damaged by tiny blood clots due to diabetes, VEGF turns on its receptor, igniting a chain reaction that culminates in new blood vessel growth. However, the backup blood vessels are faulty; they leak (causing edema), bleed and encourage scar tissue that detaches the retina, resulting in severe loss of vision. Such growth is the hallmark of diabetic retinopathy, the leading cause of blindness among young people in developed countries. Therefore, encompassed in the methods disclosed herein are subjects treated for diabetic retinopathy and/or diabetic macular edema with anti-angiogenic therapy.
- pathological angiogenesis in rheumatoid arthritis is a chronic myeloma, rheumatoid arthritis.
- VEGF vascular permeability factor
- Anti-VEGF hexapeptide RRKRRR (dRK6) (SEQ. ID. NO. 4) can suppress and mitigate the arthritis severity (Seung-Ah Yoo, et. al.,2005, supra). Accordingly, encompassed in the methods disclosed herein are subjects treated for rheumatoid arthritis with anti-angiogenic therapy.
- AD Alzheimer's disease
- AD angiogenesis in the brain vasculature can play an important role in AD.
- the brain endothelium secretes the precursor substrate for the beta-amyloid plaque and a neurotoxic peptide that selectively kills cortical neurons.
- amyloid deposition in the vasculature leads to endothelial cell apoptosis and endothelial cell activation which leads to neovascularization.
- pathological angiogenesis occurs in obesity.
- Adipogenesis in obesity requires close interplay between differentiating adipocytes, stromal cells, and blood vessels. There were close spatial and temporal interrelationships between blood vessel formation and adipogenesis, and the sprouting of new blood vessels from preexisting vasculature was coupled to adipocyte differentiation.
- Adipogenic/angiogenic cell clusters can morphologically and immunohistochemically be distinguished from crown-like structures frequently seen in the late stages of adipose tissue obesity.
- VEGF vascular endothelial growth factor
- TNP-470 reduced vascularity in the adipose tissue, thereby inhibiting the rate of growth of the adipose tissue and obesity development. Accordingly, encompassed in the methods disclosed herein are subjects treated for obesity with anti-angiogenic therapy.
- pathological angiogensis occurs in endometriosis.
- Excessive endometrial angiogenesis is proposed as an important mechanism in the pathogenesis of endometriosis (Healy, DL., et. al., Hum Reprod Update. 1998 Sep-Oct, 4(5):736-40).
- the endometrium of patients with endometriosis shows enhanced endothelial cell proliferation.
- Embodiments of the invention also provide for systems (and computer readable media for causing computer systems) to perform a method for monitoring efficacy of an antitumor or anti-angiogenic therapy in a subject and methods for monitoring tumor status in a subject by monitoring the level of PF4 in the subject regularly over time or at different time increments.
- a system comprising: (a) a measuring module quantifying a PF4 level from a sample comprising a signal capable of indicating a level of PF4 in a subject; (b) a storage module configured to store data output from the measuring module; (c) a comparison module adapted to compare the data stored on the storage module with a reference and/or control data, and to provide a retrieved content, and (d) an output module for displaying the retrieved content for the user, wherein the retrieved content the level of PF4 is higher than the reference and/or control data indicates that the therapy is ineffective and/or the tumor has recurred or regrown.
- the PF level is determined from an antibody-based moiety-PF4 complex, from quantitative RT-PCR of the mRNA of PF4 or by mass spectrometry of PF4 or the mRNA of PF4 after quantitative RT-PCR.
- control data comprises previous data from the same subject.
- a computer readable storage medium comprising:(a) a storing data module containing data from a subject that represents as a signal indicating a level of PF4 from a sample obtained from a subject; (b) a comparison module that compares the data stored on the storing data module with a reference data and/or control data, and to provide a comparison content, and (c) an output module displaying the comparison content for the user, wherein if the measured level of PF4 from the subject is lower than a reference level of PF4 indicates that indicates that the therapy is effective and/or the tumor has not recurred or re-grown or if there is a reduction of at least 10% to a prior reading, then the therapy is effective.
- the PF4 level is lower than the reference and/or control data by about at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, 100%, 200%, 300% or 1000%, including all the percentages between 10-1000%.
- the output module for displaying the comparison content of a measured level of PF4 from the subject displays a PF4 level that is higher than the reference and/or control data or if there is an increase of about at least 2 fold to a prior reading indicates that the therapy is ineffective and/or the tumor has recurred or re-grown.
- the PF4 level is higher than the reference and/or control data by about two to ten fold, including the entire intervening fold.
- Embodiments of the invention can be described through functional modules, which are defined by computer executable instructions recorded on computer readable media and which cause a computer to perform method steps when executed.
- the modules are segregated by function for the sake of clarity. However, it should be understood that the modules/systems need not correspond to discreet blocks of code and the described functions can be carried out by the execution of various code portions stored on various media and executed at various times. Furthermore, it should be appreciated that the modules can perform other functions, thus the modules are not limited to having any particular functions or set of functions.
- Computer readable storage media includes, but is not limited to, RAM (random access memory), ROM (read only memory), EPROM (eraseable programmable read only memory), EEPROM (electrically eraseable programmable read only memory), flash memory or other memory technology, CD-ROM (compact disc read only memory), DVDs (digital versatile disks) or other optical storage media, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage media, other types of volatile and non-volatile memory, and any other tangible medium which can be used to store the desired information and which can accessed by a computer including and any suitable combination of the foregoing.
- RAM random access memory
- ROM read only memory
- EPROM eraseable programmable read only memory
- EEPROM electrically eraseable programmable read only memory
- flash memory or other memory technology CD-ROM (compact disc read only memory), DVDs (digital versatile disks) or other optical storage media, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage media, other types of volatile and non-volatile memory,
- Computer-readable data embodied on one or more computer-readable media may define instructions, for example, as part of one or more programs that, as a result of being executed by a computer, instruct the computer to perform one or more of the functions described herein, and/or various embodiments, variations and combinations thereof.
- Such instructions may be written in any of a plurality of programming languages, for example, Java, J#, Visual Basic, C, C#, C++, Fortran, Pascal, Eiffel, Basic, COBOL assembly language, and the like, or any of a variety of combinations thereof.
- the computer-readable media on which such instructions are embodied may reside on one or more of the components of either of a system, or a computer readable storage medium described herein, may be distributed across one or more of such components.
- the computer-readable media may be transportable such that the instructions stored thereon can be loaded onto any computer resource to implement the aspects of the present invention discussed herein.
- the instructions stored on the computer-readable medium, described above are not limited to instructions embodied as part of an application program running on a host computer. Rather, the instructions may be embodied as any type of computer code (e.g., software or microcode) that can be employed to program a computer to implement aspects of the present invention.
- the computer executable instructions may be written in a suitable computer language or combination of several languages.
- the functional modules of certain embodiments of the invention include at minimum a determination module #40, a storage module #30, a comparison module #80, and an output module #110.
- the functional modules can be executed on one, or multiple, computers, or by using one, or multiple, computer networks.
- the measuring module has computer executable instructions to provide e.g., PF4 level etc in computer readable form.
- the storage module is adapted or configured for having recorded thereon, for example, PF4 level or expression information.
- Such information may be provided in digital form that can be transmitted and read electronically, e.g., via the Internet, on diskette, via USB (universal serial bus) or via any other suitable mode of communication.
- stored refers to a process for encoding information on the storage module.
- Those skilled in the art can readily adopt any of the presently known methods for recording information on known media to generate manufactures comprising expression level information.
- the "comparison module” #80 can use a variety of available software programs and formats for the comparison operative to compare expression data determined in the measuring module to reference samples and/or stored reference data.
- the comparison module is configured to use pattern recognition techniques to compare information from one or more entries to one or more reference data patterns.
- the comparison module can be configured using existing commercially- available or freely- available software for comparing patterns, and may be optimized for particular data comparisons that are conducted.
- the comparison module provides computer readable information related to PF4 level, presence/absence of tumor in a subject and/or efficacy of anti-tumor or anti-angiogenic therapy in a subject.
- the comparison module can include an operating system (e.g., UNIX) on which runs a relational database management system, a World Wide Web application, and a World Wide Web server.
- World Wide Web application includes the executable code necessary for generation of database language statements (e.g., Structured Query Language (SQL) statements).
- SQL Structured Query Language
- the executables will include embedded SQL statements.
- the World Wide Web application may include a configuration file which contains pointers and addresses to the various software entities that comprise the server as well as the various external and internal databases which must be accessed to service user requests.
- the Configuration file also directs requests for server resources to the appropriate hardware— as may be necessary should the server be distributed over two or more separate computers.
- the World Wide Web server supports a TCP/IP protocol.
- Local networks such as this are sometimes referred to as "Intranets.”
- An advantage of such Intranets is that they allow easy communication with public domain databases residing on the World Wide Web (e.g., the GenBank or Swiss Pro World Wide Web site).
- users can directly access data (via Hypertext links for
- the comparison module provides a computer readable comparison result that can be processed in computer readable form by predefined criteria, or criteria defined by a user, to provide a content-based in part on the comparison result that may be stored and output as requested by a user using an output module #110.
- the content based on the comparison result is displayed on a computer monitor #120. In one embodiment of the invention, the content based on the comparison result is displayed through printable media #130, #140.
- the display module can be any suitable device configured to receive from a computer and display computer readable information to a user.
- Non-limiting examples include, for example, general-purpose computers such as those based on Intel PENTIUM-type processor, Motorola PowerPC, Sun UltraSPARC, Hewlett-Packard PA-RISC processors, any of a variety of processors available from Advanced Micro Devices (AMD) of Sunnyvale, California, or any other type of processor, visual display devices such as flat panel displays, cathode ray tubes and the like, as well as computer printers of various types.
- general-purpose computers such as those based on Intel PENTIUM-type processor, Motorola PowerPC, Sun UltraSPARC, Hewlett-Packard PA-RISC processors, any of a variety of processors available from Advanced Micro Devices (AMD) of Sunnyvale, California, or any other type of processor, visual display devices such as flat panel displays, cathode ray tubes and the like, as well as computer printers of various types.
- AMD Advanced Micro Devices
- the present invention therefore provides for systems (and computer readable media for causing computer systems) to perform methods for monitoring anti-tumor and/or anti- angiogenic therapy efficacy or tumor genesis status in a subject.
- a method of monitoring the efficacy of an anti-tumor therapy in a subject comprising:
- a method of monitoring the efficacy of an anti- angiogenic therapy in a subject comprising:
- a method of monitoring the efficacy of an anti-angiogenic therapy in a subject comprising:
- a method of monitoring tumor status in a subject comprising:
- a determining at a first time point a level of PF4 in a sample taken from a subject who is in cancer remission; b. determining at a second time point, after said first time point, a level of PF4 in a sample taken from said subject;
- a system comprising:
- a measuring module quantifying a PF4 level comprising a signal capable of indicating a level of PF4 in a sample obtained from a subject
- a comparison module adapted to compare the data stored on the storage module with a reference and/or control data, and to provide a retrieved content
- an output module for displaying the retrieved content for the user, wherein the retrieved content the level of PF4 is lower than the reference and/or control data indicates that the therapy is effective, and wherein the retrieved content the level of PF4 is higher than the reference and/or control data indicates that the therapy is ineffective.
- control data comprises data from the same subject at a previous time.
- a system to monitoring anti-tumor and/or anti-angiogenic therapy or status of tumor recurrence in a subject comprising:
- a determination module configured to receive and output a PF4 level obtained from a subject,
- a comparison module adapted to compare the output data stored on the storage module with a reference and/or control data, and to provide a comparison content
- an output module for displaying the comparison content for the user, wherein if the measured level of PF4 from the subject is lower than the reference and/or control data indicates that the therapy is effective or if there is a reduction of at least 25% to a prior reading, then the indicates that the therapy is effective; or if the measured level of PF4 from the subject is higher than the reference and/or control data indicates that the therapy is not effective.
- control data comprises previous data from the same subject.
- a computer readable storage medium comprising:
- a comparison module that compares the data stored on the storing data module with a reference data and/or control data, and to provide a comparison content
- an output module displaying the comparison content for the user, wherein if the measured level of xanthophyll from the subject is lower than a reference level of xanthophyll indicates that the therapy is effective or if there is a reduction of at least 25% to a prior reading, then the indicates that the therapy is effective; or if the measured level of PF4 from the subject is higher than the reference and/or control data indicates that the therapy is not effective.
- control data comprises data comprises previous data from the same subject.
- a patient who has been recent been diagnosed with cancer but have not received any treatment, particularly an anti-angiogenic treatment the method disclosed herein can be applied.
- a patient X has been positively diagnosed with non-Hodgkin's lymphoma.
- Her doctor conducted an initial physical examination and found a small solid mass in her left arm pit. She also had other symptoms such as enlarged lymph nodes, fever, and weight loss.
- a tissue biopsy was done which confirmed the diagnosis of non-Hodgkin's lymphoma.
- patient's X oncologist wants to start her on an aggressive treatment of combined anti-B-cell and anti-angiogenic therapy comprising of rituximab and bevacizumab.
- Monitoring of her platelet-derived PF4 before and after the start of her treatment can allow her doctor to determine if the prescribed treatment is working in retarding the tumor growth, shrinking the tumor growth, and/or killing her cancer cells.
- a sample of patient's X blood can be collected in citrate (anti-coagulant) and PGE2 (anti-platelet activation).
- the platelets in her blood sample can be isolated by fractional centrifugation and collected as a pellet.
- the pellet of platelets can then be lysed and the platelet lysate can be used for the measurement of PF4 by ELISA using R&D Systems anti-human PF4 antibodies. Three separate measurements of PF4 from the same lysate are recommended and the PF4 measurements can be averaged.
- Table 1 is a hypothetical chart showing the expected changes in the platelet- derived PF4 of a patient, diagnosed with cancer, before and after receiving an anti- angiogenic therapy such as bevacizumab.
- the patient can have an average platelet-derived PF4 of 1.5 ⁇ g/ml at day zero, before the start of her combined anti-B-cell and anti- angiogenic therapy.
- This platelet-derived PF4 of 1.5 ⁇ g/ml at day zero becomes a reference measurement of platelet- derived PF4 to which subsequent PF4 measurements can be compared with.
- the patient's platelet-derived PF4 can be monitored again.
- monthly measurements of the patient's platelet-derived PF4 can be performed during the entire course of her treatment as well as when her cancer is in remission (see examples 2 and 3). If the anti-angiogenic therapy is effective, it is expected that the patient's platelet-derived PF4 should decrease compared to that the PF4 level before the start of treatment. For example, after one month of treatment with bevacizumab, patient's platelet-derived PF4 can drop to 0.5 ⁇ g/ml. Compared to the PF4 measurement at day zero, the amount of platelet-derived PF4 has decrease to one-third of day zero.
- This decrease indicates that the anti-angiogenic therapy is effective against her cancer, and is effective in reducing the effects of angiogenic factors that stimulated increase PF4 expression in the platelets.
- the patient can continue to receive the treatment for additional months and her platelet-derived PF4 can be measured monthly for the monitoring whether the treatment is still effective in killing her cancer cells and/or stopping or slowing her tumor growth and for monitoring the development cancer resistance to her current treatment program.
- Table 1 shows the changes in the amount of platelet-derived PF4 in the platelets of a patient before and after her treatment with an aggressive treatment of combined anti-B-cell and anti-angiogenic therapy comprising of rituximab and bevacizumab.
- the decreases in platelet-derived PF4 in the second, third, and fourth months after the start of treatment, when compared to the PF4 measurement at day 0 (before treatment) indicate that the aggressive combined treatment was effective in counteracting any VEGF signaling pathway-dependent activities for up to 4 months.
- This hypothetical example is to illustrate the use of the method disclosed herein for a patient whose cancer is in remission, in order to monitor for the recurrence of tumor.
- the regular monitoring of her platelet-derived PF4 can allow her doctor to determine if her cancer is back.
- this patient can have a lumpectomy, and then be started on a treatment comprising low-dose methotrexate, cyclophosphamide, and bevacizumab for a period of several months, e.g. six months.
- Her cancer went into remission after six months of treatment.
- her platelet-derived PF4 in her platelets can be monitored every three months.
- Table 2 shows a hypothetical chart of the changes of platelet-derived PF4 in such a patient' s platelets when she was first diagnosed with cancer, the platelet-derived PF4 levels when her cancer went into remission after a first treatment for six months and the platelet-derived PF4 levels when her cancer is in remission and is not receiving any treatment.
- her platelet- derived PF4 levels remained relatively constant in the low ranges of less than 0.25 ⁇ g/ml.
- her platelet-derived PF4 levels showed a very significant increase (almost three fold increase) over the preceding PF4 measurement at the 18 month.
- This increase in platelet-derive PF4 can indicate that there is a resurgence of pro-angiogenic factors in her body and her doctors should survey her cancer to determine whether the resurgence of pro-angiogenic factors had brought about re-growth of her breast cancer.
- PDGF vascular endothelial growth factor
- VEGF vascular endothelial growth factor
- bFGF vascular endothelial growth factor
- ES esdostatin
- platelet control results obtained from 52 replicates each for PDGF, PF4, TSPl and 26 replicates each for Endostatin, VEGF and bFGF over the course of 13 runs.
- CVi total individual variation, 2 serial samples from eight subjects drawn one month apart
- the time series longitudinal profiles of PF4 showed that platelet PF4 levels correlated with that of the pro-angiogenic factors PDGF, VEGF and bFGF (Fig. 3-6).
- subject 1 after surgery to remove the tumor and the administration of FOLFOX, all three of the pro-angiogenic factors decreased over the first four months and the PF4 level drop accordingly (Fig. 3).
