WO2010021940A1 - Insect proteins as adjuvants to accelerate the immune response - Google Patents
Insect proteins as adjuvants to accelerate the immune response Download PDFInfo
- Publication number
- WO2010021940A1 WO2010021940A1 PCT/US2009/053941 US2009053941W WO2010021940A1 WO 2010021940 A1 WO2010021940 A1 WO 2010021940A1 US 2009053941 W US2009053941 W US 2009053941W WO 2010021940 A1 WO2010021940 A1 WO 2010021940A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antigen
- sand fly
- subject
- polypeptide
- salivary gland
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/002—Protozoa antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/002—Protozoa antigens
- A61K39/008—Leishmania antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/002—Protozoa antigens
- A61K39/015—Hemosporidia antigens, e.g. Plasmodium antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/04—Mycobacterium, e.g. Mycobacterium tuberculosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55516—Proteins; Peptides
Definitions
- the disclosure relates to methods of using insect proteins, or recombinant vectors expressing these proteins, to prime or enhance an immune response against an antigen. More specifically, this disclosure relates to sand fly salivary proteins and sand fly midgut proteins that act as adjuvants to prime or enhance an immune response.
- a particular challenge in medicine is the development of an effective treatment, such as a vaccine, that provides a sufficiently strong and long lasting immune response in a subject.
- Vaccines are not available for many human or animal diseases (for example, malaria, tuberculosis, and leishmaniasis).
- Preventative (or prophylactic) drugs can be taken continuously to reduce the risk of infection and therapeutic drugs, taken once a person is already infected, are also available.
- the continuous administration of these drugs is expensive, particularly for those living in endemic areas.
- Diseases such as malaria and leishmaniasis are commonly associated with poverty, but they are also a cause of poverty and a major hindrance to economic development.
- a method which produces a potent protective immune response against these diseases would be advantageous.
- sand fly polypeptides that surprisingly behave as potent "non-classical" adjuvants.
- these polypeptides are immunogenic.
- classical adjuvants which include large amounts of lipid, lipopolysaccaride, or nucleic acid, cause undesirable side effects in subjects as a result of their high level of toxicity and their ability to cause severe local inflammation.
- non- classical adjuvant is immunogenic and can induce an immunologic response (such as a recall or T cell memory response), its ability to prime or enhance an immune response against an antigen is more long-lasting than that generated by a classical adjuvant.
- an immune response to a disease antigen can be primed or enhanced in a subject by administering to the subject (a) a therapeutically effective amount of an adjuvant comprising a sand fly salivary gland polypeptide that induces a T cell response in the subject, and (b) a disease antigen, wherein the disease antigen is other than a sand fly salivary gland antigen.
- a subject is administered adjuvant comprising a nucleic acid molecule encoding the sand fly polypeptide and a nucleic acid molecule encoding the disease antigen.
- compositions comprising an adjuvant comprising a sand fly salivary gland polypeptide in combination with a disease antigen (target antigen), wherein the disease antigen is an antigen other than a sand fly salivary gland antigen.
- the compositions can also comprise an adjuvant comprising a nucleic acid molecule encoding a sand fly salivary gland polypeptide in combination with a nucleic acid molecule encoding a disease antigen, wherein the disease antigen is an antigen other than a sand fly salivary gland antigen.
- the disease antigen in the disclosed methods and compositions can be, for example, an antigen of an organism causing a disease, for example a neoplastic disease (such as a tumor) or infectious disease (such as a viral, chlamydial, rickettsial, bacterial, fungal, protozoan, or helminth disease) for example, a Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma antigen.
- a disease for example a neoplastic disease (such as a tumor) or infectious disease (such as a viral, chlamydial, rickettsial, bacterial, fungal, protozoan, or helminth disease) for example, a Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma antigen.
- Figure 1 is a graph demonstrating that DNA immunization with PpSP 15,
- PpSP42 and PpSP44 induces a DTH response after challenge with salivary gland homogenate (SGH).
- SGH salivary gland homogenate
- C57BL/6 mice were immunized three times at two week intervals with DNA plasmids coding for ten Phlebotomus papatasi salivary proteins, SGH and CTL DNA in the right ear. Two weeks later the left ear was challenged intradermally with 0.5 pairs of SGH.
- the DTH response was assessed using ⁇ ear thickness (ear thickness of experimental groups subtracted from the mean ear thickness of na ⁇ ve mice) 48 hours after injection with 0.5 pairs of SGH. Bars represent the mean ⁇ ear thickness for 15 mice per group ⁇ the SEM. Asterisks indicate statistical differences (p ⁇ 0.05) compared to CTL DNA-immunized mice.
- Figure 2 is a graph demonstrating that DNA immunization with distinct
- DTH-inducing salivary proteins modulates the course of infection with L. major.
