WO2010045346A1 - Expression analysis of coronary artery atherosclerosis - Google Patents
Expression analysis of coronary artery atherosclerosis Download PDFInfo
- Publication number
- WO2010045346A1 WO2010045346A1 PCT/US2009/060663 US2009060663W WO2010045346A1 WO 2010045346 A1 WO2010045346 A1 WO 2010045346A1 US 2009060663 W US2009060663 W US 2009060663W WO 2010045346 A1 WO2010045346 A1 WO 2010045346A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- current annotation
- subject
- genes
- protein
- cad
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- CHD atherosclerotic coronary heart disease
- the intermediate CHD risk group 9 is within the intermediate CHD risk group 9 .
- the intermediate risk person defined as having at least one major risk factor or a family history of premature CHD but no clinical evidence of coronary atherosclerosis, has a 10-20% risk for a CHD event in 10 years 4 .
- Current treatment guidelines do not advocate widespread diagnostic or intensive medical preventive treatments for this risk category 4 ' 7 ' 10 . Nonetheless, within this risk group, there are likely to be a substantial number of patients whose individual CHD risk is much higher and would benefit from additional preventive interventions. Indeed, a number of expert panels have advocated for the development and study of novel approaches to further stratify individuals at intermediate CHD risk and identify a higher risk subset for more aggressive preventive strategies 4 ' 7 ' 8 ' 10 .
- Figure 1 shows Gene Network 1 - The top gene network identified by the Ingenuity Pathways Analysis included 10 of the candidate genes.
- the gene network represents biological processes of cell growth and proliferation and cell-to-cell signaling.
- the candidate genes are indicated by shading.
- Fibronectin 1 FNl integrin beta 7 ITGB7 Fibronectin leucine Rich Transmembrane Protein 2 FLRT2
- Figure 2 shows Gene Network 2 - The second most significant gene network identified by the Ingenuity Pathways Analysis involved the biological process of cell cycle signaling and contained 8 of the candidate genes.
- the present inventors have identified biomarkers that can be used for identifying a higher risk subset among the intermediate coronary artery atherosclerosis risk category.
- the markers were identified by analyzing gene expression from samples (e.g., whole blood) from subjects, and correlating the expression of particular markers with susceptibility for the presence of coronary atherosclerosis.
- Coronary artery atherosclerosis is sometimes referred to herein as CHD (coronary heart disease) and sometimes as CAD (coronary artery disease).
- the invention uses gene expression profiling of a biological sample (e.g. whole blood) to predict the presence of CAD.
- a biological sample e.g. whole blood
- CAD genetic analysis
- a method of screening a subject for the presence of coronary atherosclerosis, based on the expression levels of a selected set of genes in a bodily tissue, particularly whole blood, is provided.
- a set of about 69 genes has been identified which are diagnostic or predictive (Tables 2 and 3).
- a unique Gene Symbol is provided, as well as the full name of the gene. Either of these identifiers is adequate to unambiguously identify these genes.
- sequence (and the corresponding SEQ ID number) of a nucleic acid corresponding to each marker is also provided, as is at least one further indication of a publically available annotation concerning the gene (e.g., the cluster number, target sequence cluster description, Entrez Gene ID or other representative public ID, and/or probe set ID, which is available from the Affymetrix web site).
- GenBank Accession Numbers are also provided in the table. Note that the sequences that are presented herein are correct as of the day of filing of this application. However, in GenBank, sequences are periodically updated by the NCBI to correct errors. As the sequences are curated, and new sequences replace previous sequences that contained errors, the replacement is described in the COMMENT section of the GenBank entry. Sequences that are subsequently corrected are encompassed by the present application. At any given time, only a single sequence is associated with each GenBank Accession Number. There is no indefiniteness, variability or uncertainty as to the sequence that is associated with any particular accession number at the time this application was filed. The sequences, and the GenBank accession numbers with which they are associated, are hereby incorporated by reference. Table 2
- ggataatccggacctcatgcccccagagccttgtaaggaccggctaatgag 01.00.01 ggcaggcgagtgggaaacgaatcgtctgaacaatgatcagtcattctttcgg gcttgcaaagagggtaaaaaggttgggtctttagcggggtccgtagaagg ctttgaagacgaaaagtgctgtagaggtgctaagcagcagccaacggacc (SEQ ID NO:47) cluster_10 1560692_at Gattggtcatttctgaagcaacacagacttgtacctgtatcagcaatgtttacc /TID iHs.385500.1 atgctcataatcaaagacgtatgctagtttggaatgagctacta
- the method comprises measuring the expression level of at least 5 of the genes in a biological sample obtained from a subject, wherein an elevated level of expression of the 5 genes compared to a control level measured in a population of normal subjects is indicative of an increased probability of the presence of coronary atherosclerosis in said subject.
- expression levels of 10, 15, 20, 30, 40, 50, 60 or 69 of the genes are measured, and an increased level of expression compared to a control level is indicative of increased probability of disease.
- the predictive ability of the method is more accurate as an increasing number of the gene set is measured. Generally, it is desirable to screen at least about 21 genes in a subject sample for optimal predictive ability.
- Table 4 includes a listing of 85 clusters/metagenes representing groups of genes that are affected by atherosclerosis.
- atherosclerosis involves the processes of inflammation, immune modulation and stem cell signaling. Therefore, the 85 clusters represent the gene expression signature for a systemic inflammatory process.
- Rho guanine nucleotide exchange factor
- Rho guanine nucleotide exchange factor
- G protein-coupled receptor family C, group
- member 2 fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer
- solute carrier family 1 neurovascular/epithelial high affinity glutamate transporter, system
- PRKX Protein kinase PKXl
- solute carrier family 5 sodium/glucose
- SWI/SNF related, matrix associated, actin dependent regulator of chromatin SWI/SNF related, matrix associated, actin dependent regulator of chromatin
- the inventors Using this superset of metagenes, the inventors have identified a subset of 7 metagenes that are specifically associated with the presence of anatomic coronary artery disease. This subset is listed in Table 2. Within the 85 metagenes, it is expected that there will be subsets associated with the presence of carotid artery atherosclerosis; presence of soft, vulnerable coronary artery plaques prone to cause heart attacks; presence of normal versus dysfunctional stem cell populations for vascular repair of atherosclerosis
- the method is expected to identify subjects with at least about 50%, preferably at least 60%, 70%, 75 %, 80% or 85% probability of having CAD.
- the method may be used in conjunction with clinical variables, such as weight, body mass index, cholesterol levels, LDL/HDL ratio and other clinical variables associated with CAD for increased prediction levels.
- Gene expression profiling can be measured by any means known in the art, for example using microarrays, such as Affymetrix GeneChipTM.
- Other methods for measuring the presence and/or amounts of nucleic acids in a sample include, e.g., various types of hybridization assays, and quantitative PCR assays, such as quantitative real-time PCR, using suitable probe pairs to amplify cDNA copies of transcribed RNAs.
- transcriptomics can be used, in which the actual mRNA copy numkers are counted.
- the invention provides a method of data reduction for selecting a set of features (genes) associated with a specific condition.
- the method is particularly useful in the analysis of microarray gene data, and the selection of genetic markers for specific diseases and disorders.
- the method comprises the steps of
- SAM Signal Analysis of Microarrays
- SAM is a statistical technique for determining whether changes in gene expression are statistically significant. See, e.g., Tusher et al (2001) PNAS 98:5116-5121.) SAM is distributed by Stanford University in a R-package. See, e.g., the world wide web site stat.stanford.edu/ ⁇ tibs/SAM. Specific conditions for which the method may be useful include, for example, pharmacogenomics, ventricular arrhythmias, and identifying signals for stem cell mediated vascular repair. The method for using the feature reduction with multiple methods ending with the use of the binary trees will be very useful for complex disorders for which the gene expression signature may be subtle.
- complex disorders are likely resulting from multiple small changes that add up to the disease rather than one or two big changes.
- treatment can be provided that can prevent adverse outcomes such as myocardial infarction, sudden cardiac death, heart failure, atrial fibrillation, ventricular fibrillation/tachycardia.
- the blood profile for coronary artery disease will also be useful to detect atherosclerosis in other vascular beds, such as carotid atherosclerosis and atherosclerosis of the lower extremities - peripheral vascular disease. In doing so, we can apply treatments not only to prevent progression of these disorders, but we can also prevent the adverse outcomes that result from these two disorders: cerebrovascular disease, critical limb ischemia leading to amputation, and lower extremity ulceration.
- the method can be further refined by including an appropriate set of clinical variables.
- One aspect of the invention is a method for method for screening a subject for the presence of coronary atherosclerosis, said method comprising, measuring the expression level of at least about 5 of the genes of Table 2 (whose properties are also described in Table 3) (e.g., at least 10, 15, 20, 30, 40, 50, 60, or all 69 of the genes) in a biological sample obtained from said subject, wherein an elevated level of expression (e.g., a significantly increased level, such as a statistically significantly increased level) of said at least 5 genes compared to a control level measured in a population of normal subjects is indicative of an increased probability of the subject having significant atherosclerosis (e.g., subclinical coronary atherosclerosis).
- Table 2 whose properties are also described in Table 3
- an elevated level of expression e.g., a significantly increased level, such as a statistically significantly increased level
- a control level measured in a population of normal subjects is indicative of an increased probability of the subject having significant atherosclerosis (e.g., subclinical coronar
- the subject being tested does not exhibit any clinical manifestations of CAD. In one embodiment, a subject exhibiting such an elevated level of expression is deemed suitable to receive aggressive preventive treatments and/or additional testing.
- the genes in Table 2 are referred to herein, the gene characteristics described in TbIe 3 are also included.
- the levels of expression can be determined for any combination of 5 genes from Table 2, or more, and the levels can be determined simultaneously, or in any order.
- Another embodiment of the invention is a method for screening a subject for the presence of coronary atherosclerosis, said method comprising
- an elevated level of expression e.g., a significantly increased level, such as a statistically significantly increased level
- a sample which is "provided” can be obtained by the person (or machine) conducting the assay, or it can have been obtained by another, and transferred to the person (or machine) carrying out the assay.
- sample e.g. a test sample
- sample e.g. a test sample
- the sample is a blood sample, such as whole blood, plasma, or serum (plasma from which clotting factors have been removed).
- plasma plasma from which clotting factors have been removed
- peripheral, arterial or venous plasma or serum can be used.
- Methods for obtaining samples and preparing them for analysis are conventional and well-known in the art. Some suitable methods are described in the Examples herein or in the references cited herein.
- a "subject,” as used herein, includes any animal that has, or is at risk for, or is suspected of having, CAD.
- Suitable subjects include laboratory animals (such as mouse, rat, rabbit, guinea pig or pig), farm animals, sporting animals (e.g. dogs or horses) and domestic animals or pets (such as a horse, dog or cat).
- Non-human primates and human patients are included.
- human subjects who present with chest pain or other symptoms of cardiac distress including, e.g. shortness of breath, nausea, vomiting, sweating, weakness, fatigue, or palpitations, can be evaluated by a method of the invention.
- About 1/4 of MI myocardial infarctions are silent and without chest pain.
- patients who have been evaluated in an emergency room or in an ambulance or physician's office and then dismissed as not being ill according to current tests for CAD have an increased risk of having a heart attack in the next 24-48 hours; such patients can be monitored by a method of the invention to determine if and when they begin express markers of the invention, which indicates that, e.g., they are beginning to exhibit CAD.
- Subjects can also be monitored by a method of the invention to improve the accuracy of current provocative tests for ischemia, such as exercise stress testing.
- An individual can be monitored by a method of the invention during exercise stress tests to determine if the individual is at risk for ischemia; such monitoring can supplement or replace the test that is currently carried out.
- Athletes e.g., humans, racing dogs or race horses
- a method as above may further comprise measuring in the sample the amount of one or more other well-known markers that have been reported to be diagnostic of CAD, including the expression of cardiac specific isoforms of troponin I (TnI) and/or troponin T (TnT), wherein a significant increase (e.g., at least a statistically significant increase) of the one or more markers compared to the level in a normal control is further indicative that the subject has CAD.
- TnI troponin I
- TnT troponin T
- a method of the invention can also be combined with any of a variety of clinical tests for CAD, including some of the criteria discussed herein.
- Another aspect of the method is a method for deciding how to treat a subject suspected of having CAD, or a subject that is at high risk for having CAD, comprising determining by a method as above if the subject has (or is likely to have) CAD and, (1) if the subject is determined to have, or to be likely to have, CAD, deciding to treat the subject aggressively [such as by seeking more intensive lowering of serum cholesterol and blood pressure with medications, adding antiplatelet medications (e.g., aspirin, clopidogrel), diagnostic testing such as cardiac stress testing, cardiac MRI or coronary angiography] or (2) if the subject is determined not to have (or not to be likely to have) CAD, the current level of preventive cardiovascular management would be maintained.
- antiplatelet medications e.g., aspirin, clopidogrel
- diagnostic testing such as cardiac stress testing, cardiac MRI or coronary angiography
- Another aspect of the invention is a method for treating a subject suspected of having CAD, or a subject that is at high risk for having CAD, comprising determining by a method as above if the subject has (or is likely to have) CAD and, (1) if the subject is determined to have (or to be likely to have) CAD, treating the subject aggressively, as indicated above, or (2) if the subject is determined not to have (or not to be likely to have) CAD, treating the subject non- aggressively, as indicated above.
- kits for detecting the presence of CAD in a subject comprising reagents for detecting the levels of expression of at least five (e.g., any combination of, e.g, 5, 10, 20, 30, 40, 50, 60 or all 69) of the genes of Table 2.
- a statistical method such as multi-variant analysis or principal component analysis (PCA) is used which takes into account the levels of the various nucleic acids (e.g., using a linear regression score).
- PCA principal component analysis
- a "significant” increase in a value can refer to a difference which is reproducible or statistically significant, as determined using statistical methods that are appropriate and well-known in the art, generally with a probability value of less than five percent chance of the change being due to random variation.
- a statistically significant value is at least two standard deviations from the value in a "normal" healthy control subject. Suitable statistical tests will be evident to a skilled worker. For example, a significant increase in the amount of a nucleic acid marker compared to a baseline value can be about 50%, 2-fold, or more higher.
- a subject is "likely" to have CAD if the subject has levels of the marker nucleic acids significantly above those of a healthy control or his own baseline (taken at an earlier time point). The extent of the increased levels correlates to the % chance. For example, the subject can have greater than about a 50% chance, e.g., greater than about 70%, 80% 90%, 95% or higher chance, of having CAD.
- the presence of an elevated amount of a marker of the invention is a strong indication that the subject has CAD.
- a “baseline value” generally refers to the level (amount) of an expressed nucleic acid in a comparable sample (e.g., from the same type of tissue as the tested tissue, such as blood or serum), from a "normal" healthy subject that does not exhibit CAD. If desired, a pool or population of the same tissues from normal subjects can be used, and the baseline value can be an average or mean of the measurements. Suitable baseline values can be determined by those of skill in the art without undue experimentation. Suitable baseline values may be available in a database compiled from the values and/or may be determined based on published data or on retrospective studies of patients' tissues, and other information as would be apparent to a person of ordinary skill implementing a method of the invention. Suitable baseline values may be selected using statistical tools that provide an appropriate confidence interval so that measured levels that fall outside the standard value can be accepted as being aberrant from a diagnostic perspective, and predictive of CAD.
- baseline or normal level need not be established for each assay as the assay is performed but rather, baseline or normal levels can be established by referring to a form of stored information regarding a previously determined baseline levels for a given nucleic acid or panel of nucleic acids, such as a baseline level established by any of the above-described methods.
- Such a form of stored information can include, for example, a reference chart, listing or electronic file of population or individual data regarding "normal levels" (negative control) or positive controls; a medical chart for the patient recording data from previous evaluations; a receiver-operator characteristic (ROC) curve; or any other source of data regarding baseline levels that is useful for the patient to be diagnosed.
- the amount of the nucleic acids in a combination of nucleic acids, compared to a baseline value is expressed as a linear regression score, as described, e.g., in Irwin, in Neter, Kutner, Hästeim, Wasserman (1996) Applied Linear Statistical Models, 4 th edition, page 295.
- a baseline value can be based on earlier measurements taken from the same subject, before the treatment was administered.
- a detection (diagnostic) method of the invention can be adapted for many uses. For example, it can be used to follow the progression of CAD. In one embodiment of the invention, the detection is carried out both before (or at approximately the same time as), and after, the administration of a treatment, and the method is used to monitor the effectiveness of the treatment. A subject can be monitored in this way to determine the effectiveness for that subject of a particular drug regimen, or a drug or other treatment modality can be evaluated in a preclinical or clinical trial. If a treatment method is successful, the levels of the nucleic acid markers of the invention are expected to decrease.
- a method of the invention can be used to suggest a suitable method of treatment for a subject. For example, if a subject is determined by a method of the invention to be likely to have CAD, a decision can be made to treat the subject with an aggressive form of treatment (e.g. as described elsewhere herein); and, in one embodiment, the treatment is then administered. Methods for carrying out such treatments are conventional and well-known. By contrast, if a subject is determined not to be likely to have CAD, a decision can be made to adopt a less aggressive treatment regimen; and, in one embodiment, the subject is then treated with this less aggressive forms of treatment. Suitable less aggressive forms of treatment include, for example, maintaining the current level of preventive cardiovascular management, using procedures that are conventional and well-known in the art.
- a subject that does not have CAD is thus spared the unpleasant side-effects associated with the unnecessary, more aggressive forms of treatment.
- treated is meant that an effective amount of a drug or other anti-heart disease procedure is administered to the subject.
- An "effective" amount of an agent refers to an amount that elicits a detectable response (e.g. of a therapeutic response) in the subject.
- One aspect of the invention is a kit for detecting whether a subject is likely to have CAD, comprising one or more agents for detecting the amount of a nucleic acid marker of the invention.
- the singular forms "a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.
- kits of the invention can comprise a composition of probes or primers that are specific for one or more of the nucleic acids of the invention (e.g.
- probes arranged in the form of an array such as a microarray
- probes arranged in the form of an array such as a microarray
- one or more reagents that facilitate hybridization of the probes or primers in the composition to a test polynucleotide of interest, and/or that facilitate detection of the hybridized polynucleotide(s).
- Methods for designing and preparing probes that are specific for hybridizing and identifying a nucleic acid marker of the invention, or that can be used as primers (e.g. PCR primers) for specifically amplifying a nucleic acid marker of the invention are conventional and well-known in the art.
- kits of the invention may comprise instructions for performing the method.
- Optional elements of a kit of the invention include suitable buffers, containers, or packaging materials.
- the reagents of the kit may be in containers in which the reagents are stable, e.g., in lyophilized form or stabilized liquids.
- the reagents may also be in single use form, e.g., for the performance of an assay for a single subject.
- the present invention also relates to combinations in which the nucleic acids of the invention, or probes or primers that are specific for them, are represented, not by physical molecules, but by computer-implemented databases.
- the present invention relates to electronic forms of polynucleotides of the present invention, including a computer-readable medium (e.g., magnetic, optical, etc., stored in any suitable format, such as flat files or hierarchical files) which comprise such sequences, or fragments thereof, e-commerce-related means, etc.
- a computer-readable medium e.g., magnetic, optical, etc., stored in any suitable format, such as flat files or hierarchical files
- An investigator may, e.g., compare an expression profile exhibited by a sample from a subject to an electronic form of one of the expression profiles of the invention, and may thereby diagnose whether the subject is likely to have CAD.
- the discovery cohort was selected from the Duke Cardiac Catheterization Genetics and Genomics (CATHGEN) repository that stores blood samples in PAXgeneTM RNA tubes (PreAnalytiX, Valencia, CA).
- CATHGEN Duke Cardiac Catheterization Genetics and Genomics
- CAD coronary artery disease
- This discovery cohort consisted of two groups: 57 subjects with minimal CAD with no stenoses exceeding 25% of the coronary artery lumen diameter, and 49 subjects with severe CAD with at least one stenosis of 75% or greater. Two additional cohorts were then selected to establish the validity of the genomic findings generated using the discovery cohort.
- One group was selected from the Duke CATHGEN repository using the same criteria as the discovery cohort, 25 subjects with minimal CAD and 30 subjects with severe CAD.
- a second, external validation set was selected to examine whether the genomic predictors identified in the discovery cohort would have predictive value in subjects not treated in the Duke cardiac catheterization laboratory.
- This data set was from a separate unpublished research study.
- the microarray data were generated using peripheral blood mononuclear cells (PBMCs) of patients undergoing cardiac catheterization at an outside facility.
- PBMCs peripheral blood mononuclear cells
- a Freisinger Index was calculated in these subjects, and we divided the dataset into minimal or severe CAD groups based on the Freisinger Index 13 .
- a numeric score for CAD burden was assigned to each of the three epicardial arteries based upon the severity of disease, and the Freisinger Index reflected the sum of the three numeric scores.
- six subjects had minimal disease, defined as a Freisinger Index score of 1.5 or less, while 18 subjects had moderate to severe disease, defined as a Freisinger Index score of greater than 1.5 13 .
- the cRNA probes were generated with the Affymetrix GeneChipTM (Affymetrix, Santa Clara, CA) one-cycle in vitro transcription labeling protocol and were hybridized to the Affymetrix U133 2.0 Plus Human array that contains 54,613 transcripts.
- microarray hybridization was performed by the Duke Microarray Core Facility (Expression Analysis, Research Triangle Park, NC). The data for the second validation cohort had already been generated prior to the initiation of this investigation. The microarray data were obtained using the same methods as above. The globin reduction step was unnecessary since PBMCs were used. C. Approach for Classifying Subjects by CAD Burden using Gene Expression Data
- SAM Significance Analysis of Microarrays
- k- means correlation- based clustering to group the 4,210 genes into 300-500 clusters that typically consist of 5-50 non-overlapping genes.
- singular value decomposition was performed using the expression values of the genes within the clusters to generate a single factor or metagene.
- the metagene is in essence a composite measure representing the aggregate expression for each cluster.
- Each possible metagene combination was tested iteratively to find the metagenes that most accurately classified the samples.
- each validation cohort was adjusted to the discovery cohort using the Distance Weighted Discrimination (DWD) method 20 .
- Each validation cohort underwent quantile normalization using the same factors for quantile normalization of the discovery cohort.