- the pro-angiogenic factor PDGF began to increase and concomitantly PF4 level too, even though the two other pro-angiogenic factors VEGF and bFGF remained relatively steady between the 4 th to the 8th month. Similar decreases were noted when the treatment was FOLFOX and AVASTIN ® .
- subject 12 the combination treatment effectively decreased all three other pro-angiogenic factors which then lead to reduced PF4 levels (Fig. 4).
- the FOLFOX and AVASTIN ® combination treatment was effective in reducing the level of only one pro-angiogenic factor VEGF and not PDGF and bFGF levels. Accordingly, the PF4 level reminds high and an increase is recorded indicating the treatment is no longer effective (Fig. 6).
- Table 2 A hypothetical chart showing the changes in the platelet-derived PF4 of a patient before and after receiving treatment, and during cancer remission.
- the patient received an anti- angiogenic therapy such as bevacizumab for 6 months.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Embodiments of the present invention are based on using relative changes of the platelet- derived PF4 in platelets as indicators of changes in the presence or activity of pro-angiogenic factors, indicator of the efficacy of anti-tumor therapy and indicator of the effectiveness of an anti- angiogenic factor or therapy. Methods of monitoring efficacy of anti-tumor or anti- angiogenic therapy and also methods for monitoring tumor recurrence are provided herein.
Description
PLATELET-DERIVED PF4 AS EFFICACY MARKER FOR ANTI- ANGIOGENIC
THERAPIES
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of priority under 35 U.S.C. § 119(e) of U.S.
Provisional Application No. 61/115,705 filed November 18, 2008, the contents of which are incorporated herein by reference in its entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted via
EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on November 6, 2009, is named 20091116_SequenceListing_TextFile_701039_060481 and is 1,716 bytes in size.
BACKGROUND OF INVENTION
[0003] Angiogenesis is an important process for forming new blood vessels. It is fundamental in many biological processes including development, reproduction and wound repair. Under these conditions, angiogenesis is a highly regulated process. Angiogenesis is regulated by the balance of inducers and inhibitors of endothelial cell proliferation.
[0004] However, when angiogenesis is deregulated, pathological angiogenesis occurs.
Pathological angiogenesis is now recognized as an essential feature of conditions such as rheumatoid arthritis, diabetic retinopathy and malignant neoplasia. Pathological angiogenesis has an important role in tumor development, tumor progression and the formation of metastases. Cancerous tumors require a constant supply of nutrients to sustain continual growth. A tumor achieves this by secreting its own factors and by recruiting host factors that promote angiogenesis. The new network of blood vessels provides the necessary nutrients for sustain tumor growth, the efficient removal of waste products from the tumor and also provides a conduit for the tumor to metastasize to other parts of the body. In the absence of an adequate vasculature, tumor cells become necrotic and/or apoptotic. By far the best characterized inducers of angiogenesis in human and animal cancers are basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF).
[0005] Accordingly, inhibition of pathological angiogenesis, particularly that mediated by bFGF and/or VEGF provides an alternative to surgery, chemotherapy or radiotherapy against
12751790 2
cancer, tumors, and metastasis. The development of angiogenic inhibitors is an important therapeutic area in the treatment of human cancers and offers potentially long-term treatment, with significantly fewer side effects than traditional chemotherapeutic treatment regimes. The past decade saw the emergence of several anti-VEGF molecules for treating cancer. At least eight angiogenesis inhibitors have received FDA approval in the US, with bevacizumab (AVASTIN®) (anti-VEGF-antibody) also approved in 26 other countries.
[0006] While the anti- angiogenic therapies have been successful in a great number of individuals, there are reports of failure of the therapy in others over time. For these individuals, the anti-angiogenic therapy appeared to be effective in the beginning, evidenced by a halt in tumor growth and/or shrinkage of the tumor. Sometimes, the entire tumor disappears completely and is not detectable by the most sensitive imaging technique. In some instances, however, after a period of effective anti-angiogenic therapy, there is observed acquired resistance to anti- angiogenic drugs, especially when used as monotherapies. In such instances, after a median of 6 to 12 months of receiving therapy, in the case of renal cell carcinoma using anti-VEGF therapy, the existing tumor can begin to start growing again and/or a new tumor may emerge where the former tumor has disappeared. Possible mechanisms for such acquired or induced resistance include: (i) bypassing the VEGF pathway through expression of additional angiogenic factors; (ii) redundancy of pro-angiogenic growth factors when the drug used targets a single such growth factor or its cognate endothelial cell-associated receptor tyrosine kinase; (iii) the anti- apoptotic/pro- survival function of growth factors such as VEGF, which, in high local concentrations, can antagonize the pro-apoptotic effects of various angiogenesis inhibitors; (iv) epigenetic, transient upregulation, or induction, of various anti-apoptotic effecter molecules in host-endothelial cells; and (v) heterogeneous vascular dependence of tumor cell populations. Multiple circulating pro-angiogenic factors are induced by sunitinib malate (SUTENT®) and the induction is tumor-independent and correlates with anti-tumor treatment efficacy.
[0007] Anti-angiogenic cancer therapy targets the formation of new blood vessels used to support tumor growth. Current methods of determining the efficacy of the anti-angiogenic therapy involve monitoring the tumor size by imaging (MRI, CT, PET, MRA, 3T-MRI, and 3T- MRA), by monitoring the levels of biomarker(s) for the specific tumor type, and by monitoring the levels of circulating cytokines, and/or circulating endothelial cells (CEC) in the peripheral blood of patients. These methods can be expensive, time consuming (culturing of CECs and in vitro functional assays for cytokines), or only applicable to select tumors with known biomarkers. There is a need for alternative methods of monitoring responses to anti-angiogenic
12751790 2
treatment and the evaluation of the development of resistance to the anti-angiogenic therapy that are applicable globally to all tumor types.
SUMMARY OF THE INVENTION
[0008] Embodiments of the present invention are based on the discovery that pro- angiogenic factors (e.g. VEGF) increase platelet-associated factor 4 (also known as platelet factor 4 or PF4) in platelets and megakaryocytes. Accordingly, an anti-angiogenic factor can inhibit this increase in platelet-derived PF4 in platelets that is induced by pro-angiogenic factors. In other words, PF4 can function as a biomarker for the level/ presence of pro-angiogenic factors in the body. Accordingly, relative changes of the platelet-derived PF4 in platelets can be indicators of changes in the presence or activity of pro-angiogenic factors, indicator of the efficacy of anti-tumor therapy or the effectiveness of an anti-angiogenic factor or therapy.
[0009] In one embodiment, the present invention provides a method of monitoring the efficacy of an anti-tumor therapy in a subject comprising: (a) determining a level of PF4 in a first sample taken from a subject prior to treatment with an anti-tumor therapy; (b) determining a level of PF4 in a second sample taken from the subject after commencing treatment with the anti-tumor therapy; and (c) comparing the levels of PF4 determined in the first and second samples, wherein an increase in PF4 level in the second sample over that in the first sample indicates that the anti-tumor therapy is ineffective. The levels of PF4 at both time points are determined by the same method.
[0010] In one embodiment, the present invention provides a method of monitoring the efficacy of an anti- tumor therapy in a subject comprising: (a) determining at a first time point a level of PF4 in a sample taken from a subject undergoing treatment with an anti- tumor therapy; (b) determining at a second time point, after the first time point, a level of PF4 in a sample taken from the subject undergoing the anti- tumor therapy; and (c) comparing the levels of PF4 determined at the first and second time points, wherein an increase in the PF4 level at the second time point over that at the first time point indicates that the anti- tumor therapy is losing efficacy. The levels of PF4 at both time points are determined by the same method.
[0011] In one embodiment, the anti- tumor therapy is an anti-angiogenic therapy.
[0012] In some embodiments, the anti-angiogenic therapy can be an agent that antagonizes VEGF or bFGF signaling. In one embodiment, the agent is an antibody against VEGF.
12751790 2 3
[0013] In one embodiment, the present invention provides a method of monitoring the efficacy of an anti- angiogenic therapy in a subject comprising: (a) determining a level of PF4 in a first sample taken from a subject prior to treatment with an anti- angiogenic therapy; (b) determining a level of PF4 in a second sample taken from the subject after commencing treatment with the anti-angiogenic therapy; and (c) comparing the levels of PF4 determined in the first and second samples, wherein an increase in PF4 level in the second sample over that in the first sample indicates that the anti-angiogenic therapy is ineffective. The levels of PF4 at both time points are determined by the same method. The anti-angiogenic therapy is an agent that antagonizes VEGF or bFGF signaling, and the agent is an antibody against VEGF.
[0014] In one embodiment, the present invention provides a method of monitoring the efficacy of an anti-angiogenic therapy in a subject comprising: (a) determining at a first time point a level of PF4 in a sample taken from a subject undergoing treatment with an anti- angiogenic therapy; (b) determining at a second time point, after the first time point, a level of PF4 in a sample taken from the subject undergoing said anti-angiogenic therapy; and (c) comparing the levels of PF4 determined at the first and second time points, wherein an increase in the PF4 level at the second time point over that at the first time point indicates that the anti- angiogenic therapy is losing efficacy. The levels of PF4 at both time points are determined by the same method. The anti-angiogenic therapy is an agent that antagonizes VEGF or bFGF signaling, and the agent is an antibody against VEGF.
[0015] In one embodiment, the anti-angiogenic therapy is administered to treat a tumor.
[0016] In other embodiments, the anti-angiogenic therapy is administered to treat an angiogenic disease or disorder selected from the group consisting of: age-related macular degeneration; diabetic retinopathy; rheumatoid arthritis; Alzheimer's disease; obesity and endometriosis.
[0017] In some embodiments, the anti-angiogenic therapy can comprise an agent that antagonizes VEGF or bFGF signaling. In one embodiment, the agent is an antibody against VEGF.
[0018] In one embodiment, the present invention provides a method of monitoring tumor status in a subject comprising: (a) determining at a first time point a level of PF4 in a sample taken from a subject who is in cancer remission; (b) determining at a second time point, after the first time point, a level of PF4 in a sample taken from the subject; and (c) comparing the levels of PF4 determined at the first and second time points, wherein an increase in the PF4 level at the
12751790 2 4
second time point over that at the first time point indicates that an angiogenic tumor is present. The levels of PF4 at both time points are determined by the same method. The anti-angiogenic therapy is an agent that antagonizes VEGF or bFGF signaling, and the agent is an antibody against VEGF.
[0019] In one embodiment, the sample from which PF4 is determined is selected from the group consisting of whole blood, serum, plasma, platelets and megakaryocytes. For each methods described herein, the first and second samples used for PF4 determination and comparison are of the same type, for example, both samples are whole blood or both samples are isolated platelets.
[0020] In one embodiment, the time spans between the first and second time points of
PF4 determination are 1, 2 or 3 months apart. In other embodiments, the time spans between the first and second time points of PF4 determination can be 6 months, 1 year or 2 years apart.
[0021] In one embodiment, the anti-angiogenic therapy is an agent that antagonizes
VEGF or bFGF signaling.
[0022] In another embodiment, the agent is an antibody directed against VEGF.
[0023] In one embodiment of any of the methods described herein, the level of PF4 is determined by an antibody-based moiety method, by quantitative RT-PCR or by mass spectrometry.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 is a block diagram showing an exemplary system for the monitoring efficacy of anti-tumor/anti-angiogenic therapy and/or monitoring tumor recurrence.
[0025] Figure 2 is an exemplary set of instructions on a computer readable storage medium for use with the systems described herein.
[0026] Figure 3 shows the platelet pro-angiogenic and anti-angiogenic factors profiles of human subject 1 and human subject 5 over time after surgery and during treatment.
[0027] Figure 4 shows the platelet pro-angiogenic and anti-angiogenic factors profiles of human subject 10 and human subject 12 over time after surgery and during treatment.
12751790 2
[0028] Figure 5 shows the platelet pro-angiogenic and anti-angiogenic factors profiles of human subject 15 and human subject 23 over time after surgery and during treatment.
[0029] Figure 6 shows the platelet pro-angiogenic and anti-angiogenic factors profiles of human subject 26 and human subject 35 over time after surgery and during treatment.
DETAILED DESCRIPTION OF THE INVENTION
[0030] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Definitions of common terms in hematology, oncology, and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 18th Edition, published by Merck Research Laboratories, 2006 (ISBN 0-911910-18-2); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632- 02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); The ELISA guidebook (Methods in molecular biology 149) by Crowther J. R. (2000); Fundamentals of RIA and Other Ligand Assays by Jeffrey Travis, 1979, Scientific Newsletters; and Immunology by Werner Luttmann, published by Elsevier, 2006.
[0031] It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.
[0032] The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, "e.g." is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example."
[0033] All patents and other publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described
12751790 2
in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
Definitions of terms
[0034] As used herein, the term "tumor" means a mass of transformed cells that are characterized, at least in part, by containing angiogenic vasculature. The transformed cells are characterized by neoplastic uncontrolled cell multiplication which is rapid and continues even after the stimuli that initiated the new growth have ceased. The term "tumor" is used broadly to include the tumor parenchymal cells as well as the supporting stroma, and it includes the angiogenic blood vessels that infiltrate the tumor parenchymal cell mass. Although a tumor generally is a malignant tumor, i.e., a cancer having the ability to metastasize (i.e. a metastatic tumor), a tumor also can be nonmalignant (i.e. non-metastatic tumor). Tumors are hallmarks of cancer, a neoplastic disease the natural course of which is fatal. Cancer cells exhibit the properties of invasion and metastasis and are highly anaplastic.
[0035] As used herein, the term "metastases" or "metastatic tumor" refers to a secondary tumor that grows separately elsewhere in the body from the primary tumor and has arisen from detached, transported cells, wherein the primary tumor is a solid tumor. The primary tumor, as used herein, refers to a tumor that originated in the location or organ in which it is present and did not metastasize to that location from another location.
[0036] As used herein, a "malignant tumor" is one having the properties of invasion and metastasis and showing a high degree of anaplasia. Anaplasia is the reversion of cells to an immature or a less differentiated form, and it occurs in most malignant tumors.
[0037] As used herein, the term "recurrence" of a tumor refers to the enlargement of an existing tumor whose growth had stopped or reduced during an anti- angiogenic therapy, or the emergence of a tumor at the original (primary) site of tumor discovery after the original tumor had been excised. The recurrence of a tumor can also mean new tumor growth(s) of the same tumor type as the original tumor at a site different from the original site of tumor discovery. This
12751790 2
can be an indication that the original primary tumor has spread to other locations, or the primary tumor has emerged as an anti-angiogenic resistant form.
[0038] As used herein, the term "resistance" of tumor to an anti-angiogenic therapy refers to tumor and cancer cells' ability to escape the killing effects of the therapy, thereby survive against the anti-angiogenic therapy and eventually continue to grow. When tumor growth is resumed, recurrence of a tumor or cancer can happen.
[0039] As used herein, the term "antibody-based binding moiety" or "antibody" includes immunoglobulin molecules and immunologically active determinants of immunoglobulin molecules, e.g., molecules that contain an antigen binding site which specifically binds (immunoreacts with) to PF4. The term "antibody-based binding moiety" is intended to include whole antibodies, e.g., of any isotype (IgG, IgA, IgM, IgE, etc), and includes fragments thereof which are also specifically reactive with PF4. Antibodies can be fragmented using conventional techniques. Thus, the term includes segments of proteolytically-cleaved or recombinantly- prepared portions of an antibody molecule that are capable of selectively reacting with PF4. Non limiting examples of such proteolytic and/or recombinant fragments include Fab, F(ab')2, Fab' , Fv, dAbs and single chain antibodies (scFv) containing a VL and VH domain joined by a peptide linker. ScFv' s can be covalently or non-covalently linked to form antibodies having two or more binding sites. Thus, "antibody-based binding moiety" includes polyclonal, monoclonal, or other purified preparations of antibodies and recombinant antibodies. The term "antibody- based binding moiety" is further intended to include humanized antibodies, bispecific antibodies, and chimeric molecules having at least one antigen binding determinant derived from an antibody molecule. In a preferred embodiment, the antibody-based binding moiety is detectably labeled.
[0040] "Labeled antibody", as used herein, includes antibodies that are labeled by a detectable means and include, but are not limited to, antibodies that are enzymatically, radioactively, fluorescently, or chemiluminescently labeled. Antibodies can also be labeled with a detectable tag, such as c-Myc, HA, VSV-G, HSV, FLAG, V5, or HIS. The detection and quantification of PF4 present in the samples correlate with the intensity of the signal emitted from the detectably labeled antibody.
[0041] As used herein, the term "anti-angiogenic" refers to reducing the growth of new blood vessels or angio genesis.
12751790 2
[0042] As used herein, the term "anti-angiogenesis" refers to the prevention or inhibition of the growth of new blood vessels.
[0043] As used herein, the terms "treat" and "treatment" refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow the development or spread of cancer. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. "Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already diagnosed with cancer as well as those likely to develop secondary tumors due to metastasis.
[0044] As used herein, the term "anti-angiogenic therapy" or "anti- angiogenic treatment" refers to the use of drugs or other substances to stop cancerous tumors from developing new blood vessels, to thereby prevent continued growth of the tumor. Anti-angiogenic therapy also refers to the use of drugs or other substances to stop the development of aberrant new blood vessels in conditions such as rheumatoid arthritis and diabetic retinopathy.
[0045] As used herein, the term "angiogenesis" refers to the sprouting of new blood vessels from pre-existing blood vessels, characterized by endothelial cell proliferation and migration triggered by pro-angiogenic factors. Angiogenesis can be a good and necessary process, for example, in wound healing, or it can be an aberrant and undesired process with detrimental consequences, such as the growth of solid tumors and metastasis, and hemangiomas. Aberrant angiogenesis can lead to certain pathological conditions such as death, blindness, and disfigurement.