- Mice immunized in the right ear with CTL DNA (•), PpSP 15 (o), PpSP42 (D), PpSP44 ( ⁇ ), SGH (A) or pre-exposed to bites of uninfected sand flies (T) were challenged in the left ear with 500 L. major metacyclics and 0.5 pairs of SGH. Due to the extensive ulceration of the ears in mice immunized with PpSP44, lesion size measurements could not be performed beyond seven weeks after challenge.
- the symbols represent the mean ⁇ the SEM for ten mice per group. Asterisks indicate statistical significance (p ⁇ 0.05) compared to mice immunized with CTL DNA.
- Figure 3 is a graph and a series of images demonstrating protection or exacerbation of L. major infection in mice immunized with PpSP 15 or PpSP44.
- Mice immunized with PpSP15, PpSP44 or CTL DNA were challenged with 500 L. major metacyclics and 0.5 pairs of SGH.
- the graph shows the number of parasites per ear at 11 weeks post-challenge as measured by Real time PCR. This result is representative of the parasite load at six and nine weeks post-challenge. Bars represent the mean ⁇ the SEM for ten mice per group.
- Figures 3A-3C reflect the pathology of the ears 11 weeks post-challenge in mice previously immunized with PpSP44 (Fig. 3A), PpSP 15 (Fig. 3B) and CTL DNA (Fig. 3C). Asterisks indicate significance compared to mice immunized with CTL DNA (p ⁇ 0.05). Data are representative of three independent experiments.
- Figures 4A - 4F is a series of graphs demonstrating the frequency of CD4 + -T cells producing IFN- ⁇ or IL-4 in mice immunized with PpSP 15 or PpSP44. Mice immunized in the right ear with CTL DNA, PpSP44 or PpSP 15 were challenged in the left ear with 500 L.
- FIG. 5A - 5E is a series of graphs demonstrating the early expression of cytokines after challenge with SGH-LM in CTL DNA, PpSP 15- or PpSP44- immunized mice. Two hours after challenge with 500 L.
- mice immunized with PpSP15 mice immunized with PpSP15.
- mice immunized with PpSP44 induced the expression of IL-4 (Fig. 5C).
- Relative mRNA expression was determined by real time PCR and normalized to thel8S housekeeping gene. Values represent the fold increase over na ⁇ ve mice after challenge with SGH-LM. Bars represent the mean ⁇ the SEM for 24 mice per group. Asterisks indicate statistical significance (p ⁇ 0.05) between the PpSP 15 and the PpSP44 experimental groups. Data represent the combined outcome of three independent experiments.
- Figures 6A and 7B are a series of graphs demonstrating that sand fly bites efficiently recall the immune response in mice immunized with PpSP 15 or PpSP44.
- Relative mRNA expression was determined by real time PCR and normalized to thel8S housekeeping gene. Values represent the fold increase over na ⁇ ve mice after sand fly bites. Bars represent the mean ⁇ the SEM for 16 mice per group. Asterisks indicate significance (p ⁇ 0.05).
- Figures 7A and 7B are a series of graphs and images illustrating parasite burden following challenge with 10 5 stationary phase L. infantum chagasi promastigotes in the presence or absence of 0.5 salivary gland pairs.
- Fig. 7A shows PCR amplification of Leishmania DNA from hamster blood, spleen and liver 15 days post-infection with Leishmania alone (L. i.e.), Leishmania and SGH (L. i.e. +SGH), non-infected hamsters (-).
- Fig. 7B shows the parasite burden in the spleen and liver of hamsters (six animals/group) two and five months post-infection using the limiting dilution assay. The bars represent the mean number of parasites per organ ⁇ SEM.
- Figure 8 is a graph and a series of histology images demonstrating the immune response to Lu. longipalpis salivary proteins.
- Fig. 8A shows antibody titers to Lu. longipalpis salivary gland homogenate (SGH) and DNA plasmids coding for CTL DNA, LJM17, LJMl 1, LJLl 1 and LJM19 using ELISA (six hamsters/group). The cutoff was determined using sera from non-infected hamsters (Mean + 2 SD).
- Fig. 8B shows ear thickness prior to (0 h) and 48 h after challenge with SGH in hamsters immunized with LJM 17, LJMl 1, LJM 19, CTL DNA or SGH.
- FIG. 8C shows cellular infiltration in representative ears of hamsters immunized with LJM 19 or CTL DNA 48 h after challenge with SGH in the contralateral ear (six animals/group, H&E staining).
- Figures 9A - 9D is a series of graphs demonstrating that DNA immunization with LJM 19 protects hamsters from the fatal outcome of VL. Parasite burden at two (Fig. 9A) and five (Fig. 9B) months post-infection in hamsters immunized with
- L. infantum chagasi promastigotes in the presence of 0.5 pairs of SGH.