- DWD Distance Weighted Discrimination
- MatLab (MathWorks, Natick, MA) was used to generate multivariate logistic regression models to classify individuals into minimal or severe disease categories using only traditional risk factor data. There were missing values, especially those of systolic blood pressure and lipid levels (up to 20%). Missing values were imputed separately by polynomial linear interpolation 21 for the discovery and validation cohorts from CATHGEN. Using standard forward stepwise selection, a model of discriminatory variables was built from the 16 clinical variables in the discovery cohort. This model was used to predict the coronary artery disease status in the CATHGEN validation cohort. We lacked sufficient variables in the second validation cohort to apply the clinical prediction model. Because of the variability in the imputation of missing variables, we generated 10 different sets of imputed data and constructed multivariate logistic regression models with each set of data. The final classification accuracy reflected the average of the 10 models.
- Gene annotation was performed using: GeneCards, Information Hyperlinked Over Proteins (IHOP), GENATLAS and Ingenuity Pathways Analysis (IPA) (Ingenuity Systems, Redwood City, CA). To further characterize genes identified by this study, we also used the IPA software. We used the IPA software to determine statistically over-represented gene ontology terms within our candidate gene lists. As well, IPA was used to determine networks of genes that encompassed the candidate genes to highlight potential biological pathways as well as upstream and downstream associated genes. Example II. Results
- Table 1 lists the clinical characteristics of the discovery and the two validation cohorts. Male gender, prior coronary artery bypass grafting (CABG), CAD burden and medication use 5 were significantly different between the subjects with minimal and severe CAD. Systolic blood pressure, lipid profiles, ejection fraction, serum creatinine, active tobacco use and diabetes were not significantly different. There was missing data for some of the clinical variables, particularly systolic blood pressure and lipids, however, the missing data were evenly distributed. Table 1 Clinical characteristics of the discovery and validation cohort subjects
- Beta Blockers (%) 211 612 P ⁇ 0001** 259 467 NS**
- Ace Inhibitors (%) 175 429 P 0005** 185 333 NS**
- LAD Stenoses (%) 80 ⁇ 29 813 ⁇ 44 66 ⁇ 14 866 ⁇ 24 P ⁇ 0001*
- multivariate logistic regression models correctly classified subjects as having minimal or severe CAD with an accuracy of 84.1% by cross validation analysis.
- the models applied to the Duke validation cohort correctly classified subjects by CAD burden with a mean accuracy of 68.3%.
- the AUC for the prediction was 0.71.
- the second validation cohort lacked the necessary clinical variables for the clinical prediction model.
- FRS Risk Score
- the metagenes that enabled the classification by CAD burden in the Duke validation cohort were derived from 69 genes (Table T).
- Pathways analysis using IPA identified two statistically significant gene networks within the candidate genes ( Figures 1 and T). Gene network 1 is associated with cell growth and proliferation and cell-to-cell signaling. The association of these genes into this gene network over random chance was statistically significant (p value 10 ⁇ 22 ) There are 10 genes from the candidate gene list in network 1 ( Figure 1).
- fibronectin 1 which is involved in numerous cell adhesion functions involving platelets and/or leukocytes 23"25 and glutamate receptor precursor 26 ' 27 and integrin, beta 7 , which have been shown to be involved in T cell activation.
- IPA identified key effectors in the same network that were not in the final gene list such as fibroblast growth factor 2 (FGF2), tumor necrosis factor (TNF), osteopontin (SPPl) and mitogen-activated protein kinase 1 (MAP2K1).
- FGF2 fibroblast growth factor 2
- TNF tumor necrosis factor
- SPPl osteopontin
- MA2K1 mitogen-activated protein kinase 1
- Gene network 2 is associated with cell cycle control. The association of the genes in this network over random chance was statistically significant (p value 10 ⁇ 19 ). There were nine genes from the final gene list in gene network 2 (Figure T). These included zinc finger and btb domain containing 16, which is associated with myeloid cell differentiation 26 ' 28 , and p21-activated kinase 4, which may be involved in T cell activation 29 ' 31 . Key effectors in this network that were not in our final gene list, but were identified by IPA, included Akt, phophoinositide-3-kinase, regulatory subunit 1 (PIK3R1), transforming growth factor, beta 1 (TGFBl) and cyclin- dependent kinase inhibitor IA (CDKNlA).
- the inventors have previously identified genes whose gene expression signatures could differentiate between minimal and severe atherosclerosis in freshly collected human and mouse aortas. Now, this new analysis shows that one can also identify genes in the blood whose expression signature can be used to accurately detect the presence of severe coronary atherosclerosis.
- the CAD gene expression signature was identified in a group of patients undergoing cardiac catheterization and was validated in two separate patient groups, one from the same cardiac catheterization laboratory and another from an outside cardiac catheterization laboratory. When integrated with traditional clinical risk factors in a multivariate regression model, the combined genomic and clinical information correctly classified patients as having minimal or severe CAD with 84.1% accuracy and an AUC of 0.86. These results represent a means for selecting subjects within the intermediate CHD risk for more intensive preventive medical therapies or additional diagnostic testing.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
This invention relates, e.g., to a method for screening a subject for the presence of coronary atherosclerosis, said method comprising measuring the expression level of at least 5 of the genes of Table 2 in a biological sample obtained from said subject, wherein an elevated level of expression of said 5 genes compared to a control level measured in a population of normal subjects is indicative of an increased probability of the subject having significant subclinical coronary atherosclerosis. Methods for deciding on a treatment modality, based on a diagnostic procedure of the invention, are also described, as are kits for carrying out a method of the invention.
Description
EXPRESSION ANALYSIS OF CORONARY ARTERY ATHEROSCLEROSIS
The instant application contains a Sequence Listing which has been submitted via EFS- Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on October 14, 2009, is named 39532281.txt, and is 51,965 bytes in size.
This application claims the benefit of the filing date of provisional patent application 61/105,191, filed October 14, 2008, which is incorporated by reference in its entirety herein.
BACKGROUND INFORMATION According to statistics from the American Heart Association, the death rates from atherosclerotic coronary heart disease (CHD) decreased by a third from 1994 to 2004. This remarkable reduction in mortality is attributed to technological advances in the acute treatment of myocardial infarction, preventive interventions such as statin, antihypertensive and antiplatelet medications and lifestyle modifications, particularly smoking cessation1. Nevertheless, CHD remains the single leading cause of mortality and morbidity in the United States taking the lives of over 450,000 individuals annually and leave countless others with chronic heart failure . The aging of our population and the increasing prevalence of metabolic syndrome, obesity and diabetes portends acceleration in the enormous health burden from CHD in the coming years. The rising burden will occur in a health care system that is ill equipped to bear the ever increasing costs of diagnosing, treating and managing CHD.
One approach to reducing the burden of CHD is through the development of prospective preventive genomic medicine that identifies subsets of higher risk individuals to target for preventive interventions. Through the use of new molecular markers, higher risk individuals would be identified to receive preventive CHD interventions that ordinarily would not be availed to them under current medical guidelines. For an asymptomatic patient, a standard method for determining a prevention regimen is to categorize them as low, intermediate or high CHD risk using global risk assessment tools such as the Framingham Risk Score (FRS) 3"6. Currently, there is considerable understanding of how to manage patients with low and high CHD risk 4' 7' 8. However, the majority of adults over the age of 20, which comprises 40% of the U.S. population, are within the intermediate CHD risk group 9. The intermediate risk person, defined as having at least one major risk factor or a family history of premature CHD but no clinical evidence of coronary atherosclerosis, has a 10-20% risk for a CHD event in 10 years4. Current treatment guidelines do not advocate widespread diagnostic or intensive medical preventive treatments for
this risk category4' 7' 10. Nonetheless, within this risk group, there are likely to be a substantial number of patients whose individual CHD risk is much higher and would benefit from additional preventive interventions. Indeed, a number of expert panels have advocated for the development and study of novel approaches to further stratify individuals at intermediate CHD risk and identify a higher risk subset for more aggressive preventive strategies4' 7' 8' 10.
There is a need to identify new biomarkers that can be used for identifying a higher risk subset among the intermediate CHD risk category, and to establish susceptibility for the presence of coronary atherosclerosis.
DESCRIPTION OF THE DRAWINGS
Figure 1 shows Gene Network 1 - The top gene network identified by the Ingenuity Pathways Analysis included 10 of the candidate genes. The gene network represents biological processes of cell growth and proliferation and cell-to-cell signaling.
The candidate genes are indicated by shading. glutamate receptor, ionotrophic, AMPA 3 GRI A3
Kruppel-like factor 5 (intestinal) KLF5 follistatin FST
Fibronectin 1 FNl integrin, beta 7 ITGB7 Fibronectin leucine Rich Transmembrane Protein 2 FLRT2
Complement component receptor 2 CR2 integrin, alpha 11 ITGA 11 indolethylamine N-methyltransferase INMT
AE binding protein 2 AEBP2
Figure 2 shows Gene Network 2 - The second most significant gene network identified by the Ingenuity Pathways Analysis involved the biological process of cell cycle signaling and contained 8 of the candidate genes.
The candidate genes are indicated by shading. neuronal pentraxin receptor NPTXR zinc finger and BTB domain containing 16 ZBTB 16 forkhead box Gl/forkhead box GlA FOXG1B/A cullin 5 CUL5
SRY (sex determining region Y)-box 6 SOX6 membrane associated guanylate kinase 1 MAGIl myosin VA (heavy polypeptide 12, myoxin) MY05A galanin receptor 2 GALR2
DESCRIPTION
The present inventors have identified biomarkers that can be used for identifying a higher risk subset among the intermediate coronary artery atherosclerosis risk category. The markers were identified by analyzing gene expression from samples (e.g., whole blood) from subjects, and correlating the expression of particular markers with susceptibility for the presence of coronary atherosclerosis. Coronary artery atherosclerosis is sometimes referred to herein as CHD (coronary heart disease) and sometimes as CAD (coronary artery disease).
In one aspect, the invention uses gene expression profiling of a biological sample (e.g. whole blood) to predict the presence of CAD. Thus, a method of screening a subject for the presence of coronary atherosclerosis, based on the expression levels of a selected set of genes in a bodily tissue, particularly whole blood, is provided. In one embodiment, a set of about 69 genes has been identified which are diagnostic or predictive (Tables 2 and 3).
For each marker in these tables for which genes have been identified, a unique Gene Symbol is provided, as well as the full name of the gene. Either of these identifiers is adequate to unambiguously identify these genes. Furthermore, the sequence (and the corresponding SEQ ID number) of a nucleic acid corresponding to each marker (e.g., a transcribed RNA, a cDNA or a genomic sequence) is also provided, as is at least one further indication of a publically available annotation concerning the gene (e.g., the cluster number, target sequence cluster description, Entrez Gene ID or other representative public ID, and/or probe set ID, which is available from the Affymetrix web site). Some of the sequences were obtained from the GenBank database (at the world wide web site ncbi.nlm.nih.gov/Genbank), and the GenBank
Accession Numbers (e.g., NM numbers) are also provided in the table. Note that the sequences that are presented herein are correct as of the day of filing of this application. However, in GenBank, sequences are periodically updated by the NCBI to correct errors. As the sequences are curated, and new sequences replace previous sequences that contained errors, the replacement is described in the COMMENT section of the GenBank entry. Sequences that are subsequently corrected are encompassed by the present application. At any given time, only a single sequence is associated with each GenBank Accession Number. There is no indefiniteness, variability or uncertainty as to the sequence that is associated with any particular accession number at the time this application was filed. The sequences, and the GenBank accession numbers with which they are associated, are hereby incorporated by reference.
Table 2
Table 3
Predictor Probe Set ID Target Sequence Target Sequence Cluster Name Description cluster 32 235238_at Atatgtatgcacggatgtcactttttaaggccatattgcattgataacaagctaa /FEA=EST /CNT= 17 aagcacaactaaaatttcacatgctaacgacaacttgaatgaactgctggggc /TID=Hs.219907.00.01 agtggtatgtgcctttcaacttgataanttgggggacattttcatattgggagatt aattctaagtatcttcatgttctatgactatagaaccatttgccaaaaaaaaaag cttttcttgctacaaaaaataagcaattttcttgagccttattgactttattacatttt ctgtttagcagcatttttcactgcaatgttaaaataaatatgacattgaattcgaa ctgtgtgtatgtcagtgganatcaaatcaaaagccactaacatggctgtctgttt cactggactgtcccatttgctggttaaaaggattggggcccaaatcctctggc ctagcatttctcagtgtttgctattcagactgtctaaatacagcatgtgacaagct gaagaagccaaatctancagtcatttctgatttcattatattctccccct (SEQ ID NO: 1) cluster 32 1555179_at Gacgggtgctcataagagatccttaacttgcccattttaatgggttttccagaa /TID=iHs.375094.1 gatgtgagaagccactttgttagcaaagcatgccaaagccatgccctgctcc /CNT=2 /FEA=FLmRNA agacacatgtgagcccatttcctgctctttgcttaactgacaagctctcatcagt /FL=gb:BC032733.1 gcacctgggttaatttcacatcaggtacaggaatatgttctaaaggaaagctaa ttttataatagcaattcctgcttaataaccttcagcttcattgtttttgtgtaatctatc aacaaattatgttagttcaaggttctcaatgggagtttctaataaatagaaggga tgtatagaagttcccctaattaaaacaattgtgaacacaatcttggtattcagct gtgtctccacccttcttaccattcaccacaaagtaattctcacttctggaagctg ggttcatttt (SEQ ID NO:2) cluster 32 244278_at Catggggatcagtgtgggctgtgctggtcaaggagggcttccagggagag /FEA=EST /CNT=3 gcaactganggattcactgcaattgttccttgagaagatgaggatcaggtcg /TID=Hs.l92809.00.01 ggaattggaaacatctgagggctcaattcaacctggcttctaaaacgaacatg gtgaacatagatcaactactgaacttcttttaacctctggcatcctatctgtgaat tgtggggaggaaacagggtccacccgctgctgcacaagaggggtgtgtgc agaccgtcaccttgtgtctgctgtagcaggagacccctggccatgcgggact gaacccatgattgcagctgatcttactctgtct (SEQ ID NO: 3) cluster 32 1569962_at Gggaggtcctcgcacatgaccttgtctggtagctgcagtttgtccctcgtntg /TID=iHs.352252.1 tgccacactttgnaccancaccttcaacagctacctattgaggcccnatctag /CNT=3 /FEA=mRNA gtgctggtgcnatcnatggttctgtcttgacatctgggacagcaggctttcctg gagcctcatgtacctgccttcccacacaagctcagaggagcagtttagcattt ctcagtgactcggggtcaccctgggaacagtcatctttgtactttagaaaatgg cagctg (SEQ ID NO:4) cluster 32 1552524_at Ggactctgtccgcttgggccagtttgcctccagctccctggataaggcagtg /TID=iHs.l25680.2 gcccacagatttggtaatgccaccctcttctctctaacaacttgctttggggccc /CNT=9 /FEA=FLmRNA ctatacaggccttctctgtctttcccaaggagcgcgaggtgctgattcccc /FL=gb:NM_053017.1 (SEQ ID NO:5) gb:BC014577.1 cluster 32 1555224_at Ggttttacttctaatgcttccatcggaggacaacaatggttacattgacttaaga /TID=iHs.374705.1 tctgatgcaaatgtttaccttttggggtctgtcataccatgaagcaaacagaca /CNT=2 /FEA=FLmRNA gaaaagaaggaaacagatggcacactgaaaattaggataagttaagaagaa /FL=gb:BC021739.1
