WO2010032899A2 - Eno1-specific human antibody - Google Patents
Eno1-specific human antibody Download PDFInfo
- Publication number
- WO2010032899A2 WO2010032899A2 PCT/KR2008/006116 KR2008006116W WO2010032899A2 WO 2010032899 A2 WO2010032899 A2 WO 2010032899A2 KR 2008006116 W KR2008006116 W KR 2008006116W WO 2010032899 A2 WO2010032899 A2 WO 2010032899A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- enol
- human antibody
- composition
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
Definitions
- the present disclosure relates to a alpha-endolase (ENOl) -specific human antibody.
- ENOl alpha-endolase
- enolase has ⁇ , ⁇ , and Y homologues .
- ⁇ - enolase is present in most tissues, but particularly predominant in early embryonic tissues.
- the ⁇ -enolase (or ENOl) and MBP-I (c-myc binding protein) are derived from single genes by alternative use in translational starting sites.
- ENOl is a cytoplasmic glycolytic enzyme which is significant in formation of phosphoenolpyruvate. It has been reported that ENOl, a major enzyme in glycolysis, is overexpressed in 18 kinds of cancer cells (Altenberg B, Greulich KO. enomics 84:1014-1020, 2004). The immunogenicity of ENOl in cancer cells is identified by Western blot and ELISA using recombinant proteins (Ping H et al., Can Sci. 98:1234-1240, 2007).
- the present inventors have selected 6 kinds of human antibodies specifically bound to ENOl expressing on the surface of various kinds of cancer cell lines, confirmed that the human antibody has binding capacity similar to those of the conventional nonhuman-derived antibodies and that the human antibody of the present invention may be useful for diagnosis, prevention, and treatment of cancers, and have made the present invention.
- the human antibody has binding capacity similar to those of the conventional nonhuman-derived antibodies and that the human antibody of the present invention may be useful for diagnosis, prevention, and treatment of cancers, and have made the present invention.
- One object of the present invention is to provide an ENOl-specific human antibody.
- Still further another object of the present invention is to provide a method for preparing an ENOl-specific human antibody by incubating the transformant.
- the present invention also provides a composition including the human antibody.
- the present invention also provides a pharmaceutical composition including the human antibody as an effective ingredient .
- Another object of the present invention is to provide a method for treating an ENOl-overexpressed cancer, the method including administering a pharmaceutically effective amount of the human antibody to a subject with the ENOl-overexpressed cancer.
- Still another object of the present invention is to provide a composition including the human antibody, light or heavy chain of the human antibody or an immunologically active fragment thereof, and a radioactive isotope.
- Even another object of the present invention is to provide an immunodetection method for detecting an ex vivo ENOl-overexpressed cancer, including contacting the composition for detection of the cancer with a cancer cell .
- Yet another object of the present invention is to provide a method for imaging an in vivo ENOl-overexpressed cancer, including administering a diagnostically effective amount of the composition for detection of the cancer to a subject.
- Another object of the present invention is to provide a method for treating an in vivo ENOl-overexpressed cancer using the composition for detection.
- Still further another object of the present invention is to provide a method for prognostic evaluation of a cancer treatment using the composition for detection.
- the present invention provides an
- ENOl-specific human antibody including a heavy chain including a heavy chain variable region (v H ) including a heavy chain complementarity determining region (hereinafter, HCDR) 1 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 7 to 12, HCDR 2 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 13 to 18, and HCDR 3 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 19 to 24, or a fragment thereof; and a light chain including a light chain variable region
- V L including a light chain complementarity determining region (hereinafter, LCDR) 1 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 31 to 36, LCDR 2 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 37 to 42, and LCDR 3 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 43 to 48, or a fragment thereof.
- LCDR light chain complementarity determining region
- the present invention also provides a polynucleotide encoding a heavy chain of the human antibody or an immunologically active fragment thereof, and an expression vector including the polynucleotide.
- the present invention also provides a polynucleotide encoding a light chain of the human antibody or an immunologically active fragment thereof, and an expression vector including the polynucleotide.
- the present invention also provides a transformant prepared by introducing an expression vector including a polynucleotide encoding a heavy chain of the human antibody or an immunologically active fragment thereof into a host cell.
- the present invention also provides a transformant prepared by introducing an expression vector including a polynucleotide encoding a light chain of the human antibody or an immunologically active fragment thereof into a host cell .
- the present invention also provides a transformant prepared by introducing an expression vector including a polynucleotide encoding a heavy chain of the human antibody or an immunologically active fragment thereof and an expression vector including a polynucleotide encoding a light chain of the human antibody or an immunologically active fragment thereof simultaneously into a host cell.
- the present invention also provides a method for preparing an ENOl-specific human antibody by incubating the transformant .
- the present ⁇ invention also provides a composition including the human antibody.
- the present invention also provides a pharmaceutical composition including the human antibody.
- the present invention also provides a method for treating an ENOl-overexpressed cancer, including administering a pharmaceutically effective amount of the human antibody to a subject with the cancer.
- the present invention also provides a composition including the human antibody, a light or heavy chain of the human antibody or an immnunologically active fragment thereof, and a radioactive isotope.
- the present invention also provides an immunodetection method for detecting an ex vivo ENOl-overexpressed cancer, including contacting a composition for detection of the cancer with a cancer cell .
- the present invention also provides a method for imaging an in vivo ENOl-overexpressed cancer, the method including: 1) administering a diagnostically effective amount of a composition for detection of the cancer to a subject; and 2) obtaining a detection image for the subject.
- the present invention also provides a method for treating an in vivo ENOl-overexpressed cancer, the method including: 1) intravenously administering a composition including the radioactive isotope to a subject;
- Step 2) detecting the composition of Step 1) to identify tumor cells
- Step 3 eliminating the tumor cells identified in Step 2) by surgical operation.
- the present invention also provides a method for prognostic evaluation of a cancer patient, the method including:
- Step 2) detecting the composition of Step 1) to identify tumor cells
- step 2) judging that all tumor cells have been eliminated when tumor cells are not detected in step 2) .
- the ENOl-specific human antibody expressed in various kinds of cancer cells of the present invention may be used in diagnosis of the cancers, classification of the diseases, visualization, treatment, and prognostic evaluation.
- FIG. 1 is a group of photos illustrating results that ENOl genes are expressed in various cancer cell lines.
- FIG. 2 is a group of photos illustrating results confirming that ENOl proteins are expressed on the surface of SK0V3 (ovarian adenocarcinoma) .
- FIG. 3 is a group of photos illustrating results identifying induction conditions of transformant cells for ENOl expression according to IPTG concentration and processing time at 37 °C and 28 ° C: a: ENOl expression according to IPTG processing time at
- FIG. 4 is a group of photos illustrating results of purifying ENOl induced at 20 ° C and 28 ° C: a: ENOl expression at 20 ° C according to IPTG concentration; and, b: ENOl expression at 28 ° C according to IPTG concentration.
- FIG. 5 is a graph illustrating results of phage screening in 1st to 3rd pannings.
- FIG. 6 is a photo illustrating results of diversity of 6 monoclonal phage antibodies against ENOl, identified by fingerprinting:
- FIG. 7 is a list of sequences illustrating analysis results of polypeptides used in heavy chain and light chain CDR3 of 6 monoclonal phage antibodies against ENOl : a: heavy chain; and b: light chain.
- FIG. 8 is a photo illustrating a result comparing binding specificities of commercial ENOl antibody and phage antibody of the present invention.
- FIG. 9 is a photo illustrating results, confirming that the C2 phage antibody of the present invention is specifically bound to various cancer cell lines:
- SK0V3 ovarian adenocarcinoma
- Colo205 colon adenocarcinoma
- C 2774 (ovary serous cystadenocarcinoma) ; a: ⁇ -ENOl (SantaCruz) and normal mouse IgG (red color) as a negative control group; and, b: C2 phage antibody of the present invention and single phage as a negative control group.
- FIG. 10 is a photo illustrating results, confirming that ENO1-C2 and ENO1-B8 are converted into whole IgG forms.
- FIG. 11 is a group of cleavage maps of pNATAB H vector and pNATAB L vector: a: pNATAB H vector; and b: pNATAB L vector.
- Variable region means a region of an antibody molecule which specifically binds to an antigen and demonstrates modifications in sequence, which is exemplified by CDRl, CDR2, and CDR3. Between the CDRs, there is a framework region (FR) which supports the CDR loop.
- FR framework region
- “Complementarity determining region” is a loop-shaped site involved in antigen recognition, and specificity of an antibody against antigen depends on modification in that site. “Panning” refers to a process of selecting only a phage expressing a peptide which binds to a target molecule (antibody, enzyme, cell-surface receptor, etc.) on the coat of the phage from a phage library displaying the peptide on the coat.
- a target molecule antibody, enzyme, cell-surface receptor, etc.
- the present invention provides an ENOl-specific human antibody including: a heavy chain including a heavy chain variable region (V H ) including a heavy chain complementarity determining region (hereinafter, HCDR) 1 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 7 to 12 , HCDR 2 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 13 to 18, and HCDR 3 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 19 to 24, or a fragment thereof; and a light chain including a light chain variable region (V L ) including a light chain complementarity determining region (hereinafter, LCDR) 1 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 31 to 36, LCDR 2 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 37 to 42, and LCDR 3 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 43 to 48, or a fragment thereof.
- V H heavy chain variable
- the heavy chain variable region has an amino acid sequence selected from the group consisting of SEQ ID Nos. 25 to 30, and the light chain variable region has an amino acid sequence selected from the group consisting of SEQ ID Nos. 49 to 54.
- the antibody includes not only a whole antibody, but also a functional fragment of the antibody molecule.
- the whole antibody has a structure with two full-length light chains and two full-length heavy chains, and each light chain is linked to heavy chain by disulfide bond.
- the functional fragment of an antibody molecule indicates a fragment retaining a antigen- binding function, and examples of the antibody fragment include (i) Fab fragment consisting of light chain variable region (V L ) , heavy chain variable region (V H ) , light chain constant region (C L ) , and heavy chain 1 st constant region (C H i) ; (ii) Fd fragment consisting of V H and C H i domains; (iii) Fv fragment consisting of V L and V H domains of a monoclonal antibody; (iv) dAb fragment consisting of V H domain (Ward ES et al., Nature 341:544-546 (1989)); (v) separated CDR region; (vi) F(ab')2 fragment
- a human antibody against ENOl was obtained as scFV by using phage display technology and screened as a mono phage clone. As a result, 6 kinds of ENOl- specific monoclonal phages were obtained.
- ENOl whose gene is confirmed to be expressed in various cancer cell lines the activity (see FIG. 1) is usually expressed on the surface of cancer cell lines (see FIG. 2) , it is available as a target protein of various cancers.
- the ENOl expressed and purified through recombinant technology was reacted with a library phage constructed from human naive scFV library cells having diversity, followed by panning and screening of monoclones strongly binding to the ENOl antigen (see Tables 3 & 4 and FIG. 5) .
- the selected monoclones were identified by fingerprinting (see FIG.
- VH5-51 and each kind of VH3-9 and VH3-30 were included as a heavy chain, while 5 kinds of lambda and one kind of kappa chain were included as a light chain. Analysis showed that polypeptides of each of human heavy and light chains were different, respectively. It was confirmed that the selected monoclonal antibodies could detect antigen proteins clearly at a similar level to that of a commercially available non-human antibodies (see FIG. 8) , and that the antibodies were specifically bound to ENOl in various cancer cells (see FIG. 9) .
