WO2010051550A1 - Methods of diagnosing and treating fibrosis - Google Patents

Methods of diagnosing and treating fibrosis Download PDF

Info

Publication number
WO2010051550A1
WO2010051550A1 PCT/US2009/063016 US2009063016W WO2010051550A1 WO 2010051550 A1 WO2010051550 A1 WO 2010051550A1 US 2009063016 W US2009063016 W US 2009063016W WO 2010051550 A1 WO2010051550 A1 WO 2010051550A1
Authority
WO
WIPO (PCT)
Prior art keywords
yyl
expression
fibrosis
ezh2
trimethylation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2009/063016
Other languages
French (fr)
Inventor
Jia GUO
Xin Lin
Steve Georas
Patricia Sime
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Rochester
Original Assignee
University of Rochester
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Rochester filed Critical University of Rochester
Priority to US13/126,875 priority Critical patent/US9107942B2/en
Publication of WO2010051550A1 publication Critical patent/WO2010051550A1/en
Anticipated expiration legal-status Critical
Priority to US14/814,238 priority patent/US20160025745A1/en
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6875Nucleoproteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/44Oxidoreductases (1)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/04Drugs for skeletal disorders for non-specific disorders of the connective tissue
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39583Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials not provided for elsewhere, e.g. haptens, coenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/11Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (1.14.11)
    • C12Y114/11027[Histone H3]-lysine-36 demethylase (1.14.11.27)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/10Musculoskeletal or connective tissue disorders
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention is directed to methods of diagnosing and treating a fibrotic condition in a mammalian subject.
  • Idiopathic pulmonary fibrosis is a progressive, chronic interstitial lung disease associated with high mortality (median survival of newly diagnosed patients is ⁇ 3 years) and a uniformly poor prognosis (Khalil et al., "Idiopathic Pulmonary Fibrosis: Current Understanding of the Pathogenesis and the Status of Treatment," CMAJ 171(2): 153-60 (2004)).
  • IPF is the pathological hallmark of interstitial lung diseases (Green, F.H., “Overview of Pulmonary Fibrosis," Chest 122(6 Suppl):334S-339S (2002)) and is characterized by increased deposition of extracellular matrix (ECM), including collagen.
  • ECM extracellular matrix
  • ⁇ -smooth muscle actin ⁇ -SMA
  • ECM proteins ⁇ -smooth muscle actin-like proteins
  • Roy et al. "Regulation of ⁇ -Smooth Muscle Actin Gene Expression in Myofibroblast Differentiation from Rat Lung Fibroblasts,” Int'lJ. Biochem. Cell Biol. 33(7):723-34 (2001)).
  • Myofibroblasts acquire resistance to apoptosis, which may account for the increased number of these cells present in fibroblastic foci (Horowitz et al., "Combinatorial Activation of FAK and AKT by Transforming Growth Factor- ⁇ l Confers an Anoikis- Resistant Phenotype to Myofibroblasts," Cell Sign. 19(4):761-71 (2007)).
  • Myofibroblasts are crucial effector cells in lung fibrosis, and derive from epithelial to mesenchymal transition (EMT) (Bedi et al., "Epithelial-to- Mesenchymal Transition and Chronic Allograft Tubulointerstitial Fibrosis," Transplant.
  • EMT epithelial to mesenchymal transition
  • Avoiding the formation of over-myo fibroblasts would provide protection against lung fibrosis, and this could be achieved by inhibition of ⁇ -SMA expression in lung fibroblasts (Meyer-Ter-Vehn et al., "Lovastatin Inhibits TGF- ⁇ - Induced Myofibroblast Transdifferentiation in Human Tenon Fibroblasts," Invest. Ophthalmol. Vis. Sci. 49(9):3955-60 (2008)).
  • pro-fibrotic stimuli e.g. asbestos, silica, bleomycin
  • alveolar macrophages produce cytokines including TGF- ⁇ 1 and TNF- ⁇
  • cytokines including TGF- ⁇ 1 and TNF- ⁇
  • TGF- ⁇ i plays an essential role in wound healing and matrix molecule deposition. It induces myofibroblast differentiation and alveolar remodeling in vivo (Leask & Abraham, "TGF- ⁇ Signaling and the Fibrotic Response,” Faseb. J. 18(7):816-27 (2004); Lee et al, "Early Growth Response Gene 1 -Mediated Apoptosis Is Essential for Transforming Growth Factor ⁇ i-Induced Pulmonary Fibrosis,” J. Exp. Med.
  • TNF- ⁇ also contributes to lung fibrosis (Ortiz et al., "Expression of TNF and the Necessity of TNF Receptors in Bleomycin-Induced Lung Injury in Mice," Exp. Lung Res. 24(6):721-43 (1998)), and its effects may be mediated through activation of other growth factors.
  • TNF- ⁇ may also regulate the balance between cell survival and cell death.
  • TNF- ⁇ - deficient mice are protected against bleomycin-induced lung inflammation via reduced apoptosis of inflammatory cells (Kuroki et al., "Repression of Bleomycin- Induced Pneumopathy by TNF," J. Immunol. 170(l):567-74 (2003)).
  • Inhibition of TNF- ⁇ with infliximab may stabilize the progression of pulmonary fibrosis associated with collagen vascular disease (CVD) (Antoniou et al., "Infliximab Therapy in Pulmonary Fibrosis Associated with Collagen Vascular Disease," Clin. Exp. Rheumatol.
  • CVD collagen vascular disease
  • Yin Yang 1 (YYl) is a ubiquitously expressed zinc finger transcription factor that can either activate or repress gene transcription, and plays an important role in cellular proliferation, differentiation, and apoptosis.
  • YYl contributes to the pathogenesis of cancer and inflammation (Austen et al., "Characterization of the Transcriptional Regulator YYl. The Bipartite Transactivation Domain Is Independent of Interaction with the TATA Box-Binding Protein, Transcription Factor HB, TAFII55, or cAMP-Responsive Element-Binding Protein (CBP)-Binding Protein," J. Biol. Chem.
  • YYl negatively regulates p53, a tumor suppressor gene (Sui et al., “Yin Yang 1 Is a Negative Regulator of p53," Cell 117(7):859-72 (2004)), and promotes tumor cell survival in part by preventing apoptosis (Huerta-Yepez et al., "Involvement of the TNF- ⁇ Autocrine-Paracrine Loop, via NF -KB and YYl, in the Regulation of Tumor Cell Resistance to Fas-Induced Apoptosis," Clin.
  • TNF- ⁇ -induced YYl represses Fas expression, providing a mechanism whereby YYl contributes to TNF- ⁇ -induced cell survival (Huerta-Yepez et al., "Involvement of the TNF- ⁇ Autocrine-Paracrine Loop, via NF- ⁇ B and YYl, in the Regulation of Tumor Cell Resistance to Fas-Induced Apoptosis," Clin.
  • TNF- ⁇ induces YYl in an NF- ⁇ B-dependent manner (Wang et al., "NF -KB Regulation of YYl Inhibits Skeletal Myogenesis Through Transcriptional Silencing of Myofibrillar Genes," MoI. Cell Biol.
  • YYl can bind to and activate type I and type II collagen gene promoters in fibroblasts (Riquet et al., "YYl Is a Positive Regulator of Transcription of the Collal Gene,” J. Biol. Chem. 276(42):38665-72 (2001); Miao et al., "Identification of Two Repressor Elements in the Mouse ⁇ 2 (I) Collagen Promoter," Arch. Biochem. Biophys. 361(1):7- 16 (1999)), and also enhance fibronectin gene expression (Du et al., "Transcriptional Up-Regulation of the Delayed Early Gene HRS/SRp40 During Liver Regeneration. Interactions Among YYl , GA-Binding Proteins, and Mitogenic Signals," J. Biol.
  • cyclooxygenase-2 (which also contributes to lung fibrosis) is also regulated by YYl in macrophages (Joo et al., "Yin Yang 1 Enhances Cycloxygenase-2 Gene Expression in Macrophages," Am. J. Physiol. Lung Cell. MoI. Physiol. 292(5):L1219-26 (2007)). These reports suggest that YYl may play a role in fibrotic responses in the lung or other organs, but very little is known about the expression or function of YYl in fibrotic conditions in vivo.
  • Embryonic fibroblasts from YYl-deficient mice demonstrated reduced proliferation in vitro in proportion to the levels of YYl protein expression. This finding indicates that YYl controls fibroblast proliferation in a gene dosage-dependent manner (Affar el et al., "Essential Dosage-Dependent Functions of the Transcription Factor Yin Yang 1 in Late Embryonic Development and Cell Cycle Progression," MoI. Cell Biol. 26(9):3565-81 (2006)). However, very little is known about the expression or function of YYl in fibrotic conditions or disorders, such as lung fibrosis. [0009] The present invention is directed to overcoming these and other deficiencies in the art.
  • a first aspect of the present invention is directed to a method of diagnosing a fibrotic condition in a subject by measuring the level of trimethylation at lysine residue 27 of histone-3 ("H3K27”) in a biological sample from the subject.
  • the level of H3K27 trimethylation is compared to a standard level of H3K27 trimethylation, and the presence or absence of a fibrotic condition is correlated to the results of the comparison.
  • a second aspect of the present invention is directed to a method of diagnosing a fibrotic condition in a subject by measuring the expression level of Enhancer of Zeste Homolog 2 ("EZH2”) or Yin-Yang- 1 ("YY-I”) in a biological sample from the subject.
  • EZH2 Enhancer of Zeste Homolog 2
  • YY-I Yin-Yang- 1
  • Another aspect of the present invention is directed to a method of treating a subject having a fibrotic condition. This method involves administering to the subject an agent that inhibits or reduces H3K27 trimethylation under conditions effective to treat a fibrotic condition in the subject.
  • Another aspect of the present invention relates to a method of identifying an agent that is effective for treating a fibrotic condition.
  • This method involves obtaining a first biological sample from an in vivo or in vitro experimental model of fibrosis and administering a candidate agent to the experimental model of fibrosis.
  • a second biological sample is obtained from the experimental model after administering the candidate agent, and the level of H3K27 trimethylation in the first and second biological samples is measured.
  • the level of H3K27 trimethylation in the first and second biological samples is then compared. A decrease in the level of
  • H3K27 trimethylation in the second biological sample relative to the level of H3K27 trimethylation in the first biological sample indicates that the agent is effective for treating a fibrotic condition.
  • Another aspect of the present invention is directed to a pharmaceutical composition.
  • the pharmaceutical composition contains a pharmaceutically acceptable delivery vehicle and an effective amount of one or more agents selected from the group consisting of an agent that inhibits or reduces H3K27 trimethylation, an inhibitor of EZH2, an inhibitor of YY-I, and an inhibitor of histone deacetylase.
  • the pharmaceutical composition of the present invention is suitable for treating a fibrotic condition.
  • Pulmonary fibrosis like other fibrotic conditions, is a progressive and chronic condition involving the formation of excess connective scar tissue within the lung. Pulmonary fibrosis alone affects more than five million people worldwide, resulting in more than 40,000 deaths per year.
  • the present invention provides, inter alia, an understanding of the molecular mechanisms underlying the pathogenesis of fibrosis and fibrotic conditions that facilitates the development of early diagnostic markers as well as effective therapeutic agents that can prevent or reduce disease progression.
  • Figures IA- 1C show that YYl protein expression is increased in the lungs of idiopathic pulmonary fibrosis (IPF) patients.
  • Figure IB is an immunoblot of whole lung tissue extracts from IPF patients ("IPF") and healthy controls ("Normal”), using anti-YYl (H414, Santa Cruz) and anti- ⁇ -actin antibodies.
  • YYl expression is upregulated in whole lung tissue lysates of IPF patients.
  • YYl transcription level is upregulated in whole lung tissues of IPF patients.
  • Figures 2A-2C show that YYl protein expression is increased in the lungs of silica-challenged mice.
  • FIG. 2B is an immunoblot of whole lung tissue extracts from C57BL/6 mice treated with silica ("Silica”) or saline (“PBS”), using anti-YYl (H414, Santa Cruz) and anti-GAPDH antibodies.
  • YYl expression is upregulated in whole lung tissue lysates of silica-induced fibrosis.
  • Figure 2C is a graph showing the relative fold induction of YY-I mRNA expression in the samples shown in Figure 2 A, assessed by quantitative PCR. **p ⁇ 0.01 by Student's t-test.
  • YYl transcription level is upregulated in whole lung tissues of silica-induced fibrosis.
  • Figures 3A-3C show that YYl protein expression is increased in the lungs of bleomycin-challenged mice.
  • Figure 3 B is an immunoblot of cytoplasmic and nuclear fractions from C57BL/6 mice treated with the indicated amounts of bleomycin, using anti-YYl (H414, Santa Cruz) and anti- ⁇ -actin antibodies.
  • YYl expression is upregulated in whole lung tissue lysates of bleomycin-induced fibrosis.
  • Figure 3C is a graph showing the relative fold induction of YY-I mRNA expression in the samples shown in Figure 3A, assessed by quantitative PCR. *p ⁇ 0.05 by Student's t-test.
  • YYl transcription level is upregulated in whole lung tissues of bleomycin-induced fibrosis.
  • Figure 4A is a series of light photomicrographs of lung sections from
  • IPF IPF patients
  • Normal healthy controls
  • H&E hemotoxylin and eosin
  • Figure 5 shows the purity of primary lung fibroblasts isolated from mice treated with bleomycin. After two passages, the fibroblasts were labeled with anti-FSPl antibody and anti-mouse- APC. Red (light grey) represents isotype labeled- cells and blue (dark grey) represents anti-FSPl labeled-positive cells (89.4%).
  • Figure 6B is a series of light photomicrographs of lung samples from
  • FIGS 7A-7F show that TGF- ⁇ induces YYl protein expression, mRNA levels, and promoter activity in human and mouse lung fibroblasts.
  • Figures 7A and 7B are immunoblots of human WI-38 cells ( Figure 7A) and mouse MLg2908 cells ( Figure 7B) treated with TGF- ⁇ . After serum starvation for 24 hours, cells were treated with 10 ng/ml of TGF- ⁇ for the indicated times in serum- free DMEM.
  • Figures 7C and 7D are graphs showing the relative fold induction of YY-I mRNA expression, detected by quantitative PCR, in WI-38 cells ( Figure 7C) and MLg2908 cells (Figure 7D) treated with TGF- ⁇ .
  • Figures 7E and 7F are graphs relating to the YYl promoter activity in YYl -Luc-trans fected WI-38 cells ( Figure 7E) and YYl-Luc-transfected MLg2908 cells ( Figure 7F) treated with PBS or TGF- ⁇ for 24 hours.
  • YYl-LUC full-length YYl promoter-luciferase reporter
  • RLU Relative light units
  • Figures 8A-8B show that TGF- ⁇ induces YYl protein expression and promoter activity in adult human lung fibroblasts.
  • Figure 8A is an immunoblot of whole cell extracts from MRC5 cells treated with TGF- ⁇ for 8 hours.
  • Figure 8B is a graph of the relative light units of YYl -Lluc-trans fected MRC5 cells treated with phosphate-buffered saline ("0") or TGF- ⁇ ("10”) for 24 hours. The data are presented with standard errors derived from at least three independent experiments performed in triplicate. */? ⁇ 0.05 by the Student's t-test.
  • Figures 9A-9F show that TNF- ⁇ induces YYl protein expression, mRNA levels, and promoter activity in human and mouse lung fibroblasts.
  • Figures 9A and 9B are immunoblots of human WI-38 cells ( Figure 9A) and mouse MLg2908 cells ( Figure 9B) treated with TNF- ⁇ . After serum starvation for 24 hours, cells were treated with 10 ng/ml of TNF- ⁇ for the indicated times in serum-free DMEM. Extracts from whole cells were subjected to immunoblot analysis with anti-YYl or anti- ⁇ -actin antibody.
  • Figures 9C and 9D are graphs showing the relative fold induction of YY-I mRNA expression, detected by quantitative PCR, in WI-38 cells ( Figure 9C) and MLg2908 cells (Figure 9D) treated with TGF- ⁇ .
  • Figures 9E and 9F are graphs relating to the YYl promoter activity in YYl -Luc-trans fected WI-38 cells ( Figure 9E) and YYl-Luc-transfected MLg2908 cells ( Figure 9F) treated with TNF- ⁇ for 8 hours.
  • the full-length YYl promoter-luciferase reporter (YYl-LUC) was transfected into the cells by electroporation.
  • FIG. 1 OA- 1 OB are immunoblots that show that YY 1 protein expression is increased in WI-38 and MLg2908 cells stimulated with silica. After serum starvation for 24 hours, cells were treated with 40 ⁇ g/ml of silica for the indicated time periods in serum- free DMEM. Extracts from WI-38 ( Figure 10A) or MLg2908 ( Figure 10B) cells were immunob lotted with anti-YYl or anti- ⁇ -actin antibodies.
  • Figure 11 is a western blot of unstimulated ("resting") IC-21 alveolar macrophages or IC-21 cells stimulated with TNF- ⁇ (10 ng/ml) or silica (20 ⁇ g/ml). After two days, the cells were harvested and YYl expression was determined using anti-YYl and anti-GAPDH antibodies. YYl expression was slightly decreased by TNF- ⁇ and silica.
  • FIGS 12A-12C demonstrate that TGF- ⁇ -induced upregulation of
  • FIG. 12A is a graph of the relative fold induction of YYl mRNA expression in WI-38 cells trans fected with a wild-type YYl promoter construct ("YYl").
  • Figure 12B is a graph of the relative fold induction of YYl mRNA expression in WI-38 cells trans fected with a mutant YYl promoter contruct that has a disrupted NF- ⁇ B binding site ("mutant YYl").
  • the cells were also transiently co-transfected with a vector control ("pSG5") or 2.5 ⁇ g of NF -KB (“p65”) plasmid by electroporation, and then treated with PBS or 10 ng/ml of TGF- ⁇ for 24 hours. Data are presented with standard errors derived from at least three independent experiments performed in triplicate. ***P ⁇ 0.001 (untreated pSG5 vs. untreated p65; TGF- ⁇ -treated pSG5 vs. TGF- ⁇ -treated p65).
  • Figure 12C is an immunoblot of WI-38 cells pre-treated with 5 ⁇ M of Bay 11-7085 (an NF- ⁇ B inhibitor) for one hour and then treated with 10 ng/ml of TGF- ⁇ for the indicated times in serum-free DMEM. Extracts from whole cells were immunoblotted with anti-YYl or anti- ⁇ -actin antibody.
  • Figures 13A-13C show that ⁇ -SMA activity is upregulated by YYl .
  • Figure 13A is a graph of ⁇ -SMA activity in WI-38 cells transfected with the mouse ⁇ - SMA luciferase reporter ( ⁇ -SMA-Luc).
  • FIG. 13B is an electrophoretic mobility shift assay (EMSA) showing YYl binding activity at the ⁇ -SMA promoter in nuclear extracts isolated from WI-38 cells. EMSA was performed with a biotin-labeled probe containing a known YYl binding site in the ⁇ -SMA promoter.
  • FIG. 13C is a graph of ⁇ -SMA activity in lung fibroblasts obtained from YY1 +/" mice or wide type mice transfected with the mouse ⁇ -SMA-Luc by electroporation and then treated with PBS or 10 ng/ml of TGF- ⁇ for 24 hours. *p ⁇ 0.05, *p ⁇ 0.01. All reporter data were normalized using an empty vector control. RLU data are shown from at least five independent experiments performed in duplicate. [0031] Figures 14A-14C show that YYl expression is greater in ⁇ i CC10 mice than in normal littermate mice.
  • Figure 14A is a series of images of lung fibroblasts isolated from ⁇ i CC10 and wild type (“WT") mice immunostained with ⁇ - SMA (green) and YYl (red). All pictures are shown at the original magnification of 2OX or 4OX.
  • Figure 14B is a western blot of lung fibroblasts derived from two individual ⁇ i CC10 mice ("CClO-YYl-I” and "CC 10-YY 1-2") and two wild type mice (“WTl” and "WT2"). Whole-cell lysates were immunoblotted with anti-YYl, anti-collagen 1, anti- ⁇ -SMA, and ⁇ -actin antibodies. Representative examples obtained from three independent experiments are shown.
  • Figures 15A-15D show that expression of ⁇ -SMA and collagen 1 is diminished, and this decrease is accompanied by diminished YYl expression.
  • Figure 15A is a series of images of lung fibroblasts isolated from YYl f/f mice and then transfected with Cre-GFP vector to knockdown YYl expression. The fibroblasts were then immunostained with anti- ⁇ -SMA (red) antibody (" ⁇ -SMA"). The pictures illustrate the original magnification at 4OX.
  • Figure 15B is a western blot showing YYl protein expression in primary lung fibroblasts obtained from YYl f/f mice and transfected with Lenti-Cre or pLL37 as a control, at the indicated multiplicities of infection ("MOI"). The cells were blotted with anti-YYl and anti- ⁇ -actin antibodies.
  • Figure 15C is a series of images of LL97A cells transduced with one of two control lentivirus vector shRNAs ("Control- 1" and "Control-2") or one of two lentivirus vector YYl shRNAs ("YYl-lenti-shRNA-1" and "YYl-lenti-shRNA-2”) for three days. Puromycin was then used to select transduced cells.
  • FIG. 15D is a western blot of LL97A cells transduced with the indicated vectors, showing the expression levels of collagen 1 and YYl. Extracts from whole cells were immunoblotted with anti-collagen 1 and anti- YYl antibodies. Representative examples of three independent experiments are shown. [0033] Figures 16A-16D show that the expression of ⁇ -SMA and collagen is decreased in YY1 +/" and YYl f/f compared to littermate mice.
  • Figure 16B is a graph of the fibrosis grade-score for the lung tissue sections showin in Figure 16A, evaluated by double blind scoring using immunohistochemistry for ⁇ -SMA. *p ⁇ 0.05 by the Student's t-test.
  • Figure 16D is a graph of the fibrosis grade -score for the lung tissue sections show in Figure 16C, evaluated by double blind scoring using immunohistochemistry for ⁇ -SMA.
  • FIGS 17A-17D show that ⁇ -SMA and collagen expression is decreased in YY l f/f compared to wildtype mice.
  • Figure 17A is a series of light photomicrographs, in which H&E staining and immunohistochemistry were used to compare the histological features and the expression of ⁇ -SMA and collagen in YYl f/f compared to WT mice. Pictures are presented at their original magnification of 1OX (63X is shown in the right-hand corner).
  • Figure 17C is a graph of the relative fold induction of mRNA YYl expression in YYl f/f mice versus wildtype mice, evaluated by quantitative PCR.
  • Figure 18 is an immunoblot showing YYI in WI-38 cells that were unstimulated ("Resting") or treated with IL- l ⁇ (10 mg/ml). Immunoblots were performed on Day 1 and Day 2 using anti-YYl and anti-GAPDH antibodies. YYl expression was shown to be upregulated by IL- l ⁇ .
  • Figure 19 is a graph of the cytokines present in the bronchoalveolar lavage ("BAL") of wild type and YY1 +/" (“HET-YYl”) mice. */? ⁇ 0.05; **/K0.01.
  • Figure 20 is a graph showing the relative ⁇ -SMA promoter activity in
  • DZ-YYl is deficient in the four zinc finger domains of YY-I that mediate its binding to DNA.
  • ⁇ -SMA promoter activity in cells dually transfected with the ⁇ -SMA promoter luciferase reporter construct (alpha-SMA-luc) and the DZ-YYl construct (DZ-YYl) was attenuated compared to cells transfected with the ⁇ -SMA promoter construct alone (control).
  • TGF- ⁇ (TGF-beta) induced ⁇ -SMA promoter activity was also significantly reduced in cells transfected with the DZ-YYl construct compared to unstimulated control.
  • Figures 21A-21B are western blots showing the detection of histone-3
  • H3 lysine 27 (K27) trimethylation H3K27me3 in lung tissue samples derived from patients having idiopathic pulmonary fibrosis (IPF) and healthy control individuals (Normal) ( Figure 21A), and H3K27 trimethylation in lung tissue samples derived from silica treated (silica-induced fibrosis) and non-treated (non-silica) mice ( Figure 21B).
  • ⁇ -actin was used a loading control.
  • Figure 22 is a western blot showing the time- and dose-related increase in H3K27 trimethylation (H3K27me3) in human lung fibroblasts following silica exposure at the indicated time points, ⁇ -action was used as a loading control.
  • Figure 23 shows H3K27 trimethylation (H3K27me3) in non- transfected lung fibroblasts from YYl f/f mice (non-transfected) or lung fibroblasts from YYl f/f mice transfected (transfected) with a Cre-recombinase-GFP fusion protein (Cre-GFP). Successful transfection is indicated by GFP (green) fluorescence of the Cre-GFP construct.
  • Cre-GFP Cre-recombinase-GFP fusion protein
  • FIG. 24 is a graph showing the relative fold induction of EZH2 mRNA expression in lung tissue derived from patients having idiopathic pulmonary fibrosis (IPF) compared to healthy control individuals (Normal).
  • Figure 25 is a schematic diagram outlining the in vivo study protocols for investigating the therapeutic potential of DZ-YYl in the prevention and treatment of silica-induced lung fibrosis.
  • the present invention relates to several methods for diagnosing and treating a fibrotic condition in a subject.
  • the subject can be any animal that exhibits fibrotic processes, preferably a mammalian subject.
  • Exemplary mammalian subjects include, without limitation, humans, non-human primates, dogs, cats, rodents ⁇ e.g., mouse, rat, guinea pig), horses, cattle and cows, sheep, and pigs.
  • a fibrotic condition generally refers to the formation or development of excess fibrous connective tissue in an organ or tissue and resulting disorders/diseases. Fibrosis can affect the lungs, heart, kidneys, liver, brain, skin, or any other organ.
  • Fibrotic conditions that can be diagnosed according to the methods of the present invention include, without limitation, acute and chronic forms of pulmonary fibrosis, interstitial lung disease, human fibrotic lung disease, liver fibrosis, cardiac fibrosis, kidney fibrosis, macular degeneration, retinal and vitreal retinopathy, myocardial fibrosis, Grave's ophthalmopathy, drug induced ergotism, cardiovascular disease, atherosclerosis/restenosis, keloids and hypertrophic scars, cancer, Alzheimer's disease, skin fibrosis, scarring, scleroderma, glioblastoma in Li- Fraumeni syndrome, sporadic glioblastoma, myleoid leukemia, acute myelogenous leukemia, myelodysplastic syndrome, myeloproferative syndrome, gynecological cancer, Kaposi's sarcoma, Hansen's disease and inflammatory bowel disease, including collagenous colitis
  • a first aspect of the present invention is directed to a method of diagnosing a fibrotic condition in a subject by measuring the level of trimethylation at lysine residue 27 of histone-3 ("H3K27") in a biological sample from the subject.
  • the level of H3K27 trimethylation is compared to a standard level of trimethylation at lysine residue 27 of histone-3 and the presence or absence of a fibrotic condition is correlated to the results of the comparison.
  • Histone 3 is a protein found in association with DNA in the chromation of eukaryote cells.
  • the full-length amino acid sequences of human and mouse histone-3 (H3) proteins are well known in the art (see GenBank Accession Nos. NM 0003493 (human) and NM 030082 (mouse), which are hereby incorporated by reference in their entirety).
  • GenBank Accession Nos. NM 0003493 (human) and NM 030082 (mouse) which are hereby incorporated by reference in their entirety.
  • an increase in H3K27 trimethylation is an indicator of a fibrotic condition.
  • H3K27 trimethylation may be determined using any convenient method for detecting amino acid methylation known to one skilled in the art.
  • protein methylation at a specific residue, in this case K27 of H3 is detected using an antibody or other binding molecule which recognizes and binds to a methylated K27 residue.
  • the antibody or other binding molecule recognizes and binds to trimethylated K27 but not an unmethylated, mono- methylated, or di-methylated H3K27 residue.
  • Antibodies specific for trimethylated H3K27 are readily known in the art and are commercially available from, e.g., Santa Cruz Biotechnology, Santa Cruz, CA, and Millipore, Billerica, MA.
  • antibodies selective for binding to the trimethylated H3K27 residue can be obtained by any standard technique for generating antibodies.
  • Procedures for raising polyclonal antibodies are well known in the art. Typically, such antibodies can be raised by administering a peptide containing the epitope of interest, i.e., an H3 peptide trimethylated at residue K27, subcutaneously to New Zealand white rabbits which have first been bled to obtain pre -immune serum. The antigens can be injected at a total volume of 100 ⁇ l per site at six different sites.
  • Injected material will contain synthetic surfactant adjuvant pluronic polyols, or pulverized acrylamide gel containing the protein or polypeptide after SDS- polyacrylamide gel electrophoresis.
  • the rabbits are bled approximately every two weeks after the first injection and periodically boosted with the same antigen three times every six weeks.
  • a sample of serum is collected 10 days after each boost and polyclonal antibodies are recovered by affinity chromatography using the corresponding antigen to capture the antibody.
  • This and other procedures for raising polyclonal antibodies are disclosed in ANTIBODIES: A LABORATORY MANUAL (Harlow et al. eds., 1988), which is hereby incorporated by reference in its entirety.
  • a monoclonal antibody is obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts.
  • Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler et al., "Continuous Cultures of Fused Cells Secreting Antibody of Predefined Specificity," Nature 256:495-7 (1975), and ANTIBODIES: A LABORATORY MANUAL (Harlow et al. eds., 1988), which are hereby incorporated by reference in their entirety.
  • a mouse or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
  • the lymphocytes may be immunized in vitro.
  • the immunizing agent comprises a H3 peptide sequence containing a trimethylated K27 residue.
  • the antibody producing cells are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form hybridoma cells, which are cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
  • Detection of H3K27 trimethylation using an antibody or other protein binding molecule selective for binding to the trimethylated K27 residue of H3 can be carried out using any suitable hybridization assay.
  • suitable hybridization assays include, but are not limited to, enzyme-linked immunosorbent assay (ELISA), dot blot, western blot, chromatin immunoprecipitation (ChIP), ChiP/microarray analysis (see U.S. Patent Application Publication NO. 20070292857 to Rama et al, which is hereby incorporated by reference in its entirety), immunocytochemistry, and immunohistochemistry.
  • Other binding molecules that can be used for selective binding to trimethylated H3K27 include, without limitation, antibody fragments, antibody mimics, and nucleic acid aptamers.
  • a number of antibody mimics are known in the art including, without limitation, those known as monobodies, which are derived from the tenth human fibronectin type III domain ( 10 Fn3) (Koide et al., "The Fibronectin Type III Domain as a Scaffold for Novel Binding Proteins," J. MoI. Biol. 284:1141-1151 (1998); Koide et al., "Probing Protein Conformational Changes in Living Cells by Using Designer Binding Proteins: Application to the Estrogen Receptor," Proc. Nat 'I Acad. Sci.
  • Suitable binding molecules that can be used for detection of trimethylated H3K27 include aptamers that specifically bind to trimethylated H3K27. This is intended to encompass aptamers that, from a structural perspective, are not necessarily considered antibody mimics. Aptamers are single-stranded, partially single-stranded, partially double-stranded, or double-stranded nucleotide sequences, advantageously a replicatable nucleotide sequence, capable of specifically recognizing a selected non-oligonucleotide molecule or group of molecules by a mechanism other than Watson-Crick base pairing or triplex formation.
  • Aptamers include, without limitation, defined sequence segments and sequences comprising nucleotides, ribonucleotides, deoxyribonucleotides, nucleotide analogs, modified nucleotides, and nucleotides comprising backbone modifications, branchpoints, and non-nucleotide residues, groups, or bridges.
  • Aptamers include partially and fully single-stranded and double-stranded nucleotide molecules and sequences; synthetic RNA, DNA, and chimeric nucleotides; hybrids; duplexes; heteroduplexes; and any ribonucleotide, deoxyribonucleotide, or chimeric counterpart thereof and/or corresponding complementary sequence, promoter, or primer-annealing sequence needed to amplify, transcribe, or replicate all or part of the aptamer molecule or sequence.
  • H3K27 trimethylation can be detected using any other means for detecting protein or peptide modifications that are known in the art, including, but not limited to, two-dimensional gel electrophoresis, mass spectroscopy, matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF), surface- enhanced laser desorption ionization-time of flight (SELDI-TOF), high performance liquid chromatography (HPLC), fast protein liquid chromatography (FPLC), and multidimensional liquid chromatography (LC) followed by tandem mass spectrometry (MS/MS).
  • MALDI-TOF matrix-assisted laser desorption/ionization-time of flight
  • SELDI-TOF surface- enhanced laser desorption ionization-time of flight
  • HPLC high performance liquid chromatography
  • FPLC fast protein liquid chromatography
  • LC multidimensional liquid chromatography
  • MS/MS tandem mass spectrometry
  • H3K27 trimethylation in a sample obtained from a subject is compared to a standard level of H3K27 trimethylation.
  • H3K27 trimethylation is the average level of H3K27 trimethylation in one or more normal or non-fibrotic samples, or a range of values that are consistent with the average level of H3K27 trimethylation in normal or non-fibrotic tissue.
  • a non- fibrotic sample can be a sample that was taken from the subject being diagnosed prior to the onset of the potential fibrotic condition or a sample from one or more non- fibrotic tissues of the subject.
  • a non-fibrotic sample can also be derived from another subject (other than the subject being diagnosed) who does not have fibrosis. According to this embodiment, a higher level of H3K27 trimethylation in the sample from the subject being diagnosed compared to the standard level of H3K27 trimethylation indicates the presence of a fibrotic condition.
  • a similar or lower level of H3K27 trimethylation in the sample from the subject compared to the standard level of H3K27 trimethylation indicates the absence of a fibrotic condition.
  • the standard level of H3K27 trimethylation is the average level of H3K27 trimethylation in one or more known fibrotic samples or a range of values that are consistent with the level of H3K27 trimethylation in a fibrotic condition. Accordingly, a lower level of H3K27 trimethylation in the sample from the subject being diagnosed compared to the standard level of H3K27 trimethylation indicates the absence of a fibrotic condition.
  • a similar or higher level of H3K27 trimethylation in the sample from the subject being diagnosed compared to the standard level of H3K27 trimethylation indicates the presence of a fibrotic condition.
  • This aspect of the present invention may also be used to determine a subject's predisposition to developing a fibrotic condition. This involves comparing the level of H3K27 trimethylation in a biological sample from the subject to a standard level of H3K27 trimethylation in a non- fibrotic tissue or cell sample and to a standard level of H3K27 trimethylation in a fibrotic tissue or cell sample.
  • the subject may have a predisposition to developing a fibrotic condition.
  • Monitoring changes in H3K27 trimethylation in a subject over time to track development of, or recovery from, a fibrotic condition is also contemplated by the present invention.
  • a second aspect of the present invention is directed to a method of diagnosing a fibrotic condition in a subject by measuring the expression level of Enhancer of Zeste Homolog 2 ("EZH2") or Yin-Yang- 1 ("YY-I") in a biological sample from the subject.
  • the expression level of EZH2 or YY-I in the biological sample is compared to a standard expression level of EZH2 or YY-I and the presence or absence of a fibrotic condition is correlated to the results of the comparison.
  • YY-I is known to play an important role in the regulation of tumor cell resistance to Fas-induced apoptosis. Increased YY-I expression represses Fas expression and decreases apoptosis. Blocked NF -KB and p38 decrease YY-I expression and activate Fas expression (Huerta-Yepez et al., "Involvement of the TNF- ⁇ Autocrine-Paracrine Loop, via NF- ⁇ B and YYl, in the Regulation of Tumor Cell Resistance to Fas-induced Apoptosis," Clin. Immunol.
  • YY-I and activator protein 1 work synergistically in the activation of the tumor suppressor HLJl (Wang et al., "Synergistic Activation of the Tumor Suppressor, HLJl, by the Transcription Factors YYl and Activator Protein 1," Cancer Res. 67(10):4816-26 (2007), which is hereby incorporated by reference in its entirety).
  • YYl can bind to type I and II collagen (COL 1 and COL 2) promoters and positively activate these genes in fibroblasts (Riquet et al., "YYl Is a Positive Regulator of Transcription of the Collal Gene,” J. Biol. Chem.
  • YYl also enhances cyclooxygenase-2 (CoX-2) expression in macrophages (Joo et al., "Yin Yang 1 Enhances Cyclooxygenase-2 Gene Expression in Macrophages,” Am. J. Physiol. Lung Cell MoI. Physiol. 292(5):L1219-L1226 (2007), which is hereby incorporated by reference in its entirety).
  • EZH2 is a member of the Polycomb Group (PcG) of genes that is important for differentiation and cell cycle regulation and is aberrantly expressed in several cancers.
  • the EZH2 protein endows the Polycomb complexes, PRC2 and PR3, with histone lysine methyltransferase activity that is associated with gene transcriptional repression (Caretti et al., "The Polycomb EZH2 Methyltransferase Regulates Muscle Gene Expression and Skeletal Muscle Differentiation," Genes
  • the expression level of EZH2 or YY-I in a sample obtained from a subject is compared to a standard expression level of EZH2 or YY-I.
  • the standard expression level of EZH2 or YY-I is the average expression level of EZH2 or YY-I in one or more non-fibrotic samples or a range of values that is consistent with the expression levels of EZH2 or YY-I in normal or non-f ⁇ brotic tissue.
  • a non-f ⁇ brotic sample can be a sample taken from the subject to be diagnosed prior to the onset of the potential fibrotic condition or from one or more non-fibrotic tissues of the subject.