tgtaataagcggacaaccgacaaaggagggtgggaatgcagggcaaccg caagggctcatacagtgctgggtgaggaggacccctgacgggagctgaga tctttggtgaaggacacaactggtcagtacaaccctgcagggcaaggagctg cagaaacaactatccaaaccccacacctctccctcaccttgatctcccatgttc cacttcggctgaaccaaaccaaaagccagagggcaaggaagccatgtgtg aaaactgtgctac (SEQ ID NO: 6) cluster_32 244285_at Gccccgtggtcactgaaaagccagaatgaatattcttcctttcggaataaaaa /FEA=EST /CNT=3 ttgagctgtggaagttttgtttgctttgatgaattacttccaggctgctgtttatttg /TID=Hs.253425.00.01 gagagcaaagctccccagctgcagggtgggtagaggctgcggtcactccc ctcgtcaatgctggttcctgttcctgaggccgagagaactcctgacagcaga gtgggcatatcttggtagttncagcttttcaagacagtgtggcccagtgggga gagagcagaaaacctgggttatgctggctctgccatttatcagctgtgtaacct tgggcaagtgatacaacctctgtgtgcctcagtttcctttcctcacctgtccaca ggggatcataatcttggccctgcatgccttacaggagcgtt (SEQ ID
NO:7) cluster_32 1558199_at Gtatcctagtgacagcataaaccctagaggtgacagtctgtattattgcttttcg /TID=iHs.424388.1 cttctcttttctgcttctgttgggagccagttttcttcttacgccgcattacagaga /CNT= 12 /FEA=mRNA gaacgtcaaatttagcagccatatctgccatagggtccaaataaagagacaat aaaaacattattctctcttttttggatggaatactgcgtgaaatggttatccataca aagatactttatgtagaatagaaaaaggaggccgggtgcagtggctcacaca tgtaatcctagtgctttgggaggctaagccgggagcactgattgaggccagg agttcatgatcagcctgggcaatgaagtgagaccccgtctctacaaaaaaata tgaaaaaattagcgaggtgtggtgacacatgcctgtagtcccagctactcaag aggctgaggtagaggatcacttgagcctacgagttcaaggctgcagtgagct atgataactccactgcactgccgcctggatgacacagagagaccgtttcta (SEQ ID NO: 8) cluster_32 207658_s_at Tgagttacaacgggaccacgtcggcctaccccagccaccccatgccctac /FEA=FLmRNA agctccgtgttgactcaaaactcgctgggcaacaaccactcctcctccaccg /FL=gb:NM_004471.1 ccaacgggctgagcgtggaccggctggtcaacgggggaatcccgtacgcc /CNT=4 acgcaccacctcacggccgccgcgctaaccgcctcggtgccctgcggcct /TID=Hs.l69277.00.01 gctggtgccctgctctgggacctactccctcaacccctgctccgtcaacctgc tcgcgggccagaccagttactttttcccccacgtcccgcacccgtcaatgact tcgcagagcagcacgtccatgagcgccagggccgcgtcctcctccacgtcg ccggcaggcccccctcgacccctgccctgtgagtctttaagaccctctttgcc aagttttacgacgggactgtctgggggactgtctgattatttcacacatcaaaat caggggtcttcttccaaccctttaatacattaacatccctgggaccagactgta agtgaacgttttacacacatttgcattg (SEQ ID NO:9) cluster_32 204359_at Ccttctctgatttcttcagcagggtcaaaagacagttactagcaatggggaat /FEA=FLmRNA gcttgtcactgtggagaaagagttttgtatatgtctgataccgttgttataacaaa /FL=gb:AB007865.1 acaaatttttttactatagttttttgttttctacctgcacacccaccagaagagcac gb:AF169676.1 aaagcaaggccattgcaacaggcatttaaaaattattatcaaacatgcacatg gb:NM_013231.1 cttgtacacacacacacacacacacacaaacaggggcatttgtaaaggtgtc /CNT=86 cctggaatgtaagatttataatgtttaaggcaaggtgaaggcattgccaagtgt /TID=Hs.48998.00.02.00.0 gtgtcgctcataggactagtgtatattcactgaaagttaacctgatgatttgttat 1 tgtttgaaccatatgctgatttgcttctggtttctgtttagtgtgttctctctgataag gggctgaaagattctgcatcacacatcctctgagacctaccatgtcgcacact ttgttaatgacaaacttcactctacactatacagtaccttgt (SEQ ID NO: 10) cluster_32 217440_at Aagtcagctaattgttatgtgtcatttctttctagattttgtagtttttgtttgtttgttt /FEA=mRNA /CNT=I tacattcaatgatttagaagatttggggcttattgtggtttcttaaatattataactc /TID=Hs.274506.00.01 tatttcaaaactattctgctatgttgagctatcttatttcatactgtattttaatatgtt aggacagttctctccttacgactttcttttgcaaaaattttctagctacactcatttg gatattcttcatgatgaactctgagataattttaacacattccaaaagacatatttt tgagacttattagaattttgttaaagatactgatttatttccaaagaattacagaat ctaatcttttcatctatgtatctctattgaagcatttgttta (SEQ ID
NO: 11) cluster_32 244775_at Aaaatggcgcaaatgcaccccatctcccccgattcctgctggntgggcaag /FEA=EST /CNT=6 atggggaaatggcgcaaatgcaccccatctcccccatctccccatcttgccc /TID=Hs.l97583.00.01 aggaactccaagacatcaagatttcacgatttttaagacgtcaagatgctagc atgctaacaccatcacggttctagaactttaaaggtgtcaagattctaaagcctt
ctggattctagaatcctgtagatgtcagcattctaaagtaccatcaggttctttat ttactggattcattagttccaggattctatgagcctggtgtttagcc (SEQ ID
NO: 12) cluster_l 1 1563121_at Ggcatttccattccagagtgcatcacttcaaaccttacattcctgaggctgttc /TID=iHs.383803.1 gtcgaaggcttctcacatctaaactgcagttcatttattgcagagccctgttcac /CNT=2 /FEA=mRNA atgggttctcagagacgttttcattctcgcttctcaccacgctggagatgagaa ctagatgtggttttctagatacagtctacatttccctttgaatctggaagtccggc ttcaaggtgatccacaaacatccgagaaggaaagaaacttagaggtaaatga ttcaatgattcttaaaacctgactgtggcactcttctccaaatacctctgttctcct ccatatttctcagcccctttgaagaggcaggcccatgggatgaattctgacca atggatttggctaagatttaagagccagtgcaccatccttcagctaactcttctc tccacctgctgcaaggacataaacatttcaatggcacaaagatagagcacctt gaattgttactgcaaagaagacatcttttctggagagtcacccaa (SEQ ID NO: 13) cluster_l 1 244254_at Cctcctgagaacatgccctgacagaatgaccaatcntggtgtatgtgtgtag /FEA=EST /CNT=3 aatgattagattatccccaagcaaatatcagatacttgaatgtactaagatttctg /TID=Hs.244339.00.01 ggtatagtatactttgtcctccttcacaggcatcctcagaggtttggaaagtttn atataggatgcttgattagtcctttctgatatttgtaaacatttcccaataaagctg catattcatctgtcctttaataaagcactattgaaatatgatgacatatagggaaa gcctgtttgtgctctacaggcttgtgaaaaggtgctagaatcaaatacttgaaa atgagttgaaacatcagagacaccccataagccatatgtggcatgggcatct gaacctaatg (SEQ ID NO: 14) cluster_l 1 237398_at Ttaaccttacctgctttccaagagagattttatgttttcttggttttttttttttgtttgt /FEA=EST /CNT=6 ttgtttgtttttagggtagggtcttgtagaatgcaatggtgcaattatagctcact /TID=Hs.24598.00.01 ncngcctccaacttctgggttcaagtgatcctcccaccttgttttttgttttttgttt tgtcttgtttttttggtngagacagggttttgctgtgttccccaggctgctgtcaa actcctgggctcacccatctcngcctcctaaagcgctgggattacaggcacg agccactatacctggccaagattttatattttctaattgcttcacatactgaatgg aaaatagcatgacagttataacagaagtaaagaaagtcacatgagagtccac cacctaaaatataacttcct (SEQ ID NO: 15) cluster_l 1 224061_at Catggaacatgcttaatctaaacaatgatttgttgttcacctgaaattcaaattta /FEA=FLmRNA gctgggtgtcctgtatttcatctggcaaccctacttcagacccaggtgtaaggt /FL=gb:AF128847.1 acatggatgtgctttggtcaaggaataggccaaggcagagatccatgcctgc gb:AF128846.1 atgactcagtgggtttggtgcacaggcacacacctccacttgttatataacctg gb:NM_006774.2 /CNT=6 tttgtgtaagttcatacttggtctgagccactgttgtctgtaaaaggtaattgtcct /TID=Hs.2O4O38.00.01 gctaatgctgtacaggggctcttggggttcggctcagctcaacatggcttgac atggtgggcacactggcgcccagtaagag (SEQ ID NO: 16) cluster_l 1 217041_at Acaactccagtgcagtgccaggtgggcaggctcccactgttcacttgagac /FEA=mRNA /CNT=I gctcctccccactcaggtggggacaggggacacactcgcagggcagggc /TID=Hs.91622.00.02 attctggaggtgtgggtacaggtgaggggaaatgggaggcacagccagga gtggggcaggagggaaggccagtgcgtgggcaggctgaggagggaatat gacccccctcaagtccccaaagtggcaggcaagggaggggccctggatga ggtggcccctcatgccttggccctccccttgcagacatcgaaggcagcctttg ttgcacccccaaaggcctccaccaacttgtcttcccagggaaggacgttgcc cagcagtggcgcagtgcagttggcaatgcccaggacctgggctggtgtcag ggcgtggtcccacaggttaaactgggcaatgtcaccgacaaaggcctgggt ggcatcaaaccggccacccagggtatcctgggccaa (SEQ ID NO: 17) cluster_l 1 244767_at Gcaagggtctatgaaggtgtttcaggagatccaagcctttttagaatctgtgc /FEA=EST /CNT=5 aaacttctgtgtatgttttttggaggaaaagtccataaatttcaaattttcaaaaat /TID=Hs.44037.00.01 cagattttcaaaaggatttattgatttctgaaaactagcaaagatctgcttttataa agagcaaatagatggatagatataggagaagatgcttgacttgatgaataag agaaaggacatatagaaaatgaactgaacataagcaagtattttattgaagat atactattttaaataacatttaaacacggaatgattggcaataaactgcaaaatg agtaatttggtatcattttaaaatggttattatcagagattttccttttattaaacagt tattcattaattccacaaatatttatcaggcttctattatatgtgaggcactgagct gggcatggctgtaaaggaaccatctaggaagtaattatgcaatcatttctgaa cctgtttcagaaaagtaaatcagtgttgggtttatcagtgttt (SEQ ID NO: 18)
cluster_l 1 1569290_s_at Acaccaaccagaacaccaccgagaagcccttccatttgaattaccacgtag /TID=iHs.382602.1 atcacttggattcctccaatagtttttccgtgacaa (SEQ ID NO: 19) /CNT=5 /FEA=mRNA cluster_67 231992_x_at Agcagaggctggtgcaaccaatcacctcctttagtaagtttctccctgggctt /FEA=mRNA /CNT=13 cacctcttcacctgtgggctttccacctgtctctctctttttttttttaagacagtctc /TID=Hs.l29013.00.02.00. ctctgttgccaggctggaatgccgtggcgcagtctcggctcactgcaacctct Ol acctcctgggttcaagcgattctcctgcctcaggctcccaagtagctgggatt gcaggtgcccgccaccacaccgggctaatttttgtatttttagtagagtcggg gtttcaccatgttgcccaggctggtctcgaactcctgaccttacgtgatcctca cgcctgtaatcccagcactgtgggaggctgagacgggcagatcaccctggc cagcatggcaaaaccccatctctactaaaaatacagcaattagccgagtgtg gtggcgggcacctgtaatcccaactactcaagaggttgagacaggagaact gcttgaacccggaaggca (SEQ ID NO:20) cluster_67 234521_at Ttgcgctatgcaactgtgctcaccactgaagtcattgctgcaatgggtttaggt /FEA=DNA_3 /CNT=I gcagctgctcgaagcttcatcacccttttccctcttccctttcttattaagaggct /TID=Hs.302170.00.01 gcctatctgcagatccaatgttctttctcactcctactgcctgcacccagacatg atgaggcttgcctgtgctgatatcagtatcaacagcatctatggactctttgttct tgtatccacctttggcatggacctgttttttatcttcctctcctatgtgctcattctg cgttctgtcatggccactgcttcccgtgaggaacgcctcaaagctctcaacac atgtgtgtcacatatcctggctgtacttgcattttatgtgccaatgattggggtct ccacagtgcaccgctttgggaagcatgtcccatgctacatacatgtcctcatgt caaatgtgtacctatttgtgcctcctgtgctcaaccctctcatttatagcgccaa gacaaaggaaatccgccgagccatt (SEQ ID NO:21) cluster_67 230819_at Tttggggaggtttccagctcagaatgatgcagaaatgataagactcaaagca /FEA=EST /CNT= 12 ggggccaggccaggccagtnccttcgcctctcccggctgctggtgggcac /TID=Hs.223770.00.01 ggaggaaccagggcacatctgtggtacccagggacgtcccttgtcagcccg tttgccacacattgttcctcttgtccaggggagggtggaggagctgcttccca ggactggaggagcagctgggcccctgctgcacgtccggtgggacacacct gtgagccctccagagggagagtgcaggccccttctgagcctggtgttgcag ggctccgctctctcccggaagccagggcacccagggcggaggctcctcag gccggggaggcggggagggtgccctgcatggagagagacgccggcgct ccccgcc ttctntgatgctcacccctcccaggcccngttctccctggggtccc ccgtttantagcccccctgcactctttgatatcttagtgtctgaggttgactgtg ggtaaatctttaagacactccccagctgtgtttgtttataa (SEQ ID NO:22) cluster_67 1563145_at Gaaactattcagtggccacatgtacccagtaacagagggagcaaagcaaat /TID=iHs.l30474.1 cttatcctcaaagaactgncagctgcttgttagatctacctggtggttccataga /CNT=2 /FEA=mRNA gaaactgctcagagaacctgcctttacctcgcctaaaacagaactatcccgg agctcagcaaaggagtccattcatcctctataactgctatacaatatctcngtta aaatgctgagaagatttatcctnaaaagaaggcaccaaagcaatggggttca tcaactcagg (SEQ ID NO:23) cluster_67 24241 l_at Cacaaactccttccagtagaagcgcaggttctggctgcccccaatttctagca /FEA=EST /CNT=5 ggtccacctcaaagtccttggtgggcagacgcacggagttgaanccccagg /TID=Hs.l69095.00.01 tggggatgtggccttccagcggtggcttccccgacaacacgcgcaggaacg tgctcttgcctgcgccatccagccccagcaccagcacctcgcgntgttccag ctcctccagcgccggctcctcgtcctcctcgtcctcggggtcccactcgtccc actcggggaggcgggcagcctccgcgccccaccaggcctctccccggtcc cagcnccgctctcggccgcggccgaagtaggt (SEQ ID NO:24) cluster_67 228422_at Ggtcagttgagtccttctgggaaccggggctatgaaaactttcgtctttgggg /FEA=EST /CNT=22 accggtacccatgaaggaaaactttcctgagggggtgaggaccaaagaatc /TID=Hs.56782.00.01 aagatccttttcaggcctgatagccaagatgatgagaacttttagataaggctg tggggagagtccctggccttttgagcatcctgcttgggcacacggggaataa cctttctccagcttccagtgtgaactgagaaagagaaagggaaaccctgtcttt ggagaagctgggatcttcccagcaccagaaacttctgcaggcccctgcctg gcccacggctaacctttgggtgggactggagtttcctgaacagggaacaag ggagccttccgcagagctctgatgggcaggcctccgagggcctgtgctgtg tgctgttaggatagcttggtgttgtctataccccattagtaagttttgtctgagtgt gtcctcgctgttcattgtctaatttggtaacatttattttggtcctgaccccttctgc tgctgctgggtttaagcttcagt (SEQ ID NO:25) cluster_67 20921 l_at Ttacagtgcagtttagttaatctattaatactgactcagtgtctgcctttaaatata /FEA=FLmRNA aatgatatgttgaaaacttaaggaagcaaatgctacatatatgcaatataaaat /FL=gb:AF132818.1
agtaatgtgatgctgatgctgttaaccaaagggcagaataaataagcaaaatg gb:AF287272.1 ccaaaaggggtcttaattgaaatgaaaatttaattttgtttttaaaatattgtttatct gb:AB030824.1 ttatttatttgggggtaatattgtaagttttttagaagacaattttcataacttgataa gb:NM_001730.1 attatagttttgtttgttagaaaagtagctcttaaaagatgtaaatagatgacaaa gb:D14520.1 /CNT=158 cgatgtaaataattttgtaagaggcttcaaaatgtttatacgtggaaacacacct /TID=Hs.84728.00.01 acatgaaaagcagaaatcggttgctgttttgcttctttttccctcttatttttgtattg tggtcatttcctatgcaaataatggagcaaacagctgtatagttgtagaat
(SEQ ID NO:26) cluster_67 216126_at Cagcaccacacttgtggctttccagggtttagcatctgtagatgctctcaagg /FEA=mRNA /CNT=2 gctggccttgagtacttgtagctttttcaggctgagagtgcaagctgccagtg /TID=Hs.3O6635.00.01 gatctaccattatgatgtcaggaggacagtggttctcttctcatagctccactag gaagtgctccagtgggactctgtgtgggggctccaaccccacatttcccctcc acactgccctggtagagattctccatgagggttccactcgtgcagcaggcttc tgcgtggacatccagacttttccctgaatcttcctaaatctaggtgaaggtttcc aagcttcaactcttgcactttgcactgcaatggtagtgcaggtccactgaacca tcaaagaccaggtacatgcctctgcctggtgttctcaactcatccaccagtgtg gagctgtcatcccacttttcattacggtcatcatcgctgcc (SEQ ID
NO:27) cluster_67 205475_at Tttgcccaaactcacccagtgagtgtgagcatttaagaagcatcctctgccaa /FEA=FLmRNA gaccaaaaggaaagaagaaaaagggccaaaagccaaaatgaaactgatg /FL=gb:NM_007281.1 gtacttgttttcaccattgggctaactttgctgctaggagttcaagccatgcctg /CNT=81 caaatcgcctctcttgctacagaaagatactaaaagatcacaactgtcacaac /TID=Hs.7122.00.01 cttccggaaggagtagctgacctgacacagattgatgtcaatgtccaggatca tttctgggatgggaagggatgtgagatgatctgttactgcaacttcagcgaatt gctctgctgcccaaaagacgttttctttggaccaaagatctctttcgtgattcctt gcaacaatcaatgagaatcttcatgtattctggagaacaccattcctgatttc
(SEQ ID NO:28) cluster_67 223474_at Ggtgaaagcttccttctaaactgccccaagtgttgaagtcttcactttattttgtt /FEA=FLmRNA ctgttttgttttgtttttctgttttgtttgcaaaatggtaagggggtgtcggggggg /FL=gb:AF063597.1 atggggtgtattttgttgcaagtttgtgaggggaaaatgttttggtttgtttctact /CNT=44 gacctgaatgtgttggatctacacgtgttgttttgtttttgctttattgatgcacgg /TID=Hs.l79260.00.01.00. atgcttttgaacagtagagcgaaatgctagacatggagaatctgctctgtttgt 02.00.01 cctttatacatttctgtagttaacagaacactgtaatgtgccttggagcttagtaa cttgta (SEQ ID NO:29) cluster_67 238515_at Catctcactcacatagacagtctctgggtaggcaggtggggggtgatacaa /FEA=EST /CNT=9 gttcacactctgtgtttctcctcctgttagccattcccaccctgctgatgtttaag /TID=Hs.l 17897.00.01.00. gaaagccagggatgatgacccacttaagctttccttggccttgttaagtccaat 01.00.01 catctggggcaggaagaagagaaatgctcattgcaatctttgacccccacta actgctgtggtgactttgacccaagcccttgacctccttttccttatctgaaatgt tgctgtgattcctgtggtgagatcagatgaggcagcacttgggataagcttgc agagatgcattgagcggtatgaaagtacaggatgctatgtactttcctgcttca cagcacattttgtttcttgcaaggtgagtggcccagccgcctctccacaaaca cgtgtttctgcctttctcagcataatcagcaaga (SEQ ID NO: 30) cluster_67 228854_at Ctccttatctgttctagttccgaagcagtttcactcgaagttgtgcagtcctggtt /FEA=EST /CNT= 19 gcagctttccgcatctgccttcgtttcgtgtagattgacgcgtttctttgtaatttc /TID=Hs.l l7176.00.04.00. agtgtttctgacaagatttaaaaaaaaaaaaaaggaaaaaaaaagaaaaaat 01.00.01.00.01 gaatttactgctgcaggtttttttctctctccatgtgtcactaagtgaagtttgtgc cttctatagcaaagagaatattttttacatcctactaacagtagatttttttgtagtg aac attttttgtatttttatttataagtctc ataagaaaaatagc aatgttc agttg ta taccttgaatctgcagttaga (SEQ ID NO:31) cluster_67 204995_at Gcttttacggtgatattgtgcatgcaaaccaggagcatttngtgtcttaagaaa /FEA=FLmRNA aataatcttagaacagatggctgtgaaaattacacccatgcacagaacaagc /FL=gb:NM_003885.1 cacaggaataatagttcaggatttggtttttctctttttcttgtaaacctggagggt /CNT=84 tgatatattctttccatgcagttattagaacttagttttgttccaacagttaaacttg /TID=Hs.93597.00.01 caatgaaaagaaaatgtgccatttttttcactcagaattattcatagctgtatattt gaaactgctaattacacacgtgtgatgtatgttggttttttagtgcaatttcttctgt agctattctttgaccaaactgtgggtattgttaatattaatttatatttgtctcatttt gtatgtatgtgtagtgtgtttgtgagtatgtgtggtttataatctgacaaagtcatg aagctcagtttggctgtaatttaattccccttcccttatttttatttatttttgtactgt
gctgat (SEQ ID NO:32) cluster_67 205883_at Tctgcagtgagtgcaaccgcaccttccccagccacacggctctcaaacgcc /FEA=FLmRNA acctgcgctcacatacaggcgaccacccctacgagtgtgagttctgtggcag /FL=gb:NM_006006.1 ctgcttccgggatgagagcacactcaagagccacaaacgcatccacacgg /CNT=28 gtgagaaaccctacgagtgcaatggctgtgacaagaagttcagcctcaagc /TID=Hs.37096.00.01 atcagctggagacgcactatagggtgcacacaggtgagaagccctttgagt gtaagctctgccaccagcgctcccgggactactcggccatgatcaagcacct gagaacgcacaacggcgcctcgccctaccagtgcaccatctgcacagagta ctgccccagcctctcctccatgcagaagcacatgaagggccacaagcccga ggagatcccgcccgactggaggatagagaagacgtacctctacctgtgctat gtgtgaa (SEQ ID NO:33) cluster_67 219963_at Tctaccgtggaatgtccctggagtactatggcatcgaggcggacgacaacc /FEA=FLmRNA ccttcttcgacctcagtgtctactttctgcctgttgctcgatacatccgagctgcc /FL=gb:NM_016364.1 ctcagtgttccccaaggccgcgtgctggtacactgtgccatgggggtaagcc gb:AB027004.1 /CNT=17 gctctgccacacttgtcctggccttcctcatgatctgtgagaacatgacgctgg /TID=Hs.l78170.00.01 tagaggccatccagacggtgcaggcccaccgcaatatctgccctaactcag gcttcctccggcagctccaggttctggacaaccgactggggcgggagacg gggcggttctgatctggcaggcagccaggatccctgacccttggcccaacc ccaccagcctggccctgggaacagcaggctctgctgtttctagtgaccctga gatgtaaacagcaagtgggggctgaggcagaggcagggatagctgggtg gtgacctcttagcgggtggatttccctgacccaattcagagattctttatgcaaa agtgagttcagtccatctctataata (SEQ ID NO: 34) cluster_67 233126_s_at Tagcaaaggacatggaagcctggaaagatgtaaccagtggaaatgctaaa /FEA=mRNA /CNT=4 atttaccagcttccagggggtcacttttatcttctggatcctgcgaacgagaaat /TID=Hs.24309.00.02 taatcaagaactacataatcaagtgtctagaagtatcatcgatatccaatttttag atattttccctttcacttttaaaataatcaaagtaatatcatactcttctcagttattc agatatagctcagttttattcagattggaaattacacattttctactgtcagggag attcgttacataaatatatttacgtatctggggacaaaggtcaagccagtaaag aatacttctggcagcactttggga (SEQ ID NO: 35) cluster_75 215515_at Tggctgcgcagggagcacattggaaggggtcttggggtggacagaatttc /FEA=mRNA /CNT=3 cttttgctctaagggtgaaaccagtcaggtctctctctttctgagctctcctccca /TID=Hs.202684.00.01 gagcacctggtcaggatatcccagtcatcacctccgggaagatgatgttccct ggatagcccatacattttctcacctccatacctagctaacactgctgcatcagtc ccaatgaccccacttcccatcctttactctctgagatctggatttgccttnnaga tgcaccccccatgccactttcttaaggtagtcttctcaactccccccaaagaat gaactattatttttggggggcttccaaagcaaattgctttgaaattccaaaagat catacattctgttttaatcatagtgggttgttaagctcctgcactagactataang ctacttgtggatagggactatgatttgtttatatctgtaacttccgtctcttgcctct tttccccagcatagagcaga (SEQ ID NO:36) cluster_75 1567540_at Aatgtgaacaacagcggcctgaagattaacctgtttgatacccccttggaga /TID=iHs.404151.1 cgcagtatgtgaggctggagcccatcatctgccaccggggctgcacactcc /CNT=I /FEA=mRNA gctttgagctccttggctgtgagctgagtggatgcactgaaccccta (SEQ
