WO2010055310A1 - Herbicidal compositions - Google Patents

Herbicidal compositions Download PDF

Info

Publication number
WO2010055310A1
WO2010055310A1 PCT/GB2009/002674 GB2009002674W WO2010055310A1 WO 2010055310 A1 WO2010055310 A1 WO 2010055310A1 GB 2009002674 W GB2009002674 W GB 2009002674W WO 2010055310 A1 WO2010055310 A1 WO 2010055310A1
Authority
WO
WIPO (PCT)
Prior art keywords
inhibitors
mhz
inhibition
plant
alkyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2009/002674
Other languages
French (fr)
Inventor
Andrew Thompson
Martin Sergeant
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Warwick
Original Assignee
University of Warwick
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Warwick filed Critical University of Warwick
Publication of WO2010055310A1 publication Critical patent/WO2010055310A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N37/00Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids
    • A01N37/18Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing the group —CO—N<, e.g. carboxylic acid amides or imides; Thio analogues thereof
    • A01N37/28Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing the group —CO—N<, e.g. carboxylic acid amides or imides; Thio analogues thereof containing the group; Thio analogues thereof

Definitions

  • the invention relates to new herbicidal compositions.
  • Carotenoids are synthesised in plants and micro-organisms as photoprotective molecules and are key components in animal diets, an example being ⁇ -carotene (pro-vitamin A).
  • the oxidative cleavage of carotenoids occurs in plants, animals, and micro-organisms and leads to the release of a range of apocarotenoids that function as signalling molecules with a diverse range of functions (1).
  • the first gene identified as encoding a carotenoid cleavage dioxygenase (CCD) 1 was the maize Vpl4 gene that is required for the formation of abscisic acid (ABA), an important hormone that mediates responses to drought stress and aspects of plant development such as seed and bud dormancy (2).
  • ABA abscisic acid
  • the VP14 enzyme cleaves at the 11,12 position (Fig. 1) of the epoxycarotenoids 9'-ci5-neoxanthin and/or 9-ct.y-violaxanthin and is now classified as a 9-cw-epoxycarotenoid dioxygenase (NCED) (3), a subclass of the larger CCD family.
  • NCED 9-cw-epoxycarotenoid dioxygenase
  • CCDs have been identified where biological function is unknown, for example in Cyanobacteria where a variety of cleavage specificities have been described (10-12). In other cases there are apocarotenoids with known functions, but the identity or involvement of CCDs have not yet been described: grasshopper ketone is a defensive secretion of the flightless grasshopper Romalea microptera (13), mycorradicin is produced by plant roots during symbiosis with arbuscular mycorrhyza (14), and strigolactones (15) are plant metabolites that act as germination signals to parasitic weeds such as Striga and Orobanche (16).
  • strigolactones also function as a branching hormone in plants (17,18).
  • the existence of such a branching hormone has been known for some time, but its identity proved elusive.
  • the hormone was derived from the action of at least two CCDs, max3 and max4 (more axillary growth) (19), because deletion of either of these genes in Arabidopsis thaliana, leads to a bushy phenotype (20,21).
  • CCDs max3 and max4 (more axillary growth) (19)
  • AtCCD7 (max3) cleaves ⁇ -carotene at the 9,10 position and the apocarotenoid product (10- apo- ⁇ -carotene) is reported to be further cleaved at 13,14 by AtCCD8 (max4) to produce 13- apo- ⁇ -carotene (22). Also recent evidence suggests that AtCCD8 is highly specific, cleaving only 10-apo- ⁇ -carotene (23). How the production of 13-apo- ⁇ -carotene leads to the synthesis of the complex strigolactone is unknown. The possibility remains that the enzymes may have different specificities and cleavage activities in planta.
  • cytochrome P450 enzyme (24) is believed to be involved in strigolactone synthesis and acts in the pathway downstream of the CCD genes. Strigolactone is thought to effect branching by regulating auxin transport (25). Because of the involvement of CCDs in strigolactone synthesis, the possibility arises that plant architecture and interaction with parasitic weeds and mycorrhyza could be controlled by the manipulation of CCD activity.
  • small molecules are identified that are active against known target proteins; they are then applied to a biological system to investigate protein function in vivo (28,29).
  • This approach is complementary to conventional genetics since the small molecules can be applied easily to a broad range of species, their application can be controlled in dose, time and space to provide detailed studies of biological functions, and individual proteins or whole protein classes may be targeted by varying the specificity of the small molecules.
  • functions of the plant hormones gibberellin, brassinosteroid and abscisic acid have been successfully probed using this approach by adapting triazoles to inhibit specific cytochrome P450 monooxygenases involved in the metabolism of these hormones (30).
  • abamine In the case of the CCD family, the tertiary amines abamine (31) and the more active abamineSG (32) were reported as specific inhibitors of NCED, and abamine was used to show new functions of abscisic acid in legume nodulation (33).
  • the original aim of the Inventors was to study the inhibition of carotenoid cleavage dioxygenase and to identify compounds which increased shoot branching.
  • the Inventors unexpectedly identified a class of compounds that, instead of causing shoot branching, caused leaf bleaching, growth inhibition and/or death when applied to plants.
  • the Inventors found that an aryl group, such as an alkoxy-aryl or hydroxy-aryl group, when linked through a hydroxamic acid linker to a hydrophobic group, is used, this inhibited growth in plants or killed plants.
  • the invention therefore provides a herbicidal formulation comprising a compound of formula I
  • Ri is alkyl or H
  • R 2 , R 3 , R 4 and R 5 are independently selectable from H, halide, -NO 2 , -SO 2 R', -OH, -Oalkyl where R' is alkyl or aminoalkyl;
  • R 6 is hydrophobic group, such as a substituted or non-substituted alkyl, and/or substituted or non-substituted aryl.
  • Ri is preferably a Ci - C 4 alkyl, such as methyl, ethyl, propyl or butyl, especially methyl. Ri may also be H. R 2 , R 3 , R 4 and R 5 may all be H. Alternatively, one, two or three of those side groups may be H, the other side groups being alternative side groups.
  • the alkyl moiety of the -Oalkyl group is preferably a C 1 - C 4 alkyl, such as methyl, ethyl, propyl or butyl.
  • R5 may be Omethyl.
  • the remaining substituents, R 2 , R 3 and R 4 may be H where R 5 is -
  • R 6 is preferably a hydrophobic group.
  • R 6 may be a Ci - Ci 2 alkyl, most preferably a C 5 - Qo alkyl.
  • R 6 may be any one of a Ci, C 2 , C 3 , C 4 , C 5 , C 6 , C 7 , C 8 , C 9 , Ci 0 , Cn or Ci 2 alkyl.
  • R 6 may be a substituted alkyl or a substituted aryl.
  • the alkyl or aryl groups may be substituted with one or more halides, -OH, -NO 2 or -SO 2 .
  • the herbicidal formulation comprises R 6 of formula EL
  • R 7 is -H, -OH, -NO 2 , -SO 2 or halide.
  • halide includes fluorine, chlorine, bromine or iodine, most preferably fluorine.
  • the herbicidal effects of the compounds were unexpected.
  • the length of the hydroxamic acid linker to the hydrophobic group has been shown to be important and affects the activity of the compounds.
  • the site of action of the compound is not clear. It may be the enzyme p- hydroxyphenylpyruvate dioxygenase (HPPD), a known herbicide target.
  • HPPD p- hydroxyphenylpyruvate dioxygenase
  • HPPD substrate has some similarities to the structure of Fl and F2, two examples of the herbicidal compound of the invention. However, it contains an extra carbon atom in the linker. Longer linkers were not observed by the inventors to produce growth inhibition,
  • HPPD inhibitors are shown in the article by Grossman K and Ehrhardt T (Pest Manag.Sci).
  • the herbicidal formulation of the invention additionally comprise one or more adjuvants.
  • Adjuvants for use in herbicidal compositions are generally known in the art. These include oil-based adjuvants and mixtures, organosilicone-based adjuvants and mixtures, non-ionic based adjuvants and mixtures, polymeric-based adjuvants and mixtures, and fatty acid- based adjuvants and mixtures, and combinations thereof. Mineral oil may be added as an adjuvant.
  • the adjuvants may be added as l%-95% by weight of the active ingredients.
  • the herbicidal composition may also comprise, or additionally comprise, a solid material, such as a clay, silica or other inert solid carrier generally known in the art.
  • a solid material such as a clay, silica or other inert solid carrier generally known in the art.
  • the herbicidal composition may be applied as a solid or a liquid.
  • the liquid media used may comprise, for example, water, kerosene, xylene, an alcohol such as ethanol. Mixtures of such liquids may be used. These may be utilised in combination with surface active agents to improve the wetting of the plant or seed.
  • the herbicidal formulation may be applied directly onto the plant or applied to the soil.
  • compositions are known to be effective at, for example, 100 micromolar concentrations.
  • the invention also provides a method of killing or inhibiting growth of a plant, comprising applying to a seed or a plant a herbicidal formulation according to the invention.
  • a further aspect of the invention provides an isolated compound of formula I, as defined above.
  • the isolated compound has a formula of formula III:
  • FIGURE 1 A first figure.
  • FIGURE 2 is a diagrammatic representation of FIGURE 1
  • Protonated abamine (a), a carotenoid carbocation intermediate (b) and a hydroxamic acid inhibitor (c) are shown bound to iron(II) cof actor of a CCD.
  • CCD genes were expressed in E. coll strains that produce ⁇ -carotene.
  • the strains were grown in the presence or absence of inhibitors (100 ⁇ M) for 16 hours. This concentration of inhibitor was within the linear range of the E. coli. response (see Figure 9).
  • the relative inhibition of each class of CCD was determined by the increase in ⁇ -carotene accumulation in the presence of the inhibitor, a value of 0 would indicate ⁇ -carotene levels equal to when no inhibitor was present and a value of 100 would equal the maximum level of ⁇ -carotene as observed in strains lacking a CCD (see
  • the graph shows lag time before the commencement of bud outgrowth for CoI-O (WT) in the presence or absence of 100 ⁇ M inhibitor.
  • WT CoI-O
  • the floating black bar represents the least significant difference for comparison of any two means, and asterisks indicate values significantly different from the WT (P ⁇ 0.05).
  • Bl, D12 and D13 were prepared by activation of the appropriate acid with methyl chloroformate and triethylamine in THF, and reaction with hydroxylamine hydrochloride.
  • the intermediate for synthesis of Bl was synthesised from ⁇ -ionone (36); Bl was isolated as a 2: 1 mixture of E/Z isomers. Spectroscopic data and yields for analogues D1-D13, Fl-4, and Bl are available as supplemental data.
  • This aliquot of enzyme was then added to an assay (150 ⁇ l total volume) containing 100 mM bis-tris buffer (pH 6.7), 0.05% v/v Triton X-100, 1.0 mg/ml catalase, and 3 ⁇ g 9'-cw-neoxanthin.
  • the 9'-cw-neoxanthin substrate was prepared as described in supplemental methods.
  • the enzyme assay was incubated for 15 min in the dark at 2O 0 C. Water (700 ⁇ l) was then added, and the products extracted with ethyl acetate (3 x 1 ml).
  • NCED inhibition assays contained 1-100 ⁇ M inhibitor; inhibition was calculated from the product formation after 15 min, compared to a control assay with no inhibitor present. Retention times: 9'-cw-neoxanthin, 10.2 min; C 25 product, 6.5 min.
  • LeCCDIa enzyme assay We over-expressed LeCCDIa in E. coli, as a GST-fusion protein (supplemental methods). The in vitro assay of LeCCDIa was based on reported methods (37), and was carried out in a 200 ⁇ l total volume in a 96-well microtitre plate, with the signal detected at 485 nm.
  • the relative inhibition was calculated by the equation: (Q- CcV(Ci-Cc) x 100, where Ci is the carotenoid level with inhibitor and CCD present, C c is the level with CCD but without the inhibitor and Ci is the level in a strain where lacZ is expressed instead of the CCD, and no inhibitor is present.
  • Q-C c the increase in ⁇ -carotene due to inhibition of the CCD
  • Wild-type (ecotype Col-0) and the max3-9 mutant in the CoI-O background (21) were grown in double Magenta pots (Sigma) on 30 ml ATS media (39) containing 1% sucrose and 0.8% agar, supplemented, where stated, with 100 ⁇ M inhibitor from a 100 raM stock in ethanol. Seeds were sterilized by immersion for 1 min in 70% ethanol and 4 min in 50% household bleach before being washed 5 times in distilled water.
  • Axillary bud outgrowth assay in Arabidopsis stem sections The assays were performed essentially as described (40) with the following modifications. Small Petri dishes (50 mm diameter, 20 mm depth) were filled with 10 ml of ATS (39) supplemented with 1% agar and 1% sucrose. Inhibitors and ⁇ -naphthalene acetic acid (NAA) were added to the agar before pouring to give 100 ⁇ M and 1 ⁇ M, respectively. Thus, when the central strip was cut out of the agar, both the apical and basal media contained both NAA and inhibitor.
  • Plasmids were prepared using Qiaprep plasmid mini spin kits (Qiagen) and PCR products and cut vector were purified using QiaQuick columns (Qiagen), following manufacturer's instructions. PCR was carried out using HiFi Expand (Roche) DNA polymerase following manufacturer's instructions. Ligations were performed with T4 DNA ligase (Invitrogen) for 1 hour at 25 0 C. Constructs were initially cloned into E. coli DHlOB cells (Stratagene) and were sequenced to ensure that no PCR errors had taken place.
  • the LeCCDIa gene (AY576001) was amplified from cLET29I6 (obtained from The Institute for Genomic Research (TIGR) tomato gene index) using primers LeCCDIa-FCl:- TACGAATTCCATATGGGGAGAAAAGAAGATG and LeCCDIa-RCl:-
  • the product was cut with Ndel and Xhol and ligated into similarly cut pET30c (Novagen, VWR International, Ltd). In addition, the product was cut with EcoRl and Xhol and ligated into the similarly cut pGEX-4T (GE Healthcare).
  • AtCCD7 gene was amplified from pCR2.1-AtCCD7, kindly supplied by Ottoline Leyser (University of York), using the primers AtCCD7-FC3