  • a non- fibrotic sample can also be derived from another subject (other than the subject being diagnosed) who does not have fibrosis.
  • a higher expression level of EZH2 or YY-I in the sample from the subject to be diagnosed compared to the standard expression level of EZH2 or YY-I indicates the presence of a fibrotic condition.
  • a similar or lower expression level of EZH2 or YY-I in the sample from the subject compared to the standard expression level of EZH2 or YY-I indicates the absence of a fibrotic condition.
  • 1 is the average expression level of EZH2 or YY-I in one or more known fibrotic samples or a range of values that is consistent with the expression level of EZH2 or YY-I in a fibrotic condition. Accordingly, a lower expression level of EZH2 or YY-I in the sample from the subject to be diagnosed compared to the standard expression level of EZH2 or YY-I indicates the absence of a fibrotic condition. A similar or higher expression level of EZH2 or YY-I in the sample from the subject compared to the standard expression level of EZH2 or YY-I indicates the presence of a fibrotic condition.
  • This aspect of the present invention may also be used to determine a subject's predisposition to developing a fibrotic condition. This involves comparing the level of EZH2 or YY-I expression in a biological sample from the subject to a standard level of EZH2 or YY-I expression in a non-fibrotic tissue or cell sample and to a standard level of EZH2 or YY-I expression in a fibrotic tissue or cell sample.
  • the subject may have a predisposition to developing a fibrotic condition.
  • Monitoring changes in EZH2 and/or YY-I expression in a subject over time to track development of, or recovery from, a fibrotic condition is also contemplated by the present invention.
  • detecting the "expression level" of EZH2 or YY-I can be achieved by measuring any suitable value that is representative of gene expression level.
  • the measurement of gene expression levels can be direct or indirect.
  • a direct measurement involves measuring the level or quantity of RNA or protein.
  • An indirect measurement may involve measuring the level or quantity of cDNA, or amplified RNA, DNA, or protein; the activity level of RNA or protein; or the level or activity of other molecules (e.g., a metabolite) that are indicative of the foregoing.
  • the measurement of expression can be a measurement of the absolute quantity of a gene product.
  • the measurement can also be a value representative of the absolute or relative quantity, i.e., a normalized value (e.g., a quantity of gene product normalized against the quantity of a reference gene product), an averaged value (e.g. , average quantity obtained at different time points or from different tumor cell samples from a subject, or average quantity obtained using different probes, etc.), or a combination of both.
  • a normalized value e.g., a quantity of gene product normalized against the quantity of a reference gene product
  • an averaged value e.g. , average quantity obtained at different time points or from different tumor cell samples from a subject, or average quantity obtained using different probes, etc.
  • the expression level of EZH2 or YY-I is measured by measuring the RNA expression level of EZH2 or YY-I .
  • Methods for isolation and purification of nucleic acids suitable for measuring RNA expression levels in accordance with the methods of the present invention are described in detail in LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY: HYBRIDIZATION WITH NUCLEIC ACID PROBES, PART I. THEORY AND NUCLEIC ACID PREPARATION (P. Tijssen ed., 1993) which is hereby incorporated by reference in its entirety.
  • Total RNA can be isolated from a given sample using, for example, an acid guanidinium-phenol-chloroform extraction, a guanidinium isothiocyanate-ultracentrifugation method, or a lithium chloride-SDS-urea method, and polyA + mRNA can be isolated using oligo(dT) column chromatography or (dT)n magnetic beads (see, e.g., JOSEPH SAMBROOK et al, 1-3 MOLECULAR CLONING: A LABORATORY MANUAL (2d ed. 1989); 1-4 CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Fred M. Ausubel et al.
  • PCR polymerase chain reaction
  • the sample may also be amplified on an array as described in U.S. Patent No. 6,300,070 to Boles, which is incorporated herein by reference in its entirety.
  • Other suitable amplification methods include the ligase chain reaction
  • LCR Ligation Amplification Reaction
  • LAR Ligation Amplification Reaction
  • Measuring gene expression by quantifying mRNA expression can be achieved using any method known in the art including northern blotting and in situ hybridization (Parker et al., "mRNA: Detection by In Situ and Northern Hybridization,” Meth. MoI. Biol.
  • RNAse protection assay Hod et al., "A Simplified Ribonuclease Protection Assay," Biotechniques 13:852-854 (1992), which is hereby incorporated by reference in its entirety
  • RT-PCR reverse transcription polymerase chain reaction
  • mRNA expression is measured using a nucleic acid amplification assay that is a semi-quantitative or quantitative real-time polymerase chain reaction (RT-PCR) assay.
  • RT-PCR real-time polymerase chain reaction
  • the reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling.
  • extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, Calif, USA), following the manufacturer's instructions.
  • the derived cDNA can then be used as a template in the subsequent PCR reaction.
  • the PCR step can use a variety of thermostable DNA-dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5 '-3' nuclease activity but lacks a 3 '-5' proofreading endonuclease activity.
  • TaqMan ® PCR typically utilizes the 5'-nuclease activity of Taq or Tth polymerase to hydro lyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used.
  • TaqMan ® PCR further involves the use of two oligonucleotide primers to generate an amplicon typical of a PCR reaction.
  • a third oligonucleotide, or probe is designed to detect the nucleotide sequence located between the two PCR primers.
  • the probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe.
  • the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore.
  • TaqMan ® PCR can be performed using commercially available equipment, such as, for example, the ABI PRISM 7700 ® Sequence Detection System ® (Perkin-Elmer- Applied Biosystems, Foster City, Calif, USA) or the Lightcycler (Roche Molecular Biochemicals, Mannheim, Germany).
  • TaqMan ® PCR is one of many quantitative PCR systems known and available in the art. Other quantitative methods and reagents for real-time PCR detection that are known in the art (e.g. SYBR green, Molecular Beacons, Scorpion Probes, etc) are also suitable for use in the methods of the present invention. [0076] To minimize errors and the effect of sample-to-sample variation, RT-
  • PCR is usually performed using an internal standard.
  • the ideal internal standard is expressed at a constant level among different tissues, and is unaffected by the experimental treatment or disease.
  • RNAs most frequently used to normalize patterns of gene expression are mRNAs for the housekeeping genes glyceraldehyde-3- phosphate-dehydrogenase (GAPDH) and ⁇ -actin.
  • GPDH glyceraldehyde-3- phosphate-dehydrogenase
  • ⁇ -actin ⁇ -actin
  • Real time PCR is compatible both with quantitative competitive PCR, where an internal competitor for each target sequence is used for normalization and quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR.
  • an internal competitor for each target sequence is used for normalization
  • quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR.
  • a microarray comprises an assembly of distinct polynucleotide or oligonucleotide probes immobilized at defined positions on a substrate.
  • Arrays are formed on substrates fabricated with materials such as paper, glass, plastic ⁇ e.g., polypropylene, nylon), polyacrylamide, nitrocellulose, silicon, optical fiber or any other suitable solid or semi-solid support, and configured in a planar ⁇ e.g., glass plates, silicon chips) or three-dimensional ⁇ e.g., pins, fibers, beads, particles, microtiter wells, capillaries) configuration.
  • materials such as paper, glass, plastic ⁇ e.g., polypropylene, nylon), polyacrylamide, nitrocellulose, silicon, optical fiber or any other suitable solid or semi-solid support, and configured in a planar ⁇ e.g., glass plates, silicon chips) or three-dimensional ⁇ e.g., pins, fibers, beads, particles, microtiter wells, capillaries) configuration.
  • Probes forming the arrays may be attached to the substrate by any number of ways including (i) in situ synthesis ⁇ e.g., high-density oligonucleotide arrays) using photolithographic techniques (Fodor et al., "Light-directed, Spatially Addressable Parallel Chemical Synthesis," Science 251 :767-773 (1991); Pease et al., "Light-generated Oligonucleotide Arrays for Rapid DNA Sequence Analysis," Proc. Nat 'I Acad. Sci. U.S.A. 91 :5022-5026 (1994); Lockhart et al, "Expression Monitoring by Hybridization to High-Density Oligonucleotide Arrays," Nat.
  • Probes may also be non-covalently immobilized on the substrate by hybridization to anchors, by means of magnetic beads, or in a fluid phase such as in microtiter wells or capillaries.
  • the probe molecules are generally nucleic acids such as DNA, RNA, PNA, and cDNA, but may also include proteins, polypeptides, oligosaccharides, cells, tissues, and any permutations thereof which can specifically bind the target molecules.
  • Fluorescently labeled cDNA for hybridization to the array may be generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from the fibrotic tissue of interest. Labeled cDNA applied to the array hybridizes with specificity to each nucleic acid probe spotted on the array. After stringent washing to remove non-specifically bound cDNA, the array is scanned by confocal laser microscopy or by another detection method, such as a CCD camera.
  • Quantitation of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance.
  • dual color fluorescence separately labeled cDNA samples generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously.
  • nucleic acid detection protocols can also be employed, including (without limitation) those described in U.S. Patent Application Serial Nos. 10/847,233 and 11/337,905 to Rothberg et al., which are hereby incorporated by reference in their entirety; arrayed imaging reflectometry ("AIR") (U.S. Patent No. 7,292,349 to Miller et al., which is hereby incorporated by reference in its entirety); Brewster angle straddle interferometry (BASI) (U.S. Patent Publication No. 2007/0076214, which is hereby incorporated by reference in its entirety); imaging ellipsometry (U.S. Patent No. 5,076,696 to Cohn et al.; U.S. Patent No.
  • the expression levels of EZH2 or YY-I is measured by measuring the level of protein expression. Measuring the protein expression levels of EZHl or YY-I can be achieved using any standard protein immunodetection assay known in the art.
  • Protein preparation for analysis of protein expression level is carried out using any method that produces analyzable protein.
  • the sample cells or tissue can be lysed in a protein lysis buffer (e.g., 50 mM Tris-HCl (pH, 6.8), 100 mM DTT, 100 ⁇ g/ml PMSF, 2% SDS, 10% glycerol, 1 ⁇ g /ml each of pepstatin A, leupeptin, and aprotinin, and ImM sodium ortho vanadate) and sheared with a 22- gauge needle.
  • a protein lysis buffer e.g., 50 mM Tris-HCl (pH, 6.8), 100 mM DTT, 100 ⁇ g/ml PMSF, 2% SDS, 10% glycerol, 1 ⁇ g /ml each of pepstatin A, leupeptin, and aprotinin, and ImM sodium ortho vanadate.
  • a protein lysis buffer e.g., 50 mM Tris-HCl (pH, 6.8), 100 mM DTT, 100
  • the protein content of the samples can be estimated using the Lowry, Bradford, or bicinchoninic acid assays, or any commercially available assay based on the aforementioned techniques.
  • a protein immunodetection assay using an antibody or other agent that selectively binds to EZH2 of YY-I is employed to detect EZH2 or YY-I protein expression in a sample.
  • the level of protein expression can be measured using methods that include, but are not limited to, western blot, immunoprecipitation, ELISA, radioimmunoassay (RIA), and fluorescent activated cell sorting (FACS), or a combination thereof.
  • antibodies, aptamers, or other ligands that specifically bind to a protein can be affixed to so-called “protein chips” (protein microarrays) and used to measure the level of expression of a protein in a sample.
  • Immunofluorescence techniques can be used to visually assess the expression level of a protein in a sample. Immunofluorescence techniques involve the utilization of antibodies that specifically bind to a protein and are visualized to indirectly detect the presence of a protein in a sample.
  • assessing the level of protein expression can involve analyzing one or more proteins by two-dimensional gel electrophoresis, mass spectroscopy, MALDI-TOF, surface-enhanced laser desorption ionization-time of flight (SELDI- TOF), high performance liquid chromatography (HPLC), fast protein liquid chromatography (FPLC), multidimensional liquid chromatography (LC) followed by tandem mass spectrometry (MS/MS), protein chip expression analysis, gene chip expression analysis, and laser densitometry, or any combinations of these techniques.
  • Another aspect of the present invention is directed to a method of treating a subject having a fibrotic condition. This method involves administering to the subject an agent that inhibits or reduces H3K27 trimethylation under conditions effective to treat a fibrotic condition in the subject.
  • a subject having a fibrotic condition is selected prior to administering an agent that inhibits or reduces H3K27 trimethylation.
  • Subjects who are suitable for receiving treatment in accordance with this aspect of the present invention are those suffering from a fibrotic condition affecting the lungs, heart, kidney, liver, brain, skin, or any fibrosis related disease, including, but not limited to, those described above.
  • the fibrotic condition is lung or pulmonary fibrosis (e.g. , idiopathic pulmonary fibrosis).
  • administering the agent that inhibits or reduces H3K27 trimethylation is repeated one or more times as needed to alleviate the fibrotic condition.
  • Agents suitable for treating a subject having a fibrotic condition include those agents that inhibit or reduce H3K27 methylation.
  • Exemplary agents include histone lysine demethylases, such as those of the human jumonji C (JmjC)- domain-containing-3 family of histone demethylases.
  • the histone lysine demethylase is (a) jumonji domain containing-3 (JMJD3) or (b) ubiquitously transcribed tetratricopeptide repeat, X chromosome (UTX) demethylase.
  • agents suitable for treating a subject having a fibrotic condition are agents that inhibit EZH2 expression or activity or agents that inhibit YY-I expression or activity.
  • Therapeutic agents that inhibit EZH2 or YY-I expression include nucleic acids, proteins or peptides, and small molecule inhibitors.
  • Suitable nucleic acid molecule inhibitors of EZH2 and YY-I include antisense RNAs or RNAi, such as short interfering RNAs (siRNA), short hairpin RNAs (shRNA), and microRNAs.
  • antisense methods to inhibit the in vivo translation of genes is well known in the art (e.g., U.S. Patent No. 7,425,544 to Dobie et al; U.S. Patent No. 7,307,069 to Karras et al.; U.S. Patent No. 7,288,530 to Bennett et al.; U.S. Patent No.
  • Antisense nucleic acids are nucleic acid molecules (e.g., molecules containing DNA nucleotides, RNA nucleotides, or modifications (e.g., modification that increase the stability of the molecule, such as 2'-O-alkyl (e.g., methyl) substituted nucleotides) or combinations thereof) that are complementary to, or that hybridize to, at least a portion of a specific nucleic acid molecule, such as an RNA molecule (e.g., an mRNA molecule) (e.g., Weintraub, H. M., "Antisense DNA and RNA," Scientific Am.
  • RNA molecule e.g., an mRNA molecule
  • the antisense nucleic acids hybridize to corresponding nucleic acids, such as mRNAs, to form a double-stranded molecule, which interferes with translation of the mRNA, as the cell will not translate a double-stranded mRNA.
  • Antisense nucleic acids used in the invention are typically at least 10-12 nucleotides in length, for example, at least 15, 20, 25, 50, 75, or 100 nucleotides in length.
  • the antisense nucleic acid can also be as long as the target nucleic acid with which it is intended to form an inhibitory duplex.
  • Antisense molecules directed to YY-I and EZH2 which are known in the art, are particularly suited for use in the methods of the present invention (Kwon et al., "Yin Yang-1, A Vertebrate Polycomb Group Gene, Regulates Antero-Posterior Neural Patterning," Biochem. Biophys. Res. Comm. 306(4)1008-1013 (2003); Varambally et al., "The Polycomb Group Protein EZH2 is Involved in Progression of Prostate Cancer,” Nature 419:624-629 (2002), which are hereby incorporated by reference in their entirety).
  • Antisense nucleic acids can be introduced into cells as antisense oligonucleotides, or can be produced in a cell in which a nucleic acid encoding the antisense nucleic acid has been introduced, for example, using gene therapy methods.
  • siRNAs are double stranded synthetic RNA molecules approximately
  • siRNA molecules 20-25 nucleotides in length with short 2-3 nucleotide 3' overhangs on both ends.
  • the double stranded siRNA molecule represents the sense and anti-sense strand of a portion of the target mRNA molecule, in this case a portion of the EZH2 or YY-I mRNA sequence.
  • siRNA molecules are typically designed to target a region of the mRNA target approximately 50-100 nucleotides downstream from the start codon. Upon introduction into a cell, the siRNA complex triggers the endogenous RNA interference (RNAi) pathway, resulting in the cleavage and degradation of the target mRNA molecule.
  • RNAi RNA interference
  • siRNA molecules directed to interfering with EZH2 expression are known in the art (e.g., U.S. Patent Publication No. 2005/0159382, which is hereby incorporated by reference in its entirety) and are suitable for use in the present invention.
  • various improvements of siRNA compositions such as the incorporation of modified nucleosides or motifs into one or both strands of the siRNA molecule to enhance stability, specificity, and efficacy, have been described and are suitable for use in accordance with this aspect of the invention (International Patent Publication No. WO 2004/015107 to Giese et al.; International Patent Publication No. WO 2003/070918 to McSwiggen et al.; International Patent Publication No.
  • Short or small hairpin RNA molecules are similar to siRNA molecules in function, but comprise longer RNA sequences that make a tight hairpin turn. Like siRNA, they silence gene expression via the cellular RNA interference pathway. shRNA is cleaved by cellular machinery into siRNA. Suitable shRNA molecules for inhibiting YY-I expression that can be used in accordance with the methods of the present invention include, without limitation:
  • CCACCCGG SEQ ID NO:26 (antisense).
  • Aptamers are molecules that interact and bind to a target molecule with a very high degree of specificity.
  • aptamers are small nucleic acids ranging from 15-50 bases in length that fold into defined secondary and tertiary structures, such as stem-loops or G-quartets.
  • Aptamers can bind small molecules as well as large molecules (U.S. Patent No. 5,631,146; U.S. Patent No. 5,786,462; U.S. Patent No.
  • Aptamers can bind very tightly with K d S for the target molecule of less than 10 ⁇ 12 M. It is preferred that the aptamers bind the target molecule with a Kd less than 10 ⁇ 6 . It is more preferred that the aptamers bind the target molecule with a K ⁇ less than 10 8 .
  • YY-I include ribozymes (U.S. Patent No. 5,334,711 to Sproat et al; U.S. Patent No. 5,646,031 to DeYoung et al.; U.S. Patent No. 5,595,873 to Joyce et al.; U.S. Patent No. 5,580,967 to Joyce et al., which are hereby incorporated by reference in their entirety), triplex forming functional nucleic acid molecules (U.S. Patent No. 5,176,996 to Hogan et al., which is hereby incorporated by reference in its entirety), and external guide sequences (EGSs) (International Patent Publication No.
  • Therapeutic protein or peptide inhibitors of EZH2 or YY-I expression or activity are also suitable for use in accordance with this aspect of the present invention.
  • Protein inhibitors include antibodies (e.g. single chain antibodies, chimeric antibodies, hybrid antibodies), intrabodies, peptide aptamers, or any other binding molecules, including synthetic peptide inhibitors, having antigen binding specificity for EZH2 or YY-I .
  • Therapeutically effective antibodies or other binding molecules of the present invention are those having antigen specificity for EZH2 or YY-I, which inhibit EZH2 or YY-I activity upon binding of the antibody or binding molecule to EZH2 or YY-I .
  • the antibody or other binding molecule of the present invention recognizes one or more portions of the EZH2 or YY-I proteins involved in polycomb repressive complex formation, DNA binding, or histone-3 methylation, such that H3K27 trimethylation is inhibited.
  • Antibodies having antigen specificity for EZH2 and YY-I are known in the art (Bergad et al., "Yin-Yang 1 and Glucocorticoid Receptor Participate in the Stat5 -Mediated Growth Hormone Response of the Serine Protease Inhibitor 2.1 Gene," J. Biol. Chem. 275(11):8114-20 (2000); Raman et al., "Increased Expression of the Polycomb Group Gene, EZH2, in Transitional Cell
  • the antibody or other binding molecule of the present invention has antigen binding specificity for a protein in the EZH2 or YY-I signal transduction pathway, where upon binding of the antibody or other binding molecule to its target protein, EZH2 and/or YY-I function is indirectly disrupted.
  • An exemplary antibody known to inhibit YY-I function indirectly that is suitable for use in the methods of the present invention is Rituximab.
  • Rituximab inhibits YY-I expression and activity by disrupting both the p38 mitogen- activated protein kinase signaling pathway and NFKB activity (Vega et al., "Rituximab (Chimeric Anti-CD20) Sensitized B-NHL Cell Lines to Fas-Induced Apoptosis," Oncogene 24:8114-8127 (2005), which is hereby incorporated by reference in its entirety).
  • Alternative therapeutic protein inhibitors suitable for use in this aspect of the present invention include dominant negative forms of the EZH2 or YY-I protein.
  • Preferable dominant negative EZH2 or YY-I proteins are deficient in polycomb repressive complex formation or DNA binding capacity such that histone-3 methylation or transcriptional activity are attenuated.
  • a preferred dominant negative YY-I protein that is particularly suitable for use in the methods of the present invention is the DZ-YY-I protein, described herein, that lacks four zinc-finger domains and is deficient in DNA binding and subsequent transcriptional activity.
  • nitric oxide or nitric oxide donors such as DEA-NONOate, as described in Garban & Bonavida, "Nitric Oxide Inhibits the Transcription Repressor Yin-Yang 1 Binding Activity at the Silencer Region of the Fas Promoter: A Pivitol Role for Nitric Oxide in the Up-Regulation of Fas Gene Expression in Human Tumor Cells," J. Immun.
  • the agent for treating a subject having a fibrotic condition is a histone deacetylase (HDAC) inhibitor.
  • HDAC histone deacetylase
  • HDAC inhibitors suitable for use in the present invention include nucleoplasmin, chamydocin, Cyl-2, cyclic(eta-oxo-alpha- aminooxiraneoctanoylphenylalanylleucyl ⁇ -piperidinecarbonyl (WF-3161), depudecin, radicocol, oxamfiatin, apidicin, suberoxylanilide hydroxamic acid, and 2- amino-8-oxo-9,10-epoxy-decanoic acid as disclosed in U.S. Patent Application Publication No. 2005/0222013 to Mira et al., which is hereby incorporated by reference in its entirety.
  • HDAC inhibitors known in the art that are suitable for use in the present invention include valproic acid and its derivatives (U.S. Patent No. 7,265,154 to Gottlich, which is hereby incorporated by reference in its entirety); carbamic acid compounds comprising sulfonamide linkages (U.S. Patent No. 6,888,027 to Watkins, which is hereby incorporated by reference in its entirety); compounds having a zinc-binding moiety, such as a hydroxamic acid group (U.S. Patent No.
  • HDAC inhibitors including m- carboxycinnamic acid bis-hydroxamie and the bicyclic depsipeptide FK228 (Adachi et al., "Synergistic Effect of Histone Deacetylase Inhibitors FK228 and m- Carboxycinnamic Acid Bis-Hydroxamide with Proteasome Inhibitors PSI and PS-341 against Gastrointestinal Adenocarcinoma Cells," Clin. Cancer Res.
  • an anti-inflammatory agent is administered in conjunction with the agent that inhibits or reduces H3K27 trimethylation.
  • Suitable anti-inflammatory agents include, but are not limited to, nimesulide, 4-hydroxynimesulide, flosulide, meloxicam, celecoxib, and Rofecoxib.
  • Another aspect of the present invention is directed to a pharmaceutical composition that is suitable for the treatment of a f ⁇ brotic condition.
  • the pharmaceutical composition contains a pharmaceutically acceptable delivery vehicle and an effective amount of one or more agents selected from an agent that inhibits or reduces H3K27 trimethylation, an inhibitor of EZH2, an inhibitor of YY-I, an inhibitor of histone deacetylase, or any combination of agents thereof.
  • Appropriate delivery vehicles include, but are not limited to, lung surfactants, liposomes, viral vectors, and nanoparticle delivery vehicles, which are all described in more detail below.
  • the methods of the present invention are intended to be carried out by administering the active agents alone or in combination with one another, but preferably in the form of one or more pharmaceutical compositions that include a pharmaceutically acceptable carrier for the therapeutic agent(s).
  • administering any of the above agents to a subject to treat fibrosis may be carried out using generally known methods.
  • the agent is administered by introducing the agent into the subject. Administration can be accomplished either via systemic administration to the subject, administration directly to a f ⁇ brotic tissue site, or via targeted administration to affected cells.
  • Exemplary routes of administration include, without limitation, by intratracheal inoculation, aspiration, airway instillation, aerosolization, nebulization, intranasal instillation, oral or nasogastric instillation, intraperitoneal injection, intravascular injection, topically, transdermally, parenterally, subcutaneously, by intravenous injection, by intra-arterial injection (such as via the pulmonary artery), by intramuscular injection, by intrapleural instillation, intraventricularly, intralesionally, by application to mucous membranes (such as that of the nose, throat, and/or bronchial tubes), or by implantation of a sustained release vehicle adjacent to the affected tissue.
  • the therapeutic agent i.e., histone lysine demethylase
  • EZH2 or YY-I inhibitor, or histone deacetylase inhibitor will be administered to a mammal as a pharmaceutical formulation that includes the therapeutic agent and any pharmaceutically acceptable suitable adjuvants, carriers, excipients, and/or stabilizers, and can be in solid or liquid form, such as tablets, capsules, powders, solutions, suspensions, or emulsions.
  • the compositions preferably contain from about 0.01 to about 99 weight percent, more preferably from about 2 to about 60 weight percent, of therapeutic agent together with the adjuvants, carriers, and/or excipients.
  • the amount of active compound in such therapeutically useful compositions is such that a suitable dosage unit will be obtained.
  • the agents may be orally administered, for example, with an inert diluent, or with an assimilable edible carrier, or they may be enclosed in hard or soft shell capsules, or they may be compressed into tablets, or they may be incorporated directly with the food of the diet.
  • these active compounds may be incorporated with excipients and used in the form of tablets, capsules, elixirs, suspensions, syrups, and the like.
  • Such compositions and preparations should contain at least 0.1% of the agent.
  • the percentage of the agent in these compositions may, of course, be varied and may conveniently be between about 2% to about 60% of the weight of the unit.
  • the amount of the agent in such therapeutically useful compositions is such that a suitable dosage will be obtained.
  • the tablets, capsules, and the like may also contain a binder such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, or alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose, or saccharin.
  • a liquid carrier such as a fatty oil.
  • Various other materials may be present as coatings or to modify the physical form of the dosage unit. For instance, tablets may be coated with shellac, sugar, or both.
  • a syrup may contain, in addition to active ingredient(s), sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye, and flavoring such as cherry or orange flavor.
  • the agents may also be administered parenterally.
  • Solutions or suspensions of the agent can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils.
  • Illustrative oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, or mineral oil.
  • water, saline, aqueous dextrose and related sugar solutions, and glycols such as propylene glycol or polyethylene glycol are preferred liquid carriers, particularly for injectable solutions. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms .
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils.
  • the agents according to this aspect of the present invention may also be administered directly to the airways in the form of an aerosol.
  • the compounds of the present invention in solution or suspension may be packaged in a pressurized aerosol container together with suitable propellants, for example, hydrocarbon propellants like propane, butane, or isobutane with conventional adjuvants.
  • suitable propellants for example, hydrocarbon propellants like propane, butane, or isobutane with conventional adjuvants.
  • the materials of the present invention also may be administered in a non- pressurized form such as in a nebulizer or atomizer.
  • the agents of the present invention may be administered to the airways in the form of a lung surfactant formulation.
  • the lung surfactant formulation can include exogenous lung surfactant formulations (e.g.
  • agents of the present invention may be administered directly to the targeted tissue. Additionally and/or alternatively, the agent may be administered to a non-targeted area along with one or more agents that facilitate migration of the agent to (and/or uptake by) a targeted tissue, organ, or cell.
  • the targeted tissue can be any tissue subject to a f ⁇ brotic condition
  • preferred target tissues are lung tissue, heart tissue, liver tissue, brain tissue, kidney tissue, and the skin.
  • the therapeutic agent itself can be modified to facilitate its transport to (and uptake by) the desired tissue, organ, or cell.
  • histone lysine demethylases, EZH2 or YY-I inhibitors, or histone deacetylase inhibitors can be modified as described above to facilitate their transport to a target cell, organ (e.g. , lung), and/or tissue (e.g., lung tissue), including their transport across the blood-brain barrier; and/or their uptake by the target cell (e.g., its transport across cell membranes).
  • Exemplary delivery devices include, without limitation, nebulizers, atomizers, liposomes, transdermal patches, implants, implantable or injectable protein depot compositions, syringes, and gene therapy.
  • Other delivery systems which are known to those of skill in the art can also be employed to achieve the desired delivery of the therapeutic agent to the desired organ, tissue, or cells in vivo to carry out this aspect of the present invention.
  • any suitable approach for delivery of the agents can be utilized to practice this aspect of the present invention.
  • the agent will be administered to a patient in a vehicle that delivers the agent(s) to the target cell, tissue, or organ.
  • One approach for delivering agents into cells involves the use of liposomes (including the surfactant formulations described above). Basically, this involves providing a liposome which includes agent(s) to be delivered, and then contacting the target cell, tissue, or organ with the liposomes under conditions effective for delivery of the agent into the cell, tissue, or organ.
  • Liposomes are vesicles comprised of one or more concentrically ordered lipid bilayers which encapsulate an aqueous phase. They are normally not leaky, but can become leaky if a hole or pore occurs in the membrane, if the membrane is dissolved or degrades, or if the membrane temperature is increased to the phase transition temperature.
  • Current methods of drug delivery via liposomes require that the liposome carrier ultimately become permeable and release the encapsulated drug at the target site. This can be accomplished, for example, in a passive manner where the liposome bilayer degrades over time through the action of various agents in the body. Every liposome composition will have a characteristic half-life in the circulation or at other sites in the body and, thus, by controlling the half-life of the liposome composition, the rate at which the bilayer degrades can be somewhat regulated.
  • active drug release involves using an agent to induce a permeability change in the liposome vesicle.
  • Liposome membranes can be constructed so that they become destabilized when the environment becomes acidic near the liposome membrane (see, e.g., Wang & Huang, "pH-Sensitive Immuno liposomes Mediate Target-cell-specific Delivery and
  • liposomes When liposomes are endocytosed by a target cell, for example, they can be routed to acidic endosomes which will destabilize the liposome and result in drug release.
  • the liposome membrane can be chemically modified such that an enzyme is placed as a coating on the membrane, which enzyme slowly destabilizes the liposome. Since control of drug release depends on the concentration of enzyme initially placed in the membrane, there is no real effective way to modulate or alter drug release to achieve "on demand" drug delivery.
  • This liposome delivery system can also be made to accumulate at a target organ, tissue, or cell via active targeting (e.g., by incorporating an antibody or hormone on the surface of the liposomal vehicle). This can be achieved according to known methods.
  • liposomes can be produced such that they contain, in addition to the therapeutic agents of the present invention, other therapeutic agents, such as antiinflammatory agents, which would then be released at the target site (e.g., Wolff et al., "The Use of Monoclonal Anti-Thyl IgGl for the Targeting of Liposomes to AKR-A Cells in vitro and in vivo," Biochim. Biophys. Acta 802:259-73 (1984), which is hereby incorporated by reference in its entirety).
  • therapeutic agents such as antiinflammatory agents
  • conjugation of the desired protein or polypeptide involves the conjugation of the desired protein or polypeptide to a polymer that is stabilized to avoid enzymatic degradation of the conjugated protein or polypeptide.
  • Conjugated proteins or polypeptides of this type are described in U.S. Patent No. 5,681,811 to Ekwuribe, which is hereby incorporated by reference in its entirety.
  • the chimeric protein can include a ligand domain and the polypeptide agent (e.g., histone lysine demethylase or dominant negative YY-I).
  • the ligand domain is specific for receptors located on a target cell.
  • Nucleic acid agents for use in the methods of the present invention can be delivered to a subject in a number of ways known in the art, including through the use of gene therapy vectors and methods as described above.
  • the nucleic acid can be contained within a vector useful for gene therapy, for example, a vector that can be transferred to the cells of a subject and provide for expression of the therapeutic nucleic acid agent therein.
  • vectors include chromosomal vectors (e.g., artificial chromosomes), non-chromosomal vectors, and synthetic nucleic acids.
  • Vectors include plasmids, viruses, and phages, such as retroviral vectors, lentiviral vectors, adenoviral vectors, and adeno-associated vectors.
  • Nucleic acid agents can be transferred into a subject using ex vivo or in vivo methods. Ex vivo methods involve transfer of the nucleic acid into cells in vitro ⁇ e.g. , by transfection, infection, or injection) that are then transferred into or administered to the subject.
  • the cells can be, for example, cells derived from the subject (e.g., lymphocytes) or allogeneic cells.
  • the cells can be implanted directly into a specific tissue of the subject or implanted after encapsulation within an artificial polymer matrix.
  • Nucleic acids can also be delivered into a subject in vivo.
  • nucleic acids can be administered in an effective carrier, e.g., any formulation or composition capable of effectively delivering the nucleic acid to cells in vivo.
  • Nucleic acids contained within viral vectors can be delivered to cells in vivo by infection or transduction using virus.
  • Nucleic acids and vectors can also be delivered to cells by physical means, e.g., by electroporation, lipids, cationic lipids, liposomes, DNA gun, calcium phosphate precipitation, injection, or delivery of naked nucleic acid.
  • naked DNA or infective transformation vectors can be used for delivery, whereby the naked DNA or infective transformation vector contains a recombinant gene that encodes, for example, the histone lysine demethylase or the dominant negative YY-I or EZH2 proteins, of the present invention. The nucleic acid molecule is then expressed in the transformed cell.
  • the recombinant gene includes, operatively coupled to one another, an upstream promoter operable in mammalian cells and optionally other suitable regulatory elements (i.e., enhancer or inducer elements), a coding sequence that encodes the therapeutic nucleic acid (described above), and a downstream transcription termination region.