ID NO: 37) cluster_75 233958_at Aggagggatgatcacttgggcccggaagttcaggatcatcctggaaaatat /FEA=mRNA /CNT=4 gtcaagacttcacctctaccagaaatttacaaattagctgggcatggtagaatg /TID=Hs.l2621.00.01 tacctgtagacctagctacttaggtggaagaatcacttgagcccagcagttca aggtgacagtgaactacgatcaggccacttgattccagtcttggcaacaggg taagaccttgtctttaaaaaaataaaaagcaaaaaataaaatgctagttatatta ggaaaaagcctgactgaggtccaaatgcatgcggaagactgtttcagcaaa ggtaacatccctctatgccacagcttgattgaattttaaataaagatgatgataa aatgtacatttattaaggagataattgatgtaatgtgctcagtacaagttttggca tattacaagcattcaataaaccctacatct (SEQ ID NO: 38) cluster_75 215326_at Tgggcacggggagaggaaggcactcctctttaaggaccgacccagaggtt /FEA=mRNA /CNT=4 ttgccattgcttcactggccagagcttagtcacgcagcctcacccagaggca /TID=Hs.20447.00.07 agggaggttggaaaatgtagtgtttgtgtgtgtctaacacaaattctattaccat gcagtcaggattctccactcttgctctttcattagatttgctgggcttcaccctgg actttctgatttagtgacagaacagagaacccagaggcagacccagatgtgt acaagggcttcatatacaatcaggagatttaataatcatgctaggggccgggt gcag (SEQ ID NO:39) cluster_75 235184_at Gagggttttctctttaatcacaacttaaaaaaagaaacctttaatacctctgcat /FEA=EST /CNT= 12
aagttctctgaaagaacttaaattcttagtttatatgaaaactgatatgtatgtctg /TID=Hs.126497.00.02.00. tgtaacaaagcctgttgggtacaggtctacaaggagatactttgtttctaaaaa 01 aggagttaaatcgtgtcacctgaatttttttttttngagataagtggacattttgg ggattttggttaaaacatatttctctattctaaaaattacagaatatgtattcataaa agggaagaaattgttagaaaatttcctgtgtacgtagtttgnnnnnaaantaa agaatcttgtgacctggnnnaggacattttgcatttgtaacactgcagttttaat atatttgctgttttttttaaaattagaatatgtttaaaatttaatggttatgaggctct gtag (SEQ ID NO:40) cluster_75 226847_at Atttattggattctctgctgcctgatctgtacatacatgatccctcgggttttgttt /FEA=EST /CNT=48 acaaggaaccttgactgaccaaaaggcattataactctgactcaaatacaag /TID=Hs.301570.00.02.00. gtacagaagataagcatctttgaggaaactcctacttcagttcttttgttatgatg 01 aagacatttgtgagagaggagatgattagaattctagtaatgtacttttaagatg ttacagatacaaagaaatgatgtgggtgtcaggagactaaaggatgttgaag gctacacattcaaccttttgttaggtgtttcctttaagctactcagctgtacctttta aattagttctttttcaaccagtatatcactaaaagttatatcaaagctttatcagttc aagtttcttgcttttcataatacttttttctgatgcaattttatattttcaaacatggca agttaaaatataaattcatttaaatatatagttttgtacttttctaccatgt (SEQ ID NO:41) cluster_75 222899_at Atgacacaatccctggggctgtgcattcccacgtcttcttgctgcagcctgcc /FEA=FLmRNA cctagacatggacgcaccggcctggctgcagctgggcagcaggggtagg /FL=gb:NM_012211.1 ggtagggagcctcccctccctgtatcaccccctccctacacacacacacaca gb:AF109681.1 cacacacacacacactgcctcccatccttccctcatgcccgccagtgcacag gb: AFl 37378.2 /CNT=42 ggaagggcttggccagcgctgttgaggggtcccctctggaatgcactgaat /TID=Hs.256297.00.01 aaagcacgtgcaaggactcccggagcctgtgcagccttggtggcaaatatct catctgccggcccccaggacaagtggtatgaccagtgataatgccccaagg acaaggggcgtgcctggcgcccagtggagtaatttatgccttagtcttgttttg aggtagaaatgcaagggggacacatgaaaggcatcagtccccctgtgcata gtacgacctttact (SEQ ID NO:42) cluster_75 242883_at Gtgggcctgagtcgcagatcagaaagcaccgggaagatgcaggcctgcat /FEA=EST /CNT=6 ggtgccggggctggccctctgcctcctactggggcctcttgcaggggccaa /TID=Hs.l48586.00.01 gcctgngcaggaggaaggagacccttacgcggagctgccggccatgccct actggcctttctccacctctgacttctggaactatgtgcagcacttccaggccct gggggcctacccccagatcgaggacatggcccgaaccttctttgcccacttc cccntggggagcacgctgggcttccacgttccctatcaggaggactgaatg gtgtccagcntggtgcccgcccaccccgccaggctgcactcggtcgggcct ccacaggcatggagtccccgcaaaaacctggcccctgcaggagtcaggcc tggtctcacgctcaataaactccggactgaagatgca (SEQ ID
NO:43) cluster_75 232577_at Atgtagttgtctaccacttcctagcacacctgggctgcacaaatatgtgggtct /FEA=mRNA /CNT=9 gatataatgtcagaaatgcaggaagctatatgagattccagccctctatttttcc /TID=Hs.! 16072.00.01 aagtgtaaaagaacttatgaatcaagagccgaataaaaaacatagtactctttc tgataatctgtcaacaaatttgcaatcatgtcaggcatgttatatgattacgaatt gctcaatgctattatgaaaagtattttcaacaagtgaaacttctggagttctctgc agttctgggatcaaacctcagtgccttgtcctaacgtcccattaggacagaagt gcccttcctgagagtatggcagcataatgacattctagcacctggaccgatta cactgctctccctgaagtagtggattctttcatcagcagga (SEQ ID
NO:44) cluster_75 239693_at Gtgtctgtacttaatgtgtctactttgagtaatatttcatctacatacaagcagat /FEA=EST /CNT=5 attgtatgtttagtgtacatatatttaatttctcctcttttacaaaaatggtagcacg /TID=Hs.l68184.00.01 caatacccattgctttctatttttttttatttaacaatatcttggcaatctttctgtatca gtatataaagtgctattctctttttaaaaaaaaaaagctgtatggatcttctataatt tgtgtaaccactaccatattgatagacattttacttttcgatttcactaggcatgcc tggcccatattgctctacaggttgtgcattgcacaagtccaagcagtgtcattc acatggaccacagtgttaatagtattccaagtcatgcttggaaccctgcacttg gggaaatatcaaaaactttaatcattcaaaccatggattcacaggcaat
(SEQ ID NO:45) cluster_75 243288_at Gaggagcagagggcaaactacgttcccattaaagccacaaggtttaaaaac /FEA=EST /CNT=6 ctctaaccttggaaaagcacacttcaaccctctgcacaccanacttctctactg /TID=Hs.201767.00.01 tggtttcccctctgccnctttctccttggcgttccccnatcactgcctctagggt ctttacaagggacagcgaacgtaaggtttcggagctggcttcgcccccttcta
tttaccgggggctggtcatccttcgggccaggctgactgtctaggggtggcc ct (SEQ ID NO:46) cluster_l 0 241451 _s_at Gaccgaaggcagctttggtgactccacttctttttaaagtcaccctcctctgcc /FEA=EST /CNT=8 ctctgactttaagtgacaggcagttccctcccctctctttcaattctgtaaaatgg /TID=Hs.l32696.00.01.00. ggataatccggacctcatgcccccagagccttgtaaggaccggctaatgag 01.00.01 ggcaggcgagtgggaaacgaatcgtctgaacaatgatcagtcattctttcgg gcttgcaaagagggtaaaaaaggttgggtctttagcggggtccgtagaagg ctttgaagacgaaaagtgctgtagaggtgctaagcagcagccaacggacc (SEQ ID NO:47) cluster_10 1560692_at Gattggtcatttctgaagcaacacagacttgtacctgtatcagcaatgtttacc /TID=iHs.385500.1 atgctcataatcaaagacgtatgctagtttggaatgagctactaggctcattgta /CNT=3 /FEA=mRNA tcagtgtccaaaataatgaagatttatctgtcactgtgccaccaagagtccaac tcactggctactttgagaaagaacatggtgcactatttgcttcacactcaagaa gttaatatggaaccttaaaaattggaacggaaactaaaacaaattaaggagat ccttcagagattttaaccttatattttgtctctgcgactataactttgtaaataacca taactatgaataggaataaagatttaaaaataagttatcagacattctcaacctt gtttccaag (SEQ ID NO:48) cluster_10 219650_at Gagcctttgtctggtgaacagttggttggttctccccaggataaggcggcag /FEA=FLmRNA aggctacaaatgactatgagactcttgtaaagcgtggaaaagaactaaaaga /FL=gb:NM_017669.1 gtgtggaaaaatccaggaggccctaaactgcttagttaaagcgcttgacataa /CNT=27 aaagtgcagatcctgaagttatgctcttgactttaagtttgtataagcaacttaat /TID=Hs.89306.00.01 aacaattgagaatgtaacctgtttattgtattttaaagtgaaactgaatatgagg gaatttttgttcccataattggattctttgggaacatgaagcattcaggcttaagg caagaaagatctcaaaaagcaacttctgccctgcaacgccccccactccata gtctggtattctgagcactagcttaatatttcttcac (SEQ ID NO:49) cluster_10 156051 l_at Gtgtgcacacactcagggcagtgctgacatgccagccccctgccgtctcag /TID=iHs.436529.1 ccctctccagattttgggcactgatgagcataggaatgaagctgaggaggaa /CNT=3 /FEA=mRNA ctgagggcagcttggcagtggcctgcagacgccccttggtacctatagcctg ggcgccatgaatggcagcaggaggcagacaggtttctgggcagaagggg gtgagtccctggtgaggcccaccttcaggccagggaggccctgaaggctg ggggccaggctgtcagtgccgtggactggagtgcgaacttgtgttgccttttc tgggcctgcccatggccgcccatggaccagtcagcatgaacttccccctctc tgaggctgacagaagccccaggctcagccagagctgagcagacgtcggat gaccagctgtagtgaggaactgccctctccagggcctcctctgagctattgtc actcaata (SEQ ID NO: 50) cluster_10 1561055_at Agtaacaggcatgctttctgtccttctctccttttagattgtaagctacccaaagt /TID=iHs.407601.1 ccatctccatgggtttttttccttatgtgcaaactaccatatgacaggtgtgcctg /CNT=5 /FEA=mRNA acaataactcaggtatagctgagaatgatcctgtagtccaagaatgttggttct gagctctgaactaaggaatctgggagctgccaacccagaggtttactccttat ctatggagcataggtgaacccctggcccatttcttggaacagcatgtgcggg gaaccaaggccctttgttttgagctaggtggaggtggccaggtagaggtcgc caggaagaggtggccaggtggaggttgctaagcaaagattgctatattaact gggtgctttttagaaaccatagtggttaccccattcatc (SEQ ID
NO:51) cluster_10 1562455_at Acgcagatggctttgatcctcagggtggcagaattccaaaatgtcctttccca /TID=iHs.434442.1 gaagatcctaaataaaagagacaagctttaataatcccagatccatttgtaatta /CNT=2 /FEA=mRNA tttgtatactcactgtgatacaacagtgttcatttccatctcctttaactcatctcctt tagcctgtcccaccccagattttttgaaaaagtgagtgcaaaatttccctggga gccgtcagagaactggcttcttggtattcactctaagttcttctggcatgctcaa tatccatttctaattttgctaaggcactacatcagtagcttcagaatgcaattttatt tttgtttgtcttggagaggcaaactgcaataaacatactttaataacataaaaag aaagcaaaatgatagcctgaggacagatgtgttgcttatgaaaactggaattg tttaaatgtggaaattgtagctctcctgtggctgaa (SEQ ID NO: 52) cluster_10 217417_at Aaaactatgctcttgtatgggtggtaggacacttggtgttcaggcagctctgg /FEA=mRN A /CNT=I ggcagaggaaaaacggtacagggtaattgtattttatggctgggataataatt /TID=Hs.l70157.00.02 ctaagttttcataattagagacaacttctgcaggccagaatttgtattaactactt aaactagagcttccatgtgacaatagggaaaacaaaacttgtaattcactaac cagctttgaaattatgcaatatttgatgattgttttaattcagaagaatgtatgttat tactgatgcctcacatagagggagatgttattaatatttttatttatgtcacactatt tcagataagtataattttaaaaatcccataaagtgtgactacactgtatttctaatc
ttgaaagatattatttaattaaaatagatgcattatggttggaaatcaagaaaatc tttatcttacatccctggttacattgtacctagaagtgaccctcaaatt (SEQ
ID NO:53) cluster_l 0 232418_at Aaacggaaagtctctcatcctgtcctgtcattgcctagggtggagaaacaga /FEA=mRNA /CNT=8 agtggaaggtttgtttcaggtcctctgaggataattagtccattgcagtagtttta /TID=Hs.287630.00.01 cttgatggtaccccatgggccagaagagggcatacttaaccttctagagagc ctgaagtagctcctgatcacaccttttcaaggtaaagtgaagagcatgaaattt tggacagngtttattgntggacntttaaagtttgtgatntgcggtaacaaggag aagggtttttaagtttataaaaattatttatcaattagccgggtgtg (SEQ ID NO:54) cluster_10 241542_at Gcataatgtactctatctgcgatattagcttctcggtcttgcagtgttgcctaac /FEA=EST /CNT=4 acacacagtgatcagcacattttttgagactgcaataatcagaggaatgtaac /TID=Hs.l35866.00.01 agtgatgtgggaacaagaggaaataacatggaataataatgtacccatcattg ttctgttgtcatccctcctagccagtttggtttcccttagagcctaacaaaagctt cacgaattcaatggaataaaacatggaactgggtgcaaaattaatacatctatt cccaagctccatattcatagaaaaaaggaaaatattgactacatagggaaca gactttccctgaaagctttgtggatctatgcatatgcttatgtaatcttcaaacaa gttgtgcagccttttacaaatgtgtctagcctc (SEQ ID NO:55) cluster_10 231333_at Agctgggtctgaggagccaagcagaaaaacttcccaaaatcactgggtgg /FEA=EST /CNT= 12 ggaggggtcagagacttactgctgccccagctgttctgactctgcccccagc /TID=Hs.97764.00.01 ttttggccccacccttttaaagcaccttcagaggttcccaatggtgacagtaaa caagtctccactgtcctggccatctctgctgtgttcaccctactcctgatctttct ggctgctcagggactgacagccaagatgtgaggctgtgatgagcaggaac agggaggcctggagcccccagccattgtcatcacttccctgatctgcctaaat tctgcccagcagtccgtgaaaatggtttgctgatgacatatgtaaggactttaa ctcccctcaagcaatctgctcatctcaaagggtaaaacattggctcactcctaa tgcaat (SEQ ID NO:56) cluster_8 236810_at Gctctcaccgtctggttgattcggacgtggttgcactgtcctggatcctcagc /FEA=EST /CNT=7 cttaccctccctcttntcaggaccctcacactgggattcgtnagaaatgtggac /TID=Hs.208971.00.01 cccaggagggagtgaagagtgttcaagggtcacggtggaagacaggctct atgggaagagagcgagtggataaccacgtgaaggcagaaaaggactccaa ccccaccttatgtcctctccaggtgttcccaattctgccagcaccctgccctct gccacctggggctccttccattctgcccagtcgaggcatttctggagggagg acccgtgagaaccttgcatagaacatacaggatccagaggcctctaatacag catttcagtgcagctgccagcaagggccactgagggtcacaggctggccag gtgctgtaaatgtacagagaccatgtttgtgaagccccacatcaggacacata acct (SEQ ID NO:57) cluster_8 211226_at Cggcgcgccaagcgcaaggtgacacgcatgatcctcatcgtggccgcgct /FEA=FLmRNA cttctgcctctgctggatgccccaccacgcgctcatcctctgcgtgtggttcgg /FL=gb:AF080586.1 ccagttcccgctcacgcgcgccacttatgcgcttcgcatcctctcgcacctgg gb:AF040630.1 tctcctacgccaactcctgcgtcaaccccatcgtttacgcgctggtctccaagc gb:NM_003857.2 /CNT=5 acttccgcaaaggcttccgcacgatctgcgcgggcctgctgggccgtgccc /TID=Hs.l58351.00.01 caggccgagcctcgggccgtgtgtgcgctgccgcgcggggcacccacagt ggcagcgtgttggagcgcgagtccagcgacctgttgcacatgagcgaggc ggcgggggcccttcgtccctgccccggcgcttcccagccatgcatcctcga gccctgtcctggcccgtcctggcagggcccaaaggcaggcgacagcatcc tgacggttga (SEQ ID NO:58) cluster_8 156388 l_at Cctactctcaataaatggccaatggatgttctctaaacaaaaagagaattctaa /TID=iHs.377053.1 aacaataccaaaattctaaaaaaaaaaaacaaccaacaaaaacaatgagga /CNT=I /FEA=mRNA aaagagaagaatggagaaagtaaaactatagataaataaaatacttttcttcat cttttgagttttcttttttcccatttttattgagatataattggcatctctttaaattttcc aaattaggtttgagtgttgaagcaataatagtactgtttaatgtttctaaatgtgtg tagagagaatatttaaggtaattcattataagtgagggagggtaaaagaatatc aatggagataaggtttatctacttcagtcaaagcggtaaaatgataatgccagt agactataagatatataaaatatatttatagattatatatatatatataaaatgtgtg catatatatgtaatgtagtacctaaagcagccacttaaaagctatacaaaggag atatactcaacagtactgtag (SEQ ID NO:59) cluster_8 1564070_s_at Gctttgagcctcttcggttttccggccagacccggaaaaacgaaaacacagc /TID=iHs.320051.1 ttggggagcccccactagccggcgcctgtgccagctcacctctggccatgg /CNT=I /FEA=mRNA cgcagctgccggtgcacacggcggccaaggccagctccacattcttccctc
cccctcccacttcaccgtagccccgaaccctgcgcgcagagaaagggtctc agctccacagacgactgggtccctcctcaccaaaaatggtgagacaagattt catctgtcggccgaggagccacaagcaggtttgtctgagagggatggtgct gggggaaggctttggattgcatctcaaattaagctttgctccttaaatgtggcg ctctcgccaagaaaaagcttggggcctgaattcttgagatttatggtgcacctt attgatcaaattt (SEQ ID NO: 60) cluster_8 230393_at Ccacgtcacgtgacgcgagggcggggacgcgctcgggagcgagcgtgg /FEA=EST /CNT= 16 gagcctggaagcctcggtgggtcccgaggctgcagcgaggccgggaccg /TID=Hs.l01299.00.01.00. tgccctctgctggcgggacctggcgttttccggcaccccgccccaaatcccg 01.00.01 gactcggtgttaagggaggtgcattgtcctgaaatgcttacaacagctgtcttc aataactcgtgcatagaatgcgcccagtaaatatgtgtt (SEQ ID
NO:61) cluster_8 23288 l_at Gacgactgatcgtccaaggactggcgncggatccaacacctttccccagct /FEA=mRNA /CNT=4 ctgcgcgtancncgctntttggnaancgaattggtccctgtctgcttccaagg /TID=Hs.283846.00.01 gtccnnggaaccttctgncagctgtgcctctccagagctccgcctcattagtg ccacgttcctggtttgaaaaccatagtacttcaacctcttctagatgggagttaa cctttgccctctgaaagaaaggtttgataagcaaagagagtttggtgagcaag atccttgaggtaagagctgatctctgacgtccgctgggaactggcngctctg caggtttctgtatcacattttctgcacatgtccattagaattggagatggggcgt atctagtgttgaataaaggcccggcagnncctcccagatgcaccctgtcnna nanannnnannnnnnannnnnnanaaannacttgactcattcttggtgg cgaccaccccacccacaggcacctaaaatgaa (SEQ ID NO: 62) cluster_24 220718_at Ggtacctaattactagttacacatacatggctttgatgggaaatcaaagaaac /FEA=FLmRNA attctgacaatacagagattcatcaagcaatttgtctttgaaagttgattattcaa /FL=gb:NM_025005.1 aaacagagcttgtagcaaaagaagcagaagttagatcccacagtcatcaagt /CNT=5 ttcagatcctaaggcttgcattcttacaccaatttcttctttgcttaaatcttaatttt /TID=Hs.287563.00.01 catcagcattaattaagtgtctgggtactctgccagtcaggagagatgttacca aaggtacaggatttgagaagtattgtcagaagagccaagttcataatcaggcc cataggatcaataatttgggggagtgtttagagcagtttcaaagatgagagca gtagatcaaagtagaatttcaggactgagcacatgccaaggcacccttttatg gatattcaacc (SEQ ID NO: 63) cluster_24 244097_at Ttccttccaaatttactttgataatatataaagataggagtagcacctctggcta /FEA=EST /CNT=6 aacctttttttcatacccacttatttccttagaatagatttctagaattactaaagat /TID=Hs.291816.00.01 aagtgcatgagcatttaatatacttgataactattgtcagatgacttgccaggaa gtttgttcttagtaatatttaatgtactgggatatgtcgtgtttctcaaccccttttcc tgcttcattgatttgcctgttccattacaaaccactttgtgtttaattaatacctttat gttattatatctggtagggcaagaattcacactacaattttataggactttc
(SEQ ID NO: 64) cluster_24 216214_at Tactaaagttgacctgggatcacaggcgtgagccacggcgtctggcctattt /FEA=mRNA /CNT=4 cccttttaagtaaatatctgggtaggtggtctgagaatagtctgatgtgaaaga /TID=Hs.51649.00.01 ccttggctcccagaaactggtacatgatatttctcacnnctcattggccnagaa aacagtcacatggacaggtaacagcaaacaggcntaggaaatgcaatcntt gattatgaaaggccnatttaaccatctaaaattggggtctctaacaaaacaga agagggcaaaggattttgagaaaaactaactgcagtctctaaatatgtaggct caatcattaccttccttttccaaatgaggaaagtgagacatagagatgttaagn ntcatgcctggcattgtacaatattcccttccg (SEQ ID NO: 65) cluster_24 1553747_at Catgttagtgtcatctctattagatgctttggagcaaacatgaacttgggtttcct /TID=iHs.290691.1 tttaagatgtcctgtgattccagattcaggggaatctgagaaaagtttgaagaa /CNT=9 /FEA=FLmRNA agaaaattccactcggccagccaaccttgggtgtgcagagcctgccccgcct /FL=gb:NM_032923.1 tccccactttgtcctgagaagctgggtcctccccagcaccagagttgctgctg gb:BC008026.1 cttcccctcgcgctcttggctgctctcccggccccaagcctgagtgacactct aggattgcagatggcaggct (SEQ ID NO:66) cluster_24 240342_at Gaagcagcccacttggtggggttggggtatgagtccttcctcgcgggggct /FEA=EST /CNT=5 cggtgggtcctgagtattctttggccggatttgctgatccgtctgctccagnnn /TID=Hs.l21364.00.01 agnttnnnaangnncnnnnnnnaggccnncannnncntntgnnannnt aggaaaaaaccagccctactgagtcagaaactggggatgtggcccaggca atcttttaccaagacctccaggtgattataatgcaaggaaggattccctatcttg gacctgaggctgctttcttgaagaaaacttgactttatttcatttagtgggaaga gc age agccc agctattaagttctaatatgc aataggctgc aggctgtg aagt
gttcgtggcagtagactctgaagctaaggagctgagggcttaacaagtttcta gaagctgccatcaacatgccaagtcagtaaaactgatagttgatcagatttca aggtctggggagtatatccactgtgtactgggtcttgagctctagag (SEQ
ID NO: 67) cluster_24 237000_at Acataaatagccagaggacttgcctgggccgtacataggggaattcacatg /FEA=EST /CNT=6 atcagttttagtatatactgtcaattttnccaaagaggttgtaccaatttacttccc /TID=Hs.23681.00.01 agcagctgtgcagaagcattagtagagtttcagttgttnccacgcccttgtcaa cgctttgtgcccttgacctttacaacactccattttaaagatgagtgtgtagatgt tgaaaagtgcacaaggggaatgtttgctccatgagccaatcacggaaggaa gctgggc (SEQ ID NO: 68) cluster_24 1566030_at Gttgtatttccatcagcacatcgattttaagatattttcctcactccaaaaagaag /TID=iHs.l70411.1 cctctccctctcagctgtatctccagtccctagaatggtactgagtcctgtgggt /CNT=3 /FEA=mRNA actcggtgattttgcagctactgctgcagggacgaaggggaaactgcatgg gaaggcatctcctaaacatgaccagttattggtgtcaccattccctttgcttcac caacttgatcttcttcagatccttttcttctgcttcggcatcttttcattgtcatcattt tatcttcatcactatcatcaccttcactgcttgtttatcatcatctttgtcattttcatc tttttcttcctcattatctttccatcatcttta (SEQ ID NO: 69)
In a particular embodiment, the method comprises measuring the expression level of at least 5 of the genes in a biological sample obtained from a subject, wherein an elevated level of expression of the 5 genes compared to a control level measured in a population of normal subjects is indicative of an increased probability of the presence of coronary atherosclerosis in said subject. In other specific embodiments, expression levels of 10, 15, 20, 30, 40, 50, 60 or 69 of the genes are measured, and an increased level of expression compared to a control level is indicative of increased probability of disease. The predictive ability of the method is more accurate as an increasing number of the gene set is measured. Generally, it is desirable to screen at least about 21 genes in a subject sample for optimal predictive ability.