  • the PCR product was cut with BgIR and Xhol and cloned into ⁇ mHI/S ⁇ /I-cut pGEX-4T.
  • the MmBCOl (AF294899) was amplified from the clone IMGCLO2192191 obtained from Geneservice Ltd. (Cambridge, UK) using the primers MmBCOl-FCl TACTGAATTCCATATGGAGATAATATTTGGC and MmBCOl-RCl
  • the MmBCOl gene (AJ290392) was amplified from the clone IMGCLO2536812 (Geneservice Ltd.) using the primers MmBC02-FCl
  • the LeNCEDl cDNA (Z97215) was provided by Ian Taylor (University of Nottingham) and was cloned into the Ndel and BpullO2 sites of vector pET14b (Novagen, VWR International, Ltd) to provide an N-terminal fusion to a HiS 6 tag.
  • the plasmid was expressed in E. coli Rosetta (DE3) cells (Novagen, VWR International, Ltd). Details of strains used for inhibitor assays in E.coli are also given in Supplemental Table Sl, below.
  • the combined extract was partitioned between cold diethyl ether and saturated sodium chloride. The ether extract was collected, and the aqueous layer was re- extracted twice with cold diethyl ether. The ether extracts were combined, and solvent was removed by rotary evaporation below 32°C.
  • the solid spinach extract was applied in diethyl ether/petroleum ether (1:5), and the column washed with diethyl ether/petroleum ether (1: 1, 50 ml), diethyl ether (50 ml), and 5% ethanol in diethyl ether (50 ml), which finally eluted 9'-cw-neoxanthin.
  • the 9'-cw-neoxanthin fraction was dried with nitrogen and stored in vials wrapped with foil under nitrogen at -20 0 C.
  • Data R f 0.09 (silica, Et 2 O); l max 415, 439, 467 nm; m/z (FAB + ) 600.33, calc. 600.87 for C 40 H 56 O 4 .
  • NCED Inhibitor design and synthesis — NCED was proposed to be a dioxygenase (3), with a reaction mechanism involving a carbocation intermediate, followed by formation of a dioxetane ring or a Criegee rearrangement prior to cleavage (41); such a mechanism was supported by 18 O labelling experiments with AtCCDl (37), and was the most likely mechanism based on computational studies of the ACO crystal structure (42).
  • Hydroxamic acids are known to act as inhibitors of several different classes of metalloenzymes, such as the matrix metalloproteases, by chelation of the essential metal ion cofactor (43). Therefore, hydroxamic acid analogues were synthesised, in which the hydroxy- cyclohexyl terminus of the carotenoid substrate was mimicked as above by an oxygenated aromatic ring, and the hydroxamic acid functional group was positioned at variable distance from the aromatic ring. Thus, a collection of aryl-C 3 N analogues (D8-D13), aryl-C 2 N analogues (D1-D7), and aryl-dN analogues (F1-F4) was also synthesised (Table 1).
  • the 4- fluorobenzyl substituent found to promote activity in the abamine series (31), was included in the collection of hydroxamic acids.
  • the synthetic route, shown in Fig. 2 involves coupling of the appropriate acid with a substituted O-benzyl hydroxylamine, followed by deprotection.
  • One hydroxamic acid containing a longer C 5 spacer from a cyclohexyl moiety (Bl) was also synthesised from ⁇ -ionone.
  • a set of 18 hydroxamic acids was then used for inhibitor screening; numbering of chemical compounds is given in Table 1. Table 1.
  • Enzyme assays using E. coli cell extracts containing the recombinant CCD, were initially carried out at 100 ⁇ M inhibitor concentration; for compounds showing > 90% inhibition of LeCCDl at this concentration, IC 50 values were also determined. NT, not tested. Chemical structures hydroxamic acid inhibitors are shown below, with X and Y given in the table. The structure of abamine is given in Fig. 3.
  • E. coli strains expressing CCDs Coloured E. coli strains that produce various carotenoids can be constructed by expression of enzymes for carotenoid synthesis (26). Upon co-expression of the appropriate CCD, the bacteria lose their colour due to cleavage of the carotenoids to colourless products (4,6,27).
  • This technique was employed here to further explore the specificity of inhibitors, and to test their activity in vivo.
  • the level of carotenoid in each CCD-expressing strain was compared to the level of the carotenoid in a control strain producing ⁇ -carotene but lacking any CCD gene. The difference in the carotenoid levels gave a measure of CCD activity, and inhibition of this activity was measured by addition of inhibitors to the growing medium.
  • the inhibitors were tested against four ⁇ -carotene-producing E. coli strains (supplemental Table Sl).
  • Three of the strains expressed highly divergent CCDs that cleave at the 9,10 position: AtCCD7 from Arabidopsis (21) and MmBCO2 from mouse (6) which both cleave at a single site (9,10 or 9',10' but not both), and the tomato enzyme LeCCDIa (44) which cleaves at both sites in the same substrate molecule (9,10/9',1O' activity).
  • the fourth strain expressed another mouse CCD, MmBCOl (47), which cleaves centrally at 15,15'.
  • the compounds showed different patterns of inhibition against the three 9,10 enzymes (Fig. 4).
  • the activity of the compounds against LeCCDIa in vivo (Fig. 4) mirrored the activity observed in vitro (Table 1): D5 and D6 exhibited relatively weaker inhibition activity than the other D compounds and F3 exhibited virtually none.
  • a different pattern was obtained with AtCCD7 in the E. coli system (Fig. 4), with the compounds Fl and F2, which exhibited good activity against LeCCDIa, showing poor inhibition.
  • Fl and F2 were the most effective compounds at inhibiting MmBCO2 (Fig. 4).
  • the 15,15' cleavage enzyme MmBCOl was not inhibited to any significant extent by any of the compounds tested (Fig. 4).
  • AtCCD7 (Arabidopsis thaliana) NM_130064 9,10 pGEX-4t (GST) LeCCD 1 a ⁇ Solarium lycopersicum) A Y576001 9, 10/9', 10' pET30 (none) MmBC02 (Mm musculus) AJ290392 9,10 pET30 (none)
  • MmBCOl (Mus musculus) AF294899 15,15' pET30 (none)
  • Figure 7 shows that inhibitors Fl and F2 inhibit growth of Arabidopsis plants grown in agar media. This shows that the compounds have a herbicidal activity against the plants.
  • the Inventors have designed and tested a new class of inhibitor of the carotenoid cleavage dioxygenase family that is based on a structural mimic of the substrate that positions an iron- chelating hydroxamic acid group within the active site. Positioning was achieved by varying the distance between the hydroxamic acid and an aromatic ring so that it matched the distance within the carotenoid substrate between the proximal cyclic end-group and the cleavage site. Crystal structure of ACO, a cyanobacterial CCD, indicates that cleavage position is likely to be determined by the distance between the Fe(II) catalytic centre and the opening of the long non-polar tunnel that allows access to carotenoid substrates (11).
  • aryl-CiN, aryl-C 2 N and aryl-C 3 N compounds would be selective for 7,8, 9,10 and 11,12 cleavage reactions, respectively; we tested these classes against enzymes with 9,10, 11,12 and 15,15' specificities.
  • Certain aryl-CiN compounds (Fl, F2) were effective inhibitors of 9,10 but not 11,12 or 15,15' cleavages.
  • the aryl-C 2 N compounds were potent inhibitors of 9,10 enzymes, but also had a moderate 11,12 inhibition activity.
  • the aryl-C 3 N compounds were much less potent against 9,10 enzymes, and although this group contained the best 11,12 inhibitor (D8), they all still maintained a somewhat greater selectivity towards the 9,10 cleavage.
  • the inhibitors also exhibited different patterns of activity in E. coli against the three different enzymes with 9,10 cleavage activity.
  • Fl and F2 had high inhibitory activity against LeCCDl and MmBCO2 but were relatively ineffective against AtCCD7.
  • MmBCO2 shares only 17-23% amino acid identity with the two plant 9,10 enzymes (LeCCDIa and AtCCD7), which are themselves highly divergent, with only 19% identity to each other. This indicates that the variants of the hydroxamic inhibitors are able to distinguish between enzymes that have similar activities but highly divergent primary structure.
  • the E. coli system proved useful in measuring the efficacy of the inhibitors in vivo.
  • the E. coli assays showed Fl and F2 were poor inhibitors against AtCCD7 and this was confirmed in the Arabidopsis bud outgrowth assay (Fig. 5), which measures AtCCD7 and/or AtCCD8 activity.
  • Fig. 5 Arabidopsis bud outgrowth assay
  • D5 and D6 were poor in the E. coli assays they showed the largest effect on whole Arabidopsis plants, giving the greatest number of side branches.
  • Dl and D3 appeared to be good inhibitors of the 9,10 enzymes in vitro (Table 1), in E. coli (Fig. 4) and in the bud outgrowth assay (Fig.
  • D3 had negative effects on growth which confounded the branching assay in whole plants, whereas plants treated with Dl grew normally and without an increase in branching.
  • Dl and D3 both contained a more polar hydroxyl group on the aryl ring, therefore it is possible that these compounds are more actively transported in the plant, or metabolised more rapidly.
  • the aryl-CiN inhibitors Fl and F2 which differ only by a single fluorine, caused bleaching of leaves when applied to whole Arabidopsis plants. It is known that a deficiency of the photoprotective carotenoids, e.g. as caused by the application of herbicides that are inhibitors of phytoene desaturase (50), results in photooxidative breakdown of chlorophyll and therefore leaf bleaching. Further, the Arabidopsis variegated 3 (var3) mutant, which is reported to interact with AtCCD4 in vitro, exhibits a bleached phenotype and retardation of chloroplast development (51).
  • the aryl-QN compounds were expected to favour inhibition of CCDs with 7,8 activity, and AtCCD4 sequence is most closely related to the 7,8 cleavage enzyme CsZCD (9), hence a possible explanation for the effect of Fl and F2 may be that they inhibited the action of the Var3/AtCCD4 complex, so giving a similar phenotype to the var3 mutant.
  • Screening for Arabidopsis mutants resistant to bleaching by Fl or F2 may allow the target protein to be identified, as demonstrated for other small molecules (52).
  • the different activities observed in different assays suggest that factors such as uptake, metabolism, and effects on non-target processes may play a role in determining the suitability and effectiveness of the inhibitors in planta.
  • HPPD 4-hydroxyphenylpyruvate dioxygenase enzyme
  • E. coli cells expressing the Arabidopsis HPPD enzyme, (BL21 pAtHPPD) were obtained from Graham Moran, University of Wisconsin. One quarter of an overnight plate of BL21(p ATHPPD) was re-suspended in 10 ml of Lauria Bertini broth (LB, Merck). This was used to inoculate a one litre flask containing 400 ml of LB. The cells were grown for 3 hours at 37 0 C, before induction with O.lmM IPTG. Cells were induced for 16 hours at 2O 0 C and harvested by centrifugation (5000 rpm,10 min, 4 0 C).
  • the cell pellet was re-suspended in 10OmM KPO 4 (pH 7.3) containing 100 ⁇ g ml "1 lysozyme and mini-protease (Roche). After 10 minutes incubation at room temperature, the cell suspension was lysed by sonication (4 x 1 minute at 18 ⁇ ). The lysate was cleared by centrifugation (13000 rpm, 15 minutes, 4°C) with the supernatant being stored at -8O 0 C. The protein concentration of the lysate was measured using the bicinchoninic acid assay (Invitrogen). HPPD activity was measured using a modification of the enol-borate assay (57).
  • the reaction buffer consisted of 0.8M K 2 HPO 4 , 0.4M orthoboric acid, 0.2M Tris (pH7.5), 15 mM sodium ascorbate, 250 ⁇ g ml "1 bovine catalase and 100 ⁇ M FeSO 4 .
  • the solution was left to equilibrate for 10 minutes at room temperature before addition of 10 ⁇ l of the crude enzyme lysate diluted in 90 ⁇ l HEPES (pH 7.3).
  • the Ic50 value for Fl was calculated as 11.46 ⁇ M and that of the commercial HPPD herbicide sulcotrione was 0.027 ⁇ M, using the program BioDataFit (http://www.changbioscience.com/stat/ec50.html) and the sigmoidal and a exp(- bx)+c models respectively.
  • More detailed kinetic assays were performed on his-tagged, purified AtHPPD. This was created by amplifying the AtHPPD gene from the pAtHPPD plasmid and ligating into the vecor pET30c (Novagen).
  • the primers used were GAC GGA TCC CTA TGG GCC ACC AAA AC and GAC CTC GAG TCA CAC TAA CTG.
  • the reaction consisted of 0.75 ⁇ l of Expand HiFi (Roche), lO ⁇ M of each primer, 10 mM dNTPs, 5 ⁇ l of 10x reaction buffer (Roche) in 50 ⁇ l of H 2 O.
  • the cycling conditions were 94 0 C for 2min, followed by 10 cycles of 94 0 C for 15 sec; 48 0 C for 30 sec; 72°C for 90 sec. This was followed by 20 cycles of the same except with an extra 5 seconds on the 72 0 C step for every subsequent cycle, with a final step of 72 0 C for 7 min.
  • the PCR product was run on a 0.7% agarose gel, excised and purified using a Quiaquick column (Qiagen). The fragment, alongside with the vector were then cut with BamHl and Xhol and both were purified with a Quiaquick column.
  • plasmid Approximately 50 ng of plasmid was added to lOOng of fragment and they were ligated in a 20 ⁇ l volume using T4 DNA ligase (invitrogen) for 1 hour at 25 0 C. The ligation mix was electroporated into DHlOB cells and transformants selected on kanamycin (100 ⁇ g ml "1 ). Putative clones were restriction mapped and sequenced. The constructed plasmid (pET-AtHHPD) was then transformed into BL21.
  • T4 DNA ligase invitrogen
  • BL21(pET- AtHHPD) cells were induced and harvested as previously mentioned, except the cell pellet was re-suspended and in 50 mM KPO 4 pH7.3;0.5M NaCl; 100 ⁇ g ml "1 lysozyme.
  • the cleared lysate was the passed through a HisTrap FF column (GE Healthcare) which was washed with 100 mM KPO 4 pH7.3; 200 mM NaCl; 20 mM imidizole.
  • the protein was eluted by increasing the concentration of imidizole to 10OmM.
  • the eluted fractions containing the protein were pooled and buffer exchanged to 100 mM KPO 4 by ultrafiltration using an Ultra- 15 centrifugal filter (Amicon).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Agronomy & Crop Science (AREA)
  • Pest Control & Pesticides (AREA)
  • Plant Pathology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Dentistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Environmental Sciences (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

A herbicidal formulation comprising a compound of formula (I) where R1 is alkyl or H; R2, R3, R4 and R5 are independently selectable from H, halide, -NO2, -SO2R', -OH, -Oalkyl where R' is alkyl or aminoalkyl; and R6 is a substituted or non-substituted alkyl, and/or substituted or non-substituted aryl.