  • suitable constitutive promoter or inducible promoter can be used to regulate transcription of the recombinant gene, and one of skill in the art can readily select and utilize such promoters, whether now known or hereafter developed.
  • the promoter can also be specific for expression in cells that express YY-I or EZH2. Tissue specific promoters can also be made inducible/repressible using, e.g., a TetO response element.
  • inducible elements can also be used.
  • Known recombinant techniques can be utilized to prepare the recombinant gene, transfer it into the expression vector (if used), and administer the vector or naked DNA to a patient. Exemplary procedures are described in JOSEPH SAMBROOK et al, 1-3 MOLECULAR CLONING: A LABORATORY MANUAL (2d ed. 1989), which is hereby incorporated by reference in its entirety. One of skill in the art can readily modify these procedures, as desired, using known variations of the procedures described therein. [0127] Any suitable viral or infective transformation vector can be used.
  • Exemplary viral vectors include, without limitation, adenovirus, adeno-associated virus, and retroviral vectors (including lentiviral vectors).
  • Adenovirus gene delivery vehicles can be readily prepared and utilized given the disclosure provided in Berkner, "Development of Adenovirus Vectors for the Expression of Heterologous Genes," Biotechniques 6:616-29 (1988); Rosenfeld et al., "Adenovirus-mediated Transfer of a Recombinant ⁇ 1 -Antitrypsin Gene to the Lung Epithelium in vivo " Science 252:431-434 (1991); International Patent Publication No. WO 1993/007283 to Curiel et al.; International Patent Publication No. WO 1993/006223 to Perricaudet et al.; and International Patent Publication No.
  • Adeno-associated viral gene delivery vehicles can be constructed and used to deliver into cells a recombinant gene encoding a desired nucleic acid.
  • the use of adeno-associated viral gene delivery vehicles in vitro is described in Chatterjee et al., "Dual-Target Inhibition of HIV-I in vitro by Means of an Adeno-associated Virus Antisense Vector," Science 258:1485-8 (1992); Walsh et al., "Regulated High Level Expression of a Human ⁇ -Globin Gene Introduced into Erythroid Cells by an Adeno- associated Virus Vector," Proc. Nat'lAcad. Sci.
  • Retroviral vectors which have been modified to form infective transformation systems can also be used to deliver a recombinant gene encoding a desired nucleic acid product into a target cell.
  • retroviral vector is disclosed in U.S. Patent No. 5,849,586 to Kriegler & Perez, which is hereby incorporated by reference in its entirety.
  • Lentivirus vectors can also be utilized, including those described in U.S.
  • Inhibitory RNA can be administered to the subject systemically or locally as described above. Delivery of inhibitory RNA is preferably administered alone or as a component of a composition of the present invention. Suitable compositions include the siRNA formulated or complexed with polyethylenimine (e.g.
  • linear or branched PEI and/or polyethylenimine derivatives, including for example grafted PEIs such as galactose PEI, cholesterol PEI, antibody derivatized PEI, and polyethylene glycol PEI derivatives thereof
  • grafted PEIs such as galactose PEI, cholesterol PEI, antibody derivatized PEI, and polyethylene glycol PEI derivatives thereof
  • the inhibitory RNA molecule can also be present in the form of a bioconjugate, for example a nucleic acid conjugate as described in U.S. Patent No. 6,528,631 to Cook et al, U.S. Patent No. 6,335,434 to Guzaev et al, U.S. Patent No. 6,235,886 to Manoharan & Cook, U.S. Patent No. 6,153,737 to Manoharan et al., U.S. Patent No. 5,214,136 to Lin & Matteucci, and U.S. Patent No. 5,138,045 to Cook & Guinosso, which are hereby incorporated by reference in their entirety.
  • the inhibitory RNA can be administered via a liposomal delivery mechanism described above.
  • Many routes of delivery are known to the skilled artisan for delivery of anti-target antibodies. For example, direct injection may be suitable for delivering the antibody to the site of interest. It is also possible to utilize liposomes with antibodies in their membranes to specifically deliver the liposome to the area where H3K27 trimethylation is to be reduced or EZH2 or YY-I expression or activity is to be inhibited. These liposomes can be produced such that they contain, in addition to monoclonal antibody, other therapeutic agents, such as those described above, which would then be released at the target site.
  • Administration can be carried out as frequently as required and for a duration that is suitable to provide effective treatment for a fibrotic condition being treated or prevented.
  • administration can be carried out with a single sustained-release dosage formulation or with multiple daily doses.
  • they may be administered at the same time (e.g., present in the same pharmaceutical formulation), or separately (e.g., each present in a separate pharmaceutical formulation) but during the same course of treatment.
  • Administration can be carried out before, concurrently with, and/or after the appearance of symptoms of the fibrotic condition.
  • the amount to be administered will, of course, vary depending upon the treatment regimen.
  • an agent is administered to achieve an amount effective for amelioration of, or prevention of the development of symptoms of, the fibrotic condition (i.e., a therapeutically effective amount).
  • a therapeutically effective amount can be an amount which is capable of at least partially preventing or reversing the fibrosis related condition.
  • the dose required to obtain an effective amount may vary depending on the agent, formulation, disease or disorder, and individual to whom the agent is administered.
  • Determination of effective amounts may also involve in vitro assays in which varying doses of agent are administered to cells in culture and the concentration of agent effective for ameliorating some or all symptoms is determined in order to calculate the concentration required in vivo.
  • Effective amounts may also be based on in vivo animal studies. A therapeutically effective amount can be determined empirically by those of skill in the art.
  • the histone lysine demethylase can be administered in an amount between about 500 ⁇ g/kg and about 2.5 mg/kg, preferably between about 750 ⁇ g/kg and about 2.25 mg/kg, more preferably between about 1 mg/kg and 2 mg/kg.
  • Inhibitors of EZH2, YY-I, and histone deacetylase can be administered in an amount between about 500 ⁇ g/kg and about 10 mg/kg, preferably between about 750 ⁇ g/kg and about 5 mg/kg.
  • the amount is preferably between about 25 nmol/kg and 10 mmol/kg, more preferably between about 100 nmol/kg and about 5 mmol/kg.
  • Another aspect of the present invention relates to a method of identifying an agent that is effective for treating a fibrotic condition. This method involves obtaining a first biological sample from an in vivo or in vitro experimental model of fibrosis and administering a candidate agent to the in vivo or in vitro experimental model of fibrosis. A second biological sample is obtained from the experimental model after administering the candidate agent, and the level of H3K27 trimethylation in the first and second biological samples is measured.
  • the level of H3K27 trimethylation in the first and second biological samples is then compared.
  • a decrease in the level of H3K27 trimethylation in the second biological sample relative to the level of H3K27 trimethylation in the first biological sample indicates that the agent is effective for treating a fibrotic condition.
  • fibrosis can be induced in vivo upon intratracheal instillation of bleomycin, fluorescein isothiocyanate, irradiation, silica, or particulate matter in an animal.
  • a fibrotic condition is displayed in transgenic animals over-expressing TGF- ⁇ and upon adoptive transfer of human fibrotic fibroblasts into immunodeficient animals (Moore et al., "Murine Models of Pulmonary Fibrosis," Am. J. Physiol. Lung Cell MoI. Physiol.
  • the in vivo experimental model of fibrosis is a silica-treated mouse model as described herein.
  • an in vitro model of fibrosis comprises an isolated tissue or cell sample derived directly from f ⁇ brotic condition, for example, lung fibroblasts derived from patients having lung fibrosis, as described herein.
  • an in vitro model of fibrosis can comprises an isolated tissue or cell sample where a f ⁇ brotic phenotype is induced.
  • Fibrotic phenotypes can be induced directly by exposure to exogenous agents, or indirectly by stimulation with cytokines and other inflammatory mediators of fibrosis.
  • exposing lung fibroblasts to silica directly stimulates a f ⁇ brotic phenotype in lung fibroblasts and provides a suitable in vitro model of pulmonary fibrosis for use in accordance with this aspect of the present invention.
  • the method according to this aspect of the present invention can be used to identify agents effective for treating the f ⁇ brotic conditions described above.
  • the f ⁇ brotic condition is lung or pulmonary fibrosis.
  • YYl heterozygotes (YYl +7" ) and conditional knockout YYl (YYl f/f ) mice were obtained from Dr. Yang Shi (Harvard University, Boston, MA). All animals were grouped according to age (6-12) or weight (20-35 g). YY1 +/" mice were on a C57BL/6 background (> 6 generations). YYl f/f mice were on a C57BL/6 background (4 generations). These mice received 200-300 ⁇ g of silica or three units of bleomycin per kg of body weight by intratracheal injection. The background of ⁇ i ccl ° i s p4 C57BL/6. All animals were housed under specific pathogen-free conditions at the NIH in an American Association for the Accreditation of Laboratory Animal Care-approved facility. The URMC animal care and use committee approved all experimental procedures.
  • CC-10-driven YYl (YY1 CC1 °) mice were generated as follows.
  • the plasmid of a rat cclO promoter (kind gift of Dr. Z. Zhou, Johns Hopkins University) was digested with Xbal-BamHI and the DNA ends were blunted.
  • the murine YYl gene was digested with BamHI and the DNA ends were blunted.
  • a YYl insert was subcloned into a blunted rat cclO plasmid and the plasmid was digested with HindIII and Kpnl.
  • the 4Kb fragment was obtained and injected into zygotes of BJ6 strain to create transgenic mice.
  • Three lines were generated and genotyping was performed using the forward primer 5'-ACTGCCCATTGCCCAAACAC (SEQ ID NO:7) and the reverse primer 5'-GATGGTCTCCACCTCGATCTCATG (SEQ ID NO:8).
  • WI-38 cells human fetal lung fibroblasts
  • MLg2908 cells mouse lung fibroblasts
  • LL97A cells human adult lung fibroblasts obtained from a patient with idiopathic pulmonary fibrosis
  • MRC-5 secondary human lung fibroblasts
  • 293FT cells were obtained from Invitrogen.
  • Primary mouse lung fibroblasts were isolated as described in Baglole et al., "Isolation and Phenotypic Characterization of Lung Fibroblasts," Meth. MoI. Med. 117:115-27 (2005), which is hereby incorporated by reference in its entirety.
  • lungs were minced and digested with collagenase and DNase at 37°C for two hours. After washing with HBSS, isolated cells were collected by centrifugation and plated in T75 flasks in DMEM/F12 (1 :1) containing 10% FBS and antibiotics. This was completed in a humidified atmosphere consisting of 5% CO 2 and 95% air overnight. Non-adherent cells were removed by washing the flask with media. After the third passage, the primary lung fibroblasts were used for the experiments.
  • Example 4 Histopathological and Immunohistochemical Examination
  • Lungs were fixed with 10% buffered formalin and embedded in paraffin. H&E stains and Masson's Trichrome stains were used for analysis of pathological changes using the Accustain Trichrome Stain Kit (Sigma Chemical Co., St. Louis, MO). Immunohistochemical staining for ⁇ -SMA and YYl in tissues was performed according to the instructions provided in the Animal Research Kit (DAKO Cytomation). Briefly, lung sections were deparaffmized, incubated with hot 5% urea to retrieve antigen, blocked, and stained with primary antibodies overnight at 4°C.
  • DAKO Cytomation Animal Research Kit
  • HRP- Streptavidin streptavidin-conjugated horseradish peroxidase
  • NovaRed Vector Laboratories
  • Slides were counterstained with hematoxylin for determination of ⁇ -SMA expression. The severity of fibrosis was evaluated in stained sections by an individual who was blinded to the genotypes of the mice. Double staining kits were purchased from Biocare Medical (Concord, CA) and staining was carried out following the recommended protocols.
  • RNA from lung tissue and lung fibroblasts was extracted using
  • Quantitative PCR was performed using an iQ5 Biorad device. Data were analyzed by the 2 ⁇ ⁇ ⁇ /c y method and normalized to the expression of the GAPDH housekeeping gene. The sequences of the primers utilized are listed in Table 1. Table 1. Primer Pairs Used for Quantitative PCR
  • Protein concentrations were determined by a BCA assay. Protein samples (20 ⁇ g) were separated in 8-16% SDS/PAGE gels and transferred onto a nitrocellulose membrane. The membrane was incubated with primary antibodies diluted in 1% non-fat milk in PBS containing 0.1% Tween 20, followed by incubation with horseradish peroxidase-conjugated IgG as the secondary antibody. Visualization was carried out using an ECL (enhanced chemiluminescence) kit.
  • ECL enhanced chemiluminescence
  • Example 8 Luciferase Assay and Construct of YYl and ⁇ -SMA Luciferase Reporter
  • Plasmids containing only the YYl promoter were kindly provided by Dr. Denis C. Guttridge (Ohio State University).
  • the ⁇ -SMA- luciferase reporter plasmid the ⁇ -SMA promoter was amplified by PCR using primers M SMA-5'-CCCGCTCGAGATGGTCCTT AATCATGCT (SEQ ID NO: 17) and M SMA-5 '-CCC AAGCTTCTT ACCCTGAC AGCGACTGG (SEQ ID NO:18). Amplification was completed using mouse lung fibroblast genomic DNA.
  • the DNA was cut with Xhol and HindIII and subcloned into the Xhol and HindIII sites of the pGL3 basic vector (Promega).
  • the reporter constructs were transiently transfected into WI-38 cells, MLg2908 cells, and primary lung fibroblast of YY1 +/" and wild type mice using electroporation (300V 1050 Capacitance). These plasmids included YYl- Luc, mutant YYl -Luc, and ⁇ -SMA-Luc.
  • the transfected cells were placed in OPTI- MEM media containing 0.1% FBS overnight in 24-well plates, and were then stimulated with TGF- ⁇ for 24 hours or with TNF- ⁇ for 6 hours.
  • a p65 (NF -KB) plasmid was cotransfected with YYl -Luc, mutant YYl- Luc, or YYl with or without a p65 plasmid and ⁇ -SMA-Luc.
  • Example 9 Lentiviral shRNA, Lentiviral-Cre, and Adenoviral-Cre
  • transient virus stocks 1.0 x 10 6 293T cells were plated in 60-mm dishes. The next day, the cells were cotransfected with shRNA constructs (1.5 ⁇ g) along with pHR'8.9 ⁇ R andpCMV- VSV-G helper constructs (1.5 ⁇ g and 0.3 ⁇ g, respectively) using FuGENE 6 (Roche, Indianapolis, IN), and the medium was changed the following day. One day later, virus-containing media was harvested. The viral stocks were centrifuged and filtered to remove any nonadherent 293T cells. Next, WI-38 and LL97A cells were infected with shRNA lentiviruses.
  • Cre at different multiplicities of infection (MOI) to knockdown YYl expression. Extracts from whole cells were immunob lotted with anti-YYl antibody.
  • the Lenti- Cre vector was purchased from Addgene. The packaging and infection approach employed was the same as that described above. [0154] Adenoviral Cre was purchased from Biomicrobics System Inc.
  • Anti-S100A4 (anti-FSPl, AB68124) was purchased from Abeam and anti-mouse- APC (A21057) was purchased from Invitrogen.
  • Primary lung fibroblasts were isolated from mice treated with bleomycin (3U/kg). After incubation with F 12 10% FBS medium for a week, the fibroblasts were labeled following Abeam intracellular staining and indirect labeling protocols. The protocol can produce about 90% purity of lung fibroblasts.
  • YYl is up-regulated by TGF- ⁇ in adult fibroblasts was investigated using a human adult fibroblast cell line, MRC5. After serum starvation for 24 hours, MRC5 cells were treated with 10 ng/ml of TGF- ⁇ for 8 hours or 24 hours in serum-free DMEM. Extracts from whole cells treated with TGF- ⁇ for 8 hours were subjected to immunoblot analysis with anti-YYl or anti- ⁇ -actin antibody. YYl expression was found to be up-regulated by TGF- ⁇ stimulation.
  • MRC5 cells transfected with the full-length YYl promoter- luciferase reporter (YYl-LUC) by electroporation were treated with PBS or TGF- ⁇ for 24 hours, and the relative light units (RLU) were measured with a luminometer.
  • YYl-LUC was also found to be up- regulated TGF- ⁇ stimulation.
  • Example 13 YYl Binding Activity at the ⁇ -SMA Promoter in Nuclear Extracts from WI-38 Cells
  • Double-stranded DNA probes were prepared by annealing the oligonucleotides 5 '-3' TC AGTTCCTGGTTTC ATTACTAC AAC AC AA (SEQ ID NO :27) (sense) and 5 '-3 ' TTGTGTTGT AGTAATGAAACC AGGAACAGA (SEQ ID NO:28) (antisense).
  • the sense oligonucleotide was 5 '-end-labeled with biotin during oligonucleotide synthesis (IDT).
  • Protein binding reactions were carried out in 20 ml of buffer (2OmM Hepes pH 7.9, 80 mM KCl, 5mM MgCl 2 , 2% (v/v) Ficoll, 5% (v/v) Glycerol, 0.1 mM EDTA, 1 mM Dithiothreitol) with 20 fmole of biotinylated probe, 1 mg of poly dldC, 50 mg of Bovine serum albumin, and 5 mg of lung fibroblast nuclear protein. The mixture was incubated for 30 minutes at room temperature in the presence or absence of non-labeled competitor oligonucleotides.
  • the binding reaction mixture was pre-incubated with YYl antibodies (1703, Santa Cruz Biotechnology).
  • the protein DNA complexes were resolved by electrophoresis (6% non-denaturing polyacrylamide gel from Invitogen) in 0.5xTBE running buffer.
  • the results identify a YYl binding site located on the ⁇ -SMA protomer at residues -556 to -526. (A potential second binding site is located at residues -279 to -249.)
  • Example 14 Cytokine Profile [0159] 1 ml of bronchoalveolar lavage ("BAL") was obtained from wild type and YY1 +/" mice. Cytokines from BALs were measured using a Bio-Plex array (8- plex cytokines) from Bio-Rad. Some cytokines, such as IL- 12, IFN- ⁇ , and TNF- ⁇ , were significantly decreased in BAL of YY1 +/" mice compared to that of wild type mice.
  • Example 15 YYl Expression Is Increased in Lung Tissues Obtained from
  • Example 16 YYl Is Overexpressed in Lung Fibroblasts in Human IPF and Murine Silicosis
  • YYl was found to be over-expressed in lung tissue of human IPF and murine fibrotic models. Determining which cells from lung contribute the YYl expression can help elucidate a mechanism of lung fibrosis. Injured lung will recruit lung fibroblasts to repair the damaged lung. The recruited lung fibroblasts require YYl expression for proliferation and differentiation.
  • FSPl and YYl antibodies were used to determine whether YYl is up-regulated in lung fibroblasts using IHC staining.
  • YYl was found to be expressed in lung fibroblastal areas in murine silicosis, as shown in Figure 4A, and in human IPF, as shown in Figure 4B. This suggests that YYl expression is located in regions enriched in lung fibroblasts.
  • mice were exposed to bleomycin and lung fibroblasts were harvested 12 days later (Lawson et al., "Characterization of Fibroblast-Specific Protein 1 in
  • Double staining IHC was conducted to further confirm that YYl expression is expressed in lung fibroblasts in human IPF. As shown in Figure 6B, YYl was found to be over-expressed in lung fibroblasts. Taken together, not only was YYl expression found to be located in aggregated lung fibroblasts, but it was also found that YYl expression is increased in isolated lung fibroblasts. These suggest that increased YYl expression plays a role in lung fibroblast differentiation and proliferation in injured lung.
  • Example 17 YYl Is Upregulated by TGF- ⁇ and TNF- ⁇ in Lung Fibroblasts
  • Lung fibrosis results from proliferation and differentiation of fibroblasts in response to the P-fibrotic cytokines TGF- ⁇ and TNF- ⁇ .
  • human WI-38 and mouse MLg2908 lung fibroblast cell lines were grown in vitro and exposed to TGF- ⁇ and TNF- ⁇ for different times.
  • YYl expression was upregulated by TGF- ⁇ in both human fetal fibroblasts and murine fibroblasts, as demonstrated by western blot (Figure 7A (WI-38 cells) and Figure 7B (MLg2908 cells)) and quantitative PCR (Figure 7C (WI-38 cells) and Figure 7D (MLg2908 cells).
  • Figure 7E YYl-Luc-transfected WI-38 cells
  • Figure 7F YYl-Luc-transfected MLg2908 cells
  • a human adult fibroblast cell line (MRC5) was also used, and up-regulation of YYl expression by TGF- ⁇ was confirmed using immunoblot and YYl reporter activity assays, as shown in Figure 8A-8B.
  • YYl expression was also found to be increased by TNF- ⁇ stimulation, as shown in Figure 9A (WI-38 cells) and Figure 9B (MLg2908 cells), although with slightly different kinetics.
  • Quantitative PCR data showed that YYl transcript levels are upregulated by TNF- ⁇ , as shown in Figure 9C (WI-38 cells) and Figure 9D (MLg2908 cells).
  • YYl promoter reporter activity is upregulated by TNF- ⁇ stimulation in lung fibroblasts, as shown in Figure 9E (YYl- Luc-transfected MI-38 cells) and Figure 9F (YYl-Luc-transfected MLg2908 cells).
  • Figure 9E YYl- Luc-transfected MI-38 cells
  • Figure 9F YYl-Luc-transfected MLg2908 cells
  • crystalline silica can activate cells directly through distinct molecular pathways (Hornung et al., “Silica Crystals and Aluminum Salts Activate the NALP3 Inflammasome Through Phagosomal Destabilization,” Nat. Immunol. 9(8):847-56 (2008); Dostert et al., “Innate Immune Activation Through Nalp3 Inflammasome Sensing of Asbestos and Silica,” Science 320(5876):674-77 (2008), each of which is hereby incorporated by reference in its entirety).
  • Example 19 NF- ⁇ B-Mediated YYl Expression in Lung Fibroblasts After TGF- ⁇ Stimulation
  • TNF- ⁇ can up-regulate YYl expression mediated by NF- ⁇ B in tumor cells (Huerta-Yepez et al., "Involvement of the TNF- ⁇ Autocrine-Paracrine Loop, via NF- KB and YYl, in the Regulation of Tumor Cell Resistance to Fas-Induced Apoptosis," Clin. Immunol. 120(3):297-309 (2006), which is hereby incorporated by reference in its entirety).
  • a YYl promoter reporter was transiently trans fected with or without NF -KB expression vectors into WI-38 cells. Transfected cells were stimulated with TGF- ⁇ , and reporter gene activity was analyzed by luminometry. As shown in Figure 12 A, YYl promoter activity was significantly increased in lung fibroblasts in response to both TGF- ⁇ stimulation and co-trans fection with NF- ⁇ B (p65). As shown in Figure 12B, disruption of a potential NF -KB site blocked the enhancing effect of NF -KB co-trans fection, suggesting that this involves direct binding to the YYl promoter.
  • IK-B prevents nuclear translocation of NF- ⁇ B.
  • an indirect NF- ⁇ B inhibitor (Bay 11-7085) was employed to block IK-B degradation and prevent NF -KB translocation into the nucleus.
  • YYl expression was abolished by Bay 11-7085 after TGF- ⁇ stimulation.
  • Example 20 The Myofibroblast Marker ⁇ -SMA Is Up-Regulated by YYl
  • ⁇ -SMA and collagen are highly expressed in myofibroblasts, the presence of which is a hallmark of f ⁇ brotic lung diseases.
  • Collagen has been reported to be up-regulated by YYl binding to collagen promoters (Riquet et al., "YYl Is a Positive Regulator of Transcription of the Collal Gene,” J. Biol. Chem. 276(42):38665-72 (2001), which is hereby incorporated by reference in its entirety).
  • YYl can bind to the ⁇ -SMA promoter, it is unknown whether it upregulates or downregulates ⁇ -SMA promoter activity (Bushel et al., "Two Serum Response Elements Mediate Transcriptional Repression of Human Smooth Muscle ⁇ -Actin Promoter in Ras-Transformed Cells," Oncogene 10(7): 1361-70 (1995), which is hereby incorporated by reference in its entirety).
  • ⁇ -SMA-Luc a murine 740-bp construct driving the firefly luciferase gene
  • lung fibroblasts were isolated from wild-type and heterozygous YY1 +/" mice, which express about half the normal complement of YYl . After transient transfection using electroporation, it was found that ⁇ -SMA promoter activity was markedly decreased in fibroblasts from YY1 +/" mice compared to wild-type littermates, as shown in Figure 13C. Taken together, these data provide strong support for the idea that ⁇ -SMA is a previously unrecognized and important target of YYl in primary lung fibroblasts in vivo.
  • Example 21 Induction of ⁇ -SMA and Collagen Expression in Lung Tissues and Fibroblasts Isolated from Transgenic Mice (YYl ccl °) [0170] To assess the role of YYl in ⁇ -SMA regulation in vivo, a transgenic mouse was constructed in which the rat clara cell 10 (cclO) promoter drives expression of full-length YYl cDNA ( ⁇ i ccl ° mice).
  • cclO rat clara cell 10
  • cclO is also expressed at lower levels in lung fibroblasts (Lesur et al., "Clara Cell Protein (CC-16) Induces a Phospholipase A2-Mediated Inhibition of Fibroblast Migration in Vitro," Am. J. Respir. Crit. Care Med.
  • Example 22 ⁇ -SMA and Collagen Are Downregulated by Inhibition of YYl Expression Using YYl shRNA and Conditional Knockout YYl
  • lung fibroblasts were isolated from YYl "floxed" mice (YYl f/f ), in which the exon 1 is flanked by lox-p sites to allow for Cre-mediated deletion (Liu et al., "Yin Yang 1 Is a Critical Regulator of B-CeIl Development," Genes Dev. 21(10): 1179-89 (2007), which is hereby incorporated by reference in its entirety).
  • the lung fibroblasts were then infected with lentivirus Cre in vitro. After recovery for five days, immunob lotting was carried out using anti-YYl, demonstrating a lack of YYl expression in fibroblasts obtained from YYl f/f mice, as shown in Figure 15B.
  • Cre-GFP fusion protein it was found that both YYl and ⁇ -SMA expression were markedly reduced in transfected fibroblasts from YYl mice, as shown in Figure 15 A.
  • a fibroblast cell line (LL97A) was derived from a human subject with IPF and infected using different YYl lentiviral shRNA constructs. After transduction with two controls and two YYl lentiviral shRNA constructs, LL97A cells were allowed to recover for three days and then selected in puromycin to enrich for transduced cells.
  • Figures 15C and 15D show that decreased YYl expression inhibited both ⁇ -SMA and collagen expression in human lung fibroblasts, as determined by immunofluorescence staining and immunoblot assays.
  • Example 23 Partial YYl Deficiency Protects Mice from Lung Fibrosis After Exposure to Both Silica and Bleomycin
  • mice were utilized in two different fibrotic lung models.
  • heterozygous YYl (YY 1 +/" ) mice or littermate controls on the C57BL/6 background) were instilled with silica particles by intratracheal injection. Three weeks later, the mice were sacrificed and the lungs stained by immunohistochemistry. Connective tissue was also analyzed using Masson's trichrome straining. As shown in Figure 16A, lung fibrosis was markedly decreased in YY1 +/" compared to WT mice (indicated by the arrow).
  • bleomycin was employed in another YYl -deficient mouse model, i.e., "floxed" YYl f/f mice, which are hypomorphic and express about 75% the normal amount of YYl protein due to insertion of flox-p sites flanking exon 1 of YYl (Liu et al., "Yin Yang 1 Is a Critical Regulator of B-CeIl Development," Genes Dev. 21(10): 1179-89 (2007), which is hereby incorporated by reference in its entirety).
  • Bleomycin was administered by intratracheal instillation into wild-type of YYl littermates, and three weeks post-instillation of bleomycin, the lungs of these mice were harvested and stained by IHC.
  • Figure 16C it was found that lung fibrosis, YYl expression, and ⁇ -SMA expression were increased in the lungs of wild type mice compared to those of YYl f/f mice.
  • scar regions were scored by double blinded method depending on ⁇ -SMA expression in fibrotic lung.
  • the scores show that scarring was significantly diminished in YY l f/f compared to WT mice.
  • YYl is a versatile transcription factor that can activate, repress or initiate gene expression.
  • Several studies had demonstrated the ability of YYl to regulate cell growth, differentiation and apoptosis, but relatively little was known about the role of YYl in irreversible chronic inflammation or tissue injury and repair responses in vivo. Examples 1-25 demonstrate that YYl mRNA and protein are upregulated in two different mouse models of lung fibrosis, as well as in lungs from human subjects with IPF (see Figures IA-I C, 2A-2C, and 3A-3C), a progressive and incurable disease.
  • lung fibroblasts were focused on, because lung fibroblasts ultimately control deposition of extracellular matrix and differentiation to myofibroblasts characterizes the injury/repair response.
  • YYl expression was found to be highly increased in lung fibroblasts of human IPF and murine fibrotic models. This implies that the enhancement of lung fibroblasts requires YYl expression in injury/repair process. Since YYl can directly bind to the promoter regions of both the collagen (Riquet et al., "YYl Is a Positive Regulator of Transcription of the Collal Gene," J. Biol. Chem.
  • Lung myofibroblasts derive from multiple sources including resident progenitor cells, circulating fibrocytes (Andersson-Sjoland et al, "Fibrocytes Are a Potential Source of Lung Fibroblasts in Idiopathic Pulmonary Fibrosis," Int. J. Biochem. Cell Biol.
  • EMT epithelial to mesenchymal transition
  • fibroblasts which are characterized by expression of the ⁇ - SMA gene, are more resistant to apoptosis (Horowitz et al., "Combinatorial Activation of FAK and AKT by Transforming Growth Factor- ⁇ l Confers an Anoikis- Resistant Phenotype to Myofibroblasts," Cell Sign. 19(4):761-71 (2007); Garneau- Tsodikova & Thannickal, "Protein Kinase Inhibitors in the Treatment of Pulmonary Fibrosis," Curr. Med. Chem.
  • YYl expression is not only increased in accumulated fibroblasts but also in individual fibroblasts by silica or bleomycin instillation (see Figures 4A-4B, Figure 5, and Figures 6A-6B). This sufficiently demonstrates that YYl expression plays a very important role in the recruitment of lung fibroblasts of fibrotic lung.
  • YYl plays a novel role in myofibroblast differentiation at least in part by regulating ⁇ -SMA gene expression.
  • YYl may also confer resistance to apoptosis (Bonavida, "Rituximab-Induced Inhibition of Antiapoptotic Cell Survival Pathways: Implications in Chemo/Immunoresistance, Rituximab, Unresponsiveness, Prognostic and Novel Therapeutic Interventions," Oncogene 26(25):3629-36 (2007) , which is hereby incorporated by reference in its entirety), which is known to be induced during lung fibrotic responses after exposure to silica (Han et al, "Angelica sinensis Down-Regulates Hydroxyproline and Tgfbl and Provides Protection in Mice with Radiation-Induced Pulmonary Fibrosis," Radiat.
  • LPS induced the inflammation is different from the inflammation in silica- induced.
  • YYl expression was not found to be affected in alveolar macrophages by TNF- ⁇ or silica (see Figure 11).
  • Silica and asbestos particles have been shown to activate the Nalp3 containing inflammasome and induce caspase-1 driven processing of mature IL- l ⁇ , (Hornung et al., "Silica Crystals and Aluminum Salts Activate the NALP3 Inflammasome Through Phagosomal Destabilization," Nat. Immunol.
  • Smads are also activated by TGF- ⁇ during lung fibrosis, and although Smad3 can bind to different domains of YYl (Kurisaki et al., "Nuclear Factor YYl Inhibits Transforming Growth Factor ⁇ - and Bone Morphogenetic Protein-Induced Cell Differentiation," MoI. Cell Biol. 23(13):4494-510 (2003), which is hereby incorporated by reference in its entirety), the present Examples found that over-expressed Smad3 did not regulate YYl promoter activity in lung fibroblasts.
  • TGF- ⁇ and TNF- ⁇ are universally implicated in injury/repair and remodeling, it is predicted that YYl will play a role in fibroblast differentiation and activation in diverse tissues, and that the paradigms established in the present Examples should be broadly generalizable.
  • adaptive immune response still can accelerate the formation of lung fibrosis.
  • YYl can enhance cyclooxygenase-2 expression in alveolar macrophages, which plays a role in inflammation of lung fibrosis (Joo et al., "Yin Yang 1 Enhances Cycloxygenase-2 Gene Expression in Macrophages," Am. J. Physiol. Lung Cell. MoI. Physiol.
  • mice In support of this idea, lower levels of inflammatory cytokines were detected in bronchoalveolar lavage fluids from silica challenged YY1 +/" compared to wild type controls (see Figure 19).
  • the YY1 +/" heterozygous mice used in this study express about 50% of normal YYl levels (Affar el et al., "Essential Dosage- Dependent Functions of the Transcription Factor Yin Yang 1 in Late Embryonic Development and Cell Cycle Progression," MoI. Cell Biol.
  • YYl regulates gene expression in a gene-dosage dependent manner, consistent with prior studies in a model of allergic lung inflammation (Guo et al., Yin Yang 1 Regulates Effector Cytokine Gene Expression and T H 2 Immune Responses," J. Allergy Clin. Immunol. 122(1): 195- 201.e5 (2008), which is hereby incorporated by reference in its entirety).
  • YYl is generally considered a constitutively expressed nuclear phosphoprotein, but there is growing evidence that YYl expression can be dynamically regulated, including by compounds in therapeutic use.
  • Rituximab is an anti- CD20 antibody used for treating B cell non-Hodgkin's lymphoma (Bonavida, "Rituximab-Induced Inhibition of Antiapoptotic Cell Survival Pathways: Implications in Chemo/Immunoresistance, Rituximab, Unresponsiveness, Prognostic and Novel Therapeutic Interventions," Oncogene 26(25):3629-36 (2007), which is hereby incorporated by reference in its entirety).
  • Nitric oxide can also inhibit YYl expression in human tumor cells (Hongo et al., "Inhibition of the Transcription Factor Yin Yang 1 Activity by S-Nitrosation,” Biochem. Biophys. Res. Commun. 336(2): 692-701 (2005), which is hereby incorporated by reference in its entirety) as well as in lung fibroblasts, which may explain some of the therapeutic benefits of inhaled NO in lung fibrosis (Yung et al., "Outpatient Inhaled Nitric Oxide in a Patient with Idiopathic Pulmonary Fibrosis: A Bridge to Lung Transplantation," J. Heart Lung Transplant. 20(11): 1224-27 (2001), which is hereby incorporated by reference in its entirety).
  • YY-I binds to its core consensus sequence, 5'-CCAT-3', using a C- terminal zinc finger DNA binding domain (DBD).
  • DBD C- terminal zinc finger DNA binding domain
  • a YY-I DBD mutant lacking the four zinc finger domains that no longer binds DNA (DZ-YYl) was constructed and its capacity to interfere with YY-I transcriptional activity was assessed.
  • DZ-YYl represses basal and TGF- ⁇ induced ⁇ -SMA promoter activity in vitro.
  • YYl In addition to directly regulating gene expression at the transcriptional level, YYl is intimately involved in chromatin remodeling and epigenetic imprinting. For example, YYl can recruit histone H4-specific methyltransferases to its target promoters (Rezai-Zadeh et al., "Targeted Recruitment of a Histone H4-Specific Methyltransferase by the Transcription Factor YY 1 ,” Genes Dev.
  • H3K27 trimethylation is, in part, mediated by YY-I expression, as shown in Figure 23.
  • Lung fibroblasts isolated from YYl f/f mice were trans fected with Cre-recombinase-GFP fusion protein to attenuate YY-I expression and H3K27 trimethylation was assessed using fluorescence immunocytochemistry.
  • Non- transfected cells, expressing normal levels of YY-I protein have a higher level of H3K27 trimethylation than transfected cells.
  • Example 27 — EZH2 Expression Is Enhanced in Lung Pulmonary Fibrosis
  • DZ-YYl has "dominant negative" activity on ⁇ -SMA promoter activity, its therapeutic potential for inhibiting silica dependent fibroblast activation in vitro and silica induced fibrosis in vivo will be investigated.
  • WI-38 fibroblasts will be grown to 70-80% confluence and transfected by electroporation (300 volts, 1050 capacitance) with the ⁇ -SMA luciferase reporter with or without pSG5 DZ-YYl (1-6 ⁇ g) or empty vector control.
  • ⁇ -SMA promoter activity by luminescence. Renilla luciferase will be co- transfected as internal control for transfection efficiency and results will be expressed both as raw RLU and also relative to renilla luciferase. A separate aliquot of cells will be lysed and used to evaluate YY-I and ⁇ -SMA protein expression and RNA expression.
  • DZ-YYl For in vivo studies using DZ-YYl , C57BL/6 wild-type mice will be exposed intranasally to silica either before or after DZ-YYl administration (see Figure 25). Using this approach, whether DZ-YYl can prevent or reverse fibrosis will be determined. A 4:1 molar ratio of DZ-YYl with transfection reagents LipofectAMINE or DOTAP (N-[l-(2,3-dioleoyl)propyl]-N,N,N-trimethylammonium methylsulfate) will be prepared to form DNA-liposome complexes (Invitrogen Life Technologies and Boehringer Mannheim, respectively).
  • LipofectAMINE or DOTAP N-[l-(2,3-dioleoyl)propyl]-N,N,N-trimethylammonium methylsulfate
  • mice will be administered three weekly treatments of DZ-YYl beginning one week prior to silica and then weekly for two weeks followed by sacrifice at three weeks.
  • mice will be administered three weekly treatments of DZ-YYl beginning three weeks after silica exposure followed by sacrifice at six weeks.
  • bronchial-alveolar lavage BAL
  • BAL bronchial-alveolar lavage
  • Lungs will be perfused with PBS, fixed in 10% formaldehyde, and processed for histochemical analysis using H&E staining, Masson's trichrome, and ⁇ -SMA expression.
  • One lung lobe will be removed and homogenized with PBS for measuring collagen, ⁇ -SMA, and hydroxyproline using western blot and ELISA.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Urology & Nephrology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention is directed to methods of diagnosing and treating a fibrotic condition in a mammalian subject. These methods involve measuring the levels of trimethylation at lysine residue 27 of histone-3 and/or measuring the expression levels of EZH2 or YY-1. Agents useful for treating fibrosis or a fibrotic condition are also disclosed.