Table 4 includes a listing of 85 clusters/metagenes representing groups of genes that are affected by atherosclerosis. As a systemic vascular process, atherosclerosis involves the processes of inflammation, immune modulation and stem cell signaling. Therefore, the 85 clusters represent the gene expression signature for a systemic inflammatory process.
Table 4
Cluster Affymetrix number ID Gene Annotation
1 243783_at no current annotation
1 216116_at NCK interacting protein with SH3 domain sine oculis homeobox homolog 1
1 205817_at (Drosophila) cytochrome P450, family 3, subfamily A,
1 211440_x_at polypeptide 43
1 240848 at no current annotation
1 226610 at proline rich 6
1 218629_at smoothened homolog (Drosophila)
2 220927_s_at heparanase 2
2 206777_s_at crystal Nn, beta B2
223106_at transmembrane protein 14C
1558421_a_at similar to RIKEN cDNA A530016L24 gene
214800_x_at basic transcription factor 3
1562217_at no current annotation
227584_at neuron navigator 1
1569555_at guanine deaminase
1562590_at hypothetical protein FLJ25756
203929_s_at microtubule-associated protein tau
224061_at indolethylamine N-methyltransferase
240534_at LIM homeobox transcription factor 1, alpha glycoprotein 2 (zymogen granule
214324_at membrane) 215973_at no current annotation calcium channel, voltage-dependent, alpha
231147_at 2/delta subunit 4 deleted in a mouse model of primary ciliary
1560614_at dyskinesia 1563458 at parvin, alpha sema domain, transmembrane domain (TM), and cytoplasmic domain,
220574_at (semaphorin) 6D 240825_at no current annotation 243516_at formin 1 216182_at synaptojanin 2 1554601_at no current annotation epidermal growth factor receptor pathway
238372_s_at substrate 8 206377_at forkhead box F2
C-terminal PDZ domain ligand of neuronal
215153_at nitric oxide synthase
228887_x_at no current annotation
228467_at purine-rich element binding protein B aryl hydrocarbon receptor interacting
235731_at protein-like 1 236290_at docking protein 6 1556771 a at ciliary neurotrophic factor receptor leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains),
1569504_at member 1 230071_at septin 11 interleukin 6 signal transducer (gpl30,
204864_s_at oncostatin M receptor) 217500 at no current annotation cytidine monophosphate-N- acetylneuraminic acid hydroxylase (CMP-N-
21057l_s_at acetylneuraminate monooxygenase) 224239_at defensin, beta 103A phospholipase A2, group IVC (cytosolic,
209785_s_at calcium-independent) 220266_s_at Kruppel-like factor 4 (gut) 212777_at son of sevenless homolog 1 (Drosophila) inositol polyphosphate-5-phosphatase,
213643_s_at 75kDa 203372 s at suppressor of cytokine signaling 2
206079_at choroideremia-like (Rab escort protein 2)
241241_at ribosomal protein S14
222024_s_at A kinase (PRKA) anchor protein 13
232845_at cadherin-like 23
241879_at no current annotation
206769_at thymosin, beta 4, Y-linked
216391_s_at no current annotation
230785_at sal-like 3 (Drosophila)
225822_at hypothetical protein MGC17299
209534_x_at A kinase (PRKA) anchor protein 13
215697 at RIM binding protein 2
226891 at chromosome 3 open reading frame 21
203825_at bromodomain containing 3 chromodomain helicase DNA binding
212571_at protein 8
204263_s_at carnitine palmitoyltransferase II
232464_at tripartite motif-containing 34
1553437_at no current annotation
1568876_a_at no current annotation
234049 at no current annotation
234203 at like-glycosyltransferase
1561263_at no current annotation
234394_at no current annotation
244736_at no current annotation smu-1 suppressor of mec-8 and unc-52
222618 at homolog (C. elegans)
236810_at integrin, beta 7
211226 at galanin receptor 2
1563881_at BAIl-associated protein 1
1564070 s at no current annotation
230393 at no current annotation
232881 at GNASl antisense
37201_at no current annotation
Rho guanine nucleotide exchange factor
237398_at (GEF) 12
209211 at Kruppel-like factor 5 (intestinal)
231375 at hypothetical protein LOC202181
219963_at dual specificity phosphatase 13
242308_at mucolipin 3
241451 s at no current annotation
1560692 at hypothetical protein MGC33530
219650_at FLJ20105 protein
1560511_at no current annotation
1561055_at no current annotation
1562455_at no current annotation
217417_at myosin VA (heavy polypeptide 12, myoxin)
232418_at leucine zipper transcription factor-like 1
241542_at SRY (sex determining region Y)-box 6
231333 at no current annotation
1563121_at no current annotation
244254_at no current annotation
Rho guanine nucleotide exchange factor
237398_at (GEF) 12
224061 at indolethylamine N-methyltransferase
217041_at neuronal pentraxin receptor
244767_at no current annotation
1569290_s_at glutamate receptor, ionotrophic, AMPA 3 aldolase A, fructose-bisphosphate
244789_at pseudogene 2 eukaryotic translation initiation factor IA,
201016_at X-linked
244877_at no current annotation
236477_at no current annotation
237684_at no current annotation
203930 s at microtubule-associated protein tau
238882_at no current annotation
214678_x_at zinc finger protein, X-linked
232429_at no current annotation insulin-like growth factor 1 (somatomedin
209540_at C) sprouty homolog 1, antagonist of FGF
212558_at signaling (Drosophila) ubiquitously transcribed tetratricopeptide
20399l_s_at repeat, X chromosome
202260_s_at syntaxin binding protein 1
230151_at chromosome 13 open reading frame 1
235331_x_at polycomb group ring finger 5
203738_at hypothetical protein FLJ 11193
218853_s_at motile sperm domain containing 1 cytochrome P450, family 3, subfamily A,
211440_x_at polypeptide 43
226747_at KIAA1344 ubiquitin protein ligase E3 component n-
212760_at recognin 2
238164_at USP6 N-terminal like
201734_at no current annotation
212164_at chromosome 1 open reading frame 37
ATP-binding cassette, sub-family C
203196_at (CFTR/MRP), member 4
1552660_a_at hypothetical protein FLJ 11193
219017_at ethanolamine kinase 1
215150_at no current annotation
227728_at no current annotation
242601 at hypothetical protein LOC253012
202334_s_at no current annotation protein phosphatase 1, catalytic subunit,
201407_s_at beta isoform
208116_s_at mannosidase, alpha, class IA, member 1
218277 s at DEAH (Asp-Glu-Ala-His) box polypeptide 40
217880_at no current annotation
GULP, engulfment adaptor PTB domain
204237_at containing 1 xenotropic and polytropic retrovirus
226615 at receptor
211763 s at no current annotation
209298 s at intersectin 1 (SH3 domain protein)
203302_at deoxycytidine kinase
225217 s at bromodomain and PHD finger containing, 3
protein phosphatase 3 (formerly 2B), regulatory subunit B, 19kDa, alpha isoform
204506_at (calcineurin B, type I)
243619_at FGFRl oncogene partner 2
1552790_a_at no current annotation
202460_s_at lipin 2
236994 at no current annotation
209316_s_at HBSl-like (S. cerevisiae)
201772_at antizyme inhibitor 1
229194_at polycomb group ring finger 5
202055_at karyopherin alpha 1 (importin alpha 5)
ANl, ubiquitin-like, homolog (Xenopus
223624_at laevis)
227498_at no current annotation
221778_at KIAA1718 protein
202459 s at lipin 2
202076 at no current annotation
223005_s_at chromosome 9 open reading frame 5 eukaryotic translation initiation factor 3,
208264_s_at subunit 1 alpha, 35kDa
227357 at TAKl-binding protein 3
200711_s_at no current annotation
226220_at DORA reverse strand protein 1 proteasome (prosome, macropain)
212219_at activator subunit 4 telomeric repeat binding factor 2,
201174 s at interacting protein
222605_at REST corepressor 3 protein phosphatase 1, catalytic subunit,
201409 s at beta isoform
229800_at doublecortin and CaM kinase-like 1
235849_at hypothetical protein MGC45780
1554419_x_at zinc finger protein 403
1552987 a at no current annotation
230425_at EPH receptor Bl
1560788_at myosin IIIB
1569840_at no current annotation
240114_s_at hypothetical protein MGC13034
1554707 at chromosome 9 open reading frame 68
230823_at no current annotation
1553550 at vomeronasal 1 receptor 5
20999l_x_at G protein-coupled receptor 51
1564149_at no current annotation
241357_at mitogen-activated protein kinase 15 potassium voltage-gated channel,
207635_s_at subfamily H (eag-related), member 1
213990_s_at p21(CDKNlA)-activated kinase 7 chromodomain helicase DNA binding
233810 x at protein 9
211809_x_at collagen, type XIII, alpha 1
206291_at neurotensin
DEAD (Asp-Glu-Ala-Asp) box polypeptide
1553181 at 31
aldehyde dehydrogenase 4 family, member
203722_at Al
212012_at Melanoma associated gene
217409_at myosin VA (heavy polypeptide 12, myoxin)
215311_at no current annotation
232468_at FERM domain containing 4A transition protein 1 (during histone to
206568_at protamine replacement)
1554840_at no current annotation
G protein-coupled receptor, family C, group
228313_at 5, member B
217330 at disrupted in schizophrenia 1
1561910_at no current annotation
204503_at envoplakin
NTPase, KAP family P-loop domain
1560430 at containing 1
234698_at chromosome 21 open reading frame 127 glutamate receptor, ionotropic, N-methyl-
231304 at D-aspartate 3A
239182 at hypothetical LOC401022
1562093_at no current annotation
226192_at no current annotation
1554140_at hypothetical protein FLJ23129
237021_at hypothetical protein LOC144486
1556810 a at Wiskott-Aldrich syndrome-like
228291 s at chromosome 20 open reading frame 19
219288 at chromosome 3 open reading frame 14
222808_at glycosyltransferase 28 domain containing 1
SMAD, mothers against DPP homolog 2
203075_at (Drosophila) likely ortholog of mouse hypoxia induced
217845 x at gene 1
218856 at no current annotation
226837_at sprouty-related, EVHl domain containing 1
220549 at no current annotation
201366_at annexin A7
217870_s_at UMP-CMP kinase
209404_s_at no current annotation
224892_at no current annotation
1560565_at no current annotation
207405_s_at RAD17 homolog (S. pombe)
225087_at hypothetical protein FLJ31153
SMC6 structural maintenance of
236535 at chromosomes 6-like 1 (yeast)
218603 at headcase homolog (Drosophila)
202007_at nidogen (enactin)
220103_s_at mitochondrial ribosomal protein S18C
238647_at chromosome 14 open reading frame 28
ATPase, aminophospholipid transporter
213106_at (APLT), Class I, type 8A, member 1
238614_x_at zinc finger protein 430
220652_at no current annotation
243918_at no current annotation
222974 at interleukin 22
217240_at no current annotation solute carrier family 12 (potassium/chloride
211112_at transporters), member 4 prostaglandin F2 receptor negative
224950_at regulator
206079_at choroideremia-like (Rab escort protein 2)
231525_at IQ motif containing Fl
1552322_at hypothetical protein BC017868
213197_at astrotactin
243247_at hypothetical protein MGC27434 olfactory receptor, family 8, subfamily B,
1555212_at member 8
215759_at no current annotation
205579_at histamine receptor Hl
EGF-like repeats and discoidin I-like
1558643_s_at domains 3
216927_at no current annotation
203930_s_at microtubule-associated protein tau
214981_at periostin, osteoblast specific factor
218995_s_at endothelin 1
1561703_at no current annotation
220718_at no current annotation complement component (3d/Epstein Barr
244097_at virus) receptor 2
216214_at no current annotation
1553747_at no current annotation
240342_at tripartite motif-containing 61
237000_at no current annotation
1566030_at phosphatase and actin regulator 3
239506_s_at hypothetical protein LOC151300
232277 at no current annotation
227932_at ariadne homolog 2 (Drosophila)
211801_x_at mitofusin 1
243725_at no current annotation
220743 at PRO0149 protein
1562093_at no current annotation solute carrier family 13 (sodium/sulfate
220502_s_at symporters), member 1
227126_at no current annotation
244520_at ubiquitin specific protease 1
211634_x_at netrin 2-like (chicken) laminin, alpha 2 (merosin, congenital
1560997_at muscular dystrophy)
229370 at no current annotation
1563496_at Six-twelve leukemia gene
1552687 a at chromosome 20 open reading frame 152
1568935_at no current annotation neural precursor cell expressed,
1566115 at developmental^ down-regulated 4-like
238835 at no current annotation
231098_at no current annotation protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma
1562290 at isoform
a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type
214454_at 1 motif, 2
228712_at WNK lysine deficient protein kinase 1
1561532_at no current annotation
214603_at no current annotation
226836 at chromosome 6 open reading frame 83
206530_at RAB30, member RAS oncogene family
216572_at no current annotation
215394_at phosphoinositide-3-kinase, class 3
205056 s at gene rich cluster, A gene
1562728_at no current annotation
1557328_at hypothetical protein LOC283665 solute carrier organic anion transporter
211481_at family, member 1A2
1557636 a at hypothetical protein LOC136288
213303_x_at zinc finger and BTB domain containing 7A
232577_at hypothetical protein LOC145945
226612 at similar to CG4502-PA
233285_at hypothetical protein MGC34824
1563477 at no current annotation
233188_at casein kinase 2, alpha 1 polypeptide
1561408_at no current annotation
242419 at SET and MYND domain containing 3
232830_at no current annotation heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1,
239052_at 37kDa)
234097 s at no current annotation
208239_at no current annotation runt-related transcription factor 1 (acute
210365_at myeloid leukemia 1
1559800_a_at no current annotation
1557661 at START domain containing 10
233000_x_at no current annotation
221945_at no current annotation
209490 s at EGF-like-domain, multiple 8
236098_at RecQ protein-like 5
Pvtl oncogene homolog, MYC activator
216240_at (mouse)
213281_at no current annotation
1560576_at no current annotation
1556883_a_at hypothetical gene supported by AK127288
237670 at hypothetical protein LOC284801
243881 at no current annotation
234608_at no current annotation
241841_at carnitine palmitoyltransferase IB (muscle)
235238_at rai-like protein
1555179_at immunoglobulin heavy variable 7-81
244278_at no current annotation
1569962_at KIAA1026 protein
1552524_at ADP-ribosyltransferase 5
1555224_at no current annotation
244285 at chromosome 6 open reading frame 102
1558199_at fibronectin 1
207658_s_at no current annotation fibronectin leucine rich transmembrane
204359_at protein 2
217440_at no current annotation
244775_at immunoglobulin superfamily, member 4C
243991_at no current annotation leucine-rich repeats and calponin homology
232937_at (CH) domain containing 1 interferon regulatory factor 2 binding
227389_x_at protein 2
216707 at protocadherin 9
225616 at hypothetical protein LOC283377
236895 at sphingosine-1-phosphate lyase 1
231098_at no current annotation
206067 s at Wilms tumor 1
232830_at no current annotation
227554_at no current annotation
242284_at hypothetical protein LOC199899
241215_at muscle RAS oncogene homolog
208367_x_at no current annotation
222247_at putative X-linked retinopathy protein opioid binding protein/cell adhesion
234126 at molecule-like
229538 s at no current annotation
236098_at RecQ protein-like 5
244877_at no current annotation v-yes-1 Yamaguchi sarcoma viral oncogene
244362_at homolog 1 serine palmitoyltransferase, long chain
227752 at base subunit 2-like (aminotransferase 2)
223889 at no current annotation
232048_at hypothetical protein MGC33371
DEAD (Asp-Glu-Ala-Asp) box polypeptide
1553181_at 31
219402 s at Deri-like domain family, member 1
209053_s_at Wolf-Hirschhorn syndrome candidate 1
242224_at G patch domain containing 2
222736 s at transmembrane protein 38B
226836_at chromosome 6 open reading frame 83 type 1 tumor necrosis factor receptor
210385_s_at shedding aminopeptidase regulator
207045 at hypothetical protein FLJ20097
236315_at no current annotation
205794 s at no current annotation
230138_at no current annotation
222802 at no current annotation
233527_at endothelial cell adhesion molecule heat shock 7OkDa protein 5 (glucose-
218834_s_at regulated protein, 78kDa) binding protein 1
1565073_at no current annotation
216927 at no current annotation
236206 at dorsal neural-tube nuclear protein
206291 at neurotensin
1562112_at no current annotation
1559002_at hypothetical protein LOC340544
1556854_at ATPase, Class VI, type HA
1556810_a_at Wiskott-Aldrich syndrome-like
227655_at no current annotation
1562086_at no current annotation
237598_at no current annotation
217440 at no current annotation
239220_at protease, serine, 23
234507_at no current annotation potassium inwardly-rectifying channel,
222901 s at subfamily J, member 16
233972_s_at zinc finger protein 312
207017_at RAB27B, member RAS oncogene family aldolase A, fructose-bisphosphate
244789_at pseudogene 2
244103_at chromosome 1 open reading frame 55
217500_at no current annotation
219421_at no current annotation down-regulator of transcription 1, TBP-
209187_at binding (negative cofactor 2)
225872 at solute carrier family 35, member F5
233898_s_at FGFRl oncogene partner 2
236477_at no current annotation
204496 at striatin, calmodulin binding protein 3
222408_s_at yippee-like 5 (Drosophila)
201435_s_at eukaryotic translation initiation factor 4E
DnaJ (Hsp40) homolog, subfamily B,
1554462 a at member 9
203689_s_at fragile X mental retardation 1 pantothenate kinase 2 (Hallervorden-Spatz
238856 s at syndrome)
208316_s_at no current annotation
212867 at no current annotation
223085 at ring finger protein 19
225133_at no current annotation
205518 s at no current annotation
235394_at no current annotation
227519_at placenta-specific 4 solute carrier family 5 (sodium/glucose
207771 at cotransporter), member 2 fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer
211398_at syndrome, Jackson-Weiss syndrome)
1561148_at no current annotation
DEAD (Asp-Glu-Ala-Asp) box polypeptide 3,
201210_at X-linked echinoderm microtubule associated protein
223069_s_at like 4
242312_x_at no current annotation
221873_at zinc finger protein 143 (clone pHZ-1)
1554274 a at slingshot homolog 1 (Drosophila)
glycoprotein 2 (zymogen granule
214324_at membrane)
231342_at no current annotation potassium voltage-gated channel,
1552897_a_at subfamily G, member 3
225627_s_at KIAA1573 protein
214372_x_at no current annotation
217302_at no current annotation
217598_at no current annotation
232335_at no current annotation pleckstrin homology, Sec7 and coiled-coil
236136_at domains 3
1560411_at ataxin 2-binding protein 1
1554744_at no current annotation
208220_x_at amelogenin, Y-linked
1569634_at no current annotation
219691_at sterile alpha motif domain containing 9
232751_at no current annotation
1563121_at no current annotation
210467_x_at melanoma antigen family A, 2
234905_at DKFZP434H168 protein
218752_at U11/U12 snRNP 2OK
1560609_at crystallin, zeta (quinone reductase)-like 1 sine oculis homeobox homolog 1
205817_at (Drosophila)
1558649_at hypothetical protein LOC145757
1561460_at no current annotation
24423 l_at no current annotation
227804_at hypothetical protein BC014072 protein phosphatase 4, regulatory subunit
241864 x at 2
237522 at Fas (TNF receptor superfamily, member 6)
1566638 at no current annotation
203158 s at glutaminase
220927 s at heparanase 2
1560692_at hypothetical protein MGC33530 leucine-rich repeats and calponin homology
232937 at (CH) domain containing 1
229288_at no current annotation
204556_s_at DAZ interacting protein 1
1554707_at chromosome 9 open reading frame 68
211531_x_at proline-rich protein BstNI subfamily 1
1560588_at no current annotation
UDP-GlcNAc:betaGal beta-l,3-N-
221240_s_at acetylglucosaminyltransferase 4 olfactory receptor, family 2, subfamily H,
1556986_at member 1
229493_at no current annotation potassium voltage-gated channel, delayed-
1554680_s_at rectifier, subfamily S, member 2 aldehyde dehydrogenase 1 family, member
207016_s_at A2
1566803 at no current annotation
228563 at no current annotation
216581_at no current annotation
220819_at FERM domain containing 1
1561778_at no current annotation
230015_at cytoglobin solute carrier family 16 (monocarboxylic
231051_at acid transporters), member 9
220032_at hypothetical protein FLJ21986
227441 s at E2a-Pbxl-associated protein
1560833_at no current annotation insulin-like growth factor 1 (somatomedin
209540_at C)
234879_at no current annotation chloride channel, calcium activated, family
206165_s_at member 2
206070_s_at EPH receptor A3
1555135_at no current annotation
231365_at homeo box A9
1555253_at collagen, type XXV, alpha 1
220862_s_at no current annotation
237358_at no current annotation
206000_at meprin A, alpha (PABA peptide hydrolase)
1559641_at chromosome 10 open reading frame 56 a disintegrin and metalloproteinase domain
215613_at 12 (meltrin alpha)
1563496_at Six-twelve leukemia gene
1568733_at chromosome 10 open reading frame 76
242820_at hypothetical protein FLJ37549
233658_at no current annotation
1553032_at interleukin 31 receptor A
217081_at no current annotation
222196_at hypothetical protein LOC286434
207611_at histone 1, H2bl
230823_at no current annotation
1561212_at no current annotation
1561290_at hypothetical protein LOC339622
226756_at no current annotation
217585_at nebulette
211130_x_at ectodysplasin A
203962 s at nebulette
218629_at smoothened homolog (Drosophila)
208548_at interferon, alpha 6
1562201_x_at regulator of G-protein signalling 12
241942_at hypothetical protein FLJ25471
1565554_at hypothetical protein LOC127841
1560305 x at no current annotation
236967_at no current annotation
242067_at no current annotation
1557759 at hypothetical protein FLJ 10241
1566002 at ankyrin repeat domain 11
240203_at no current annotation solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system
213664_at Xag), member 1
1561527 at no current annotation
243783_at no current annotation
237415_at no current annotation
233000_x_at no current annotation
236206_at dorsal neural-tube nuclear protein
219835_at PR domain containing 8
239776_at no current annotation
1558421_a_at similar to RIKEN cDNA A530016L24 gene
1560788_at myosin IIIB
220152_at chromosome 10 open reading frame 95
237099_at chromosome 20 open reading frame 70
206079_at choroideremia-like (Rab escort protein 2)
240250_at no current annotation
220449_at no current annotation mitogen-activated protein kinase kinase
211437_at kinase 4 similar to Serine/threonine-protein kinase
238717_at PRKX (Protein kinase PKXl) solute carrier family 5 (sodium/glucose
207771_at cotransporter), member 2
1560482 at no current annotation
211793_s_at abl interactor 2
217712_at no current annotation
222196 at hypothetical protein LOC286434
242909_at no current annotation
1565424 at chromosome 8 open reading frame 8
233389_at chromosome 20 open reading frame 26 glutamine-fructose-6-phosphate
205100_at transaminase 2
207658_s_at no current annotation
216722_at no current annotation
234375 x at no current annotation
207981_s_at estrogen-related receptor gamma cyclin-dependent kinase inhibitor IA (p21,