- the present invention also provides a polynucleotide encoding a heavy chain of the human antibody or an immunologically active fragment thereof, and an expression vector including the polynucleotide.
- the present invention also provides a polynucleotide encoding a light chain of the human antibody or an immunologically active fragment thereof, and an expression vector including the polynucleotide.
- ENOl expressed on the surface of various cancer cell lines (see FIG. 1 and I) 1 and expressed and purified through recombinant technology was reacted with a library phage constructed from human naive scFV library cells having diversity, followed by panning and screening of monoclones strongly binding to the ENOl antigen (see Tables 3 & 4 and FIG. 5) .
- the selected monoclones were identified by fingerprinting (see FIG.
- one or more nucleotides may be modified by substitution, deletion, insertion, or a combination thereof as long as the polynucleotide of the present invention encodes a protein with an equivalent activity thereof, and they are also included in the present invention.
- the sequence of the polynucleotide may be a single or double chain, and a DNA or RNA (mRNA) molecule.
- an expression control sequence such as a promoter, a terminator, an enhancer, etc., a sequence for membrane targeting or secretion, etc. may be appropriately selected according to a kind of host cell in which light and heavy chains of the human antibody or a fragment thereof are to be produced, and may be variously combined according to its purpose.
- the expression vector of the present invention includes, but is not limited to, a plasmid vector, a cosmid vector, a bacteriophage, and a viral vector.
- a suitable expression vector may include expression regulatory elements such as a promoter, an operator, an initiation codon, a stop codon, a polyadenylation signal, and an enhancer and a signal sequence or leader sequence for membrane targeting or secretion, and may be variously prepared according to its purpose.
- a promoter of the expression vector may be constitutive or inductive.
- the signal sequence for use may include, but is not limited to, a PhoA signal sequence and an QmpA signal sequence for genus Escherichia hosts; an ⁇ -amylase signal sequence and a subtilicin signal sequence for genus Bacillus hosts; an MFa signal sequence and an SUC2 signal sequence for yeast hosts; and an insulin signal sequence, an ⁇ -interferon signal sequence, and an antibody molecule signal sequence for animal cell hosts.
- the expression vector may include a selection marker for selecting host cells containing the vector, and a replication origin when it is a replicable expression vector.
- the present invention also provides a transformant prepared by introducing an expression vector including a polynucleotide encoding a heavy chain of the human antibody or an immunologically active fragment thereof into a host cell.
- the present invention also provides a transformant prepared by introducing an expression vector including a polynucleotide encoding a light chain of the human antibody or an immunologically active fragment thereof into a host cell.
- the present invention also provides a transformant prepared by introducing an expression vector including a polynucleotide encoding a heavy chain of the human antibody or a fragment thereof and an expression vector including a polynucleotide encoding a light chain of the human antibody or a fragment thereof simultaneously into a host cell.
- genes encoding light and heavy chains of a monoclonal phage were obtained and linked to a vector, respectively, and then the expression vectors were simultaneously introduced into a host cell to prepare a whole human IgG antibody for in vivo diagnosis and treatment of cancers.
- the expression vector according to the present invention may be transformed into a suitable host cell, for example, E. coli or yeast cell, and the transformed host cell may be incubated to produce light and heavy chains of the human antibody of the present invention or a fragment thereof in mass quantities. Incubation methods and media conditions suitable for a kind of host cell may be easily chosen from those known to those skilled in the art.
- the host cell may be a prokaryote such as E. coli or Bacillus subtilis.
- it may be a eukaryotic cell derived from a yeast such as Saccharomyces cerevisiae, an insect cell, a vegetable cell, and an animal cell. More preferably, the animal cell may be an autologous or allogeneic animal cell.
- a transformant prepared through introduction into an autologous or allogeneic animal cell may be administered to a subject for use in cellular therapy for cancer.
- a method for introducing an expression vector into the host cell it is possible to use any method if it is known, to those skilled in the art.
- the present invention also provides a method for preparing an ENOl-specific human antibody by incubating the transformant .
- the present invention provides a method for preparing an ENOl-specific human antibody, the method including:
- the culture medium it is desirable to select and use a culture medium suitable for the transformant among those known to those skilled in the art.
- the method for purifying human antibodies it is possible to use any method known to those skilled in the art.
- the present invention also provides a composition including the human antibody.
- the present invention also provides a pharmaceutical composition including the human antibody.
- the pharmaceutical composition may be useful for prevention and treatment of an ENOl-overexpressed cancer.
- the ENOl-overexpressed cancer is preferably one selected from the group consisting of, but not limited to, lung cancer, colorectal cancer, breast cancer, ovarian cancer, renal cell cancer, and prostate cancer, and includes all the ENOl- overexpressed cancers .
- the pharmaceutical composition of the present invention may selectively contain the ENOl-specific human antibody or the transformant, and may additionally contain one or more effective ingredients exhibiting functions identical or similar to those of the ingredient.
- the pharmaceutical composition of the present invention may be formulated by including one or more pharmaceutically acceptable carriers in addition to the effective ingredients described above.
- the pharmaceutically acceptable carrier includes saline solution, sterilized water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, and at least one combination thereof, and other general additives such as antioxidants, buffer solution, bacteriostatic agents, etc. may be added if necessary.
- it may be formulated in the form of an injectable formulation such as aqueous solution, suspension, emulsion, etc. by additionally adding diluent, dispersing agent, surfactant, binder and lubricant, and antibodies and other ligands specific to a target cell may be used in combination with the carrier to be specifically reacted with the target cell.
- composition may be preferably formulated according to each disease or ingredient using a suitable method in the art or a method which is taught in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA.
- the pharmaceutical composition of the present invention may be parenterally administered, and the parenteral administration is effected by subcutaneous injection, intravenous injection, intramuscular injection, or intrapleural injection.
- the pharmaceutical composition of the present invention may be mixed with a stabilizer or buffer to prepare a solution or suspension, which may then be provided as ampoules or vials each containing a unit dosage form.
- the pharmaceutical composition of the present invention may be prepared in various forms according to the route of administration.
- the pharmaceutical composition of the present invention may be formulated to a sterilized aqueous solution or dispersion for injection, or may be prepared in a freeze-dried form through a freeze-drying technique.
- the freeze-dried pharmaceutical composition may be stored typically at about 4°C and may be reconstituted with a stabilizer that may contain an adjuvant such as saline solution and/or HEPE.
- factors affecting the amount of the pharmaceutical composition to be administered include, but are not limited to, administration mode, administration frequency, specific disease under treatment, severity of disease, history of disease, whether the subject is under treatment in combination with other therapeutics, the subject's age, height, weight, health, and physical conditions. As the patient's weight under treatment increases, the pharmaceutical composition of the present invention may preferably be administered in increasing amounts .
- the present invention also provides a method for treating an ENOl-overexpressed cancer, the method including administering a pharmaceutically active amount of the human antibody to a subject with the cancer.
- the subject applicable in the present invention is a vertebrate, preferably a mammal, more preferably an experimental animal such as mouse, rabbit, guinea pig, hamster, dog, and cat, and most preferably a primate such as chimpanzee and gorilla.
- the method for administering the human antibody of the present invention may be conducted by parenteral administration (for example, intravenous, subcutaneous, intraperitoneal, or local administration) according to the purpose of use, and preferably by intravenous administration.
- parenteral administration for example, intravenous, subcutaneous, intraperitoneal, or local administration
- intravenous administration In administration for solid cancer, local administration may be often preferable for rapid and facilitated access of the antibody.
- the dose may vary depending on weight, age, sex, and health condition of a patient, diet, administration time, administration method, excretion rate, and severity of disease.
- the single dose is in the range of 5 to 500 mg/irf, which may be administered daily or weekly.
- the effective amount may be controlled at the discretion of a doctor treating the patient.
- the human antibody of the present invention may be used alone or in combination with surgery, hormone therapy, chemical therapy, and a biological response controller for treatment of a patient.
- the present invention also provides a composition including the human antibody, light and heavy chains of the human antibody, or an immunologically active fragment thereof, and a radioactive isotope.
- composition may be useful for radioimmuno treatment and detection of an ENOl-overexpressed cancer.
- radioactive isotopes examples include 3 H, 11 C, 14 C, 18 F, 64 Cu, 76 Br, 86 Y, 99m Tc, 111 In, 123 I, 177 Lu, and a mixture or combination thereof.
- the radioactive isotope is characterized by the fact that it is bound to a human antibody and included in a carrier to which the human antibody is bound.
- the present invention also provides an immunodetection method for detecting an ex vivo ENOl-overexpressed cancer, the method including: contacting a composition including the radioactive isotope with cancer cells.
- the composition for detection may be bound to a solid substrate in order to facilitate the subsequent steps such as washing or separation of complexes.
- the solid substrate includes, for example, synthetic resin, nitrocellulose, glass substrate, metal substrate, glass fiber, microsphere, microbead, etc.
- the synthetic resin includes polyester, polyvinyl chloride, polystyrene, polypropylene, PVDF, nylon, etc .
- cancer cell may be appropriately diluted before it is contacted with the composition for detection.
- the present invention also provides a method for imaging an ENOl-overexpressed cancer, the method including 1) administering a diagnostically effective amount of a compound including the radioactive isotope to a subject; and 2) obtaining a detection image for the subject.
- the detection image is characterized by the fact that it is obtained by near-infrared light imaging, PET, MRI, or ultrasonic imaging.
- the present invention also provides a method for treating an in vivo ENOl-overexpressed cancer, the method including:
- Step 3 eliminating the tumor cells identified in Step 2) by surgical operation.
- the present invention provides a method for prognostic evaluation of a cancer patient, the method including:
- step 2) judging that all tumor cells have been eliminated when tumor cells are not detected in step 2) .
- QiagenEasyRNA kit (USA) was used in 15 kinds of different cancer cell lines in Table 1 to extract a total RNA, and each of 1 ⁇ g of Superscriptase II Reverse-Transcriptase (Invitrogen, USA) as a total RNA was used respectively to synthesize a cDNA.
- the cDNA was diluted with sterilized distilled water to prepare a 2% cDNA, and then each of 10 pmole// ⁇ of Taq DNA polymerase (Solgent, Korea) , forward primer (SEQ ID No. 1: 5'-GAATTGAAGAGGAGCTGGGC-S'), and reverse primer (SEQ ID No. 2: 5'-GTGTAGCCAACAGGTGACCG-S') was used to perform a PCR under conditions described in Table 2.
- GAPDH was used as gel loading control group.
- ENOl may be used as a target protein for various cancers.
- Example 2 Investigation of ENOl expression location using immunofluorescence microscopy
- IX PBS was used to prepare all the solutions. Coverglass was placed in a 6-well plate, and coating with 20% FBS was performed. Subsequently, SKOV3 ovarian cancer cell line with dominant EOl expression was incubated in the plate. After an incubation for 24 hours, the cell line was immobilized with 4% paraformaldehyde for 10 minutes, and membrane permeabilization was carried out with 0.05% Triton X- 100 for 5 minutes. The cell line was blocked with 3% normal goat serum (vector Lab.
- ENOl antibodies diluted at 1:50 in a dilution buffer (0.1% BSA, 0.05% Triton X-IOO) was used to stain the cell line for 1.5 hours, followed by washing three times with IX PBS.