Description

METHODS OF DIAGNOSING AND TREATING FIBROSIS
[0001] This application claims the benefit of U.S. Provisional Patent
Application Serial No. 61/110,267, filed October 31, 2008, which is hereby incorporated by reference in its entirety.
[0002] This invention was made with government support under grant number
ROl HL073952 awarded by the National Institutes of Health. The government has certain rights in this invention.
FIELD OF THE INVENTION
[0003] The present invention is directed to methods of diagnosing and treating a fibrotic condition in a mammalian subject.
BACKGROUND OF THE INVENTION
[0004] Idiopathic pulmonary fibrosis (IPF) is a progressive, chronic interstitial lung disease associated with high mortality (median survival of newly diagnosed patients is ~3 years) and a uniformly poor prognosis (Khalil et al., "Idiopathic Pulmonary Fibrosis: Current Understanding of the Pathogenesis and the Status of Treatment," CMAJ 171(2): 153-60 (2004)). IPF is the pathological hallmark of interstitial lung diseases (Green, F.H., "Overview of Pulmonary Fibrosis," Chest 122(6 Suppl):334S-339S (2002)) and is characterized by increased deposition of extracellular matrix (ECM), including collagen. This lethal lung disorder presents a major clinical challenge, since effective therapeutic agents for reversing lung fibrosis have not yet been discovered (Phan et al., "The Myofibroblast as an Inflammatory Cell in Pulmonary Fibrosis," Curr. Top. Pathol. 93:173-82 (1999)). The current hypothesis is that IPF represents a chronic injury/repair response to specific environmental insults (such as silica or asbestos). However, the precise molecular mechanisms underlying persistent fibroblast activation remains poorly understood. Myofibroblasts are now recognized as major effector cells in pulmonary fibrosis. They are characterized by the expression of α-smooth muscle actin (α-SMA), enhanced proliferation, and synthesis of ECM proteins (Sheppard et al., "Transcriptional Activation by NF-κB Requires Multiple Coactivators," MoI. Cell. Biol. 19(9):6367-78 (1999)), and are thought to be derived from fibroblasts via the activity of TGF-β and other stimuli (Roy et al., "Regulation of α-Smooth Muscle Actin Gene Expression in Myofibroblast Differentiation from Rat Lung Fibroblasts," Int'lJ. Biochem. Cell Biol. 33(7):723-34 (2001)). In pulmonary fibrosis, myofibroblasts acquire resistance to apoptosis, which may account for the increased number of these cells present in fibroblastic foci (Horowitz et al., "Combinatorial Activation of FAK and AKT by Transforming Growth Factor-βl Confers an Anoikis- Resistant Phenotype to Myofibroblasts," Cell Sign. 19(4):761-71 (2007)). [0005] Myofibroblasts are crucial effector cells in lung fibrosis, and derive from epithelial to mesenchymal transition (EMT) (Bedi et al., "Epithelial-to- Mesenchymal Transition and Chronic Allograft Tubulointerstitial Fibrosis," Transplant. Rev. 22(1): 1-5 (2008)), circulating fibrocytes (Andersson-Sjoland et al., "Fibrocytes Are a Potential Source of Lung Fibroblasts in Idiopathic Pulmonary Fibrosis," Int. J. Biochem. Cell Biol. 40(10):2129-40 (2008)), and by self renewal in response to lung injury or chronic inflammation induced by stimuli such as silica and bleomycin. These myofibroblasts are accumulated in the injured lung and block alveolar gas exchange. Avoiding the formation of over-myo fibroblasts would provide protection against lung fibrosis, and this could be achieved by inhibition of α-SMA expression in lung fibroblasts (Meyer-Ter-Vehn et al., "Lovastatin Inhibits TGF-β- Induced Myofibroblast Transdifferentiation in Human Tenon Fibroblasts," Invest. Ophthalmol. Vis. Sci. 49(9):3955-60 (2008)).
[0006] After inhalation of pro-fibrotic stimuli (e.g. asbestos, silica, bleomycin) alveolar macrophages produce cytokines including TGF-β 1 and TNF-α) that contribute to lung inflammation and fibrosis via different mechanisms (Hardie et al., "Conditional Expression of Transforming Growth Factor-α in Adult Mouse Lung Causes Pulmonary Fibrosis," Am. J. Physiol. Lung Cell. MoI. Physiol. 286(4):L741- 49 (2004); Liu et al., "Transforming Growth Factor-βi Overexpression in Tumor Necrosis Factor-α Receptor Knockout Mice Induces Fibroproliferative Lung Disease," Am. J. Respir. Cell MoI. Biol. 25(l):3-7 (2001)). TGF-βi plays an essential role in wound healing and matrix molecule deposition. It induces myofibroblast differentiation and alveolar remodeling in vivo (Leask & Abraham, "TGF-β Signaling and the Fibrotic Response," Faseb. J. 18(7):816-27 (2004); Lee et al, "Early Growth Response Gene 1 -Mediated Apoptosis Is Essential for Transforming Growth Factor βi-Induced Pulmonary Fibrosis," J. Exp. Med. 200(3):377-89 (2004)), and over- expression of this potent pro fibrotic mediator leads to progressive fibrosis in mice, with minimal inflammation (Sime et al., "Adenovector-Mediated Gene Transfer of Active Transforming Growth Factor-βl Induces Prolonged Severe Fibrosis in Rat Lung," J. Clin. Invest. 100(4):768-76 (1997)). TNF-α also contributes to lung fibrosis (Ortiz et al., "Expression of TNF and the Necessity of TNF Receptors in Bleomycin-Induced Lung Injury in Mice," Exp. Lung Res. 24(6):721-43 (1998)), and its effects may be mediated through activation of other growth factors. TNF-α may also regulate the balance between cell survival and cell death. For example, TNF-α- deficient mice are protected against bleomycin-induced lung inflammation via reduced apoptosis of inflammatory cells (Kuroki et al., "Repression of Bleomycin- Induced Pneumopathy by TNF," J. Immunol. 170(l):567-74 (2003)). Inhibition of TNF-α with infliximab may stabilize the progression of pulmonary fibrosis associated with collagen vascular disease (CVD) (Antoniou et al., "Infliximab Therapy in Pulmonary Fibrosis Associated with Collagen Vascular Disease," Clin. Exp. Rheumatol. 25(l):23-28 (2007)). [0007] Yin Yang 1 (YYl) is a ubiquitously expressed zinc finger transcription factor that can either activate or repress gene transcription, and plays an important role in cellular proliferation, differentiation, and apoptosis. Growing evidence indicates that YYl contributes to the pathogenesis of cancer and inflammation (Austen et al., "Characterization of the Transcriptional Regulator YYl. The Bipartite Transactivation Domain Is Independent of Interaction with the TATA Box-Binding Protein, Transcription Factor HB, TAFII55, or cAMP-Responsive Element-Binding Protein (CBP)-Binding Protein," J. Biol. Chem. 272(3): 1709-17 (1997); Gordon et al., "Transcription Factor YYl : Structure, Function, and Therapeutic Implications in Cancer Biology," Oncogene 25(8): 1125-42 (2006)). For example, YYl negatively regulates p53, a tumor suppressor gene (Sui et al., "Yin Yang 1 Is a Negative Regulator of p53," Cell 117(7):859-72 (2004)), and promotes tumor cell survival in part by preventing apoptosis (Huerta-Yepez et al., "Involvement of the TNF-α Autocrine-Paracrine Loop, via NF -KB and YYl, in the Regulation of Tumor Cell Resistance to Fas-Induced Apoptosis," Clin. Immunol. 120(3):297-309 (2006); Vega et al., "Rituximab (Chimeric anti-CD20) Sensitizes B-NHL Cell Lines to Fas-Induced Apoptosis," Oncogene 24(55):8114-27 (2005)). TNF-α-induced YYl represses Fas expression, providing a mechanism whereby YYl contributes to TNF-α-induced cell survival (Huerta-Yepez et al., "Involvement of the TNF-α Autocrine-Paracrine Loop, via NF-κB and YYl, in the Regulation of Tumor Cell Resistance to Fas-Induced Apoptosis," Clin. Immunol. 120(3):297-309 (2006)). In fibroblasts, TNF-α induces YYl in an NF-κB-dependent manner (Wang et al., "NF -KB Regulation of YYl Inhibits Skeletal Myogenesis Through Transcriptional Silencing of Myofibrillar Genes," MoI. Cell Biol. 27(12):4374-87 (2007)), supporting a link between the NF- KB pathway and YYl expression (Huerta-Yepez et al., "Involvement of the TNF-α Autocrine-Paracrine Loop, via NF -KB and YYl, in the Regulation of Tumor Cell Resistance to Fas-Induced Apoptosis," Clin. Immunol. 120(3):297-309 (2006); Vega et al., "Rituximab (Chimeric anti-CD20) Sensitizes B-NHL Cell Lines to Fas-Induced Apoptosis," Oncogene 24(55):8114-27 (2005); Lei et al., "p38 MAPK-Dependent and YYl -Mediated Chemokine Receptors CCR5 and CXCR4 Up-Regulation in U937 Cell Line Infected by Mycobacterium tuberculosis or Antinobacillus actinomycetemcomitans," Biochem. Biophys. Res. Commun. 329(2):610-15 (2005)). YYl can bind to and activate type I and type II collagen gene promoters in fibroblasts (Riquet et al., "YYl Is a Positive Regulator of Transcription of the Collal Gene," J. Biol. Chem. 276(42):38665-72 (2001); Miao et al., "Identification of Two Repressor Elements in the Mouse α2(I) Collagen Promoter," Arch. Biochem. Biophys. 361(1):7- 16 (1999)), and also enhance fibronectin gene expression (Du et al., "Transcriptional Up-Regulation of the Delayed Early Gene HRS/SRp40 During Liver Regeneration. Interactions Among YYl , GA-Binding Proteins, and Mitogenic Signals," J. Biol.
Chem. 273(52):35208-15 (1998)). The expression of cyclooxygenase-2 (which also contributes to lung fibrosis) is also regulated by YYl in macrophages (Joo et al., "Yin Yang 1 Enhances Cycloxygenase-2 Gene Expression in Macrophages," Am. J. Physiol. Lung Cell. MoI. Physiol. 292(5):L1219-26 (2007)). These reports suggest that YYl may play a role in fibrotic responses in the lung or other organs, but very little is known about the expression or function of YYl in fibrotic conditions in vivo. [0008] Experiments employing conditional deletion mouse stains revealed a crucial role for YYl in the proliferation and differentiation of B lymphocytes (Liu et al., "Yin Yang 1 Is a Critical Regulator of B-CeIl Development," Genes Dev. 21(10): 1179-89 (2007)) and oligodendrocytes (He et al., "The Transcription Factor Yin Yang 1 Is Essential for Oligodendrocyte Progenitor Differentiation," Neuron
55(2):217-30 (2007)). Embryonic fibroblasts from YYl-deficient mice demonstrated reduced proliferation in vitro in proportion to the levels of YYl protein expression. This finding indicates that YYl controls fibroblast proliferation in a gene dosage- dependent manner (Affar el et al., "Essential Dosage-Dependent Functions of the Transcription Factor Yin Yang 1 in Late Embryonic Development and Cell Cycle Progression," MoI. Cell Biol. 26(9):3565-81 (2006)). However, very little is known about the expression or function of YYl in fibrotic conditions or disorders, such as lung fibrosis. [0009] The present invention is directed to overcoming these and other deficiencies in the art.
SUMMARY OF THE INVENTION
[0010] A first aspect of the present invention is directed to a method of diagnosing a fibrotic condition in a subject by measuring the level of trimethylation at lysine residue 27 of histone-3 ("H3K27") in a biological sample from the subject. The level of H3K27 trimethylation is compared to a standard level of H3K27 trimethylation, and the presence or absence of a fibrotic condition is correlated to the results of the comparison. [0011] A second aspect of the present invention is directed to a method of diagnosing a fibrotic condition in a subject by measuring the expression level of Enhancer of Zeste Homolog 2 ("EZH2") or Yin-Yang- 1 ("YY-I") in a biological sample from the subject. The expression level of EZH2 or YY-I in the biological sample is compared to a standard expression level of EZH2 or YY-I, and the presence of absence of a fibrotic condition is correlated to the results of the comparison. [0012] Another aspect of the present invention is directed to a method of treating a subject having a fibrotic condition. This method involves administering to the subject an agent that inhibits or reduces H3K27 trimethylation under conditions effective to treat a fibrotic condition in the subject.
[0013] Another aspect of the present invention relates to a method of identifying an agent that is effective for treating a fibrotic condition. This method involves obtaining a first biological sample from an in vivo or in vitro experimental model of fibrosis and administering a candidate agent to the experimental model of fibrosis. A second biological sample is obtained from the experimental model after administering the candidate agent, and the level of H3K27 trimethylation in the first and second biological samples is measured. The level of H3K27 trimethylation in the first and second biological samples is then compared. A decrease in the level of
H3K27 trimethylation in the second biological sample relative to the level of H3K27 trimethylation in the first biological sample indicates that the agent is effective for treating a fibrotic condition. [0014] Another aspect of the present invention is directed to a pharmaceutical composition. The pharmaceutical composition contains a pharmaceutically acceptable delivery vehicle and an effective amount of one or more agents selected from the group consisting of an agent that inhibits or reduces H3K27 trimethylation, an inhibitor of EZH2, an inhibitor of YY-I, and an inhibitor of histone deacetylase. The pharmaceutical composition of the present invention is suitable for treating a fibrotic condition.
[0015] Pulmonary fibrosis, like other fibrotic conditions, is a progressive and chronic condition involving the formation of excess connective scar tissue within the lung. Pulmonary fibrosis alone affects more than five million people worldwide, resulting in more than 40,000 deaths per year. The present invention provides, inter alia, an understanding of the molecular mechanisms underlying the pathogenesis of fibrosis and fibrotic conditions that facilitates the development of early diagnostic markers as well as effective therapeutic agents that can prevent or reduce disease progression.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figures IA- 1C show that YYl protein expression is increased in the lungs of idiopathic pulmonary fibrosis (IPF) patients. Figure IA is a series of representative light photomicrographs of lung tissue samples from IPF patients ("IPF") and healthy controls ("Normal") (n=5). Samples in the top panel ("H&E") were stained with hemotoxylin and eosin to identify histological features. H&E staining shows that highly inflammatory lung was found in IPF samples. Immunohistochemistry was used on the samples in the bottom panel ("YYl") to identify the expression of YYl . Pictures were obtained at the original magnification of 1OX. The 63X magnification is shown in the upper right-hand corner. Figure IB is an immunoblot of whole lung tissue extracts from IPF patients ("IPF") and healthy controls ("Normal"), using anti-YYl (H414, Santa Cruz) and anti-β-actin antibodies. YYl expression is upregulated in whole lung tissue lysates of IPF patients. Figure 1C is a graph showing the relative fold induction of YY-I mRNA expression in lung tissue derived from IPF subjects ("IPF") compared to lung tissue from healthy controls ("Normal") (n=5), assessed by quantitative PCR. *p<0.05 by Student's t- test. YYl transcription level is upregulated in whole lung tissues of IPF patients. [0017] Figures 2A-2C show that YYl protein expression is increased in the lungs of silica-challenged mice. Figure 2 A is a series of representative light photomicrographs of lung tissue samples from C57BL/6 mice treated with silica ("Silica") or saline ("PBS") (n=5 mice per group). Samples in the top panel ("H&E") were stained with hemotoxylin and eosin to identify histological features. H&E staining shows that highly inflammatory lung was found in silica-induced pulmonary fibrosis. Immunohistochemistry was used on the samples in the bottom panel ("YYl ") to identify the expression of YYl . Pictures were obtained at the original magnification of 10X. The 63X magnification is shown in the upper right-hand corner. Figure 2B is an immunoblot of whole lung tissue extracts from C57BL/6 mice treated with silica ("Silica") or saline ("PBS"), using anti-YYl (H414, Santa Cruz) and anti-GAPDH antibodies. YYl expression is upregulated in whole lung tissue lysates of silica-induced fibrosis. Figure 2C is a graph showing the relative fold induction of YY-I mRNA expression in the samples shown in Figure 2 A, assessed by quantitative PCR. **p<0.01 by Student's t-test. YYl transcription level is upregulated in whole lung tissues of silica-induced fibrosis.
[0018] Figures 3A-3C show that YYl protein expression is increased in the lungs of bleomycin-challenged mice. Figure 3 A is a series of representative light photomicrographs of lung tissue samples from C57BL/6 mice treated with bleomycin ("Bleomycin") or saline ("PBS") (n=5 mice per group). Samples in the top panel ("H&E") were stained with hemotoxylin and eosin to identify histological features. H&E staining shows that highly inflammatory lung was found in bleomycin-induced pulmonary fibrosis. Immunohistochemistry was used on the samples in the bottom panel ("YYl") to identify the expression of YYl . Pictures were obtained at the original magnification of 1OX. The 63X magnification is shown in the upper right- hand corner. Figure 3 B is an immunoblot of cytoplasmic and nuclear fractions from C57BL/6 mice treated with the indicated amounts of bleomycin, using anti-YYl (H414, Santa Cruz) and anti-β-actin antibodies. YYl expression is upregulated in whole lung tissue lysates of bleomycin-induced fibrosis. Figure 3C is a graph showing the relative fold induction of YY-I mRNA expression in the samples shown in Figure 3A, assessed by quantitative PCR. *p < 0.05 by Student's t-test. YYl transcription level is upregulated in whole lung tissues of bleomycin-induced fibrosis. [0019] Figure 4A is a series of light photomicrographs of lung sections from
C57BL/6 mice instilled with saline ("PBS") or silica and evaluated 21 days after silica treatment (the YYl -labeled samples are same the same as those shown in Figure 2A). Samples were stained with anti-YYl, anti-α-SMA, and anti-FSPl. The expression of YYl and α-SMA were increased in FSPl positive cells in mouse silicosis compared to PBS instillation control. Magnification was 1OX (left panels) and 63X (right panels). All experiments were performed at least three times. [0020] Figure 4B is a series of light photomicrographs of lung sections from
IPF patients ("IPF") and healthy controls ("Normal") (n=3) stained with anti- FSPl, anti- YYl, and hemotoxylin and eosin ("H&E"). YYl was expression was located in FSPl positive cells. H&E showed typical lung fibrosis in IPF.
Magnification was 1OX and 63X, as indicated. All experiments were performed at least three times.
[0021] Figure 5 shows the purity of primary lung fibroblasts isolated from mice treated with bleomycin. After two passages, the fibroblasts were labeled with anti-FSPl antibody and anti-mouse- APC. Red (light grey) represents isotype labeled- cells and blue (dark grey) represents anti-FSPl labeled-positive cells (89.4%). [0022] Figure 6A is an immunoblot of lung fibroblasts isolated from mice treated intratracheally with 3U/kg of bleomycin ("BLM") and untreated mice (n=4 mice per group). After 12 days, the fibroblasts were isolated and incubated for 6 days (two passages). YYl expression was determined by immunoblot using anti-YYl and anti-β-actin antibodies.
[0023] Figure 6B is a series of light photomicrographs of lung samples from
IPF patients ("IPF") and healthy controls ("Normal") double stained with anti-YYl (brown) and anti-α-SMA (red). Double positive cells are indicated by the arrows. Magnification was as indicated. All experiments were performed at least three times. [0024] Figures 7A-7F show that TGF-β induces YYl protein expression, mRNA levels, and promoter activity in human and mouse lung fibroblasts. Figures 7A and 7B are immunoblots of human WI-38 cells (Figure 7A) and mouse MLg2908 cells (Figure 7B) treated with TGF-β. After serum starvation for 24 hours, cells were treated with 10 ng/ml of TGF-β for the indicated times in serum- free DMEM. Extracts from whole cells were subjected to immunoblot analysis with anti-YYl or anti-β-actin antibody. Figures 7C and 7D are graphs showing the relative fold induction of YY-I mRNA expression, detected by quantitative PCR, in WI-38 cells (Figure 7C) and MLg2908 cells (Figure 7D) treated with TGF-β. Figures 7E and 7F are graphs relating to the YYl promoter activity in YYl -Luc-trans fected WI-38 cells (Figure 7E) and YYl-Luc-transfected MLg2908 cells (Figure 7F) treated with PBS or TGF-β for 24 hours. The full-length YYl promoter-luciferase reporter (YYl-LUC) was transfected into the cells by electroporation. Relative light units (RLU) were measured with a luminometer. Fold changes result from the RLU of stimulated cells divided by the RLU of non- stimulated cells. The data are presented with standard errors derived from at least three independent experiments performed in triplicate. *p < 0.05 and **p < 0.01 by the Student's f-test.
[0025] Figures 8A-8B show that TGF-β induces YYl protein expression and promoter activity in adult human lung fibroblasts. Figure 8A is an immunoblot of whole cell extracts from MRC5 cells treated with TGF-β for 8 hours. Figure 8B is a graph of the relative light units of YYl -Lluc-trans fected MRC5 cells treated with phosphate-buffered saline ("0") or TGF-β ("10") for 24 hours. The data are presented with standard errors derived from at least three independent experiments performed in triplicate. */?<0.05 by the Student's t-test.
[0026] Figures 9A-9F show that TNF-α induces YYl protein expression, mRNA levels, and promoter activity in human and mouse lung fibroblasts. Figures 9A and 9B are immunoblots of human WI-38 cells (Figure 9A) and mouse MLg2908 cells (Figure 9B) treated with TNF-α. After serum starvation for 24 hours, cells were treated with 10 ng/ml of TNF-α for the indicated times in serum-free DMEM. Extracts from whole cells were subjected to immunoblot analysis with anti-YYl or anti-β-actin antibody. Figures 9C and 9D are graphs showing the relative fold induction of YY-I mRNA expression, detected by quantitative PCR, in WI-38 cells (Figure 9C) and MLg2908 cells (Figure 9D) treated with TGF-β. Figures 9E and 9F are graphs relating to the YYl promoter activity in YYl -Luc-trans fected WI-38 cells (Figure 9E) and YYl-Luc-transfected MLg2908 cells (Figure 9F) treated with TNF-α for 8 hours. The full-length YYl promoter-luciferase reporter (YYl-LUC) was transfected into the cells by electroporation. Relative light units (RLU) were measured with a luminometer. Fold changes result from the RLU of stimulated cells divided by the RLU of non- stimulated cells. The data are presented with standard errors derived from at least three independent experiments performed in triplicate. */?<0.05, **p<0.01, and ***/?<0.001 by the Student's t-test. [0027] Figures 1 OA- 1 OB are immunoblots that show that YY 1 protein expression is increased in WI-38 and MLg2908 cells stimulated with silica. After serum starvation for 24 hours, cells were treated with 40 μg/ml of silica for the indicated time periods in serum- free DMEM. Extracts from WI-38 (Figure 10A) or MLg2908 (Figure 10B) cells were immunob lotted with anti-YYl or anti-β-actin antibodies.
[0028] Figure 11 is a western blot of unstimulated ("resting") IC-21 alveolar macrophages or IC-21 cells stimulated with TNF-α (10 ng/ml) or silica (20 μg/ml). After two days, the cells were harvested and YYl expression was determined using anti-YYl and anti-GAPDH antibodies. YYl expression was slightly decreased by TNF-α and silica.
[0029] Figures 12A-12C demonstrate that TGF-β-induced upregulation of
YY-I expression is mediated by NF-κB. Figure 12A is a graph of the relative fold induction of YYl mRNA expression in WI-38 cells trans fected with a wild-type YYl promoter construct ("YYl"). Figure 12B is a graph of the relative fold induction of YYl mRNA expression in WI-38 cells trans fected with a mutant YYl promoter contruct that has a disrupted NF-κB binding site ("mutant YYl"). In both cases, the cells were also transiently co-transfected with a vector control ("pSG5") or 2.5 μg of NF -KB ("p65") plasmid by electroporation, and then treated with PBS or 10 ng/ml of TGF-β for 24 hours. Data are presented with standard errors derived from at least three independent experiments performed in triplicate. ***P<0.001 (untreated pSG5 vs. untreated p65; TGF-β-treated pSG5 vs. TGF-β-treated p65). Figure 12C is an immunoblot of WI-38 cells pre-treated with 5 μM of Bay 11-7085 (an NF-κB inhibitor) for one hour and then treated with 10 ng/ml of TGF-β for the indicated times in serum-free DMEM. Extracts from whole cells were immunoblotted with anti-YYl or anti-β-actin antibody. [0030] Figures 13A-13C show that α-SMA activity is upregulated by YYl . Figure 13A is a graph of α-SMA activity in WI-38 cells transfected with the mouse α- SMA luciferase reporter (α-SMA-Luc). Cells were also transiently transfected by electroporation with control vector ("pSG5") or 2.5 μg of YYl ("YYl") and NF-κB ("p65") (alone or in combination) and then treated with PBS or 10 ng/ml of TGF-β for 24 hours. *p<0.05, **p<0.01. Figure 13B is an electrophoretic mobility shift assay (EMSA) showing YYl binding activity at the α-SMA promoter in nuclear extracts isolated from WI-38 cells. EMSA was performed with a biotin-labeled probe containing a known YYl binding site in the α-SMA promoter. EMSAs with no antibody, control IgG, and YYl antibody were used to confirm the presence of YYl binding complexes. Figure 13C is a graph of α-SMA activity in lung fibroblasts obtained from YY1+/" mice or wide type mice transfected with the mouse α-SMA-Luc by electroporation and then treated with PBS or 10 ng/ml of TGF-β for 24 hours. *p<0.05, *p<0.01. All reporter data were normalized using an empty vector control. RLU data are shown from at least five independent experiments performed in duplicate. [0031] Figures 14A-14C show that YYl expression is greater in γγiCC10 mice than in normal littermate mice. Figure 14A is a series of images of lung fibroblasts isolated from γγiCC10 and wild type ("WT") mice immunostained with α- SMA (green) and YYl (red). All pictures are shown at the original magnification of 2OX or 4OX. Figure 14B is a western blot of lung fibroblasts derived from two individual γγiCC10 mice ("CClO-YYl-I" and "CC 10-YY 1-2") and two wild type mice ("WTl" and "WT2"). Whole-cell lysates were immunoblotted with anti-YYl, anti-collagen 1, anti-α-SMA, and β-actin antibodies. Representative examples obtained from three independent experiments are shown. Figure 14C is a series of light photomicrographs of lung samples from γγiCC10 and wildtype mice ("Littermate") (n=8 mice per group). Immunohistochemistry was used to compare the α-SMA and collagen expression in the control mice and the YYl mice. Pictures are presented at the original magnification (10X), and a 63X micrograph is shown in the upper right-hand corner.
[0032] Figures 15A-15D, show that expression of α-SMA and collagen 1 is diminished, and this decrease is accompanied by diminished YYl expression. Figure 15A is a series of images of lung fibroblasts isolated from YYlf/fmice and then transfected with Cre-GFP vector to knockdown YYl expression. The fibroblasts were then immunostained with anti-α-SMA (red) antibody ("α-SMA"). The pictures illustrate the original magnification at 4OX. Figure 15B is a western blot showing YYl protein expression in primary lung fibroblasts obtained from YYlf/f mice and transfected with Lenti-Cre or pLL37 as a control, at the indicated multiplicities of infection ("MOI"). The cells were blotted with anti-YYl and anti-β-actin antibodies. Figure 15C is a series of images of LL97A cells transduced with one of two control lentivirus vector shRNAs ("Control- 1" and "Control-2") or one of two lentivirus vector YYl shRNAs ("YYl-lenti-shRNA-1" and "YYl-lenti-shRNA-2") for three days. Puromycin was then used to select transduced cells. The selected LL97A cells were immunostained with anti-α-SMA (green) and anti-YYl (red) antibodies, or with anti-collagen I (green) and anti-YYl (red) antibodies. Pictures are presented at the original magnification of 4OX. Figure 15D is a western blot of LL97A cells transduced with the indicated vectors, showing the expression levels of collagen 1 and YYl. Extracts from whole cells were immunoblotted with anti-collagen 1 and anti- YYl antibodies. Representative examples of three independent experiments are shown. [0033] Figures 16A-16D show that the expression of α-SMA and collagen is decreased in YY1+/" and YYlf/f compared to littermate mice. Figure 16A is a series of light photomicrographs of lung sections from silica-treated YY l+/~ or littermate mice evaluated 21 days after silica treatment (n=6 mice per group). H&E staining and immunohistochemistry were used to compare histological features and the expression of α-SMA and collagen in YY1+/" compared to littermate mice. Pictures are presented at their original magnification of 1OX (63X is shown in the right-hand corner). Figure 16B is a graph of the fibrosis grade-score for the lung tissue sections showin in Figure 16A, evaluated by double blind scoring using immunohistochemistry for α-SMA. *p<0.05 by the Student's t-test. Figure 16C is a series of light photomicrographs of lung sections obtained from bleomycin-treated YYlf/f mice (F4) or wild type mice evaluated 21 days after bleomycin treatment (n=4 mice per group). H&E staining and immunohistochemistry were used to compare histological features and the expression of α-SMA and YYl in the YYlf/f mice compared to the wild type control mice. Pictures are shown at their original magnification of 1OX (63X is indicated in the upper right-hand corner). Figure 16D is a graph of the fibrosis grade -score for the lung tissue sections show in Figure 16C, evaluated by double blind scoring using immunohistochemistry for α-SMA. **p<0.01 by the Student's t-test. All experiments were performed at least 2 times. [0034] Figures 17A-17D show that α-SMA and collagen expression is decreased in YY lf/f compared to wildtype mice. C57BL/6 mice (n=5) and YYlf/f (n=5) mice were instilled by silica (200 μg/mouse). 11 days after silica installation, the mice were treated with adenoviral Cre (4x108 pfu) for 21 days. Following treatment, lung sections were harvested for analysis. Figure 17A is a series of light photomicrographs, in which H&E staining and immunohistochemistry were used to compare the histological features and the expression of α-SMA and collagen in YYlf/f compared to WT mice. Pictures are presented at their original magnification of 1OX (63X is shown in the right-hand corner). Figure 17B is a graph of the fibrosis grade- score for the lung tissue sections shown in Figure 17A evaluated by double blind scoring using immunohistochemistry for α-SMA (n=4 mice per group). *p<0.05 by the Student's t-test. Figure 17C is a graph of the relative fold induction of mRNA YYl expression in YYlf/f mice versus wildtype mice, evaluated by quantitative PCR. Figure 17D is a western blot of lung sections obtained from adenoviral Cre- and silica-treated YYlf/fmice ("YYlf/f+ad-cre") and wild type mice ("Wild type+ad-cre") (n=3 per group). Lung sections were ground in liquid nitrogen and part of grinded lung for extraction of RNA or lyses for western blot. [0035] Figure 18 is an immunoblot showing YYI in WI-38 cells that were unstimulated ("Resting") or treated with IL- lβ (10 mg/ml). Immunoblots were performed on Day 1 and Day 2 using anti-YYl and anti-GAPDH antibodies. YYl expression was shown to be upregulated by IL- lβ.
[0036] Figure 19 is a graph of the cytokines present in the bronchoalveolar lavage ("BAL") of wild type and YY1+/" ("HET-YYl") mice. */?<0.05; **/K0.01. [0037] Figure 20 is a graph showing the relative α-SMA promoter activity in
Wl 38 fibroblasts expressing the dominant negative YY-I protein DZ-YYl. DZ-YYl is deficient in the four zinc finger domains of YY-I that mediate its binding to DNA. α-SMA promoter activity in cells dually transfected with the α-SMA promoter luciferase reporter construct (alpha-SMA-luc) and the DZ-YYl construct (DZ-YYl) was attenuated compared to cells transfected with the α-SMA promoter construct alone (control). TGF-β (TGF-beta) induced α-SMA promoter activity was also significantly reduced in cells transfected with the DZ-YYl construct compared to unstimulated control. [0038] Figures 21A-21B are western blots showing the detection of histone-3
(H3) lysine 27 (K27) trimethylation (H3K27me3) in lung tissue samples derived from patients having idiopathic pulmonary fibrosis (IPF) and healthy control individuals (Normal) (Figure 21A), and H3K27 trimethylation in lung tissue samples derived from silica treated (silica-induced fibrosis) and non-treated (non-silica) mice (Figure 21B). β-actin was used a loading control.
[0039] Figure 22 is a western blot showing the time- and dose-related increase in H3K27 trimethylation (H3K27me3) in human lung fibroblasts following silica exposure at the indicated time points, β-action was used as a loading control. [0040] Figure 23 shows H3K27 trimethylation (H3K27me3) in non- transfected lung fibroblasts from YYlf/f mice (non-transfected) or lung fibroblasts from YYlf/f mice transfected (transfected) with a Cre-recombinase-GFP fusion protein (Cre-GFP). Successful transfection is indicated by GFP (green) fluorescence of the Cre-GFP construct. H3K27 trimethylation was detected using an anti-H3K27 antibody and visualized by red fluorescence (H3K27me3). Nuclear staining is shown by Dapi staining. Merged images (Merged) are also shown. Upon transfection of the fibroblasts with cre-recombinase, YY-I expression was knocked down and a decrease in H3K27 methylation was observed compared to the non-transfected fibroblasts. [0041] Figure 24 is a graph showing the relative fold induction of EZH2 mRNA expression in lung tissue derived from patients having idiopathic pulmonary fibrosis (IPF) compared to healthy control individuals (Normal). [0042] Figure 25 is a schematic diagram outlining the in vivo study protocols for investigating the therapeutic potential of DZ-YYl in the prevention and treatment of silica-induced lung fibrosis.
DETAILED DESCRIPTION OF THE INVENTION [0043] The present invention relates to several methods for diagnosing and treating a fibrotic condition in a subject. The subject can be any animal that exhibits fibrotic processes, preferably a mammalian subject. Exemplary mammalian subjects include, without limitation, humans, non-human primates, dogs, cats, rodents {e.g., mouse, rat, guinea pig), horses, cattle and cows, sheep, and pigs. [0044] A fibrotic condition generally refers to the formation or development of excess fibrous connective tissue in an organ or tissue and resulting disorders/diseases. Fibrosis can affect the lungs, heart, kidneys, liver, brain, skin, or any other organ. Fibrotic conditions that can be diagnosed according to the methods of the present invention include, without limitation, acute and chronic forms of pulmonary fibrosis, interstitial lung disease, human fibrotic lung disease, liver fibrosis, cardiac fibrosis, kidney fibrosis, macular degeneration, retinal and vitreal retinopathy, myocardial fibrosis, Grave's ophthalmopathy, drug induced ergotism, cardiovascular disease, atherosclerosis/restenosis, keloids and hypertrophic scars, cancer, Alzheimer's disease, skin fibrosis, scarring, scleroderma, glioblastoma in Li- Fraumeni syndrome, sporadic glioblastoma, myleoid leukemia, acute myelogenous leukemia, myelodysplastic syndrome, myeloproferative syndrome, gynecological cancer, Kaposi's sarcoma, Hansen's disease and inflammatory bowel disease, including collagenous colitis, ocular scarring, and cataracts. [0045] A first aspect of the present invention is directed to a method of diagnosing a fibrotic condition in a subject by measuring the level of trimethylation at lysine residue 27 of histone-3 ("H3K27") in a biological sample from the subject. The level of H3K27 trimethylation is compared to a standard level of trimethylation at lysine residue 27 of histone-3 and the presence or absence of a fibrotic condition is correlated to the results of the comparison.
[0046] Histone 3 is a protein found in association with DNA in the chromation of eukaryote cells. The full-length amino acid sequences of human and mouse histone-3 (H3) proteins are well known in the art (see GenBank Accession Nos. NM 0003493 (human) and NM 030082 (mouse), which are hereby incorporated by reference in their entirety). As shown herein, an increase in H3K27 trimethylation is an indicator of a fibrotic condition.
[0047] H3K27 trimethylation may be determined using any convenient method for detecting amino acid methylation known to one skilled in the art. Generally, protein methylation at a specific residue, in this case K27 of H3, is detected using an antibody or other binding molecule which recognizes and binds to a methylated K27 residue. In a preferred embodiment, the antibody or other binding molecule recognizes and binds to trimethylated K27 but not an unmethylated, mono- methylated, or di-methylated H3K27 residue. Antibodies specific for trimethylated H3K27 are readily known in the art and are commercially available from, e.g., Santa Cruz Biotechnology, Santa Cruz, CA, and Millipore, Billerica, MA. Alternatively, antibodies selective for binding to the trimethylated H3K27 residue can be obtained by any standard technique for generating antibodies. [0048] Procedures for raising polyclonal antibodies are well known in the art. Typically, such antibodies can be raised by administering a peptide containing the epitope of interest, i.e., an H3 peptide trimethylated at residue K27, subcutaneously to New Zealand white rabbits which have first been bled to obtain pre -immune serum. The antigens can be injected at a total volume of 100 μl per site at six different sites. Injected material will contain synthetic surfactant adjuvant pluronic polyols, or pulverized acrylamide gel containing the protein or polypeptide after SDS- polyacrylamide gel electrophoresis. The rabbits are bled approximately every two weeks after the first injection and periodically boosted with the same antigen three times every six weeks. A sample of serum is collected 10 days after each boost and polyclonal antibodies are recovered by affinity chromatography using the corresponding antigen to capture the antibody. This and other procedures for raising polyclonal antibodies are disclosed in ANTIBODIES: A LABORATORY MANUAL (Harlow et al. eds., 1988), which is hereby incorporated by reference in its entirety. [0049] A monoclonal antibody is obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler et al., "Continuous Cultures of Fused Cells Secreting Antibody of Predefined Specificity," Nature 256:495-7 (1975), and ANTIBODIES: A LABORATORY MANUAL (Harlow et al. eds., 1988), which are hereby incorporated by reference in their entirety. In a hybridoma method, a mouse or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro. In accordance with the present invention, the immunizing agent comprises a H3 peptide sequence containing a trimethylated K27 residue. [0050] The antibody producing cells are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form hybridoma cells, which are cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells. This and other procedures for producing monoclonal antibodies are disclosed in GoDiNG, MONOCLONAL ANTIBODIES: PRINCIPLES AND PRACTICE 59-103 (1986), Kozbor et al., "A Human Hybrid Myeoloma for Production of Human Monoclonal Antibodies," J. Immunol. 133:3001-05 (1984), and MONOCLONAL ANTIBODY PRODUCTION TECHNIQUES AND APPLICATIONS 51-63 (L.B. Shook ed., 1987), which are hereby incorporated by reference in their entirety. [0051] Detection of H3K27 trimethylation using an antibody or other protein binding molecule selective for binding to the trimethylated K27 residue of H3 can be carried out using any suitable hybridization assay. Suitable hybridization assays include, but are not limited to, enzyme-linked immunosorbent assay (ELISA), dot blot, western blot, chromatin immunoprecipitation (ChIP), ChiP/microarray analysis (see U.S. Patent Application Publication NO. 20070292857 to Rama et al, which is hereby incorporated by reference in its entirety), immunocytochemistry, and immunohistochemistry. [0052] Other binding molecules that can be used for selective binding to trimethylated H3K27 include, without limitation, antibody fragments, antibody mimics, and nucleic acid aptamers.
[0053] A number of antibody mimics are known in the art including, without limitation, those known as monobodies, which are derived from the tenth human fibronectin type III domain (10Fn3) (Koide et al., "The Fibronectin Type III Domain as a Scaffold for Novel Binding Proteins," J. MoI. Biol. 284:1141-1151 (1998); Koide et al., "Probing Protein Conformational Changes in Living Cells by Using Designer Binding Proteins: Application to the Estrogen Receptor," Proc. Nat 'I Acad. Sci. USA 99:1253-1258 (2002), each of which is hereby incorporated by reference in its entirety); and those known as affϊbodies, which are derived from the stable α-helical bacterial receptor domain Z of staphylococcal protein A (Nord et al., "Binding Proteins Selected from Combinatorial Libraries of an α-Helical Bacterial Receptor Domain," Nat. Biotechnol. 15(8):772-777 (1997), which is hereby incorporated by reference in its entirety). Variations in these antibody mimics can be created by substituting one or more domains of these polypeptides and then screening the modified monobodies or affibodies for specificity for binding to trimethylated H3K27.
[0054] Other suitable binding molecules that can be used for detection of trimethylated H3K27 include aptamers that specifically bind to trimethylated H3K27. This is intended to encompass aptamers that, from a structural perspective, are not necessarily considered antibody mimics. Aptamers are single-stranded, partially single-stranded, partially double-stranded, or double-stranded nucleotide sequences, advantageously a replicatable nucleotide sequence, capable of specifically recognizing a selected non-oligonucleotide molecule or group of molecules by a mechanism other than Watson-Crick base pairing or triplex formation. Aptamers include, without limitation, defined sequence segments and sequences comprising nucleotides, ribonucleotides, deoxyribonucleotides, nucleotide analogs, modified nucleotides, and nucleotides comprising backbone modifications, branchpoints, and non-nucleotide residues, groups, or bridges. Aptamers include partially and fully single-stranded and double-stranded nucleotide molecules and sequences; synthetic RNA, DNA, and chimeric nucleotides; hybrids; duplexes; heteroduplexes; and any ribonucleotide, deoxyribonucleotide, or chimeric counterpart thereof and/or corresponding complementary sequence, promoter, or primer-annealing sequence needed to amplify, transcribe, or replicate all or part of the aptamer molecule or sequence.