Description

HERBICIDAL COMPOSITIONS
Field of the Invention
The invention relates to new herbicidal compositions.
Background to the Invention
Carotenoids are synthesised in plants and micro-organisms as photoprotective molecules and are key components in animal diets, an example being β-carotene (pro-vitamin A). The oxidative cleavage of carotenoids occurs in plants, animals, and micro-organisms and leads to the release of a range of apocarotenoids that function as signalling molecules with a diverse range of functions (1). The first gene identified as encoding a carotenoid cleavage dioxygenase (CCD)1 was the maize Vpl4 gene that is required for the formation of abscisic acid (ABA), an important hormone that mediates responses to drought stress and aspects of plant development such as seed and bud dormancy (2). The VP14 enzyme cleaves at the 11,12 position (Fig. 1) of the epoxycarotenoids 9'-ci5-neoxanthin and/or 9-ct.y-violaxanthin and is now classified as a 9-cw-epoxycarotenoid dioxygenase (NCED) (3), a subclass of the larger CCD family.
Since the discovery of Vpl4, many other CCDs have been shown to be involved in the production of a variety of apocarotenoids (Fig. 1). In insects, the visual pigment retinal is formed by oxidative cleavage of β-carotene by β-carotene-15,15'-dioxygenase (4). Retinal is produced by an orthologous enzyme in vertebrates, where it is also converted to retinoic acid, a regulator of differentiation during embryogenesis (5). A distinct mammalian CCD is believed to cleave carotenoids asymmetrically at the 9,10 position (6) and, although its function is unclear, recent evidence suggests a role in the metabolism of dietary lycopene (7). The plant volatiles β-ionone and geranylacetone are produced from an enzyme that cleaves at the 9,10 position (8) and the pigment α-crocin found in the spice saffron results from an 7,8- cleavage enzyme (9).
Other CCDs have been identified where biological function is unknown, for example in Cyanobacteria where a variety of cleavage specificities have been described (10-12). In other cases there are apocarotenoids with known functions, but the identity or involvement of CCDs have not yet been described: grasshopper ketone is a defensive secretion of the flightless grasshopper Romalea microptera (13), mycorradicin is produced by plant roots during symbiosis with arbuscular mycorrhyza (14), and strigolactones (15) are plant metabolites that act as germination signals to parasitic weeds such as Striga and Orobanche (16).
Recently it was discovered that strigolactones also function as a branching hormone in plants (17,18). The existence of such a branching hormone has been known for some time, but its identity proved elusive. However, it was known that the hormone was derived from the action of at least two CCDs, max3 and max4 (more axillary growth) (19), because deletion of either of these genes in Arabidopsis thaliana, leads to a bushy phenotype (20,21). In E. coli assays, AtCCD7 (max3) cleaves β-carotene at the 9,10 position and the apocarotenoid product (10- apo-β-carotene) is reported to be further cleaved at 13,14 by AtCCD8 (max4) to produce 13- apo- β-carotene (22). Also recent evidence suggests that AtCCD8 is highly specific, cleaving only 10-apo-β-carotene (23). How the production of 13-apo-β-carotene leads to the synthesis of the complex strigolactone is unknown. The possibility remains that the enzymes may have different specificities and cleavage activities in planta. In addition, a cytochrome P450 enzyme (24) is believed to be involved in strigolactone synthesis and acts in the pathway downstream of the CCD genes. Strigolactone is thought to effect branching by regulating auxin transport (25). Because of the involvement of CCDs in strigolactone synthesis, the possibility arises that plant architecture and interaction with parasitic weeds and mycorrhyza could be controlled by the manipulation of CCD activity.
Although considerable success has been obtained using genetic approaches to probe function and substrate specificity of CCDs in their native biological contexts, particularly in plant species with simple genetic systems or that are amenable to transgenesis, there are many systems where genetic approaches are difficult or impossible. Also, when recombinant CCDs are studied either in vitro or in heterologous in vivo assays, such as in E. coli strains engineered to accumulate carotenoids (26), they are often active against a broad range of substrates (5,21,27), and in many cases the true in vivo substrate of a particular CCD remains unknown. Therefore additional experimental tools are needed to investigate both apocarotenoid and CCD functions in their native cellular environments.
In the reverse chemical genetics approach, small molecules are identified that are active against known target proteins; they are then applied to a biological system to investigate protein function in vivo (28,29). This approach is complementary to conventional genetics since the small molecules can be applied easily to a broad range of species, their application can be controlled in dose, time and space to provide detailed studies of biological functions, and individual proteins or whole protein classes may be targeted by varying the specificity of the small molecules. Notably, functions of the plant hormones gibberellin, brassinosteroid and abscisic acid have been successfully probed using this approach by adapting triazoles to inhibit specific cytochrome P450 monooxygenases involved in the metabolism of these hormones (30).
In the case of the CCD family, the tertiary amines abamine (31) and the more active abamineSG (32) were reported as specific inhibitors of NCED, and abamine was used to show new functions of abscisic acid in legume nodulation (33).
The original aim of the Inventors was to study the inhibition of carotenoid cleavage dioxygenase and to identify compounds which increased shoot branching. However, the Inventors unexpectedly identified a class of compounds that, instead of causing shoot branching, caused leaf bleaching, growth inhibition and/or death when applied to plants. The Inventors found that an aryl group, such as an alkoxy-aryl or hydroxy-aryl group, when linked through a hydroxamic acid linker to a hydrophobic group, is used, this inhibited growth in plants or killed plants.
Summary of the Invention
The invention therefore provides a herbicidal formulation comprising a compound of formula I
where:
Ri is alkyl or H;
Figure imgf000004_0001
R2, R3, R4 and R5 are independently selectable from H, halide, -NO2, -SO2R', -OH, -Oalkyl where R' is alkyl or aminoalkyl; and
R6 is hydrophobic group, such as a substituted or non-substituted alkyl, and/or substituted or non-substituted aryl.
Ri is preferably a Ci - C4 alkyl, such as methyl, ethyl, propyl or butyl, especially methyl. Ri may also be H. R2, R3, R4 and R5 may all be H. Alternatively, one, two or three of those side groups may be H, the other side groups being alternative side groups. The alkyl moiety of the -Oalkyl group is preferably a C1 - C4 alkyl, such as methyl, ethyl, propyl or butyl.
R5 may be Omethyl. The remaining substituents, R2, R3 and R4 may be H where R5 is -
Omethyl.
R6 is preferably a hydrophobic group. R6 may be a Ci - Ci2 alkyl, most preferably a C5 - Qo alkyl. R6 may be any one of a Ci, C2, C3, C4, C5, C6, C7, C8, C9, Ci0, Cn or Ci2 alkyl. R6 may also be an aryl group or -(CH2),, aryl, where n = an integer of 1 to 4 and aryl is substituted or non-substituted, n is preferably 1.
R6 may be a substituted alkyl or a substituted aryl. The alkyl or aryl groups may be substituted with one or more halides, -OH, -NO2 or -SO2.
Preferably the herbicidal formulation comprises R6 of formula EL
Figure imgf000005_0001
wherein R7 is -H, -OH, -NO2, -SO2 or halide.
As used herein, the term "halide" includes fluorine, chlorine, bromine or iodine, most preferably fluorine.
The herbicidal effects of the compounds were unexpected. The length of the hydroxamic acid linker to the hydrophobic group has been shown to be important and affects the activity of the compounds.
The site of action of the compound is not clear. It may be the enzyme p- hydroxyphenylpyruvate dioxygenase (HPPD), a known herbicide target. The structure of the
HPPD substrate has some similarities to the structure of Fl and F2, two examples of the herbicidal compound of the invention. However, it contains an extra carbon atom in the linker. Longer linkers were not observed by the inventors to produce growth inhibition,
HPPD inhibitors are shown in the article by Grossman K and Ehrhardt T (Pest Manag.Sci
2007, 63, 429-439).
The herbicidal formulation of the invention additionally comprise one or more adjuvants.
Adjuvants for use in herbicidal compositions are generally known in the art. These include oil-based adjuvants and mixtures, organosilicone-based adjuvants and mixtures, non-ionic based adjuvants and mixtures, polymeric-based adjuvants and mixtures, and fatty acid- based adjuvants and mixtures, and combinations thereof. Mineral oil may be added as an adjuvant.
The adjuvants may be added as l%-95% by weight of the active ingredients.
The herbicidal composition may also comprise, or additionally comprise, a solid material, such as a clay, silica or other inert solid carrier generally known in the art.
The herbicidal composition may be applied as a solid or a liquid. The liquid media used may comprise, for example, water, kerosene, xylene, an alcohol such as ethanol. Mixtures of such liquids may be used. These may be utilised in combination with surface active agents to improve the wetting of the plant or seed.
The herbicidal formulation may be applied directly onto the plant or applied to the soil.
The compositions are known to be effective at, for example, 100 micromolar concentrations.
The invention also provides a method of killing or inhibiting growth of a plant, comprising applying to a seed or a plant a herbicidal formulation according to the invention.
A further aspect of the invention provides an isolated compound of formula I, as defined above.
Preferably the isolated compound has a formula of formula III:
Figure imgf000006_0001
The invention will now be described by way of example only, with reference to the following figures.
FIGURE LEGENDS
FIGURE 1.
Reactions catalysed by the carotenoid cleavage dioxygenases: a, 11, 12-oxidative cleavage of
9'-cis- neoxanthin by NCED; b, oxidative cleavage reactions on β-carotene and zeaxanthin.
FIGURE 2.
Synthetic route for preparation of hydroxamic acids and inhibitors.
FIGURE 3.
Inhibitor design. Protonated abamine (a), a carotenoid carbocation intermediate (b) and a hydroxamic acid inhibitor (c) are shown bound to iron(II) cof actor of a CCD.
FIGURE 4.
The relative inhibition of four CCDs in E. coli. CCD genes were expressed in E. coll strains that produce β-carotene. The strains were grown in the presence or absence of inhibitors (100 μM) for 16 hours. This concentration of inhibitor was within the linear range of the E. coli. response (see Figure 9). The relative inhibition of each class of CCD was determined by the increase in β-carotene accumulation in the presence of the inhibitor, a value of 0 would indicate β-carotene levels equal to when no inhibitor was present and a value of 100 would equal the maximum level of β-carotene as observed in strains lacking a CCD (see
Experimental Procedures for equation). Error bars represent the standard error of the mean, n
= 4. The floating black bar represents the least significant difference (P <0.05) for comparison of any two means.
FIGURE 5.
The effect of inhibitors on the outgrowth of buds from excised Arabidopsis nodes in the presence of 1 μM NAA. The graph shows lag time before the commencement of bud outgrowth for CoI-O (WT) in the presence or absence of 100 μM inhibitor. A null mutant of
AtCCDIl (max3) was included without inhibitor as control. Values represent means from five independent experiments; n = 35 (WT), n = 18 (max3), n = 14-16 )WT plus inhibitors).
The floating black bar represents the least significant difference for comparison of any two means, and asterisks indicate values significantly different from the WT (P< 0.05).
FIGURE 6.
Branching phenotypes of Arabidopsis plants grown in agar media for 45 days supplemented with inhibitor D6. Images are shown: (a) CoI-O (WT) without inhibitor; (b) max3-9 mutant without inhibitor; (c) CoI-O with 100 μM D6. The numbers (d) of rosette branches were quantified. Error bars represent standard error of the mean, n = 6 to 12.
FIGURE 7.
Bleaching of plants grown in the presence of specific inhibitors. Arabidopsis thaliana CoI-O plants were grown in agar media containing inhibitors Fl (a) or F2 (b) at 100 μM.
FIGURE 8.
The amount of β-carotene present (expressed as μg ml"1 of culture) in β-carotene accumulating E. coli strains expressing CCDs in the presence of inhibitor. The strains were grown in the presence or absence of inhibitors (100 μM) for 16 hours (see method section in the main manuscript). Error bars represent the standard error of the mean, n = 4. (A) AtCCD7