1555186_at Cipl)
216448_at no current annotation
205777 at dual specificity phosphatase 9
215680_at BCL2-interacting killer (apoptosis-inducing)
208057_s_at GLI-Kruppel family member GLI2 sema domain, immunoglobulin domain (Ig), short basic domain, secreted,
215643 at (semaphorin) 3D
207289_at matrix metalloproteinase 25
210503_at no current annotation
PRP18 pre-mRNA processing factor 18
221546 at homolog (yeast)
231389_at no current annotation
243991_at no current annotation
240222_at no current annotation gremlin 1 homolog, cysteine knot
218468_s_at superfamily (Xenopus laevis)
1557604_at hypothetical gene supported by BC039682
1560177_at no current annotation
209904_at troponin C, slow
211909 x at no current annotation
234407_s_at no current annotation
236895_at sphingosine-1-phosphate lyase 1
229772_at defensin, beta 123
215815_at pentatricopeptide repeat domain 1
227893_at chromosome 9 open reading frame 130
239235_at no current annotation
1557114 a at no current annotation
232751 at no current annotation
216586_at no current annotation
1561673_at no current annotation
208789_at polymerase I and transcript release factor calcium channel, voltage-dependent,
1552602_at gamma subunit 5
SWI/SNF related, matrix associated, actin dependent regulator of chromatin,
206532_at subfamily b, member 1 retinitis pigmentosa 9 (autosomal
227849_at dominant) eukaryotic translation initiation factor IA,
204409_s_at Y-linked
1554042_s_at chromosome 20 open reading frame 141
234135_x_at palladin
207553_at opioid receptor, kappa 1
208335_s_at Duffy blood group
230393_at no current annotation
237263_at no current annotation
224321_at no current annotation
1561778_at no current annotation
UDP-GlcNAc:betaGal beta-l,3-N-
221240_s_at acetylglucosaminyltransferase 4
1557753_at no current annotation
1554646_at oxysterol binding protein-like IA
232192_at hypothetical protein LOC153811
209779_at hypothetical protein MGC14817
1570284_x_at no current annotation
1561212_at no current annotation
201647_s_at scavenger receptor class B, member 2
220549_at no current annotation protein kinase (cAMP-dependent, catalytic)
223551_at inhibitor beta
1565906 at no current annotation
231342_at no current annotation
1563725 at zinc finger protein 583
216906_at no current annotation
1561055_at no current annotation
238222 at down-regulated in gastric cancer GDDR
232259 s at no current annotation
230996_at hypothetical protein LOC339929
205579_at histamine receptor Hl
224429_x_at no current annotation v-myb myeloblastosis viral oncogene
1562398_at homolog (avian)
1566551 at PDZ domain containing RING finger 3
1562718 at no current annotation
229332_at hypothetical protein MGC15668
235627_at no current annotation
1553115_at naked cuticle homolog 1 (Drosophila)
1553813_s_at no current annotation
1569680_at no current annotation
223661_at no current annotation
223326_s_at hypothetical protein FLJ90297
GA binding protein transcription factor,
206173_x_at beta subunit 2, 47kDa translocation associated membrane protein
201399_s_at 1
205246_at peroxisome biogenesis factor 13
207472 at no current annotation
220156_at hypothetical protein FLJ 11767
224061 at indolethylamine N-methyltransferase
1561532_at no current annotation
242465_at no current annotation
234954_at no current annotation
1559226_x_at late cornified envelope IE gap junction protein, alpha 7, 45kDa
208460_at (connexin 45)
222771 s at myelin expression factor 2
236099_at no current annotation cyclin Dl (PRADl: parathyroid
208712 at adenomatosis 1)
229566_at no current annotation
242354 at no current annotation
1552698_at alpha tubulin-like
226670_s_at no current annotation adaptor-related protein complex 1, sigma 3
1555731_a_at subunit microtubule associated monoxygenase,
231985_at calponin and LIM domain containing 3
244508 at septin 7
221030_s_at Rho GTPase activating protein 24
215767 at chromosome 2 open reading frame 10
1561469 at no current annotation
224989_at no current annotation
210150 s at no current annotation
222996 s at CXXC finger 5
242365 at hypothetical protein MGC20481
223967_at no current annotation poly (ADP-ribose) polymerase family,
209940_at member 3
47553 at deafness, autosomal recessive 31
222238_s_at polymerase (DNA directed), mu
238987_at no current annotation
215688_at no current annotation
243450_at A kinase (PRKA) anchor protein 13 protein tyrosine phosphatase, non-receptor
240260_at type 1 guanine nucleotide binding protein (G
233790_at protein), gamma 7
1559776 at GM2 ganglioside activator
cyclin-dependent kinase-like 1 (CDC2-
241928_at related kinase)
NIMA (never in mitosis gene a)- related
1557172_x_at kinase 8
IMP2 inner mitochondrial membrane
1555571_at protease-like (S. cerevisiae) cAMP responsive element binding protein
212345_s_at 3-like 2
ATP-binding cassette, sub-family A (ABCl),
235335_at member 9
209598 at paraneoplastic antigen MA2
239812_s_at hypothetical protein FLJ 12476
1563797 at dystonin
221390_s_at myotubularin related protein 7
221945_at no current annotation
1562455 at no current annotation
241390_at no current annotation basic helix-loop-helix domain containing,
244323_at class B, 5
210064_s_at uroplakin IB
206070 s at EPH receptor A3
239910 at pregnancy specific beta-1-glycoprotein 1
217668 at similar to hypothetical protein LOC192734
236323 at no current annotation
230508 at dickkopf homolog 3 (Xenopus laevis)
236895_at sphingosine-1-phosphate lyase 1
241230 at no current annotation
1569719_at BCL2-like 14 (apoptosis facilitator)
234424_at no current annotation
215845_x_at no current annotation cadherin, EGF LAG seven-pass G-type
204029_at receptor 2 (flamingo homolog, Drosophila)
230727_at polycomb group ring finger 2
231162_at hypothetical protein MGC33839
237771_s_at no current annotation
216182 at synaptojanin 2
223966_at no current annotation
MovlOll, Moloney leukemia virus 10-like 1,
239257_at homolog (mouse) solute carrier family 13 (sodium-dependent
230686_s_at dicarboxylate transporter), member 3 serine (or cysteine) proteinase inhibitor,
217272_s_at clade B (ovalbumin), member 13
215370 at similar to KIAA0160 gene product is novel
1561149 at no current annotation
232437_at related to CPSF subunits 68 kDa
234407_s_at no current annotation
231992_x_at no current annotation
234521 at no current annotation
230819_at KIAA1957
1563145_at hypothetical protein MGC39681
24241 l_at ADP-ribosylation factor-like 1OA
228422_at lipoma HMGIC fusion partner-like protein 4
209211 at Kruppel-like factor 5 (intestinal)
216126_at no current annotation
205475_at scrapie responsive protein 1
223474_at chromosome 14 open reading frame 4
238515_at no current annotation
228854_at no current annotation cyclin-dependent kinase 5, regulatory
204995_at subunit 1 (p35)
205883 at zinc finger and BTB domain containing 16
219963_at dual specificity phosphatase 13
233126_s_at thioesterase domain containing 1
215685_s_at distal-less homeo box 2
239575_at transmembrane protein 10
244367_at LIM domain only 2 (rhombotin-like 1)
219450_at hypothetical protein FLJ11017 spectrin repeat containing, nuclear
240777_at envelope 2
240497 at no current annotation
231508 s at no current annotation
232751 at no current annotation
236353_at no current annotation
1553894_at no current annotation
220213_at no current annotation
OMAl homolog, zinc metallopeptidase (S.
226020 s at cerevisiae)
1562939_at leucine rich repeat containing 16
204562 at interferon regulatory factor 4
206337 at chemokine (C-C motif) receptor 7
235353_at KIAA0746 protein related RAS viral (r-ras) oncogene homolog
208456_s_at 2
225635_s_at no current annotation
224048 at no current annotation
213054 at KIAA0841
231964_at no current annotation nuclear transcription factor, X-box binding
202585_s_at 1
1558809_s_at hypothetical protein LOC284408
230598_at no current annotation
242064_at sidekick homolog 2 (chicken)
1555388_s_at sorting nexin 25
202759_s_at no current annotation
231472_at F-box protein 15 membrane-spanning 4-domains, subfamily
231418_at A, member 1
239074 at GRB2-related adaptor protein
228392_at zinc finger protein 302
243957 at no current annotation
232733 s at KIAA1510 protein
229400_at homeo box DlO
1561211 at no current annotation
216906_at no current annotation
1559804_at no current annotation
225566_at neuropilin 2
208220 x at amelogenin, Y-linked
214651_s_at homeo box A9
233472_at no current annotation
220595_at PDZ domain containing RING finger 4
222597_at synaptosomal-associated protein, 29kDa
216564_at no current annotation
227771_at leukemia inhibitory factor receptor
242257_at no current annotation cytochrome P450, family 2, subfamily A,
214320_x_at polypeptide 7
1563069_at no current annotation
217684_at thymidylate synthetase echinoderm microtubule associated protein
223069_s_at like 4 cytochrome P450, family 2, subfamily R,
244757_at polypeptide 1
209324_s_at regulator of G-protein signalling 16
227190_at transmembrane protein 37
ST6 beta-galactosamide alpha-2,6-
228821_at sialyltranferase 2 fibroblast growth factor receptor 1 (fms-
207937 x at related tyrosine kinase 2, Pfeiffer syndrome)
208335 s at Duffy blood group
230393 at no current annotation
224399_at programmed cell death 1 ligand 2 triggering receptor expressed on myeloid
1567558 at cells-like 4
1561041_at no current annotation
1554886_a_at Mix interactor
223745_at F-box protein 31
1569644_at no current annotation
1570394_at 5'-3' exoribonuclease 1 calcium channel, voltage-dependent, alpha
208377 s at IF subunit
214090_at PRKC, apoptosis, WTl, regulator aldolase A, fructose-bisphosphate
1556133_s_at pseudogene 2
215810_x_at dystonin protein phosphatase 1, regulatory subunit
230455_at 9B, spinophilin
227050_at odz, odd Oz/ten-m homolog 3 (Drosophila) protein kinase, cAMP-dependent, catalytic,
207228_at gamma
214105_at suppressor of cytokine signaling 3
236822_at no current annotation
1559513_a_at Fanconi anemia, complementation group C
216600_x_at aldolase B, fructose-bisphosphate
231556_at glycoprotein, synaptic 2
242205_at no current annotation
244854 at leupaxin
229288_at no current annotation
214981_at periostin, osteoblast specific factor
237099_at chromosome 20 open reading frame 70 gap junction protein, alpha 7, 45kDa
208460 at (connexin 45)
74 1559641_at chromosome 10 open reading frame 56
74 1556810_a_at Wiskott-Aldrich syndrome-like
74 239519_at neuropilin 1
75 215515_at kin of IRRE like (Drosophila)
75 1567540_at no current annotation
75 233958_at no current annotation
75 215326 at p21(CDKNlA)-activated kinase 4
75 235184_at AE binding protein 2
75 226847_at follistatin
75 222899_at integrin, alpha 11
75 242883_at otospiralin
75 232577 at hypothetical protein LOC145945
75 239693 at sorting nexing 24
75 243288_at SET and MYND domain containing 2 aldolase A, fructose-bisphosphate
76 244789_at pseudogene 2
76 214354 x at surfactant, pulmonary-associated protein B
76 217351_at no current annotation fucosyltransferase 1 (galactoside 2-alpha-
76 206109_at L-fucosyltransferase)
77 220743_at PRO0149 protein
77 237545 at calmodulin binding transcription activator 1
77 1562093_at no current annotation
77 234449_at no current annotation
77 222675_s_at BAIl-associated protein 2-like 1
77 1564017_at chromosome 21 open reading frame 123
77 1560498_at no current annotation
77 1556810_a_at Wiskott-Aldrich syndrome-like
78 1570295_at vacuolar protein sorting 13A (yeast)
78 1559901 s at chromosome 21 open reading frame 34
78 1563367 at intramembrane protease 5
78 1563316_at neuronal growth regulator 1
78 217081_at no current annotation
78 1565906_at no current annotation olfactory receptor, family 4, subfamily N,
79 1564856_s_at member 4
79 1552865_a_at likely ortholog of mouse Pasl candidate 1
79 1556786_at no current annotation
79 1554528 at chromosome 3 open reading frame 15
79 236098_at RecQ protein-like 5
SMC4 structural maintenance of
79 215623_x_at chromosomes 4-like 1 (yeast)
79 232048_at hypothetical protein MGC33371 solute carrier family 7 (cationic amino acid
79 202752_x_at transporter, y+ system), member 8
79 1567376_at heat shock regulated 1
79 206067_s_at Wilms tumor 1
80 241301_at RAB22A, member RAS oncogene family
80 237193_s_at ribosomal protein L21 steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta
80 206938_at 4-dehydrogenase alpha 2)
81 1562775_at no current annotation
81 242979 at no current annotation
mediator of RNA polymerase II
81 219318_x_at transcription, subunit 31 homolog (yeast)
81 229332_at hypothetical protein MGC15668
81 216707_at protocadherin 9
81 228724_at no current annotation
81 232429_at no current annotation
81 227797 x at hypothetical protein dJ122O8.2
81 1561261_at no current annotation
MCM3 minichromosome maintenance
82 1560542_at deficient 3 (S. cerevisiae) associated protein
82 210712_at lactate dehydrogenase A-like 6B
82 216116 at NCK interacting protein with SH3 domain
82 220927_s_at heparanase 2
82 214651_s_at homeo box A9 golgi associated, gamma adaptin ear
82 214233_at containing, ARF binding protein 2 carnitine deficiency-associated, expressed
82 223736_at in ventricle 1
82 1560550 at no current annotation
83 231350_at no current annotation
83 241260_at no current annotation
83 208566 at no current annotation
83 236357 at no current annotation
83 243991_at no current annotation
83 240222_at no current annotation
83 1552514 at hypothetical protein MGC26816
83 231911_at KIAAl 189
83 206375_s_at heat shock 27kDa protein 3
84 1554983_at chromosome 21 open reading frame 117
84 207477_at no current annotation
84 208500_x_at forkhead box D3 translocation associated membrane protein
84 1554383_a_at 2
84 1569545 at no current annotation
84 1560962_at no current annotation
85 1566551_at PDZ domain containing RING finger 3
85 1554646 at oxysterol binding protein-like IA
Using this superset of metagenes, the inventors have identified a subset of 7 metagenes that are specifically associated with the presence of anatomic coronary artery disease. This subset is listed in Table 2. Within the 85 metagenes, it is expected that there will be subsets associated with the presence of carotid artery atherosclerosis; presence of soft, vulnerable coronary artery plaques prone to cause heart attacks; presence of normal versus dysfunctional stem cell populations for vascular repair of atherosclerosis
It has further been determined that selection of the gene set so that they fall within at least 5 of the 7 groups of metagenes represented by the 69 genes, i.e. metagene groups 32, 11, 67, 75, 10, 8 and 24, preferably within all 7 of the groups, improves the predictive ability.
Depending upon selection of the gene set and individual subject results, the method is expected to identify subjects with at least about 50%, preferably at least 60%, 70%, 75 %, 80% or 85% probability of having CAD. The method may be used in conjunction with clinical variables, such as weight, body mass index, cholesterol levels, LDL/HDL ratio and other clinical variables associated with CAD for increased prediction levels.
Gene expression profiling can be measured by any means known in the art, for example using microarrays, such as Affymetrix GeneChip™. Other methods for measuring the presence and/or amounts of nucleic acids in a sample include, e.g., various types of hybridization assays, and quantitative PCR assays, such as quantitative real-time PCR, using suitable probe pairs to amplify cDNA copies of transcribed RNAs. Alternatively, transcriptomics can be used, in which the actual mRNA copy numkers are counted.
In another aspect, the invention provides a method of data reduction for selecting a set of features (genes) associated with a specific condition. The method is particularly useful in the analysis of microarray gene data, and the selection of genetic markers for specific diseases and disorders. In one embodiment, the method comprises the steps of
(a) Using significance analysis of microarrays (SAM) from data obtained from an experimental and a control group of subjects to select an initial set of features;
(b) Using binary prediction tree analysis to select additional features; thereby obtaining a set of features that is predictive of the condition.
"Significance Analysis of Microarrays" (SAM) is a statistical technique for determining whether changes in gene expression are statistically significant. See, e.g., Tusher et al (2001) PNAS 98:5116-5121.) SAM is distributed by Stanford University in a R-package. See, e.g., the world wide web site stat.stanford.edu/~tibs/SAM. Specific conditions for which the method may be useful include, for example, pharmacogenomics, ventricular arrhythmias, and identifying signals for stem cell mediated vascular repair. The method for using the feature reduction with multiple methods ending with the use of the binary trees will be very useful for complex disorders for which the gene expression signature may be subtle. By definition, complex disorders are likely resulting from multiple small changes that add up to the disease rather than one or two big changes. By identifying individuals with coronary artery disease, treatment can be provided that can prevent adverse outcomes such as myocardial infarction, sudden cardiac death, heart failure, atrial fibrillation, ventricular fibrillation/tachycardia.
It is also very likely that the blood profile for coronary artery disease will also be useful to detect atherosclerosis in other vascular beds, such as carotid atherosclerosis and atherosclerosis of the lower extremities - peripheral vascular disease. In doing so, we can apply treatments not only to prevent progression of these disorders, but we can also prevent the adverse outcomes that result from these two disorders: cerebrovascular disease, critical limb ischemia leading to amputation, and lower extremity ulceration.
For optimal prediction level, the method can be further refined by including an appropriate set of clinical variables.
One aspect of the invention is a method for method for screening a subject for the presence of coronary atherosclerosis, said method comprising, measuring the expression level of at least about 5 of the genes of Table 2 (whose properties are also described in Table 3) (e.g., at least 10, 15, 20, 30, 40, 50, 60, or all 69 of the genes) in a biological sample obtained from said subject, wherein an elevated level of expression (e.g., a significantly increased level, such as a statistically significantly increased level) of said at least 5 genes compared to a control level measured in a population of normal subjects is indicative of an increased probability of the subject having significant atherosclerosis (e.g., subclinical coronary atherosclerosis). In one embodiment of the invention, the subject being tested does not exhibit any clinical manifestations of CAD. In one embodiment, a subject exhibiting such an elevated level of expression is deemed suitable to receive aggressive preventive treatments and/or additional testing. When the genes in Table 2 are referred to herein, the gene characteristics described in TbIe 3 are also included.
The levels of expression can be determined for any combination of 5 genes from Table 2, or more, and the levels can be determined simultaneously, or in any order. Another embodiment of the invention is a method for screening a subject for the presence of coronary atherosclerosis, said method comprising
(a) providing a sample obtained from a subject, for example a subject suspected of having, or at risk for having, CAD;
(b) determining in the sample the amount of expression of at least about 5 of the genes of Table 2 (e.g., at least 10, 15, 20, 30, 40, 50, 60, or all 69 of the genes); and
(c) comparing the levels of expression of the genes to a control level measured in a population of normal subjects,
wherein an elevated level of expression (e.g., a significantly increased level, such as a statistically significantly increased level) of said at least 5 genes compared to the control level is indicative of an increased probability of the subject having coronary atherosclerosis (e.g., significant subclinical coronary atherosclerosis). A sample which is "provided" can be obtained by the person (or machine) conducting the assay, or it can have been obtained by another, and transferred to the person (or machine) carrying out the assay.
By a "sample" (e.g. a test sample) from a subject meant a sample that might be expected to contain elevated levels of the expression markers of the invention in a subject having CAD. Many suitable sample types will be evident to a skilled worker. In one embodiment of the invention, the sample is a blood sample, such as whole blood, plasma, or serum (plasma from which clotting factors have been removed). For example, peripheral, arterial or venous plasma or serum can be used. Methods for obtaining samples and preparing them for analysis (e.g., for detection of the amount of nucleic acid) are conventional and well-known in the art. Some suitable methods are described in the Examples herein or in the references cited herein.
A "subject," as used herein, includes any animal that has, or is at risk for, or is suspected of having, CAD. Suitable subjects (patients) include laboratory animals (such as mouse, rat, rabbit, guinea pig or pig), farm animals, sporting animals (e.g. dogs or horses) and domestic animals or pets (such as a horse, dog or cat). Non-human primates and human patients are included. For example, human subjects who present with chest pain or other symptoms of cardiac distress, including, e.g. shortness of breath, nausea, vomiting, sweating, weakness, fatigue, or palpitations, can be evaluated by a method of the invention. About 1/4 of MI (myocardial infarctions) are silent and without chest pain. Furthermore, patients who have been evaluated in an emergency room or in an ambulance or physician's office and then dismissed as not being ill according to current tests for CAD have an increased risk of having a heart attack in the next 24-48 hours; such patients can be monitored by a method of the invention to determine if and when they begin express markers of the invention, which indicates that, e.g., they are beginning to exhibit CAD. Subjects can also be monitored by a method of the invention to improve the accuracy of current provocative tests for ischemia, such as exercise stress testing. An individual can be monitored by a method of the invention during exercise stress tests to determine if the individual is at risk for ischemia; such monitoring can supplement or replace the test that is currently carried out. Athletes (e.g., humans, racing dogs or race horses) can be
monitored during training to ascertain if they are exerting themselves too vigorously and are in danger of undergoing an MI.