[0055] Alternatively, H3K27 trimethylation can be detected using any other means for detecting protein or peptide modifications that are known in the art, including, but not limited to, two-dimensional gel electrophoresis, mass spectroscopy, matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF), surface- enhanced laser desorption ionization-time of flight (SELDI-TOF), high performance liquid chromatography (HPLC), fast protein liquid chromatography (FPLC), and multidimensional liquid chromatography (LC) followed by tandem mass spectrometry (MS/MS).
[0056] In accordance with this aspect of the present invention, the level of
H3K27 trimethylation in a sample obtained from a subject is compared to a standard level of H3K27 trimethylation. [0057] In one embodiment of the present invention, the standard level of
H3K27 trimethylation is the average level of H3K27 trimethylation in one or more normal or non-fibrotic samples, or a range of values that are consistent with the average level of H3K27 trimethylation in normal or non-fibrotic tissue. A non- fibrotic sample can be a sample that was taken from the subject being diagnosed prior to the onset of the potential fibrotic condition or a sample from one or more non- fibrotic tissues of the subject. A non-fibrotic sample can also be derived from another subject (other than the subject being diagnosed) who does not have fibrosis. According to this embodiment, a higher level of H3K27 trimethylation in the sample from the subject being diagnosed compared to the standard level of H3K27 trimethylation indicates the presence of a fibrotic condition. A similar or lower level of H3K27 trimethylation in the sample from the subject compared to the standard level of H3K27 trimethylation indicates the absence of a fibrotic condition. [0058] In another embodiment, the standard level of H3K27 trimethylation is the average level of H3K27 trimethylation in one or more known fibrotic samples or a range of values that are consistent with the level of H3K27 trimethylation in a fibrotic condition. Accordingly, a lower level of H3K27 trimethylation in the sample from the subject being diagnosed compared to the standard level of H3K27 trimethylation indicates the absence of a fibrotic condition. A similar or higher level of H3K27 trimethylation in the sample from the subject being diagnosed compared to the standard level of H3K27 trimethylation indicates the presence of a fibrotic condition. [0059] This aspect of the present invention may also be used to determine a subject's predisposition to developing a fibrotic condition. This involves comparing the level of H3K27 trimethylation in a biological sample from the subject to a standard level of H3K27 trimethylation in a non- fibrotic tissue or cell sample and to a standard level of H3K27 trimethylation in a fibrotic tissue or cell sample. If the level of H3K27 trimethylation in the sample from the subject is higher than the standard level of H3K27 trimethylation in a non- fibrotic sample, but lower than the standard level of H3K27 trimethylation in a fibrotic sample, the subject may have a predisposition to developing a fibrotic condition. Monitoring changes in H3K27 trimethylation in a subject over time to track development of, or recovery from, a fibrotic condition is also contemplated by the present invention. [0060] A second aspect of the present invention is directed to a method of diagnosing a fibrotic condition in a subject by measuring the expression level of Enhancer of Zeste Homolog 2 ("EZH2") or Yin-Yang- 1 ("YY-I") in a biological sample from the subject. The expression level of EZH2 or YY-I in the biological sample is compared to a standard expression level of EZH2 or YY-I and the presence or absence of a fibrotic condition is correlated to the results of the comparison.
[0061] YY-I is known to play an important role in the regulation of tumor cell resistance to Fas-induced apoptosis. Increased YY-I expression represses Fas expression and decreases apoptosis. Blocked NF -KB and p38 decrease YY-I expression and activate Fas expression (Huerta-Yepez et al., "Involvement of the TNF-α Autocrine-Paracrine Loop, via NF-κB and YYl, in the Regulation of Tumor Cell Resistance to Fas-induced Apoptosis," Clin. Immunol. 120(3):297-309 (2006); Vega et al., "Rituximab (Chimeric Anti-CD20) Sensitizes B-NHL Cell Lines to Fas- induced Apoptosis," Oncogene 24(55):8114-27 (2005); Lei et al, "p38 MAPK- dependent and YYl -mediated Chemokine Receptors CCR5 and CXCR4 Up- regulation in U937 Cell Line Infected by Mycobacterium tuberculosis or Actinobacillus actinomycetemcomitans," Biochem. Biophys. Res. Commun. 329(2):610-15 (2005), which are hereby incorporated by reference in their entirety). YY-I and activator protein 1 work synergistically in the activation of the tumor suppressor HLJl (Wang et al., "Synergistic Activation of the Tumor Suppressor, HLJl, by the Transcription Factors YYl and Activator Protein 1," Cancer Res. 67(10):4816-26 (2007), which is hereby incorporated by reference in its entirety). Interestingly, YYl can bind to type I and II collagen (COL 1 and COL 2) promoters and positively activate these genes in fibroblasts (Riquet et al., "YYl Is a Positive Regulator of Transcription of the Collal Gene," J. Biol. Chem. 276(42):38665-72 (2001); Miao et al., "Identification of Two Repressor Elements in the Mouse Alpha 2(1) Collagen Promoter," Arch. Biochem. Biophys. 361(1):7-16 (1999), which are hereby incorporated by reference in their entirety). YYl also enhances cyclooxygenase-2 (CoX-2) expression in macrophages (Joo et al., "Yin Yang 1 Enhances Cyclooxygenase-2 Gene Expression in Macrophages," Am. J. Physiol. Lung Cell MoI. Physiol. 292(5):L1219-L1226 (2007), which is hereby incorporated by reference in its entirety). [0062] EZH2 is a member of the Polycomb Group (PcG) of genes that is important for differentiation and cell cycle regulation and is aberrantly expressed in several cancers. The EZH2 protein endows the Polycomb complexes, PRC2 and PR3, with histone lysine methyltransferase activity that is associated with gene transcriptional repression (Caretti et al., "The Polycomb EZH2 Methyltransferase Regulates Muscle Gene Expression and Skeletal Muscle Differentiation," Genes
Devel. 18:2627-38 (2004), which is hereby incorporated by reference in its entirety). [0063] In accordance with this aspect of the present invention, the expression level of EZH2 or YY-I in a sample obtained from a subject is compared to a standard expression level of EZH2 or YY-I. [0064] In one embodiment of the present invention, the standard expression level of EZH2 or YY-I is the average expression level of EZH2 or YY-I in one or more non-fibrotic samples or a range of values that is consistent with the expression levels of EZH2 or YY-I in normal or non-fϊbrotic tissue. A non-fϊbrotic sample can be a sample taken from the subject to be diagnosed prior to the onset of the potential fibrotic condition or from one or more non-fibrotic tissues of the subject. A non- fibrotic sample can also be derived from another subject (other than the subject being diagnosed) who does not have fibrosis. According to this embodiment, a higher expression level of EZH2 or YY-I in the sample from the subject to be diagnosed compared to the standard expression level of EZH2 or YY-I indicates the presence of a fibrotic condition. A similar or lower expression level of EZH2 or YY-I in the sample from the subject compared to the standard expression level of EZH2 or YY-I indicates the absence of a fibrotic condition.
[0065] In another embodiment, the standard expression level of EZH2 or YY-
1 is the average expression level of EZH2 or YY-I in one or more known fibrotic samples or a range of values that is consistent with the expression level of EZH2 or YY-I in a fibrotic condition. Accordingly, a lower expression level of EZH2 or YY-I in the sample from the subject to be diagnosed compared to the standard expression level of EZH2 or YY-I indicates the absence of a fibrotic condition. A similar or higher expression level of EZH2 or YY-I in the sample from the subject compared to the standard expression level of EZH2 or YY-I indicates the presence of a fibrotic condition. [0066] This aspect of the present invention may also be used to determine a subject's predisposition to developing a fibrotic condition. This involves comparing the level of EZH2 or YY-I expression in a biological sample from the subject to a standard level of EZH2 or YY-I expression in a non-fibrotic tissue or cell sample and to a standard level of EZH2 or YY-I expression in a fibrotic tissue or cell sample. If the level of EZH2 or YY-I expression in the sample from the subject is higher than the standard level of EZH2 or YY-I expression in a non-fibrotic sample, but lower than the standard level of EZH2 or YY-I expression in a fibrotic sample, the subject may have a predisposition to developing a fibrotic condition. Monitoring changes in EZH2 and/or YY-I expression in a subject over time to track development of, or recovery from, a fibrotic condition is also contemplated by the present invention.
[0067] As described herein, detecting the "expression level" of EZH2 or YY-I can be achieved by measuring any suitable value that is representative of gene expression level. The measurement of gene expression levels can be direct or indirect. A direct measurement involves measuring the level or quantity of RNA or protein. An indirect measurement may involve measuring the level or quantity of cDNA, or amplified RNA, DNA, or protein; the activity level of RNA or protein; or the level or activity of other molecules (e.g., a metabolite) that are indicative of the foregoing. The measurement of expression can be a measurement of the absolute quantity of a gene product. The measurement can also be a value representative of the absolute or relative quantity, i.e., a normalized value (e.g., a quantity of gene product normalized against the quantity of a reference gene product), an averaged value (e.g. , average quantity obtained at different time points or from different tumor cell samples from a subject, or average quantity obtained using different probes, etc.), or a combination of both.
[0068] In a preferred embodiment of the present invention, the expression level of EZH2 or YY-I is measured by measuring the RNA expression level of EZH2 or YY-I . Methods for isolation and purification of nucleic acids suitable for measuring RNA expression levels in accordance with the methods of the present invention are described in detail in LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY: HYBRIDIZATION WITH NUCLEIC ACID PROBES, PART I. THEORY AND NUCLEIC ACID PREPARATION (P. Tijssen ed., 1993) which is hereby incorporated by reference in its entirety. Total RNA can be isolated from a given sample using, for example, an acid guanidinium-phenol-chloroform extraction, a guanidinium isothiocyanate-ultracentrifugation method, or a lithium chloride-SDS-urea method, and polyA+ mRNA can be isolated using oligo(dT) column chromatography or (dT)n magnetic beads (see, e.g., JOSEPH SAMBROOK et al, 1-3 MOLECULAR CLONING: A LABORATORY MANUAL (2d ed. 1989); 1-4 CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Fred M. Ausubel et al. eds., 1994), which are hereby incorporated by reference in their entirety). See also WO/2000024939 to Dong et al., which is hereby incorporated by reference in its entirety, for complexity management and other nucleic acid sample preparation techniques. [0069] It may be desirable to amplify the nucleic acid sample prior to detecting gene expression. Typically, methods for amplifying nucleic acids employ a polymerase chain reaction (PCR) (see e.g., PCR TECHNOLOGY: PRINCIPLES AND APPLICATIONS FOR DNA AMPLIFICATION (Erlich ed., 1992); PCR PROTOCOLS: A GUIDE TO METHODS AND APPLICATIONS (Innis et al. eds., 1990); Mattila et al, "Fidelity of DNA Synthesis by the Thermococcus litoralis DNA Polymerase — An Extremely Heat Stable Enzyme with Proofreading Activity," Nucleic Acids Res. 19:4967-73 (1991); Eckert et al., "DNA Polymerase Fidelity and the Polymerase Chain Reaction," PCR Meth. Applic. 1 : 17-24 (1991); MICHAEL MCPHERSON & SIMON MOLLER, PCR (THE BASICS) (2d. ed. 2006); U.S. Patent No. 4,683,202 to Mullis et al.; U.S. Patent No. 4,683,195 to Mullis et al.; U.S. Patent No. 4,800,159 to Mullis et al.; U.S. Patent No. 4,965,188 to Mullis et al.; U.S. Patent No. 5,333,675 to Mullis et al., which are hereby incorporated by reference in their entirety). The sample may also be amplified on an array as described in U.S. Patent No. 6,300,070 to Boles, which is incorporated herein by reference in its entirety. [0070] Other suitable amplification methods include the ligase chain reaction
(LCR) {e.g., Wu et al., "The Ligation Amplification Reaction (LAR) — Amplification of Specific DNA Sequences Using Sequential Rounds of Template-Dependent Ligation," Genomics 4:560-9 (1989); Landegren et al., "A Ligase-Mediated Gene Detection Technique," Science 241 :1077-80 (1988); Barringer et al., "Blunt-End and Single-Strand Ligations by Escherichia coli Ligase: Influence on an In vitro Amplification Scheme," Gene 89:117-22 (1990), which are hereby incorporated by reference in their entirety); transcription amplification (Kwoh et al., "Transcription- Based Amplification System and Detection of Amplified Human Immunodeficiency Virus Type 1 with a Bead-Based Sandwich Hybridization Format," Proc. Nat 'I Acad. ScL USA 86:1173-77 (1989); International Patent Publication No. WO88/10315 to Gingeras, which are hereby incorporated by reference in their entirety); self-sustained sequence replication (Guatelli et al., "Isothermal, In vitro Amplification of Nucleic
Acids by a Multienzyme Reaction Modeled After Retroviral Replication," Proc. Nat 'I Acad. Sci. USA 87:1874-78 (1990); International Patent Publication No. WO90/06995 to Gingeras, which are hereby incorporated by reference in their entirety); selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276 to Burg et al, which is hereby incorporated by reference in its entirety); consensus sequence primed polymerase chain reaction (CP-PCR) (U.S. Patent No.5,437,975 to McClelland, which is hereby incorporated by reference in its entirety); arbitrarily primed polymerase chain reaction (AP-PCR) (U.S. Patent No. 5,413,909 to Bassam; U.S. Patent No. 5,861,245 to McClelland, which are hereby incorporated by reference in their entirety); and nucleic acid based sequence amplification (NABSA) (see U.S. Patent No. 5,409,818 to Davey; U.S. Patent No.5,554,517 to Davey; U.S. Patent No.6,063, 603 to Davey, which are hereby incorporated by reference in their entirety). Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794 to Whiteley; 5,494,810 to Barany; and 4,988,617 to Landegren, which are hereby incorporated by reference in their entirety. [0071] Measuring gene expression by quantifying mRNA expression can be achieved using any method known in the art including northern blotting and in situ hybridization (Parker et al., "mRNA: Detection by In Situ and Northern Hybridization," Meth. MoI. Biol. 106:247-283 (1999), which is hereby incorporated by reference in its entirety); RNAse protection assay (Hod et al., "A Simplified Ribonuclease Protection Assay," Biotechniques 13:852-854 (1992), which is hereby incorporated by reference in its entirety); reverse transcription polymerase chain reaction (RT-PCR) (Weis et al., "Detection of Rare mRNAs via Quantitative RT- PCR," Trends Genet. 8:263-264 (1992), which is hereby incorporated by reference in its entirety), and serial analysis of gene expression (SAGE) (e.g., Velculescu et al., "Serial Analysis of Gene Expression," Science 270:484-487 (1995); Velculescu et al., "Characterization of the Yeast Transcriptome," Cell 88:243-51 (1997), which are hereby incorporated by reference in their entirety). Alternatively, antibodies may be employed that recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. [0072] In a preferred embodiment of the present invention, mRNA expression is measured using a nucleic acid amplification assay that is a semi-quantitative or quantitative real-time polymerase chain reaction (RT-PCR) assay. Because RNA cannot serve as a template for PCR, the first step in gene expression profiling by RT- PCR is the reverse transcription of the RNA template into cDNA, followed by its exponential amplification and detection in a PCR reaction. The two most commonly used reverse transcriptases are avilo myeloblastosis virus reverse transcriptase (AMV- RT) and Moloney murine leukemia virus reverse transcriptase (MLV-RT), although others are also known and suitable for this purpose. The reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling. For example, extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, Calif, USA), following the manufacturer's instructions. The derived cDNA can then be used as a template in the subsequent PCR reaction.
[0073] Although the PCR step can use a variety of thermostable DNA- dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5 '-3' nuclease activity but lacks a 3 '-5' proofreading endonuclease activity. TaqMan® PCR typically utilizes the 5'-nuclease activity of Taq or Tth polymerase to hydro lyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used. TaqMan® PCR further involves the use of two oligonucleotide primers to generate an amplicon typical of a PCR reaction. A third oligonucleotide, or probe, is designed to detect the nucleotide sequence located between the two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data. [0074] TaqMan® PCR can be performed using commercially available equipment, such as, for example, the ABI PRISM 7700® Sequence Detection System® (Perkin-Elmer- Applied Biosystems, Foster City, Calif, USA) or the Lightcycler (Roche Molecular Biochemicals, Mannheim, Germany).
[0075] TaqMan® PCR is one of many quantitative PCR systems known and available in the art. Other quantitative methods and reagents for real-time PCR detection that are known in the art (e.g. SYBR green, Molecular Beacons, Scorpion Probes, etc) are also suitable for use in the methods of the present invention. [0076] To minimize errors and the effect of sample-to-sample variation, RT-
PCR is usually performed using an internal standard. The ideal internal standard is expressed at a constant level among different tissues, and is unaffected by the experimental treatment or disease. RNAs most frequently used to normalize patterns of gene expression are mRNAs for the housekeeping genes glyceraldehyde-3- phosphate-dehydrogenase (GAPDH) and β-actin.
[0077] Real time PCR is compatible both with quantitative competitive PCR, where an internal competitor for each target sequence is used for normalization and quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR. For further details see, e.g., Heid et al., "Real Time Quantitative PCR," Gen. Res. 6:986-94 (1996), which is incorporated by reference in its entirety.
[0078] When it is desirable to analyze a large quantity of samples for EZH2 and YY-I expression levels in a high-throughput manner, or when it is desirable to measure the expression levels of other genes in addition to EZH2 and YY-I, an array- based technique can be employed. These arrays, also commonly referred to as "microarrays" or "chips," have been generally described in the art {e.g., U.S. Patent No. 5,143,854 to Pirrung et al.; U.S. Patent No. 5,445,934 to Fodor et al.; U.S. Patent No. 5,744,305 to Fodor et al.; U.S. Patent No. 5,677,195 to Winkler et al.; U.S. Patent No. 6,040,193 to Winkler et al.; U.S. Patent No. 5,424,186 to Fodor et al., which are all hereby incorporated by reference in their entirety). A microarray comprises an assembly of distinct polynucleotide or oligonucleotide probes immobilized at defined positions on a substrate. Arrays are formed on substrates fabricated with materials such as paper, glass, plastic {e.g., polypropylene, nylon), polyacrylamide, nitrocellulose, silicon, optical fiber or any other suitable solid or semi-solid support, and configured in a planar {e.g., glass plates, silicon chips) or three-dimensional {e.g., pins, fibers, beads, particles, microtiter wells, capillaries) configuration. Probes forming the arrays may be attached to the substrate by any number of ways including (i) in situ synthesis {e.g., high-density oligonucleotide arrays) using photolithographic techniques (Fodor et al., "Light-directed, Spatially Addressable Parallel Chemical Synthesis," Science 251 :767-773 (1991); Pease et al., "Light-generated Oligonucleotide Arrays for Rapid DNA Sequence Analysis," Proc. Nat 'I Acad. Sci. U.S.A. 91 :5022-5026 (1994); Lockhart et al, "Expression Monitoring by Hybridization to High-Density Oligonucleotide Arrays," Nat. Biotechnol. 14:1675 (1996); U.S. Patent No. 5,578,832 to Trulson; U.S. Patent No. 5,556,752 to Lockhart; U.S. Patent No. 5,510,270 to Fodor, which are hereby incorporated by reference in their entirety); (ii) spotting/printing at medium to low-density {e.g., cDNA probes) on glass, nylon or nitrocellulose (Schena et al., "Quantitative Monitoring of Gene Expression Patterns with a Complementary DNA Microarray," Science 21QΑ61-A1Q (1995); DeRisi et al., "Use of a cDNA Microarray to Analyze Gene Expression Patterns in Human Cancer," Nat. Genet. 14:457-460 (1996); Shalon et al., "A DNA Microarray System for Analyzing Complex DNA Samples Using Two-Color
Fluorescent Probe Hybridization," Gen. Res. 6:639-645 (1996); Schena et al., "Proc. Nat'lAcad. ScL U.S.A. 93:10539-11286) (1995), which are hereby incorporated by reference in their entirety); (iii) masking (Maskos et al., "Oligonucleotide Hybridizations on Glass Supports: A Novel Linker for Oligonucleotide Synthesis and Hybridization Properties of Oligonucleotides Synthesized In Situ," Nucl. Acids. Res. 20:1679-1684 (1992), which is hereby incorporated by reference in its entirety); and (iv) dot-blotting on a nylon or nitrocellulose hybridization membrane {e.g., JOSEPH SAMBROOK et al., 1-3 MOLECULAR CLONING: A LABORATORY MANUAL (2d ed. 1989), which is hereby incorporated by reference in its entirety). Probes may also be non-covalently immobilized on the substrate by hybridization to anchors, by means of magnetic beads, or in a fluid phase such as in microtiter wells or capillaries. The probe molecules are generally nucleic acids such as DNA, RNA, PNA, and cDNA, but may also include proteins, polypeptides, oligosaccharides, cells, tissues, and any permutations thereof which can specifically bind the target molecules. [0079] Fluorescently labeled cDNA for hybridization to the array may be generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from the fibrotic tissue of interest. Labeled cDNA applied to the array hybridizes with specificity to each nucleic acid probe spotted on the array. After stringent washing to remove non-specifically bound cDNA, the array is scanned by confocal laser microscopy or by another detection method, such as a CCD camera. Quantitation of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance. With dual color fluorescence, separately labeled cDNA samples generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously.
[0080] Other nucleic acid detection protocols can also be employed, including (without limitation) those described in U.S. Patent Application Serial Nos. 10/847,233 and 11/337,905 to Rothberg et al., which are hereby incorporated by reference in their entirety; arrayed imaging reflectometry ("AIR") (U.S. Patent No. 7,292,349 to Miller et al., which is hereby incorporated by reference in its entirety); Brewster angle straddle interferometry (BASI) (U.S. Patent Publication No. 2007/0076214, which is hereby incorporated by reference in its entirety); imaging ellipsometry (U.S. Patent No. 5,076,696 to Cohn et al.; U.S. Patent No. 6,594,011 to Kempen, which are hereby incorporated by reference in their entirety); and surface plasmon resonance ellipsometry ("SPR") (U.S. Patent No. 7,332,239 to Wark et al., which is hereby incorporated by reference in its entirety). [0081] In another embodiment of the present invention, the expression levels of EZH2 or YY-I is measured by measuring the level of protein expression. Measuring the protein expression levels of EZHl or YY-I can be achieved using any standard protein immunodetection assay known in the art. [0082] Protein preparation for analysis of protein expression level is carried out using any method that produces analyzable protein. For example, the sample cells or tissue can be lysed in a protein lysis buffer (e.g., 50 mM Tris-HCl (pH, 6.8), 100 mM DTT, 100 μg/ml PMSF, 2% SDS, 10% glycerol, 1 μg /ml each of pepstatin A, leupeptin, and aprotinin, and ImM sodium ortho vanadate) and sheared with a 22- gauge needle. Other methods of protein isolation that are suitable for use in carrying out the methods of the present invention are fully described in C. DENNISON, A GUIDE TO PROTEIN ISOLATION (2d ed. 2003), which is hereby incorporated by reference in its entirety. The protein content of the samples can be estimated using the Lowry, Bradford, or bicinchoninic acid assays, or any commercially available assay based on the aforementioned techniques. [0083] In a preferred embodiment of the present invention, a protein immunodetection assay using an antibody or other agent that selectively binds to EZH2 of YY-I is employed to detect EZH2 or YY-I protein expression in a sample. For example, the level of protein expression can be measured using methods that include, but are not limited to, western blot, immunoprecipitation, ELISA, radioimmunoassay (RIA), and fluorescent activated cell sorting (FACS), or a combination thereof. Also, antibodies, aptamers, or other ligands that specifically bind to a protein can be affixed to so-called "protein chips" (protein microarrays) and used to measure the level of expression of a protein in a sample. Immunofluorescence techniques can be used to visually assess the expression level of a protein in a sample. Immunofluorescence techniques involve the utilization of antibodies that specifically bind to a protein and are visualized to indirectly detect the presence of a protein in a sample. Alternatively, assessing the level of protein expression can involve analyzing one or more proteins by two-dimensional gel electrophoresis, mass spectroscopy, MALDI-TOF, surface-enhanced laser desorption ionization-time of flight (SELDI- TOF), high performance liquid chromatography (HPLC), fast protein liquid chromatography (FPLC), multidimensional liquid chromatography (LC) followed by tandem mass spectrometry (MS/MS), protein chip expression analysis, gene chip expression analysis, and laser densitometry, or any combinations of these techniques. [0084] Another aspect of the present invention is directed to a method of treating a subject having a fibrotic condition. This method involves administering to the subject an agent that inhibits or reduces H3K27 trimethylation under conditions effective to treat a fibrotic condition in the subject.
[0085] In a preferred embodiment of this aspect of the present invention, a subject having a fibrotic condition is selected prior to administering an agent that inhibits or reduces H3K27 trimethylation. Subjects who are suitable for receiving treatment in accordance with this aspect of the present invention are those suffering from a fibrotic condition affecting the lungs, heart, kidney, liver, brain, skin, or any fibrosis related disease, including, but not limited to, those described above. In a preferred embodiment the fibrotic condition is lung or pulmonary fibrosis (e.g. , idiopathic pulmonary fibrosis). [0086] In another embodiment of this aspect of the present invention, administering the agent that inhibits or reduces H3K27 trimethylation is repeated one or more times as needed to alleviate the fibrotic condition. [0087] Agents suitable for treating a subject having a fibrotic condition include those agents that inhibit or reduce H3K27 methylation. Exemplary agents include histone lysine demethylases, such as those of the human jumonji C (JmjC)- domain-containing-3 family of histone demethylases. Preferably, the histone lysine demethylase is (a) jumonji domain containing-3 (JMJD3) or (b) ubiquitously transcribed tetratricopeptide repeat, X chromosome (UTX) demethylase. [0088] In another embodiment of this aspect of the present invention, agents suitable for treating a subject having a fibrotic condition are agents that inhibit EZH2 expression or activity or agents that inhibit YY-I expression or activity. Therapeutic agents that inhibit EZH2 or YY-I expression include nucleic acids, proteins or peptides, and small molecule inhibitors.
[0089] Suitable nucleic acid molecule inhibitors of EZH2 and YY-I include antisense RNAs or RNAi, such as short interfering RNAs (siRNA), short hairpin RNAs (shRNA), and microRNAs. [0090] The use of antisense methods to inhibit the in vivo translation of genes is well known in the art (e.g., U.S. Patent No. 7,425,544 to Dobie et al; U.S. Patent No. 7,307,069 to Karras et al.; U.S. Patent No. 7,288,530 to Bennett et al.; U.S. Patent No. 7,1791796 to Cowsert et al., which are hereby incorporated by reference in their entirety). Antisense nucleic acids are nucleic acid molecules (e.g., molecules containing DNA nucleotides, RNA nucleotides, or modifications (e.g., modification that increase the stability of the molecule, such as 2'-O-alkyl (e.g., methyl) substituted nucleotides) or combinations thereof) that are complementary to, or that hybridize to, at least a portion of a specific nucleic acid molecule, such as an RNA molecule (e.g., an mRNA molecule) (e.g., Weintraub, H. M., "Antisense DNA and RNA," Scientific Am. 262:40-46 (1990), which is hereby incorporated by reference in its entirety). The antisense nucleic acids hybridize to corresponding nucleic acids, such as mRNAs, to form a double-stranded molecule, which interferes with translation of the mRNA, as the cell will not translate a double-stranded mRNA. Antisense nucleic acids used in the invention are typically at least 10-12 nucleotides in length, for example, at least 15, 20, 25, 50, 75, or 100 nucleotides in length. The antisense nucleic acid can also be as long as the target nucleic acid with which it is intended to form an inhibitory duplex. Antisense molecules directed to YY-I and EZH2, which are known in the art, are particularly suited for use in the methods of the present invention (Kwon et al., "Yin Yang-1, A Vertebrate Polycomb Group Gene, Regulates Antero-Posterior Neural Patterning," Biochem. Biophys. Res. Comm. 306(4)1008-1013 (2003); Varambally et al., "The Polycomb Group Protein EZH2 is Involved in Progression of Prostate Cancer," Nature 419:624-629 (2002), which are hereby incorporated by reference in their entirety). Antisense nucleic acids can be introduced into cells as antisense oligonucleotides, or can be produced in a cell in which a nucleic acid encoding the antisense nucleic acid has been introduced, for example, using gene therapy methods. [0091] siRNAs are double stranded synthetic RNA molecules approximately
20-25 nucleotides in length with short 2-3 nucleotide 3' overhangs on both ends. The double stranded siRNA molecule represents the sense and anti-sense strand of a portion of the target mRNA molecule, in this case a portion of the EZH2 or YY-I mRNA sequence. siRNA molecules are typically designed to target a region of the mRNA target approximately 50-100 nucleotides downstream from the start codon. Upon introduction into a cell, the siRNA complex triggers the endogenous RNA interference (RNAi) pathway, resulting in the cleavage and degradation of the target mRNA molecule. A number of siRNA molecules directed to interfering with EZH2 expression are known in the art (e.g., U.S. Patent Publication No. 2005/0159382, which is hereby incorporated by reference in its entirety) and are suitable for use in the present invention. In addition, various improvements of siRNA compositions, such as the incorporation of modified nucleosides or motifs into one or both strands of the siRNA molecule to enhance stability, specificity, and efficacy, have been described and are suitable for use in accordance with this aspect of the invention (International Patent Publication No. WO 2004/015107 to Giese et al.; International Patent Publication No. WO 2003/070918 to McSwiggen et al.; International Patent Publication No. WO 1998/39352 to Imanishi et al.; U.S. Patent Application Publication No. 2002/0068708 to Jesper et al.; U.S. Patent Application Publication No. 2002/0147332 to Kaneko et al; U.S. Patent Application Publication No. 2008/0119427 to Bhat et al., which are hereby incorporated by reference in their entirety). [0092] Short or small hairpin RNA molecules are similar to siRNA molecules in function, but comprise longer RNA sequences that make a tight hairpin turn. Like siRNA, they silence gene expression via the cellular RNA interference pathway. shRNA is cleaved by cellular machinery into siRNA. Suitable shRNA molecules for inhibiting YY-I expression that can be used in accordance with the methods of the present invention include, without limitation:
CGACGGTTGTAATAAGAAGTTCTCGAGAACTTCTTATTACAACCGTCG
(SEQ ID NO :1),
CCCTAAGCAACTGGCAGAATTCTCGAGAATTCTGCCAGTTGCTTAGGG (SEQ ID NO:2),
GTGGTTGAAGAGCAGATCATTCTCGAGAATGATCTGCTCTTCAACCAC
(SEQ ID NO:3),
CACATCTTAACACACGCTAAACTCGAGTTTAGCGTGTGTTAAGATGTG
(SEQ ID NO:4), GCCCTCATAAAGGCTGCACAACTCGAGTTGTGCAGCCTTTATGAGGGC
(SEQ ID NO:5),
CCCTCCTGATTATTCAGAATATTAGTGAAGCCACAGATGTA
ATATTCTGAATAATCAGGAGGT (SEQ ID NO:6),
CCGGGCCCTCATAAAGGCTGCACAACTCGAGTTGTGCAGCCTTTATGAGG GCTTTTTG (SEQ ID NO:23) (sense),
CAAAAAGCCCTCATAAAGGCTGCACAACTCGAGTTGTGCAGCCTTTATGA
GGGCCCGG (SEQ ID NO:24) (antisense),
CCGGGTGGTTGAAGAGCAGATCATTCTCGAGAATGATCTGCTCTTCAACC
ACTTTTTG (SEQ ID NO:25) (sense), and CAAAAAGTGGTTGAAGAGCAGATCATTCTCGAGAATGATCTGCTCTTCAA
CCACCCGG (SEQ ID NO:26) (antisense).
[0093] Aptamers are molecules that interact and bind to a target molecule with a very high degree of specificity. Typically, aptamers are small nucleic acids ranging from 15-50 bases in length that fold into defined secondary and tertiary structures, such as stem-loops or G-quartets. Aptamers can bind small molecules as well as large molecules (U.S. Patent No. 5,631,146; U.S. Patent No. 5,786,462; U.S. Patent No.
5,543,293; U.S. Patent No. 5,580,737, which are hereby incorporated by reference in their entirety). Aptamers can bind very tightly with KdS for the target molecule of less than 10~12 M. It is preferred that the aptamers bind the target molecule with a Kd less than 10~6. It is more preferred that the aptamers bind the target molecule with a K^ less than 10 8. [0094] Other nucleic acid molecules suitable for the inhibition of EZH2 or
YY-I include ribozymes (U.S. Patent No. 5,334,711 to Sproat et al; U.S. Patent No. 5,646,031 to DeYoung et al.; U.S. Patent No. 5,595,873 to Joyce et al.; U.S. Patent No. 5,580,967 to Joyce et al., which are hereby incorporated by reference in their entirety), triplex forming functional nucleic acid molecules (U.S. Patent No. 5,176,996 to Hogan et al., which is hereby incorporated by reference in its entirety), and external guide sequences (EGSs) (International Patent Publication No. WO 92/03566 to Yale; Forster & Altman, "External Guide Sequences for an RNA Enzyme," Science 249:783-86 (1990), which are hereby incorporated by reference in their entirety). [0095] Therapeutic protein or peptide inhibitors of EZH2 or YY-I expression or activity are also suitable for use in accordance with this aspect of the present invention. Protein inhibitors include antibodies (e.g. single chain antibodies, chimeric antibodies, hybrid antibodies), intrabodies, peptide aptamers, or any other binding molecules, including synthetic peptide inhibitors, having antigen binding specificity for EZH2 or YY-I . Therapeutically effective antibodies or other binding molecules of the present invention are those having antigen specificity for EZH2 or YY-I, which inhibit EZH2 or YY-I activity upon binding of the antibody or binding molecule to EZH2 or YY-I . Preferably the antibody or other binding molecule of the present invention recognizes one or more portions of the EZH2 or YY-I proteins involved in polycomb repressive complex formation, DNA binding, or histone-3 methylation, such that H3K27 trimethylation is inhibited. Antibodies having antigen specificity for EZH2 and YY-I are known in the art (Bergad et al., "Yin-Yang 1 and Glucocorticoid Receptor Participate in the Stat5 -Mediated Growth Hormone Response of the Serine Protease Inhibitor 2.1 Gene," J. Biol. Chem. 275(11):8114-20 (2000); Raman et al., "Increased Expression of the Polycomb Group Gene, EZH2, in Transitional Cell
Carcinoma of the Bladder," Clin. Cancer Res. 11 :8750-76 (2005), which are hereby incorporated by reference in their entirety). Alternatively, the antibody or other binding molecule of the present invention has antigen binding specificity for a protein in the EZH2 or YY-I signal transduction pathway, where upon binding of the antibody or other binding molecule to its target protein, EZH2 and/or YY-I function is indirectly disrupted. An exemplary antibody known to inhibit YY-I function indirectly that is suitable for use in the methods of the present invention is Rituximab. Rituximab inhibits YY-I expression and activity by disrupting both the p38 mitogen- activated protein kinase signaling pathway and NFKB activity (Vega et al., "Rituximab (Chimeric Anti-CD20) Sensitized B-NHL Cell Lines to Fas-Induced Apoptosis," Oncogene 24:8114-8127 (2005), which is hereby incorporated by reference in its entirety).
[0096] Alternative therapeutic protein inhibitors suitable for use in this aspect of the present invention include dominant negative forms of the EZH2 or YY-I protein. Preferable dominant negative EZH2 or YY-I proteins are deficient in polycomb repressive complex formation or DNA binding capacity such that histone-3 methylation or transcriptional activity are attenuated. A preferred dominant negative YY-I protein that is particularly suitable for use in the methods of the present invention is the DZ-YY-I protein, described herein, that lacks four zinc-finger domains and is deficient in DNA binding and subsequent transcriptional activity. [0097] Other known inhibitors of YY-I that are suitable for use in accordance with this aspect of the invention include nitric oxide or nitric oxide donors, such as DEA-NONOate, as described in Garban & Bonavida, "Nitric Oxide Inhibits the Transcription Repressor Yin-Yang 1 Binding Activity at the Silencer Region of the Fas Promoter: A Pivitol Role for Nitric Oxide in the Up-Regulation of Fas Gene Expression in Human Tumor Cells," J. Immun. 167:75-81 (2001), which is hereby incorporated by reference in its entirety, and NPI-0052, as described in Baritaki et al., "Inhibition of Yin Yang 1 -Dependent Repressor Activity of DR5 Transcription and Expression by the Novel Proteasome Inhibitor NPI-0052 Contributes to Its TRAIL- Enhanced Apoptosis in Cancer Cells,"J. Immun. 180:6199-210 (2008), which is hereby incorporated by reference in its entirety. [0098] In another embodiment of this aspect of the present invention, the agent for treating a subject having a fibrotic condition is a histone deacetylase (HDAC) inhibitor. HDAC inhibitors suitable for use in the present invention include nucleoplasmin, chamydocin, Cyl-2, cyclic(eta-oxo-alpha- aminooxiraneoctanoylphenylalanylleucyl^-piperidinecarbonyl (WF-3161), depudecin, radicocol, oxamfiatin, apidicin, suberoxylanilide hydroxamic acid, and 2- amino-8-oxo-9,10-epoxy-decanoic acid as disclosed in U.S. Patent Application Publication No. 2005/0222013 to Mira et al., which is hereby incorporated by reference in its entirety. In addition, U.S. Patent No. 6,376,508 to Li, which is hereby incorporated by reference in its entirety, discloses the use of butyrate, trapoxin analogs, and trichostatin A as potent HDAC inhibitors that are also suitable for use in the present invention. Other HDAC inhibitors known in the art that are suitable for use in the present invention include valproic acid and its derivatives (U.S. Patent No. 7,265,154 to Gottlicher, which is hereby incorporated by reference in its entirety); carbamic acid compounds comprising sulfonamide linkages (U.S. Patent No. 6,888,027 to Watkins, which is hereby incorporated by reference in its entirety); compounds having a zinc-binding moiety, such as a hydroxamic acid group (U.S. Patent No. 6,495,716 to Lan-Hargest et al., which is hereby incorporated by reference in its entirety); cyclic tetrapeptide derivatives disclosed in U.S. Patent 6,825,317 to Nishino, which is hereby incorporated by reference in its entirety; and any of the HDAC inhibitory compounds disclosed in U.S. Patent No. 7,399,884 to Bressi, U.S. Patent No. 7,381,825 to Bressi, U.S. Patent No. 7,375,228 to Bressi, U.S. Patent No. 7,169,801 to Bressi, and U.S. Patent No. 7,154,002 to Bressi, which are hereby incorporated by reference in their entirety. Other HDAC inhibitors, including m- carboxycinnamic acid bis-hydroxamie and the bicyclic depsipeptide FK228 (Adachi et al., "Synergistic Effect of Histone Deacetylase Inhibitors FK228 and m- Carboxycinnamic Acid Bis-Hydroxamide with Proteasome Inhibitors PSI and PS-341 Against Gastrointestinal Adenocarcinoma Cells," Clin. Cancer Res. 10:3853-62 (2004), which is hereby incorporated by reference in its entirety); the benzamide M344 (Riessland et al., "The Benzamide M344, A Novel Histone Deacetylase Inhibitor, Significantly Increases SMN2 RNA/Protein Levels in Spinal Muscular Atrophy Cells," Hum. Genet. 120(10)101-10 (2006), which is hereby incorporated by reference in its entirety); and 3-(4-aroyl-2-pyrrolyl)-N-hydroxy-2-propenamides