- the secondary antibody anti-mouse IgG-FITC, Vector Lab. Inc. FI-200, USA
- diluted at 1:2500 in the dilution buffer was used to stain the cell line for 45 minutes, followed by washing three times with IX PBS.
- the cell line was stained with DAPI (Glass-Slide) for 5 minutes and washed with PBS.
- DAPI Glass-Slide
- the coverglass was transferred and mounted onto a Glass-Slide, and nail-polish was used for sealing.
- the reaction results were analyzed by a fluorescent microscope (MFI-4000, Leica) .
- ENOl was present in cytoplasm and cell membrane of SKOV3 cell line and expressed generally on the surface of cells, which is identical to results confirmed in previous reports (Chang GC et al., Clin Cancer Res 2006; 12:574654; Satoshi Ito et al. , Cancer Sci. 2007, 98 (4): 499-505).
- a plasmid (IRAT-14-BO9) containing a human ENOl gene was provided from KUGI (Korean UniGene Information) of the Center for Functional Analysis of Human Genome in Korea Research Institute of Bioscience and Biotechnology.
- the plasmid was used as a template DNA.
- a forward primer (SEQ ID No. 3: CGCGGATCCTCTATTCTCAAGATCCATGC) and a reverse primer (SEQ ID No. 4: CCGCTCGAGCTTGGCCAAGGGGTTTCTGAA) were used to amplify the gene under the following conditions, followed by subcloning into a pET28A (Novagen 69864-3, USA) .
- PCR conditions are as follows: when a total reaction reagent was 50 ⁇ i, 100 ng of the template was introduced and a reaction at 94°C for 2 minutes, 30 cycles of reactions at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72 ° C for a half minutes, and at a reaction at 72 ° C for 10 minutes were performed to get a PCR product. Furthermore, the base sequence of the subcloned vector was identified
- the expression was the most dominant when 0.5 mM of IPTG was treated at 28 ° C for 4 hours. However, the expression was quite favorable at 37 ° C without much fluctuation over according to time. In addition, a lot of insoluble proteins were observed, but soluble proteins were also expressed to some degree.
- 2XYTCM 17 g of Tryptone (CONDA, 1612.00), 10 g of yeast extract (CONDA, 1702.00), 5 g of NaCl (Sigma, S7653-5 kg), 34 ⁇ g/wl of chloramphenicol (Sigma, C0857)], 2% glucose (Sigma, G5400) , and 5
- the cells were infected with helper phage, followed by incubation in a medium containing 2 xYTCMK [2 XYT CM, 70 ⁇ g/ml of Kanamycin (Sigma, K1876) , 1 mM IPTG (ELPISBIO, IPTG025)] at 30 ° C for 16 hours.
- the incubated cells were centrifuged (4500 rpm, 15 min, 4 ° C) to obtain a supernatant.
- the supernatant was treated with PEG (Fluka,
- the reactant was centrifuged again (8000 rpm, 20 min, 4 ° C).
- the pellet was dissolved in PBS, which proceeded to centrifugation again (12000 rpm, 10 min, 4 ° C) .
- the supernatant containing library phage was obtained, which was transferred to a new tube and stored at 4 ° C.
- An immunosorb tube (Nunc 470319) was coated with 30 ⁇ g of the purified ENOl-antigens (TMPS4-FLAG and TM-EK) obtained in
- a single phage antibody which was specifically binding to WW45 antigen associated with a developmental process unrelated to VEGF and constructed by a method in Example of the present invention, was used as a control group.
- the incubated cells were centrifuged (4500 rpm, 15 min, 4 ° C), and the supernatant was transferred to a new tube (1st ⁇ 3rd panning poly scFv-phage) .
- a 96-well immuno-plate (NUNC 439454) was coated with ENO antibody-His and ⁇ xHis antigens (100 ng/well) using a coating buffer at 4 ° C for 16 hours, followed by blocking with skim milk dissolved in PBS (4%) . Each well of the 96-well immuno- plate was washed with 0.2 ml of PBS-tween20 (0.05%) . 100 ⁇ Jt of the 1st - 3rd panning poly scFV-phage was added into each well, followed by reaction at room temperature for 2 hours.
- 100-200 ⁇ i of the solution was incubated in 1 mi of a medium supplemented with 2xYTCM, 5 mM MgCl 2 , and 1 mM IPTG, which was loaded in a 96-deep well plate at 37 °C for 2-3 hours, followed by inoculation at an initial OD 60O value of 0.1.
- the cultured cells were centrifuged (4500 rpm, 15 itiin, 4°C) and a supernatant was obtained, to which 4% PEG 6000 and 3% NaCl were added. Upon completion of dissolving, reaction was induced in ice for 1 hour. The reactant was centrifuged (8000 rpm, 20 min, 4 ° C) and pellet was dissolved in PBS. Centrifugation (12000 rpm, 10 min, 4°C) was performed again and a supernatant was obtained, from which the 3rd panning monoclonal scFv phage was obtained. The phage was transferred to a new tube and stored at 4°C. A 96-well immuno-plate was coated with the two antigens
- CTAGATAACGAGGGCAAATCATG-3 ' CTAGATAACGAGGGCAAATCATG-3 '
- reverse primer cla3, SEQ. ID.
- the colony PCR product was identified on a 1% agarose gel (Seakem LE, CAMERES 50004). 0.2 ⁇ i of fistNI
- the fragmented product was identified on an 8% DNA polyacryl amide gel .
- a supernatant of the monoclonal C2 phage antibody selected in Example 5 was diluted at 1:50 in skim milk dissolved in TBST, followed by reaction at room temperature for 1 and a half hours. The dilution was washed five times with TBST, each of anti-mouse IgG-HRP (Sigma) and anti-Ml3-HRP (Amersham bioscience) was used for dilution at 1:1000 in skim milk in TBST (4%), followed by reaction at room temperature for 30 minutes. Then, it was washed by the same manner. After washing, developments were performed (Intron, Cat. No. 12145) to compare amounts of antigen proteins which could be detected by a commercially available antibody and a monoclonal phage antibody.
- C2 phage antibodies of the present invention was used to detect about 48 KDa of antigen protein clearly at a similar level to that of a commercially available antibody.
- Phage FACS analysis Ovarian cancer cell line (SKOV3, 2774; ATCC) and colorectal cancer cell line were washed twice with PBS in a 100 mm plate.
- Am enzyme-free PBS-based lysis buffer (Gibco) was added into the plate, followed by incubation at 37 ° C for 10 minutes. Subsequently, cells were collected by a scrapper and centrifuged at 1300 rpm for 3 minutes. The pellet was washed twice with a 2% PBF solution (lXPBS supplemented with 2% FBS) , followed by resuspension with 2% PBF solution at a concentration of ⁇ 5 X 10 5 cells.
- 100 fd of the monoclonal phage antibody of the present invention was concentrated 10 times by PEG, followed by dilution at 1:2. The dilution was mixed and stirred with the cells. The mixture was reacted in ice for 1 hour, followed by centrifugation at 1300 rpm at 4 ° C for 3 minutes to remove a supernatant. The precipitate was washed three times with 200 ⁇ l of a 2% PBF solution. 100 ⁇ l of anti-g8p antibody (Abeam) diluted at 1:200 in a 2% PBF solution was mixed and stirred with the resulting solution, followed by reaction in ice for 30 minutes.
- Abeam anti-g8p antibody
- the reactant was centrifuged at 1300 rpm at 4 ° C for 3 minutes for removal of a supernatant, followed by washing three times with 200 ⁇ l of a 2% PBF solution.
- 100 ⁇ i of FITC-linked anti-mouse IgG diluted at 1:1000 in a 2% PBF solution was mixed with each specimen, followed by reaction in ice for 30 minutes. After a washing was additionally performed, 500 ⁇ X of a 2% PBF solution was added into it. The mixture was transferred to a tube for FACS (Falcon) and vortexed, followed by analysis of stained cells by flow cytometer (Beckman Coulter) .
- pNATAB L vector (FIG. lib) was used by the same manner to extract a DNA of the light chain. Sequencing of the obtained DNA was performed by using a CMV-proF primer (SEQ ID No. 62: AAA TGG GCG GTA GGC GTG) (Solgent) .
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention relates to an alpha-endolase (ENO1) -specific human antibody, and more particularly to a human antibody including a complementarity determining region (CDR) and a framework region (FR) derived from a human antibody specifically bound to ENO1. The ENO1-specific human antibody expressed in the various kinds of cancer cells of the present invention may be used in diagnosis of the cancer, classification of the disease, visualization, treatment, and prognostic evaluation.
Description
[DESCRIPTION]
[invention Title]
ENOl-SPECIFIC HUMANANTIBODY
[Technical Field]
The present disclosure relates to a alpha-endolase (ENOl) -specific human antibody.
[Background Art] It is known that enolase has α , β , and Y homologues . α - enolase is present in most tissues, but particularly predominant in early embryonic tissues. The α -enolase (or ENOl) and MBP-I (c-myc binding protein) are derived from single genes by alternative use in translational starting sites.
ENOl is a cytoplasmic glycolytic enzyme which is significant in formation of phosphoenolpyruvate. It has been reported that ENOl, a major enzyme in glycolysis, is overexpressed in 18 kinds of cancer cells (Altenberg B, Greulich KO. enomics 84:1014-1020, 2004). The immunogenicity of ENOl in cancer cells is identified by Western blot and ELISA using recombinant proteins (Ping H et al., Can Sci. 98:1234-1240, 2007). In addition, it is confirmed by immunohistochemical staining (IHC staining) that ENOl is overexpressed in tumor tissues of non-small cell lung cancer
(NSCLC) patients, and by FACS that ENOl is expressed on the surface of lung cancer cells. It is expected that as the expression of ENOl is enhanced on the surface of cancer cells, autoantibody reaction is induced as a result of autoantigenicity. As a reaction to up-regulation of ENOl expression, the fibrinolytic system process is significantly accelerated. The resulting increase in local fibrinolysis is considered to contribute to invasion and metastasis of cancer cells. In the case of NSCLC patients, the results are identical in the fact that patients with Ul/TV stage cancer tend to have more autoantibody dominance in autoantibody against ENOl than those with I/II stage cancer. However, because the expression level of ENOl in patients without autoantibody is also increased, ENOl expression itself is not sufficient for autoantibody production. Thus, studies on more specific mechanisms associated with autoantibody reaction are needed.
Thus, the present inventors have selected 6 kinds of human antibodies specifically bound to ENOl expressing on the surface of various kinds of cancer cell lines, confirmed that the human antibody has binding capacity similar to those of the conventional nonhuman-derived antibodies and that the human antibody of the present invention may be useful for diagnosis, prevention, and treatment of cancers, and have made the present invention.
[Disclosure] [Technical Problem]
One object of the present invention is to provide an ENOl-specific human antibody.
Another object of the present invention is to provide a polynucleotide encoding a heavy chain of the human antibody or a fragment thereof, and an expression vector including the polynucleotide and a constant region of human heavy chain. Still another object of the present invention is to provide a polynucleotide encoding a light chain of the human antibody or a fragment thereof, and an expression vector including the polynucleotide and a constant region of human light chain. Even another object of the present invention is to provide a transformant prepared by introducing an expression vector including a polynucleotide encoding the heavy chain of the human antibody or an immunologically active fragment thereof into a host cell . Yet another object of the present invention is to provide a transformant prepared by introducing an expression vector including a polynucleotide encoding the light chain of the human antibody or an immunologically active fragment thereof into a host cell. Further another object of the present invention is to
provide a transformant prepared by introducing an expression vector including a polynucleotide encoding the heavy chain of the human antibody or a fragment thereof and an expression vector including a polynucleotide encoding the light chain or a fragment thereof simultaneously into a host cell .