- Parasite burden was determined by limiting dilution assay (six hamsters/group).
- Fig. 9C shows the percent survival of hamsters immunized with LJM 19 and CTL DNA following intradermal challenge with L. infantum chagasi and SGH (12 hamsters/group).
- Fig. 9D shows anti-Leishmania antibodies detected by ELISA in hamsters immunized with LJM 19 and CTL DNA two and five months after intradermal challenge with L.
- Figure 10 is a series of graphs demonstrating that the protection against the fatal outcome of VL correlates with hepatic and splenic IFN- ⁇ and iNOS expression.
- L. infantum chagasi promastigotes in the presence of 0.5 pairs of SGH.
- mRNA iNOS expression in the spleen (Fig. 10C) and liver (Fig. 10D) two and five months after intradermal challenge with L. infantum chagasi and SGH. All cytokine expression levels were normalized to HPRT mRNA expression levels. * indicates significance at/? ⁇ 0.05 (Six animals/group).
- Figure 11 is a series of graphs and histology images demonstrating the immune response in the ear tissue of hamsters immunized with LJM 19 and CTL DNA following uninfected sand fly bites.
- Fig. 1 IA shows cellular infiltration in representative ears of hamsters immunized with LJM 19 or CTL DNA 48 h after challenge with uninfected sand fly bites in the contralateral ear (six animals/group, H&E staining).
- Fig. 1 IB shows IFN- ⁇ and IL-10 mRNA expression in hamsters immunized with LJM 19 and CTL DNA 48 h after uninfected sand fly bites. The data were normalized to HPRT expression. * indicates significance at/? ⁇ 0.05. SEQUENCE LISTING
- nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. ⁇ 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
- SEQ ID Nos: 1, 2, and 3 show the amino acid sequence of Phlebotomus papatasi salivary gland polypeptides (PpSP 15, PpSP42, and PpSP44, respectively).
- SEQ ID NO: 4 shows the amino acid sequence of a Lutzomyia longipalpis salivary gland polypeptide (LJM 19).
- SEQ ID NO: 5 shows the nucleic acid sequence encoding a Lutzomyia longipalpis salivary gland polypeptide (LJM 19).
- SEQ ID NO: 6 shows the amino acid sequence encoding a Lutzomyia longipalpis salivary gland polypeptide (LJMl 1).
- SEQ ID NO: 7 shows the nucleic acid sequence encoding a Lutzomyia longipalpis salivary gland polypeptide (LJMl 1).
- SEQ ID NOs: 8, 9, and 10 show the nucleic acid sequence encoding Phlebotomus papatasi salivary gland polypeptides (PpSP15, PpSP42, and PpSP44, respectively).
- SEQ ID NOs: 11-34 show the nucleic acid sequences of oligonucleotide primers.
- sand fly molecules such as salivary gland or midgut polypeptides, or nucleic acids encoding these polypeptides, can be used as adjuvants to prime or enhance an immune response to a disease antigen (target antigen) in a subject.
- an immune response to a disease antigen can be primed or enhanced in a subject by administering to the subject (a) a therapeutically effective amount of an adjuvant comprising a sand fly salivary gland polypeptide to induce a T cell response in the subject, wherein the therapeutically effective amount of adjuvant is below the amount required for a classical adjuvant, and (b) a disease antigen, wherein the disease antigen is other than a sand fly salivary gland antigen, thereby priming or enhancing an immune response in the subject.
- the T cell response can be a CD4 T helper cell response, wherein the CD4 T helper cell response is a ThI cell response.
- the antigen is administered to the subject simultaneously with the administration of the sand fly salivary gland. In other embodiments, the antigen is administered to the subject after the administration of the sand fly salivary gland polypeptide and within a sufficient amount of time to induce the immune response.
- the antigen can be, for example, an antigen of an organism causing a disease, for example a Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma antigen.
- the adjuvant comprises a sand fly midgut polypeptide.
- a subject is administered adjuvant comprising a nucleic acid molecule encoding the sand fly polypeptide and a nucleic acid molecule encoding the disease antigen.
- compositions comprising an adjuvant comprising a sand fly salivary gland polypeptide in combination with a disease antigen (target antigen), wherein the disease antigen is an antigen other than a sand fly salivary gland antigen.
- the compositions can also comprise an adjuvant comprising nucleic acid molecule encoding a sand fly salivary gland polypeptide in combination with a nucleic acid molecule encoding a disease antigen (target antigen), wherein the disease antigen is an antigen other than a sand fly salivary gland antigen.
- the sand fly polypeptide, or the nucleic acid molecule encoding this polypeptide is from the midgut of a sand fly.
- the antigen can be of any disease-causing organism.
- the disease causing organism is Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma. Also disclosed herein are methods of priming or enhancing an immune response to an antigen in a subject using the compositions provided herein.