(Massa et al., "3-(4-aroyl-lH-pyrrol-2-yl)-N-hydroxy-2-propenamides, A New Class of Synthetic Histone Deacetylase Inhibitors," J. Med. Chem. 44(13)2069-72 (2001), which is hereby incorporated by reference in its entirety), are also suitable for use in the present invention.
[0099] In another embodiment of the present invention, an anti-inflammatory agent is administered in conjunction with the agent that inhibits or reduces H3K27 trimethylation. Suitable anti-inflammatory agents include, but are not limited to, nimesulide, 4-hydroxynimesulide, flosulide, meloxicam, celecoxib, and Rofecoxib. [0100] Another aspect of the present invention is directed to a pharmaceutical composition that is suitable for the treatment of a fϊbrotic condition. The pharmaceutical composition contains a pharmaceutically acceptable delivery vehicle and an effective amount of one or more agents selected from an agent that inhibits or reduces H3K27 trimethylation, an inhibitor of EZH2, an inhibitor of YY-I, an inhibitor of histone deacetylase, or any combination of agents thereof. Appropriate delivery vehicles include, but are not limited to, lung surfactants, liposomes, viral vectors, and nanoparticle delivery vehicles, which are all described in more detail below.
[0101] The methods of the present invention are intended to be carried out by administering the active agents alone or in combination with one another, but preferably in the form of one or more pharmaceutical compositions that include a pharmaceutically acceptable carrier for the therapeutic agent(s). [0102] As will be apparent to one of ordinary skill in the art, administering any of the above agents to a subject to treat fibrosis may be carried out using generally known methods. Typically, the agent is administered by introducing the agent into the subject. Administration can be accomplished either via systemic administration to the subject, administration directly to a fϊbrotic tissue site, or via targeted administration to affected cells. Exemplary routes of administration include, without limitation, by intratracheal inoculation, aspiration, airway instillation, aerosolization, nebulization, intranasal instillation, oral or nasogastric instillation, intraperitoneal injection, intravascular injection, topically, transdermally, parenterally, subcutaneously, by intravenous injection, by intra-arterial injection (such as via the pulmonary artery), by intramuscular injection, by intrapleural instillation, intraventricularly, intralesionally, by application to mucous membranes (such as that of the nose, throat, and/or bronchial tubes), or by implantation of a sustained release vehicle adjacent to the affected tissue.
[0103] Typically, the therapeutic agent (i.e., histone lysine demethylase,
EZH2 or YY-I inhibitor, or histone deacetylase inhibitor) will be administered to a mammal as a pharmaceutical formulation that includes the therapeutic agent and any pharmaceutically acceptable suitable adjuvants, carriers, excipients, and/or stabilizers, and can be in solid or liquid form, such as tablets, capsules, powders, solutions, suspensions, or emulsions. The compositions preferably contain from about 0.01 to about 99 weight percent, more preferably from about 2 to about 60 weight percent, of therapeutic agent together with the adjuvants, carriers, and/or excipients. The amount of active compound in such therapeutically useful compositions is such that a suitable dosage unit will be obtained.
[0104] The agents may be orally administered, for example, with an inert diluent, or with an assimilable edible carrier, or they may be enclosed in hard or soft shell capsules, or they may be compressed into tablets, or they may be incorporated directly with the food of the diet. For oral therapeutic administration, these active compounds may be incorporated with excipients and used in the form of tablets, capsules, elixirs, suspensions, syrups, and the like. Such compositions and preparations should contain at least 0.1% of the agent. The percentage of the agent in these compositions may, of course, be varied and may conveniently be between about 2% to about 60% of the weight of the unit. The amount of the agent in such therapeutically useful compositions is such that a suitable dosage will be obtained. [0105] The tablets, capsules, and the like may also contain a binder such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, or alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose, or saccharin. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a fatty oil. [0106] Various other materials may be present as coatings or to modify the physical form of the dosage unit. For instance, tablets may be coated with shellac, sugar, or both. A syrup may contain, in addition to active ingredient(s), sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye, and flavoring such as cherry or orange flavor.
[0107] The agents may also be administered parenterally. Solutions or suspensions of the agent can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils. Illustrative oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, or mineral oil. In general, water, saline, aqueous dextrose and related sugar solutions, and glycols such as propylene glycol or polyethylene glycol, are preferred liquid carriers, particularly for injectable solutions. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms .
[0108] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils.
[0109] The agents according to this aspect of the present invention may also be administered directly to the airways in the form of an aerosol. For use as aerosols, the compounds of the present invention in solution or suspension may be packaged in a pressurized aerosol container together with suitable propellants, for example, hydrocarbon propellants like propane, butane, or isobutane with conventional adjuvants. The materials of the present invention also may be administered in a non- pressurized form such as in a nebulizer or atomizer. [0110] As another alternative, the agents of the present invention may be administered to the airways in the form of a lung surfactant formulation. The lung surfactant formulation can include exogenous lung surfactant formulations (e.g. , Infasurf® (Forest Laboratories), Survanta® (Ross Products), and Curosurf® (DEY, California, USA) or synthetic lung surfactant formulations (e.g., Exosurf® (Glaxo Wellcome Inc.) and ALEC). These surfactant formulations are typically administered via airway instillation (i.e., after intubation) or intratracheally. [0111] The agents of the present invention may be administered directly to the targeted tissue. Additionally and/or alternatively, the agent may be administered to a non-targeted area along with one or more agents that facilitate migration of the agent to (and/or uptake by) a targeted tissue, organ, or cell. While the targeted tissue can be any tissue subject to a fϊbrotic condition, preferred target tissues are lung tissue, heart tissue, liver tissue, brain tissue, kidney tissue, and the skin. As will be apparent to one of ordinary skill in the art, the therapeutic agent itself can be modified to facilitate its transport to (and uptake by) the desired tissue, organ, or cell. For example, histone lysine demethylases, EZH2 or YY-I inhibitors, or histone deacetylase inhibitors can be modified as described above to facilitate their transport to a target cell, organ (e.g. , lung), and/or tissue (e.g., lung tissue), including their transport across the blood-brain barrier; and/or their uptake by the target cell (e.g., its transport across cell membranes).
[0112] Exemplary delivery devices include, without limitation, nebulizers, atomizers, liposomes, transdermal patches, implants, implantable or injectable protein depot compositions, syringes, and gene therapy. Other delivery systems which are known to those of skill in the art can also be employed to achieve the desired delivery of the therapeutic agent to the desired organ, tissue, or cells in vivo to carry out this aspect of the present invention.
[0113] Any suitable approach for delivery of the agents can be utilized to practice this aspect of the present invention. Typically, the agent will be administered to a patient in a vehicle that delivers the agent(s) to the target cell, tissue, or organ. [0114] One approach for delivering agents into cells involves the use of liposomes (including the surfactant formulations described above). Basically, this involves providing a liposome which includes agent(s) to be delivered, and then contacting the target cell, tissue, or organ with the liposomes under conditions effective for delivery of the agent into the cell, tissue, or organ.
[0115] Liposomes are vesicles comprised of one or more concentrically ordered lipid bilayers which encapsulate an aqueous phase. They are normally not leaky, but can become leaky if a hole or pore occurs in the membrane, if the membrane is dissolved or degrades, or if the membrane temperature is increased to the phase transition temperature. Current methods of drug delivery via liposomes require that the liposome carrier ultimately become permeable and release the encapsulated drug at the target site. This can be accomplished, for example, in a passive manner where the liposome bilayer degrades over time through the action of various agents in the body. Every liposome composition will have a characteristic half-life in the circulation or at other sites in the body and, thus, by controlling the half-life of the liposome composition, the rate at which the bilayer degrades can be somewhat regulated.
[0116] In contrast to passive drug release, active drug release involves using an agent to induce a permeability change in the liposome vesicle. Liposome membranes can be constructed so that they become destabilized when the environment becomes acidic near the liposome membrane (see, e.g., Wang & Huang, "pH-Sensitive Immuno liposomes Mediate Target-cell-specific Delivery and
Controlled Expression of a Foreign Gene in Mouse," Proc. Nat 'I Acad. Sci. USA 84:7851-5 (1987), which is hereby incorporated by reference in its entirety). When liposomes are endocytosed by a target cell, for example, they can be routed to acidic endosomes which will destabilize the liposome and result in drug release. [0117] Alternatively, the liposome membrane can be chemically modified such that an enzyme is placed as a coating on the membrane, which enzyme slowly destabilizes the liposome. Since control of drug release depends on the concentration of enzyme initially placed in the membrane, there is no real effective way to modulate or alter drug release to achieve "on demand" drug delivery. The same problem exists for pH-sensitive liposomes in that as soon as the liposome vesicle comes into contact with a target cell, it will be engulfed and a drop in pH will lead to drug release. [0118] This liposome delivery system can also be made to accumulate at a target organ, tissue, or cell via active targeting (e.g., by incorporating an antibody or hormone on the surface of the liposomal vehicle). This can be achieved according to known methods.
[0119] Different types of liposomes can be prepared according to Bangham et al., "Diffusion of Univalent Ions Across the Lamellae of Swollen Phospholipids," J. MoI. Biol. 13:238-52 (1965); U.S. Patent No. 5,653,996 to Hsu; U.S. Patent No. 5,643,599 to Lee et al; U.S. Patent No. 5,885,613 to Holland et al; U.S. Patent No. 5,631,237 to Dzau & Kaneda; and U.S. Patent No. 5,059,421 to Loughrey et al., which are hereby incorporated by reference in their entirety. [0120] These liposomes can be produced such that they contain, in addition to the therapeutic agents of the present invention, other therapeutic agents, such as antiinflammatory agents, which would then be released at the target site (e.g., Wolff et al., "The Use of Monoclonal Anti-Thyl IgGl for the Targeting of Liposomes to AKR-A Cells in vitro and in vivo," Biochim. Biophys. Acta 802:259-73 (1984), which is hereby incorporated by reference in its entirety).
[0121] An alternative approach for delivery of proteins or polypeptide agents
(e.g., histone lysine demethylases) involves the conjugation of the desired protein or polypeptide to a polymer that is stabilized to avoid enzymatic degradation of the conjugated protein or polypeptide. Conjugated proteins or polypeptides of this type are described in U.S. Patent No. 5,681,811 to Ekwuribe, which is hereby incorporated by reference in its entirety.
[0122] Yet another approach for delivery of proteins or polypeptide agents involves preparation of chimeric proteins according to U.S. Patent No. 5,817,789 to Heartlein et al., which is hereby incorporated by reference in its entirety. The chimeric protein can include a ligand domain and the polypeptide agent (e.g., histone lysine demethylase or dominant negative YY-I). The ligand domain is specific for receptors located on a target cell. Thus, when the chimeric protein is delivered intravenously or otherwise introduced into blood or lymph, the chimeric protein will adsorb to the targeted cell, and the targeted cell will internalize the chimeric protein. [0123] Nucleic acid agents (including RNA and DNA) for use in the methods of the present invention can be delivered to a subject in a number of ways known in the art, including through the use of gene therapy vectors and methods as described above. The nucleic acid can be contained within a vector useful for gene therapy, for example, a vector that can be transferred to the cells of a subject and provide for expression of the therapeutic nucleic acid agent therein. Such vectors include chromosomal vectors (e.g., artificial chromosomes), non-chromosomal vectors, and synthetic nucleic acids. Vectors include plasmids, viruses, and phages, such as retroviral vectors, lentiviral vectors, adenoviral vectors, and adeno-associated vectors. [0124] Nucleic acid agents can be transferred into a subject using ex vivo or in vivo methods. Ex vivo methods involve transfer of the nucleic acid into cells in vitro {e.g. , by transfection, infection, or injection) that are then transferred into or administered to the subject. The cells can be, for example, cells derived from the subject (e.g., lymphocytes) or allogeneic cells. For example, the cells can be implanted directly into a specific tissue of the subject or implanted after encapsulation within an artificial polymer matrix. Examples of sites of implantation include the lungs or airways, skin, conjunctiva, central nervous system, peripheral nerve, a grafted kidney, or an inflamed joint. Nucleic acids can also be delivered into a subject in vivo. For example, nucleic acids can be administered in an effective carrier, e.g., any formulation or composition capable of effectively delivering the nucleic acid to cells in vivo. Nucleic acids contained within viral vectors can be delivered to cells in vivo by infection or transduction using virus. Nucleic acids and vectors can also be delivered to cells by physical means, e.g., by electroporation, lipids, cationic lipids, liposomes, DNA gun, calcium phosphate precipitation, injection, or delivery of naked nucleic acid. [0125] As an alternative to non-infective delivery of nucleic acids as described above, naked DNA or infective transformation vectors can be used for delivery, whereby the naked DNA or infective transformation vector contains a recombinant gene that encodes, for example, the histone lysine demethylase or the dominant negative YY-I or EZH2 proteins, of the present invention. The nucleic acid molecule is then expressed in the transformed cell. [0126] The recombinant gene includes, operatively coupled to one another, an upstream promoter operable in mammalian cells and optionally other suitable regulatory elements (i.e., enhancer or inducer elements), a coding sequence that encodes the therapeutic nucleic acid (described above), and a downstream transcription termination region. Any suitable constitutive promoter or inducible promoter can be used to regulate transcription of the recombinant gene, and one of skill in the art can readily select and utilize such promoters, whether now known or hereafter developed. The promoter can also be specific for expression in cells that express YY-I or EZH2. Tissue specific promoters can also be made inducible/repressible using, e.g., a TetO response element. Other inducible elements can also be used. Known recombinant techniques can be utilized to prepare the recombinant gene, transfer it into the expression vector (if used), and administer the vector or naked DNA to a patient. Exemplary procedures are described in JOSEPH SAMBROOK et al, 1-3 MOLECULAR CLONING: A LABORATORY MANUAL (2d ed. 1989), which is hereby incorporated by reference in its entirety. One of skill in the art can readily modify these procedures, as desired, using known variations of the procedures described therein. [0127] Any suitable viral or infective transformation vector can be used.
Exemplary viral vectors include, without limitation, adenovirus, adeno-associated virus, and retroviral vectors (including lentiviral vectors).
[0128] Adenovirus gene delivery vehicles can be readily prepared and utilized given the disclosure provided in Berkner, "Development of Adenovirus Vectors for the Expression of Heterologous Genes," Biotechniques 6:616-29 (1988); Rosenfeld et al., "Adenovirus-mediated Transfer of a Recombinant α 1 -Antitrypsin Gene to the Lung Epithelium in vivo " Science 252:431-434 (1991); International Patent Publication No. WO 1993/007283 to Curiel et al.; International Patent Publication No. WO 1993/006223 to Perricaudet et al.; and International Patent Publication No. WO 1993/007282 to Curiel et al., which are hereby incorporated by reference in their entirety. Additional types of adenovirus vectors are described in U.S. Patent No. 6,057,155 to Wickham et al., U.S. Patent No. 6,033,908 to Bout & Hoeben, U.S. Patent No. 6,001,557 to Wilson et al., U.S. Patent No. 5,994,132 to Chamberlain & Kumar-Singh, U.S. Patent No. 5,981,225 to Kochanek & Schniedner, U.S. Patent No. 5,885,808 to Spooner & Epenetos, and U.S. Patent No. 5,871,727 to Curiel, which are hereby incorporated by reference in their entirety.
[0129] Adeno-associated viral gene delivery vehicles can be constructed and used to deliver into cells a recombinant gene encoding a desired nucleic acid. The use of adeno-associated viral gene delivery vehicles in vitro is described in Chatterjee et al., "Dual-Target Inhibition of HIV-I in vitro by Means of an Adeno-associated Virus Antisense Vector," Science 258:1485-8 (1992); Walsh et al., "Regulated High Level Expression of a Human γ-Globin Gene Introduced into Erythroid Cells by an Adeno- associated Virus Vector," Proc. Nat'lAcad. Sci. USA 89:7257-61 (1992); Walsh et al., "Phenotypic Correction of Fanconi Anemia in Human Hematopoietic Cells with a Recombinant Adeno-associated Virus Vector," J. Clin. Invest. 94:1440-8 (1994); Flotte et al., "Expression of the Cystic Fibrosis Transmembrane Conductance Regulator from a Novel Adeno-associated Virus Promoter," J. Biol. Chem. 268:3781— 90 (1993); Ponnazhagan et al., "Suppression of Human α-Globin Gene Expression Mediated by the Recombinant Adeno-associated Virus 2-based Antisense Vectors," J. Exp. Med. 179:733-8 (1994); Miller et al., "Recombinant Adeno-associated Virus (rAAV)-mediated Expression of a Human γ-Globin Gene in Human Progenitor- derived Erythroid Cells," Proc. Nat 7 Acad. Sci. USA 91 :10183-7 (1994); Einerhand et al., "Regulated High-level Human β-Globin Gene Expression in Erythroid Cells Following Recombinant Adeno-associated Virus-mediated Gene Transfer," Gene Ther. 2:336-43 (1995); Luo et al., "Adeno-associated Virus 2-mediated Gene Transfer and Functional Expression of the Human Granulocyte-macrophage Colony- stimulating Factor," Exp. Hematol. 23:1261-7 (1995); and Zhou et al., "Adeno- associated Virus 2-mediated Transduction and Erythroid Cell-specific Expression of a Human β-Globin Gene," Gene Ther. 3:223-9 (1996), which are hereby incorporated by reference in their entirety. In vivo use of these vehicles is described in Flotte et al., "Stable in vivo Expression of the Cystic Fibrosis Transmembrane Conductance Regulator with an Adeno-associated Virus Vector," Proc. Nat 'I Acad. Sci. USA
90:10613-7 (1993), and Kaplitt et al., "Long-term Gene Expression and Phenotypic Correction Using Adeno-associated Virus Vectors in the Mammalian Brain," Nat. Genet. 8:148-54 (1994), which are hereby incorporated by reference in their entirety. [0130] Retroviral vectors which have been modified to form infective transformation systems can also be used to deliver a recombinant gene encoding a desired nucleic acid product into a target cell. One such type of retroviral vector is disclosed in U.S. Patent No. 5,849,586 to Kriegler & Perez, which is hereby incorporated by reference in its entirety. Lentivirus vectors can also be utilized, including those described in U.S. Patent No. 6,790,657 to Arya, U.S. Patent Application Publication No. 2004/0170962 to Kafri et al., and U.S. Patent Application Publication No. 2004/0147026 to Arya, which are hereby incorporated by reference in their entirety. [0131] Inhibitory RNA can be administered to the subject systemically or locally as described above. Delivery of inhibitory RNA is preferably administered alone or as a component of a composition of the present invention. Suitable compositions include the siRNA formulated or complexed with polyethylenimine (e.g. , linear or branched PEI) and/or polyethylenimine derivatives, including for example grafted PEIs such as galactose PEI, cholesterol PEI, antibody derivatized PEI, and polyethylene glycol PEI derivatives thereof (see, e.g., Blazek-Welsh & Rhodes, "Maltodextrin-based Proniosomes," AAPS Pharm. Sci. 3(1):1-11 (2001); Furgeson et al., "Modified Linear Polyethylenimine-cholesterol Conjugates for DNA Complexation," Bioconjug. Chem. 14:840-7 (2003); Kunath et al., "The Structure of PEG-modified Poly(Ethylene Imines) Influences Biodistribution and Pharmacokinetics of Their Complexes with NF -KB Decoy in Mice," Pharm. Res. 19:810-7 (2002); Choi et al., "Effect of Polyethylene Glycol) Grafting on Polyethylenimine as a Gene Transfer Vector in vitro," Bull. Korean Chem. Soc. 22(l):46-52 (2001); Bettinger et al., "Size Reduction of Galactosylated PEI/DNA Complexes Improves Lectin-mediated Gene Transfer into Hepatocytes," Bioconjug. Chem. 10:558-61 (1999); Petersen et al., "Polyethylenimine-graft-poly(ethylene glycol) Copolymers: Influence of Copolymer Block Structure on DNA Complexation and Biological Activities as Gene Delivery System," Bioconjug. Chem. 13:845-54 (2002); Erbacher et al., "Transfection and Physical Properties of Various Saccharide, Poly(Ethylene Glycol), and Antibody-derivatized Polyethylenimines (PEI)," J. Gene Med. l(3):210-22 (1999); Godbey et al., "Tracking the Intracellular Path of Poly(Ethylenimine)/DNA Complexes for Gene Delivery," Proc. Nat 'I Acad. Sci. USA 96:5177-81 (1999); Godbey et al., "Poly(Ethylenimine) and Its Role in Gene Delivery," J. Control. Release 60:149-60 (1999); Diebold et al., "Mannose
Polyethylenimine Conjugates for Targeted DNA Delivery into Dendritic Cells," J. Biol. Chem. 274:19087-94 (1999); Thomas & Klibanov, "Enhancing Polyethylenimine' s Delivery of Plasmid DNA into Mammalian Cells," Proc. Nat'l Acad. Sci. USA 99:14640-5 (2002); U.S. Patent No. 6,586,524 to Sagara, which are hereby incorporated by reference in their entirety).
[0132] The inhibitory RNA molecule can also be present in the form of a bioconjugate, for example a nucleic acid conjugate as described in U.S. Patent No. 6,528,631 to Cook et al, U.S. Patent No. 6,335,434 to Guzaev et al, U.S. Patent No. 6,235,886 to Manoharan & Cook, U.S. Patent No. 6,153,737 to Manoharan et al., U.S. Patent No. 5,214,136 to Lin & Matteucci, and U.S. Patent No. 5,138,045 to Cook & Guinosso, which are hereby incorporated by reference in their entirety. [0133] The inhibitory RNA, or any composition or bioconjugate containing the same, can be administered via a liposomal delivery mechanism described above. [0134] Many routes of delivery are known to the skilled artisan for delivery of anti-target antibodies. For example, direct injection may be suitable for delivering the antibody to the site of interest. It is also possible to utilize liposomes with antibodies in their membranes to specifically deliver the liposome to the area where H3K27 trimethylation is to be reduced or EZH2 or YY-I expression or activity is to be inhibited. These liposomes can be produced such that they contain, in addition to monoclonal antibody, other therapeutic agents, such as those described above, which would then be released at the target site. [0135] Administration can be carried out as frequently as required and for a duration that is suitable to provide effective treatment for a fibrotic condition being treated or prevented. For example, administration can be carried out with a single sustained-release dosage formulation or with multiple daily doses. Where more than one of the above described agents is administered, they may be administered at the same time (e.g., present in the same pharmaceutical formulation), or separately (e.g., each present in a separate pharmaceutical formulation) but during the same course of treatment. Administration can be carried out before, concurrently with, and/or after the appearance of symptoms of the fibrotic condition. [0136] The amount to be administered will, of course, vary depending upon the treatment regimen. Generally, an agent is administered to achieve an amount effective for amelioration of, or prevention of the development of symptoms of, the fibrotic condition (i.e., a therapeutically effective amount). Thus, a therapeutically effective amount can be an amount which is capable of at least partially preventing or reversing the fibrosis related condition. The dose required to obtain an effective amount may vary depending on the agent, formulation, disease or disorder, and individual to whom the agent is administered. [0137] Determination of effective amounts may also involve in vitro assays in which varying doses of agent are administered to cells in culture and the concentration of agent effective for ameliorating some or all symptoms is determined in order to calculate the concentration required in vivo. Effective amounts may also be based on in vivo animal studies. A therapeutically effective amount can be determined empirically by those of skill in the art.
[0138] By way of example, the histone lysine demethylase can be administered in an amount between about 500 μg/kg and about 2.5 mg/kg, preferably between about 750 μg/kg and about 2.25 mg/kg, more preferably between about 1 mg/kg and 2 mg/kg. Inhibitors of EZH2, YY-I, and histone deacetylase can be administered in an amount between about 500 μg/kg and about 10 mg/kg, preferably between about 750 μg/kg and about 5 mg/kg. In the case of EZH2 or YY-I siRNA or shRNA, the amount is preferably between about 25 nmol/kg and 10 mmol/kg, more preferably between about 100 nmol/kg and about 5 mmol/kg. [0139] Another aspect of the present invention relates to a method of identifying an agent that is effective for treating a fibrotic condition. This method involves obtaining a first biological sample from an in vivo or in vitro experimental model of fibrosis and administering a candidate agent to the in vivo or in vitro experimental model of fibrosis. A second biological sample is obtained from the experimental model after administering the candidate agent, and the level of H3K27 trimethylation in the first and second biological samples is measured. The level of H3K27 trimethylation in the first and second biological samples is then compared. A decrease in the level of H3K27 trimethylation in the second biological sample relative to the level of H3K27 trimethylation in the first biological sample indicates that the agent is effective for treating a fibrotic condition.
[0140] In vivo models of fibrosis are well known in the art. For example, fibrosis can be induced in vivo upon intratracheal instillation of bleomycin, fluorescein isothiocyanate, irradiation, silica, or particulate matter in an animal. Additionally, a fibrotic condition is displayed in transgenic animals over-expressing TGF-β and upon adoptive transfer of human fibrotic fibroblasts into immunodeficient animals (Moore et al., "Murine Models of Pulmonary Fibrosis," Am. J. Physiol. Lung Cell MoI. Physiol. 294:L152-60 (2008); Gharaee-Kermani et al., "Animal Models of Pulmonary Fibrosis," Methods MoI. Med. 117:251-9 (2005), which are hereby incorporated by reference in their entirety). In one embodiment of this aspect of the present invention, the in vivo experimental model of fibrosis is a silica-treated mouse model as described herein. [0141] In vitro models of fibrosis are also well known in the art. Typically, an in vitro model of fibrosis comprises an isolated tissue or cell sample derived directly from fϊbrotic condition, for example, lung fibroblasts derived from patients having lung fibrosis, as described herein. Alternatively, an in vitro model of fibrosis can comprises an isolated tissue or cell sample where a fϊbrotic phenotype is induced. Fibrotic phenotypes can be induced directly by exposure to exogenous agents, or indirectly by stimulation with cytokines and other inflammatory mediators of fibrosis. As described herein, exposing lung fibroblasts to silica directly stimulates a fϊbrotic phenotype in lung fibroblasts and provides a suitable in vitro model of pulmonary fibrosis for use in accordance with this aspect of the present invention. [0142] As will be apparent to the skilled artisan, the method according to this aspect of the present invention can be used to identify agents effective for treating the fϊbrotic conditions described above. In a preferred embodiment, the fϊbrotic condition is lung or pulmonary fibrosis. [0143] The present invention is illustrated, but not limited, by the following examples.
EXAMPLES Example 1 — Animals and Silica or Bleomycin Administration
[0144] YYl heterozygotes (YYl+7") and conditional knockout YYl (YYlf/f) mice were obtained from Dr. Yang Shi (Harvard University, Boston, MA). All animals were grouped according to age (6-12) or weight (20-35 g). YY1+/" mice were on a C57BL/6 background (> 6 generations). YYlf/f mice were on a C57BL/6 background (4 generations). These mice received 200-300 μg of silica or three units of bleomycin per kg of body weight by intratracheal injection. The background of γγiccl° is p4 C57BL/6. All animals were housed under specific pathogen-free conditions at the NIH in an American Association for the Accreditation of Laboratory Animal Care-approved facility. The URMC animal care and use committee approved all experimental procedures.
Example 2 — Construction of Clara Cell Promoter Driven YYl (YYlccl° )
[0145] CC-10-driven YYl (YY1CC1°) mice were generated as follows. The plasmid of a rat cclO promoter (kind gift of Dr. Z. Zhou, Johns Hopkins University) was digested with Xbal-BamHI and the DNA ends were blunted. The murine YYl gene was digested with BamHI and the DNA ends were blunted. A YYl insert was subcloned into a blunted rat cclO plasmid and the plasmid was digested with HindIII and Kpnl. The 4Kb fragment was obtained and injected into zygotes of BJ6 strain to create transgenic mice. Three lines were generated and genotyping was performed using the forward primer 5'-ACTGCCCATTGCCCAAACAC (SEQ ID NO:7) and the reverse primer 5'-GATGGTCTCCACCTCGATCTCATG (SEQ ID NO:8).
Example 3 — Cell Lines and Isolation of Primary Mouse Lung Fibroblasts
[0146] WI-38 cells (human fetal lung fibroblasts), MLg2908 cells (mouse lung fibroblasts), LL97A cells (human adult lung fibroblasts obtained from a patient with idiopathic pulmonary fibrosis), and MRC-5 (secondary human lung fibroblasts) were all purchased from the American Type Culture Collection. 293FT cells were obtained from Invitrogen. Primary mouse lung fibroblasts were isolated as described in Baglole et al., "Isolation and Phenotypic Characterization of Lung Fibroblasts," Meth. MoI. Med. 117:115-27 (2005), which is hereby incorporated by reference in its entirety. Briefly, lungs were minced and digested with collagenase and DNase at 37°C for two hours. After washing with HBSS, isolated cells were collected by centrifugation and plated in T75 flasks in DMEM/F12 (1 :1) containing 10% FBS and antibiotics. This was completed in a humidified atmosphere consisting of 5% CO2 and 95% air overnight. Non-adherent cells were removed by washing the flask with media. After the third passage, the primary lung fibroblasts were used for the experiments. Example 4 — Histopathological and Immunohistochemical Examination
[0147] Lungs were fixed with 10% buffered formalin and embedded in paraffin. H&E stains and Masson's Trichrome stains were used for analysis of pathological changes using the Accustain Trichrome Stain Kit (Sigma Chemical Co., St. Louis, MO). Immunohistochemical staining for α-SMA and YYl in tissues was performed according to the instructions provided in the Animal Research Kit (DAKO Cytomation). Briefly, lung sections were deparaffmized, incubated with hot 5% urea to retrieve antigen, blocked, and stained with primary antibodies overnight at 4°C. After application of the appropriate secondary antibody, streptavidin-conjugated horseradish peroxidase (HRP- Streptavidin) was applied, and staining was visualized with NovaRed (Vector Laboratories). Slides were counterstained with hematoxylin for determination of α-SMA expression. The severity of fibrosis was evaluated in stained sections by an individual who was blinded to the genotypes of the mice. Double staining kits were purchased from Biocare Medical (Concord, CA) and staining was carried out following the recommended protocols.
Example 5 — Quantitative PCR
[0148] Total RNA from lung tissue and lung fibroblasts was extracted using
TRIzol® reagent (Invitrogen). Then, 0.5-1 μg of total RNA was reverse-transcribed using oligo dT as a primer. Quantitative PCR was performed using an iQ5 Biorad device. Data were analyzed by the 2^Δ/cy method and normalized to the expression of the GAPDH housekeeping gene. The sequences of the primers utilized are listed in Table 1. Table 1. Primer Pairs Used for Quantitative PCR
Figure imgf000052_0001
Example 6 — Immunofluorescent Staining
[0149] Primary lung fibroblasts from YYlccl°, wild type, and YYlf/f mice were transfected with Cre-GFP, or LL97A cells derived from human fibroblasts obtained from IPF patients were transduced with YYl shRNA, and were plated in four- well chamber slides. Cells were supplemented with DMEM and 10% FBS at 37°C for four days. Cells were fixed with 4% paraformaldehyde, permeabilized with 0.1% PBS-Triton-100, blocked with protein block serum-free solution (DAKO Cytomation), and incubated with anti-α-SMA antibody (1A4, DAKO Cytomation) for one hour at room temperature. They were then incubated with secondary antibody (goat anti-mouse Alexa Fluor 488, Invitrogen) for one hour at room temperature. Incubation with anti-YYl antibody (H-414, Santa Cruz) was performed at 4°C overnight. Secondary antibody (goat anti-rabbit Texas Red-X, Invitrogen) was used for one hour at room temperature. Stained cells were embedded in mounting medium with DAPI (Invitrogen) and examined with a Zeiss fluorescence microscope.
Example 7 — Western Blot Analysis
[0150] Cells or lung tissues were solubilized in lysis buffer (50 mM Tris/HCl
(pH 8.0), 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 0.02% Na3N, 1% Nonidet P40, 1 mM PMSF, and 2 μg/ml aprotinin). Protein concentrations were determined by a BCA assay. Protein samples (20 μg) were separated in 8-16% SDS/PAGE gels and transferred onto a nitrocellulose membrane. The membrane was incubated with primary antibodies diluted in 1% non-fat milk in PBS containing 0.1% Tween 20, followed by incubation with horseradish peroxidase-conjugated IgG as the secondary antibody. Visualization was carried out using an ECL (enhanced chemiluminescence) kit.
Example 8 — Luciferase Assay and Construct of YYl and α-SMA Luciferase Reporter
[0151] Plasmids containing only the YYl promoter (or a YYl promoter with a mutant NF -KB binding site driving a luciferase reporter gene) were kindly provided by Dr. Denis C. Guttridge (Ohio State University). To construct the α-SMA- luciferase reporter plasmid, the α-SMA promoter was amplified by PCR using primers M SMA-5'-CCCGCTCGAGATGGTCCTT AATCATGCT (SEQ ID NO: 17) and M SMA-5 '-CCC AAGCTTCTT ACCCTGAC AGCGACTGG (SEQ ID NO:18). Amplification was completed using mouse lung fibroblast genomic DNA. The DNA was cut with Xhol and HindIII and subcloned into the Xhol and HindIII sites of the pGL3 basic vector (Promega). The reporter constructs were transiently transfected into WI-38 cells, MLg2908 cells, and primary lung fibroblast of YY1+/" and wild type mice using electroporation (300V 1050 Capacitance). These plasmids included YYl- Luc, mutant YYl -Luc, and α-SMA-Luc. The transfected cells were placed in OPTI- MEM media containing 0.1% FBS overnight in 24-well plates, and were then stimulated with TGF-β for 24 hours or with TNF-α for 6 hours. Using the same procedure, a p65 (NF -KB) plasmid was cotransfected with YYl -Luc, mutant YYl- Luc, or YYl with or without a p65 plasmid and α-SMA-Luc.
Example 9 — Lentiviral shRNA, Lentiviral-Cre, and Adenoviral-Cre
[0152] Constructs used for depletion of YYl shRNA were obtained from
Open Biosystems (Huntsville, AL). For each gene, five pre-made shRNA constructs were obtained and tested. The constructs were used to identify genes capable of achieving efficient knockdown of YYl at the protein level. Negative control constructs for the same vector system (vector alone, scrambled, and luciferase shRNA) were created in Dr. Jia Guo's lab (University of Rochester, Rochester, NY). The lentiviral helper plasmids pHR'8.9ΔR and pCMV-VSV-G were obtained from Dr. Linzhao Chen (Johns Hopkins University). All plasmids were prepped, and their integrity was confirmed by restriction analysis. To prepare transient virus stocks, 1.0 x 106 293T cells were plated in 60-mm dishes. The next day, the cells were cotransfected with shRNA constructs (1.5 μg) along with pHR'8.9ΔR andpCMV- VSV-G helper constructs (1.5 μg and 0.3 μg, respectively) using FuGENE 6 (Roche, Indianapolis, IN), and the medium was changed the following day. One day later, virus-containing media was harvested. The viral stocks were centrifuged and filtered to remove any nonadherent 293T cells. Next, WI-38 and LL97A cells were infected with shRNA lentiviruses. To accomplish this, cells were plated at subconfluent densities and infected one day later with a cocktail of one ml of virus-containing medium, three ml of regular medium, and eight μg/ml of Polybrene. The medium was changed one day after infection. Selective medium was added two days post-infection (two μg/ml of puromycin for WI-38 and LL97A cells). After three days of puromycin selection, the mock-infected cells had all died. Stably-infected pooled clones were then studied. The shRNA sequences are listed in Table 2 below. Table 2. Lentiviral shRNA Sequences
Control-shRNA-1
Sense 5'-3'
CCGGGCAGCTGCCAGATAGCATGAACTCGAGTTCATGCTATCTGGCAGCTGCT TTTTG (SEQ ID NO: 19)
Antisense 5'-3'
AATTCAAAAAGCAGCTGCCAGATAGCATGAACTCGAGTTCATGCTATCTGGCAG CTGC (SEQ ID NO:20)
Control -sh RN A-2
Sense 5'-3'
CCGGCGTACGCGGAATACTTCGACTCGAGTCGAAGTATTCCGCGTACGTTTTTG
(SEQ ID NO:21 )
Antisense 5'-3'
CAAAAACGTACGCGGAATACTTCGACTCGAGTCGAAGTATTCCGCGTACGCCG G (SEQ ID NO:22)
YY1 -shRNA-1
Sense 5'-3'
CCGGGCCCTCATAAAGGCTGCACAACTCGAGTTGTGCAGCCTTTATGAGGGCT TTTTG (SEQ ID NO:23)
Antisense 5'-3'
CAAAAAGCCCTCATAAAGGCTGCACAACTCGAGTTGTGCAGCCTTTATGAGGGC CCGG (SEQ ID NO:24)
YY1 -shRNA-2
Sense 5'-3'
CCGGGTGGTTGAAGAGCAGATCATTCTCGAGAATGATCTGCTCTTCAACCACTT TTTG (SEQ ID NO:25)
Antisense 5'-3'
CAAAAAGTGGTTGAAGAGCAGATCATTCTCGAGAATGATCTGCTCTTCAACCAC CCGG (SEQ ID NO:26)
[0153] Lung fibroblasts isolated from YYlf/f mice were transduced with Lenti-
Cre at different multiplicities of infection (MOI) to knockdown YYl expression. Extracts from whole cells were immunob lotted with anti-YYl antibody. The Lenti- Cre vector was purchased from Addgene. The packaging and infection approach employed was the same as that described above. [0154] Adenoviral Cre was purchased from Biomicrobics System Inc.
(Canada) in 6x109 pfu.
Example 10 — Statistical Analysis
[0155] Quantitative PCR, YYl and α-SMA promoter reporter assay, and histological score of lung fibrosis were analyzed for statistical significance by using the paired Student's t-test using Microsoft Excel software. Kp value of <0.05 was considered statistically significant.
Example 11 — Purification of Primary Lung Fibroblasts
[0156] Anti-S100A4 (anti-FSPl, AB68124) was purchased from Abeam and anti-mouse- APC (A21057) was purchased from Invitrogen. Primary lung fibroblasts were isolated from mice treated with bleomycin (3U/kg). After incubation with F 12 10% FBS medium for a week, the fibroblasts were labeled following Abeam intracellular staining and indirect labeling protocols. The protocol can produce about 90% purity of lung fibroblasts.
Example 12 — Evaluation of YYl Up-Regulation by TGF-β in MRC5 Human Adult Fibroblasts
[0157] Whether YYl is up-regulated by TGF-β in adult fibroblasts was investigated using a human adult fibroblast cell line, MRC5. After serum starvation for 24 hours, MRC5 cells were treated with 10 ng/ml of TGF-β for 8 hours or 24 hours in serum-free DMEM. Extracts from whole cells treated with TGF-β for 8 hours were subjected to immunoblot analysis with anti-YYl or anti-β-actin antibody. YYl expression was found to be up-regulated by TGF-β stimulation. MRC5 cells transfected with the full-length YYl promoter- luciferase reporter (YYl-LUC) by electroporation were treated with PBS or TGF-β for 24 hours, and the relative light units (RLU) were measured with a luminometer. YYl-LUC was also found to be up- regulated TGF-β stimulation. Example 13 — YYl Binding Activity at the α-SMA Promoter in Nuclear Extracts from WI-38 Cells