[0046] As used herein, the term "pro-angiogenic factors" refers to factors that directly or indirectly promote new blood vessels formation. These factors can be expressed and secreted by normal and tumor cells. In one embodiment, the pro-angiogenic factors include, but are not limited to EGF, E-cadherin, VEGF, angiogenin, angiopoietin-1, fibroblast growth factors: acidic (aFGF) and basic (bFGF), fibrinogen, fibronectin, heparanase, hepatocyte growth factor (HGF), insulin-like growth factor- 1 (IGF-I), IGF, BP-3, PDGF, VEGF-A VEGF-C, pigment epithelium-derived factor (PEDF), vitronection, leptin, trefoil peptides (TFFs), CYR61 (CCNl) and NOV (CCN3), leptin, midkine, placental growth factor platelet-derived endothelial cell growth factor (PD-ECGF), platelet-derived growth factor-BB (PDGF-BB), pleiotrophin (PTN),
12751790 2
progranulin, proliferin, transforming growth factor-alpha (TGF-alpha), transforming growth factor-beta (TGF-beta), tumor necrosis factor-alpha (TNF-alpha), c-Myc, granulocyte colony- stimulating factor (G-CSF), stromal derived factor 1 (SDF-I), scatter factor (SF), osteopontin, stem cell factor (SCF), matrix metalloproteinases (MMPs), thrombospondin-1 (TSP-I), and inflammatory cytokines and chemokines that are inducers of angiogenesis and increased vascularity, eg. CCL2 (MCP-I), interleukin-8 (IL-8) and CCL5 (RANTES).
[0047] As used herein, the term "angiogenesis-dependent disease or disorder" refers to diseases or disorders that are dependent on a rich blood supply and blood vessel proliferation for the diseases' pathological progression (e.g. metastatic tumors) or diseases or disorders that are the direct result of aberrant blood vessel proliferation (e.g. diabetic retinopathy and hemangiomas). Examples include abnormal vascular proliferation, ascites formation, psoriasis, age-related macular degeneration, thyroid hyperplasia, preeclampsia, rheumatoid arthritis and osteoarthritis, Alzheimer's disease, obesity, pleural effusion, atherosclerosis, endometriosis, diabetic/other retinopathies, ocular neovascularizations such as neovascular glaucoma and corneal neovascularization.
[0048] As used herein the term "VEGF inhibitors" refers to any compound or agent that produces a direct or indirect effect on the VEGF signaling pathways that promote growth, proliferation and survival of a cell by inhibiting the function of the VEGF protein, including inhibiting the function of VEGF receptor proteins. The term "agent" or "compound" as used herein means any organic or inorganic molecule, including but not limited to modified and unmodified nucleic acids such as antisense nucleic acids, RNAi agents such as siRNA or shRNA, peptides, peptidomimetics, receptors, ligands, and antibodies. The siRNAs are targeted at components of the VEGF pathways and can inhibit the VEGF pathway. Preferred VEGF inhibitors, include for example, AVASTIN® (bevacizumab), an anti-VEGF monoclonal antibody of Genentech, Inc. of South San Francisco, CA, VEGF Trap (Regeneron / Aventis). Additional VEGF inhibitors include CP-547,632 (3-(4-Bromo-2,6-difluoro- benzyloxy)-5-[3-(4-pyrrolidin 1-yl- butyl)-ureido]-isothiazole-4- carboxylic acid amide hydrochloride; Pfizer Inc. , NY), AG13736, AG28262 (Pfizer Inc.), SU5416, SUl 1248, & SU6668 (formerly Sugen Inc., now Pfizer, New York, New York), ZD-6474 (AstraZeneca), ZD4190 which inhibits VEGF-R2 and - Rl (AstraZeneca), CEP-7055 (Cephalon Inc., Frazer, PA), PKC 412 (Novartis), AEE788 (Novartis), AZD-2171), NEXA V AR® (BAY 43-9006, sorafenib; Bayer Pharmaceuticals and Onyx Pharmaceuticals), vatalanib (also known as PTK-787, ZK-222584: Novartis & Schering: AG), MACUGEN® (pegaptanib octasodium, NX-1838, EYE-001, Pfizer Inc./Gilead/Eyetech),
12751790 2 10
IM862 (glufanide disodium, Cytran Inc. of Kirkland, Washington, USA), VEGFR2- selective monoclonal antibody DClOl (ImClone Systems, Inc.), angiozyme, a synthetic ribozyme from Ribozyme (Boulder, Colorado) and Chiron (Emeryville, California), Sirna-027 (an siRNA-based VEGFRl inhibitor, Sirna Therapeutics, San Francisco, CA) Caplostatin, soluble ectodomains of the VEGF receptors, Neovastat (Sterna Zentaris Inc; Quebec City, CA), ZM323881 (CalBiochem. CA, USA), pegaptanib (MACUGEN®) (Eyetech Pharmaceuticals), an anti-VEGF aptamer and combinations thereof.
[0049] As used herein the term "an increase in platelet-derived PF4" refers to an increase of at least two fold and preferably an increase of at least two to ten fold or more of platelet- derived PF4 in a second sample compared to the platelet-derived PF4 level obtained in a first sample. The first sample is taken preceding the second sample, and the times at which the first and second samples are taken are separated by a span of time. The span of time can be 1 month, 2 months, 3 months, 6 months or 1 year or more.
[0050] As used herein the term "a decrease in platelet-derived PF4" refers to a decrease of at least 25% and preferably a decrease of at least 35%, 45%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or even 100% (no PF4 present) of platelet-derived PF4 in a second sample compared to the platelet-derived PF4 level obtained in a first sample. The first sample is taken preceding the second sample, and time at which the first and second samples were taken is separated by a span of time. The span of time can be 1 month, 2 months, 3 months, 6 months or 1 year or more.
[0051] As used herein the term "a change in platelet-derived PF4" refers to an increase of at least two-fold or a decrease of at least 25% and preferably an increase of at least two to ten fold or more, or a decrease of at least 35%, 45%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or even 100% of platelet-derived PF4 in a second sample compared to the platelet-derived PF4 level obtained in a first sample. The first sample is taken preceding the second sample, and time at which the first and second samples were taken is separated by a span of time. The span of time can be 1 month, 2 months, 3 months, 6 months or 1 year or more.
[0052] As used herein, the term "comprising" means that other elements can also be present in addition to the defined elements presented. The use of "comprising" indicates inclusion rather than limitation.
[0053] The term "consisting of" refers to methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
12751790 2 1 1
[0054] Embodiments of the present invention are based on the discovery that pro- angiogenic factors (e.g. VEGF) increase platelet-associated factor 4 (also known as platelet factor 4 or PF4) in platelets. Accordingly, an anti-angiogenic factor can inhibit this increase in platelet-derived PF4 in platelets that is a result of pro-angiogenic factors. Accordingly, relative changes of the platelet-derived PF4 in platelets can be indicators of changes in the presence or activity of pro-angiogenic factors. In other words, PF4 can function as a biomarker for the level/ presence of pro-angiogenic factors in the body. For example, an increase in platelet-derived PF4 can indicate an increased amount of angiogenic factor(s). Likewise, a drop in platelet-derived PF4 can indicate a drop in the amount of angiogenic factor(s) and /or a drop in the signaling derived from the pro-angiogenic pathway(s) as inhibited by anti-angiogenic factor(s).
[0055] The inventors have discovered that in addition to platelet-derived PF4 in platelets being up-regulated in the presence of angiogenic factors such as VEGF, platelet-derived PF4 up- regulation correlates with the presence of microscopic tumors in vivo. For example, after xerografts of human liposarcoma, mammary adenocarcinoma, and oestosarcoma were implanted in mice, there was a time-dependent increase in the amount of platelet-derived PF4 due to the induction of angiogenic factors by and from these tumors. In other words, as the xenografts of human liposarcoma, mammary adenocarcinoma, and oestosarcoma grew in these mice, there was a steady increase in the amount of platelet-derived PF4 detected in the mice over time. Since this increase in platelet-derived PF4 was observed for several different types of tumors with differing tissue origin, this change in platelet-derived PF4 can be applicable to across a spectrum of human cancers.
[0056] While not wishing to be bound by theory, when a tumor gradually develops resistance to the anti-angiogenic therapy, for example, via bypassing the VEGF pathway through the expression of additional angiogenic factors, the platelet-derived PF4 will increase. For example, when resistance to anti-angiogenic therapy, such as anti-VEGF, bevacizumab (AVASTIN®) anti-angiogenic therapy develops, the platelet-derived PF4 will increase. Since platelet-derived PF4 increase is dependent on the presence of angiogenic factors and not on any specific type of tumor, monitoring platelet-derived PF4 fluxes in platelets and megakaryocytes can be used globally for determining the efficacy of the anti-angiogenic therapy in all cancer and tumor types. Hence, platelet-derived PF4 fluxes in platelets and megakaryocytes over time can be used as an indicator, for monitoring the efficacy of an anti-angiogenic therapy in cancer treatment. Measurement of platelet-derived PF4 fluxes can also be used for surveillance of the development of resistance to anti-angiogenic therapy.
12751790 2 12
[0057] Platelets are cellular fragments that have budded off from the much larger megakaryocytes and comprise many cellular components except a nucleus. Platelets are characterized by alpha granules containing growth factors which are released when the platelets are activated.
[0058] Platelet-derived PF4 is a 70-amino acid protein that is released from the alpha- granules of activated platelets and binds with high affinity to heparin. Platelet factor-4 is also known by the terms platelet factor-4, CXCL4, PF-4, PF4, Iroplact, Onco statin- A, SCYB4, and MGC138298. Its major physiologic role appears to be neutralization of heparin-like molecules on the endothelial surface of blood vessels, thereby inhibiting local antithrombin III activity and promoting coagulation. As a strong chemoattractant for neutrophils and fibroblasts, PF4 probably has a role in inflammation and wound repair. Oncostatin-A is a member of the CXC chemokine family. Human PF4 is used to differentiate heparin-induced thrombocytopenia. The Entrez Gene symbol is PF4, the Entrez Gene official full name is "platelet factor 4 (chemokine (C-X-C motif) ligand 4)"; the Genbank Accession number for the human platelet factor-4 is NM_002619 and the protein ID is NP_002610.
[0059] In one embodiment, the determination of the efficacy of an anti-angiogenic therapy in the treatment of a pathological angiogenic disease or disorder can be achieved by monitoring the platelet-derived PF4 in platelets before and after initiation of the therapy as well as throughout the time course of the therapy. Comparison of platelet-derived PF4 in platelets obtained at different time periods with platelet-derived PF4 in platelets from one or more earlier time periods can be made. In the course of an effective anti-angiogenic therapy, the platelet- derived PF4 level should continue to decrease over time as the therapy progresses. This platelet- derived PF4 decrease is taken as an indication that the anti-angiogenic therapy is effective in inhibiting angiogenesis, e.g. by suppressing positive factors that tend to activate PF4 expression or accumulation. However, if during the course of the therapy, the trend shows an increase in the platelet-derived PF4 level, often a gradual increase, this is taken to indicate that the anti- angiogenic therapy is losing or has lost its effectiveness. There is a resurgence of pro-angiogenic factors that can promote pathological angiogenesis again. The resurgence of pro-angiogenic factors can include an increase in the expression of the pro-angiogenic factors other than the target of the prescribed anti-angiogenic therapy. For example, the prescribed angiogenic therapy comprises the anti-VEGF, bevacizumab (AVASTIN®) which targets the ligand VEGF. A resurgence of pro-angiogenic factors can include the increase in expression of bFGF and PDGF
12751790 2 13
for which bevacizumab does not inhibit. An increase in expression of bFGF and PDGF can promote re-growth of any existing tumor cells.
[0060] In one embodiment, disclosed herein is a method of monitoring the efficacy of an anti- angiogenic therapy in a subject comprising: (a) determining a level of platelet-derived PF4 in a first sample taken from a subject prior to treatment with an anti- angiogenic therapy; (b) determining a level of platelet-derived PF4 in a second sample taken from the subject after commencing treatment with the anti-angiogenic therapy; and (c) comparing the levels of platelet-derived PF4 determined in the first and second samples, wherein an increase in platelet- derived PF4 level in the second sample over that in the first sample indicates that the anti- angiogenic therapy is ineffective. At the first time point, the subject has been diagnosed to have at least a tumor in the body but has not received any anti-angiogenic therapy. The methods of confirming presence of a tumor include but are not limited to imaging, tissue biopsy, histology, measurements of tumor-related biomarkers and combinations thereof. The first sample becomes a reference sample to which all subsequent samples' platelet-derived PF4 level from the same subject can be compared.
[0061] In one embodiment, the increase in platelet-derived PF4 level in the second sample taken from a subject after commencing treatment with the anti-angiogenic therapy is at least two or more fold over the platelet-derived PF4 level in the first sample taken from a subject prior to treatment with an anti-angiogenic therapy, that is the platelet-derived PF4 can be at least
2X, 3X, 4X, 5X, 10X...or more over the platelet-derived PF4 level in the first sample. Such levels are indicative of the anti-angiogenic therapy having become ineffective.
[0062] While it is preferable to make a first measurement of the platelet-derived PF4 before commencing an angiogenic therapy after the positive diagnosis of cancer, the methods disclosed herein are also applicable to situations where an angiogenic therapy has been initiated. One would still expect the platelet-derived PF4 levels to reflect the levels of pro-angiogenic factors. Thus an increase in platelet-derived PF4 at any time during the anti-angiogenic therapy would indicate an adverse change of angiogenic state, a recurrence of tumor growth and a likely emergence of a resistant tumor phenotype.
[0063] In another embodiment, disclosed herein is a method of monitoring the efficacy of an anti-angiogenic therapy in a subject, comprising: (a) determining at a first time point a level of platelet-derived PF4 in a sample taken from a subject undergoing treatment with an anti- angiogenic therapy; (b) determining at a second time point, after the first time point, a level of
12751790 2 14
platelet-derived PF4 in a sample taken from the subject undergoing the anti-angiogenic therapy; and (c) comparing the levels of platelet-derived PF4 determined at the first and second time points, wherein an increase in the platelet-derived PF4 level at the second time point over that at the first time point indicates that the anti-angiogenic therapy is losing efficacy. At this first time point, the subject has been diagnosed to have at least a tumor in the body and has received anti- angiogenic therapy for at least one month. This first sample becomes a reference sample to which all subsequent samples' platelet-derived PF4 level from the same subject can be compared.
[0064] In one embodiment, the increase in platelet-derived PF4 level in a second sample taken from a subject undergoing treatment with an anti-angiogenic therapy is at least two or more fold over the platelet-derived PF4 level in the first sample taken from the same subject undergoing treatment with the anti-angiogenic therapy, that is the platelet-derived PF4 can be
2X, 3X, 4X, 5X, 1OX or more over the platelet-derived PF4 level in the first sample. Such levels are indicative of the anti-angiogenic therapy having become ineffective.
[0065] In another embodiment, changes in the level of platelet-derived PF4 can also be used to monitor the recurrence of cancerous tumor cells in a patient who is in remission after completion of an anti-angiogenic therapy and/or other anti-cancer therapies or combinations thereof. Determination of recurrence of a tumor or cancer is mostly done at present by imaging and/or by surveillance of the respective biomarkers. Changes in the level of platelet-derived PF4 can indicate a recurrence of a tumor before the tumor has grown large enough to be detected by routine imaging and in tumor types where there are no specific biomarkers. Accordingly, disclosed herein is a method of assessing the recurrence of a tumor in subject, comprising: (a) determining at a first time point a level of platelet-derived PF4 in a sample taken from a subject who is in cancer remission; (b) determining at a second time point, after the first time point, a level of platelet-derived PF4 in a sample taken from the subject who is in cancer remission; and (c) comparing the levels of platelet-derived PF4 determined at the first and second time points, wherein an increase in the platelet-derived PF4 level at the second time point over that at the first time point indicates that a tumor has recurred. At the first time point, the subject had previously been diagnosed to have at least a tumor in the body, had received at least one anti- angiogenesis therapy, and the tumors have regressed or surgically removed such that no tumor is undetectable by standard methods and tests, e.g. biomarkers screening, scans and x-rays. This first sample becomes a reference sample to which all subsequent samples' platelet-derived PF4
12751790 2 15
level from the same subject can be compared, for example, with samples after commencing the second or subsequent anti-angiogenic therapy.
[0066] In one embodiment, the increase in platelet-derived PF4 level in the second sample taken from a subject who is in remission is at least two or more fold over the platelet- derived PF4 level in the first sample taken from the same subject in remission, that is the PF4 can be 2X, 3X, 4X, 5X, 1OX or more over the platelet-derived PF4 level in the first sample.
Such levels are indicative of the recurrence of a tumor.
[0067] In one embodiment of each of the aspects described herein, the subject that is about to commence an anti-angiogenic therapy is a mammal, such as a dog, a cat, a horse, or a human, preferably a human. In another embodiment of each of the aspects described herein, the subject that is undergoing treatment with an anti-angiogenic therapy is a mammal, preferably a human. In another embodiment of each of the aspects described herein, the subject that is in remission after undergoing treatment with an anti-angiogenic therapy is a mammal, preferably a human. The terms "subject" and "patient" are used interchangeably herein to refer to the same thing.
[0068] In one embodiment of each of the aspects described herein, the samples taken from a subject for the determination of platelet-derived PF4 levels are selected from the group consisting of whole blood, serum, plasma, platelets and megakaryocytes. Collections of samples can be performed by methods well known to those skilled in the art. In another embodiment of each of the aspects described herein, the first and second samples must be from the same group, for example, the first and second samples collected are plasma, and platelet-derived PF4 levels are determined from these plasma samples.