(B) LeCCDl (C) MmBC02 (D) MmBCOl
FIGURE 9
The response of the E. coli assays to different inhibitor concentrations .The relative inhibition was calculated as detailed in the main methods section. The strains were grown in the presence of varying amount of inhibitors for 16 hours. Error bars represent the standard error of the mean, n = 3. A logarithmic trend line was added fitted using Excel and the R2 value is displayed on the graph. (A) LeCDDl (B) AtCCD7 (C) MmBCO2. FIGURE 10
The effect of different concentrations of Fl and sulcotrione on the activity of AtHPPD FIGURE 11
(a) The effect of increasing substrate concentration in presence of Fl (b) The effect of preincubation of Fl with AtHPPD
EXAMPLES EXAMPLE 1 EXPERIMENTAL PROCEDURES
Synthesis of tertiary amine inhibitors — Abamine was synthesised according to published procedures (31,34).
Synthesis of hydroxamic acid inhibitors — Synthesis is shown in Fig. 2 and structures are given in Table 1. N-Boc,O-benzyl-hydroxylamine was treated with NaH in DMF, followed by the appropriate benzyl or alkyl bromide (35). Deprotection was carried out by treatment with 1% trifluoroacetic acid in dichloromethane, to give the N-substituted hydroxylamine. Hydroxamic acid formation was carried out using DCC (1.1 equiv.) and 4- dimethylaminopyridine (0.2 equiv.) and the appropriate carboxylic acid, in dichloromethane. The hydroxamic acid products were purified by silica gel column chromatography. Bl, D12 and D13 were prepared by activation of the appropriate acid with methyl chloroformate and triethylamine in THF, and reaction with hydroxylamine hydrochloride. The intermediate for synthesis of Bl was synthesised from β-ionone (36); Bl was isolated as a 2: 1 mixture of E/Z isomers. Spectroscopic data and yields for analogues D1-D13, Fl-4, and Bl are available as supplemental data.
In vitro NCED enzyme assay — We over-expressed LeNCEDl in E. coli, as an N-terminal His6-fusion protein (supplemental methods). Cell-free extract containing recombinant LeNCEDl was prepared in 100 mM bis-tris buffer (pH 6.7). 15 μl extract was pre-activated by addition of iron (II) sulphate (20 mM, 1 μl) and ascorbic acid (20 mM, 1 μl) on ice for 2 min, prior to use. This aliquot of enzyme was then added to an assay (150 μl total volume) containing 100 mM bis-tris buffer (pH 6.7), 0.05% v/v Triton X-100, 1.0 mg/ml catalase, and 3 μg 9'-cw-neoxanthin. The 9'-cw-neoxanthin substrate was prepared as described in supplemental methods. The enzyme assay was incubated for 15 min in the dark at 2O0C. Water (700 μl) was then added, and the products extracted with ethyl acetate (3 x 1 ml). The organic solvent was removed at reduced pressure, the residue was dissolved in methanol (200 μl), and then 100 μl was injected onto a Phenomenex C18 reverse phase HPLC column, and a gradient of 5-10% methanol in acetonitrile/0.05% triethylamine was applied at 0.5 ml/min over 20 min, detecting at 440 nm. NCED inhibition assays contained 1-100 μM inhibitor; inhibition was calculated from the product formation after 15 min, compared to a control assay with no inhibitor present. Retention times: 9'-cw-neoxanthin, 10.2 min; C25 product, 6.5 min.
In vitro LeCCDIa enzyme assay — We over-expressed LeCCDIa in E. coli, as a GST-fusion protein (supplemental methods). The in vitro assay of LeCCDIa was based on reported methods (37), and was carried out in a 200 μl total volume in a 96-well microtitre plate, with the signal detected at 485 nm. To prepare substrate solution for each assay, 5 μl of 4% (w/v in ethanol) apo-8'-carotenal (Sigma) was mixed with 25 μl of 4% (w/v in ethanol) β- octylglucoside (Sigma), the ethanol was then evaporated under nitrogen, and the residue dissolved in 150 μl PBS buffer containing 10 mM sodium ascorbate by incubation at 200C for 30 min. 50 μl of cell-free extract containing recombinant LeCCDIa was added, and the reactions monitored over 30 min at 200C.
In vivo enzyme assays in E. coli — The genes of interest (supplemental Table Sl) were cloned into the vector pET30c (Novagen) fused directly to the initial ATG codon with no tag, or into pGEX-4T such that the gene was fused to an N-terminal GST tag. All genes were full length except AtCCD7, which had the chloroplast signal sequence removed (supplemental methods). This gene, when fused to GST in the pGEX-4t vector (GE Healthcare), showed greater CCD activity than when expressed in a pET vector without a tag. Therefore, this construct was used in subsequent assays. The plasmids were transferred to the E. coli expression strain BL21(DE3), harbouring pAC-BETA (38), and therefore producing β- carotene.
For each inhibitor assay, 2.5 ml LB media with the appropriate antibiotics (25 μg ml"1 chloramphenicol and 50 μg ml"1 kanamycin or 100 μg ml" ampicillin) and 2.5 μM IPTG, was prepared. Inhibitors (0.1 M in 100% ethanol) were added to the media to a final concentration of 100 μM. The media was then inoculated with 0.25 ml of overnight culture (grown at 370C with the appropriate antibiotics) and incubated with shaking (200 rpm) at 280C for 16 hours. One ml of culture was harvested by microcentrifugation and resuspended thoroughly in 1 ml ethanol containing 0.2 % Triton X-100. After vortexing, the extract was incubated at room temperature in the dark for 3 hours, again vortexed and then spun in a microcentrifuge for 5 min at 13000 rpm. The supernatant was removed and the O.D.453 - O.D.550 was measured. The amount of β-carotene was calculated using a standard curve generated from a dilution series of β-carotene (Sigma) in ethanol with 0.2% Triton X-100; the absolute levels of β- carotene are shown in Figure 8. The relative inhibition was calculated by the equation: (Q- CcV(Ci-Cc) x 100, where Ci is the carotenoid level with inhibitor and CCD present, Cc is the level with CCD but without the inhibitor and Ci is the level in a strain where lacZ is expressed instead of the CCD, and no inhibitor is present. Thus the increase in β-carotene due to inhibition of the CCD (Q-Cc) was expressed relative to the maximum possible β-carotene content when CCD is absent (Q-Cc).
Growth of Arabidopsis — Wild-type (ecotype Col-0) and the max3-9 mutant in the CoI-O background (21) were grown in double Magenta pots (Sigma) on 30 ml ATS media (39) containing 1% sucrose and 0.8% agar, supplemented, where stated, with 100 μM inhibitor from a 100 raM stock in ethanol. Seeds were sterilized by immersion for 1 min in 70% ethanol and 4 min in 50% household bleach before being washed 5 times in distilled water. Six seeds were placed in each Magenta pot, they were vernalized in the dark at 40C for two days and then placed in a growth room (24°C, 16 hr light period, 150 μmol m2 s"1 photosynthetically active radiation) for 45 days before being photographed. Side shoots from rosette nodes were counted for each plant.
Axillary bud outgrowth assay in Arabidopsis stem sections — The assays were performed essentially as described (40) with the following modifications. Small Petri dishes (50 mm diameter, 20 mm depth) were filled with 10 ml of ATS (39) supplemented with 1% agar and 1% sucrose. Inhibitors and α-naphthalene acetic acid (NAA) were added to the agar before pouring to give 100 μM and 1 μM, respectively. Thus, when the central strip was cut out of the agar, both the apical and basal media contained both NAA and inhibitor. Any nodes in which the apical end had curled out of the media or which bud length was less than 2 mm at the end of the experiment were discounted. Measurement of the shoot length was performed every 24 hours. For each assay a logistic curve was fitted using Genstat (10th edition, VSN international) with the fitcurve directive and the lag phase was calculated by extrapolating the linear part of the curve and the initial plateau (see supplementary methods). The x value of where these two lines intersected represented the lag phase.
Statistical analysis — For data in Fig. 4 and 5 analysis was by Residual Maximum Likelihood (REML) in Genstat 10. In both cases an F-test showed that overall the treatment effects were highly significant (P < 0.001). The maximum value of the least significant difference (LSD) was calculated by multiplying the maximum standard error of differences by a t-value (P = 0.05), and is presented on the graphs. There were 105 and 157 degrees of freedom for the LSDs shown in Fig. 4 and 5 respectively. The maximum LSD was used because individual LSDs varied but if differences between means were significant using the maximum values then they were also significantly different at the individual value for any two selected means. Supplemental methods Strain Construction
Plasmids were prepared using Qiaprep plasmid mini spin kits (Qiagen) and PCR products and cut vector were purified using QiaQuick columns (Qiagen), following manufacturer's instructions. PCR was carried out using HiFi Expand (Roche) DNA polymerase following manufacturer's instructions. Ligations were performed with T4 DNA ligase (Invitrogen) for 1 hour at 250C. Constructs were initially cloned into E. coli DHlOB cells (Stratagene) and were sequenced to ensure that no PCR errors had taken place.
The LeCCDIa gene (AY576001) was amplified from cLET29I6 (obtained from The Institute for Genomic Research (TIGR) tomato gene index) using primers LeCCDIa-FCl:- TACGAATTCCATATGGGGAGAAAAGAAGATG and LeCCDIa-RCl:-
TAGTCTCGAGTCACAGTTTGGCTTGTTC. The product was cut with Ndel and Xhol and ligated into similarly cut pET30c (Novagen, VWR International, Ltd). In addition, the product was cut with EcoRl and Xhol and ligated into the similarly cut pGEX-4T (GE Healthcare).
The AtCCD7 gene was amplified from pCR2.1-AtCCD7, kindly supplied by Ottoline Leyser (University of York), using the primers AtCCD7-FC3
TATGCTCGAGGAGATCTGGATTAATGGCCGCAATATCAATATC and AtCCD7-RCl TAGTCTCGAGTCAGTCGCTAGCCCATAAAC. The PCR product was cut with BgIR and Xhol and cloned into βαmHI/Sα/I-cut pGEX-4T.
The MmBCOl (AF294899) was amplified from the clone IMGCLO2192191 obtained from Geneservice Ltd. (Cambridge, UK) using the primers MmBCOl-FCl TACTGAATTCCATATGGAGATAATATTTGGC and MmBCOl-RCl
TACTCTCGAGTGAGTGTTAGGATTAAAG. The PCR product was cut with NdeVXhol and cloned into similarly cut pET30c.
The MmBCOl gene (AJ290392) was amplified from the clone IMGCLO2536812 (Geneservice Ltd.) using the primers MmBC02-FCl
TATCGGATCCCATATGTTGGGACCGAAGCAGAG and MmBC02-RCl
TATCCTCGAG TCAGATAGGCACAAAGGT. The product was cut with NdeVXhol and cloned into similarly cut pET30c.
The LeNCEDl cDNA (Z97215) was provided by Ian Taylor (University of Nottingham) and was cloned into the Ndel and BpullO2 sites of vector pET14b (Novagen, VWR International, Ltd) to provide an N-terminal fusion to a HiS6 tag. The plasmid was expressed in E. coli Rosetta (DE3) cells (Novagen, VWR International, Ltd). Details of strains used for inhibitor assays in E.coli are also given in Supplemental Table Sl, below.
Preparation of cell-free extracts
For the production of cell-free extracts of LeCCDIa and LeNCEDl, cultures were grown to an OD of 0.6 at 370C, then isopropyl β-D- 1 -thiogalactopyranoside (IPTG) was added to 0.2 mM and the cultures grown overnight at 2O0C. The cells (200 ml cultures) were harvested by centrifugation (5000 rpm,10 min) and the pellet re-suspended in 4 ml PBS, 0.1% Triton-X 100. Lysozyme was added to a final concentration of 25 μg ml"1 and the solution incubated at room temperature for 15 min before sonication (3 x 30 s at 18 Ω) on ice. The lysate was then centrifuged (13000 rpm , 15 min, 40C) and the supernatant used for the assay. Calculation of lag phase for shoot elongation assays
A logistic curve, y = A + C/(l+e"B(t m)), was fitted to the data for each shoot using GenStat (10th edition). The lag phase was then calculated using the equation m-(2/B) which effectively gave the t value (time) of the intercept of the two extrapolated lines from the linear part of the curve and the initial plateau. Preparation of 9'-cis-neoxanthin
Fresh spinach (20 g) was washed and crushed with BHT (0.03 g) and sodium bicarbonate (0.3 g) in cold methanol (30 ml) using a pestle and mortar for 3 min in the dark, and the mixture was then filtered under suction. This was repeated 6 times until the retentate became nearly colourless. The combined extract was partitioned between cold diethyl ether and saturated sodium chloride. The ether extract was collected, and the aqueous layer was re- extracted twice with cold diethyl ether. The ether extracts were combined, and solvent was removed by rotary evaporation below 32°C. The residue was saponified with 6 % KOH in 9 ml of methanol and 1 ml of diethyl ether in the dark at 40C for 16 hr. Saturated aqueous sodium chloride solution (50 ml) was added, extracted with diethyl ether (100 ml x 3), dried over Na2SO4, and solvent was removed as above. 9'-c/j-neoxanthin was then purified by column chromatography, using deactivated alumina (1O g alumina, mixed for 5 minutes with 1 ml distilled water and 10 ml petroleum ether). The solid spinach extract was applied in diethyl ether/petroleum ether (1:5), and the column washed with diethyl ether/petroleum ether (1: 1, 50 ml), diethyl ether (50 ml), and 5% ethanol in diethyl ether (50 ml), which finally eluted 9'-cw-neoxanthin. The 9'-cw-neoxanthin fraction was dried with nitrogen and stored in vials wrapped with foil under nitrogen at -200C. Data: Rf 0.09 (silica, Et2O); lmax 415, 439, 467 nm; m/z (FAB+) 600.33, calc. 600.87 for C40H56O4. Results