A method as above may further comprise measuring in the sample the amount of one or more other well-known markers that have been reported to be diagnostic of CAD, including the expression of cardiac specific isoforms of troponin I (TnI) and/or troponin T (TnT), wherein a significant increase (e.g., at least a statistically significant increase) of the one or more markers compared to the level in a normal control is further indicative that the subject has CAD. A method of the invention can also be combined with any of a variety of clinical tests for CAD, including some of the criteria discussed herein. Another aspect of the method is a method for deciding how to treat a subject suspected of having CAD, or a subject that is at high risk for having CAD, comprising determining by a method as above if the subject has (or is likely to have) CAD and, (1) if the subject is determined to have, or to be likely to have, CAD, deciding to treat the subject aggressively [such as by seeking more intensive lowering of serum cholesterol and blood pressure with medications, adding antiplatelet medications (e.g., aspirin, clopidogrel), diagnostic testing such as cardiac stress testing, cardiac MRI or coronary angiography] or (2) if the subject is determined not to have (or not to be likely to have) CAD, the current level of preventive cardiovascular management would be maintained.
Another aspect of the invention is a method for treating a subject suspected of having CAD, or a subject that is at high risk for having CAD, comprising determining by a method as above if the subject has (or is likely to have) CAD and, (1) if the subject is determined to have (or to be likely to have) CAD, treating the subject aggressively, as indicated above, or (2) if the subject is determined not to have (or not to be likely to have) CAD, treating the subject non- aggressively, as indicated above. Another aspect of the invention is a kit for detecting the presence of CAD in a subject, comprising reagents for detecting the levels of expression of at least five (e.g., any combination of, e.g, 5, 10, 20, 30, 40, 50, 60 or all 69) of the genes of Table 2.
When the values of more than one expressed marker are being analyzed, a statistical method such as multi-variant analysis or principal component analysis (PCA) is used which takes into account the levels of the various nucleic acids (e.g., using a linear regression score).
In some embodiments, it is desirable to express the results of an assay in terms of an increase (e.g., a statistically significant increase) in a value (or combination of values) compared to a baseline value.
A "significant" increase in a value, as used herein, can refer to a difference which is reproducible or statistically significant, as determined using statistical methods that are appropriate and well-known in the art, generally with a probability value of less than five percent chance of the change being due to random variation. In general, a statistically significant value is at least two standard deviations from the value in a "normal" healthy control subject. Suitable statistical tests will be evident to a skilled worker. For example, a significant increase in the amount of a nucleic acid marker compared to a baseline value can be about 50%, 2-fold, or more higher. A significantly elevated amount of a nucleic acid expression marker of the invention compared to a suitable baseline value, then, is indicative that a test subject has CAD (indicates that the subject is likely to have CAD). A subject is "likely" to have CAD if the subject has levels of the marker nucleic acids significantly above those of a healthy control or his own baseline (taken at an earlier time point). The extent of the increased levels correlates to the % chance. For example, the subject can have greater than about a 50% chance, e.g., greater than about 70%, 80% 90%, 95% or higher chance, of having CAD. In general, the presence of an elevated amount of a marker of the invention is a strong indication that the subject has CAD.
As used herein, a "baseline value" generally refers to the level (amount) of an expressed nucleic acid in a comparable sample (e.g., from the same type of tissue as the tested tissue, such as blood or serum), from a "normal" healthy subject that does not exhibit CAD. If desired, a pool or population of the same tissues from normal subjects can be used, and the baseline value can be an average or mean of the measurements. Suitable baseline values can be determined by those of skill in the art without undue experimentation. Suitable baseline values may be available in a database compiled from the values and/or may be determined based on published data or on retrospective studies of patients' tissues, and other information as would be apparent to a person of ordinary skill implementing a method of the invention. Suitable baseline values may be selected using statistical tools that provide an appropriate confidence interval so that measured levels that fall outside the standard value can be accepted as being aberrant from a diagnostic perspective, and predictive of CAD.
It is generally not practical in a clinical or research setting to use patient samples as sources for baseline controls. Therefore, one can use any of variety of reference values in which the same or a similar level of expression is found as in a subject that does not have CHD.
It will be appreciated by those of skill in the art that a baseline or normal level need not be established for each assay as the assay is performed but rather, baseline or normal levels can be established by referring to a form of stored information regarding a previously determined baseline levels for a given nucleic acid or panel of nucleic acids, such as a baseline level established by any of the above-described methods. Such a form of stored information can include, for example, a reference chart, listing or electronic file of population or individual data regarding "normal levels" (negative control) or positive controls; a medical chart for the patient recording data from previous evaluations; a receiver-operator characteristic (ROC) curve; or any other source of data regarding baseline levels that is useful for the patient to be diagnosed. In one embodiment of the invention, the amount of the nucleic acids in a combination of nucleic acids, compared to a baseline value, is expressed as a linear regression score, as described, e.g., in Irwin, in Neter, Kutner, Nachtsteim, Wasserman (1996) Applied Linear Statistical Models, 4th edition, page 295.
In an embodiment in which the progress of a treatment is being monitored, a baseline value can be based on earlier measurements taken from the same subject, before the treatment was administered.
In general, molecular biology methods referred to herein are well-known in the art and are described, e.g., in Sambrook et al., Molecular Cloning: A Laboratory Manual, current edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & sons, New York, NY.
A detection (diagnostic) method of the invention can be adapted for many uses. For example, it can be used to follow the progression of CAD. In one embodiment of the invention, the detection is carried out both before (or at approximately the same time as), and after, the administration of a treatment, and the method is used to monitor the effectiveness of the treatment. A subject can be monitored in this way to determine the effectiveness for that subject of a particular drug regimen, or a drug or other treatment modality can be evaluated in a preclinical or clinical trial. If a treatment method is successful, the levels of the nucleic acid markers of the invention are expected to decrease.
A method of the invention can be used to suggest a suitable method of treatment for a subject. For example, if a subject is determined by a method of the invention to be likely to have CAD, a decision can be made to treat the subject with an aggressive form of treatment (e.g. as described elsewhere herein); and, in one embodiment, the treatment is then administered. Methods for carrying out such treatments are conventional and well-known. By contrast, if a
subject is determined not to be likely to have CAD, a decision can be made to adopt a less aggressive treatment regimen; and, in one embodiment, the subject is then treated with this less aggressive forms of treatment. Suitable less aggressive forms of treatment include, for example, maintaining the current level of preventive cardiovascular management, using procedures that are conventional and well-known in the art. A subject that does not have CAD is thus spared the unpleasant side-effects associated with the unnecessary, more aggressive forms of treatment. By "treated" is meant that an effective amount of a drug or other anti-heart disease procedure is administered to the subject. An "effective" amount of an agent refers to an amount that elicits a detectable response (e.g. of a therapeutic response) in the subject. One aspect of the invention is a kit for detecting whether a subject is likely to have CAD, comprising one or more agents for detecting the amount of a nucleic acid marker of the invention. As used herein, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. For example, "a" nucleic acid of the invention, as used above, includes 2, 3, 4, 5 or more of the nucleic acids. In addition, agents for detecting other markers for CAD (e.g., as discussed elsewhere herein) can also be present in a kit. The kit may also include additional agents suitable for detecting, measuring and/or quantitating the amount of nucleic acid, including conventional analytes for creation of standard curves. Among other uses, kits of the invention can be used in experimental applications. A skilled worker will recognize components of kits suitable for carrying out a method of the invention. A kit of the invention can comprise a composition of probes or primers that are specific for one or more of the nucleic acids of the invention (e.g. , probes arranged in the form of an array, such as a microarray) and, optionally, one or more reagents that facilitate hybridization of the probes or primers in the composition to a test polynucleotide of interest, and/or that facilitate detection of the hybridized polynucleotide(s). Methods for designing and preparing probes that are specific for hybridizing and identifying a nucleic acid marker of the invention, or that can be used as primers (e.g. PCR primers) for specifically amplifying a nucleic acid marker of the invention, are conventional and well-known in the art.
Optionally, a kit of the invention may comprise instructions for performing the method. Optional elements of a kit of the invention include suitable buffers, containers, or packaging materials. The reagents of the kit may be in containers in which the reagents are stable, e.g., in lyophilized form or stabilized liquids. The reagents may also be in single use form, e.g., for the performance of an assay for a single subject.
The present invention also relates to combinations in which the nucleic acids of the invention, or probes or primers that are specific for them, are represented, not by physical molecules, but by computer-implemented databases. For example, the present invention relates to electronic forms of polynucleotides of the present invention, including a computer-readable medium (e.g., magnetic, optical, etc., stored in any suitable format, such as flat files or hierarchical files) which comprise such sequences, or fragments thereof, e-commerce-related means, etc. An investigator may, e.g., compare an expression profile exhibited by a sample from a subject to an electronic form of one of the expression profiles of the invention, and may thereby diagnose whether the subject is likely to have CAD.
In the foregoing and in the following examples, all temperatures are set forth in uncorrected degrees Celsius; and, unless otherwise indicated, all parts and percentages are by weight.
EXAMPLES
Example I. Materials and Methods
A. Subjects
The discovery cohort was selected from the Duke Cardiac Catheterization Genetics and Genomics (CATHGEN) repository that stores blood samples in PAXgene™ RNA tubes (PreAnalytiX, Valencia, CA). Wanting to reflect a general population of patients presenting for cardiac catheterization, we selected a discovery cohort that considered the extent of coronary artery disease (CAD) as the sole selection criterion. This discovery cohort consisted of two groups: 57 subjects with minimal CAD with no stenoses exceeding 25% of the coronary artery lumen diameter, and 49 subjects with severe CAD with at least one stenosis of 75% or greater. Two additional cohorts were then selected to establish the validity of the genomic findings generated using the discovery cohort. One group was selected from the Duke CATHGEN repository using the same criteria as the discovery cohort, 25 subjects with minimal CAD and 30 subjects with severe CAD.
A second, external validation set was selected to examine whether the genomic predictors identified in the discovery cohort would have predictive value in subjects not treated in the Duke cardiac catheterization laboratory. This data set was from a separate unpublished research study. The microarray data were generated using peripheral blood mononuclear cells (PBMCs) of patients undergoing cardiac catheterization at an outside facility. A Freisinger Index
was calculated in these subjects, and we divided the dataset into minimal or severe CAD groups based on the Freisinger Index13. In this CAD scoring method, a numeric score for CAD burden was assigned to each of the three epicardial arteries based upon the severity of disease, and the Freisinger Index reflected the sum of the three numeric scores. For the second validation cohort, six subjects had minimal disease, defined as a Freisinger Index score of 1.5 or less, while 18 subjects had moderate to severe disease, defined as a Freisinger Index score of greater than 1.513.
B. Generation of Microarray Data
For the discovery and validation cohorts selected from CATHGEN, RNA was extracted using the Versagene™ RNA Purification Kit (Gentra Systems, Inc, Minneapolis, MN). RNA quality was evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies). We performed globin reduction with a standard human GLOBINclear™ (Ambion, Austin, TX) protocol14, and quality was reconfirmed by the Agilent 2100 Bioanalyzer. The cRNA probes were generated with the Affymetrix GeneChip™ (Affymetrix, Santa Clara, CA) one-cycle in vitro transcription labeling protocol and were hybridized to the Affymetrix U133 2.0 Plus Human array that contains 54,613 transcripts. The microarray hybridization was performed by the Duke Microarray Core Facility (Expression Analysis, Research Triangle Park, NC). The data for the second validation cohort had already been generated prior to the initiation of this investigation. The microarray data were obtained using the same methods as above. The globin reduction step was unnecessary since PBMCs were used. C. Approach for Classifying Subjects by CAD Burden using Gene Expression Data
Significance Analysis of Microarrays (SAM) was used for the initial feature selection from among the 54,613 genes represented on the microarray15. The metagene construction and binary classification tree analysis was utilized for additional feature selection and to build the CAD prediction model 16~18. Affymetrix MAS5 data was used for this analysis. Given the heterogeneity of the study subjects, we systematically performed feature selection from the discovery cohort prior to model building. Based upon prior experience with the binary prediction tree approach16' 17' 19, we wanted to begin the model building with a starting gene set of around 3000-5000. First, we performed SAM on Iog2-transformed data and found that a correlation score cut-off of ±1.5 allowed us to reduce the data set to 4,210 genes from the original 54,613 genes.
For the second phase of feature selection in the discovery cohort, we used the classification tree analysis to identify genes with the highest discriminatory power within the 4,210 individual genes. Following quantile normalization, we performed k- means correlation-
based clustering to group the 4,210 genes into 300-500 clusters that typically consist of 5-50 non-overlapping genes. In order to use these gene groups in classification trees, singular value decomposition was performed using the expression values of the genes within the clusters to generate a single factor or metagene. The metagene is in essence a composite measure representing the aggregate expression for each cluster. These metagenes were used in classification trees to determine the metagenes that most accurately classified individual samples as minimal or severe CAD. At each node of the tree, the metagene was used as a threshold to partition the samples into the two classes. Each possible metagene combination was tested iteratively to find the metagenes that most accurately classified the samples. We performed multiple rounds of the classification tree analysis to identify different metagene sets and kept those metagenes that could classify the samples with > 70% accuracy by hold-one-out cross- validation analysis. There were 10 sets of metagenes that met the classification accuracy criteria, with the final set consisting of 85 metagenes. We used these 85 metagenes to classify the discovery cohort with the classification trees using a hold-one-out cross validation analysis. To adjust for systematic experimental error such as batch differences between the discovery and validation cohorts, each validation cohort was adjusted to the discovery cohort using the Distance Weighted Discrimination (DWD) method20. Each validation cohort underwent quantile normalization using the same factors for quantile normalization of the discovery cohort. We then analyzed the ability of the 85 metagene predictors identified from the analysis of the discovery cohort to classify the subjects in each of the two validation cohorts as having either minimal or severe CAD.
D. Approach for Classifying Subjects by CAD Burden using Clinical Data
MatLab (MathWorks, Natick, MA) was used to generate multivariate logistic regression models to classify individuals into minimal or severe disease categories using only traditional risk factor data. There were missing values, especially those of systolic blood pressure and lipid levels (up to 20%). Missing values were imputed separately by polynomial linear interpolation21 for the discovery and validation cohorts from CATHGEN. Using standard forward stepwise selection, a model of discriminatory variables was built from the 16 clinical variables in the discovery cohort. This model was used to predict the coronary artery disease status in the CATHGEN validation cohort. We lacked sufficient variables in the second validation cohort to apply the clinical prediction model. Because of the variability in the imputation of missing variables, we generated 10 different sets of imputed data and constructed multivariate logistic
regression models with each set of data. The final classification accuracy reflected the average of the 10 models.
E. Approach for Classifying Subjects by CAD Burden using Combined Clinical and Gene Expression Data To construct a model that combined both clinical and genomic information, the classification probabilities of a subject having either minimal or severe disease that were generated from the genomic prediction model were used as variables in the clinical prediction model. The multivariate logistic regression model described above that generated disease status predictions from solely clinical variables were refitted to also include the genomic classification probabilities. As before, the models were built in the discovery cohort using now 17 variables, and then tested in the validation cohort. As above, multivariate regression models were generated using each of the 10 different imputed sets of clinical data but now also including the genomic classification probability as an additional variable. The final classification accuracy reflected the average of all 10 models. F. Descriptive Statistics
Microsoft Excel was used for descriptive and ANOVA analysis of subject clinical characteristics. Categorical variables were analyzed by Fisher's exact test using MedCalc statistical software. MedCalc was used to calculate model performance - sensitivity, specificity, overall accuracy, positive predictive value, negative predictive value, receiver operating characteristic curve (ROC) and the area under the ROC (AUC or c-index). Model performance was not calculated for the second validation set given the small sample size and the lack of full clinical variables.
G. Gene functional annotation
Gene annotation was performed using: GeneCards, Information Hyperlinked Over Proteins (IHOP), GENATLAS and Ingenuity Pathways Analysis (IPA) (Ingenuity Systems, Redwood City, CA). To further characterize genes identified by this study, we also used the IPA software. We used the IPA software to determine statistically over-represented gene ontology terms within our candidate gene lists. As well, IPA was used to determine networks of genes that encompassed the candidate genes to highlight potential biological pathways as well as upstream and downstream associated genes.
Example II. Results
A. Patient Characteristics
Table 1 lists the clinical characteristics of the discovery and the two validation cohorts. Male gender, prior coronary artery bypass grafting (CABG), CAD burden and medication use 5 were significantly different between the subjects with minimal and severe CAD. Systolic blood pressure, lipid profiles, ejection fraction, serum creatinine, active tobacco use and diabetes were not significantly different. There was missing data for some of the clinical variables, particularly systolic blood pressure and lipids, however, the missing data were evenly distributed. Table 1 Clinical characteristics of the discovery and validation cohort subjects
Discovery Cohort Validation Cohort
Controls Cases Controls Cases
Age (yrs) 563 ± 31 603 ± 24 565 ± 18 615 ± 18 NS*
Systolic Blood Pressure 1374±52 1427 ± 47 1393 ±32 1314 ±33 NS*
Diastolic Blood Pressure 794 ± 35 7374 ± 17 757 ± 17 738 ± 17 NS*
Total Cholesterol 1847 ±111 1816 ±136 1916 ±65 1673 ±75 NS*
Triglyceride 1270 ± 141 1961 ±3370 1694 ±201 1914 ±238 NS*
HDL 534 ±45 465 ± 30 509 ± 28 439 ± 26 NS*
LDL 1051 ± 99 1015 ±108 1107±55 931 ± 73 NS*
Ejection Fraction (%) 491 ± 44 529 ± 28 561 ±26 560 ±22 NS*
Serum Creatinine 16±04 15±03 1 O±OO 13±02 NS*
Diabetes Mellitus 228 327 NS** 185 367 NS**
Active Smoker 333 449 NS** 370 500 NS**
Male Gender (%) 048 067 NS** 042 074 p = 0002**
Aspirin (%) 439 714 P = 0006** 333 567 NS**
Beta Blockers (%) 211 612 P <0001** 259 467 NS**
Ace Inhibitors (%) 175 429 P = 0005** 185 333 NS**
Statins (%) 246 551 P = 0002** 370 600 NS**
Plavix (%) 18 245 P <0001** 37 233 NS**
Any cardiac drug 526 776 P = 0009** 556 633 NS**
LCX Stenoses (%) 52±27 741 ± 62 24±09 798 ± 37 P<0001*
LAD Stenoses (%) 80±29 813±44 66±14 866 ±24 P < 0001*
RCA Stenoses (%) 35 ± 15 647 ± 68 47±12 75,7 ±46 P<0001*
LM Stenoses (%) 19± 13 242 ± 54 23±10 207 ± 44 P < 0001*
Left Main disease (%) 00 100 00 100 P<0001*
3 vessel disease (%) 00 560 00 467 P < 0001*
2 vessel disease (%) 00 180 00 333 P<0001*
1 vessel disease (%) 00 140 00 100 P < 0001*
History of CABG (%) 00 333 00 333 P<0001*
* ANOVA
** Fisher's Exact Test
10
B. Predicting CAD Burden Using Blood Gene Expression
Using the 85 metagenes identified in the discovery cohort, we correctly classified 80.0% (44/55) of the subjects in the Duke validation cohort as having either minimal or severe CAD with a sensitivity of 80.0% and specificity of 80.0%. The area under the receiver operator curve (AUC) or c-index was 0.81 indicating the model has good discriminatory value between minimal and severe CAD groups22. The positive and negative predictive values of the model were 82.8% and 76.9%, respectively. There were seven metagenes consisting of 69 genes that provided the majority of the discriminatory power in the classification. In our second validation cohort, the 85-metagene model correctly predicted the CAD status of 79.2% (20/24). C. Predicting CAD burden using clinical variables
In the discovery cohort, multivariate logistic regression models correctly classified subjects as having minimal or severe CAD with an accuracy of 84.1% by cross validation analysis. The models applied to the Duke validation cohort correctly classified subjects by CAD burden with a mean accuracy of 68.3%. The AUC for the prediction was 0.71. The second validation cohort lacked the necessary clinical variables for the clinical prediction model.
D. Predicting CAD burden using combined clinical variables and gene expression data
In the discovery cohort, we generated multivariate logistic regression models that included the prediction probabilities for the presence of severe CAD from the metagene classification trees as a variable along with the clinical variables. The combined genomic and clinical models correctly predicted the classification of subjects by CAD burden in the discovery group with 100% accuracy by cross validation analysis. When the models were applied to the Duke validation group, the average prediction accuracy was 84.1% with AUC of 0.86.
E. Reclassification of Subjects with Intermediate CHD Risk
We simulated how a blood gene expression signature for coronary artery disease might be used to further stratify individuals classified as intermediate CHD risk by the Framingham
Risk Score (FRS) using the subjects from the Duke CATHGEN repository. For the simulation, all of the subjects were assumed to be asymptomatic. We calculated a FRS for the entire
CATHGEN cohort of 160 subjects and we were blinded to the coronary artery disease burden. If a subject was classified as having intermediate CHD risk and did not have characteristics such as diabetes, which would have automatically moved them to a higher risk category, we examined whether the genomic prediction model could be used to further stratify this group based upon the presence of significant coronary artery disease. In our total group of 160 subjects, we were able
to complete the FRS for 108 subjects and 24 of them were classified as having an intermediate CHD risk without having higher risk characteristics such as diabetes. For these 24 subjects, the genomic prediction model would have elevated 10 of the subjects to a higher risk category because they had the blood transcriptome profile associated with severe coronary artery disease. For these 10 patients, when we looked at their coronary disease burden, all of them had severe coronary artery disease. The remaining 14 of 24 subjects would have remained classified as intermediate risk because they had the blood transcriptome profile of minimal coronary artery disease. Each of these 14 individuals actually had minimal coronary atherosclerosis. In the standard treatment paradigm, all of these 24 subjects would be have received the preventive interventions designated for intermediate CHD risk. By using the blood transcriptome profile, 10 of the subjects would have been moved into a higher risk category for more intensive preventive treatments while the remaining 14 would have continued to be treated as having intermediate CHD risk.