[0069] In one embodiment of each of the aspects described herein, the first and second time points are about 1, 2 or 3 months apart. In another embodiment, the first and second time points can be about 6 months, 1 year or 2 years apart.
[0070] In one embodiment of any of the methods described herein, the level of PF4 is determined by an antibody-based method wherein the sample containing PF4 to be measured is contacted with an anti-PF4 antibody-based moiety, wherein an antibody-PF4 complex in formed and wherein the complex in then detected. Examples of antibody-based methods include but are not limited to ELISA and Western blots.
12751790 2 16
[0071] In one embodiment of any of the methods described herein, the level of PF4 is determined by quantitative RT-PCR wherein the expression level of PF4, mRNA is measured. Specifically, the amount of PF4 mRNA is quantitatively amplified by PCR.
[0072] In one embodiment of any of the methods described herein, the level of PF4 is determined by mass spectrometry.
Sample preparation
[0073] The patient' s blood can be drawn directly into anti-coagulants containing citrate,
EDTA, PGE, and theophylline to avoid release of PF4 from residual platelets. The whole blood should be separated into the plasma portion, the cells, and platelets portion by refrigerated centrifugation at 3500 g, 2 minutes. Since platelets have a tendency to adhere to glass, it is preferred that the collection tube be siliconized. After centrifugation, the supernatant is the plasma. The plasma is filtered though a 0.2 μm filter to remove residual platelets and is kept at - 2O0C before the plasma PF4 concentration is measured.
[0074] Alternately, the serum can be collected from the whole blood. Collect the blood in a hard plastic or glass tube; blood will not clot in soft plastic. Draw 15 mL of whole blood for 6 mL of serum. The whole blood is allowed to stand at room temperature for 30 minutes to 2 hours until a clot has formed. Carefully separate clot from the sides of the container using a glass rod or wooden applicator stick and leave overnight at 40C. After which, decant serum, centrifuge, and/or using a Pasteur pipette, remove serum into a clean tube. Clarify the serum by centrifugation at 2000-3000 rpm for 10 minutes. The serum is stored at -20° or -8O0C before the PF4 concentration is measured. Detailed described of obtaining serum using collection tubes can be found in U. S. Patent No. 3,837,376 and is incorporated by reference. Blood collection tubes can also be purchased from BD Diagnostic Systems, Greiner Bio-One, and Kendall Company.
[0075] In one embodiment, platelets can be separated from whole blood and the PF4
(protein and/or mRNA levels) in platelets is determined. When whole blood is centrifuged as described herein to separate the blood cells from the plasma, a pellet is formed at the end of the centrifugation, with the plasma above it. Centrifugation separates out the blood components (red blood cells, white blood cells, and platelets) by their various densities. The red blood cells (RBCs) are denser and will be the first to move to the bottom of the collection/centrifugation tube, followed by the smaller white blood cells, and finally the platelets. The plasma fraction is the least dense and is found on top of the pellet. The "buffy coat" which contains the majority of
12751790 2 17
platelets will be sandwiched between the plasma and above the RBCs. Centrifugation of whole blood (with anti-coagulant, PGE and theophylline) can produce an isolated a platelet rich "buffy coat" that lies just above the buoy. The buffy coat contains the concentrated platelets and white blood cells.
[0076] In another embodiment, platelets can be separated from blood according to methods described in United States Patent No. 4,656,035 using lectin to agglutinate the platelets in whole blood. Alternatively, the methods and apparatus described in United States Patent No. 7,223,346 can be used involving a platelet collection device comprising a centrifugal spin- separator container with a cavity having a longitudinal inner surface in order to collect the "buffy coat" enriched with platelets after centrifugation. As another alternative, the methods and apparatus as described in WO/2001/066172 can be used. Each of these is incorporated by reference herein in their entirety.
[0077] In another embodiment, platelets can be isolated by the two methods described in
A. L. Copley and R. B. Houlihan, Blood, 1947, 2:170-181, which is incorporated by reference herein in its entirety. Both methods are based on the principle that the platelet layer can be obtained by repeated fractional centrifugation.
[0078] The whole blood can be first separated into platelet-rich plasma and cells (white and red blood cells). Platelet rich plasma (PRP) can be isolated from the blood centrifugation of citrated whole blood at 200 g for 20 minutes. The platelet rich plasma is then transferred to a fresh polyethylene tube. This PRP is then centrifuged at 800 g to pellet the platelets and the supernatant (platelet poor plasma [PPP]) can be saved for analysis by ELIZA at a later stage. Platelets can be then gently re-suspended in a buffer such as Tyrodes buffer containing lU/ml PGE2 and pelleted by centrifugation again. The wash can be repeated twice in this manner before removing the membrane fraction of platelets by centrifugation with Triton X, and lysing the pellet of platelet for platelet-derived PF4 analyses. Platelets can be lysed using 50 mM Tris HCL, 100-120 mM NaCl, 5 mM EDTA, 1% Igepal and Protease Inhibitor Tablet (complete TM mixture, Boehringer Manheim, Indianopolis, IN). For the analysis of PF4 mRNA, the pellet of platelets can be dissolved in TRIZOL® immediately after separation from the plasma.
[0079] For the measurement of PF4 expression, the whole blood and/or pelleted cells or platelets can be processed for mRNA analysis using TRIZOL® extraction (Gibco BRL Cat# 15596-026) with methods known in one skilled in the art. Methods for isolating RNA are described in detail in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring
12751790 2 18
Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (1982); Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., USA (1989); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1986); and Current Protocols in Molecular Biology (CPMB) (Fred M. Ausubel, et al. ed., John Wiley and Sons, Inc.), which are all incorporated by reference herein in their entireties. The dissolved RNA is stored at -2O0C before the PF4 mRNA is measured.
[0080] In one embodiment, the platelets and plasma are prepared according to Cervi, D. et al., 2008, Blood, 111:1201-7, which is herein incorporated by reference in its entirety.
Determining the level of PF4 protein
[0081] In one embodiment, the levels of the PF4 protein can be measured by contacting the PF4-containing sample with an antibody-based binding moiety that specifically binds to PF4. Formation of the antibody-PF4 complex is then detected by a variety of methods known in the art.
[0082] In one embodiment, the antibody-based binding moiety is detectably labeled by linking the antibody to an enzyme. The enzyme, in turn, when exposed to its substrate, will react with the substrate in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorometric or by visual means. Enzymes which can be used to detectably label the antibodies that specifically binds PF4 include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-V-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose- VI-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.
[0083] Detection can also be accomplished using any of a variety of other immunoassays. For example, by radioactively labeling an antibody, it is possible to detect the antibody through the use of radioimmune assays. The radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by audioradiography. Isotopes which are particularly useful for the purpose of the present invention are 3H, 131I, 35S, 14C, and preferably 125I.
12751790 2 19
[0084] In addition, it is also possible to label an antibody with a fluorescent compound.
When the fluorescently labeled antibody is exposed to light of the proper wavelength, its presence can then be detected due to fluorescence. Among the most commonly used fluorescent labeling compounds are CYE dyes, fluorescein isothiocyanate, rhodamine, phycoerytherin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.
[0085] An antibody can also be detectably labeled using fluorescence emitting metals such as 152Eu, or others of the lanthanide series. These metals can be attached to the antibody using such metal chelating groups as diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
[0086] An antibody also can be detectably labeled by coupling it to a chemiluminescent compound. The presence of the chemiluminescent-antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, luciferin, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
[0087] As mentioned above, the level of PF4 can be detected by immunoassays, such as enzyme linked immunoabsorbent assay (ELISA), radioimmunoassay (RIA), immunoradiometric assay (IRMA), Western blotting, immunocytochemistry or immunohistochemistry, each of which are described in more detail below. Immunoassays such as ELISA or RIA, which can be extremely rapid, are more generally preferred. Antibody arrays or protein chips can also be employed, see for example U.S. Patent Application Nos: 20030013208 Al; 20020155493A1; 20030017515 and U.S. Patent Nos: 6,329,209; 6,365,418, which are herein incorporated by reference in their entirety.
Immunoassays
[0088] The most common enzyme immunoassay is the "Enzyme-Linked Immunosorbent
Assay (ELISA)." ELISA is a technique for detecting and measuring the concentration of an antigen using a labeled (e.g. enzyme linked) form of the antibody. There are different forms of ELISA, which are well known to those skilled in the art. The standard techniques known in the art for ELISA are described in "Methods in Immunodiagnosis", 2nd Edition, Rose and Bigazzi, eds. John Wiley & Sons, 1980; Campbell et al., "Methods and Immunology", W. A. Benjamin, Inc., 1964; and Oellerich, M. 1984, J. Clin. Chem. Clin. Biochem., 22:895-904.
12751790 2 20
[0089] In a "sandwich ELISA", an antibody (e.g. anti-PF4 etc.) is linked to a solid phase
(i.e. a microtiter plate) and exposed to a biological sample containing antigen (e.g. PF4). The solid phase is then washed to remove unbound antigen. A labeled antibody (e.g. enzyme linked) is then bound to the bound-antigen (if present) forming an antibody- antigen- antibody sandwich. Non-limiting examples of enzymes that can be linked to the antibody are alkaline phosphatase, horseradish peroxidase, luciferase, urease, and B-galactosidase. The enzyme linked antibody reacts with a substrate to generate a colored reaction product that can be measured.
[0090] In a "competitive ELISA", antibody is incubated with a sample containing antigen (e.g. PF4). The antigen- antibody mixture is then contacted with a solid phase (e.g. a microtiter plate) that is coated with antigen (e.g., PF4). The more antigen present in the sample, the less free antibody that will be available to bind to the solid phase. A labeled (e.g., enzyme linked) secondary antibody is then added to the solid phase to determine the amount of primary antibody bound to the solid phase.
[0091] In an "immunohistochemistry assay" a section of tissue is tested for specific proteins by exposing the tissue to antibodies that are specific for the protein that is being assayed. The antibodies are then visualized by any of a number of methods to determine the presence and amount of the protein present. Examples of methods used to visualize antibodies are, for example, through enzymes linked to the antibodies (e.g., luciferase, alkaline phosphatase, horseradish peroxidase, or beta-galactosidase), or chemical methods (e.g., DAB/Substrate chromagen). The sample is then analysed microscopically, most preferably by light microscopy of a sample stained with a stain that is detected in the visible spectrum, using any of a variety of such staining methods and reagents known to those skilled in the art.
[0092] Alternatively, "Radioimmunoassays" can be employed. A radioimmunoassay is a technique for detecting and measuring the concentration of an antigen using a labeled (e.g.. radioactively or fluorescently labeled) form of the antigen. Examples of radioactive labels for antigens include 3H, 14C, and 125I. The concentration of an antigen (e.g. PF4) in a biological sample is measured by having the antigen (e.g. PF4) in the biological sample compete with the labeled (e.g. radioactively) antigen (e.g. labeled PF4) for binding of an antibody to the antigen. To ensure competitive binding between the labeled antigen and the unlabeled antigen, the labeled antigen is present in a concentration sufficient to saturate the binding sites of the antibody. The higher the concentration of antigen in the sample, the lower the concentration of labeled antigen that will bind to the antibody.
12751790 2 21
[0093] In a radioimmunoassay, to determine the concentration of labeled antigen bound to antibody, the antigen- antibody complex must be separated from the free antigen. One method for separating the antigen-antibody complex from the free antigen is by precipitating the antigen-antibody complex with an anti-isotype antiserum. Another method for separating the antigen-antibody complex from the free antigen is by precipitating the antigen- antibody complex with formalin-killed S. aureus. Yet another method for separating the antigen-antibody complex from the free antigen is by performing a "solid-phase radioimmunoassay" where the antibody is linked (e.g., covalently) to Sepharose beads, polystyrene wells, polyvinylchloride wells, or microtiter wells. By comparing the concentration of labeled antigen bound to antibody to a standard curve based on samples having a known concentration of antigen, the concentration of antigen in the biological sample can be determined.
[0094] An "Immunoradiometric assay" (IRMA) is an immunoassay in which the antibody reagent is radioactively labeled. An IRMA requires the production of a multivalent antigen conjugate by techniques such as conjugation to a protein e.g., rabbit serum albumin (RSA). The multivalent antigen conjugate must have at least 2 antigen residues per molecule and the antigen residues must be of sufficient distance apart to allow binding by at least two antibodies to the antigen. For example, in an IRMA the multivalent antigen conjugate can be attached to a solid surface such as a plastic sphere. Unlabeled "sample" antigen and antibody to antigen which is radioactively labeled are added to a test tube containing the multivalent antigen conjugate coated sphere. The antigen in the sample competes with the multivalent antigen conjugate for antigen antibody binding sites. After an appropriate incubation period, the unbound reactants are removed by washing and the amount of radioactivity on the solid phase is determined. The amount of bound radioactive antibody is inversely proportional to the concentration of antigen in the sample.
[0095] Normal human plasma PF4 is present at the nanomolar to micromolar concentrations. For example, the human plasma PF4 from unstimulated platelets, anticoagulated with citrate, contained ~8 ng/ml to 0.19 μg/mL of PF4. When platelets were aggregated and activated by the addition of either heparin, collagen alone, or collagen plus heparin, the plasma PF4 can increase to approximately 5 μg/mL of PF4.
[0096] The level of PF4 can be assayed with commercial radio-immuno assay (RIA) and ELISA that has a sensitivity of <2ng/ml. These assays take on average about 2-3 hours. Commercial ELISA kits for determining the amount of plasma PF4 can be found at R&D
12751790 2 22
Systems, catalog #DY795E; and from DiaPharma PF4, ELISA / RUO kit from DIAPHARMA® Catalog #: DPGR006A.
[0097] In one embodiment, PF4 is measured according the method of Schraw, T. and
Whiteheart, S., Transfusion, 2005, 45(5):717-724(8) which is hereby incorporated by reference. The method provides a sensitive, cost-effective, sandwich enzyme-linked immunosorbent assay (ELISA) developed with commercially available antibodies to human PF4. The method can be used for measuring PF4 from whole human platelets or secreted from activated platelets. This method has a maximal sensitivity of 10 pg and a dynamic quantitative range from 100 to 2500
Pg-
[0098] A competition radioimmunoassay was developed by Peter M. Newman and Beng
H. Chong (Blood, 2000, 96: 182-187) to measure the PF4 concentration in plasma, serum, and cell lysate derived from collected blood samples. Microtiter wells that could be individually separated (MaxiSorp-BreakApart; Nunc, Roskilde, Denmark) were coated with affinity-purified sheep anti-PF4 IgG and blocked with BSA. Dilutions of test plasma and purified PF4 standards (0-2 μg/mL) were prepared in a solution containing 1% BSA, 0.38% trisodium citrate, 10% ETP, and PBS-Tween. When the test plasma contained 0.5 U/mL heparin, the same heparin concentration was maintained throughout dilution of the test and standard PF4 solutions.
[0099] Standard or unknown PF4 solution (110 μL) was equilibrated for 30 minutes with an equal volume of 125I-PF4 solution (0.2 μg/mL, 4 KBq/mL) containing polybrene (50 μg/mL). One hundred microliters of PF4 mixture was incubated, in duplicate, for 15 minutes in the wells coated with anti-PF4 IgG. Wells were washed 3 times with PBS-Tween and then broken apart, and radioactivity was measured in a γ-counter. The PF4 concentration was determined by comparing counts with the appropriate standard curve, depending on the presence or absence of 0.5 U/mL heparin. The standard curve with heparin was shifted by 0.25 μg/mL to the right of the curve without heparin. The most sensitive region of the PF4 standard curve was 0.05 to 1 μg/mL PF4, and samples were diluted to fall within this range. Polybrene was required in this assay to prevent heparin from abolishing the binding between PF4 and antibody.
[0100] In one embodiment, PF4 protein and /or its mRNA levels in a sample can be determined by mass spectrometry such as MALDFIOF (time-of- flight), SELDI/TOF, liquid chromatography-mass spectrometry (LC-MS), gas chromatography- mass spectrometry (GC- MS), high performance liquid chromatography-mass spectrometry (HPLC-MS), capillary electrophoresis-mass spectrometry, nuclear magnetic resonance spectrometry, or tandem mass
12751790 2 23
spectrometry (e.g., MS/MS, MS/MS/MS, ESI-MS/MS, etc.). See for example, U.S. Patent Application Nos: 20030199001, 20030134304, 20030077616, which are herein incorporated by reference.
Mass spectrometry
[0101] Mass spectrometry methods are well known in the art and have been used to quantify and/or identify biomolecules, such as proteins (see, e.g., Li et al. (2000) Tibtech 18:151-160; Rowley et al. (2000) Methods 20: 383-397; and Kuster and Mann (1998) Curr. Opin. Structural Biol. 8: 393-400). Further, mass spectrometric techniques have been developed that permit at least partial de novo sequencing of isolated proteins. Chait et al., Science 262:89- 92 (1993); Keough et al., Proc. Natl. Acad. Sci. USA. 96:7131-6 (1999); reviewed in Bergman, EXS 88:133-44 (2000).
[0102] In certain embodiments, a gas phase ion spectrophotometer is used. In other embodiments, laser-desorption/ionization mass spectrometry is used to analyze the sample. Modern laser desorption/ionization mass spectrometry ("LDI-MS") can be practiced in two main variations: matrix assisted laser desorption/ionization ("MALDI") mass spectrometry and surface-enhanced laser desorption/ionization ("SELDI"). In MALDI, the analyte is mixed with a solution containing a matrix, and a drop of the liquid is placed on the surface of a substrate. The matrix solution then co-crystallizes with the biological molecules. The substrate is inserted into the mass spectrometer. Laser energy is directed to the substrate surface where it desorbs and ionizes the biological molecules without significantly fragmenting them. See, e.g., U.S. Pat. No. 5,118,937 (Hillenkamp et al.), and U.S. Pat. No. 5,045,694 (Beavis & Chait).