Still further another object of the present invention is to provide a method for preparing an ENOl-specific human antibody by incubating the transformant.
The present invention also provides a composition including the human antibody.
The present invention also provides a pharmaceutical composition including the human antibody as an effective ingredient .
Another object of the present invention is to provide a method for treating an ENOl-overexpressed cancer, the method including administering a pharmaceutically effective amount of the human antibody to a subject with the ENOl-overexpressed cancer.
Still another object of the present invention is to provide a composition including the human antibody, light or heavy chain of the human antibody or an immunologically active fragment thereof, and a radioactive isotope.
Even another object of the present invention is to provide an immunodetection method for detecting an ex vivo ENOl-overexpressed cancer, including contacting the
composition for detection of the cancer with a cancer cell .
Yet another object of the present invention is to provide a method for imaging an in vivo ENOl-overexpressed cancer, including administering a diagnostically effective amount of the composition for detection of the cancer to a subject.
Further another object of the present invention is to provide a method for treating an in vivo ENOl-overexpressed cancer using the composition for detection.
Still further another object of the present invention is to provide a method for prognostic evaluation of a cancer treatment using the composition for detection. [Technical Solution]
To achieve the objects, the present invention provides an
ENOl-specific human antibody including a heavy chain including a heavy chain variable region (vH) including a heavy chain complementarity determining region (hereinafter, HCDR) 1 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 7 to 12, HCDR 2 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 13 to 18, and HCDR 3 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 19 to 24, or a fragment thereof; and a light chain including a light chain variable region
(VL) including a light chain complementarity determining region (hereinafter, LCDR) 1 having an amino acid sequence
selected from the group consisting of SEQ ID Nos. 31 to 36, LCDR 2 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 37 to 42, and LCDR 3 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 43 to 48, or a fragment thereof.
The present invention also provides a polynucleotide encoding a heavy chain of the human antibody or an immunologically active fragment thereof, and an expression vector including the polynucleotide. The present invention also provides a polynucleotide encoding a light chain of the human antibody or an immunologically active fragment thereof, and an expression vector including the polynucleotide.
The present invention also provides a transformant prepared by introducing an expression vector including a polynucleotide encoding a heavy chain of the human antibody or an immunologically active fragment thereof into a host cell.
The present invention also provides a transformant prepared by introducing an expression vector including a polynucleotide encoding a light chain of the human antibody or an immunologically active fragment thereof into a host cell .
The present invention also provides a transformant prepared by introducing an expression vector including a polynucleotide encoding a heavy chain of the human antibody or an immunologically active fragment thereof and an expression
vector including a polynucleotide encoding a light chain of the human antibody or an immunologically active fragment thereof simultaneously into a host cell.
The present invention also provides a method for preparing an ENOl-specific human antibody by incubating the transformant .
The present ■ invention also provides a composition including the human antibody.
The present invention also provides a pharmaceutical composition including the human antibody.
The present invention also provides a method for treating an ENOl-overexpressed cancer, including administering a pharmaceutically effective amount of the human antibody to a subject with the cancer. The present invention also provides a composition including the human antibody, a light or heavy chain of the human antibody or an immnunologically active fragment thereof, and a radioactive isotope.
The present invention also provides an immunodetection method for detecting an ex vivo ENOl-overexpressed cancer, including contacting a composition for detection of the cancer with a cancer cell .
The present invention also provides a method for imaging an in vivo ENOl-overexpressed cancer, the method including: 1) administering a diagnostically effective amount of a
composition for detection of the cancer to a subject; and 2) obtaining a detection image for the subject. The present invention also provides a method for treating an in vivo ENOl-overexpressed cancer, the method including: 1) intravenously administering a composition including the radioactive isotope to a subject;
2) detecting the composition of Step 1) to identify tumor cells; and
3) eliminating the tumor cells identified in Step 2) by surgical operation.
The present invention also provides a method for prognostic evaluation of a cancer patient, the method including:
1) intravenously administering a composition including the radioactive isotope to a patient whose tumor has been eliminated;
2) detecting the composition of Step 1) to identify tumor cells; and
3) judging that all tumor cells have been eliminated when tumor cells are not detected in step 2) .
[Advantageous Effect]
The ENOl-specific human antibody expressed in various kinds of cancer cells of the present invention may be used in diagnosis of the cancers, classification of the diseases,
visualization, treatment, and prognostic evaluation.
[Description of Drawings]
The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which:
FIG. 1 is a group of photos illustrating results that ENOl genes are expressed in various cancer cell lines. FIG. 2 is a group of photos illustrating results confirming that ENOl proteins are expressed on the surface of SK0V3 (ovarian adenocarcinoma) .
FIG. 3 is a group of photos illustrating results identifying induction conditions of transformant cells for ENOl expression according to IPTG concentration and processing time at 37 °C and 28°C: a: ENOl expression according to IPTG processing time at
37°C and 28°C ; b: ENOl expression according to IPTG concentration and processing time at 37°C ; c: ENOl expression according to IPTG concentration and processing time at 28°C; and, d: ENOl expression when IPTG is treated at a concentration of 0.5 mM at 37°C and 28°C for 4 hours. FIG. 4 is a group of photos illustrating results of
purifying ENOl induced at 20°C and 28°C: a: ENOl expression at 20°C according to IPTG concentration; and, b: ENOl expression at 28°C according to IPTG concentration.
FIG. 5 is a graph illustrating results of phage screening in 1st to 3rd pannings.
FIG. 6 is a photo illustrating results of diversity of 6 monoclonal phage antibodies against ENOl, identified by fingerprinting:
FIG. 7 is a list of sequences illustrating analysis results of polypeptides used in heavy chain and light chain CDR3 of 6 monoclonal phage antibodies against ENOl : a: heavy chain; and b: light chain.
FIG. 8 is a photo illustrating a result comparing binding specificities of commercial ENOl antibody and phage antibody of the present invention.
FIG. 9 is a photo illustrating results, confirming that the C2 phage antibody of the present invention is specifically bound to various cancer cell lines:
A: SK0V3 (ovarian adenocarcinoma) ;
B: Colo205 (colon adenocarcinoma) ;
C: 2774 (ovary serous cystadenocarcinoma) ; a: α -ENOl (SantaCruz) and normal mouse IgG (red color)
as a negative control group; and, b: C2 phage antibody of the present invention and single phage as a negative control group.
FIG. 10 is a photo illustrating results, confirming that ENO1-C2 and ENO1-B8 are converted into whole IgG forms.
FIG. 11 is a group of cleavage maps of pNATAB H vector and pNATAB L vector: a: pNATAB H vector; and b: pNATAB L vector.
[Best Mode]
Features and advantages of the present invention will be more clearly understood by the following detailed description of the present preferred embodiments by reference to the accompanying drawings. It is first noted that terms or words used herein should be construed as meanings or concepts corresponding with the technical sprit of the present invention, based on the principle that the inventor can appropriately define the concepts of the terms to best describe his own invention. Also, it should be understood that detailed descriptions of well-known functions and structures related to the present invention will be omitted so as not to unnecessarily obscure the important point of the present invention. Hereinafter, the terms of the present invention will be
described.
"Variable region" means a region of an antibody molecule which specifically binds to an antigen and demonstrates modifications in sequence, which is exemplified by CDRl, CDR2, and CDR3. Between the CDRs, there is a framework region (FR) which supports the CDR loop.
"Complementarity determining region" is a loop-shaped site involved in antigen recognition, and specificity of an antibody against antigen depends on modification in that site. "Panning" refers to a process of selecting only a phage expressing a peptide which binds to a target molecule (antibody, enzyme, cell-surface receptor, etc.) on the coat of the phage from a phage library displaying the peptide on the coat. Hereinafter, the present invention will be described in detail .
The present invention provides an ENOl-specific human antibody including: a heavy chain including a heavy chain variable region (VH) including a heavy chain complementarity determining region (hereinafter, HCDR) 1 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 7 to 12 , HCDR 2 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 13 to 18, and HCDR 3 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 19 to 24, or a fragment thereof; and
a light chain including a light chain variable region (VL) including a light chain complementarity determining region (hereinafter, LCDR) 1 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 31 to 36, LCDR 2 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 37 to 42, and LCDR 3 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 43 to 48, or a fragment thereof.
Preferably, the heavy chain variable region has an amino acid sequence selected from the group consisting of SEQ ID Nos. 25 to 30, and the light chain variable region has an amino acid sequence selected from the group consisting of SEQ ID Nos. 49 to 54.
The antibody includes not only a whole antibody, but also a functional fragment of the antibody molecule. The whole antibody has a structure with two full-length light chains and two full-length heavy chains, and each light chain is linked to heavy chain by disulfide bond. The functional fragment of an antibody molecule indicates a fragment retaining a antigen- binding function, and examples of the antibody fragment include (i) Fab fragment consisting of light chain variable region (VL) , heavy chain variable region (VH) , light chain constant region (CL) , and heavy chain 1st constant region (CHi) ; (ii) Fd fragment consisting of VH and CHi domains; (iii) Fv fragment consisting of VL and VH domains of a monoclonal
antibody; (iv) dAb fragment consisting of VH domain (Ward ES et al., Nature 341:544-546 (1989)); (v) separated CDR region; (vi) F(ab')2 fragment including two linked Fab fragments, as a divalent fragment; (vii) single chain Fv molecule (scFv) in which VH and VL domains are linked by a peptide linker to form an antigen binding site; (viii) bi-specific single chain Fv dimmer (PCT/US92/09965) , and (ix) multivalent or multi- specific diabody fragment (WO94/13804) prepared by gene fusion. In the present invention, a human antibody against ENOl was obtained as scFV by using phage display technology and screened as a mono phage clone. As a result, 6 kinds of ENOl- specific monoclonal phages were obtained.
In a specific example of the present invention, because ENOl whose gene is confirmed to be expressed in various cancer cell lines the activity (see FIG. 1) is usually expressed on the surface of cancer cell lines (see FIG. 2) , it is available as a target protein of various cancers. The ENOl expressed and purified through recombinant technology (see FIGs. 3 and 4) was reacted with a library phage constructed from human naive scFV library cells having diversity, followed by panning and screening of monoclones strongly binding to the ENOl antigen (see Tables 3 & 4 and FIG. 5) . The selected monoclones were identified by fingerprinting (see FIG. 6) , followed by sequencing to identify CDR regions of VH and VL of
the antibody (see SEQ ID Nos. 7 to 54 in Table 7 and FIG. 7) . The I g BLAST program of NCBI ( //www.ncbi .nlm.nih.gov/igblast/) was used for identification of similarity between the antibody and a germ line antibody group (see Table 8) . The heavy chain exhibited a homology of 84% to 96% with the sequence of human germ cell line while the light chain exhibited a homology of 86% to 96%. 4 kinds of VH5-51 and each kind of VH3-9 and VH3-30 were included as a heavy chain, while 5 kinds of lambda and one kind of kappa chain were included as a light chain. Analysis showed that polypeptides of each of human heavy and light chains were different, respectively. It was confirmed that the selected monoclonal antibodies could detect antigen proteins clearly at a similar level to that of a commercially available non-human antibodies (see FIG. 8) , and that the antibodies were specifically bound to ENOl in various cancer cells (see FIG. 9) .