[0158] Nuclear extracts from WI-38 cells were prepared as described in
Kurisaki et al., "Nuclear Factor YYl Inhibits Transforming Growth Factor β- and Bone Morpho genetic Protein-Induced Cell Differentiation," MoI. Cell Biol.
23(13):4494-510 (2003), which is hereby incorporated by reference in its entirety. The protein concentration was determined by BCA (Pierce) using bovine serum albumin as a standard. Double-stranded DNA probes were prepared by annealing the oligonucleotides 5 '-3' TC AGTTCCTGGTTTC ATTACTAC AAC AC AA (SEQ ID NO :27) (sense) and 5 '-3 ' TTGTGTTGT AGTAATGAAACC AGGAACAGA (SEQ ID NO:28) (antisense). The sense oligonucleotide was 5 '-end-labeled with biotin during oligonucleotide synthesis (IDT). Protein binding reactions were carried out in 20 ml of buffer (2OmM Hepes pH 7.9, 80 mM KCl, 5mM MgCl2, 2% (v/v) Ficoll, 5% (v/v) Glycerol, 0.1 mM EDTA, 1 mM Dithiothreitol) with 20 fmole of biotinylated probe, 1 mg of poly dldC, 50 mg of Bovine serum albumin, and 5 mg of lung fibroblast nuclear protein. The mixture was incubated for 30 minutes at room temperature in the presence or absence of non-labeled competitor oligonucleotides. For super-shift assays, the binding reaction mixture was pre-incubated with YYl antibodies (1703, Santa Cruz Biotechnology). The protein DNA complexes were resolved by electrophoresis (6% non-denaturing polyacrylamide gel from Invitogen) in 0.5xTBE running buffer. The results identify a YYl binding site located on the α-SMA protomer at residues -556 to -526. (A potential second binding site is located at residues -279 to -249.)
Example 14 — Cytokine Profile [0159] 1 ml of bronchoalveolar lavage ("BAL") was obtained from wild type and YY1+/" mice. Cytokines from BALs were measured using a Bio-Plex array (8- plex cytokines) from Bio-Rad. Some cytokines, such as IL- 12, IFN-γ, and TNF-α, were significantly decreased in BAL of YY1+/" mice compared to that of wild type mice. Example 15 — YYl Expression Is Increased in Lung Tissues Obtained from
Humans with Idiopathic Pulmonary Fibrosis (IPF), as Well as in Silica and Bleomycin-Exposed Mice
[0160] To determine whether YYl is induced in human IPF (Figures IA-I C) and the silica and bleomycin mouse models of lung fibrosis (Figures 2 A-2B (silica) and Figures 3A-3C (bleomycin)), immunohistochemistry and immunoblot assays were performed with anti-YYl and anti-S100A (also called fibroblast specific protein 1, FSPl) antibodies. YYl was markedly increased in lung fibroblasts of fibrotic areas of human IPF, as shown in Figure IA, and in mouse lung models following silica or bleomycin instillation, as shown in Figure 2A (silica installation) and Figure 3 A (bleomycin installation).
[0161] Immunohistochemistry localized YYl expression to bronchial epithelial cells and fibroblast foci in human IPF and in mice with induced fibrosis. Immunoblot analysis confirmed that total YYl expression was upregulated in the human IPF lung, as shown in Figure IB, as well as in silica and bleomycin mouse models, as shown in Figure 2B (silica mouse model) and Figure 3B (bleomycin mouse model). Using quantitative PCR, it was found that YYl transcript levels were increased both in lungs obtained from subjects with IPF, as shown in Figure 1C, as well as silica- and bleomycin-exposed mice, as shown in Figure 2C (silica-exposed) and Figure 3C (bleomycin-exposed). Taken together, these findings indicate that lung fibrotic responses are associated with enhanced expression of both YYl mRNA and protein. Next, the cell types expressing YYl were explored in more detail.
Example 16 — YYl Is Overexpressed in Lung Fibroblasts in Human IPF and Murine Silicosis [0162] YYl was found to be over-expressed in lung tissue of human IPF and murine fibrotic models. Determining which cells from lung contribute the YYl expression can help elucidate a mechanism of lung fibrosis. Injured lung will recruit lung fibroblasts to repair the damaged lung. The recruited lung fibroblasts require YYl expression for proliferation and differentiation. To investigate whether YYl is over-expressed in lung fibroblasts, FSPl and YYl antibodies were used to determine whether YYl is up-regulated in lung fibroblasts using IHC staining. YYl was found to be expressed in lung fibroblastal areas in murine silicosis, as shown in Figure 4A, and in human IPF, as shown in Figure 4B. This suggests that YYl expression is located in regions enriched in lung fibroblasts.
[0163] In order to further confirm that YYl is over-expressed in lung fibroblasts, mice were exposed to bleomycin and lung fibroblasts were harvested 12 days later (Lawson et al., "Characterization of Fibroblast-Specific Protein 1 in
Pulmonary Fibrosis," Am. J. Respir. Crit. Care Med. 171(8): 899-907 (2005); Baglole et al., "Isolation and Phenotypic Characterization of Lung Fibroblasts," Meth. MoI. Med. 117:115-27 (2005), each of which is hereby incorporated by reference in its entirety). YYl expression was determined by a western blot in the harvested fibroblasts (see Figure 5 for the purity of the fibroblasts). As shown in Figure 6 A, YYl expression was found to be dramatically increased in lung fibroblasts from bleomycin treated mice compared to untreated mice. Double staining IHC was conducted to further confirm that YYl expression is expressed in lung fibroblasts in human IPF. As shown in Figure 6B, YYl was found to be over-expressed in lung fibroblasts. Taken together, not only was YYl expression found to be located in aggregated lung fibroblasts, but it was also found that YYl expression is increased in isolated lung fibroblasts. These suggest that increased YYl expression plays a role in lung fibroblast differentiation and proliferation in injured lung.
Example 17 — YYl Is Upregulated by TGF-β and TNF-α in Lung Fibroblasts [0164] Lung fibrosis results from proliferation and differentiation of fibroblasts in response to the P-fibrotic cytokines TGF-β and TNF-α. To test the possibility that these cytokines directly induce YYl expression, human WI-38 and mouse MLg2908 lung fibroblast cell lines were grown in vitro and exposed to TGF-β and TNF-α for different times. As shown in Figures 7A-7D, YYl expression was upregulated by TGF-β in both human fetal fibroblasts and murine fibroblasts, as demonstrated by western blot (Figure 7A (WI-38 cells) and Figure 7B (MLg2908 cells)) and quantitative PCR (Figure 7C (WI-38 cells) and Figure 7D (MLg2908 cells). Using an YYl promoter-driven luciferase reporter construct, it was discovered that YYl promoter activity is significantly increased by TGF-β stimulation in lung fibroblasts, as shown in Figure 7E (YYl-Luc-transfected WI-38 cells) and Figure 7F (YYl-Luc-transfected MLg2908 cells). A human adult fibroblast cell line (MRC5) was also used, and up-regulation of YYl expression by TGF-β was confirmed using immunoblot and YYl reporter activity assays, as shown in Figure 8A-8B. [0165] YYl expression was also found to be increased by TNF-α stimulation, as shown in Figure 9A (WI-38 cells) and Figure 9B (MLg2908 cells), although with slightly different kinetics. Quantitative PCR data showed that YYl transcript levels are upregulated by TNF-α, as shown in Figure 9C (WI-38 cells) and Figure 9D (MLg2908 cells). It was also confirmed that YYl promoter reporter activity is upregulated by TNF-α stimulation in lung fibroblasts, as shown in Figure 9E (YYl- Luc-transfected MI-38 cells) and Figure 9F (YYl-Luc-transfected MLg2908 cells). Taken together, these data suggest that YYl is upregulated by the P-fϊbrotic cytokines TGF-β and TNF-α in both human and mouse lung fibroblasts.
Example 18 — YYl Is Over-Expressed After Crystalline Silica Stimulation in Lung Fibroblasts
[0166] In addition to the indirect effects of lung inflammation, crystalline silica can activate cells directly through distinct molecular pathways (Hornung et al., "Silica Crystals and Aluminum Salts Activate the NALP3 Inflammasome Through Phagosomal Destabilization," Nat. Immunol. 9(8):847-56 (2008); Dostert et al., "Innate Immune Activation Through Nalp3 Inflammasome Sensing of Asbestos and Silica," Science 320(5876):674-77 (2008), each of which is hereby incorporated by reference in its entirety). Therefore, whether silica particles directly regulate YYl expression in fibroblasts was tested by incubating cells for up to 8 hours in vitro with a fixed concentration of silica. As shown in Figure 1OA and Figure 1OB, YYl expression was dramatically increased over an 8-hour time period in both human (Figure 10A) and mouse (Figure 10B) lung fibroblasts. This suggests that YYl expression is directly regulated by silica stimulation in lung fibroblasts. As shown in Figure 11, neither silica nor TNF-α affected YYl expression in macrophages, suggesting their enhancing effects on YYl was relatively specific for fibroblasts.
Example 19 — NF-κB-Mediated YYl Expression in Lung Fibroblasts After TGF-β Stimulation [0167] Recent studies have linked the NF -KB pathway to YYl in other cell types. TNF-α can up-regulate YYl expression mediated by NF-κB in tumor cells (Huerta-Yepez et al., "Involvement of the TNF-α Autocrine-Paracrine Loop, via NF- KB and YYl, in the Regulation of Tumor Cell Resistance to Fas-Induced Apoptosis," Clin. Immunol. 120(3):297-309 (2006), which is hereby incorporated by reference in its entirety). To determine whether TGF-β induces YYl expression through NF -KB in lung fibroblasts, a YYl promoter reporter was transiently trans fected with or without NF -KB expression vectors into WI-38 cells. Transfected cells were stimulated with TGF-β, and reporter gene activity was analyzed by luminometry. As shown in Figure 12 A, YYl promoter activity was significantly increased in lung fibroblasts in response to both TGF-β stimulation and co-trans fection with NF-κB (p65). As shown in Figure 12B, disruption of a potential NF -KB site blocked the enhancing effect of NF -KB co-trans fection, suggesting that this involves direct binding to the YYl promoter. This suggests that YYl gene expression is mediated by NF -KB. [0168] IK-B prevents nuclear translocation of NF-κB. To further investigate the requirement for the NF-κB pathway after TGF-β stimulation, an indirect NF-κB inhibitor (Bay 11-7085) was employed to block IK-B degradation and prevent NF -KB translocation into the nucleus. As shown in Figure 12C, YYl expression was abolished by Bay 11-7085 after TGF-β stimulation. These findings suggest that the pathway leading to YYl up-regulation is mediated through NF -KB by TGF-β stimulation in lung fibroblasts.
Example 20 — The Myofibroblast Marker α-SMA Is Up-Regulated by YYl
[0169] α-SMA and collagen are highly expressed in myofibroblasts, the presence of which is a hallmark of fϊbrotic lung diseases. Collagen has been reported to be up-regulated by YYl binding to collagen promoters (Riquet et al., "YYl Is a Positive Regulator of Transcription of the Collal Gene," J. Biol. Chem. 276(42):38665-72 (2001), which is hereby incorporated by reference in its entirety). Although YYl can bind to the α-SMA promoter, it is unknown whether it upregulates or downregulates α-SMA promoter activity (Bushel et al., "Two Serum Response Elements Mediate Transcriptional Repression of Human Smooth Muscle α-Actin Promoter in Ras-Transformed Cells," Oncogene 10(7): 1361-70 (1995), which is hereby incorporated by reference in its entirety). To investigate the ability of YYl to regulate α-SMA promoter activity, a murine 740-bp construct driving the firefly luciferase gene (α-SMA-Luc) was constructed. This construct was transfected with or without a YYl expression vector into WI-38 cells. As shown in Figure 13 A, over- expressed YYl alone significantly increased α-SMA promoter activity, and this effect was further enhanced by TGF-βi stimulation. Using electromobility gel shift assays, it was confirmed that nuclear YYl can directly bind to the α-SMA promoter, as shown in Figure 13B. Therefore, in addition to type I collagen, the α-SMA gene represents another potential YYl target in lung fibroblasts. The enhancing effects of YYl on α-SMA-Luc activity were further augmented by co-transfection with NF-κB. This finding suggests that these two factors interact to regulate α-SMA promoter activity, as shown in Figure 13 A. To determine whether YYl regulates α-SMA promoter activity in primary lung cells, lung fibroblasts were isolated from wild-type and heterozygous YY1+/" mice, which express about half the normal complement of YYl . After transient transfection using electroporation, it was found that α-SMA promoter activity was markedly decreased in fibroblasts from YY1+/" mice compared to wild-type littermates, as shown in Figure 13C. Taken together, these data provide strong support for the idea that α-SMA is a previously unrecognized and important target of YYl in primary lung fibroblasts in vivo.
Example 21 — Induction of α-SMA and Collagen Expression in Lung Tissues and Fibroblasts Isolated from Transgenic Mice (YYl ccl°) [0170] To assess the role of YYl in α-SMA regulation in vivo, a transgenic mouse was constructed in which the rat clara cell 10 (cclO) promoter drives expression of full-length YYl cDNA (γγiccl° mice). Although primarily restricted to the airway epithelium, cclO is also expressed at lower levels in lung fibroblasts (Lesur et al., "Clara Cell Protein (CC-16) Induces a Phospholipase A2-Mediated Inhibition of Fibroblast Migration in Vitro," Am. J. Respir. Crit. Care Med.
152(l):290-97 (1995), which is hereby incorporated by reference in its entirety). When lung fibroblasts were isolated from γγiccl° mice or wild type controls, α-SMA expression was strikingly increased and associated with a larger cell size, as evidenced by imrnuno fluorescent staining, as shown in Figure 14 A. As shown in Figure 14B, YYl, collagen, and α-SMA protein were increased in the fibroblasts of YYjccio mjce tøy immunob lotting. Via immunohistochemistry, increased expression of YYl, collagen 1, and α-SMA was observed in the lungs of YYlccl° mice, especially around the airways, as shown in Figure 14C. Therefore, over-expressed YYl increases α-SMA expression in fibroblasts both in vitro (see Figure 15A) and in vivo (see Figure 14B and Figure 14C).
Example 22 — α-SMA and Collagen Are Downregulated by Inhibition of YYl Expression Using YYl shRNA and Conditional Knockout YYl
Figure imgf000063_0001
[0171] To complement the gain-of-function studies in γγiccl° mice, two different YYl -knockdown approaches were used to evaluate whether α-SMA and collagen were reduced using loss-of-function strategies. First, lung fibroblasts were isolated from YYl "floxed" mice (YYlf/f), in which the exon 1 is flanked by lox-p sites to allow for Cre-mediated deletion (Liu et al., "Yin Yang 1 Is a Critical Regulator of B-CeIl Development," Genes Dev. 21(10): 1179-89 (2007), which is hereby incorporated by reference in its entirety). The lung fibroblasts were then infected with lentivirus Cre in vitro. After recovery for five days, immunob lotting was carried out using anti-YYl, demonstrating a lack of YYl expression in fibroblasts obtained from YYlf/f mice, as shown in Figure 15B. Using a Cre-GFP fusion protein, it was found that both YYl and α-SMA expression were markedly reduced in transfected fibroblasts from YYl mice, as shown in Figure 15 A. These data indicate that YYl is an important regulator of α-SMA expression in lung fibroblasts in vitro.
[0172] Whether reducing the expression of YYl would affect gene expression in human lung fibroblasts was then tested. A fibroblast cell line (LL97A) was derived from a human subject with IPF and infected using different YYl lentiviral shRNA constructs. After transduction with two controls and two YYl lentiviral shRNA constructs, LL97A cells were allowed to recover for three days and then selected in puromycin to enrich for transduced cells. Figures 15C and 15D show that decreased YYl expression inhibited both α-SMA and collagen expression in human lung fibroblasts, as determined by immunofluorescence staining and immunoblot assays. These data strongly suggest that knockdown of YYl expression in lung fibroblasts inhibits fibroblast activation. Furthermore, these data suggest that YYl may be a potential therapeutic target for fibrotic lung disease in vitro. Example 23 — Partial YYl Deficiency Protects Mice from Lung Fibrosis After Exposure to Both Silica and Bleomycin
[0173] To test the hypothesis that decreased YYl expression provides protection against lung fibrosis, two partially deficient mice were utilized in two different fibrotic lung models. First, heterozygous YYl (YY 1+/") mice (or littermate controls on the C57BL/6 background) were instilled with silica particles by intratracheal injection. Three weeks later, the mice were sacrificed and the lungs stained by immunohistochemistry. Connective tissue was also analyzed using Masson's trichrome straining. As shown in Figure 16A, lung fibrosis was markedly decreased in YY1+/" compared to WT mice (indicated by the arrow). There was elevated α-SMA, collagen, and inflammatory cell numbers in wild type compared to YY1+/" mice. α-SMA staining of scar regions present in whole lung was scored by a double blind method. As shown in Figure 16B, lung scarring was significantly diminished in YYl+/"than in WT groups. This suggests that lung fibrosis was significantly inhibited in YY1+/" mice, and that decreased YYl expression protects against lung fibrosis.
[0174] To further demonstrate that partially deficient YYl mice are protected against lung fibrosis, bleomycin was employed in another YYl -deficient mouse model, i.e., "floxed" YYlf/f mice, which are hypomorphic and express about 75% the normal amount of YYl protein due to insertion of flox-p sites flanking exon 1 of YYl (Liu et al., "Yin Yang 1 Is a Critical Regulator of B-CeIl Development," Genes Dev. 21(10): 1179-89 (2007), which is hereby incorporated by reference in its entirety). Bleomycin was administered by intratracheal instillation into wild-type of YYl littermates, and three weeks post-instillation of bleomycin, the lungs of these mice were harvested and stained by IHC. As shown in Figure 16C, it was found that lung fibrosis, YYl expression, and α-SMA expression were increased in the lungs of wild type mice compared to those of YYl f/f mice. Similar to Example 24, scar regions were scored by double blinded method depending on α-SMA expression in fibrotic lung. As shown in Figure 16D, the scores show that scarring was significantly diminished in YY lf/f compared to WT mice. Taken together, findings obtained from the two YYl -deficient mouse lines indicate that YYl is a regulator of lung fibrosis and myofibroblast differentiation. Example 24 — Treatment Instilled by Adeno-Cre in YYl* n Mice
[0175] Finally, to further demonstrate that inducible deletion of YYl could treat mice with fibrosis, adenoviral Cre was instilled into wild-type and YYlf/f mice after silica particles had been instilled into the mice for 5 days. Lungs were harvested 21 days later. Figures 17A-17D show that lung fibrosis and YYl expression were markedly attenuated in YYl (but not wild type mice) exposed to silica and treated with adenoviral Cre. As shown in Figure 17A, α-SMA and collagen were decreased in YYlf/f mice compared with wild type mice. As shown in Figure 17B, α-SMA staining of scar regions present in whole lung was scored by a double blind method. YYl expression was confirmed by immunoblot and quantitative PCR, as shown in Figures 17C and 17D.
Discussion of Examples 1-24
[0176] YYl is a versatile transcription factor that can activate, repress or initiate gene expression. Several studies had demonstrated the ability of YYl to regulate cell growth, differentiation and apoptosis, but relatively little was known about the role of YYl in irreversible chronic inflammation or tissue injury and repair responses in vivo. Examples 1-25 demonstrate that YYl mRNA and protein are upregulated in two different mouse models of lung fibrosis, as well as in lungs from human subjects with IPF (see Figures IA-I C, 2A-2C, and 3A-3C), a progressive and incurable disease. Although several lung cells types can express YYl, lung fibroblasts were focused on, because lung fibroblasts ultimately control deposition of extracellular matrix and differentiation to myofibroblasts characterizes the injury/repair response. Importantly, YYl expression was found to be highly increased in lung fibroblasts of human IPF and murine fibrotic models. This implies that the enhancement of lung fibroblasts requires YYl expression in injury/repair process. Since YYl can directly bind to the promoter regions of both the collagen (Riquet et al., "YYl Is a Positive Regulator of Transcription of the Collal Gene," J. Biol. Chem. 276(42):38665-72 (2001), which is hereby incorporated by reference in its entirety) and α-smooth muscle actin (α-SMA) genes, and is required for their expression (see Figure 13A), it was concluded that YYl directly regulates two crucial genes involved in fibroblast activation and myofibroblast differentiation. This suggested that YYl might regulate lung fibrosis in vivo, which was confirmed using both gain-of-function and loss-of-function approaches in two distinct mouse models. Thus, the present studies elucidate that by regulating gene expression in fibroblasts, YYl plays a novel role in tissue repair and fibroblast differentiation. [0177] Lung myofibroblasts derive from multiple sources including resident progenitor cells, circulating fibrocytes (Andersson-Sjoland et al, "Fibrocytes Are a Potential Source of Lung Fibroblasts in Idiopathic Pulmonary Fibrosis," Int. J. Biochem. Cell Biol. 40(10):2129-40 (2008), which is hereby incorporated by reference in its entirety) or by epithelial to mesenchymal transition (EMT) (Kuroishi et al., "Epithelial-Mesenchymal Transition Induced by Transforming Growth Factor- βl in Mouse Tracheal Epithelial Cells," Respirology 14(6):828-37 (2009); Radisky et al., "Fibrosis and Cancer: Do Myofibroblasts Come Also from Epithelial Cells via EMT?," J. Cell. Biochem. 101(4):830-39 (2007), each of which is hereby incorporated by reference in its entirety). Regardless of their derivation, the differentiation of fibroblasts into myofibroblasts is recognized as a key process in fibrotic responses. Myofibroblasts, which are characterized by expression of the α- SMA gene, are more resistant to apoptosis (Horowitz et al., "Combinatorial Activation of FAK and AKT by Transforming Growth Factor-βl Confers an Anoikis- Resistant Phenotype to Myofibroblasts," Cell Sign. 19(4):761-71 (2007); Garneau- Tsodikova & Thannickal, "Protein Kinase Inhibitors in the Treatment of Pulmonary Fibrosis," Curr. Med. Chem. 15(25):2632-40 (2008), each of which is hereby incorporated by reference in its entirety), and synthesize and secrete collagens, α- SMA, and other extracellular matrix molecules that lead to tissue remodeling. The present Examples show that YYl expression is not only increased in accumulated fibroblasts but also in individual fibroblasts by silica or bleomycin instillation (see Figures 4A-4B, Figure 5, and Figures 6A-6B). This sufficiently demonstrates that YYl expression plays a very important role in the recruitment of lung fibroblasts of fibrotic lung. It was also demonstrated that YYl directly binds to the proximal α- SMA promoter (in keeping with Ellis et al., "Increased Actin Polymerization Reduces the Inhibition of Serum Response Factor Activity by Yin Yang 1 ," Biochem. J. 364(Pt 2):547-54 (2002), which is hereby incorporated by reference in its entirety), and that over-expressed YYl enhances α-SMA gene expression. In contrast, using both shRNA and Cre-mediated knock-down of YYl expression in primary lung fibroblasts (see Figure 15A and 15C), loss of YYl was found to markedly reduce α-SMA expression. Taken together, these data suggest that YYl plays a novel role in myofibroblast differentiation at least in part by regulating α-SMA gene expression. In addition to regulating myofibroblast gene expression, YYl may also confer resistance to apoptosis (Bonavida, "Rituximab-Induced Inhibition of Antiapoptotic Cell Survival Pathways: Implications in Chemo/Immunoresistance, Rituximab, Unresponsiveness, Prognostic and Novel Therapeutic Interventions," Oncogene 26(25):3629-36 (2007) , which is hereby incorporated by reference in its entirety), which is known to be induced during lung fibrotic responses after exposure to silica (Han et al, "Angelica sinensis Down-Regulates Hydroxyproline and Tgfbl and Provides Protection in Mice with Radiation-Induced Pulmonary Fibrosis," Radiat. Res. 165(5):546-52 (2006); Gambelunghe et al., "[Crystalline Silica Can Induce Oxidative Stress by Inhibiting Glyoxalase System in Bronchial Epithelial Cells]," G. Ital. Med. Lav. Ergon. 29(3 Suppl): 397-99 (2007), each of which is hereby incorporated by reference in its entirety), TGF-β (Honda et al., "Immunogenetic Analysis of Silicosis in Japan," Am. J. Respir. Cell MoI. Biol. 8(1): 106-11 (1993), which is hereby incorporated by reference in its entirety), and TNF-α (Huerta-Yepez et al., "Involvement of the TNF-α Autocrine-Paracrine Loop, via NF -KB and YYl, in the Regulation of Tumor Cell Resistance to Fas-Induced Apoptosis," Clin. Immunol. 120(3):297-309 (2006); Zhao et al., "Time-Dependent Apoptosis of Alveolar Macrophages from Rats Exposed to Bleomycin: Involvement of TNF Receptor 2," J. Toxicol. Environ. Health A 67(17): 1391-06 (2004)), each of which is hereby incorporated by reference in its entirety). Thus decreasing YYl expression may attenuate fibrotic responses by decreasing myofibroblast resistance to apoptosis, in keeping with a growing role for YYl in cell survival in response to injury (Cunningham et al., "mTOR Controls Mitochondrial Oxidative Function Through a YYl -PGC- lα Transcriptional Complex," Nature 450(7170):736-406 (2007); Grubach et al., "Gene Expression Profiling of Polycomb, Hox and Meis Genes in Patients with Acute Myeloid Leukaemia," Eur. J. Haematol. 81(2):112-22 (2008), each of which is hereby incorporated by reference in its entirety). [0178] Direct exposure to profϊbrotic silica particles, or indirect exposure to the profibrotic cytokines TNF-α and TGF-β, were found to induce YYl expression in fibroblasts (see Figures 7A-7F, 8A-B, and 9A-9F, and 1 OA-I OB). Although YYl is upregulated by TGF-β in LPS-induced macrophage (Joo et al., "Yin Yang 1 Enhances Cycloxygenase-2 Gene Expression in Macrophages," Am. J. Physiol. Lung Cell. MoI. Physiol. 292(5):L1219-26 (2007), which is hereby incorporated by reference in its entirety), LPS induced the inflammation is different from the inflammation in silica- induced. In contrast YYl expression was not found to be affected in alveolar macrophages by TNF-α or silica (see Figure 11). Silica and asbestos particles have been shown to activate the Nalp3 containing inflammasome and induce caspase-1 driven processing of mature IL- lβ, (Hornung et al., "Silica Crystals and Aluminum Salts Activate the NALP3 Inflammasome Through Phagosomal Destabilization," Nat. Immunol. 9(8):847-56 (2008); Dostert et al., "Innate Immune Activation Through Nalp3 Inflammasome Sensing of Asbestos and Silica," Science 320(5876):674-77 (2008); Cassel et al., "The Nalp3 Inflammasome Is Essential for the Development of Silicosis," Proc. N at' I Acad. Sd. U.S.A. 105(26):9035-40 (2008), each of which is hereby incorporated by reference in its entirety), which the present Examples also show upregulates fibroblast YYl expression in vitro (see Figure 18). Cytokine- dependent induction of YYl required the transcription factor NF -KB (see Figures 12A-12C and 13A-13C), in keeping with prior studies in other cell types (Huerta- Yepez et al., "Involvement of the TNF-α Autocrine-Paracrine Loop, via NF-κB and YYl, in the Regulation of Tumor Cell Resistance to Fas-Induced Apoptosis," Clin. Immunol. 120(3):297-309 (2006); Baritaki et al., "Inhibition of Yin Yang 1- Dependent Repressor Activity of DR5 Transcription and Expression by the Novel Proteasome Inhibitor NPI-0052 Contributes to Its TRAIL-Enhanced Apoptosis in Cancer Cells," J. Immunol. 180(9):6199-210 (2008), each of which is hereby incorporated by reference in its entirety). Thus in addition to promoting expression of cytokines, chemokines, and other mediators that promote inflammation, the present Examples suggest that by inducing YYl expression, NF -KB promotes the expression of genes involved in tissue repair responses. Increased YYl expression mediated by NF-κB can downregulate Fas and death receptor 5 (DR5) (Huerta-Yepez et al., "Involvement of the TNF-α Autocrine-Paracrine Loop, via NF -KB and YYl, in the Regulation of Tumor Cell Resistance to Fas-Induced Apoptosis," Clin. Immunol. 120(3):297-309 (2006); Huerta-Yepez et al, "Nitric Oxide Sensitizes Tumor Cells to TRAIL-Induced Apoptosis via Inhibition of the DR5 Transcription Repressor Yin Yang 1," Nitric Oxide 20(l):39-52 (2009), each of which is hereby incorporated by reference in its entirety) expression and consequently protect lung myofibroblasts from apoptosis. Smads are also activated by TGF-β during lung fibrosis, and although Smad3 can bind to different domains of YYl (Kurisaki et al., "Nuclear Factor YYl Inhibits Transforming Growth Factor β- and Bone Morphogenetic Protein-Induced Cell Differentiation," MoI. Cell Biol. 23(13):4494-510 (2003), which is hereby incorporated by reference in its entirety), the present Examples found that over-expressed Smad3 did not regulate YYl promoter activity in lung fibroblasts. Since TGF-β and TNF-α are universally implicated in injury/repair and remodeling, it is predicted that YYl will play a role in fibroblast differentiation and activation in diverse tissues, and that the paradigms established in the present Examples should be broadly generalizable.
[0179] Two distinct models of lung fibrosis were used and it was found that even partial YYl deficiency protected mice from the effects of both silica particles and bleomycin. Using both models, lung fibrosis was found to be reduced in YYl deficient mice using both quantitative and qualitative readouts of fibroblast activation and differentiation, in keeping with studies of lung fibroblasts in vitro. Since exposure to silica and bleomycin are thought to induce lung fibrosis by different mechanisms (i.e., mitochondria and lysosome damage caused by silica versus DNA damage caused by bleomycin), this important result suggests that YYl activation is a final common mechanism leading to fibrosis during repair responses. YYl also plays a role in DNA repair by homologous recombination (Wu et al., "A YY1-INO80
Complex Regulates Genomic Stability Through Homologous Recombination-Based Repair," Nat. Struct. MoI. Biol. 14(12): 1165-72 (2007), which is hereby incorporated by reference in its entirety). Therefore, YYl expression may repair damaged DNA in lung fibrosis. Although Rag knockout mice still develop lung fibrosis in response to fluorescein isothiocyanate (Christensen et al., "Induction of Lung Fibrosis in the Mouse by Intratracheal Instillation of Fluorescein Isothiocyanate Is not T-CeIl- Dependent," Am. J. Pathol. 155(5): 1773-79 (1999), which is hereby incorporated by reference in its entirety), adaptive immune response still can accelerate the formation of lung fibrosis. YYl can enhance cyclooxygenase-2 expression in alveolar macrophages, which plays a role in inflammation of lung fibrosis (Joo et al., "Yin Yang 1 Enhances Cycloxygenase-2 Gene Expression in Macrophages," Am. J. Physiol. Lung Cell. MoI. Physiol. 292(5):L1219-26 (2007), which is hereby incorporated by reference in its entirety), and can increase cytokine expression (Guo et al., "Yin Yang-1 Activates Interleukin-4 Gene Expression in T Cells," J. Biol. Chem. 276(52):48871-78 (2001); Guo et al., Yin Yang 1 Regulates Effector Cytokine Gene Expression and TH2 Immune Responses," J. Allergy Clin. Immunol. 122(1): 195-201.e5 (2008), each of which is hereby incorporated by reference in its entirety) in T cells. Thus decreasing YYl expression may inhibit inflammation during injury/repair responses, and may help to protect against lung fibrosis by this mechanism. In support of this idea, lower levels of inflammatory cytokines were detected in bronchoalveolar lavage fluids from silica challenged YY1+/" compared to wild type controls (see Figure 19). The YY1+/" heterozygous mice used in this study express about 50% of normal YYl levels (Affar el et al., "Essential Dosage- Dependent Functions of the Transcription Factor Yin Yang 1 in Late Embryonic Development and Cell Cycle Progression," MoI. Cell Biol. 26(9):3565-81 (2006); Donohoe et al., "Targeted Disruption of Mouse Yin Yang 1 Transcription Factor Results in Peri-Implantation Lethality," MoI. Cell Biol. 19(10): 7237-44 (1999), each of which is hereby incorporated by reference in its entirety), whereas the YYlf/f alleles are hypomorphic leading to expression of about 75% of normal levels of YYl (Liu et al., "Yin Yang 1 Is a Critical Regulator of B-CeIl Development," Genes Dev. 21(10): 1179-89 (2007); Affar el et al., "Essential Dosage-Dependent Functions of the Transcription Factor Yin Yang 1 in Late Embryonic Development and Cell Cycle Progression," MoI. Cell Biol. 26(9):3565-81 (2006), each of which is hereby incorporated by reference in its entirety). In an additional approach, it was also found that decreasing YYl expression by adenoviral Cre in YYlf/f mice can protect from lung fibrosis. This approach by exogenous Iy given adenoviral Cre suggests that similar strategies may be useful therapeutically. Thus these data indicate that during tissue inflammation and repair responses in vivo, YYl regulates gene expression in a gene-dosage dependent manner, consistent with prior studies in a model of allergic lung inflammation (Guo et al., Yin Yang 1 Regulates Effector Cytokine Gene Expression and TH2 Immune Responses," J. Allergy Clin. Immunol. 122(1): 195- 201.e5 (2008), which is hereby incorporated by reference in its entirety). [0180] YYl is generally considered a constitutively expressed nuclear phosphoprotein, but there is growing evidence that YYl expression can be dynamically regulated, including by compounds in therapeutic use. For example, YYl and NF -KB expression are diminished in B cells by Rituximab, which is an anti- CD20 antibody used for treating B cell non-Hodgkin's lymphoma (Bonavida, "Rituximab-Induced Inhibition of Antiapoptotic Cell Survival Pathways: Implications in Chemo/Immunoresistance, Rituximab, Unresponsiveness, Prognostic and Novel Therapeutic Interventions," Oncogene 26(25):3629-36 (2007), which is hereby incorporated by reference in its entirety). Nitric oxide (NO) can also inhibit YYl expression in human tumor cells (Hongo et al., "Inhibition of the Transcription Factor Yin Yang 1 Activity by S-Nitrosation," Biochem. Biophys. Res. Commun. 336(2): 692-701 (2005), which is hereby incorporated by reference in its entirety) as well as in lung fibroblasts, which may explain some of the therapeutic benefits of inhaled NO in lung fibrosis (Yung et al., "Outpatient Inhaled Nitric Oxide in a Patient with Idiopathic Pulmonary Fibrosis: A Bridge to Lung Transplantation," J. Heart Lung Transplant. 20(11): 1224-27 (2001), which is hereby incorporated by reference in its entirety).
Example 25 — Dominant Negative YY-I Protein Represses α-SMA Promoter Activity
[0181] YY-I binds to its core consensus sequence, 5'-CCAT-3', using a C- terminal zinc finger DNA binding domain (DBD). A YY-I DBD mutant lacking the four zinc finger domains that no longer binds DNA (DZ-YYl) was constructed and its capacity to interfere with YY-I transcriptional activity was assessed. As demonstrated in Figure 20, DZ-YYl represses basal and TGF-β induced α-SMA promoter activity in vitro. These data show that an intact YY-I DBD is essential for transacting effects of YYl. Example 26 — H3K27 Trimethylation Is Enhanced in Lung Pulmonary Fibrosis
[0182] In addition to directly regulating gene expression at the transcriptional level, YYl is intimately involved in chromatin remodeling and epigenetic imprinting. For example, YYl can recruit histone H4-specific methyltransferases to its target promoters (Rezai-Zadeh et al., "Targeted Recruitment of a Histone H4-Specific Methyltransferase by the Transcription Factor YY 1 ," Genes Dev. 17(8): 1019-29 (2003), which is hereby incorporated by reference in its entirety), and together with Polycomb group family members generates high levels of H3-K27 trimethylation needed to maintain a repressed chromatin state (Caretti et al., "The Polycomb Ezh2 Methyltransferase Regulates Muscle Gene Expression and Skeletal Muscle Differentiation," Genes. Dev. 18(21):2627-38 (2004); van Leenders et al., "Polycomb-Group Oncogenes EZH2, BMIl, and RINGl Are Overexpressed in Prostate Cancer with Adverse Pathologic and Clinical Features," Eur. Urol. 52(2):455-63 (2007); Nekrasov et al., "Pcl-PRC2 Is Needed to Generate High Levels of H3-K27 Trimethylation at Polycomb Target Genes," Embo. J. 26(18):4078-88 (2007), each of which is hereby incorporated by reference in its entirety). [0183] The level of H3K27 trimethylation was investigated in lung tissues derived from human patients having IPF and compared to that of normal human lung tissue. Figure 21 A is a western blot of lung tissue samples showing the increase in H3 trimethylation in IPF lung samples compared to normal healthy lung tissue. As shown in Figure 2 IB, an increase in H3K27 methylation was also observed in lung tissue from mice intratracheally exposed to silica. Time course and dose dependent in vivo silica exposures in mice show an increase in H3 trimethylation at low dose (4 ug) of silica at all timepoints tested, as shown in Figure 22. [0184] H3K27 trimethylation is, in part, mediated by YY-I expression, as shown in Figure 23. Lung fibroblasts isolated from YYlf/f mice were trans fected with Cre-recombinase-GFP fusion protein to attenuate YY-I expression and H3K27 trimethylation was assessed using fluorescence immunocytochemistry. Non- transfected cells, expressing normal levels of YY-I protein, have a higher level of H3K27 trimethylation than transfected cells. Example 27 — EZH2 Expression Is Enhanced in Lung Pulmonary Fibrosis
[0185] To investigate the relevance of EZH2 expression in lung pulmonary fibrosis, the EZH2 mRNA expression level was determined in IPF lung samples and normal healthy lung samples. Figure 24 shows a four-fold induction of EZH2 expression in IPF lung samples compared to its expression in healthy lung samples.
Example 28 — Use of DZ-YYl to Inhibit Fibrosis
[0186] Because DZ-YYl has "dominant negative" activity on α-SMA promoter activity, its therapeutic potential for inhibiting silica dependent fibroblast activation in vitro and silica induced fibrosis in vivo will be investigated. [0187] WI-38 fibroblasts will be grown to 70-80% confluence and transfected by electroporation (300 volts, 1050 capacitance) with the α-SMA luciferase reporter with or without pSG5 DZ-YYl (1-6 μg) or empty vector control. After recovery for 16 hours, cells will be transferred to 1% serum for 12 hours, and then stimulated with Crystalline silica (1, 10, 20, 40 μg/ml) for 6, 12, 24, and 48 hours followed by analysis of α-SMA promoter activity by luminescence. Renilla luciferase will be co- transfected as internal control for transfection efficiency and results will be expressed both as raw RLU and also relative to renilla luciferase. A separate aliquot of cells will be lysed and used to evaluate YY-I and α-SMA protein expression and RNA expression. [0188] For in vivo studies using DZ-YYl , C57BL/6 wild-type mice will be exposed intranasally to silica either before or after DZ-YYl administration (see Figure 25). Using this approach, whether DZ-YYl can prevent or reverse fibrosis will be determined. A 4:1 molar ratio of DZ-YYl with transfection reagents LipofectAMINE or DOTAP (N-[l-(2,3-dioleoyl)propyl]-N,N,N-trimethylammonium methylsulfate) will be prepared to form DNA-liposome complexes (Invitrogen Life Technologies and Boehringer Mannheim, respectively). Complexes will be prepared in distilled water and incubated for 10 minutes before being administered to anesthetized mice as follows. Ketamine and xylazine (80-100 mg/kg plus 10 mg/kg, respectively) will be administered intraperitoneally and mice placed onto heated boards in the supine position. Mice will be administered 100 μg plasmid DNA- liposome complex in 60 μl final volume, followed by recovery at a 45° angle to ensure aspiration. This is essentially identical to the silica protocol. Control groups will receive equal amounts of sterile saline, or transfection reagent plus empty vector pSG5. All plasmids will be prepared using endotoxin-free columns, and incubated at 300C for 20 minutes prior to injection. To determine whether DZ-YYl administration can prevent silica induced fibrosis, mice will be administered three weekly treatments of DZ-YYl beginning one week prior to silica and then weekly for two weeks followed by sacrifice at three weeks. To determine whether DZ-YYl administration can reverse the formation of fibrosis, mice will be administered three weekly treatments of DZ-YYl beginning three weeks after silica exposure followed by sacrifice at six weeks. At time of sacrifice, bronchial-alveolar lavage (BAL) will be harvested for cell count analysis and production of cytokines and chemokines in BAL supernatant using bead array technology. Lungs will be perfused with PBS, fixed in 10% formaldehyde, and processed for histochemical analysis using H&E staining, Masson's trichrome, and α-SMA expression. One lung lobe will be removed and homogenized with PBS for measuring collagen, α-SMA, and hydroxyproline using western blot and ELISA.
[0189] It is expected that the dominant negative DZ-YYl protein will compete with endogenous YYl protein, decreasing YY-I activities related to cell cycle progression, cell proliferation, and chromatin remodeling. [0190] Although preferred embodiments have been depicted and described in detail herein, it will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, and the like can be made without departing from the spirit of the invention and these are therefore considered to be within the scope of the invention as defined in the claims which follow.