- the sand fly salivary gland polypeptide is a polypeptide obtained from the salivary gland from any vector species of sand fly, such as a Phlebotomus or Lutzomyia sand fly, for example (but not limited to) Phlebotomus papatasi, Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P. sergenti, P. arabicus, P. tobbi, or Lutzomyia longipalpis.
- Phlebotomus or Lutzomyia sand fly for example (but not limited to) Phlebotomus papatasi, Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P. sergenti, P. arabicus, P. tobbi, or Lutz
- the sand fly salivary gland polypeptide can comprise the amino acid sequences set forth as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 6. More specifically, the nucleic acid molecule encoding the sand fly polypeptide can comprise SEQ ID NO: 5 or SEQ ID NOs 7-10.
- the subject can be a human or a non-human veterinary subject, such as a dog, a mouse, or a monkey.
- V L Variable light domain VL Visceral leishmaniasis
- Adjuvant A substance distinct from antigen that enhances T cell activation by promoting the innate immune response leading to the accumulation and activation of other leukocytes (accessory cells) at the site of antigen exposure. Adjuvants enhance accessory cell expression of T cell-activating co-stimulators and cytokine and may also prolong the expression of peptide-MHC complexes on the surface of antigen-presenting cells.
- a classical adjuvant such as liposomes, lipopolysaccharide (LPS), components of bacterial cell walls, and endocytosed nucleic acids
- LPS lipopolysaccharide
- endocytosed nucleic acids is not immunogenic and does not generate an immune response against itself. Thus, repeated exposure to classical adjuvants does not lead to enhanced immune responses against the adjuvant (i.e. immunologic memory).
- a non-classical adjuvant is itself immunogenic. Thus, it is more potent than a classical adjuvant and much smaller amounts of non-classical adjuvants are required to prime or enhance an immune response against an antigen. Also, as a non-classical adjuvant is immunogenic and can induce an immunologic response (such as a recall or T cell memory response), its ability to prime or enhance an immune response against an antigen is more long-lasting than that generated by a classical adjuvant.
- Amplification of a nucleic acid molecule (for example, a DNA or RNA molecule): A technique that increases the number of copies of a nucleic acid molecule in a specimen.
- An example of amplification is the polymerase chain reaction, in which a biological sample collected from a subject is contacted with a pair of oligonucleotide primers, under conditions that allow for the hybridization of the primers to a nucleic acid template in the sample.
- the primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid.
- the product of amplification may be characterized by electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing using standard techniques.
- Other examples of amplification include strand displacement amplification, as disclosed in U.S. Patent No. 5,744,311; transcription-free isothermal amplification, as disclosed in U.S. Patent No. 6,033,881; repair chain reaction amplification, as disclosed in WO 90/01069; ligase chain reaction amplification, as disclosed in EP 0320308; gap filling ligase chain reaction amplification, as disclosed in U.S. Patent No. 5,427,930; and NASBATM RNA transcription-free amplification, as disclosed in U.S. Patent No. 6,025,134.
- Animal Living multi-cellular vertebrate organisms, a category that includes, for example, mammals and birds.
- mammal includes both human and non- human mammals.
- subject includes both human and veterinary subjects, such as dogs, monkeys, mice, and hamsters.
- Antibody immunoglobulin molecules and immunologically active portions of immunoglobulin molecules. For instance, molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen.
- a naturally occurring antibody for example, IgG, IgM, IgD
- IgG, IgM, IgD includes four polypeptide chains, two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
- H heavy
- L light
- binding fragments encompassed within the term antibody include (i) an Fab fragment consisting of the V L , V H , C L , and CHl domains; (ii) an Fd fragment consisting of the V H and CHl domains; (iii) an Fv fragment consisting of the V L and V H domains of a single arm of an antibody, (iv) a dAb fragment (Ward et al, Nature 341 : 544-546, 1989) which consists of a V H domain; (v) an isolated complimentarity determining region (CDR); and (vi) an F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region.
- Immunoglobulins and certain variants thereof are known and many have been prepared in recombinant cell culture (for example, see U.S. Patent No. 4,745,055; U.S. Patent No. 4,444,487; WO 88/03565; EP 0256654; EP 0120694; EP 0125023; Faoulkner et al, Nature 298:286, 1982; Morrison, J. Immunol. 123:793, 1979; Morrison et al., Ann Rev. Immunol 2:239, 1984).
- Antigen A substance against which an immune response is desired.
- An antigen can be a disease antigen or a target antigen.
- a disease or target antigen is an antigen from a pathogen that confers immune protection agasint a disease.