The present invention also provides a polynucleotide encoding a heavy chain of the human antibody or an immunologically active fragment thereof, and an expression vector including the polynucleotide.
The present invention also provides a polynucleotide encoding a light chain of the human antibody or an immunologically active fragment thereof, and an expression vector including the polynucleotide.
In a specific embodiment of the present invention, ENOl expressed on the surface of various cancer cell lines (see FIG. 1 and I)1 and expressed and purified through recombinant technology was reacted with a library phage constructed from human naive scFV library cells having diversity, followed by panning and screening of monoclones strongly binding to the ENOl antigen (see Tables 3 & 4 and FIG. 5) . The selected monoclones were identified by fingerprinting (see FIG. 6) , followed by sequencing to identify CDR regions of VH and VL of the antibody (see SEQ ID Nos. 7 to 54 in Table 7 and FIG. 7) . 4 kinds of VH5-51 and each kind of VH3-9 and VH3-30 were included as a heavy chain, while 5 kinds of lambda and one kind of kappa chain were included as a light chain. Analysis showed that polypeptides of each of human heavy and light chains were different, respectively. It was confirmed that the selected monoclonal antibodies could detect antigen proteins clearly at a similar level to that of a commercially available non-human antibodies (see FIG. 8) , and that the antibodies were specifically bound to ENOl in various cancer cells (see FIG. 9) .
In the polynucleotide encoding a light and heavy chain of the human antibody of the present invention or a fragment thereof, due to degeneracy of the codon or in consideration of a preferred codon in an organism where light and heavy chains of the human antibody or a fragment thereof are to be
expressed, various modifications may be made in a coding region within a scope that the amino acid sequences of light and heavy chains or a fragment thereof are not changed, and various changes or modifications may be made even in portions other than the coding region within a scope that the gene expression is not affected. It will be appreciated by those skilled in the art that these modified genes are also included within the scope of the present invention. That is, one or more nucleotides may be modified by substitution, deletion, insertion, or a combination thereof as long as the polynucleotide of the present invention encodes a protein with an equivalent activity thereof, and they are also included in the present invention. The sequence of the polynucleotide may be a single or double chain, and a DNA or RNA (mRNA) molecule. In preparation of the expression vector, an expression control sequence such as a promoter, a terminator, an enhancer, etc., a sequence for membrane targeting or secretion, etc. may be appropriately selected according to a kind of host cell in which light and heavy chains of the human antibody or a fragment thereof are to be produced, and may be variously combined according to its purpose.
The expression vector of the present invention includes, but is not limited to, a plasmid vector, a cosmid vector, a bacteriophage, and a viral vector. A suitable expression vector may include expression regulatory elements such as a
promoter, an operator, an initiation codon, a stop codon, a polyadenylation signal, and an enhancer and a signal sequence or leader sequence for membrane targeting or secretion, and may be variously prepared according to its purpose. A promoter of the expression vector may be constitutive or inductive. Examples of the signal sequence for use may include, but is not limited to, a PhoA signal sequence and an QmpA signal sequence for genus Escherichia hosts; an α-amylase signal sequence and a subtilicin signal sequence for genus Bacillus hosts; an MFa signal sequence and an SUC2 signal sequence for yeast hosts; and an insulin signal sequence, an α-interferon signal sequence, and an antibody molecule signal sequence for animal cell hosts. In addition, the expression vector may include a selection marker for selecting host cells containing the vector, and a replication origin when it is a replicable expression vector.
The present invention also provides a transformant prepared by introducing an expression vector including a polynucleotide encoding a heavy chain of the human antibody or an immunologically active fragment thereof into a host cell.
The present invention also provides a transformant prepared by introducing an expression vector including a polynucleotide encoding a light chain of the human antibody or an immunologically active fragment thereof into a host cell. The present invention also provides a transformant
prepared by introducing an expression vector including a polynucleotide encoding a heavy chain of the human antibody or a fragment thereof and an expression vector including a polynucleotide encoding a light chain of the human antibody or a fragment thereof simultaneously into a host cell.
In a specific example of the present invention, genes encoding light and heavy chains of a monoclonal phage were obtained and linked to a vector, respectively, and then the expression vectors were simultaneously introduced into a host cell to prepare a whole human IgG antibody for in vivo diagnosis and treatment of cancers.
The expression vector according to the present invention may be transformed into a suitable host cell, for example, E. coli or yeast cell, and the transformed host cell may be incubated to produce light and heavy chains of the human antibody of the present invention or a fragment thereof in mass quantities. Incubation methods and media conditions suitable for a kind of host cell may be easily chosen from those known to those skilled in the art. The host cell may be a prokaryote such as E. coli or Bacillus subtilis. In addition, it may be a eukaryotic cell derived from a yeast such as Saccharomyces cerevisiae, an insect cell, a vegetable cell, and an animal cell. More preferably, the animal cell may be an autologous or allogeneic animal cell. A transformant prepared through introduction into an autologous
or allogeneic animal cell may be administered to a subject for use in cellular therapy for cancer. As for a method for introducing an expression vector into the host cell, it is possible to use any method if it is known, to those skilled in the art.
The present invention also provides a method for preparing an ENOl-specific human antibody by incubating the transformant .
Specifically, the present invention provides a method for preparing an ENOl-specific human antibody, the method including:
1) incubating the transformant; and,
2) purifying the human antibody from the medium.
As for the culture medium, it is desirable to select and use a culture medium suitable for the transformant among those known to those skilled in the art. As for the method for purifying human antibodies, it is possible to use any method known to those skilled in the art.
The present invention also provides a composition including the human antibody.
The present invention also provides a pharmaceutical composition including the human antibody.
The pharmaceutical composition may be useful for prevention and treatment of an ENOl-overexpressed cancer. The ENOl-overexpressed cancer is preferably one selected from the
group consisting of, but not limited to, lung cancer, colorectal cancer, breast cancer, ovarian cancer, renal cell cancer, and prostate cancer, and includes all the ENOl- overexpressed cancers . The pharmaceutical composition of the present invention may selectively contain the ENOl-specific human antibody or the transformant, and may additionally contain one or more effective ingredients exhibiting functions identical or similar to those of the ingredient. For administration, the pharmaceutical composition of the present invention may be formulated by including one or more pharmaceutically acceptable carriers in addition to the effective ingredients described above. For example, the pharmaceutically acceptable carrier includes saline solution, sterilized water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, and at least one combination thereof, and other general additives such as antioxidants, buffer solution, bacteriostatic agents, etc. may be added if necessary. In addition, it may be formulated in the form of an injectable formulation such as aqueous solution, suspension, emulsion, etc. by additionally adding diluent, dispersing agent, surfactant, binder and lubricant, and antibodies and other ligands specific to a target cell may be used in combination with the carrier to be specifically reacted with the target cell. Furthermore, the
composition may be preferably formulated according to each disease or ingredient using a suitable method in the art or a method which is taught in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA. The pharmaceutical composition of the present invention may be parenterally administered, and the parenteral administration is effected by subcutaneous injection, intravenous injection, intramuscular injection, or intrapleural injection. For parenteral administration, the pharmaceutical composition of the present invention may be mixed with a stabilizer or buffer to prepare a solution or suspension, which may then be provided as ampoules or vials each containing a unit dosage form.
The pharmaceutical composition of the present invention may be prepared in various forms according to the route of administration. For example, the pharmaceutical composition of the present invention may be formulated to a sterilized aqueous solution or dispersion for injection, or may be prepared in a freeze-dried form through a freeze-drying technique. The freeze-dried pharmaceutical composition may be stored typically at about 4°C and may be reconstituted with a stabilizer that may contain an adjuvant such as saline solution and/or HEPE.
In a method of the present invention, factors affecting the amount of the pharmaceutical composition to be
administered include, but are not limited to, administration mode, administration frequency, specific disease under treatment, severity of disease, history of disease, whether the subject is under treatment in combination with other therapeutics, the subject's age, height, weight, health, and physical conditions. As the patient's weight under treatment increases, the pharmaceutical composition of the present invention may preferably be administered in increasing amounts . The present invention also provides a method for treating an ENOl-overexpressed cancer, the method including administering a pharmaceutically active amount of the human antibody to a subject with the cancer.
The subject applicable in the present invention is a vertebrate, preferably a mammal, more preferably an experimental animal such as mouse, rabbit, guinea pig, hamster, dog, and cat, and most preferably a primate such as chimpanzee and gorilla.
The method for administering the human antibody of the present invention may be conducted by parenteral administration (for example, intravenous, subcutaneous, intraperitoneal, or local administration) according to the purpose of use, and preferably by intravenous administration. In administration for solid cancer, local administration may be often preferable for rapid and facilitated access of the
antibody. The dose may vary depending on weight, age, sex, and health condition of a patient, diet, administration time, administration method, excretion rate, and severity of disease. The single dose is in the range of 5 to 500 mg/irf, which may be administered daily or weekly. The effective amount may be controlled at the discretion of a doctor treating the patient.
The human antibody of the present invention may be used alone or in combination with surgery, hormone therapy, chemical therapy, and a biological response controller for treatment of a patient.
The present invention also provides a composition including the human antibody, light and heavy chains of the human antibody, or an immunologically active fragment thereof, and a radioactive isotope.
The composition may be useful for radioimmuno treatment and detection of an ENOl-overexpressed cancer.
Examples of preferred radioactive isotopes include 3H, 11C, 14C, 18F, 64Cu, 76Br, 86Y, 99mTc, 111In, 123I, 177Lu, and a mixture or combination thereof. The radioactive isotope is characterized by the fact that it is bound to a human antibody and included in a carrier to which the human antibody is bound.
The present invention also provides an immunodetection method for detecting an ex vivo ENOl-overexpressed cancer, the
method including: contacting a composition including the radioactive isotope with cancer cells.
The composition for detection may be bound to a solid substrate in order to facilitate the subsequent steps such as washing or separation of complexes. The solid substrate includes, for example, synthetic resin, nitrocellulose, glass substrate, metal substrate, glass fiber, microsphere, microbead, etc. The synthetic resin includes polyester, polyvinyl chloride, polystyrene, polypropylene, PVDF, nylon, etc .
In addition, cancer cell may be appropriately diluted before it is contacted with the composition for detection.
The present invention also provides a method for imaging an ENOl-overexpressed cancer, the method including 1) administering a diagnostically effective amount of a compound including the radioactive isotope to a subject; and 2) obtaining a detection image for the subject. The detection image is characterized by the fact that it is obtained by near-infrared light imaging, PET, MRI, or ultrasonic imaging.
The present invention also provides a method for treating an in vivo ENOl-overexpressed cancer, the method including:
1) intravenously administering a composition including the radioactive isotope to a subject; 2) detecting the composition of Step 1) to identify tumor
cells; and
3) eliminating the tumor cells identified in Step 2) by surgical operation.
Furthermore, the present invention provides a method for prognostic evaluation of a cancer patient, the method including:
1) intravenously administering a composition including the radioactive isotope to a patient whose tumor has been eliminated; 2) detecting the composition of Step 1) to identify tumor cells; and
3) judging that all tumor cells have been eliminated when tumor cells are not detected in step 2) .