Inhibitor design and synthesis — NCED was proposed to be a dioxygenase (3), with a reaction mechanism involving a carbocation intermediate, followed by formation of a dioxetane ring or a Criegee rearrangement prior to cleavage (41); such a mechanism was supported by 18O labelling experiments with AtCCDl (37), and was the most likely mechanism based on computational studies of the ACO crystal structure (42).
It was reported that the tertiary amine abamine (see Fig.3a for structure) is a reversible competitive inhibitor (IQ = 39 μM) of recombinant NCED and that it inhibited abscisic acid production in planta at 50-100 μM concentration (31). AbamineSG, with an extended 3 carbon linker between the methyl ester and the nitrogen atom, was subsequently developed with an improved activity (Kj = 18.5 μM) (32). The precise mechanism of action of abamine is uncertain, but our hypothesis was that the protonated amine mimics a carbocation intermediate in the catalytic mechanism, with the oxygenated aromatic ring bound in place of the hydroxy-cyclohexyl terminus of the carotenoid substrates (41), as shown in Fig. 3. Inhibition may be due in part to chelation of the essential metal ion cofactor by the methyl ester of abamine However, a derivative of abamine, containing an acid group (COOH) in place of the methyl ester, was not active (32), even though in theory this should be more effective at binding the iron cofactor
Hydroxamic acids are known to act as inhibitors of several different classes of metalloenzymes, such as the matrix metalloproteases, by chelation of the essential metal ion cofactor (43). Therefore, hydroxamic acid analogues were synthesised, in which the hydroxy- cyclohexyl terminus of the carotenoid substrate was mimicked as above by an oxygenated aromatic ring, and the hydroxamic acid functional group was positioned at variable distance from the aromatic ring. Thus, a collection of aryl-C3N analogues (D8-D13), aryl-C2N analogues (D1-D7), and aryl-dN analogues (F1-F4) was also synthesised (Table 1). The 4- fluorobenzyl substituent, found to promote activity in the abamine series (31), was included in the collection of hydroxamic acids. The synthetic route, shown in Fig. 2, involves coupling of the appropriate acid with a substituted O-benzyl hydroxylamine, followed by deprotection. One hydroxamic acid containing a longer C5 spacer from a cyclohexyl moiety (Bl) was also synthesised from β-ionone. A set of 18 hydroxamic acids was then used for inhibitor screening; numbering of chemical compounds is given in Table 1. Table 1.
Inhibition of recombinant LeCCDl and LeNCEDl enzymes using in vitro assays.
Enzyme assays, using E. coli cell extracts containing the recombinant CCD, were initially carried out at 100 μM inhibitor concentration; for compounds showing > 90% inhibition of LeCCDl at this concentration, IC50 values were also determined. NT, not tested. Chemical structures hydroxamic acid inhibitors are shown below, with X and Y given in the table. The structure of abamine is given in Fig. 3.
LeCCDIa LeNCEDl
Inhibitor
(9,10/9',10') (11,12)
I
CIa Inhibition @ C50 Inhibition @ 100
SS ame 100 μM (%) ( μM (%) μM)
Abamine 20, 49a 20
10
4-
H >95
OMe .0
4-
>95
Ary 2 OMe .5
1-C1N 3,4-
H 50
(OMe)2
3,4-
(OMe)2
4-
H >95 27
OH .9
>95 29
OH
3,4-
>95
(OH)2
Ary 4-
>95 33
1-C2N OMe .5
3,4-
H >95
(OMe)2 .0
3,4-
>95 18
(OMe)2 .0
3,4-
>95 33
OCH2O .0
3,4- 40
Ary 61 (OMe)2 H2Ph I C3N 4-
>95 27
OMe H2Ph
3,4- n
65 14
10 (OMe)2 -octyl
4- n 53 15
11 OMe -octyl
3,4-
H 26 11
12 (OMe)2
4-
H 46 13
13 OMe
Rin
90 g-C5N a, two independent measurements of inhibition at 100 μM gave values of 20 and 49%
Cyclohβxyl-C5N (B1)
Figure imgf000015_0002
Figure imgf000015_0001
Specificity of inhibition in vitro for tomato genes LeNCEDl and LeCCDIa — In order to screen the inhibitors against enzymes which cleave carotenoids at the 9,10 position, we used the recombinant tomato LeCCDIa protein (44), because this type of enzyme can be studied using an in vitro colourimetric assay with β-apo-8'-carotenal as substrate (37). To establish the specificity of the inhibitors, they were also tested against the tomato LeNCEDl recombinant protein which cleaves 9-cis carotenoids at the 11,12 position (45). For this enzyme, the cleavage reaction was monitored by C18 reverse phase HPLC, using 9'-cis- neoxanthin as substrate. As reported by others (46), each enzyme activity was found to be unstable (lifetime < 24 h) towards storage or purification, therefore enzyme assays were carried out using recombinant cell-free extract (no cleavage activity was observed using E. coli extract lacking the recombinant CCD gene).
Against LeNCEDl, several hydroxamic acids (notably D8, D7, and D4) showed 1.5-2 fold higher inhibitory activity than the designated NCED inhibitor, abamine (31), which in our hands showed only 20% inhibition at 100 μM concentration (see Table 1). Against LeCCDl, potent inhibition was observed by all the aryl-C2N hydroxamic acids, and certain other hydroxamic acids. 4-methoxyaryl hydroxamic acids were effective inhibitors in each series, but the most potent inhibition was observed with the 4-hydroxyaryl hydroxamic acids Dl, D2, and D3, which gave IC50 values of 0.8-0.9 μM. Abamine showed only 50% inhibition of LeCCDl at 100 μM.
Comparison of inhibition data for LeNCEDl and LeCCDIa shows that all the active compounds show some selectivity towards LeCCDl, with compounds D3, Fl, and F2 showing high levels of inhibition of LeCCDl, and little or no inhibition of LeNCEDl (Table
I)-
In vivo activity of inhibitors applied to E. coli strains expressing CCDs — Coloured E. coli strains that produce various carotenoids can be constructed by expression of enzymes for carotenoid synthesis (26). Upon co-expression of the appropriate CCD, the bacteria lose their colour due to cleavage of the carotenoids to colourless products (4,6,27). This technique was employed here to further explore the specificity of inhibitors, and to test their activity in vivo. The level of carotenoid in each CCD-expressing strain was compared to the level of the carotenoid in a control strain producing β-carotene but lacking any CCD gene. The difference in the carotenoid levels gave a measure of CCD activity, and inhibition of this activity was measured by addition of inhibitors to the growing medium.
The inhibitors were tested against four β-carotene-producing E. coli strains (supplemental Table Sl). Three of the strains expressed highly divergent CCDs that cleave at the 9,10 position: AtCCD7 from Arabidopsis (21) and MmBCO2 from mouse (6) which both cleave at a single site (9,10 or 9',10' but not both), and the tomato enzyme LeCCDIa (44) which cleaves at both sites in the same substrate molecule (9,10/9',1O' activity). The fourth strain expressed another mouse CCD, MmBCOl (47), which cleaves centrally at 15,15'. Ourselves and other researchers (48) have found that expressing CCDs (and presumably other proteins) can lead to loss of carotenoids by non-specific means. However, detection of cleavage products by HPLC in the E. coli cells and media confirmed that in all four strains used here, CCD cleavage was the cause of carotenoid loss. NCED activity could not be studied in E. coli cells because the enzyme required for production of the 9-cis carotenoid substrates of NCED has not yet been identified. We synthesized the genes CsZCD (9) and BoLCD (49), expressed them in E. coli, and looked for the reported 5,6 and 7,8 cleavage activities both in vitro and in E. coli cells. However, we were not able to detect activity, and so it was not possible to test inhibitors against the 5,6 and 7,8 cleavage specificities.
The compounds showed different patterns of inhibition against the three 9,10 enzymes (Fig. 4). The activity of the compounds against LeCCDIa in vivo (Fig. 4) mirrored the activity observed in vitro (Table 1): D5 and D6 exhibited relatively weaker inhibition activity than the other D compounds and F3 exhibited virtually none. A different pattern was obtained with AtCCD7 in the E. coli system (Fig. 4), with the compounds Fl and F2, which exhibited good activity against LeCCDIa, showing poor inhibition. In contrast Fl and F2 were the most effective compounds at inhibiting MmBCO2 (Fig. 4). The 15,15' cleavage enzyme MmBCOl was not inhibited to any significant extent by any of the compounds tested (Fig. 4). Stimulation of shoot branching in Arabidopsis stem sections by application of inhibitor — Auxin inhibits the outgrowth of axillary buds in wild-type Arabidopsis plants. In the AtCCD7 and AtCCD8 null mutants (max3 and max4, respectively) the response to auxin is reduced, presumably due to a block in formation of an apocarotenoid hormone (recently shown (17,18) to be strigolactone or a related compound) that suppresses branching (19), and axillary buds extend earlier, leading to formation of side branches. An in vitro assay was previously developed in which the growth of axillary buds from isolated sections of Arabidopsis stem was used to assess max mutants (40). In such assays, it was reported that bud outgrowth of the max4-l mutant (AtCCD8) was 2 days earlier than for wild-type (20) and a similar phenotype is expected of the highly branched max3-9 mutant (21). We tested hydroxamic acid inhibitors at 100 μM in this assay and found that Dl to D6, and F3 all significantly (P < 0.05) advanced the timing of bud outgrowth in wild-type, with the advancement ranging from one day (Dl) to three days (D3) (Fig. 5). This earlier bud outgrowth was equivalent to that observed in the AtCCD7 null mutant max3-9 (Fig. 5), and indicates an inhibition of AtCCD7 and/or possibly AtCCD8 in this tissue. The effect of the inhibitors in this assay only partially mirrored the activities in the E. coli assay, with compounds Fl and F2 having a relatively small activity in both the bud outgrowth assay (Fig. 5) and the E. coli AtCCD7 assay (Fig. 4). However, in the case of F3 there was disagreement because it was inactive in the E. coli assay for AtCCD7, but it was active in stimulating bud outgrowth. One possibility in this case is that F3 stimulated branching by inhibiting AtCCD8 (not tested in vitro or in E. coli) rather than AtCCD7.
Stimulation of shoot branching in whole Arabidopsis plants — Inhibitors were also applied to Arabidopsis whole plants grown under sterile conditions in agar. The max3-9 plants (Fig. 6b) and those treated with D2, D4, D5 and D6 (Fig. 6c shows D6 treated plants) exhibited a bushy appearance compared to the untreated wild-type controls (Fig. 6a). This bushy appearance was due to the increased number of side branches from the rosette nodes, with max3-9 plants exhibiting 3 to 4 side branches compared to a mean of 0.25 for wild type. Inhibitor treated plants were intermediate (mean of approximately 2 branches) and so partially mimicked max3-9 (Fig. 6d). Fl and F2 were toxic to whole plants at 100 μM and caused bleaching of leaves and poor growth (Fig. 7). D3 was active in the stem section assay (Fig. 5), but in whole plants D3 had a negative effect on Arabidopsis growth when added to the agar media, and a toxicity effect was suggested by the observation that roots grew across the agar surface rather than penetrating. This general growth effect may have masked any possible stimulatory effects of D3 on side branching.
Supplemental data
Spectroscopic data for synthetic inhibitors
Dl. N-benzyl-4-hydroxyphenylacetyl hydroxamic acid. Yield 0.59 g (coupling 54%, deprotection 74%). δH (400 MHz, CD3OD) 3.77 (2H, s, CH2CO), 4.78 (2H, s, CH2N), 6.77 (2H, d, J = 8.0 Hz), 7.13 (2H, d, J = 8.0 Hz), 7.25-7.35 (5H, m). δc (100 MHz, CD3OD) 39.2, 53.1, 116.3, 127.5, 128.6, 129.3, 129.5, 131.6, 137.7, 157.2, 174.7 ppm. MS (ES) 280.1 (MNa+), HRMS obs. 280.0949, calc. 280.0944 for C15H15NO3Na.
D2. N-(4-fluorobenzyl)-4-hydroxyphenylacetyl hydroxamic acid. Yield 0.12 g (coupling 93%, deprotection 55%). 6H (400 MHz, CD3OD) 3.72 (2H, s, CH2CO), 4.78 (2H, s, CH2N), 6.73 (2H, d, J = 8.0 Hz), 7.06 (2H, t, J = 8.0 Hz), 7.11 (2H, d, J = 8.0 Hz), 7.30 (2H, m). δc (100 MHz, CD3OD) 39.2, 52.3, 114.9, 116.0, 116.2, 128.5, 129.5, 131.3, 131.5, 142.4 (carbonyl not seen) ppm. MS (ES) 298.1 (MNa+), HRMS obs. 298.0860, calc. 298.0850 for
Figure imgf000018_0001
D3. N-(4-fluorobenzyl)-3,4-dihydroxyphenylacetyl hydroxamic acid. Yield 0.08 g (coupling 50%, deprotection 78%). δH (300 MHz, CD3OD) 3.68 (2H, s, CH2CO), 4.74 (2H, s, CH2N), 6.60 (IH, dd, J = 2.0,8.0 Hz), 6.72 (IH, d, J = 8.0 Hz), 6.78 (IH, d, J = 2.0 Hz), 7.03 (2H, t, J = 8.0 Hz), 7.28 (2H, m). δc (75 MHz, CD3OD) 39.4, 52.3, 116.0, 116.3, 117.7, 121.9, 127.9, 131.3, 145.1, 146.2, 162.1, 165.3, 174.1 ppm. MS (ES) 314.3 (MNa+). D4. N-(4-fluorobenzyl)-4-methoxyphenylacetyl hydroxamic acid. Yield 0.24 g (coupling 78%, deprotection 83%). δϋ (400 MHz, CDCl3) 3.70 (2H, s, CH2CO), 3.73 (3H, s, CH3O) 4.69 (2H, s, CH2N), 6.77 (2H, d, J = 8.0 Hz), 6.94 (2H, t, J = 8.0 Hz), 7.13 (2H, d, J = 8.0 Hz), 7.20 (2H, m). δc (100 MHz, CDCl3) 38.9, 40.4, 52.0, 114.5, 115.7, 115.9, 128.2, 131.1, 131.3, 159.3, 163.7 (carbonyl not seen) ppm. MS (ES) 312.2 (MNa+), HRMS obs. 312.1004, calc. 312.1006 for Ci6Hi6NO3FNa.