- Conservative variants Conservative amino acid substitution tables providing functionally similar amino acids are well known to one of ordinary skill in the art. The following six groups are examples of amino acids that are considered to be conservative substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T);
- I Isoleucine
- L Leucine
- M Methionine
- V Valine
- F Phenylalanine
- Y Tyrosine
- W Tryptophan
- a non-conservative amino acid substitution can result from changes in: (a) the structure of the amino acid backbone in the area of the substitution; (b) the charge or hydrophobicity of the amino acid; or (c) the bulk of an amino acid side chain.
- Substitutions generally expected to produce the greatest changes in protein properties are those in which: (a) a hydrophilic residue is substituted for (or by) a hydrophobic residue; (b) a proline is substituted for (or by) any other residue; (c) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine; or (d) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl.
- non-conservative substitutions are those that reduce an activity or antigenicity.
- cDNA complementary DNA: A piece of DNA lacking internal, non- coding segments (introns) and expression control sequences. cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.
- Degenerate variant A polynucleotide encoding a sand fly salivary gland or midgut polypeptide that includes a sequence that is degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon.
- DTH Delayed-type hypersensitivity
- Epitope An antigenic determinant. There are particular chemical groups or peptide sequences on a molecule that are antigenic, for instance, that elicit a specific immune response. An antibody specifically binds a particular antigenic epitope on a polypeptide. Specific, non-limiting examples of an epitope include a tetra- to penta- peptide sequence in a polypeptide, a tri- to penta-glycoside sequence in a polysaccharide. In the animal most antigens will present several or even many antigenic determinants simultaneously. Such a polypeptide may also be qualified as an immunogenic polypeptide and the epitope may be identified.
- Expression Control Sequences Nucleic acid sequences that control and regulate the expression of a nucleic acid sequence, such as a heterologous nucleic acid sequence, to which it is operably linked.
- Expression control sequences are operably linked to a nucleic acid sequence when the expression control sequences control and regulate the transcription and, as appropriate, translation of the nucleic acid sequence.
- expression control sequences can include appropriate promoters, enhancers, transcription terminators, polyA signals, a start codon (for instance, ATG) in front of a protein-encoding polynucleotide sequence, splicing signal for introns, maintenance of the correct reading frame of that gene to permit proper translation of mRNA, and stop codons.
- control sequences is intended to include, at a minimum, components whose presence can influence expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences.
- Expression control sequences can include a promoter.
- a promoter is a minimal sequence sufficient to direct transcription of a nucleic acid. Promoters may be cell-type specific or tissue specific. A promoter includes necessary nucleic acid sequences near the start site of transcription, such as a TATA element. A promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription. Both constitutive and inducible promoters are included (see for example, Bitter et ah, Methods in Enzymology 153:516-544, 1987).
- inducible promoters such as pL of bacteriophage lambda, plac, ptrp, ptac (ptrp-lac-hybrid promoter) and the like may be used.
- promoters derived from the genome of mammalian cells for example, metallothionein promoter
- mammalian viruses for example, the retrovirus long terminal repeat; the adenovirus late promoter; the vaccinia virus 7.5K promoter
- Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for transcription of the nucleic acid sequences.
- a polynucleotide can be inserted into an expression vector that contains a promoter sequence which facilitates the efficient transcription of the inserted genetic sequence of the host.
- the expression vector typically contains an origin of replication, a promoter, as well as specific nucleic acid sequences that allow phenotypic selection of the transformed cells.
- the promoter is a cytomegalovirus promoter.
- Hookworm The hookworm is a parasitic nematode worm that lives in the small intestine of its host, which may be a mammal such as a dog, cat, or human. Two species of hookworms commonly infect humans, Ancylostoma duodenale and Necator americanus. Necator americanus predominates in the Americas, Sub-
- Host cells Cells in which a vector can be propagated and its DNA expressed.
- the cell may be prokaryotic or eukaryotic.
- the term also includes any progeny of the subject host cell. It is understood that all progeny may not be identical to the parental cell since there may be mutations that occur during replication. However, such progeny are included when the term "host cell” is used. Also includes the cells of the subject.
- Immune response A response of a cell of the immune system, such as a B cell, T cell, or monocyte, to a stimulus.
- An immune response can be a cellular response or a humoral response. In one embodiment, the response is specific for a particular antigen (an "antigen-specific response").
- the response can also be a nonspecific response (not targeted specifically to salivary polypeptides) such as production of lymphokines.
- an immune response is a T cell response, such as a CD4 + response or a CD8 + response.
- the response is a ThI or a Th2 (subsets of helper T cells) response.
- the response is a B cell response, and results in the production of specific antibodies.
- the immune response can be a lymphocyte response, such as a NK cell or NKT cell response.
- Immunogenic composition A composition comprising an immunogenic sand fly polypeptide (for example, a salivary gland polypeptide or a midgut polypeptide) that induces an immune response (such as a T cell response) against a disease, for example Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma.
- the immunogenic composition consists of the immunogenic sand fly polypeptide alone.