[0103] In SELDI, the substrate surface is modified so that it is an active participant in the desorption process. In one variant, the surface is derivatized with adsorbent and/or capture reagents that selectively bind the protein of interest. In another variant, the surface is derivatized with energy absorbing molecules that are not desorbed when struck with the laser. In another variant, the surface is derivatized with molecules that bind the protein of interest and that contain a photolytic bond that is broken upon application of the laser. In each of these methods, the derivatizing agent generally is localized to a specific location on the substrate surface where the sample is applied. See, e.g., U.S. Pat. No. 5,719,060 and WO 98/59361. The two methods can be combined by, for example, using a SELDI affinity surface to capture an analyte and adding matrix-containing liquid to the captured analyte to provide the energy absorbing material.
12751790 2 24
[0104] For additional information regarding mass spectrometers, see, e.g., Principles of
Instrumental Analysis, 3rd edition., Skoog, Saunders College Publishing, Philadelphia, 1985; and Kirk-Othmer Encyclopedia of Chemical Technology, 4.sup.th ed. Vol. 15 (John Wiley & Sons, New York 1995), pp. 1071-1094.
[0105] Detection and quantification of the PF4 protein will typically depend on the detection of signal intensity. This, in turn, can reflect the quantity and character of a polypeptide bound to the substrate. For example, in certain embodiments, the signal strength of peak values from spectra of a first sample and a second sample can be compared (e.g., visually, by computer analysis etc.), to determine the relative amounts of particular biomolecules. Software programs such as the Biomarker Wizard program (Ciphergen Biosystems, Inc., Fremont, Calif.) can be used to aid in analyzing mass spectra. The mass spectrometers and their techniques are well known to those of skill in the art.
Determining PF4 expression level by measuring mRNA
[0106] In one embodiment, the mRNA of PF4 in platelets can be determined by quantitative real-time PCT. Real time PCR is an amplification technique that can be used to determine levels of mRNA expression. (See, e.g., Gibson et al., Genome Research 6:995-1001, 1996; Heid et al., Genome Research 6:986-994, 1996). Real-time PCR evaluates the level of PCR product accumulation during amplification. This technique permits quantitative evaluation of mRNA levels in multiple samples. For mRNA levels, mRNA is extracted from a biological sample, e.g. whole blood, platelets, megakaryocytes etc, and cDNA is prepared using standard techniques. Real-time PCR can be performed, for example, using a Perkin Elmer/ Applied Biosystems (Foster City, Calif.) 7700 Prism instrument. Matching primers and fluorescent probes can be designed for genes of interest using, for example, the primer express program provided by Perkin Elmer/Applied Biosystems (Foster City, Calif.). Optimal concentrations of primers and probes can be initially determined by those of ordinary skill in the art, and control (for example, beta-actin) primers and probes can be obtained commercially from, for example, Perkin Elmer/ Applied Biosystems (Foster City, Calif.). To quantify the amount of the specific nucleic acid of interest in a sample, a standard curve is generated using a control. Standard curves can be generated using the Ct values determined in the real-time PCR, which are related to the initial concentration of the nucleic acid of interest used in the assay. Standard dilutions ranging from 10-106 copies of the gene of interest are generally sufficient. In addition, a standard curve is generated for the control sequence. This permits standardization of initial
12751790 2 25
content of the nucleic acid of interest in a tissue sample to the amount of control for comparison purposes.
[0107] Methods of real-time quantitative PCR using TaqMan probes are well known in the art. Detailed protocols for real-time quantitative PCR are provided, for example, for RNA in: Gibson et al., 1996, A novel method for real time quantitative RT-PCR. Genome Res., 10:995- 1001; and for DNA in: Heid et al., 1996, Real time quantitative PCR. Genome Res., 10:986-994.
[0108] The TaqMan based assays use a fluorogenic oligonucleotide probe that contains a
5' fluorescent dye and a 3' quenching agent. The probe hybridizes to a PCR product, but cannot itself be extended due to a blocking agent at the 3' end. When the PCR product is amplified in subsequent cycles, the 5' nuclease activity of the polymerase, for example, AmpliTaq, results in the cleavage of the TaqMan probe. This cleavage separates the 5' fluorescent dye and the 3' quenching agent, thereby resulting in an increase in fluorescence as a function of amplification (see, for example, www2.perkin-elmer.com).
[0109] PCR primers for amplifying the mRNA of PF4 should be about 15 -20 base-pairs long and anneal or complementary base-pair with the sequence of the human PF4 mRNA in found in Genbank Accession No.: NM_002619; 5'-
CCGCAGCATGAGCTCCGCAGCCGGGTTCTGCGCCTCACGCCCCGGGCTGCTGTTCCT
GGGGTTGCTGCTCCTGCCACTTGTGGTCGCCTTCGCCAGCGCTGAAGCTGAAGAAG
ATGGGGACCTGCAGTGCCTGTGTGTGAAGACCACCTCCCAGGTCCGTCCCAGGCAC
ATCACCAGCCTGGAGGTGATCAAGGCCGGACCCCACTGCCCCACTGCCCAACTGAT
AGCCACGCTGAAGAATGGAAGGAAAATTTGCTTGGACCTGCAAGCCCCGCTGTACA
AGAAAATAATTAAGAAACTTTTGGAGAGTTAGCTACTAGCTGCCTACGTGTGTGCA
TTTGCTATATAGCATACTTCTTTTTTCCAGTTTCAATCTAACTGTGAAAGAAACTTCT
GATATTTGTGTTATCCTTATGATTTTAAATAAACAAAATAAATC-S' (SEQ. ID. NO. 1).
[0110] An example of a forward primer is 5'-AAGATGGGGACCTGCAGTGC-S'
(SEQ. ID. NO. 2) and an example of a reverse primer is 5'-GTAGCTAACTCTCCAAAAG-S' (SEQ. ID. NO.3). Amplification using this pair of primers will amplify a -210 base pair fragment in the presence of a human PF4 mRNA template.
[0111] In another embodiment, the detection of RNA transcripts of PF4 in platelets can be achieved by Northern blotting, wherein a preparation of RNA is run on a denaturing agarose gel, and transferred to a suitable support, such as activated cellulose, nitrocellulose or glass or
12751790 2 26
nylon membranes. Labeled (e.g., radiolabeled) cDNA or RNA is then hybridized to the preparation, washed and analyzed by methods such as autoradiography.
[0112] In another embodiment, the detection of RNA transcripts of PF4 in platelets can further be accomplished using known amplification methods. For example, it is within the scope of the present invention to reverse transcribe mRNA into cDNA followed by polymerase chain reaction (RT-PCR); or, to use a single enzyme for both steps as described in U.S. Pat. No. 5,322,770, or reverse transcribe mRNA into cDNA followed by symmetric gap lipase chain reaction (RT-AGLCR) as described by R. L. Marshall, et al., PCR Methods and Applications 4: 80-84 (1994). One suitable method for detecting enzyme mRNA transcripts is described in reference Pabic et. al. Hepatology, 37(5): 1056-1066, 2003, which is herein incorporated by reference in its entirety.
[0113] In other embodiments, the detection of RNA transcripts of PF4 in platelets can be achieved with other known amplification methods which include but are not limited to the so- called "NASBA" or "3SR" technique described in PNAS USA 87: 1874-1878 (1990) and also described in Nature 350: 91-92 (1991); Q-beta amplification as described in published European Patent Application (EPA) No. 4544610; strand displacement amplification (as described in G. T. Walker et al., Clin. Chem. 42: 9-13 (1996) and European Patent Application No. 684315; and target mediated amplification, as described by PCT Publication WO 9322461.
[0114] Encompassed in the method described herein is employing in situ hybridization visualization for the detection of PF4 RNA transcripts in platelets. In in situ hybridization, a radioactively labeled antisense RNA probe is hybridized with a thin smear of platelets, after which the smear of platelets is washed, cleaved with RNase, and exposed to a sensitive emulsion for autoradiography. The samples can be stained with haematoxylin to demonstrate the histological composition of the sample, and dark field imaging with a suitable light filter shows the developed emulsion. Non-radioactive labels such as digoxigenin can also be used.
[0115] Alternatively, mRNA expression can be detected on a DNA array, chip or a microarray. Oligonucleotides corresponding to PF4 are immobilized on a chip which is then hybridized with labeled nucleic acids of a sample of platelets obtained from a patient. Positive hybridization signal is obtained with the sample containing PF4 transcripts. Methods of preparing DNA arrays and their use are well known in the art. (See, for example U.S. Patent Nos: 6,618,6796; 6,379,897; 6,664,377; 6,451,536; 548,257; U.S. 20030157485 and Schena et al. 1995 Science 20:467-470; Gerhold et al. 1999 Trends in Biochem. Sci. 24, 168-173; and
12751790 2 27
Lennon et al. 2000 Drug discovery Today 5: 59-65, which are herein incorporated by reference in their entirety). Serial Analysis of Gene Expression (SAGE) can also be performed (See for example U.S. Patent Application 20030215858).
[0116] To monitor mRNA levels, for example, mRNA is extracted from the platelet sample to be tested, reverse transcribed, and fluorescent-labeled cDNA probes are generated. The microarrays capable of hybridizing to PF4 cDNA are then probed with the labeled cDNA probes, the slides scanned and fluorescence intensity measured. This intensity correlates with the hybridization intensity and expression levels.
[0117] Methods of "quantitative" amplification are well known to those of skill in the art. For example, quantitative PCR involves simultaneously co-amplifying a known quantity of a control sequence using the same primers. This provides an internal standard that can be used to calibrate the PCR reaction. Detailed protocols for quantitative PCR are provided, for example, in Innis et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc. N.Y.
Antibodies or antisera against PF4
[0118] In one embodiment, the methods disclosed herein uses antibodies or anti-sera for determining the levels of PF4. The antibodies can be obtained from a commercial source such as R&D Systems, catalog # AF795, IC7952A, BAF795, IC7952F, MAB795, MAB7951, MAB7952, and IC7952P.
[0119] Antibodies for use in the methods described herein can be produced using standard methods to produce antibodies, for example, by monoclonal antibody production (Campbell, A.M., Monoclonal Antibodies Technology: Laboratory Techniques in Biochemistry and Molecular Biology, Elsevier Science Publishers, Amsterdam, the Netherlands (1984); St. Groth et al., J. Immunology, (1990) 35: 1-21; and Kozbor et al., Immunology Today (1983) 4:72). Antibodies can also be readily obtained by using antigenic portions of the protein to screen an antibody library, such as a phage display library by methods well known in the art. For example, U.S. patent 5,702,892 (U.S.A. Health & Human Services) and WO 01/18058 (Novopharm Biotech Inc.) disclose bacteriophage display libraries and selection methods for producing antibody binding domain fragments.
[0120] Detection of PF4 antibodies can be achieved by direct labeling of the antibodies themselves, with labels including a radioactive label such as 3H, 14C, 35S, 125I, or 131I, a
12751790 2 28
fluorescent label, a hapten label such as biotin, or an enzyme such as horse radish peroxidase or alkaline phosphatase. Alternatively, unlabeled primary antibody is used in conjunction with labeled secondary antibody, comprising antisera, polyclonal antisera or a monoclonal antibody specific for the primary antibody. In a preferred embodiment, the primary antibody or antisera is unlabeled, the secondary antisera or antibody is conjugated with biotin and enzyme-linked strepavidin is used to produce visible staining for histochemical analysis.
Anti-tumor therapy
[0121] In one embodiment, the present invention provides a method of monitoring the efficacy of an anti-tumor therapy in a subject comprising: (a) determining at a first time point a level of PF4 in a sample taken from a subject undergoing treatment with an anti-tumor therapy; (b) determining at a second time point, after the first time point, a level of PF4 in a sample taken from the subject undergoing the anti-tumor therapy; and (c) comparing the levels of PF4 determined at the first and second time points, wherein an increase in the PF4 level at the second time point over that at the first time point indicates that the anti-tumor therapy is losing efficacy.
[0122] In one embodiment, the present invention provides a method of monitoring the efficacy of an anti-tumor therapy in a subject comprising: (a) determining at a first time point a level of PF4 in a sample taken from a subject undergoing treatment with an anti-tumor therapy; (b) determining at a second time point, after the first time point, a level of PF4 in a sample taken from the subject-undergoing the anti-tumor therapy; and (c) comparing the levels of PF4 determined at the first and second time points, wherein an increase in the PF4 level at the second time point over that at the first time point indicates that the anti-tumor therapy is losing efficacy.
[0123] In some embodiments, the anti-tumor therapy is an anti-angio genie therapy. In other embodiments, the anti-tumor therapy in a not anti-angiogenic therapy.
[0124] There are currently numerous anti-tumor therapies that are practiced. There are western medicines and technologies such as the various anti-angiogenic therapies described herein. There is the use of immunotoxins (FTs) such as recombinant immunotoxins 8H9(Fv)- PE38 against breast cancer, osteosarcoma, and neuroblastoma. As an anti-tumor therapy, the strategy of the immunotoxins (FTs) can be described as a cancer missile. FT is composed of a monoclonal antibody, a target system, and a toxin part, the bomber. The antibody will bind the surface antigen specifically presented on the cancer cells. The toxin, which is delivered by the antibody, will enter the cytosolic part of the cancer cell to kill the cell. The toxins can be diphtheria toxin, pseudomonas exotoxin (PE), and ricin etc. Those toxins are glycosidases.
12751790 2 29
There is the use of endoscopic ultrasound to kill tumors and also to deliver chemotherapy drugs directly to the tumor cells. There is the use of drugs and chemicals for chemotherapy where the drugs and chemicals inhibit/the expressions of various enzymes or proteins, e.g. p21 cyclin- dependent kinase; transcription factors, e. g. p53; and proteins involve in mitosis and cell division, e. g. taxol. Other anti-tumor therapies include radiation therapy, e. g. radioactive iodine treatment for thyroid cancer.
[0125] In some embodiments, anti-tumor therapies are non traditional therapies such as holistic medicine and homeopathic medicine. These anti-tumor therapies are non-conventional western medicines and can involve dietary supplements, e. g. UMI NO SHIZUKU, a dietary supplement made from "Fucoidan" a natural complex extracted from Okinawa Mozuku (Nemacystus decipiens) and Wakame (Undaria pinnatifida), which can boost the immune system, increase Natural killer cell activity as well as improve activation of macrophage, T- cells and B-cells. Mushroom such as Shiitake, Krestin, Reishi, and Maitake have been reported to have anti-tumor activity.
Anti-angiogenesis, pro-angiogenic factors and anti- angiogenic therapy
[0126] There are three main types of anti-angiogenic drugs that are currently approved by the United State Food and Drug Administration (FDA) for the treatment of cancer and tumors: (1) Drugs that stop new blood vessels from sprouting (true angiogenesis inhibitors); (2) Drugs that attack a tumor's established blood supply (vascular targeting agents); and (3) Drugs that attack both the cancer cells as well as the blood vessel cells (the double-barreled approach).
[0127] In one embodiment, the anti-angiogenic therapies include but are not limited to the administration of monoclonal antibody therapies directed against specific pro-angiogenic growth factors and/or their receptors. Examples of these are: bevacizumab (AVASTIN®), cetuximab (ERBITUX®), panitumumab (VECTIBIX™), and trastuzumab (HERCEPTIN®).
[0128] In another embodiment, the anti-angiogenic therapies include but are not limited to administration of small molecule tyrosine kinase inhibitors (TKIs) of multiple pro-angiogenic growth factor receptors. The three TKIs that are currently approved as anti-cancer therapies are erlotinib (TARCEVA®), sorafenib (NEXA VAR®), and sunitinib (SUTENT®).
[0129] In another embodiment, the anti-angiogenic therapies include but are not limited to administration of inhibitors of mTOR (mammalian target of rapamycin) such as temsirolimus (TORICEL™), bortezomib (VELCADE®), thalidomide (THALOMID®) and doxycyclin,
12751790 2 30
[0130] Many of the current anti-angiogenesis drugs attack the VEGF pathway.
Bevacizumab (AVASTIN®) was the first drug that targeted new blood vessels to be approved for use against cancer. It is a monoclonal antibody that binds to VEGF, thereby blocking VEGF from reaching the VEGF receptor (VEGFR). Other drugs, such as sunitinib (SUTENT®) and sorafenib (NEXA V AR®), are small molecules that attach to the VEGF receptor itself, preventing it from being turned on. Such drugs are collectively termed VEGF inhibitors.
[0131] As the VEGF/VPF protein interacts with the VEGFRs, inhibition of either the ligand VEGF, e.g. by reducing the amount that is available to interact with the receptor; or inhibition of the receptor's intrinsic tyrosine kinase activity, blocks the function of this pathway. This pathway controls endothelial cell growth, as well as permeability, and these functions are mediated through the VEGFRs.