[Mode for Invention]
Hereinafter, the present invention will be described in more detail with reference to examples.
However, the following examples are provided for illustrative purposes only, and the scope of the present invention should not be limited thereto in any manner.
<Example 1> Identification of ENOl expression in various cancer cell lines through RT-PCR
QiagenEasyRNA kit (USA) was used in 15 kinds of different cancer cell lines in Table 1 to extract a total RNA, and each of 1 βg of Superscriptase II Reverse-Transcriptase
(Invitrogen, USA) as a total RNA was used respectively to synthesize a cDNA. The cDNA was diluted with sterilized distilled water to prepare a 2% cDNA, and then each of 10 pmole//^ of Taq DNA polymerase (Solgent, Korea) , forward primer (SEQ ID No. 1: 5'-GAATTGAAGAGGAGCTGGGC-S'), and reverse primer (SEQ ID No. 2: 5'-GTGTAGCCAACAGGTGACCG-S') was used to perform a PCR under conditions described in Table 2. GAPDH was used as gel loading control group.
Table 1
Table2
As a result, as shown in FIG. 1, it was confirmed that ENOl genes were expressed in various cancer cell lines. That is, ENOl may be used as a target protein for various cancers.
<Example 2> Investigation of ENOl expression location using immunofluorescence microscopy
IX PBS was used to prepare all the solutions. Coverglass was placed in a 6-well plate, and coating with 20% FBS was performed. Subsequently, SKOV3 ovarian cancer cell line with dominant EOl expression was incubated in the plate. After an incubation for 24 hours, the cell line was immobilized with 4% paraformaldehyde for 10 minutes, and membrane permeabilization was carried out with 0.05% Triton X- 100 for 5 minutes. The cell line was blocked with 3% normal goat serum (vector Lab. Inc, USA) , and then ENOl antibodies diluted at 1:50 in a dilution buffer (0.1% BSA, 0.05% Triton X-IOO) was used to stain the cell line for 1.5 hours, followed by washing three times with IX PBS. The secondary antibody (anti-mouse IgG-FITC, Vector Lab. Inc. FI-200, USA) diluted at 1:2500 in the dilution buffer was used to stain the cell line for 45 minutes, followed by washing three times with IX PBS.
The cell line was stained with DAPI (Glass-Slide) for 5 minutes and washed with PBS. The coverglass was transferred and mounted onto a Glass-Slide, and nail-polish was used for sealing. The reaction results were analyzed by a fluorescent microscope (MFI-4000, Leica) .
As a result, as shown in FIG. 2, it was confirmed that
ENOl was present in cytoplasm and cell membrane of SKOV3 cell line and expressed generally on the surface of cells, which is
identical to results confirmed in previous reports (Chang GC et al., Clin Cancer Res 2006; 12:574654; Satoshi Ito et al. , Cancer Sci. 2007, 98 (4): 499-505).
<Example 3> Preparation of ENOl antigen protein <3-l> ENOl gene cloning
A plasmid (IRAT-14-BO9) containing a human ENOl gene was provided from KUGI (Korean UniGene Information) of the Center for Functional Analysis of Human Genome in Korea Research Institute of Bioscience and Biotechnology. The plasmid was used as a template DNA. A forward primer (SEQ ID No. 3: CGCGGATCCTCTATTCTCAAGATCCATGC) and a reverse primer (SEQ ID No. 4: CCGCTCGAGCTTGGCCAAGGGGTTTCTGAA) were used to amplify the gene under the following conditions, followed by subcloning into a pET28A (Novagen 69864-3, USA) . PCR conditions are as follows: when a total reaction reagent was 50 μi, 100 ng of the template was introduced and a reaction at 94°C for 2 minutes, 30 cycles of reactions at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for a half minutes, and at a reaction at 72°C for 10 minutes were performed to get a PCR product. Furthermore, the base sequence of the subcloned vector was identified
<3-2> Expression and purification of ENOl protein The subcloned vector was transformed with BL21 (DE3), and then inducing conditions for protein expression were examined.
The vector was treated with IPTG at concentrations of 0.1, 0.5, and 1 iriM at 37 °C and 28°C and cells were collected at 1, 2, and 4 hours. Followed by adjusting the final O.D values, subsequently, the protein expression aspect in whole cell lysate was identified by SDS-PAGE.
As a result, as shown in FIG. 3, the expression was the most dominant when 0.5 mM of IPTG was treated at 28°C for 4 hours. However, the expression was quite favorable at 37°C without much fluctuation over according to time. In addition, a lot of insoluble proteins were observed, but soluble proteins were also expressed to some degree.
Because protein is stable at low temperatures, inducing conditions for protein expression were compared at decreased temperatures, 28"C and 20°C. Then, 0.5 mM IPTG was treated for 4 hours to incubate each of 300 mi of protein. A Ni-NTA column (Qiagen, USA) was used for the protein to be eluted and purified with 500 mM Imidazole, and then the purity of ENOl purified was identified by SDS-PAGE according to concentrations compared to BSA. As a result, as shown in FIG. 4, about 500 βg and 1 mg of the purified ENOl were obtained at 28°C and 20°C, respectively, and used in panning for antibody preparation. <Example 4> Construction of library phage 2.7 x 1010 human naive scFv library cells having diversity were incubated in a medium (3 L) containing 2XYTCM
[17 g of Tryptone (CONDA, 1612.00), 10 g of yeast extract (CONDA, 1702.00), 5 g of NaCl (Sigma, S7653-5 kg), 34 βg/wl of chloramphenicol (Sigma, C0857)], 2% glucose (Sigma, G5400) , and 5 mM MgCl2 (Sigma, M2393) at 37°C for 2-3 hours (00600=0.5-0.7) . Then, the cells were infected with helper phage, followed by incubation in a medium containing 2 xYTCMK [2 XYT CM, 70 βg/ml of Kanamycin (Sigma, K1876) , 1 mM IPTG (ELPISBIO, IPTG025)] at 30°C for 16 hours. The incubated cells were centrifuged (4500 rpm, 15 min, 4°C) to obtain a supernatant. The supernatant was treated with PEG (Fluka,
81253) and NaCl (Sigma, S7653) until the two reagents became
4% and 3%, respectively. The reactant was centrifuged again (8000 rpm, 20 min, 4°C). The pellet was dissolved in PBS, which proceeded to centrifugation again (12000 rpm, 10 min, 4°C) . As a result, the supernatant containing library phage was obtained, which was transferred to a new tube and stored at 4°C.
<Example 5> Preparation of monoclonal antibody <5-l> Panning process
An immunosorb tube (Nunc 470319) was coated with 30 βg of the purified ENOl-antigens (TMPS4-FLAG and TM-EK) obtained in
Example 3 using 4 mi of a coating buffer [1.59 g of Na2CO3
(Sigma, S7795) , 2.93 g of NaHCO3 (Sigma, S8875) , 0.2 g of NaN3 (Sigma, S2002)] at 4°C for 16 hours with rotator. Then, the
antigen was dissolved in PBS at room temperature for 2 hours, followed by blocking in the immunotube using skim milk
[ (BD, 232100) -4% in IXPBS]. 2 mi of library phage constructed in Example 4 was added into the immunotube, followed by reaction at room temperature for 2 hours. The immunotube was washed five times with PBST (0.05%) and twice with PBS. After washing, antigen specific scFV-phage was eluted using 100 mM TEA (Sigma T-0886) . E. coli (XLl-blue, stratagene, 200249) was transfected with the eluted phage, followed by amplification. The 2nd and 3rd pannings was performed on the phage amplified at the first panning by the same manner as described above except that washing times with PBST were increased (2nd: 13 times, 3rd: 23 times) .
As a result, as shown in Table 3, it was confirmed that colony titer of the phage against the antigen was increased at least 1000 times in the 3rd panning.
[Table 1]
<5-2-l> Identification of panning results
Cell stocks obtained from the lst-3rd pannings and stored as frozen were dissolved in a medium containing 5 mi of 2XYTCM, 2% glucose, and 5 mM MgCl2 to make OD60O as 0.1. Then, the cells were incubated at 37°C for 2-3 hours (OD600=O.5-0.7) , which were infected with Ml helper phage. Then, the cells were incubated in a medium containing 2XYTCMK, 5 mM MgCl2 and 1 mM IPTG at 30°C for 16 hours. At this point, a single phage antibody, which was specifically binding to WW45 antigen associated with a developmental process unrelated to VEGF and constructed by a method in Example of the present invention, was used as a control group. The incubated cells were centrifuged (4500 rpm, 15 min, 4°C), and the supernatant was transferred to a new tube (1st ~ 3rd panning poly scFv-phage) .
A 96-well immuno-plate (NUNC 439454) was coated with ENO antibody-His and βxHis antigens (100 ng/well) using a coating buffer at 4°C for 16 hours, followed by blocking with skim milk dissolved in PBS (4%) . Each well of the 96-well immuno- plate was washed with 0.2 ml of PBS-tween20 (0.05%) . 100 μJt of the 1st - 3rd panning poly scFV-phage was added into each well, followed by reaction at room temperature for 2 hours.
Again, each well was washed four times with 0.2 mi of PBS- tween20 (0.05%). The secondary antibody anti-Ml3-HRP (Amersham 27-9421-01) was diluted at 1:2000, followed by
reaction at room temperature for 1 hour. The reactant was washed with 0.2 mi of PBS-tween20 (0.05%). An OPD tablet
(Sigma 8787-TAB) was added into a PC buffer [5.1 g of C6H8O7H2O
(Sigma, C0706) , 7.3 g of Na2HPO4 (Sigma, S7907) ] to make a substrate solution, which was added into each well by 100 μβ/well, followed by color development for 10 minutes. The optical density was measured at 490 ran by using a spectrophotometer (MolecularDevice, USA) .
As a result, as shown in Figure 5, it was confirmed that binding capacities to ENOl antigen were increased from the 2nd pannings to reach a saturated state, and binding capacities to the antigen were enhanced in the 3rd panning.
<5-2-2> Selection of monoclonal antibodies Colonies obtained from a polyclonal antibody groups (the 2nd and 3rd pannings) having strong binding capaciies were incubated in a 96-deep well plate (Bioneer, 90030) containing 1 mi of a medium supplemented with 2XYTCM, 2% glucose and 5 itiM MgCl2 at 37°C for 16 hours. 100-200 μi of the solution was incubated in 1 mi of a medium supplemented with 2xYTCM, 5 mM MgCl2, and 1 mM IPTG, which was loaded in a 96-deep well plate at 37 °C for 2-3 hours, followed by inoculation at an initial OD60O value of 0.1. The cells were infected with Ml helper phage (MOI=I: 20) and the infected cells were cultured in a medium supplemented with 2XYTCMK, 5 mM MgCl2, and 1 mM IPTG at
30°C for 16 hours. The cultured cells were centrifuged (4500 rpm, 15 itiin, 4°C) and a supernatant was obtained, to which 4% PEG 6000 and 3% NaCl were added. Upon completion of dissolving, reaction was induced in ice for 1 hour. The reactant was centrifuged (8000 rpm, 20 min, 4°C) and pellet was dissolved in PBS. Centrifugation (12000 rpm, 10 min, 4°C) was performed again and a supernatant was obtained, from which the 3rd panning monoclonal scFv phage was obtained. The phage was transferred to a new tube and stored at 4°C. A 96-well immuno-plate was coated with the two antigens
(100 ng/well) at 4°C for 16 hours, followed by blocking with skim milk dissolved in PBS (4%) . Each well of the 96-well immuno-plate was washed with 0.2 ml of PBS-tween20 (0.05%). 100 μl of the 3rd panning monoclonal scFV-phage was added to each well, followed by reaction at room temperature for 2 hours. Each well was washed four times with 0.2 ml of PBS- tween20 (0.05%) . The secondary antibody anti-Ml3-HRP was diluted at 1:2000, followed by reaction at room temperature for 1 hour. The plate was washed with 0.2 ml of PBS-tween20 (0.05%), followed by color development. The optical density was measured at 490 nm.