- the immunogenic composition comprises the immunogenic polypeptide and an antigen (for example a Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma antigen).
- the immunogenic composition can also include a pharmaceutically acceptable carrier and/or other agents.
- Immunogenic polypeptide A polypeptide which comprises an allele- specif ⁇ c motif, an epitope or other sequence such that the polypeptide will bind an MHC molecule and induce a cytotoxic T lymphocyte ("CTL") response, and/or a B cell response (for example, antibody production), and/or T-helper lymphocyte response, and/or a delayed type hypersensitivity (DTH) response against the antigen from which the immunogenic polypeptide is derived.
- CTL cytotoxic T lymphocyte
- B cell response for example, antibody production
- T-helper lymphocyte response for example, antibody production
- DTH delayed type hypersensitivity
- immunogenic polypeptides are identified using sequence motifs or other methods known in the art.
- algorithms are used to determine the "binding threshold" of polypeptides to select those with scores that give them a high probability of binding at a certain affinity and will be immunogenic.
- the algorithms are based either on the effects on MHC binding of a particular amino acid at a particular position, the effects on antibody binding of a particular amino acid at a particular position, or the effects on binding of a particular substitution in a motif- containing polypeptide.
- a "conserved residue” is one which appears in a significantly higher frequency than would be expected by random distribution at a particular position in a polypeptide.
- a conserved residue is one where the MHC structure may provide a contact point with the immunogenic polypeptide.
- Retroviridae for example, human immunodeficiency viruses, such as HIV-I (also referred to as HTLV-III, LAV or HTLV-III/LAV, or HIV-III) and other isolates, such as HIV-LP; Picornaviridae (for example, polio viruses, hepatitis A virus; enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (such as strains that cause gastroenteritis); Togaviridae (for example, equine encephalitis viruses, rubella viruses); Flaviridae (for example, dengue viruses, encephalitis viruses, yellow fever viruses); Coronaviridae (for example, coronaviruses); Rhab
- infectious bacteria examples include: Helicobacter pylons, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (such as. M. tuberculosis, M. avium, M. intracellular, M. kansaii, M.
- infectious fungi examples include, but are not limited to, Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans.
- infectious organisms include: Plasmodium falciparum and Toxoplasma gondii.
- Isolated An "isolated" biological component (such as a nucleic acid or protein or organelle) has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, for instance, other chromosomal and extra-chromosomal DNA and RNA, proteins, and organelles.
- Nucleic acids and proteins that have been "isolated” include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant technology as well as chemical synthesis.
- Label A detectable compound or composition that is conjugated directly or indirectly to another molecule to facilitate detection of that molecule.
- Specific, non- limiting examples of labels include fluorescent tags, enzymatic linkages, and radioactive isotopes.
- Leishmaniasis A parasitic disease spread by the bite of infected sand flies.
- the trypanosomatid parasite of the genus Leishmania is the etiological agent of a variety of disease manifestations, which are collectively known as leishmaniasis.
- Leishmaniasis is prevalent through out the tropical and sub-tropical regions of Africa, Asia, the Mediterranean, Southern Europe (old world), and South and Central America (new world). The old world species are transmitted by the sand fly vector Phlebotomus sp. Humans, wild animals and domestic animals (such as dogs) are known to be targets of these sand flies and to act as reservoir hosts or to develop leishmaniasis.
- Cutaneous leishmaniasis starts as single or multiple nodules that develop into ulcers in the skin at the site of the bite.
- the chiclero ulcer typically appears as a notch- like loss of tissue on the ear lobe.
- the incubation period ranges from days to months, even a year in some cases. The sores usually last months to a few years, with most cases healing on their own.
- the mucocutaneous type can develop into erosive lesions in the nose, mouth, or throat and can lead to severe disfigurement.
- Visceral leishmaniasis often has fever occurring in a typical daily pattern, abdominal enlargement with pain, weakness, widespread swelling of lymph nodes, and weight loss, as well as superimposed infections because of a weakened immune system.
- Visceral leishmaniasis (VL) can result in high death rates. The onset of symptoms can be sudden, but more often tends to be insidious.
- Lutzomyia longipalpis (Lu. longipalpis): A species of sand fly endogenous to the New World (South and Central America). This sand fly is the principal vector of American visceral leishmaniasis, a potentially fatal disease that primarily affects children in several countries of South and Central America.
- Lymphocytes A type of white blood cell that is involved in the immune defenses of the body. There are two main types of lymphocytes: B cells and T cells. A lymphocyte can also be referred to as a leukocyte.