D5. N-benzyl-3,4-dimethoxyphenylacetyl hydroxamic acid. Yield 0.23 g (coupling 62%, deprotection 66%). δH (300 MHz, CDCl3) 3.64 (2H, s, CH2CO), 3.70 (3H, s, OCH3), 3.76 (3H, s, OCH3), 4.65 (2H, s, CH2N), 6.63-6.73 (3H, m), 7.15-7.30 (5H, m). δc (75 MHz, CDCl3) 38.0, 51.4, 55.1, 55.2, 110.5, 111.9, 121.0, 126.9, 127.1, 127.8, 128.3, 135.4, 147.1,
148.1, 172.1 ppm. MS (ES) 324.2 (MNa+), HRMS obs. 324.1216, calc. 324.1206 for
CnH19NO4Na.
D6. N-(4-fluorobenzyl)-3,4-dimethoxyphenylacetyl hydroxamic acid. Yield 0.22 g (coupling
100%, deprotection 69%). 6H (400 MHz, CD3OD) 3.40 (2H, s, CH2CO), 3.80 (3H, s, OCH3),
3.84 (3H, s, OCH3), 4.76 (2H, s, CH2N), 6.81 (IH, d, J = 8.0 Hz), 6.89 (IH, d, J = 8.0 Hz),
6.91 (IH, s), 7.04 (2H, t, J = 8.0 Hz), 7.30 (2H, m). δc (100 MHz, CD3OD) 39.5, 52.3, 56.4,
56.6, 113.1, 114.4, 116.3, 123.0, 129.4, 131.5, 133.9, 149.4, 162.5, 164.9, 174.3 ppm. MS
(ES) 342.2 (MNa+), HRMS obs. 342.1110, calc. 342.1112 for CnH18NO4FNa.
D7. N-(4-fluorobenzyl)-3,4-methylenoxyphenylacetyl hydroxamic acid. Yield 0.26 g
(coupling 51%, deprotection 100%). 5H (400 MHz, CD3OD) 3.45 (2H, s, CH2CO), 4.86 (2H, s, CH2N), 6.05 (2H, s, OCH2O), 6.85 (2H, s), 6.91 (IH, s), 7.08 (2H, t, J = 8.0 Hz), 7.33 (2H, m). δc (100 MHz, CD3OD) 39.7, 52.5, 102.4, 109.2, 111.0, 116.3, 123.7, 130.3, 131.5, 133.6,
149.7, 162.7, 165.1, 175.0 ppm. MS (ES) 304.1 (MH+), HRMS obs. 304.0980, calc. 304.0980 for Ci6H15NO4F.
D8. N-benzyl-3,4-dimethoxyphenylpropionyl hydroxamic acid. Yield 0.15 g (coupling 71%, deprotection 94%). δH (400 MHz, CDCl3) 2.60 (4H, m), 3.73 (6H, s, 2 x OCH3), 4.68 (2H, s,
CH2N), 6.63-6.73 (3H, m), 7.15-7.30 (5H, m). δc (100 MHz, CDCl3) 30.4, 34.3, 51.9, 55.8,
55.9, 111.3, 111.9, 120.3, 126.9, 128.0, 128.8, 133.9, 136.2, 147.3, 148.8 (carbonyl not seen) ppm. MS (ES) 316.2 (MH+), HRMS obs. 316.1547, calc. 316.1549 for Ci8H2iNO4.
D9. N-benzyl-4-methoxyphenylpropionyl hydroxamic acid. Yield 0.13 g (coupling 82%, deprotection 82%). δπ (400 MHz, CDCl3) 2.82 (4H, m), 3.68 (3H, s, OCH3), 4.68 (2H, s,
CH2N), 6.67 (2H, d, J = 8.0 Hz), 7.01 (2H, d, J = 8.0 Hz), 7.15-7.30 (5H, m). δc (100 MHz,
CDCl3) 28.0, 32.3, 50.9, 54.2, 112.9, 120.3, 126.6, 127.5, 128.3, 134.3, 136.3, 147.5
(carbonyl not seen) ppm. MS (ES) 286.2 (MH+), HRMS obs. 286.1447, calc. 286.1443 for
C17H19NO3.
DlO. N-octyl-3,4-dimethoxyphenylpropionyl hydroxamic acid. Yield 0.10 g (coupling 57%, deprotection 85%). δH (400 MHz, CDCl3) 0.88 (3H, t, J = 7.0 Hz), 1.25-1.35 (12H, m), 2.61
(2H, t, J = 7.0 Hz), 2.89 (2H, t, J = 7.0 Hz), 3.39 (2H, t, J = 7.0 Hz, CH2N), 3.88 (6H, s, 2 x
OCH3), 6.63-6.73 (3H, m), 7.15-7.30 (5H, m). δc (100 MHz, CDCl3) 14.5, 23.0, 26.9, 28.0,
29.6, 31.0, 31.4, 32.2, 32.3, 36.4, 56.2, 56.3, 111.6, 112.1, 120.6, 133.4, 148.0, 149.3
(carbonyl not seen) ppm. MS (ES) 338.2 (MH+), HRMS obs. 337.2262, calc. 337.2253 for
C19H31NO4 DI l. N-octyl-4-methoxyphenylpropionyl hydroxamic acid. Yield 0.12 g (coupling 62%, deprotection 92%). δH (400 MHz, CDCl3) 0.78 (3H, t, J = 7.0 Hz), 1.20-1.35 (12H, m), 2.60 (2H, t, J = 7.0 Hz), 2.85 (2H, t, J = 7.0 Hz), 3.53 (2H, t, J = 7.0 Hz, CH2N), 3.72 (3H, s, OCH3), 6.72 (2H, d, J = 8.0 Hz), 7.05 (2H, d, J = 8.0 Hz). δc (100 MHz, CDCl3) 13.7, 22.6, 26.8, 27.0, 29.1, 29.4, 31.3, 32.3, 32.3, 36.4, 55.1, 113.7, 129.2, 137.2, 156.7, 172.7 ppm. MS (ES) 308.2 (MH+), HRMS obs. 308.2237, calc. 308.2226 for C18H29NO3 Fl. N-benzyl-4-methoxybenzoyl hydroxamic acid. Yield 55 mg (13%). δH (300 MHz, CDCl3)
3.70 (3H, s, OCH3), 4.75 (2H, s, CH2N), 6.75 (2H, d, J = 8.0 Hz), 7.20-7.30 (5H, m), 7.45 (2H, d, J = 8.0 Hz). δc (100 MHz, CDCl3) 54.9, 55.4, 113.8, 124.3, 127.5, 128.6, 129.5, 130.1, 135.6, 161.8, 168.4 ppm. MS (ES) 258.2 (MH+), HRMS obs. 258.1128, calc. 258.1130 for Ci5H16NO3.
F2. N-(4-fluorobenzyl)-4-methoxybenzoyl hydroxamic acid. Yield 38 mg (coupling 50%, deprotection 60%). δH (300 MHz, CDCl3) 3.80 (3H, s, OCH3), 4.75 (2H, s, CH2N), 6.80 (2H, d, J = 8.0 Hz), 6.95 (2H, t, J = 9.0 Hz), 7.15 (2H, m), 7.40 (2H, d, J = 8.0 Hz). δc (100 MHz, CDCl3) 54.5, 55.4, 113.7, 115.5, 121.3, 128.4, 129.1, 129.9, 159.9, 162.0, 169.6 ppm. MS (ES) 276.2 (MH+), HRMS obs. 276.1039, calc. 276.1036 for C15Hi5NO3F. F3. N-benzyl-3,4-dimethoxybenzoyl hydroxamic acid. Yield 0.23 g (53%). δπ (300 MHz, CDCl3) 3.65 (3H, s, OCH3), 3.85 (3H, s, OCH3), 4.80 (2H, s, CH2N), 6.80 (IH, d, J = 8.0 Hz), 7.03 (IH, d, J = 2.0 Hz), 7.10 (IH, dd, J = 2.0, 8.0 Hz), 7.25-7.35 (5H, m). δc (100 MHz, CDCl3) 55.2, 55.9, 56.0, 110.5, 111.1, 121.3, 123.9, 127.1, 128.6, 128.8, 135.6, 148.9, 151.5, 168.0 ppm. MS (ES) 288.2 (MH+), HRMS obs. 288.1242, calc. 288.1236 for Ci6H18NO4. F4. N-(4-fluorobenzyl)-3,4-dimethoxybenzoyl hydroxamic acid. Yield 9 mg (35%). δn (300 MHz, CDCl3) 3.45 (6H, s, OCH3), 4.55 (2H, s, CH2N), 6.75 (IH, d, J = 8.0 Hz), 6.95 (2H, t, J = 9.0 Hz), 7.25-7.35 (4H, m). MS (ES) 306.2 (MH+), HRMS obs. 306.1140, calc. 306.1136 for Ci6H17NO4F.
Bl. (2£)-3-Methyl-5-(2,6,6-trimethyl-cylohexen-l-enyl)-penta-2,4-dienoyl hydroxamic acid. 0.09 g (62%). δH (400 MHz, CDCl3) 1.02 (3H, s), 1.08 (3H, s), 1.48 (2H, m), 1.62 (2H, m),
1.71 (3H, s, E isomer), 1.78 (3H, s, Z isomer), 5.68 (IH, s, Z isomer), 5.78 (IH, s, E isomer), 6.12 (IH, d, J = 15.0 Hz), 6.62 (IH, d, J = 15.0 Hz). δc (100 MHz, CDCl3) 13.7, 18.9, 20.8, 21.5, 28.7, 32.9, 39.3, 115.0, 116.8, 129.8, 133.7, 134.5, 135.8 (carbonyl not seen) ppm. MS (ES) 273.2 (MNa+).
D12. 3,4-Dimethoxyphenylpropenoyl hydroxamic acid. Yield 0.18 g (54%). δπ (400 MHz, CDCl3) 3.79 (6H, s, 2 x OCH3), 6.25 (IH, d, J = 16.0 Hz), 6.85 (IH, d, J = 8.0 Hz), 7.03 (2H, m), 7.42 (IH, d, J = 16.0 Hz). MS (ES) 246.1 (MNa+). D13. 4-Methoxyphenylpropenoyl hydroxamic acid. Yield 1.07 g (50%). δπ (400 MHz,
CD3OD) 3.78 (3H, s, OCH3), 6.38 (IH, d, J = 16.0 Hz), 6.89 (2H, d, J = 8.0 Hz), 7.48 (2H, d,
J = 8.0 Hz), 7.56 (IH, d, J = 16.0 Hz). δc (100 MHz, CD3OD) 55.9, 115.5, 118.4, 128.8,
130.8, 141.6, 145.1, 167.0 ppm. MS (ES) 194.2 (MH+), HRMS obs. 194.0816, calc. 194.0818 for Ci0H12NO3.
El. N-benzyl-N-(4-methoxybenzyl)-glycine methyl ester. δH (300 MHz, CDCl3) 3.40 (2H, s, CH2N), 3.81 (3H, s, OCH3), 3.86 (2H, s, CH2N), 3.90 (3H, s, CO2CH3), 6.97 (2H, d, J = 8.0 Hz), 7.25-7.50 (7H, m). δc (75 MHz, CDCl3) 50.7, 52.6,
54.6, 56.5, 57.0, 113.1, 126.5, 127.7, 128.3, 129.5, 130.4, 135.3, 137.6, 171.4 ppm. m/z 322.1
(MNa+).
Supplemental table
Table Sl.
CCD constructs used in BL21(DE3) (pAC-BETA) E. coli strains to measure levels of inhibition
Gene (source species) Accession number Position of Vector (tag) cleavage
AtCCD7 (Arabidopsis thaliana) NM_130064 9,10 pGEX-4t (GST) LeCCD 1 a {Solarium lycopersicum) A Y576001 9, 10/9', 10' pET30 (none) MmBC02 (Mm musculus) AJ290392 9,10 pET30 (none)
MmBCOl (Mus musculus) AF294899 15,15' pET30 (none)
Figure 7 shows that inhibitors Fl and F2 inhibit growth of Arabidopsis plants grown in agar media. This shows that the compounds have a herbicidal activity against the plants.
Discussion
The Inventors have designed and tested a new class of inhibitor of the carotenoid cleavage dioxygenase family that is based on a structural mimic of the substrate that positions an iron- chelating hydroxamic acid group within the active site. Positioning was achieved by varying the distance between the hydroxamic acid and an aromatic ring so that it matched the distance within the carotenoid substrate between the proximal cyclic end-group and the cleavage site. Crystal structure of ACO, a cyanobacterial CCD, indicates that cleavage position is likely to be determined by the distance between the Fe(II) catalytic centre and the opening of the long non-polar tunnel that allows access to carotenoid substrates (11). This idea is supported by the observation that for NosCCD (from Nostoc sp. PCC 7120) cleavage of the monocyclic γ- carotene occurs at the 7',8' position where the proximal terminus is linear, but at the 9,10 position when the proximal terminus has a more compact cyclic end group (48); indeed it was suggested that the cyclic end group may be arrested at the entrance of the tunnel (48). The Inventors predicted from this crystal structure, and our model for the cleavage mechanism (Fig. 3), that aryl-CiN, aryl-C2N and aryl-C3N compounds would be selective for 7,8, 9,10 and 11,12 cleavage reactions, respectively; we tested these classes against enzymes with 9,10, 11,12 and 15,15' specificities. Certain aryl-CiN compounds (Fl, F2) were effective inhibitors of 9,10 but not 11,12 or 15,15' cleavages. The aryl-C2N compounds were potent inhibitors of 9,10 enzymes, but also had a moderate 11,12 inhibition activity. The aryl-C3N compounds were much less potent against 9,10 enzymes, and although this group contained the best 11,12 inhibitor (D8), they all still maintained a somewhat greater selectivity towards the 9,10 cleavage. In comparison, a further analogue, abamineSG, was reported to be more active against the 11,12 cleavage than the 9,10 cleavage; at 100 μM it inhibited AtNCED3 by 78% and AtCCDl by < 20% (32). None of the compounds tested inhibited the 15,15' enzyme, presumably because the spacing was too small. Thus we conclude that the strategy of varying the positioning of the hydroxamic acid group was only moderately successful, since some overlap existed between the classes. Nevertheless, individual compounds were identified with very high specificity to the 9,10 cleavage in vitro, e.g. IC50 for Fl was 2.0 μM but no inhibition of LeNCEDl was detected.
The inhibitors also exhibited different patterns of activity in E. coli against the three different enzymes with 9,10 cleavage activity. For example, Fl and F2 had high inhibitory activity against LeCCDl and MmBCO2 but were relatively ineffective against AtCCD7. Such differences are not surprising since MmBCO2 shares only 17-23% amino acid identity with the two plant 9,10 enzymes (LeCCDIa and AtCCD7), which are themselves highly divergent, with only 19% identity to each other. This indicates that the variants of the hydroxamic inhibitors are able to distinguish between enzymes that have similar activities but highly divergent primary structure.
The E. coli system proved useful in measuring the efficacy of the inhibitors in vivo. For example, the E. coli assays showed Fl and F2 were poor inhibitors against AtCCD7 and this was confirmed in the Arabidopsis bud outgrowth assay (Fig. 5), which measures AtCCD7 and/or AtCCD8 activity. However, although D5 and D6 were poor in the E. coli assays they showed the largest effect on whole Arabidopsis plants, giving the greatest number of side branches. Also Dl and D3 appeared to be good inhibitors of the 9,10 enzymes in vitro (Table 1), in E. coli (Fig. 4) and in the bud outgrowth assay (Fig. 5), but D3 had negative effects on growth which confounded the branching assay in whole plants, whereas plants treated with Dl grew normally and without an increase in branching. Dl and D3 both contained a more polar hydroxyl group on the aryl ring, therefore it is possible that these compounds are more actively transported in the plant, or metabolised more rapidly.
The aryl-CiN inhibitors Fl and F2, which differ only by a single fluorine, caused bleaching of leaves when applied to whole Arabidopsis plants. It is known that a deficiency of the photoprotective carotenoids, e.g. as caused by the application of herbicides that are inhibitors of phytoene desaturase (50), results in photooxidative breakdown of chlorophyll and therefore leaf bleaching. Further, the Arabidopsis variegated 3 (var3) mutant, which is reported to interact with AtCCD4 in vitro, exhibits a bleached phenotype and retardation of chloroplast development (51). The aryl-QN compounds were expected to favour inhibition of CCDs with 7,8 activity, and AtCCD4 sequence is most closely related to the 7,8 cleavage enzyme CsZCD (9), hence a possible explanation for the effect of Fl and F2 may be that they inhibited the action of the Var3/AtCCD4 complex, so giving a similar phenotype to the var3 mutant. Screening for Arabidopsis mutants resistant to bleaching by Fl or F2 may allow the target protein to be identified, as demonstrated for other small molecules (52). Overall, the different activities observed in different assays suggest that factors such as uptake, metabolism, and effects on non-target processes may play a role in determining the suitability and effectiveness of the inhibitors in planta. Our results underline the importance of performing secondary screens in the biological systems where the compounds are to be used. Here we have been able to demonstrate that D2, D4, D5 and D6 appear to inhibit CCDs in all the assays tested, including in planta, without negative unintended effects on whole plants. These compounds represent useful chemical genetic agents to explore the function of CCDs in plants, animals and micro-organisms.