[0132] "VEGF inhibitors" include any compound or agent that produces a direct or indirect effect on the signaling pathways that promote growth, proliferation and survival of a cell by inhibiting the function of the VEGF protein, including inhibiting the function of VEGF receptor proteins. These include any organic or inorganic molecule, including, but not limited to modified and unmodified nucleic acids such as antisense nucleic acids, RNAi agents such as siRNA or shRNA, peptides, peptidomimetics, receptors, ligands, and antibodies that inhibit the VEGF signaling pathway. The siRNAs are targeted at components of the VEGF pathways and can inhibit the VEGF pathway. Preferred VEGF inhibitors, include for example, AVASTIN® (bevacizumab), an anti-VEGF monoclonal antibody of Genentech, Inc. of South San Francisco, CA, VEGF Trap (Regeneron / Aventis). Additional VEGF inhibitors include CP-547,632 (3-(4- Bromo-2,6-difluoro- benzyloxy)-5-[3-(4-pyrrolidin 1-yl- butyl)-ureido]-isothiazole-4- carboxylic acid amide hydrochloride; Pfizer Inc. , NY), AG13736, AG28262 (Pfizer Inc.), SU5416, SUl 1248, & SU6668 (formerly Sugen Inc., now Pfizer, New York, New York), ZD- 6474 (AstraZeneca), ZD4190 which inhibits VEGF-R2 and -Rl (AstraZeneca), CEP-7055 (Cephalon Inc., Frazer, PA), PKC 412 (Novartis), AEE788 (Novartis), AZD-2171), NEXA V AR® (BAY 43-9006, sorafenib; Bayer Pharmaceuticals and Onyx Pharmaceuticals), vatalanib (also known as PTK-787, ZK-222584: Novartis & Schering: AG), MACUGEN® (pegaptanib octasodium, NX-1838, EYE-001, Pfizer Inc./Gilead/Eyetech), IM862 (glufanide disodium, Cytran Inc. of Kirkland, Washington, USA), VEGFR2-selective monoclonal antibody DClOl (ImClone Systems, Inc.), angiozyme, a synthetic ribozyme from Ribozyme (Boulder, Colorado) and Chiron (Emeryville, California), Sirna-027 (an siRNA-based VEGFRl inhibitor, Sirna Therapeutics, San Francisco, CA) Caplostatin, soluble ectodomains of the VEGF
12751790 2 31
receptors, Neovastat (Sterna Zentaris Inc; Quebec City, CA), ZM323881 (CalBiochem. CA, USA), pegaptanib (MACUGEN®) (Eyetech Pharmaceuticals), an anti-VEGF aptamer and combinations thereof.
[0133] VEGF inhibitors are also disclosed in US Patent No. 6,534,524 and 6,235,764, both of which are incorporated in their entirety. Additional VEGF inhibitors are described in, for example in WO 99/24440 (published May 20, 1999), International Application PCT/IB99/00797 (filed May 3, 1999), in WO 95/21613 (published August 17, 1995), WO 99/61422 (published December 2, 1999), U.S. Pat. Publ. No. 20060094032 "siRNA agents targeting VEGF", U.S. Patent 6, 534,524 (discloses AG13736), U.S. Patent 5,834,504 (issued November 10, 1998), WO 98/50356 (published November 12, 1998), U.S. Patent 5, 883,113 (issued March 16, 1999), U.S. Patent 5, 886,020 (issued March 23, 1999), U.S. Patent 5,792,783 (issued August 11, 1998), U.S. Patent No. US 6,653,308 (issued November 25, 2003), WO 99/10349 (published March 4, 1999), WO 97/32856 (published September 12, 1997), WO 97/22596 (published June 26, 1997), WO 98/54093 (published December 3, 1998), WO 98/02438 (published January 22, 1998), WO 99/16755 (published April 8, 1999), and WO 98/02437 (published January 22, 1998), WO 01/02369 (published January 11, 2001); U.S. Provisional Application No. 60/491,771 piled July 31, 2003); U.S. Provisional Application No. 60/460,695 (filed April 3, 2003); and WO 03/106462A1 (published December 24, 2003). Other examples of VEGF inhibitors are disclosed in International Patent Publications WO 99/62890 published December 9, 1999, WO 01/95353 published December 13, 2001 and WO 02/44158 published June 6, 2002.
[0134] In another embodiment, the anti- angiogenic therapy includes, but is not limited to the use of VEGF inhibitors.
[0135] In another embodiment, the anti- angiogenic therapy includes, but is not limited to the use of anti-angiogenic factors such as alpha-2 antiplasmin (fragment), angiostatin (plasminogen fragment), antiangiogenic antithrombin III, cartilage-derived inhibitor (CDI), CD59 complement fragment, endostatin (collagen XVIII fragment), fibronectin fragment, gro- beta ( a C-X-C chemokine), heparinases heparin hexasaccharide fragment, human chorionic gonadotropin (hCG), interferon alpha/beta/gamma, interferon inducible protein (IP-10), interleukin-12, kringle 5 (plasminogen fragment), beta-thromboglobulin, EGF (fragment), VEGF inhibitor, endostatin, fibronection (45 kD fragment), high molecular weight kininogen (domain 5), NKl, NK2, NK3 fragments of HGF, PF-4, serpin proteinase inhibitor 8, TGF-beta- 1, thrombospondin-1, prosaposin, p53, angioarrestin, metalloproteinase inhibitors (TIMPs), 2-
12751790 2 32
Methoxyestradiol, placental ribonuclease inhibitor, plasminogen activator inhibitor, prolactin 16kD fragment, proliferin-related protein (PRP), retinoids, tetrahydrocortisol-S transforming growth factor-beta (TGF-b), vasculostatin, and vasostatin (calreticulin fragment), pamidronate thalidomide, TNP470, the bisphosphonate family such as amino-bisphosphonate zoledronic acid, bombesin/gastrin-releasing peptide (GRP) antagonists such as RC-3095 and RC-3940-II (Bajol AM, et. al., British Journal of Cancer (2004) 90, 245-252), anti-VEGF peptide RRKRRR (dRK6) (SEQ. ID. No. 4) (Seung-Ah Yoo, J.Immuno, 2005, 174: 5846-5855).
[0136] In one embodiment, the anti- angiogenic therapy includes the administration of more than one anti-angiogenic factor. The therapy can also be administered in conjunction with other anti-cancer treatment such as biological, chemotherapy and radiotherapy. Biological therapies use the body's immune system, either directly or indirectly, to fight cancer or to lessen the side effects that may be caused by some cancer treatments. Immune response modifying therapies such as the administration of interferons, interleukins, colony- stimulating factors, monoclonal antibodies, vaccines, gene therapy, and nonspecific immuno modulating agents are also envisioned as anti-cancer therapies.
[0137] In one embodiment, the anti-angiogenic therapy disclosed herein is directed at angiogenic diseases and disorders. When angiogenesis occurs at inappropriate locations, is aberrant, and/or uncontrolled and results in undesirable effects, then that angiogenesis pathological. The pathological angiogenic diseases and disorders include but are not limited to cancer, ascites formation, psoriasis, age-related macular degeneration, thyroid hyperplasia, preeclampsia, rheumatoid arthritis and osteoarthritis, Alzheimer's disease, obesity, pleura effusion, atherosclerosis, endometriosis, diabetic/other retinopathies, neovascular glauocoma, age-related macular degeneration, hemangiomas, and corneal neovascularization.
[0138] In one embodiment, the pathological angiogenic disease or disorder is cancer, where the rapidly dividing neoplastic cancer cells require an efficient blood supply to sustain their continual growth of the tumor. As used herein, cancer refers to any of various malignant neoplasms characterized by the proliferation of anaplastic cells that tend to invade surrounding tissue and metastasize to new body sites and also refers to the pathological condition characterized by such malignant neoplastic growths. The blood vessels provide conduits to metastasize and spread elsewhere in the body. Upon arrival at the metastatic site, the cancer cells then work on establishing a new blood supply network. Inhibition of angiogenesis at the primary tumor site and secondary tumor site serve to prevent and limit the progression of the disease.
12751790 2 33
[0139] Encompassed in the methods disclosed herein are subjects that are treated for cancer, including but not limited to all types of carcinomas and sarcomas, such as those found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon/rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovaries, pancreas, penis, prostate, skin, small intestine, stomach, spinal marrow, tailbone, testicles, thyroid and uterus. The types of carcinomas include papilloma/carcinoma, choriocarcinoma, endodermal sinus tumor, teratoma, adenoma/adenocarcinoma, melanoma, fibroma, lipoma, leiomyoma, rhabdomyoma, mesothelioma, angioma, osteoma, chondroma, glioma, lymphoma/leukemia, squamous cell carcinoma, small cell carcinoma, large cell undifferentiated carcinomas, basal cell carcinoma and sinonasal undifferentiated carcinoma. The types of sarcomas include soft tissue sarcoma such as alveolar soft part sarcoma, angiosarcoma, dermatofibro sarcoma, desmoid tumor, desmoplastic small round cell tumor, extraskeletal chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, hemangiopericytoma, hemangiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangio sarcoma, lymphosarcoma, malignant fibrous histiocytoma, neurofibrosarcoma, rhabdomyosarcoma, synovial sarcoma, and Askin's tumor, Ewing's sarcoma (primitive neuroectodermal tumor), malignant hemangioendothelioma, malignant schwannoma, osteosarcoma, and chondrosarcoma. Abnormal build up and growth of blood vessels in the skin or internal organs in the form of hemangiomas can also be treated and/or monitored according to the methods described herein.
[0140] In one embodiment, pathological angiogenesis occurs in age-related macular degeneration. It is known that VEGF contributes to abnormal blood vessel growth from the choroid layer of the eye into the retina, similar to what occurs during the wet or neovascular form of age-related macular degeneration. Macular degeneration, often called AMD or ARMD (age-related macular degeneration), is the leading cause of vision loss and blindness in Americans aged 65 and older. New blood vessels grow (neovascularization) beneath the retina and leak blood and fluid. This leakage causes permanent damage to light-sensitive retinal cells, which die off and create blind spots in central vision or the macula. Accordingly, encompassed in the methods disclosed herein are subjects treated for age-related macular degeneration with anti-angiogenic therapy.
[0141] In one embodiment, pathological angiogenesis occurs in diabetic retinopathy where abnormal blood vessel growth is associated with diabetic eye diseasesand diabetic macular edema. VEGF inhibitors can block and/or reduce the activity of VEGF and pathologic
12751790 2 34
angiogenesis. Released by the retina (light-sensitive tissue in back of the eye) when normal blood vessels are damaged by tiny blood clots due to diabetes, VEGF turns on its receptor, igniting a chain reaction that culminates in new blood vessel growth. However, the backup blood vessels are faulty; they leak (causing edema), bleed and encourage scar tissue that detaches the retina, resulting in severe loss of vision. Such growth is the hallmark of diabetic retinopathy, the leading cause of blindness among young people in developed countries. Therefore, encompassed in the methods disclosed herein are subjects treated for diabetic retinopathy and/or diabetic macular edema with anti-angiogenic therapy.
[0142] In one embodiment, pathological angiogenesis in rheumatoid arthritis.
Rheumatoid arthritis (RA) is characterized by synovial tissue swelling, leukocyte ingress and angiogenesis, or new blood vessel growth. The disease is thought to occur as an immunological response to an as yet unidentified antigen. The expansion of the synovial lining of joints in rheumatoid arthritis (RA) and the subsequent invasion by the pannus of underlying cartilage and bone necessitate an increase in the vascular supply to the synovium, to cope with the increased requirement for oxygen and nutrients. Angiogenesis is now recognized as a key event in the formation and maintenance of the pannus in RA (Paleolog, E. M., Arthritis Res. 2002;4 Suppl 3:S81-90; Afuwape AO, Histol Histopathol. 2002;17(3):961-72). Even in early RA, some of the earliest histological observations are blood vessels. A mononuclear infiltrate characterizes the synovial tissue along with a luxuriant vasculature. Angiogenesis is integral to formation of the inflammatory pannus and without angiogenesis, leukocyte ingress could not occur (Koch, A. E., Ann. Rheum. Dis. 2000, 59 Suppl I:i65-71). Disruption of the formation of new blood vessels would not only prevent delivery of nutrients to the inflammatory site, it could also reduce joint swelling due to the additional activity of VEGF, a potent proangiogenic factor in RA, as a vascular permeability factor. Anti-VEGF hexapeptide RRKRRR (dRK6) (SEQ. ID. NO. 4) can suppress and mitigate the arthritis severity (Seung-Ah Yoo, et. al.,2005, supra). Accordingly, encompassed in the methods disclosed herein are subjects treated for rheumatoid arthritis with anti-angiogenic therapy.
[0143] In one embodiment, pathological angiogenesis occurs in Alzheimer's disease.
Alzheimer's disease (AD) is the most common cause of dementia worldwide. AD is characterized by an excessive cerebral amyloid deposition leading to degeneration of neurons and eventually to dementia. The exact cause of AD is still unknown. It has been shown by epidemiological studies that long-term use of non-steroidal anti-inflammatory drugs, statins, histamine H2-receptor blockers, or calcium-channel blockers, all of which are cardiovascular
12751790 2 35
drugs with an anti-angiogenic effect, seem to prevent Alzheimer's disease and/or influence the outcome of AD patients. Therefore, AD angiogenesis in the brain vasculature can play an important role in AD. In Alzheimer's disease, the brain endothelium secretes the precursor substrate for the beta-amyloid plaque and a neurotoxic peptide that selectively kills cortical neurons. Moreover, amyloid deposition in the vasculature leads to endothelial cell apoptosis and endothelial cell activation which leads to neovascularization. Vessel formation could be blocked by the VEGF antagonist SU 4312 as well as by statins, indicating that anti-angiogenesis strategies can interfere with endothelial cell activation in AD (Schultheiss C, el. al., 2006; Grammas P., et. al., 1999) and can be used for preventing and/or treating AD. Accordingly, encompassed in the methods disclosed herein are subjects treated for Alzheimer's disease with anti-angiogenic therapy.
[0144] In one embodiment, pathological angiogenesis occurs in obesity. Adipogenesis in obesity requires close interplay between differentiating adipocytes, stromal cells, and blood vessels. There were close spatial and temporal interrelationships between blood vessel formation and adipogenesis, and the sprouting of new blood vessels from preexisting vasculature was coupled to adipocyte differentiation. Adipogenic/angiogenic cell clusters can morphologically and immunohistochemically be distinguished from crown-like structures frequently seen in the late stages of adipose tissue obesity. Administration of anti-vascular endothelial growth factor (VEGF) antibodies inhibited not only angiogenesis but also the formation of adipogenic/angiogenic cell clusters, indicating that the coupling of adipogenesis and angiogenesis is essential for differentiation of adipocytes in obesity and that VEGF is a key mediator of that process. (Satoshi Nishimura et. al., 2007, Diabetes 56:1517-1526). It has been shown that the angiogenesis inhibitor, TNP-470 was able to prevent diet-induced and genetic obesity in mice (Ebba Brakenhielm et. al., Circulation Research, 2004, 94:1579). TNP-470 reduced vascularity in the adipose tissue, thereby inhibiting the rate of growth of the adipose tissue and obesity development. Accordingly, encompassed in the methods disclosed herein are subjects treated for obesity with anti-angiogenic therapy.
[0145] In one embodiment, pathological angiogensis occurs in endometriosis. Excessive endometrial angiogenesis is proposed as an important mechanism in the pathogenesis of endometriosis (Healy, DL., et. al., Hum Reprod Update. 1998 Sep-Oct, 4(5):736-40). The endometrium of patients with endometriosis shows enhanced endothelial cell proliferation. Moreover there is an elevated expression of the cell adhesion molecule integrin vB3 in more blood vessels in the endometrium of women with endometriosis when compared with normal
12751790 2 36
women. The U.S. Patent No. 6,121,230 described the use of anti-VEGF agents in the treatment of endometriosis and this Patent is incorporated hereby reference. Accordingly, encompassed in the methods disclosed herein are subjects treated for endometriosis with anti-angiogenic therapy.
Systems for monitoring efficacy of therapy or tumor status
[0146] Embodiments of the invention also provide for systems (and computer readable media for causing computer systems) to perform a method for monitoring efficacy of an antitumor or anti-angiogenic therapy in a subject and methods for monitoring tumor status in a subject by monitoring the level of PF4 in the subject regularly over time or at different time increments.
[0147] In one embodiment, provided herein is a system comprising: (a) a measuring module quantifying a PF4 level from a sample comprising a signal capable of indicating a level of PF4 in a subject; (b) a storage module configured to store data output from the measuring module; (c) a comparison module adapted to compare the data stored on the storage module with a reference and/or control data, and to provide a retrieved content, and (d) an output module for displaying the retrieved content for the user, wherein the retrieved content the level of PF4 is higher than the reference and/or control data indicates that the therapy is ineffective and/or the tumor has recurred or regrown. The PF4 level is higher than the reference and/or control data by about two fold or more, by about two to ten fold, including the entire intervening fold. In another embodiment, the retrieved content the level of PF4 is lower than the reference and/or control data indicates that the therapy is effective and/or the tumor has not recurred or re-grown. The PF4 level is lower than the reference and/or control data by at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, 100%, 200%, 300% or 1000%, including all the percentages between 10-1000%.
[0148] In one embodiment, provided herein is a system monitoring efficacy of an antitumor or anti-angiogenic therapy in a subject and methods for monitoring tumor status in a subject, comprising: (a) a determination module configured to receive and output a PF4 level obtained from a sample a subject; (b) a storage module configured to store output data from the determination module; (c) a comparison module adapted to compare the output data stored on the storage module with a reference and/or control data, and to provide a comparison content, and (d) an output module for displaying the comparison content for the user, wherein if the measured level of PF4 from the subject is lower than the reference and/or control data indicates that the therapy is effective and/or the tumor has not recurred or re-grown or if there is a
12751790 2 37
reduction of about at least 25% to a prior reading, then the therapy is effective. The PF4 level is lower than the reference and/or control data by about, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, 100%, 200%, 300% or 1000%, including all the percentages between 10-1000%. In another embodiment, the output module for displaying the comparison content of a measured level of PF4 from the subject displays a PF4 level that is higher than the reference and/or control data or if there is an increase of about at least 2 fold to a prior reading indicates that the therapy is ineffective and/or the tumor has recurred or re-grown. The PF4 level is higher than the reference and/or control data by about two to ten fold, including the entire intervening fold.