F. Gene Expression Signatures Do Not Predict Gender or Medication Usage Because we wanted the cohorts to be reflective of a general catheterization laboratory population, the clinical characteristics of the minimal and severe CAD subjects were not matched. Certain characteristics were overrepresented in the severe CAD subjects relative to the minimal CAD subjects, in particular male gender and medication usage. To evaluate the possibility that the genomic model developed was actually detecting male gender or medication usage rather than CAD burden, we reassigned the outcome groups in the validation cohorts by gender or medication usage rather than CAD burden. The predictive accuracies for gender and medication usage were 52.6% and 54.0%, respectively indicating that gender and medication usage were not the dominant characteristics driving the prediction. If these clinical characteristics had been the dominant effects within the predictive model, the classification accuracies should have mirrored the results of the CAD burden prediction.
G. Predictive Genes for CAD Burden
The metagenes that enabled the classification by CAD burden in the Duke validation cohort were derived from 69 genes (Table T). The molecular and cellular functions that were statistically overrepresented, as defined by gene ontology terms, were: cellular movement, cell- to-cell signaling/communication, cellular assembly/organization and cell morphology. Pathways analysis using IPA identified two statistically significant gene networks within the candidate genes (Figures 1 and T).
Gene network 1 is associated with cell growth and proliferation and cell-to-cell signaling. The association of these genes into this gene network over random chance was statistically significant (p value 10~22) There are 10 genes from the candidate gene list in network 1 (Figure 1). These include fibronectin 1, which is involved in numerous cell adhesion functions involving platelets and/or leukocytes23"25 and glutamate receptor precursor26' 27 and integrin, beta 7 , which have been shown to be involved in T cell activation. IPA identified key effectors in the same network that were not in the final gene list such as fibroblast growth factor 2 (FGF2), tumor necrosis factor (TNF), osteopontin (SPPl) and mitogen-activated protein kinase 1 (MAP2K1). Previously, we had described osteopontin as a highly ranked candidate gene in our analysis of aortic atherosclerosis in both humans and mice29' 30.
Gene network 2 is associated with cell cycle control. The association of the genes in this network over random chance was statistically significant (p value 10~19). There were nine genes from the final gene list in gene network 2 (Figure T). These included zinc finger and btb domain containing 16, which is associated with myeloid cell differentiation26' 28, and p21-activated kinase 4, which may be involved in T cell activation29' 31. Key effectors in this network that were not in our final gene list, but were identified by IPA, included Akt, phophoinositide-3-kinase, regulatory subunit 1 (PIK3R1), transforming growth factor, beta 1 (TGFBl) and cyclin- dependent kinase inhibitor IA (CDKNlA).
The inventors have previously identified genes whose gene expression signatures could differentiate between minimal and severe atherosclerosis in freshly collected human and mouse aortas. Now, this new analysis shows that one can also identify genes in the blood whose expression signature can be used to accurately detect the presence of severe coronary atherosclerosis. The CAD gene expression signature was identified in a group of patients undergoing cardiac catheterization and was validated in two separate patient groups, one from the same cardiac catheterization laboratory and another from an outside cardiac catheterization laboratory. When integrated with traditional clinical risk factors in a multivariate regression model, the combined genomic and clinical information correctly classified patients as having minimal or severe CAD with 84.1% accuracy and an AUC of 0.86. These results represent a means for selecting subjects within the intermediate CHD risk for more intensive preventive medical therapies or additional diagnostic testing. In a simulation of how these results might be used clinically, we can consider the 24 subjects in our total study group with intermediate CHD risk by Framingham criteria. Our predictive model combining genomic and clinical data would
have correctly stratified all 24 subjects - 14 subjects would have remained classified as intermediate risk and receive the appropriate standard of care treatment, but 10 subjects would have been up-staged and reclassified as high risk.
From the foregoing description, one skilled in the art can easily ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make changes and modifications of the invention to adapt it to various usage and conditions and to utilize the present invention to its fullest extent. The preceding preferred specific embodiments are to be construed as merely illustrative, and not limiting of the scope of the invention in any way whatsoever. The entire disclosure of all applications, patents, and publications (including provisional patent application 61/105,191, filed October 14, 2008) cited above and in the figures are hereby incorporated in their entirety by reference.
REFERENCES 1. Zerhouni E. Fiscal Year 2004 President's Budget Request. 2003.
2. Rosamond W, Flegal K, Furie K, Go A, Greenlund K. ... Disease and Stroke Statistics— 2008 Update: A Report From the American Heart Association Statistics .... Circulation. 2008.
3. Fuster V, Hurst J. Hurst's the heart; 2004. 4. Greenland P, Smith S, Grundy S. Improving coronary heart disease risk assessment in asymptomatic people: role of traditional risk factors and noninvasive cardiovascular tests. Circulation. 2001;104(15):1863-1867.
5. Rosamond W, Folsom A, Chambless L, Wang C, Communities AIARi. Coronary heart disease trends in four United States communities. The Atherosclerosis Risk in Communities (ARIC) study 1987-1996. Int J Epidemiol. 2001;30 Suppl l:S17-22.
6. Thaulow E, Erikssen J, Sandvik L, Erikssen G, Jorgensen L, Cohn P. Initial clinical presentation of cardiac disease in asymptomatic men with silent myocardial ischemia and angiographically documented coronary artery disease (the Oslo Ischemia Study). Am J Cardiol. 1993;72(9):629-633. 7. Pasternak R, Abrams J, Greenland P, Smaha L, Wilson P, Houston-Miller N. Task force #1— identification of coronary heart disease risk: is there a detection gap? J Am Coll Cardiol. 2003;41(l l): 1863-1874.
8. Pignone, Fowler-Brown A, Pletcher M, Tice J. U Department of Health and Human Services 2003.
9. Jacobson TA, Griffiths GG, Varas C, Gause D. Impact of Evidence-Based" Clinical Judgment" on the Number of American Adults Requiring Lipid- .... Archives of Internal Medicine. 2000.
10. Greenland P, Gaziano JM. Selecting asymptomatic patients for coronary computed tomography or electrocardiographic exercise .... N Engl J Med. 2003.
11. Jaffer FA, O'Donnell CJ, Larson MG, Chan SK. Age and Sex Distribution of Subclinical Aortic Atherosclerosis A Magnetic Resonance Imaging .... Arteriosclerosis. 2002. 12. Simon A, Chironi G, Levenson J. ... of subclinical atherosclerosis tests in predicting coronary heart disease in asymptomatic .... European Heart Journal. 2007.
13. Friesinger GC, Page EE, Ross RS. Prognostic significance of coronary arteriography. Transactions of the Association of American Physicians. 1970;83:78-92.
14. Field LA, Jordan RM, Hadix JA, Dunn MA, Shriver CD, Ellsworth RE, Ellsworth DL. Functional identity of genes detectable in expression profiling assays following globin mRNA reduction of peripheral blood samples. Clinical biochemistry. 2007;40(7):499- 502.
15. Tusher V, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A. 2001;98(9):5116-5121. 16. Pittman J, Huang E, Nevins J, Wang Q, West M. Bayesian analysis of binary prediction tree models for retrospectively sampled outcomes. Biostatistics. 2004;5(4):587-601. 17. Seo D, Wang T, Dressman H, Herderick EE, Iversen ES, Dong C, Vata K, Milano CA, Rigat F, Pittman J, Nevins JR, West M, Goldschmidt-Clermont PJ. Gene expression phenotypes of atherosclerosis. Arterioscler Thromb Vase Biol. 2004;24(10): 1922- 1927. 18. West M, Blanchette C, Dressman H, Huang E, Ishida S, Spang R, Zuzan H, Olson JA, Marks JR, Nevins JR. Predicting the clinical status of human breast cancer by using gene expression profiles. Proc Natl Acad Sci U SA. 2001;98(20):11462-11467.
19. Pittman J, Huang E, Dressman H, Horng CF, Cheng SH, Tsou MH, Chen CM, BiId A, Iversen ES, Huang AT, Nevins JR, West M. Integrated modeling of clinical and gene expression information for personalized prediction of disease outcomes. Proc Natl Acad
Sci U S A. 2004;101(22):8431-8436.
20. Benito M, Parker J, Du Q, Wu J, Xiang D, Perou C, Marron J. Adjustment of systematic microarray data biases. Bioinformatics. 2004;20(l): 105-114.
21. Groth EJ. Timing of the Crab pulsar. I- Arrival times. The Astrophysical Journal Supplement Series. 1975.
22. Ohman E, Granger C, Harrington R, Lee K. Risk stratification and therapeutic decision making in acute coronary syndromes. JAMA. 2000;284(7):876-878. 23. Erie DJ, Sheppard D, Breuss J, Ruegg C, Pytela R. Novel integrin alpha and beta subunit cDNAs identified in airway epithelial cells and lung leukocytes using the polymerase chain reaction. Am JRespir Cell MoI Biol. 1991;5(2):170-177.
24. Ganor Y, Besser M, Ben-Zakay N, Unger T, Levite M. Human T cells express a functional ionotropic glutamate receptor GluR3, and glutamate by itself triggers integrin- mediated adhesion to laminin and fibronectin and chemotactic migration. J Immunol.
2003;170(8):4362-4372.
25. Ganor Y, Teichberg VI, Levite M. TCR activation eliminates glutamate receptor GluR3 from the cell surface of normal human T cells, via an autocrine/paracrine granzyme B- mediated proteolytic cleavage. J Immunol. 2007;178(2):683-692. 26. Koken MH, Reid A, Quignon F, Chelbi-Alix MK, Davies JM, Kabarowski JH, Zhu J, Dong S, Chen S, Chen Z, Tan CC, Licht J, Waxman S, de The H, Zelent A. Leukemia- associated retinoic acid receptor alpha fusion partners, PML and PLZF, heterodimerize and colocalize to nuclear bodies. Proc Natl Acad Sci U SA. 1997;94(19): 10255-10260.
27. Seo D, Ginsburg GS, Goldschmidt-Clermont PJ. Gene expression analysis of cardiovascular diseases: novel insights into biology and clinical applications. J Am Coll
Cardiol. 2006;48(2):227-235.
28. Reid A, Gould A, Brand N, Cook M, Strutt P, Li J, Licht J, Waxman S, Krumlauf R, Zelent A. Leukemia translocation gene, PLZF, is expressed with a speckled nuclear pattern in early hematopoietic progenitors. Blood. 1995;86(12):4544-4552. 29. Abo A, Qu J, Cammarano MS, Dan C, Fritsch A, Baud V, Belisle B, Minden A. PAK4, a novel effector for Cdc42Hs, is implicated in the reorganization of the actin cytoskeleton and in the formation of filopodia. EMBO J. 1998;17(22):6527-6540.
30. Karra R, Vemullapalli S, Dong C, Herderick EE, Song X, Slosek K, Nevins JR, West M, Goldschmidt-Clermont PJ, Seo D. Molecular evidence for arterial repair in atherosclerosis. Proc Natl Acad Sci U S A. 2005;102(46):16789-16794.
31. del Pozo MA, Vicente-Manzanares M, Tejedor R, Serrador JM, Sanchez-Madrid F. Rho GTPases control migration and polarization of adhesion molecules and cytoskeletal ERM components in T lymphocytes. Eur J Immunol. 1999;29(l l):3609-3620.
Claims
1. A method of screening a subject for the presence of coronary atherosclerosis, said method comprising, measuring the expression level of at least 5 of the genes of Table 2 in a biological sample obtained from said subject, wherein an elevated level of expression of said 5 genes compared to a control level measured in a population of normal subjects is indicative of an increased probability of the subject having significant coronary atherosclerosis.
2. The method of claim 1 that comprises measuring the expression level of at least 10 of the genes, wherein an elevated level of expression of at least 10 of said genes is indicative of an increased probability of the presence of coronary atherosclerosis in said subject.
3. The method of claim 1 that comprises measuring the expression level of at least 15 of the genes, wherein an elevated level of expression of at least 15 of said genes is indicative of an increased probability of the presence of coronary atherosclerosis in said subject.
4. The method of claim 1 that comprises measuring the expression level of at least 20 of the genes, wherein an elevated level of expression of at least 20 of said genes is indicative of an increased probability of the presence of coronary atherosclerosis in said subject.
5. The method of claim 1 that comprises measuring the expression level of at least 30 of the genes, wherein an elevated level of expression of at least 30 of said genes is indicative of an increased probability of the presence of coronary atherosclerosis in said subject.
6. The method of claim 1 that comprises measuring the expression level of at least 40 of the genes, wherein an elevated level of expression of at least 40 of said genes is indicative of an increased probability of the presence of coronary atherosclerosis in said subject.
7. The method of one of claims 2-6, wherein the genes are selected from at least 5 of the 7 families of the group consisting of metagene groups 32, 11, 67, 75, 10, 8 and 24.
8. The method of claim 1, wherein the probability of having significant subclinical coronary atherosclerosis is at least about 50%.
9. The method of claim 8, wherein the probability is at least about 80%.
10. The method of claim 9, wherein the probability is at least about 4 fold.
11. A method for determinig a treatment regimen for a subject suspected of having CAD, comprising determining by a method of claim 1 whether the subject is likely to have CAD and, if the subject is determined to be likely to have CAD, deciding to treat the subject aggressively for the CAD, and if the subject is determined not to be likely to have CAD, deciding to treat the subject aggressively for the CAD.
12. The method of claim 1, wherein the biological sample is a blood sample.
13. The method of claim 12, wherein the blood sample is whole blood.
14. The method of claim 1, wherein the subject is human.
15. A method of data reduction for selecting a set of features (genes) associated with a specific condition, said method comprising the steps of
(a) Using significance analysis of microarrays (SAM) from data obtained from an experimental and a control group of subjects to select an initial set of features;
(b) Using binary prediction tree analysis to select additional features; and obtaining a set of features that is predictive of the condition.
16. The method of claim 15, wherein a feature is an expressed gene.
17. The method of claim 15 or 16, wherein the specific condition is a disease or disorder.
18. The method of one of claims 15 or 16, wherein the set of features is diagnostic.
19. The method of one of claims 15 or 16, wherein the set of features is prognostic.
20. The method of one of claims 15 or 16, wherein the data is obtained from blood.
21. The method of claim 20 wherein the blood is whole blood.
22. A kit for detecting the presence of CAD in a subject, comprising reagents for detecting the amount of expression of at least five of the genes in Table 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/124,220 US20110287961A1 (en) | 2008-10-14 | 2009-10-14 | Expression analysis of coronary artery atherosclerosis |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10519108P | 2008-10-14 | 2008-10-14 | |
| US61/105,191 | 2008-10-14 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010045346A1 true WO2010045346A1 (en) | 2010-04-22 |
Family
ID=42106873
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2009/060663 Ceased WO2010045346A1 (en) | 2008-10-14 | 2009-10-14 | Expression analysis of coronary artery atherosclerosis |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20110287961A1 (en) |
| WO (1) | WO2010045346A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018045079A1 (en) * | 2016-09-01 | 2018-03-08 | The George Washington University | Blood rna biomarkers of coronary artery disease |
| WO2018200489A1 (en) * | 2017-04-25 | 2018-11-01 | The Brigham And Women’S Hospital, Inc. | Il-8, il-6, il-1b and tet2 and dnmt3a in atherosclerosis |
| RU2770269C1 (en) * | 2021-06-11 | 2022-04-15 | Федеральное государственное бюджетное научное учреждение Томский национальный исследовательский медицинский центр Российской академии наук (Томский НИМЦ), Тюменский кардиологический научный центр | Method for predicting the risk of developing subclinical atherosclerosis of the carotid arteries in shift workers in the arctic |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060134664A1 (en) * | 2004-11-03 | 2006-06-22 | Scherzer Clemens R | Identification of dysregulated genes in patients with neurological diseases |
| EP1889908A1 (en) * | 2005-06-03 | 2008-02-20 | Mochida Pharmaceutical Co., Ltd. | Anti-cd14 antibody-fused protein |
| US20080057590A1 (en) * | 2006-06-07 | 2008-03-06 | Mickey Urdea | Markers associated with arteriovascular events and methods of use thereof |
| US20080228824A1 (en) * | 2007-03-16 | 2008-09-18 | Expanse Networks, Inc. | Treatment Determination and Impact Analysis |
-
2009
- 2009-10-14 WO PCT/US2009/060663 patent/WO2010045346A1/en not_active Ceased
- 2009-10-14 US US13/124,220 patent/US20110287961A1/en not_active Abandoned
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060134664A1 (en) * | 2004-11-03 | 2006-06-22 | Scherzer Clemens R | Identification of dysregulated genes in patients with neurological diseases |
| EP1889908A1 (en) * | 2005-06-03 | 2008-02-20 | Mochida Pharmaceutical Co., Ltd. | Anti-cd14 antibody-fused protein |
| US20080057590A1 (en) * | 2006-06-07 | 2008-03-06 | Mickey Urdea | Markers associated with arteriovascular events and methods of use thereof |
| US20080228824A1 (en) * | 2007-03-16 | 2008-09-18 | Expanse Networks, Inc. | Treatment Determination and Impact Analysis |
Non-Patent Citations (6)
| Title |
|---|
| "BC021739, Homo sapiens hypothetical LOC554201, mRNA (cDNA clone IMAGE:4823306).", 2005, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/nuccore/20987607> [retrieved on 20100118] * |
| BC032733, Homo sapiens immunoglobulin heavy variable 7-81 (non-functional) 09-JUL-2002 [online]. [Retrieved from the Intemet on 2010.01.15: <URL: http://srs6.ebi.ac.uk/srs6binlcgi- bin/wgetz?[imgtligm-AccNumber:BC032733]+-e>] * |
| CHARLES ET AL.: "A gene signature of nonhealing venous ulcers: potential diagnostic markers.", J AM ACAD DERMATOL., vol. 59, no. 5, 20 August 2008 (2008-08-20), pages 758 - 771 * |
| HWANG: "How to find the atherosclerosis-related genes using microarray?", 2007, Retrieved from the Internet <URL:http://www.lipid.or.kr/upload/pds/%ED%99%A9%EC%83%81%EC%A4%80.pdf> [retrieved on 20100115] * |
| NM_032923, Homo sapiens hypothetical protein MGC16025 (MGC16025), mRNA. 2003. [online]. [Retrieved from the Internet on 2010.01.15]: <URL: http://www.ncbi.nlm.nih.gov/nuccore/NM_ 032923.1?report=genbank>] * |
| W73431, zd53c05.r1 Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE: 344360 5- similar to contains Alu repetitive element; mRNA sequence. 1996: <URL:http://www.ncbi.nlm.nih.gov/nucest/W73431.1?ordinalpos=1&itool=EntrezSystem2.PEntr ez.Sequence.Sequence_ResultsPanel.Sequence_RVDocSum> * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018045079A1 (en) * | 2016-09-01 | 2018-03-08 | The George Washington University | Blood rna biomarkers of coronary artery disease |
| CN110225982A (en) * | 2016-09-01 | 2019-09-10 | 乔治·华盛顿大学 | Blood RNA Biomarkers of Coronary Artery Disease |
| JP2019528706A (en) * | 2016-09-01 | 2019-10-17 | ザ ジョージ ワシントン ユニヴァーシティー | Blood RNA biomarkers for coronary artery disease |
| US12104210B2 (en) | 2016-09-01 | 2024-10-01 | The George Washington University | Blood RNA biomarkers of coronary artery disease |
| WO2018200489A1 (en) * | 2017-04-25 | 2018-11-01 | The Brigham And Women’S Hospital, Inc. | Il-8, il-6, il-1b and tet2 and dnmt3a in atherosclerosis |
| RU2770269C1 (en) * | 2021-06-11 | 2022-04-15 | Федеральное государственное бюджетное научное учреждение Томский национальный исследовательский медицинский центр Российской академии наук (Томский НИМЦ), Тюменский кардиологический научный центр | Method for predicting the risk of developing subclinical atherosclerosis of the carotid arteries in shift workers in the arctic |
Also Published As
| Publication number | Publication date |
|---|---|
| US20110287961A1 (en) | 2011-11-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220033905A1 (en) | Method for diagnosis and prognosis of chronic heart failure | |
| EP2715348B1 (en) | Molecular diagnostic test for cancer | |
| US11591655B2 (en) | Diagnostic transcriptomic biomarkers in inflammatory cardiomyopathies | |
| US20230036585A1 (en) | Novel methods for early identification of bone healing ability in injured patients | |
| AU2017203453A1 (en) | Cancer biomarkers | |
| CA2993142A1 (en) | Gene signature for immune therapies in cancer | |
| EP1721159B1 (en) | Breast cancer prognostics | |
| AU2011282892A1 (en) | Method for using gene expression to determine prognosis of prostate cancer | |
| CA2761571A1 (en) | Prognostic and predictive gene signature for non-small cell lung cancer and adjuvant chemotherapy | |
| EP2611941A2 (en) | Gene signatures for cancer diagnosis and prognosis | |
| JP2011509689A (en) | Molecular staging and prognosis of stage II and III colon cancer | |
| US20250137066A1 (en) | Compostions and methods for diagnosing lung cancers using gene expression profiles | |
| EP2333112B1 (en) | Breast cancer prognostics | |
| KR20190089552A (en) | Biomarkers for diagnosis of Non-muscle invasive bladder cancer and uses thereof | |
| CN101326290B (en) | Markers for predicting response to anticancer drugs in patients with acute myeloid leukemia | |
| US20110287961A1 (en) | Expression analysis of coronary artery atherosclerosis | |
| EP3105350B1 (en) | Transcriptomic biomarkers, method for determination thereof and use of transcriptomic biomarkers for individual risk assessment of developing post-infarction heart failure | |
| WO2005074540A2 (en) | Novel predictors of transplant rejection determined by peripheral blood gene-expression profiling | |
| WO2009049257A2 (en) | Predictive models and methods for diagnosing and assessing coronary artery disease | |
| KR20210048794A (en) | Composition for diagnosing nontuberculous mycobacterial infection or infection disease | |
| EP4584399A1 (en) | Methods to predict response to icbt of a patient having cancer | |
| US20250298015A1 (en) | Diagnostic method of detecting inflammation biomarker(s) | |
| EP3577235A1 (en) | Predictive methods of ascending aorta dilation and bicuspid aortic valve |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09821188 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13124220 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 09821188 Country of ref document: EP Kind code of ref document: A1 |