As a result, as shown in Table 4, ELISA was performed on monoclones selected from the 2nd and 3rd polyphage pools to select 40 monoclonal phages having ENOl binding capacity values of 1.5 or more (highlighted in Table 4) .
<5-3-l> Verification by fingerprinting
1 μl of the fifty monoclonal cells firstly selected, 0.2 μi of Taq DNA polymerase (Gendocs, Korea) (5 U/ul) , 0.2 μi of each forward primer (pelB5, SEQ. ID. No. 5: 5'-
CTAGATAACGAGGGCAAATCATG-3 ' ) and reverse primer (cla3, SEQ. ID.
No. 6: 5'-CGTCACCAATGAAACCATC-S') at 50 p/μi, 3 μi of 1OX buffer, 0.6 μi of 10 mM dNTP mix, and 24.8 μl of distilled water were mixed to perform a colony PCR (iCycler iQ, BIO-
RAD) . PCR conditions are as shown in Table 5.
[Table 5]
The colony PCR product was identified on a 1% agarose gel (Seakem LE, CAMERES 50004). 0.2 μi of fistNI
(Rochell288075001, 10 υ/μi) was added to perform a reaction at
37 °C for 2-3 hours. Reaction conditions are as shown, in Table
6. The fragmented product was identified on an 8% DNA
polyacryl amide gel .
[Table 6]
As a result, as shown in Figure 6, fragments of monoclonal phage antibodies digested by BstNI were proved to have diversity.
<5-3-2> Verification by base sequence analysis 6 kinds of the monoclonal phages were incubated in a medium (5 ml) supplemented with 2XYTCM, 2% glucose, and 5 itiM MgCl2 at 37°C for 16 hours. A DNA purification kit (Nuclogen 5112) was used for the incubated monoclones to obtain a DNA, and then sequencing was performed by using a pelB5 primer of SEQ ID No. 125 (Solgent, Korea) . As a result, as shown in Table 7 and FIG. 7, CDR regions of VH and VL of the selected antibody were identified.
Similarity between the antibody and germ line antibody group was investigated by Ig BLAST program of NCBI
(//www.ncbi.nlm.nih.gov/igblast/) . As a result, 6 kinds of ENOl specific phage antibodies were obtained, and the result was summarized and presented in Table 8. In particular, The
heavy chain exhibited a homology of 84% to 96% with the sequence of human germ cell line while the light chain exhibited a homology of 86% to 96%. 4 kinds of VH5-51 and each kind of VH3-9 and VH3-30 were included as a heavy chain, while 5 kinds of lambda and one kind of kappa chain were included as a light chain. Analysis showed that polypeptides of each of human heavy and light chains were different, respectively.
[Table 7]
<Example 6> Analysis of characteristics of human antibody against ENOl <6-l> Western blot analysis of phage
Two sheets of 10% SDS-PAGE gel into which the antigen ENOl is loaded (200 and 400 ng/well) were electrophoresized at 100 V for 2 hours and transfered to NC membrane (Millipore Cat. No. HATFOOOlO) at 85 V for 2 hours, followed by blocking with skim milk dissolved in TBST (4%) at 4°C overnight. Subsequently, α -ENOl antibody (1 mg/m#; SC-100812) prepared from a commercially available mouse was diluted at 1:100 in skim milk dissolved in TBST. A supernatant of the monoclonal C2 phage antibody selected in Example 5 was diluted at 1:50 in skim milk dissolved in TBST, followed by reaction at room temperature for 1 and a half hours. The dilution was washed
five times with TBST, each of anti-mouse IgG-HRP (Sigma) and anti-Ml3-HRP (Amersham bioscience) was used for dilution at 1:1000 in skim milk in TBST (4%), followed by reaction at room temperature for 30 minutes. Then, it was washed by the same manner. After washing, developments were performed (Intron, Cat. No. 12145) to compare amounts of antigen proteins which could be detected by a commercially available antibody and a monoclonal phage antibody.
As a result, as shown in FIG. 8, C2 phage antibodies of the present invention was used to detect about 48 KDa of antigen protein clearly at a similar level to that of a commercially available antibody.
<6-2> Phage FACS analysis Ovarian cancer cell line (SKOV3, 2774; ATCC) and colorectal cancer cell line were washed twice with PBS in a 100 mm plate. Am enzyme-free PBS-based lysis buffer (Gibco) was added into the plate, followed by incubation at 37 °C for 10 minutes. Subsequently, cells were collected by a scrapper and centrifuged at 1300 rpm for 3 minutes. The pellet was washed twice with a 2% PBF solution (lXPBS supplemented with 2% FBS) , followed by resuspension with 2% PBF solution at a concentration of ≥ 5 X 105 cells. 100 fd of the monoclonal phage antibody of the present invention was concentrated 10 times by PEG, followed by dilution at 1:2. The dilution was
mixed and stirred with the cells. The mixture was reacted in ice for 1 hour, followed by centrifugation at 1300 rpm at 4°C for 3 minutes to remove a supernatant. The precipitate was washed three times with 200 μl of a 2% PBF solution. 100 μl of anti-g8p antibody (Abeam) diluted at 1:200 in a 2% PBF solution was mixed and stirred with the resulting solution, followed by reaction in ice for 30 minutes. The reactant was centrifuged at 1300 rpm at 4°C for 3 minutes for removal of a supernatant, followed by washing three times with 200 μl of a 2% PBF solution. 100 μi of FITC-linked anti-mouse IgG diluted at 1:1000 in a 2% PBF solution was mixed with each specimen, followed by reaction in ice for 30 minutes. After a washing was additionally performed, 500 μX of a 2% PBF solution was added into it. The mixture was transferred to a tube for FACS (Falcon) and vortexed, followed by analysis of stained cells by flow cytometer (Beckman Coulter) . In each experiment, monoclonal phage antibodies were treated with a specimen under the same conditions and used as an internal control group. WINMDI2.9 software (//facs.scripps.edu/software.html, The Scripps Research Institute) was used to analyze the data.
As a result, as shown in FIG. 9, it was confirmed that C2 phage antibodies of the present invention specifically bound to ENOl in various cancer cells like commercially available antibodies .
<6-3> Analysis of whole IgG conversion
To covert monoclonal phage antibodies against ENOl into whole IgG vectors in phages, 1 βi of monoclonal DNA, 10 pmole/μβ of each of heavy chain forward primer and reverse primer in Table 8, 5 μl of 1OX buffer, 1 μl of 10 mM dNTP mix, 0.5 μl of pfu DNA polymerase (Solgent, 2.5 XJ/βl) , and distilled water were mixed to perform a colony PCR (iCycler iQ, BIO- RAD) . In addition, light chain forward and reverse primers in Table 9 were used to perform a colony PCR by the same manner.
[Table 9]
After a heavy chain gene obtained through PCR was purified with DNA-gel extraction kit (Qiagen) , 1 μl of pNATAB H vector (FIG. Ha) (10 ng), 15 /(I of heavy chain (100-200
ng), 2 μi of 1OX buffer, 1 μi of ligase (1 \J/βi) , and distilled water were mixed with the gene and left still at room temperature for 1-2 hours for linkage to the vector. The vector was left still in ice for 30 minutes along with a cell for transformation (XLl-blue), followed by heat shock at 42 °C for 90 sec for transfection. It was again left still in ice for 5 minutes and 1 vd of LB medium was injected, followed by incubation at 37°C for 1 hour. The mixture was smeared in LB Amp solid medium, followed by incubation at 37°C for 16 hours. Single colony was inoculated into 5 VΆI of LB Amp liquid medium, followed by incubation at 37 °C for 16 hours. A DNA- prep kit (Nuclogen) was used for the medium to extract a DNA.
In addition, pNATAB L vector (FIG. lib) was used by the same manner to extract a DNA of the light chain. Sequencing of the obtained DNA was performed by using a CMV-proF primer (SEQ ID No. 62: AAA TGG GCG GTA GGC GTG) (Solgent) .
As a result, it was confirmed that the sequences of heavy and light chains of the 2 clone phages against ENOl converted into whole IgG were identical to those of the phage antibodies .
<6-4> Verification of whole IgG
40 βg of PEI (Cat# 23966, Polysciences, Inc) and 10 βg of each antibody heavy chain DNA and light chain DNA in the whole
form were added into 293E cells (Invitrogen) for co- transfection to obtain a supernatant, which was identified by Western blot. Normal human IgG (Jackson Lab) was used as a control group. As a result, as shown in FIG. 10, it was confirmed that ENO1-C2 and ENO1-B8 were successfully converted into whole IgG form compared to a control group.
Although the preferred embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the invention as disclosed in the accompanying claims .
Claims
[CLAIMS] [Claim 1]
AN ENOl-specific human antibody comprising a heavy chain comprising a heavy chain variable region (VH) comprising a heavy chain complementarity determining region (HCDR) 1 having an amino acid sequence selected from the group consisting of SEQ ID Nos . 7 to 12 , HCDR 2 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 13 to 18, and HCDR 3 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 19 to 24, or a fragment thereof; and a light chain comprising a light chain variable region (VL) comprising a light chain complementarity determining region (LCDR) 1 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 31 to 36, LCDR 2 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 37 to 42, and LCDR 3 having an amino acid sequence selected from the group consisting of SEQ ID Nos. 43 to 48, or a fragment thereof.
[Claim 2]
The human antibody as set forth in claim 1, wherein the heavy chain variable region has an amino acid sequence selected from the group consisting of SEQ ID Nos. 25 to 30.
[Claim 3]
The human antibody as set forth in claim 1, wherein the light chain variable region has an amino acid sequence selected from the group consisting of SEQ ID Nos. 49 to 54.
[Claim 4]
A polynucleotide encoding a heavy chain of the human antibody of claim 1 or an immunologically active fragment thereof .
[Claim 5]
A polynucleotide encoding a light chain of the human antibody of claim 1 or an immunologically active fragment thereof .
[Claim 6]
An expression vector comprising the polynucleotide of claim 4.
[Claim 7]
An expression vector comprising the polynucleotide of claim 5.
[Claim 8] A transformant prepared by introducing the expression vector of claim 6 into a host cell .
[Claim 9]
A transformant prepared, by introducing the expression vector of claim 7 into a host cell .
[Claim 10]
A transformant prepared by introducing the expression vectors of claims 6 and 7 simultaneously into a host cell .
[Claim 11]
A method for preparing an ENOl-specific human antibody, the method comprising:
1) incubating the transformant of claim 10; and
2) purifying the human antibody of claim 1 from the medium.
[Claim 12]
A composition comprising the human antibody of claim 1.
[Claim 13]
A pharmaceutical composition comprising the human antibody of claim 1.