[0149] In one embodiment of the system described herein, the PF level is determined from an antibody-based moiety-PF4 complex, from quantitative RT-PCR of the mRNA of PF4 or by mass spectrometry of PF4 or the mRNA of PF4 after quantitative RT-PCR.
[0150] In one embodiment of the system described herein, the control data comprises previous data from the same subject.
[0151] In one embodiment, provided herein is a computer readable storage medium comprising:(a) a storing data module containing data from a subject that represents as a signal indicating a level of PF4 from a sample obtained from a subject; (b) a comparison module that compares the data stored on the storing data module with a reference data and/or control data, and to provide a comparison content, and (c) an output module displaying the comparison content for the user, wherein if the measured level of PF4 from the subject is lower than a reference level of PF4 indicates that indicates that the therapy is effective and/or the tumor has not recurred or re-grown or if there is a reduction of at least 10% to a prior reading, then the therapy is effective. The PF4 level is lower than the reference and/or control data by about at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, 100%, 200%, 300% or 1000%, including all the percentages between 10-1000%. In another embodiment, the output module for displaying the comparison content of a measured level of PF4 from the subject displays a PF4 level that is higher than the reference and/or control data or if there is an increase of about at least 2 fold to a prior reading indicates that the therapy is ineffective and/or the tumor has recurred or re-grown. The PF4 level is higher than the reference and/or control data by about two to ten fold, including the entire intervening fold.
[0152] In one embodiment of any of the system described herein, the reference or control data comprises prior data from the same subject at various time points, e. g. before treatment
12751790 2 38
with any anti-tumor or anti-angiogenic therapy; after start of treatment; in remission etc; and the determination methods for the reference or control data and the output data from the measuring module are the same.
[0153] Embodiments of the invention can be described through functional modules, which are defined by computer executable instructions recorded on computer readable media and which cause a computer to perform method steps when executed. The modules are segregated by function for the sake of clarity. However, it should be understood that the modules/systems need not correspond to discreet blocks of code and the described functions can be carried out by the execution of various code portions stored on various media and executed at various times. Furthermore, it should be appreciated that the modules can perform other functions, thus the modules are not limited to having any particular functions or set of functions.
[0154] The computer readable storage media #30 can be any available tangible media that can be accessed by a computer. Computer readable storage media includes volatile and nonvolatile, removable and non-removable tangible media implemented in any method or technology for storage of information such as computer readable instructions, data structures, program modules or other data. Computer readable storage media includes, but is not limited to, RAM (random access memory), ROM (read only memory), EPROM (eraseable programmable read only memory), EEPROM (electrically eraseable programmable read only memory), flash memory or other memory technology, CD-ROM (compact disc read only memory), DVDs (digital versatile disks) or other optical storage media, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage media, other types of volatile and non-volatile memory, and any other tangible medium which can be used to store the desired information and which can accessed by a computer including and any suitable combination of the foregoing.
[0155] Computer-readable data embodied on one or more computer-readable media may define instructions, for example, as part of one or more programs that, as a result of being executed by a computer, instruct the computer to perform one or more of the functions described herein, and/or various embodiments, variations and combinations thereof. Such instructions may be written in any of a plurality of programming languages, for example, Java, J#, Visual Basic, C, C#, C++, Fortran, Pascal, Eiffel, Basic, COBOL assembly language, and the like, or any of a variety of combinations thereof. The computer-readable media on which such instructions are embodied may reside on one or more of the components of either of a system, or a computer readable storage medium described herein, may be distributed across one or more of such components.
12751790 2 39
[0156] The computer-readable media may be transportable such that the instructions stored thereon can be loaded onto any computer resource to implement the aspects of the present invention discussed herein. In addition, it should be appreciated that the instructions stored on the computer-readable medium, described above, are not limited to instructions embodied as part of an application program running on a host computer. Rather, the instructions may be embodied as any type of computer code (e.g., software or microcode) that can be employed to program a computer to implement aspects of the present invention. The computer executable instructions may be written in a suitable computer language or combination of several languages. Basic computational biology methods are known to those of ordinary skill in the art and are described in, for example, Setubal and Meidanis et al., Introduction to Computational Biology Methods (PWS Publishing Company, Boston, 1997); Salzberg, Searles, Kasif, (Ed.), Computational Methods in Molecular Biology, (Elsevier, Amsterdam, 1998); Rashidi and Buehler, Bioinformatics Basics: Application in Biological Science and Medicine (CRC Press, London, 2000) and Ouelette and Bzevanis Bioinformatics: A Practical Guide for Analysis of Gene and Proteins (Wiley & Sons, Inc., 2nd ed., 2001).
[0157] The functional modules of certain embodiments of the invention include at minimum a determination module #40, a storage module #30, a comparison module #80, and an output module #110. The functional modules can be executed on one, or multiple, computers, or by using one, or multiple, computer networks. The measuring module has computer executable instructions to provide e.g., PF4 level etc in computer readable form.
[0158] The determination module #40, can comprise any system for detecting a signal representing PF4 level in a sample from a subject, e.g. whole blood or plasma. In some embodiments, such systems can include a real-time qRT-PRC machine or a mass spectrometer.
[0159] The information determined in the determination module can be read by the storage module #30. As used herein the "storage module" is intended to include any suitable computing or processing apparatus or other device configured or adapted for storing data or information. Examples of electronic apparatus suitable for use with the present invention include stand-alone computing apparatus, data telecommunications networks, including local area networks (LAN), wide area networks (WAN), Internet, Intranet, and Extranet, and local and distributed computer processing systems. Storage modules also include, but are not limited to: magnetic storage media, such as floppy discs, hard disc storage media, magnetic tape, optical storage media such as CD-ROM, DVD, electronic storage media such as RAM, ROM, EPROM, EEPROM and the like, general hard disks and hybrids of these categories such as
12751790 2 40
magnetic/optical storage media. The storage module is adapted or configured for having recorded thereon, for example, PF4 level or expression information. Such information may be provided in digital form that can be transmitted and read electronically, e.g., via the Internet, on diskette, via USB (universal serial bus) or via any other suitable mode of communication.
[0160] As used herein, "stored" refers to a process for encoding information on the storage module. Those skilled in the art can readily adopt any of the presently known methods for recording information on known media to generate manufactures comprising expression level information.
[0161] The "comparison module" #80 can use a variety of available software programs and formats for the comparison operative to compare expression data determined in the measuring module to reference samples and/or stored reference data. In one embodiment, the comparison module is configured to use pattern recognition techniques to compare information from one or more entries to one or more reference data patterns. The comparison module can be configured using existing commercially- available or freely- available software for comparing patterns, and may be optimized for particular data comparisons that are conducted. In some embodiments, the comparison module provides computer readable information related to PF4 level, presence/absence of tumor in a subject and/or efficacy of anti-tumor or anti-angiogenic therapy in a subject.
[0162] The comparison module, or any other module of the invention, can include an operating system (e.g., UNIX) on which runs a relational database management system, a World Wide Web application, and a World Wide Web server. World Wide Web application includes the executable code necessary for generation of database language statements (e.g., Structured Query Language (SQL) statements). Generally, the executables will include embedded SQL statements. In addition, the World Wide Web application may include a configuration file which contains pointers and addresses to the various software entities that comprise the server as well as the various external and internal databases which must be accessed to service user requests. The Configuration file also directs requests for server resources to the appropriate hardware— as may be necessary should the server be distributed over two or more separate computers. In one embodiment, the World Wide Web server supports a TCP/IP protocol. Local networks such as this are sometimes referred to as "Intranets." An advantage of such Intranets is that they allow easy communication with public domain databases residing on the World Wide Web (e.g., the GenBank or Swiss Pro World Wide Web site). Thus, in a particular preferred embodiment of the present invention, users can directly access data (via Hypertext links for
12751790 2 41
example) residing on Internet databases using a HTML interface provided by Web browsers and Web servers.
[0163] The comparison module provides a computer readable comparison result that can be processed in computer readable form by predefined criteria, or criteria defined by a user, to provide a content-based in part on the comparison result that may be stored and output as requested by a user using an output module #110.
[0164] In some embodiments, the content based on the comparison result can be an expression value compared to a reference showing the effective anti-tumor or anti-angiogenic therapy in a subject or showing the recurrence of a tumor in an individual.
[0165] In one embodiment of the invention, the content based on the comparison result is displayed on a computer monitor #120. In one embodiment of the invention, the content based on the comparison result is displayed through printable media #130, #140. The display module can be any suitable device configured to receive from a computer and display computer readable information to a user. Non-limiting examples include, for example, general-purpose computers such as those based on Intel PENTIUM-type processor, Motorola PowerPC, Sun UltraSPARC, Hewlett-Packard PA-RISC processors, any of a variety of processors available from Advanced Micro Devices (AMD) of Sunnyvale, California, or any other type of processor, visual display devices such as flat panel displays, cathode ray tubes and the like, as well as computer printers of various types.
[0166] In one embodiment, a World Wide Web browser is used for providing a user interface for display of the content based on the comparison result. It should be understood that other modules of the invention can be adapted to have a web browser interface. Through the Web browser, a user can construct requests for retrieving data from the comparison module. Thus, the user will typically point and click to user interface elements such as buttons, pull down menus, scroll bars and the like conventionally employed in graphical user interfaces.
[0167] The present invention therefore provides for systems (and computer readable media for causing computer systems) to perform methods for monitoring anti-tumor and/or anti- angiogenic therapy efficacy or tumor genesis status in a subject.
[0168] Systems and computer readable media described herein are merely illustrative embodiments of the invention for assessing the level of PF4 in a subject and monitoring therapy efficacy or tumor status, and therefore are not intended to limit the scope of the invention.
12751790 2 42
Variations of the systems and computer readable media described herein are possible and are intended to fall within the scope of the invention.
[0169] The modules of the machine, or those used in the computer readable medium, may assume numerous configurations. For example, function may be provided on a single machine or distributed over multiple machines.
[0170] The present invention can be defined in any of the following alphabetized paragraphs:
[A] A method of monitoring the efficacy of an anti-tumor therapy in a subject comprising:
a. determining a level of PF4 in a first sample taken from a subject prior to treatment with an anti-tumor therapy;
b. determining a level of PF4 in a second sample taken from said subject after commencing treatment with said anti-tumor therapy; and
c. comparing the levels of PF4 determined in said first and second samples, wherein an increase in PF4 level in said second sample over that in said first sample indicates that said anti-tumor therapy is ineffective.
[B] A method of monitoring the efficacy of an anti-tumor therapy in a subject comprising:
a. determining at a first time point a level of PF4 in a sample taken from a subject undergoing treatment with an anti-tumor therapy;
b. determining at a second time point, after said first time point, a level of PF4 in a sample taken from said subject undergoing said anti-tumor therapy; and
c. comparing the levels of PF4 determined at said first and second time points, wherein an increase in the PF4 level at said second time point over that at said first time point indicates that said anti-tumor therapy is losing efficacy.
[C] The method of paragraph [A] or [B], wherein said anti-tumor therapy is an anti- angiogenic therapy.
12751790 2 43
[D] A method of monitoring the efficacy of an anti- angiogenic therapy in a subject comprising:
a. determining a level of PF4 in a first sample taken from a subject prior to treatment with an anti- angiogenic therapy;
b. determining a level of PF4 in a second sample taken from said subject after commencing treatment with said anti- angiogenic therapy; and
c. comparing the levels of PF4 determined in said first and second samples, wherein an increase in PF4 level in said second sample over that in said first sample indicates that said anti- angiogenic therapy is ineffective.
[E] A method of monitoring the efficacy of an anti-angiogenic therapy in a subject comprising:
a. determining at a first time point a level of PF4 in a sample taken from a subject undergoing treatment with an anti- angiogenic therapy;
b. determining at a second time point, after said first time point, a level of PF4 in a sample taken from said subject undergoing said anti-angiogenic therapy; and
c. comparing the levels of PF4 determined at said first and second time points, wherein an increase in the PF4 level at said second time point over that at said first time point indicates that said anti-angiogenic therapy is losing efficacy.
[F] The method of paragraph [D] or [F], wherein said anti-angiogenic therapy is administered to treat an angiogenic disease or disorder selected from the group consisting of: age-related macular degeneration; diabetic retinopathy; rheumatoid arthritis; Alzheimer's disease; obesity and endometriosis.
[G] The method of paragraph [D] or [F], wherein said anti-angiogenic therapy is administered to treat a tumor.
[H] A method of monitoring tumor status in a subject comprising:
a. determining at a first time point a level of PF4 in a sample taken from a subject who is in cancer remission;
b. determining at a second time point, after said first time point, a level of PF4 in a sample taken from said subject; and
c. comparing the levels of PF4 determined at said first and second time points, wherein an increase in the PF4 level at said second time point over that at said first time point indicates that an angiogenic tumor is present.
[I] The method of paragraph [A], [B], [D], [F] or [H], wherein the sample is selected from the group consisting of whole blood, serum, plasma, platelets and megakaryocytes.
[J] The method of paragraph [A], [B], [D], [F] or [H], wherein said first and second time points are 1, 2 or 3 months apart.
[K] The method of paragraph [C], [D], [F] or [H], wherein the anti-angiogenic therapy is an agent that antagonizes VEGF or bFGF signaling.
[L] The method of paragraph [K], wherein the agent is an antibody directed against VEGF.
[M] The method of any of paragraph [A], [B], [D], [F] or [H], wherein the level of PF4 is determined by an antibody-based moiety method, by quantitative RT-PCR or by mass spectrometry.
[N] The method of any of paragraph [A], [B], [D], [F] or [H], wherein the level of PF4 at the first and second time points are determined by the same method.
[O] A system comprising:
(a). a measuring module quantifying a PF4 level comprising a signal capable of indicating a level of PF4 in a sample obtained from a subject;
(b). a storage module configured to store data output from the measuring module;
(c). a comparison module adapted to compare the data stored on the storage module with a reference and/or control data, and to provide a retrieved content, and
(d). an output module for displaying the retrieved content for the user, wherein the retrieved content the level of PF4 is lower than the reference and/or
control data indicates that the therapy is effective, and wherein the retrieved content the level of PF4 is higher than the reference and/or control data indicates that the therapy is ineffective.
[P] The system of paragraph [O], wherein the control data comprises data from the same subject at a previous time.
[Q] A system to monitoring anti-tumor and/or anti-angiogenic therapy or status of tumor recurrence in a subject, comprising:
(a). a determination module configured to receive and output a PF4 level obtained from a subject,;
(b). a storage module configured to store output data from the determination module;
(c). a comparison module adapted to compare the output data stored on the storage module with a reference and/or control data, and to provide a comparison content, and
(d). an output module for displaying the comparison content for the user, wherein if the measured level of PF4 from the subject is lower than the reference and/or control data indicates that the therapy is effective or if there is a reduction of at least 25% to a prior reading, then the indicates that the therapy is effective; or if the measured level of PF4 from the subject is higher than the reference and/or control data indicates that the therapy is not effective.
[R] The computer system of paragraph [Q], wherein the control data comprises previous data from the same subject.
[S] A computer readable storage medium comprising:
(a). a storing data module containing data from a subject that represents as a signal indicating a level of PF4;
(b). a comparison module that compares the data stored on the storing data module with a reference data and/or control data, and to provide a comparison content, and
(c). an output module displaying the comparison content for the user, wherein if the measured level of xanthophyll from the subject is lower than a reference level of xanthophyll indicates that the therapy is effective or if there is a reduction of at least 25% to a prior reading, then the indicates that the therapy is effective; or if the measured level of PF4 from the subject is higher than the reference and/or control data indicates that the therapy is not effective.
[T] The system of paragraph [S], wherein the control data comprises data comprises previous data from the same subject.
[0171] This invention is further illustrated by the following example which should not be construed as limiting. The contents of all references cited throughout this application, as well as the figures and tables are incorporated herein by reference.
EXAMPLES
Example 1
[0172] For a patient who has been recent been diagnosed with cancer but have not received any treatment, particularly an anti-angiogenic treatment, the method disclosed herein can be applied. For instance, a patient X has been positively diagnosed with non-Hodgkin's lymphoma. Her doctor conducted an initial physical examination and found a small solid mass in her left arm pit. She also had other symptoms such as enlarged lymph nodes, fever, and weight loss. A tissue biopsy was done which confirmed the diagnosis of non-Hodgkin's lymphoma. Now patient's X oncologist wants to start her on an aggressive treatment of combined anti-B-cell and anti-angiogenic therapy comprising of rituximab and bevacizumab. Monitoring of her platelet-derived PF4 before and after the start of her treatment can allow her doctor to determine if the prescribed treatment is working in retarding the tumor growth, shrinking the tumor growth, and/or killing her cancer cells.
[0173] Before the start of her treatment, a sample of patient's X blood can be collected in citrate (anti-coagulant) and PGE2 (anti-platelet activation). The platelets in her blood sample can be isolated by fractional centrifugation and collected as a pellet. The pellet of platelets can then be lysed and the platelet lysate can be used for the measurement of PF4 by ELISA using R&D Systems anti-human PF4 antibodies. Three separate measurements of PF4 from the same lysate are recommended and the PF4 measurements can be averaged.