Using the inhibitors described here, it will now be possible to inhibit the CCD(s) involved in branching in a wide range of plant species and then look for changes in carotenoids and apocarotenoids - this could provide a powerful approach for the identification of the precursors of strigolactone, the identity of other active strigolactone-related compounds, and to the further elucidation of the biosynthetic pathway. The inhibitors could also be used to probe for functional variation in the role of strigolactone between species. Branching- promoting chemicals may have applications in horticulture where compact plant architecture is often highly desirable, e.g. in orchard crops (53).
Other biological systems where genetic manipulations are not practical include the production of saffron (9) and bixin (49) in Crocus and Bixa plants respectively, where the in vivo substrates of the CCDs involved are not clear, and also in the study of the functions of mycorradicin and strigolactone in plant interactions with mycorrhyza (54) and parasitic weeds (15), respectively. Finally, there may be pharmaceutical applications for inhibitors of BCO2 in humans because products from 9,10 carotenoid cleavage have been implicated in DNA damage and carcinogenesis (55,56).
EXAMPLE 2
Following the identification in example 1 of Fl and F2 as herbicidal, the inventors further tested Fl to confirm its activity.
The enzyme 4-hydroxyphenylpyruvate dioxygenase enzyme (HPPD) is a non-heme dioxygenase and thus is a potential target for the iron chelating Fl. Furthermore, HPPD is also the target for triketone and pyrazolone classes of bleaching herbicides. Therefore, the effect of Fl on the activity of HPPD was studied
Effect of Fl on crude preparations of HPPD
E. coli cells expressing the Arabidopsis HPPD enzyme, (BL21 pAtHPPD) were obtained from Graham Moran, University of Wisconsin. One quarter of an overnight plate of BL21(p ATHPPD) was re-suspended in 10 ml of Lauria Bertini broth (LB, Merck). This was used to inoculate a one litre flask containing 400 ml of LB. The cells were grown for 3 hours at 370C, before induction with O.lmM IPTG. Cells were induced for 16 hours at 2O0C and harvested by centrifugation (5000 rpm,10 min, 40C). The cell pellet was re-suspended in 10OmM KPO4 (pH 7.3) containing 100 μg ml"1 lysozyme and mini-protease (Roche). After 10 minutes incubation at room temperature, the cell suspension was lysed by sonication (4 x 1 minute at 18Ω). The lysate was cleared by centrifugation (13000 rpm, 15 minutes, 4°C) with the supernatant being stored at -8O0C. The protein concentration of the lysate was measured using the bicinchoninic acid assay (Invitrogen). HPPD activity was measured using a modification of the enol-borate assay (57). The reaction buffer consisted of 0.8M K2HPO4, 0.4M orthoboric acid, 0.2M Tris (pH7.5), 15 mM sodium ascorbate, 250 μg ml"1 bovine catalase and 100 μM FeSO4. To this was added lμl of a 0.25M solution of A- hydroxyphenylpyruvate (pHPP) in ethanol. The solution was left to equilibrate for 10 minutes at room temperature before addition of 10 μl of the crude enzyme lysate diluted in 90 μl HEPES (pH 7.3). Different concentrations of Fl and sulcotrione in 2 μl of DMSO were added to the diluted enzyme and pre-incubated for 30 minutes before addition to the reaction mixture. A control with just DMSO was also used as well as a control with lOμl of lsyate from BL21 not expressing any recombinant protein. The O.D.32o was the monitored and the rate of the reaction was expressed as reduction in O.D. per minute. The amount of activity for each reaction was corrected for the activity observed in the BL21 lysate control and the inhibition was calculated relative to control without inhibitor. Percentage activity was plotted against inhibitor concentration (Figure 10). The Ic50 value for Fl was calculated as 11.46 μM and that of the commercial HPPD herbicide sulcotrione was 0.027μM, using the program BioDataFit (http://www.changbioscience.com/stat/ec50.html) and the sigmoidal and a exp(- bx)+c models respectively.
Effect of Fl on purified HPPD
More detailed kinetic assays were performed on his-tagged, purified AtHPPD. This was created by amplifying the AtHPPD gene from the pAtHPPD plasmid and ligating into the vecor pET30c (Novagen). The primers used were GAC GGA TCC CTA TGG GCC ACC AAA AC and GAC CTC GAG TCA CAC TAA CTG. The reaction consisted of 0.75 μl of Expand HiFi (Roche), lOμM of each primer, 10 mM dNTPs, 5 μl of 10x reaction buffer (Roche) in 50 μl of H2O. The cycling conditions were 940C for 2min, followed by 10 cycles of 940C for 15 sec; 480C for 30 sec; 72°C for 90 sec. This was followed by 20 cycles of the same except with an extra 5 seconds on the 720C step for every subsequent cycle, with a final step of 720C for 7 min. The PCR product was run on a 0.7% agarose gel, excised and purified using a Quiaquick column (Qiagen). The fragment, alongside with the vector were then cut with BamHl and Xhol and both were purified with a Quiaquick column. Approximately 50 ng of plasmid was added to lOOng of fragment and they were ligated in a 20 μl volume using T4 DNA ligase (invitrogen) for 1 hour at 250C. The ligation mix was electroporated into DHlOB cells and transformants selected on kanamycin (100 μg ml"1). Putative clones were restriction mapped and sequenced. The constructed plasmid (pET-AtHHPD) was then transformed into BL21. BL21(pET- AtHHPD) cells were induced and harvested as previously mentioned, except the cell pellet was re-suspended and in 50 mM KPO4 pH7.3;0.5M NaCl; 100 μg ml"1 lysozyme. The cleared lysate was the passed through a HisTrap FF column (GE Healthcare) which was washed with 100 mM KPO4 pH7.3; 200 mM NaCl; 20 mM imidizole. The protein was eluted by increasing the concentration of imidizole to 10OmM. The eluted fractions containing the protein were pooled and buffer exchanged to 100 mM KPO4 by ultrafiltration using an Ultra- 15 centrifugal filter (Amicon). From an 800 ml of culture, 4 ml of purified enzyme was produced with a concentration of 3.96 mg ml"1. The enol-borate assay was performed as previously described except 20 μl of the purified enzyme was used, which was pre-incubated for 10 minutes in 10OmM KPO4 with Fl. In the presence of Fl, increasing the concentration of the pHPP substrate did not increase the rate of reaction (Figure Ha), indicating that the substrate was inefficient at competing with Fl at the active site. Hence the inhibitor is likely to bind tightly to HPPD. Supporting this was the fact that pre-incubation of Fl with the enzyme greatly increased inhibition, suggesting a slow tight binding mechanism.
REFERENCES
1. Auldridge, M. E., McCarty, D. R., and Klee, H. J. (2006) Curr. Opin. Plant Biol. 9, 315-321
2. Zeevaart, J. A. D., and Creelman, R. A. (1988) Annu. Rev. Plant Physiol. Plant MoL Biol. 39, 439-473
3. Schwartz, S. H., Tan, B. C, Gage, D. A., Zeevaart, J. A. D., and McCarty, D. R. (1997) Plant Physiol. 114, 798-798
4. von Lintig, J., and Vogt, K. (2000) J. Biol. Chem. 275, 11915-11920
5. Wyss, A., Wirtz, G., Woggon, W. D., Brugger, R., Wyss, M., Friedlein, A., Bachmann, H., and Hunziker, W. (2000) Biochem. Biophys. Res. Commun. 271, 334-336
6. Kiefer, C, Hessel, S., Lampert, J. M., Vogt, K., Lederer, M. O., Breithaupt, D. E., and von Lintig, J. (2001) 7. Biol. Chem. 276, 14110-14116
7. Hu, K. Q., Liu, C, Ernst, H., Krinsky, N. L, Russell, R. M., and Wang, X. D. (2006) J. Biol. Chem. 281, 19327-19338
8. Dudareva, N., Negre, F., Nagegowda, D. A., and Orlova, I. (2006) Crit. Rev. Plant ScL 25, 417-440
9. Bouvier, F., Suire, C, Mutterer, J., and Camara, B. (2003) Plant Cell 15, 47-62
10. Juttner, F., and Hoflacher, B. (1985) Arch. Microbiol. 141, 337-343
11. Kloer, D. P., Ruch, S., Al-Babili, S., Beyer, P., and Schulz, G. E. (2005) Science 308, 267-269
12. Marasco, E. K., Vay, K., and Schmidt-Dannert, C. (2006) J. Biol. Chem. 281, 31583- 31593
13. Eisner, T., and Meinwald, J. (1966) Science 53, 1341-1350
14. Fester, T., Schmidt, D., Lohse, S., Walter, M. H., Giuliano, G., Bramley, P. M., Fraser, P. D., Hause, B., and Strack, D. (2002) Planta 216, 148-154
15. Matusova, R., Rani, K., Verstappen, F. W. A., Franssen, M. C. R., Beale, M. H., and Bouwmeester, H. J. (2005) Plant Physiol. 139, 920-934
16. Akiyama, K., and Hayashi, H. (2006) Ann. Bot. 97, 925-931
17. Gomez-Roldan, V., Fermas, S., Brewer, P. B., Puech-Pages, V., Dun, E. A., Pillot, J. P., Letisse, F., Matusova, R., Danoun, S., Portais, J. C, Bouwmeester, H., Becard, G., Beveridge, C. A., Rameau, C, and Rochange, S. F. (2008) Nature 455, 189-194 18. Umehara, M., Hanada, A., Yoshida, S., Akiyama, K., Arite, T., Takeda-Kamiya, N., Magome, H., Kamiya, Y., Shirasu, K., Yoneyama, K., Kyozuka, J., and Yamaguchi, S. (2008) Nature 455, 195-200
19. Ward, S. P., and Leyser, O. (2004) Curr. Opin. Plant Biol. 7, 73-78
20. Sorefan, K., Booker, J., Haurogne, K., Goussot, M., Bainbridge, K., Foo, E., Chatfield, S., Ward, S., Beveridge, C, Rameau, C, and Leyser, O. (2003) Genes Dev. 17, 1469-1474
21. Booker, J., Auldridge, M., Wills, S., McCarty, D., Klee, H., and Leyser, C. (2004) Curr. Biol. 14, 1232-1238
22. Schwartz, S. H., Qin, X. Q., and Loewen, M. C. (2004) J. Biol. Chem. 279, 46940- 46945
23. Alder, A., Holdermann, L, Beyer, P., and Al-Babili, S. (2008) Biochem. J. BJ20080568
24. Booker, J., Sieberer, T., Wright, W., Williamson, L., Willett, B., Stirnberg, P., Turnbull, C, Srinivasan, M., Goddard, P., and Leyser, O. (2005) Dev. Cell 8, 443-449
25. Bennett, T., Sieberer, T., Willett, B., Booker, J., Luschnig, C, and Leyser, O. (2006) Curr. Biol. 16, 553-563
26. Cunningham, F. X., and Gantt, E. (2007) Photosynth. Res. 92, 245-259
27. Schwartz, S. H., Qin, X. Q., and Zeevaart, J. A. D. (2001) J. Biol. Chem. 276, 25208- 25211
28. Stockwell, B. R. (2000) Nat. Rev. Genet. 1, 116-125
29. Armstrong, J. I. (2007) J. ScL FoodAgric. 87, 1985-1990
30. Kaschani, F., and van der Hoorn, R. (2007) Curr. Opin. Chem. Biol. 11, 88-98
31. Han, S. Y., Kitahata, N., Sekimata, K., Saito, T., Kobayashi, M., Nakashima, K., Yamaguchi-Shinozaki, K., Shinozaki, K., Yoshida, S., and Asami, T. (2004) Plant Physiol. 135, 1574-1582
32. Kitahata, N., Han, S. Y., Noji, N., Saito, T., Kobayashi, M., Nakano, T., Kuchitsu, K., Shinozaki, K., Yoshida, S., Matsumoto, S., Tsujimoto, M., and Asami, T. (2006) Bioorg. Med. Chem. 14, 5555-5561
33. Suzuki, A., Akune, M., Kogiso, M., Imagama, Y., Osuki, K., Uchiumi, T., Higashi, S., Han, S. Y., Yoshida, S., Asami, T., and Abe, M. (2004) Plant Cell Physiol. 45, 914-922
34. Han, S. Y., Kitahata, N., Saito, T., Kobayashi, M., Shinozaki, K., Yoshida, S., and Asami, T. (2004) Bioorg. Med. Chem. Lett. 14, 3033-3036
35. Bergeron, R. J., and McManis, J. S. (1989) Tetrahedron 45, 4939-4944
36. Kawase, M., and Kikugawa, Y. (1979) J Chem. Soc, Perkin. Trans. 1, 643-645 37. Schmidt, H., Kurtzer, R., Eisenreich, W., and Schwab, W. (2006) /. Biol. Chem. 281, 9845-9851
38. Cunningham, F. X., Pogson, B., Sun, Z. R., McDonald, K. A., DellaPenna, D., and Gantt, E. (1996) Plant Cell 8, 1613-1626
39. Wilson, A. K., Pickett, F. B., Turner, J. C, and Estelle, M. (1990) MoI. Gen. Genet. 222, 377-383
40. Chatfield, S. P., Stirnberg, P., Forde, B. G., and Leyser, O. (2000) Plant J. 24, 159- 169
41. Taylor, I. B., Sonneveld, T., Bugg, T. D. H., and Thompson, A. J. (2005) J. Plant Growth Regul. 24, 253-273
42. Borowski, T., Blgomberg, M. R. A., and Siegbahn, P. E. M. (2008) Chem. Eur. J. 14, 2264-2276
43. Kontogiorgis, C. A., Papaioannou, P., and Hadjipavlou-Litina, D. J. (2005) Curr. Med. Chem. 12, 339-355
44. Simkin, A. J., Schwartz, S. H., Auldridge, M., Taylor, M. G., and Klee, H. J. (2004) Plant J. 40, 882-892
45. Burbidge, A., Grieve, T. M., Jackson, A., Thompson, A., McCarty, D. R., and Taylor, I. B. (1999) Plant J. 17, 427-431
46. Vogel, J. T., Tan, B. C, McCarty, D. R., and Klee, H. J. (2008) J. Biol. Chem. 283, 11364-11373
47. Paik, J., During, A., Harrison, E. H., Mendelsohn, C. L., Lai, K., and Blaner, W. S. (2001) 7. Biol. Chem. 276, 32160-32168
48. Scherzinger, D., and Al-Babili, S. (2008) MoI. Microbiol. 69, 231-244
49. Bouvier, F., Dogbo, O., and Camara, B. (2003) Science 300, 2089-2091
50. Sandmann, G., Schmidt, A., Linden, H., and Boger, P. (1991) Weed ScL 39, 474-479
51. Naested, H., Holm, A., Jenkins, T., Nielsen, H. B., Harris, C. A., Beale, M. H., Andersen, M., Mant, A., Scheller, H., Camara, B., Mattsson, O., and Mundy, J. (2004) J. Cell Sci. 117, 4807-4818
52. Walsh, T. A., Bauer, T., Neal, R., Merlo, A. O., Schmitzer, P. R., Hicks, G. R., Honma, M., Matsumura, W., Wolff, K., and Davies, J. P. (2007) Plant Physiol. 144, 1292- 1304
53. Quinlan, J. D., and Tobutt, K. R. (1990) Hortscience 25, 60-64
54. Walter, M. H., Floss, D. S., Hans, J., Fester, T., and Strack, D. (2007) Phytochemistry 68, 130-138
55. Yeh, S. L., and Wu, S. H. (2006) Chem-Biol. Interact. 163, 199-206 56. Alija, A. J., Bresgen, N., Sommerburg, O., LanghanS, C. D., Siems, W., and Eckl, P. M. (2006) Carcinogenesis 27, 1128-1133
57. Lindstedt, S. and M. Rundgen. Biochemica et Biophysica Acta 704 (1982) 66-74