[Claim 14] The pharmaceutical composition as set forth in claim 13, wherein the pharmaceutical composition is used to prevent or treat an ENOl-overexpressed cancer.
[Claim 15] The pharmaceutical composition as set forth in claim 14, wherein the ENOl-overexpressed cancer is selected from the group consisting of lung cancer, colorectal cancer, breast cancer, ovarian cancer, renal cell cancer, and prostate cancer.
[Claim 16]
The pharmaceutical composition as set forth in claim 13, wherein the pharmaceutical composition is administered in combination with chemotherapy.
[Claim 17]
A method for treating an ENOl-overexpressed cancer, the method comprising administering a pharmaceutically effective amount of the human antibody of claim 1 to a subject with the cancer.
[Claim 18]
The method as set forth in claim 17, wherein the ENOl- overexpressed cancer is selected from the group consisting of lung cancer, colorectal cancer, breast cancer, ovarian cancer, renal cell cancer, and prostate cancer.
[Claim 19]
A composition comprising the human antibody of claim 1, a light or heavy chain of the human antibody or an immunologically active fragment thereof, and a radioactive isotope.
[Claim 20]
The composition as set forth in claim 19, wherein the composition is used for radioimmuno treatment or detection of an ENOl-overexpressed cancer.
[Claim 21]
The composition as set forth in claim 20, wherein the ENOl-overexpressed cancer is selected from the group consisting of lung cancer, colorectal cancer, breast cancer, ovarian cancer, renal cell cancer, and prostate cancer.
[Claim 22] The composition as set forth in claim 19, wherein the radioactive isotope is selected from the group consisting of 3H, 11C, 14C, 18F, 64Cu, 76Br, 86Y, 99mTc, 111In, 123I, 177Lu, and a mixture or combination thereof .
[Claim 23]
The composition as set forth in any one of claims 19 to 22, wherein the radioactive isotope is bound to a human antibody or included in a carrier to which the human antibody is bound.
[Claim 24]
An immunodetection method for detecting an ex vivo ENOl- overexpressed cancer, the method comprising contacting the composition of claim 19 with a cancer cell .
[Claim 25]
A method for imaging an in vivo ENOl-overexpressed cancer, the method comprising: 1) administering a diagnostically effective amount of the composition of claim 19 to a subject; and
2) obtaining a detection image for the subject.
[Claim 26] The method as set forth in claim 25, wherein the detection image is obtained by near-infrared light imaging, PET, MRI, or ultrasonic imaging.
[Claim 27]
A method for treating an in vivo ENOl-overexpressed cancer, the method comprising:
1) intravenously administering a composition for detection of claim 19 to a subject;
2) detecting the composition of Step 1) to identify tumor cells; and
3) eliminating the tumor cells identified in Step 2) by surgical operation.
[Claim 28]
A method for prognostic evaluation of a cancer patient, the method comprising:
1) intravenously administering a composition of claim 19 to a patient whose tumor has been eliminated;
2) detecting the composition of Step 1) to identify tumor cells; and
3) judging that all tumor cells have been eliminated when tumor cells are not detected in step 2) .
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020080092736A KR100910962B1 (en) | 2008-09-22 | 2008-09-22 | ENO1-specific human antibodies |
| KR10-2008-0092736 | 2008-09-22 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2010032899A2 true WO2010032899A2 (en) | 2010-03-25 |
| WO2010032899A3 WO2010032899A3 (en) | 2010-07-15 |
Family
ID=41209526
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2008/006116 Ceased WO2010032899A2 (en) | 2008-09-22 | 2008-10-16 | Eno1-specific human antibody |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR100910962B1 (en) |
| WO (1) | WO2010032899A2 (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110182907A1 (en) * | 2010-01-28 | 2011-07-28 | Taipei Medical University | Anti-alpha-Enolase I Antibodies for Diagnosis and Treatment of alpha-Enolase I-Associated Diseases |
| WO2016108894A1 (en) | 2014-12-31 | 2016-07-07 | Develpment Center For Biotechnology | Humanized alpha-enolase specific antibodies and methods of uses in cancer therapy |
| TWI572358B (en) * | 2013-12-20 | 2017-03-01 | 財團法人生物技術開發中心 | Alpha-enolase specific antibodies and methods of use in immune diseases |
| TWI579304B (en) * | 2014-12-31 | 2017-04-21 | 財團法人生物技術開發中心 | Humanized alpha-enolase specific antibodies and methods of uses in cancer therapy |
| EP3083697A4 (en) * | 2013-12-20 | 2017-06-28 | Development Center for Biotechnology | Alpha-enolase specific antibodies and methods of uses in cancer therapy |
| AU2017306506B2 (en) * | 2016-08-05 | 2020-05-21 | Y-Biologics Inc. | Antibody to programmed cell death 1 (PD-1) and use thereof |
| WO2021228044A1 (en) * | 2020-05-11 | 2021-11-18 | Hunilife Biotechnology, Inc. | Drug conjugates containing alpha-enolase antibodies and uses thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TWI468176B (en) * | 2010-01-28 | 2015-01-11 | Univ Taipei Medical | Anti-α-enolase i antibodies for diagnosis and treatment of α-enolase i-associated diseases |
| KR102438838B1 (en) * | 2013-01-18 | 2022-09-02 | 서울대학교산학협력단 | Biomarkers for the diagnosis of rheumatoid arthritis |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS58198758A (en) * | 1982-05-15 | 1983-11-18 | Amano Pharmaceut Co Ltd | Method for determining enolase and diagnosing cancer using it |
| US20070077583A1 (en) * | 2005-09-21 | 2007-04-05 | Aurelium Biopharma, Inc. | Alpha enolase-directed diagnostics and therapeutics for cancer and chemotherapeutic drug resistance |
| TWI304443B (en) * | 2005-12-30 | 2008-12-21 | Nat Health Research Institutes | Alpha-enolase specific antibody and method of use |
-
2008
- 2008-09-22 KR KR1020080092736A patent/KR100910962B1/en not_active Expired - Fee Related
- 2008-10-16 WO PCT/KR2008/006116 patent/WO2010032899A2/en not_active Ceased
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8449881B2 (en) * | 2010-01-28 | 2013-05-28 | Taipei Medical University | Anti-α-enolase I antibodies for diagnosis and treatment of α-enolase I-associated diseases |
| US20110182907A1 (en) * | 2010-01-28 | 2011-07-28 | Taipei Medical University | Anti-alpha-Enolase I Antibodies for Diagnosis and Treatment of alpha-Enolase I-Associated Diseases |
| US9750804B2 (en) | 2013-12-20 | 2017-09-05 | Development Center For Biotechnology | Alpha-enolase specific antibodies and method of use in immune diseases |
| RU2656153C1 (en) * | 2013-12-20 | 2018-05-31 | Девелопмент Сентер Фор Байотекнолоджи | Alpha-enolase specific antibodies and methods of uses in cancer therapy |
| TWI572358B (en) * | 2013-12-20 | 2017-03-01 | 財團法人生物技術開發中心 | Alpha-enolase specific antibodies and methods of use in immune diseases |
| EP3082863A4 (en) * | 2013-12-20 | 2017-06-28 | Development Center for Biotechnology | Alpha-enolase specific antibodies and method of use in immune diseases |
| EP3083697A4 (en) * | 2013-12-20 | 2017-06-28 | Development Center for Biotechnology | Alpha-enolase specific antibodies and methods of uses in cancer therapy |
| CN107427563A (en) * | 2014-12-31 | 2017-12-01 | 财团法人生物技术开发中心 | Humanization α enolases specific antibody and the method for treatment of cancer |
| TWI579304B (en) * | 2014-12-31 | 2017-04-21 | 財團法人生物技術開發中心 | Humanized alpha-enolase specific antibodies and methods of uses in cancer therapy |
| JP2018508184A (en) * | 2014-12-31 | 2018-03-29 | ディヴェロップメント センター フォー バイオテクノロジー | Humanized α-enolase specific antibodies and methods for their use in cancer therapy |
| WO2016108894A1 (en) | 2014-12-31 | 2016-07-07 | Develpment Center For Biotechnology | Humanized alpha-enolase specific antibodies and methods of uses in cancer therapy |
| EP3240566A4 (en) * | 2014-12-31 | 2018-06-06 | Development Center for Biotechnology | Humanized alpha-enolase specific antibodies and methods of uses in cancer therapy |
| CN107427563B (en) * | 2014-12-31 | 2021-03-02 | 财团法人生物技术开发中心 | Humanized alpha-enolase-specific antibodies and methods for cancer treatment |
| RU2761662C2 (en) * | 2014-12-31 | 2021-12-13 | Девелопмент Сентер Фор Байотекнолоджи | Humanized antibodies specific to alpha-enolase and methods for use in antitumor therapy |
| AU2017306506B2 (en) * | 2016-08-05 | 2020-05-21 | Y-Biologics Inc. | Antibody to programmed cell death 1 (PD-1) and use thereof |
| US11248048B2 (en) | 2016-08-05 | 2022-02-15 | Y-Biologics Inc. | Antibody to programmed cell death 1 (PD-1) and use thereof |
| WO2021228044A1 (en) * | 2020-05-11 | 2021-11-18 | Hunilife Biotechnology, Inc. | Drug conjugates containing alpha-enolase antibodies and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| KR100910962B1 (en) | 2009-08-05 |
| WO2010032899A3 (en) | 2010-07-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2010032899A2 (en) | Eno1-specific human antibody | |
| JP5289285B2 (en) | VEGF-specific human antibodies | |
| EP3054298B1 (en) | Method for detecting pancreatic tumor | |
| KR20120059556A (en) | Antibodies for the detection of integrin complexes in ffpe material | |
| US8501175B2 (en) | TMPRSS4-specific human antibody | |
| CA2479494A1 (en) | Compositions and methods associated with pro5725 and its use for the diagnosis of lung and colon tumor | |
| KR20100002207A (en) | Cd9-specific human antibody | |
| CN112409485B (en) | Anti-CEACAM6 single domain antibody, humanized single domain antibody and its Fc fusion protein and application | |
| CN111825767B (en) | Single-domain antibody of human epidermal growth factor receptor 2, detection kit and application thereof | |
| EP2285403A2 (en) | Human monoclonal antibodies against human chemokine receptor ccr7 | |
| CN112457402A (en) | anti-CEACAM 6 single-domain antibody, humanized single-domain antibody, fusion protein and application thereof | |
| KR101473328B1 (en) | Cytokaratin 17-specific human antibody | |
| CN114539393B (en) | 2019-New coronavirus N protein single domain antibody and its application | |
| CA2554410A1 (en) | Biotherapeutics, diagnostics and research reagents | |
| CN119371532B (en) | Single-domain antibody of anti-CD 99 protein, and coding gene and application thereof | |
| WO2020239014A1 (en) | Anti-cgrp antibody and application thereof | |
| CN119899272B (en) | Anti-CKBB antibodies and uses thereof | |
| CN112062848B (en) | anti-CD47 monoclonal antibody and application thereof | |
| CN120271712A (en) | Nectin-4 targeted nanobody and application thereof | |
| CN120271711A (en) | Nectin-4 targeting antibodies and uses thereof | |
| CN121914264A (en) | Monoclonal antibody specifically binding to human BEND2 protein and application thereof | |
| CN112079928A (en) | An anti-PD-L1 monoclonal antibody |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08876997 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 08876997 Country of ref document: EP Kind code of ref document: A2 |