12751790 2 47
[0174] Table 1 is a hypothetical chart showing the expected changes in the platelet- derived PF4 of a patient, diagnosed with cancer, before and after receiving an anti- angiogenic therapy such as bevacizumab. The patient can have an average platelet-derived PF4 of 1.5 μg/ml at day zero, before the start of her combined anti-B-cell and anti- angiogenic therapy. This platelet-derived PF4 of 1.5 μg/ml at day zero becomes a reference measurement of platelet- derived PF4 to which subsequent PF4 measurements can be compared with.
[0175] As shown on the hypothetical table 1, after one month of treatment, the patient's platelet-derived PF4 can be monitored again. In fact, monthly measurements of the patient's platelet-derived PF4 can be performed during the entire course of her treatment as well as when her cancer is in remission (see examples 2 and 3). If the anti-angiogenic therapy is effective, it is expected that the patient's platelet-derived PF4 should decrease compared to that the PF4 level before the start of treatment. For example, after one month of treatment with bevacizumab, patient's platelet-derived PF4 can drop to 0.5 μg/ml. Compared to the PF4 measurement at day zero, the amount of platelet-derived PF4 has decrease to one-third of day zero. This decrease indicates that the anti-angiogenic therapy is effective against her cancer, and is effective in reducing the effects of angiogenic factors that stimulated increase PF4 expression in the platelets. The patient can continue to receive the treatment for additional months and her platelet-derived PF4 can be measured monthly for the monitoring whether the treatment is still effective in killing her cancer cells and/or stopping or slowing her tumor growth and for monitoring the development cancer resistance to her current treatment program.
Example 2
[0176] Table 1 shows the changes in the amount of platelet-derived PF4 in the platelets of a patient before and after her treatment with an aggressive treatment of combined anti-B-cell and anti-angiogenic therapy comprising of rituximab and bevacizumab. The decreases in platelet-derived PF4 in the second, third, and fourth months after the start of treatment, when compared to the PF4 measurement at day 0 (before treatment) indicate that the aggressive combined treatment was effective in counteracting any VEGF signaling pathway-dependent activities for up to 4 months.
[0177] When an anti-angiogenic treatment is no longer effective in controlling the growth of a tumor, there can be an increase in the platelet-derived PF4 compared to the PF4 measurement at preceding time point. In Table 1, by the fifth month into treatment, , the patient's platelet-derived PF4 has increase from 0.22 μg/ml (in the 4th month) to 0.60 μg/ml.
12751790 2 48
This is about a three fold increase over a span of one month. This recent increase in PF4 levels, after a period of decrease and maintenance in the lower ranges of around 0.20 μg/ml, can be indicative that there is a resurgence of pro-angiogenic factors in her body and her doctors should survey her lymphoma to determine whether the resurgence of pro-angiogenic factors has brought about re-growth of her lymphoma.
Example 3
[0178] This hypothetical example is to illustrate the use of the method disclosed herein for a patient whose cancer is in remission, in order to monitor for the recurrence of tumor. Assume that for a patient B diagnosed with non-HER2 breast cancer about 2 years ago and is currently in remission, the regular monitoring of her platelet-derived PF4 can allow her doctor to determine if her cancer is back. Shortly after being diagnosed, this patient can have a lumpectomy, and then be started on a treatment comprising low-dose methotrexate, cyclophosphamide, and bevacizumab for a period of several months, e.g. six months. Her cancer went into remission after six months of treatment. During her treatment and during cancer remission, her platelet-derived PF4 in her platelets can be monitored every three months. Table 2 shows a hypothetical chart of the changes of platelet-derived PF4 in such a patient' s platelets when she was first diagnosed with cancer, the platelet-derived PF4 levels when her cancer went into remission after a first treatment for six months and the platelet-derived PF4 levels when her cancer is in remission and is not receiving any treatment.
[0179] In this example, for about 18 months after completing her treatment, her platelet- derived PF4 levels remained relatively constant in the low ranges of less than 0.25 μg/ml. At the 21 month, her platelet-derived PF4 levels showed a very significant increase (almost three fold increase) over the preceding PF4 measurement at the 18 month. This increase in platelet-derive PF4 can indicate that there is a resurgence of pro-angiogenic factors in her body and her doctors should survey her cancer to determine whether the resurgence of pro-angiogenic factors had brought about re-growth of her breast cancer.
Example 4
Long-term monitoring of individual cancer human subjects
[0180] In a time series longitudinal study, three pro-angiogenic factors/biomarkers
(PDGF, VEGF and bFGF) and three anti- angiogenic factors/biomarkers (PF4, TSP, and esdostatin (ES)) were monitored in the platelets of individual cancer subjects post-surgery and
12751790 2 49
during ongoing anti-tumor and/or anti-angiogenic therapy. At T = 0 (day of surgery) and the time points after surgery, samples taken weekly from eight human individuals (subjects 1, 5, 10, 12, 23, 26 and 35).
[0181] To identify clinical significance, we studied the degrees of variance for the six analytes over five weeks in these eight individuals. The CVi (for the individuals) was calculated by ANOVA as the Inter- Week component from 52 replicates each for PDGF, PF4, TSPl and 26 replicates each for Endostatin, VEGF and bFGF from 8 donors over 2 time-points separated by 4 weeks, as this most closely resembled a clinical scenario.
[0182] Platelet biomarker Results were Normalized to T = 0 to register unit-less changes in levels.
[0183] % Changes were compared to Relative Change Values (RCV) calculated for each biomarker with the Biovariability approach.
Table 3
[0184] To calculate the analytical variance CVA, platelet control results obtained from 52 replicates each for PDGF, PF4, TSPl and 26 replicates each for Endostatin, VEGF and bFGF over the course of 13 runs.
Table 4
12751790 2 50
[0185] With knowledge of analytical variability (CVA) from platelet control results and the biovariability in given individuals (CVi) from the longitudinal studies, it was possible to determine what may be a normal range for an individual over a period of time.
[0187] Where: n (number of serial samples) = 2
Z-score = 1.96 for a bi-directional probability of 95%
CVA = total analytical variation, Platelet Control results (normalized to Actin) for each analyte
CVi = total individual variation, 2 serial samples from eight subjects drawn one month apart
[0188] Reference Change Value that is above which variance is more than just common causes (C.G.Fraser, Changes in Serial Results, in: Biological Variation: From Principles to Practice, AACC Press, Washington DC, 2001, pp. 67 - 90.)
Results.
[0189] In general, the time series longitudinal profiles of PF4 showed that platelet PF4 levels correlated with that of the pro-angiogenic factors PDGF, VEGF and bFGF (Fig. 3-6). In subject 1, after surgery to remove the tumor and the administration of FOLFOX, all three of the pro-angiogenic factors decreased over the first four months and the PF4 level drop accordingly (Fig. 3). After that, the pro-angiogenic factor PDGF began to increase and concomitantly PF4 level too, even though the two other pro-angiogenic factors VEGF and bFGF remained relatively steady between the 4th to the 8th month. Similar decreases were noted when the treatment was FOLFOX and AVASTIN®. In subject 12, the combination treatment effectively decreased all three other pro-angiogenic factors which then lead to reduced PF4 levels (Fig. 4).
12751790.2 51
When the pro-angiogenic factor levels began to increase after the 3rd month, the PF4 level also gradually increased. At this stage, the combination treatment is no longer effective. In subject 15, the initial three months of treatment with FOLFOX had no effect as seen from the increasing levels of pro-angiogenic factors and PF4 the level (Fig. 5). However, by the sixth month and following into the ninth month, the level of pro-angiogenic factors and PF4 steadily decreased, indicating that the treatment was effective. At the ninth month, the treatment was stopped as the levels of pro-angiogenic factors and PF4 were below the 0% change. In subject 26, the FOLFOX and AVASTIN® combination treatment was effective in reducing the level of only one pro-angiogenic factor VEGF and not PDGF and bFGF levels. Accordingly, the PF4 level reminds high and an increase is recorded indicating the treatment is no longer effective (Fig. 6).
12751790 2 52
Table 1. A hypothetical chart showing the changes in the platelet-derived PF4 of a patient before and after receiving treatment of an anti-angiogenic therapy such as bevacizumab.
Table 2. A hypothetical chart showing the changes in the platelet-derived PF4 of a patient before and after receiving treatment, and during cancer remission. The patient received an anti- angiogenic therapy such as bevacizumab for 6 months.
Claims
1. A method of monitoring the efficacy of an anti-tumor therapy in a subject comprising:
a. determining a level of PF4 in a first sample taken from a subject prior to treatment with an anti-tumor therapy;
b. determining a level of PF4 in a second sample taken from said subject after commencing treatment with said anti-tumor therapy; and
c. comparing the levels of PF4 determined in said first and second samples, wherein an increase in PF4 level in said second sample over that in said first sample indicates that said anti-tumor therapy is ineffective.
2. A method of monitoring the efficacy of an anti-tumor therapy in a subject comprising:
a. determining at a first time point a level of PF4 in a sample taken from a subject undergoing treatment with an anti-tumor therapy;
b. determining at a second time point, after said first time point, a level of PF4 in a sample taken from said subject-undergoing said anti-tumor therapy; and
c. comparing the levels of PF4 determined at said first and second time points, wherein an increase in the PF4 level at said second time point over that at said first time point indicates that said anti-tumor therapy is losing efficacy.
3. The method of claim 1 or 2, wherein said anti-tumor therapy is an anti-angiogenic therapy.
4. A method of monitoring the efficacy of an anti- angiogenic therapy in a subject comprising:
a. determining a level of PF4 in a first sample taken from a subject prior to treatment with an anti- angiogenic therapy;
b. determining a level of PF4 in a second sample taken from said subject after commencing treatment with said anti- angiogenic therapy; and
12751790 2 55 c. comparing the levels of PF4 determined in said first and second samples, wherein an increase in PF4 level in said second sample over that in said first sample indicates that said anti- angiogenic therapy is ineffective.
5. A method of monitoring the efficacy of an anti-angiogenic therapy in a subject comprising:
a. determining at a first time point a level of PF4 in a sample taken from a subject undergoing treatment with an anti- angiogenic therapy;
b. determining at a second time point, after said first time point, a level of PF4 in a sample taken from said subject-undergoing said anti-angiogenic therapy; and
c. comparing the levels of PF4 determined at said first and second time points, wherein an increase in the PF4 level at said second time point over that at said first time point indicates that said anti-angiogenic therapy is losing efficacy
6. The method of claim 4 or 5, wherein said anti-angiogenic therapy is administered to treat an angiogenic disease or disorder selected from the group consisting of: age-related macular degeneration; diabetic retinopathy; rheumatoid arthritis; Alzheimer's disease; obesity and endometriosis.
7. The method of claim 4 or 5, wherein said anti-angiogenic therapy is administered to treat a tumor.
8. A method of monitoring tumor status in a subject comprising:
a. determining at a first time point a level of PF4 in a sample taken from a subject who is in cancer remission;
b. determining at a second time point, after said first time point, a level of PF4 in a sample taken from said subject; and
c. comparing the levels of PF4 determined at said first and second time points, wherein an increase in the PF4 level at said second time point over that at said first time point indicates that an angiogenic tumor is present.
9. The method of claim 1, 2, 4, 5, or 8, wherein the sample is selected from the group consisting of whole blood, serum, plasma, platelets and megakaryocytes.
12751790 2 56
10. The method of claim 1, 2, 4, 5, or 8, wherein said first and second time points are 1, 2 or 3 months apart.
11. The method of claim 3, 4, 5 or 8, wherein the anti-angiogenic therapy is an agent that antagonizes VEGF or bFGF signaling.
12. The method of claim 11, wherein the agent is an antibody directed against VEGF.
13. The method of any of claim 1, 2 4, 5, or 8, wherein the level of PF4 is determined by an antibody-based moiety method, by quantitative RT-PCR or by mass spectrometry.
14. The method of any of claim 1, 2 4, 5, or 8, wherein the levels of PF4 at the first and second time points are determined by the same method.
12751790 2 57
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US11570508P | 2008-11-18 | 2008-11-18 | |
| US61/115,705 | 2008-11-18 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010059541A1 true WO2010059541A1 (en) | 2010-05-27 |
Family
ID=41571084
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2009/064517 Ceased WO2010059541A1 (en) | 2008-11-18 | 2009-11-16 | Platelet-derived pf4 as efficacy marker for anti-angiogenic therapies |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2010059541A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013010274A1 (en) * | 2011-07-19 | 2013-01-24 | Wilfred Jefferies | Methods for diagnosing and treating alzheimer's disease by administering an ανίίangiogenic agent |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006022895A2 (en) * | 2004-08-02 | 2006-03-02 | Children's Medical Center Corporation | Platelet biomarkers for cancer |
| WO2006052788A2 (en) * | 2004-11-04 | 2006-05-18 | Monogram Biosciences, Inc. | Detection of activation of endothelial cells as surrogate marker for angiogenesis |
| WO2007022412A2 (en) * | 2005-08-18 | 2007-02-22 | The General Hospital Corporation | Combination therapy for preventing angiogenesis comprising a inhibitor ofhif-1 and a further anti-angiogenic agent |
-
2009
- 2009-11-16 WO PCT/US2009/064517 patent/WO2010059541A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006022895A2 (en) * | 2004-08-02 | 2006-03-02 | Children's Medical Center Corporation | Platelet biomarkers for cancer |
| WO2006052788A2 (en) * | 2004-11-04 | 2006-05-18 | Monogram Biosciences, Inc. | Detection of activation of endothelial cells as surrogate marker for angiogenesis |
| WO2007022412A2 (en) * | 2005-08-18 | 2007-02-22 | The General Hospital Corporation | Combination therapy for preventing angiogenesis comprising a inhibitor ofhif-1 and a further anti-angiogenic agent |
Non-Patent Citations (1)
| Title |
|---|
| CACCIOLA E ET AL: "Treatment of essential thrombocythemia with anagrelide: A novel antiangiogenic agent?", BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 104, no. 11, Part 2, 1 November 2004 (2004-11-01), pages 269B, XP009128762, ISSN: 0006-4971 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013010274A1 (en) * | 2011-07-19 | 2013-01-24 | Wilfred Jefferies | Methods for diagnosing and treating alzheimer's disease by administering an ανίίangiogenic agent |
| CN103974714A (en) * | 2011-07-19 | 2014-08-06 | 威尔弗雷德·杰弗里斯 | Alzheimer's disease diagnosis and treatment |
| CN105749282A (en) * | 2011-07-19 | 2016-07-13 | 威尔弗雷德·杰弗里斯 | Alzheimer's disease diagnosis and treatment |
| US10792347B2 (en) | 2011-07-19 | 2020-10-06 | Alternative Extracts Inc. | Methods for diagnosing and treating Alzheimer's disease |
| AU2020204610B2 (en) * | 2011-07-19 | 2022-05-26 | Cava Healthcare Inc. | Methods for diagnosing and treating alzheimer’s disease |
| US11925678B2 (en) | 2011-07-19 | 2024-03-12 | Cava Healthcare Inc. | Methods for diagnosing and treating Alzheimer's disease |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Apostolidis et al. | Single cell RNA sequencing identifies HSPG2 and APLNR as markers of endothelial cell injury in systemic sclerosis skin | |
| US20080038192A1 (en) | Diagnostic Methods Of Multiple Organ Amyloidosis | |
| US20100166739A1 (en) | Methods and Compositions for Diagnosing Urological Disorders | |
| US10712349B2 (en) | Circulating KIM-1 levels for detection of pathologies associated with injury to, or cancer of, the kidney | |
| WO2015160805A1 (en) | Circulating kim-1 levels for detection of pathologies associated with injury to, or cancer of, the kidney | |
| He et al. | ITGA2 protein is associated with rheumatoid arthritis in Chinese and affects cellular function of T cells | |
| US20170315119A1 (en) | Urinary biomarkers for sle and lupus nephritis | |
| US20160169901A1 (en) | Methods for diagnosis of cutaneous t-cell lymphoma | |
| AU2016273230B2 (en) | Biomarkers for a combination therapy comprising lenvatinib and everolimus | |
| JP2021523351A (en) | Biomarkers for combination therapy with lenvatinib and PD-1 antagonists | |
| EP3861347B1 (en) | Biomarkers for a combination therapy comprising lenvatinib and everolimus | |
| US9944718B2 (en) | ADAM22 for use as a prognostic variable, and target for therapy, of a metastatic breast cancer disease | |
| WO2010059541A1 (en) | Platelet-derived pf4 as efficacy marker for anti-angiogenic therapies | |
| Shi et al. | Dickkopf-related protein 2 impairs neurovascular Wnt signalling and worsens stroke outcome | |
| Wang et al. | MAVS/CMTM6 axis couples mitochondrial homeostasis to immunogenic senescence via CCL3-driven T-cell recruitment in renal carcinoma | |
| US12504431B2 (en) | Biomarkers for a therapy comprising a sorafenib compound | |
| JP2014095643A (en) | Screening method for inflammatory disease therapeutic agent, and treatment and inspection of inflammatory disease | |
| US20240410887A1 (en) | Use of biomarkers in diagnosing and treating lupus nephritis | |
| WO2009098656A2 (en) | Method for predicting or diagnosing outcome of intracranial tumors in a subject | |
| Barinotti | IDENTIFICATION OF NOVEL BIOMARKERS OF KIDNEY FIBROSIS SUITABLE FOR HIGH-THROUGHPUT SCREENING OF ANTI-FIBROTIC AGENTS | |
| Xue et al. | The decreasion of integrin α5β1/FAK associates with increased apoptosis of aortic smooth muscle cells in acute type A aortic dissection | |
| WO2025056812A1 (en) | Biomarker for cancer | |
| WO2023150294A2 (en) | Methods of detecting and treating cerebral aneurysms |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09756221 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 09756221 Country of ref document: EP Kind code of ref document: A1 |