Claims

Claims
1. A herbicidal formulation comprising a compound of formula I:
where:
Figure imgf000030_0001
Ri is alkyl or H;
R2, R3, R4 and R5 are independently selectable from H, halide, -NO2, -SO2R', -OH, -Oalkyl where R' is alkyl or aminoalkyl; and
R6 is a substituted or non-substituted alkyl, and/or substituted or non-substituted aryl.
2. A herbicidal formulation according to claim 1, wherein R2, R3, R4 and R5 are H.
3. A herbicidal formulation according to claim 1 or claim 2, wherein Ri is a Ci - C4 alkyl.
4. A herbicidal formulation according to claim 1 or claim 3, wherein Ri is a Ci - C4 alkyl.
5. A herbicidal formulation according to any preceding claim, wherein the alkyl in R6 is a C1 - C,2 alkyl.
6. A herbicidal formulation according to claims 1 to 5, wherein R6 is a substituted alkyl or substituted aryl, substituted with one or more of halide, -OH, -NO2 or -SO2.
7. A herbicidal formulation according to any preceding claims, wherein R6 is a substituted or non-substituted aryl of formula -(CH2)n aryl, where n is an integer of 0 to 4.
8. A herbicidal formulation according to claim 7, wherein R6 has the formula II
Figure imgf000030_0002
9. A herbicidal formulation additionally comprising one or more adjuvants.
10. A method of killing or inhibiting growth of a plant, comprising applying to a seed or a plant a herbicidal formulation according to any preceding claim.
11. An isolated compound of formula III
Figure imgf000031_0001
PCT/GB2009/002674 2008-11-17 2009-11-17 Herbicidal compositions Ceased WO2010055310A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB0821011A GB0821011D0 (en) 2008-11-17 2008-11-17 Herbicidal composition
GB0821011.4 2008-11-17

Publications (1)

Publication Number Publication Date
WO2010055310A1 true WO2010055310A1 (en) 2010-05-20

Family

ID=40194766

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2009/002674 Ceased WO2010055310A1 (en) 2008-11-17 2009-11-17 Herbicidal compositions

Country Status (2)

Country Link
GB (1) GB0821011D0 (en)
WO (1) WO2010055310A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2358197A2 (en) * 2008-11-17 2011-08-24 Syngenta Participations AG Plant development control composition
WO2013186040A3 (en) * 2012-06-11 2014-04-17 Syngenta Participations Ag Crop enhancement compositions

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3236871A (en) * 1961-02-09 1966-02-22 Dow Chemical Co 3, 5-dinitro-o-toluhydroxamic acid and esters and anhydrides thereof
US3457063A (en) * 1964-06-12 1969-07-22 Gulf Oil Corp Methods of controlling weeds with derivatives of aminooxy lower alkanoic acids
EP0326520A2 (en) * 1988-01-29 1989-08-02 Sandoz Ag Hydrazides and hydroxamic acid derivatives
WO2000027204A1 (en) * 1998-11-09 2000-05-18 Novozymes A/S Antimicrobial composition comprising an oxidoreductase and an enhancing agent of the n-hydroxyanilide-type

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3236871A (en) * 1961-02-09 1966-02-22 Dow Chemical Co 3, 5-dinitro-o-toluhydroxamic acid and esters and anhydrides thereof
US3457063A (en) * 1964-06-12 1969-07-22 Gulf Oil Corp Methods of controlling weeds with derivatives of aminooxy lower alkanoic acids
EP0326520A2 (en) * 1988-01-29 1989-08-02 Sandoz Ag Hydrazides and hydroxamic acid derivatives
WO2000027204A1 (en) * 1998-11-09 2000-05-18 Novozymes A/S Antimicrobial composition comprising an oxidoreductase and an enhancing agent of the n-hydroxyanilide-type

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2358197A2 (en) * 2008-11-17 2011-08-24 Syngenta Participations AG Plant development control composition
WO2013186040A3 (en) * 2012-06-11 2014-04-17 Syngenta Participations Ag Crop enhancement compositions

Also Published As

Publication number Publication date
GB0821011D0 (en) 2008-12-24

Similar Documents

Publication Publication Date Title
Sergeant et al. Selective inhibition of carotenoid cleavage dioxygenases: phenotypic effects on shoot branching
Xie et al. Enantioselective effects of chiral amide herbicides napropamide, acetochlor and propisochlor: the more efficient R-enantiomer and its environmental friendly
Pedras et al. Pathogen inactivation of cruciferous phytoalexins: Detoxification reactions, enzymes and inhibitors
Liu et al. Novel interrelationship between salicylic acid, abscisic acid, and PIP2-specific phospholipase C in heat acclimation-induced thermotolerance in pea leaves
Renard-Merlier et al. Iodus 40, salicylic acid, heptanoyl salicylic acid and trehalose exhibit different efficacies and defence targets during a wheat/powdery mildew interaction
Larrieu et al. Q&A: How does jasmonate signaling enable plants to adapt and survive?
Veloso et al. Properties of capsaicinoids for the control of fungi and oomycetes pathogenic to pepper
Ueeda et al. Contribution of jasmonic acid to resistance against Phytophthora blight in Capsicum annuum cv. SCM334
HUE030956T2 (en) Herbicidal and fungicidal 5-oxy-substituted 3-phenylisoxazolin-5-carboxamides and 5-oxy-substituted 3-phenylisoxazolin-5-thioamides
Zhu et al. GhPLP2 positively regulates cotton resistance to verticillium wilt by modulating fatty acid accumulation and jasmonic acid signaling pathway
AU2009315393B2 (en) Plant development control composition
Hou et al. Overexpression of persimmon 9-lipoxygenase DkLOX3 confers resistance to Pseudomonas syringae pv. tomato DC3000 and Botrytis cinerea in Arabidopsis
Villedieu-Percheron et al. Chemicals inducing seed germination and early seedling development
Deng et al. Stereoselective physiological effects of metconazole on seed germination and seedling growth of wheat
Mitić et al. Physiological and cell ultrastructure disturbances in wheat seedlings generated by Chenopodium murale hairy root exudate
Li et al. Strigolactone mimic 2‐nitrodebranone is highly active in Arabidopsis growth and development
WO2010055310A1 (en) Herbicidal compositions
Duhan et al. Phytohormones mediated antifungal resistance against Fusarium oxysporum
Kumar et al. Hormone signaling: current perspectives on the roles of salicylic acid and its derivatives in plants
Riechers et al. Crop selectivity and herbicide safeners: Historical perspectives and development, safener-regulated gene expression, signaling, and new research directions
Dhawan et al. Little seed canary grass resistance to sulfonyl–urea herbicides and its possible management with pendimethalin
PT94889B (en) PROCESS FOR THE PREPARATION OF AZOPHENYLIC COMPOUNDS
Khan et al. The Roles of Oxylipins in Plant Systemic Resistance
Repka Hydrogen peroxide generated via the octadecanoid pathway is neither necessary nor sufficient for methyl jasmonate-induced hypersensitive cell death in woody plants
Hell et al. Molecular analysis of sulfur-based defense reactions in plantpathogen interactions

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09752454

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09752454

Country of ref document: EP

Kind code of ref document: A1