Claims

WHAT IS CLAIMED:
1. A method of diagnosing a fibrotic condition in a subject, said method comprising: measuring the level of trimethylation at lysine residue 27 of histone-3 ("H3K27") in a biological sample from the subject; comparing the level of H3K27 trimethylation in the biological sample to a standard level of H3K27 trimethylation; and diagnosing the presence or absence of a fibrotic condition based on said comparing.
2. The method according to claim 1, wherein the standard level of H3K27 trimethylation comprises an average level of trimethylation at lysine residue 27 of histone-3 in a non- fibrotic sample, and a higher level of H3K27 trimethylation in the biological sample from the subject compared to the standard level of H3K27 trimethylation indicates the presence of a fibrotic condition in the subject.
3. The method according to claim 1, wherein the standard level of H3K27 trimethylation comprises an average level of trimethylation at lysine residue 27 of histone-3 in a fibrotic sample, and a lower level of H3K27 trimethylation in the biological sample from the subject compared to the standard level of H3K27 trimethylation indicates the absence of a fibrotic condition in the subject.
4. The method according to claim 1, wherein the fibrotic condition is pulmonary fibrosis, cardiac fibrosis, kidney fibrosis, liver fibrosis, neurofϊbrosis, or skin fibrosis.
5. The method according to claim 1, wherein said measuring comprises: detecting H3K27 trimethylation using an immunodetection assay with a binding molecule that recognizes and binds to a trimethylated lysine 27 residue of histone-3.
6. A method of diagnosing a fibrotic condition in a subject, said method comprising: measuring the expression level of Enhancer of Zeste Homolog 2 ("EZH2") or Yin- Yang- 1 ("YY-I") in a biological sample from the subject; comparing the expression level of EZH2 or YY-I in the biological sample from the subject to a standard expression level of EZH2 or YY-I; and diagnosing the presence of absence of a fibrotic condition based on said comparing.
7. The method according to claim 6, wherein the standard expression level of EZH2 or YY-I comprises an average expression level of EZH2 or YY-I in a non- fibrotic sample, and a higher expression level of EZH2 or YY-I in the biological sample from the subject compared to the standard expression level indicates the presence of a fibrotic condition in the subject.
8. The method according to claim 6, wherein the standard expression level of EZH2 or YY-I comprises an average expression level of EZH2 or YY-I in a fibrotic sample, and a lower expression level of EZH2 or YY-I in the biological sample from the subject compared to the standard expression level indicates the presence of fibrosis a fibrotic condition in the subject.
9. The method according to claim 6, wherein the fibrotic condition is pulmonary fibrosis, cardiac fibrosis, kidney fibrosis, liver fibrosis, or skin fibrosis.
10. The method according to claim 6, wherein said measuring comprises: measuring the RNA expression level of EZH2 or YY-I .
11. The method according to claim 10, wherein the RNA expression level is measured using a nucleic acid hybridization assay or a nucleic acid amplification assay.
12. The method according to claim 6, wherein said measuring comprises: measuring the protein expression level of EZH2 or YY-I.
13. The method according to claim 12, wherein the protein expression level is measured using an immunodetection assay.
14. A method of treating a subject having a fibrotic condition, said method comprising : administering to the subject an agent that inhibits or reduces trimethylation at lysine residue 27 of histone-3 under conditions effective to treat a fibrotic condition in the subject.
15. The method according to claim 14 further comprising: selecting a subject having a fibrotic condition before said administering.
16. The method according to claim 14, wherein said fibrotic condition is pulmonary fibrosis, cardiac fibrosis, kidney fibrosis, liver fibrosis, neurofibrosis, or skin fibrosis.
17. The method according to claim 14, wherein the agent is a histone lysine demethylase.
18. The method according to claim 17, wherein the histone lysine demethylase is (a) jumonji domain containing-3 ("JMJD3") or (b) ubiquitously transcribed tetratricopeptide repeat, X chromosome ("UTX") demethylase.
19. The method according to claim 14, wherein the agent is an
EZH2 inhibitor.
20. The method according to claim 19, wherein the EZH2 inhibitor is a siRNA or shRNA molecule that interferes with EZH2 expression.
21. The method according to claim 20, wherein the siRNA molecule that interferes with EZH2 expression comprises a nucleotide sequence selected from the siRNA molecules disclosed in U.S. Patent Publication No. 2005/0159382.
22. The method according to claim 14, wherein the agent is a YY-I inhibitor.
23. The method according to claim 22, wherein the agent is NPI- 0052.
24. The method according to claim 22, wherein the agent is nitric oxide or a nitric oxide donor.
25. The method according to claim 22, wherein the agent is a protein or peptide inhibitor of YY-I .
26. The method according to claim 25, wherein the protein inhibitor is an antibody.
27. The method according to claim 26, wherein the antibody is Rituximab.
28. The method according to claim 25, wherein the protein inhibitor is a dominant negative YY-I protein.
29. The method according to claim 25, wherein the YY-I inhibitor is a siRNA or shRNA molecule that interferes with YY-I expression.
30. The method according to claim 29, wherein the siRNA molecule that interferes with YY-I expression has a nucleotide sequence comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, or SEQ ID NO:26.
31. The method according to claim 14, wherein the agent is a histone deacetylase inhibitor.
32. The method according to claim 31 , wherein the histone lysine deactylase inhibitor is selected from the group consisting of apicidin, nucleoplasmin, chamydocin, Cyl-2, cyclic(eta-oxo-alpha-aminooxiraneoctanoylphenylalanylleucyl-2- piperidinecarbonyl (WF-3161), depudecin, radicocol, oxamfϊatin, suberoxylanilide hydroxamic acid, the cinnamic hydroxamic acid analog, LBH589, 2-amino-8-oxo- 9,10-epoxy-decanoic acid, butyrate, trapoxin analogs, trichostatin A, valproic acid and its derivatives, carbamic acid compounds comprising sulfonamide linkages, compounds having a zinc-binding moiety, cyclic tetrapeptide derivatives m- carboxycinnamic acid bis-hydroxamie, FK228, M344, 3-(4-aroyl-2-pyrrolyl)-N- hydroxy-2-propenamide, and (2E)-N-hydroxy-3-[4-[[(2-hydroxyethyl[2-(lH-indol-3- yl)ethyl] amino]methyl]phenyl] -2-propenamide (LAQ824) .
33. The method according to claim 14, wherein a pharmaceutical formulation containing the agent is administered.
34. The method according to claim 33, wherein the pharmaceutical formulation is administered topically.
35. The method according to claim 33, wherein the pharmaceutical formulation is administered systemically via an enteral or parenteral route of administration.
36. The method according to claim 33, wherein the pharmaceutical formulation is administered to the site of fibrosis.
37. The method according to claim 14, wherein said administering further comprises administering an anti-inflammatory agent.
38. The method according to claim 37, wherein the antiinflammatory agent is selected from the group consisting of nimesulide, A- hydroxynimesulide, flosulide, meloxicam, celecoxib, and Rofecoxib.
39. The method according to claim 14, wherein said administering is repeated.
40. A pharmaceutical composition comprising: a pharmaceutically acceptable delivery vehicle; and an effective amount of one or more agents selected from the group consisting of an agent that inhibits or reduces trimethylation at lyside residue 27 of histone-3 ("H3K27"), an inhibitor of EZH2, an inhibitor of YY-I, an inhibitor of histone deacetylase, which is suitable to treat a fibrotic condition.
41. The pharmaceutical composition according to claim 40, wherein the agent that inhibits or reduces H3K27 trimethylation is present.
42. The pharmaceutical composition according to claim 41, wherein the agent that inhibits or reduces H3K27 trimethylation is a recombinant histone lysine demethylase.
43. The pharmaceutical composition according to claim 40, wherein the inhibitor of EZH2 is present.
44. The pharmaceutical composition according to claim 43, wherein the inhibitor of EZH2 is an antibody, antibody fragment or antibody mimic that binds specifically to EZH2, a peptide or nucleic acid aptamer that binds specifϊcally to EZH2, an inhibitory nucleic acid molecule, or an expression vector that encodes an inhibitory nucleic acid molecule.
45. The pharmaceutical composition according to claim 44, wherein the inhibitory nucleic acid molecule is an siRNA molecule selected from the siRNA molecules disclosed in U.S. Patent Publication No. 2005/0159382.
46. The pharmaceutical composition according to claim 40, wherein the inhibitor of YY-I is present.
47. The pharmaceutical composition according to claim 46, wherein the inhibitor of YY-I is an antibody, antibody fragment or antibody mimic that binds specifically to YY-I, a peptide or nucleic acid aptamer that binds specifically to YY-I, an inhibitory nucleic acid molecule, or an expression vector that encodes an inhibitory nucleic acid molecule.
48. The pharmaceutical composition according to claim 47, wherein the inhibitor of YY-I is Rituximab.
49. The pharmaceutical composition according to claim 46, wherein the inhibitor of YY-I is NPI-0052.
50. The pharmaceutical composition according to claim 46, wherein the inhibitor of YY-I is nitric oxide or a nitric oxide donor.
51. The pharmaceutical composition according to claim 40, wherein the inhibitor of histone deacetylase is present.
52. The pharmaceutical composition according to claim 51 , wherein the inhibitor of histone deacetylase is selected from the group consisting of apicidin, nucleoplasmin, chamydocin, Cyl-2, cyclic(eta-oxo-alpha- aminooxiraneoctanoylphenylalanylleucyl-2-piperidinecarbonyl (WF-3161), depudecin, radicocol, oxamfiatin, suberoxylanilide hydroxamic acid, the cinnamic hydroxamic acid analog, LBH589, 2-amino-8-oxo-9,10-epoxy-decanoic acid, butyrate, trapoxin analogs, trichostatin A, valproic acid and its derivatives, carbamic acid compounds comprising sulfonamide linkages, compounds having a zinc-binding moiety, cyclic tetrapeptide derivatives m-carboxycinnamic acid bis-hydroxamie, FK228, M344, 3-(4-aroyl-2-pyrrolyl)-N-hydroxy-2-propenamide, and (2E)-N- hydroxy-3-[4-[[(2 -hydro xyethyl[2-(lH-indol-3-yl)ethyl]amino]methyl]phenyl]-2- propenamide (LAQ824).
53. A method of identifying an agent that is effective for treating fibrosis, said method comprising: obtaining a first biological sample from an in vivo or in vitro experimental model of fibrosis; administering a candidate agent to the experimental model; obtaining a second biological sample from the experimental model after said administering; measuring the level of trimethylation at lysine residue 27 of histone-3 ("H3K27") in the first and second biological samples; and comparing the level of H3K27 trimethylation in the first and second biological samples, wherein a decrease in the level of H3K27 trimethylation in the second biological sample relative to the level of H3K27 trimethylation in the first biological sample indicates that the agent is effective for treating fibrosis.
54. The method according to claim 53, wherein the in vivo experimental model of fibrosis comprises a silica or bleomycin-treated mouse model.
55. The method according to claim 53, wherein the in vitro experimental model of fibrosis comprises a cell or tissue sample derived from fibrotic tissue.
56. The method according to claim 53, wherein the fibrosis is pulmonary fibrosis, cardiac fibrosis, kidney fibrosis, liver fibrosis, neurofibrosis, or skin fibrosis
PCT/US2009/063016 2008-10-31 2009-11-02 Methods of diagnosing and treating fibrosis Ceased WO2010051550A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US13/126,875 US9107942B2 (en) 2008-10-31 2009-11-02 Methods of diagnosing and treating fibrosis
US14/814,238 US20160025745A1 (en) 2008-10-31 2015-07-30 Methods of diagnosing and treating fibrosis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US11026708P 2008-10-31 2008-10-31
US61/110,267 2008-10-31

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/126,875 A-371-Of-International US9107942B2 (en) 2008-10-31 2009-11-02 Methods of diagnosing and treating fibrosis
US14/814,238 Division US20160025745A1 (en) 2008-10-31 2015-07-30 Methods of diagnosing and treating fibrosis

Publications (1)

Publication Number Publication Date
WO2010051550A1 true WO2010051550A1 (en) 2010-05-06

Family

ID=42129331

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/063016 Ceased WO2010051550A1 (en) 2008-10-31 2009-11-02 Methods of diagnosing and treating fibrosis

Country Status (2)

Country Link
US (2) US9107942B2 (en)
WO (1) WO2010051550A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014167564A1 (en) * 2013-04-08 2014-10-16 Carmel-Haifa University Economic Corporation Ltd. Sept4/ARTS AS A TUMOR SUPPRESSOR IN THE DIAGNOSIS, PROGNOSIS AND TREATMENT OF HEPATIC DISORDERS
AU2012332297B2 (en) * 2011-11-04 2016-01-07 Glaxosmithkline Intellectual Property (No.2) Limited Method of treatment
CN108379245A (en) * 2018-02-05 2018-08-10 广东药科大学 Application of N- (2- the ethoxyl phenenyls)-N- hydroxyl suberamides in preparing anti-hepatic fibrosis medicines

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013144672A1 (en) * 2012-03-30 2013-10-03 Société De Développement Et De Recherche Industrielle Method and kit for the classification and prognosis of wounds
KR101468773B1 (en) * 2012-10-04 2014-12-09 중앙대학교 산학협력단 Pharmaceutical Composition Comprising Histone H3K9 Methyltransferase G9a for Preventing and Treating Myeloproliferative Disorders
KR102229478B1 (en) 2012-11-01 2021-03-18 인피니티 파마슈티칼스, 인코포레이티드 Treatment of cancers using pi3 kinase isoform modulators
US20160024051A1 (en) 2013-03-15 2016-01-28 Infinity Pharmaceuticals, Inc. Salts and solid forms of isoquinolinones and composition comprising and methods of using the same
ES2834638T3 (en) 2013-05-30 2021-06-18 Infinity Pharmaceuticals Inc Cancer treatment using PI3 kinase isoform modulators
PE20160685A1 (en) 2013-10-04 2016-07-23 Infinity Pharmaceuticals Inc HETEROCYCLIC COMPOUNDS AND USES OF THEM
US9751888B2 (en) 2013-10-04 2017-09-05 Infinity Pharmaceuticals, Inc. Heterocyclic compounds and uses thereof
WO2015061204A1 (en) 2013-10-21 2015-04-30 Infinity Pharmaceuticals, Inc. Heterocyclic compounds and uses thereof
WO2015120372A2 (en) * 2014-02-10 2015-08-13 University Of Rochester Compositions and methods to inhibit ezh2 for the treatment of cardiovascular diseases
SG10201808053XA (en) 2014-03-19 2018-10-30 Infinity Pharmaceuticals Inc Heterocyclic compounds for use in the treatment of pi3k-gamma mediated disorders
US20150320754A1 (en) 2014-04-16 2015-11-12 Infinity Pharmaceuticals, Inc. Combination therapies
US9708348B2 (en) 2014-10-03 2017-07-18 Infinity Pharmaceuticals, Inc. Trisubstituted bicyclic heterocyclic compounds with kinase activities and uses thereof
US10961532B2 (en) 2015-04-07 2021-03-30 The General Hospital Corporation Methods for reactivating genes on the inactive X chromosome
US10160761B2 (en) 2015-09-14 2018-12-25 Infinity Pharmaceuticals, Inc. Solid forms of isoquinolinones, and process of making, composition comprising, and methods of using the same
AU2017217688B2 (en) * 2016-02-10 2023-01-19 Wake Forest University Health Sciences Model system of liver fibrosis and method of making and using the same
US10919914B2 (en) 2016-06-08 2021-02-16 Infinity Pharmaceuticals, Inc. Heterocyclic compounds and uses thereof
MX391135B (en) 2016-06-24 2025-03-21 Infinity Pharmaceuticals Inc COMBINATION THERAPIES.
US11400099B2 (en) 2016-09-23 2022-08-02 Thomas Jefferson University Drug-induced epigenetic remodeling to prevent fibrosis
US12605387B2 (en) 2020-07-24 2026-04-21 Secura Bio, Inc. Treatment of cancers using PI3 kinase isoform modulators
CN120437063A (en) * 2025-05-13 2025-08-08 上海交通大学医学院附属第九人民医院 Liposomes targeting lung macrophages and their application in the treatment of pulmonary fibrosis
CN120459328A (en) * 2025-05-13 2025-08-12 上海交通大学医学院附属第九人民医院 Application of KDM6A in lung macrophages in the treatment, prevention or diagnosis of pulmonary fibrosis

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050059682A1 (en) * 2003-09-12 2005-03-17 Supergen, Inc., A Delaware Corporation Compositions and methods for treatment of cancer
US20050159382A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of polycomb group protein EZH2 gene expression using short interfering nucleic acid (siNA)
US20060003958A1 (en) * 2004-05-11 2006-01-05 Melville Mark W Novel polynucleotides related to oligonucleotide arrays to monitor gene expression
US20060257403A1 (en) * 2005-04-14 2006-11-16 Young Deborah A Methods for treating and preventing fibrosis

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050122210A (en) * 2003-03-17 2005-12-28 다케다 샌디에고, 인코포레이티드 Histone deacetylase inhibitors
WO2007011372A2 (en) * 2004-09-09 2007-01-25 The Regents Of The University Of California Therapeutic and prognostic factor yy1 in human cancer

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050159382A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of polycomb group protein EZH2 gene expression using short interfering nucleic acid (siNA)
US20050059682A1 (en) * 2003-09-12 2005-03-17 Supergen, Inc., A Delaware Corporation Compositions and methods for treatment of cancer
US20060003958A1 (en) * 2004-05-11 2006-01-05 Melville Mark W Novel polynucleotides related to oligonucleotide arrays to monitor gene expression
US20060257403A1 (en) * 2005-04-14 2006-11-16 Young Deborah A Methods for treating and preventing fibrosis

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
AGGER ET AL.: "UTX and JMJD3 are histone H3K27 demethylases involved in HOX gene regulation and development.", NATURE REVIEWS GENETICS, vol. 449, 11 October 2007 (2007-10-11), pages 731 - 734 *
BARITAKI ET AL.: "'Inhibition of Yin Yang 1-Dependent Repressor Activity of DR5 Transcription and Expression by the Novel Proteasome Inhibitor NPI-0052 Contributes to its TRAIL-Enhanced Apoptosis in Cancer Cells.", THE JOURNAL OF IMMUNOLOGY, vol. 180, May 2008 (2008-05-01), pages 6199 - 6210 *
BURGESS ET AL.: "PPARy agonists inhibit TGF-y induced pulmonary myofibroblast differentiation and collagen production: implications for therapy of lung fibrosis.", AMERICAN JOURNAL OF PHYSIOLOGY - LUNG CELLULAR AND MOLECULAR PHYSIOLOGY, vol. 288, 25 February 2005 (2005-02-25), pages 1146 - 1153 *
MARTINEZ-CHANTAR ET AL.: "Loss of the Glycine N-Methyltransferase Gene Leads to Steatosis and Hepatocellular Carcinoma in Mice.", HEPATOLOGY, vol. 47, no. 4, April 2008 (2008-04-01), pages 1191 - 1199 *
MOELLER ET AL.: "The bleomycin animal model: A useful tool to investigate treatment options for idiopathic pulmonary fibrosis?", THE INTERNATIONAL JOURNAL OF BIOCHEMISTRY & CELL BIOLOGY, vol. 40, no. 3, 30 August 2007 (2007-08-30), pages 362 - 382 *
VEGA ET AL.: "Rituximab-Induced Inhibition of YY1 and Bcl-xL Expression in Ramos Non- Hodgkin's Lymphoma Cell Line via Inhibition of NF-kB Activity: Role of YY1 and Bcl-xL in Fas Resistance and Chemoresistance, Respectively.'", THE JOURNAL OF IMMUNOLOGY, vol. 175, 2005, pages 2174 - 2183 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2012332297B2 (en) * 2011-11-04 2016-01-07 Glaxosmithkline Intellectual Property (No.2) Limited Method of treatment
WO2014167564A1 (en) * 2013-04-08 2014-10-16 Carmel-Haifa University Economic Corporation Ltd. Sept4/ARTS AS A TUMOR SUPPRESSOR IN THE DIAGNOSIS, PROGNOSIS AND TREATMENT OF HEPATIC DISORDERS
CN108379245A (en) * 2018-02-05 2018-08-10 广东药科大学 Application of N- (2- the ethoxyl phenenyls)-N- hydroxyl suberamides in preparing anti-hepatic fibrosis medicines
CN108379245B (en) * 2018-02-05 2020-02-18 广东药科大学 Application of N-(2-ethoxyphenyl)-N-hydroxysuberamide in the preparation of anti-hepatic fibrosis drugs

Also Published As

Publication number Publication date
US9107942B2 (en) 2015-08-18
US20110286990A1 (en) 2011-11-24
US20160025745A1 (en) 2016-01-28

Similar Documents

Publication Publication Date Title
US9107942B2 (en) Methods of diagnosing and treating fibrosis
US9486521B2 (en) Therapeutic applications targeting SARM1
EP2958580B1 (en) Inhibition of sema3a in the prevention and treatment of ocular hyperpermeability
JP6437946B2 (en) Fibrosis detection and treatment
US20120213737A1 (en) Compositions and methods for therapeutic membrane repair
US20130195863A1 (en) Methods and Pharmaceutical Compositions for the Treatment of Bone Density Related Diseases
US20240131050A1 (en) Inhibition of expansion and function of pathogenic age-associated b cells and use for the prevention and treatment of autoimmune disease
WO2014111876A2 (en) Modulation of mitophagy and use thereof
JP2025118647A (en) Compositions and methods for the treatment of leukodystrophies, and whole animal and cell models for identifying effective agents for the treatment of leukodystrophies
JP2023052057A (en) Compositions and methods for diagnosis and treatment of lymphatic system disorders
AU2014329606A1 (en) Methods for the identification, assessment, prevention, and treatment of neurological disorders and diseases using Fndc5
WO2023230339A1 (en) Method of treating, ameliorating and/or preventing polycystic kidney disease
US20130333059A1 (en) Hox compositions and methods
Qin et al. DNA polymerase β deficiency promotes the occurrence of esophageal precancerous lesions in mice
WO2009053683A2 (en) Treatment of inflammatory diseases
WO2019115472A1 (en) Polycomb inhibitors and uses thereof
WO2013149191A1 (en) Methods for regulating hair growth disorders
EP3983544A1 (en) Treatment and prevention of disease mediated by wwp2
US20250228918A1 (en) Methods of controlling body weight and/or energy expenditure
RU2812912C2 (en) Treatment of ophthalmological pathological conditions with angiopoetin-like protein 7 (angptl7) inhibitors
JP2018164442A (en) Method for determining, preventing or treating cutaneous squamous cell carcinoma
Wahhab Investigating the Role of Dysregulated Protein Translation in the Pathogenesis of X-linked Myotubular Myopathy
WO2026096962A1 (en) Methods and compounds for treating, ameliorating and/or preventing fibrotic diseases
US11273176B2 (en) Use of PLA2G5-deficient suppressive macrophages in suppression of inflammation
US20110092428A1 (en) Detecting and controlling abnormal hematopoiesis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09824235

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 13126875

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 09824235

Country of ref document: EP

Kind code of ref document: A1