- Malaria Malaria is caused by protozoan parasites of the genus Plasmodium (phylum Apicomplexa). In humans malaria is caused by P. falciparum, P. malariae, P. ovale, P. vivax and P. knowlesi. P. falciparum is the most common cause of infection and is responsible for about 80% of all malaria cases, and is also responsible for about 90% of the deaths from malaria. Parasitic Plasmodium species also infect birds, reptiles, monkeys, chimpanzees and rodents. There have been documented human infections with several simian species of malaria, namely P. knowlesi, P. inui, P. cynomolgi, P. simiovale, P. brazilianum, P. schwetzi and P. simium; however, with the exception of P. knowlesi, these are mostly of limited public health importance.
- NK Cells A type of cytotoxic lymphocyte that constitute a major component of the innate immune system. NK cells play a major role in the rejection of tumors and cells infected by viruses. The cells kill by releasing small cytoplasmic granules of proteins called perform and granzyme that cause the target cell to die by apoptosis or necrosis. NK-cells are defined as large granular lymphocytes (LGL) and constitute the third kind of cells differentiated from the common lymphoid progenitor generating B and T lymphocytes.
- LGL large granular lymphocytes
- TCR T-cell antigen receptors
- Pan T marker CD3 or surface immunoglobulins (Ig) B cell receptor but that usually express the surface markers CD 16 (Fc ⁇ RIII) and CD56 in humans, and NKl.l/NK1.2 in certain strains of mice. Up to 80% ofNK cells also express CD8.
- Natural Killer T cells A heterogeneous group of T cells that share properties of both T cells and natural killer (NK) cells. Many of these cells recognize the non-polymorphic CDId molecule, an antigen-presenting molecule that binds self- and foreign lipids and glyco lipids. They constitute only 0.2% of all peripheral blood T cells. NKT cells are a subset of T cells that co-express an ⁇ T cell receptor (TCR), but also express a variety of molecular markers that are typically associated with NK cells, such as NKl .1.
- NKT cells include both NKl. I + and NKl.1 " , as well as CD4 + , CD4 , CD8 + and CD8 cells.
- Natural Killer T cells share other features with NK cells as well, such as CD 16 and CD56 expression and granzyme production.
- Oligonucleotide A linear polynucleotide sequence of up to about 100 nucleotide bases in length.
- ORF Open reading frame
- a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
- a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
- operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.
- Sand fly salivary gland polypeptides include synthetic embodiments of polypeptides described herein.
- analogues non-peptide organic molecules
- derivatives chemically functionalized peptide molecules obtained starting with the disclosed polypeptide sequences
- variants homo logs
- Each polypeptide of the disclosure is comprised of a sequence of amino acids, which may be either L- and/or D- amino acids, naturally occurring and otherwise.
- Polypeptides may be modified by a variety of chemical techniques to produce derivatives having essentially the same activity as the unmodified polypeptides, and optionally having other desirable properties.
- carboxylic acid groups of the protein may be provided in the form of a salt of a pharmaceutically-acceptable cation or esterified to form a Ci-Ci 6 ester, or converted to an amide of formula NRiR 2 wherein Ri and R 2 are each independently H or C 1 -C 16 alkyl, or combined to form a heterocyclic ring, such as a 5- or 6- membered ring.
- Amino groups of the peptide may be in the form of a pharmaceutically-acceptable acid addition salt, such as the HCl, HBr, acetic, benzoic, toluene sulfonic, maleic, tartaric, and other organic salts, or may be modified to Ci-Ci 6 alkyl or dialkyl amino or further converted to an amide.
- a pharmaceutically-acceptable acid addition salt such as the HCl, HBr, acetic, benzoic, toluene sulfonic, maleic, tartaric, and other organic salts
- Hydroxyl groups of the peptide side chains maybe converted to Ci-Ci 6 alkoxy or to a Ci-Ci 6 ester using well-recognized techniques.
- Phenyl and phenolic rings of the peptide side chains may be substituted with one or more halogen atoms, such as fluorine, chlorine, bromine, or iodine, or with Ci-Ci 6 alkyl, Ci-Ci 6 alkoxy, carboxylic acids and esters thereof, or amides of such carboxylic acids.
- Methylene groups of the peptide side chains can be extended to homologous C 2 -C 4 alkylenes.
- Thiols can be protected with any one of a number of well-recognized protecting groups, such as acetamide groups.
- protecting groups such as acetamide groups.
- Peptidomimetic and organomimetic embodiments are envisioned, whereby the three-dimensional arrangement of the chemical constituents of such peptido- and organomimetics mimic the three-dimensional arrangement of the peptide backbone and component amino acid side chains, resulting in such peptido- and organomimetics of a L. longipalpis polypeptide having measurable or enhanced ability to generate an immune response.
- a pharmacophore is an idealized, three-dimensional definition of the structural requirements for biological activity.
- Peptido- and organomimetics can be designed to fit each pharmacophore with current computer modeling software (using computer assisted drug design or CADD).
- parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like
- solid compositions for example, freeze-dried pastille, powder, pill, tablet, or capsule forms
- conventional non-toxic solid vehicles or excipients can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate.
- immunogenic compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- Phlebotomus ariasi A species of Phlebotomus (sand flies) genus endogenous to the Old World, in particular to southern Europe and Mediterranean countries, more particularly to Spain and France. This sand fly is a proven vector of visceral leishmaniasis. P. ariasi is a member of the subgenera of Phlebotomus Larroussius.
- Phlebotomus papatasi (P. papatasi): A species of Phlebotomus (sand flies) genus endogenous to the Old World, in particular to southern Europe, and Mediterranean countries, more particularly to France, Italy, Greece, Sydney, and Spain. This sand fly is a proven vector of the visceral leishmaniasis.
- Phlebotomus perniciosus (P. perniciosus): A species of Phlebotomus (sand flies) genus endogenous to the Old World, in particular to southern Europe, and Mediterranean countries, more particularly to France, Italy, Greece, Morocco, and Spain. This sand fly is a proven vector of the visceral leishmaniasis.
- P. papatasi A species of Phlebotomus (sand flies) genus endogenous to the Old World, in particular to southern Europe, and Mediterranean countries, more particularly to France, Italy, Greece, Morocco, and Spain. This sand fly is a proven vector of
- polynucleotide or nucleic acid sequence refers to a polymeric form of nucleotide at least 10 bases in length, thus including oligonucleotides and genes.
- a recombinant polynucleotide includes a polynucleotide that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived.
- the term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (for example, a cDNA) independent of other sequences.
- the polynucleotides can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide.
- the term includes single -and double -stranded forms of DNA.
- Polypeptide Any chain of amino acids, regardless of length (thus encompassing oligopeptides, peptides, and proteins) or post-translational modification (for example, glycosylation, phosphorylation, or acylation).
- a polypeptide encompasses also the precursor, as well as the mature protein.
- the polypeptide is a polypeptide isolated from Lu. longipalpis, or encoded by a nucleic acid isolated from Lu. longipalpis, such as the Lu. longipalpis polypeptides disclosed herein.
- a probe comprises an isolated polynucleotide attached to a detectable label or reporter molecule.
- Primers are short polynucleotides. In one embodiment, polynucleotides are 15 nucleotides or more in length. Primers may be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, for example, by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods known in the art.
- PCR polymerase chain reaction
- probes and primers may be selected that comprise at least 15, 20, 25, 30, 35, 40, 50 or more consecutive nucleotides.
- the sand fly salivary gland polypeptides disclosed herein can be purified by any of the means known in the art. See, for example, Guide to Protein Purification, Deutscher (ed.), Meth. Enzymol. 185, Academic Press, San Diego, 1990; and Scopes, Protein Purification: Principles and Practice, Springer Verlag, New York, 1982.
- Substantial purification denotes purification from other proteins or cellular components.
- a substantially purified protein is at least 60%, 70%, 80%, 90%, 95%, or 98% pure.
- a substantially purified protein is 90% free of other proteins or cellular components.
- a purified polypeptide preparation is one in which the polypeptide is more enriched than the polypeptide is in its natural environment.
- a polypeptide preparation is substantially purified such that the polypeptide represents several embodiments at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98%, of the total polypeptide content of the preparation.
- the polypeptides disclosed herein can be purified by any of the means known in the art (see, for example, Guide to Protein Purification, Inc.), Meth. Enzymol. 185, Academic Press, San Diego, 1990; and Scopes, Protein Purification: Principles and Practice, Springer Verlag, New York, 1982).
- a recombinant polynucleotide is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, for example, by genetic engineering techniques.
- a recombinant polynucleotide encodes a recombinant polypeptide. In one specific, non-limiting embodiment, a recombinant polynucleotide encodes a fusion protein.
- nucleic acid hybridization reactions the conditions used to achieve a particular level of stringency will vary, depending on the nature of the nucleic acids being hybridized. For example, the length, degree of complementarity, nucleotide sequence composition (for example, GC versus AT content), and nucleic acid type (for example, RNA versus DNA) of the hybridizing regions of the nucleic acids can be considered in selecting hybridization conditions. An additional consideration is whether one of the nucleic acids is immobilized, for example, on a filter.
- a specific, non-limiting example of progressively higher stringency conditions is as follows: 2 x SSC/0.1% SDS at about room temperature (hybridization conditions); 0.2 x SSC/0.1% SDS at about room temperature (low stringency conditions); 0.2 x SSC/0.1% SDS at about 42 0 C (moderate stringency conditions); and 0.1 x SSC at about 68 0 C (high stringency conditions).
- hybridization conditions 2 x SSC/0.1% SDS at about room temperature
- low stringency conditions low stringency conditions
- 0.2 x SSC/0.1% SDS at about 42 0 C moderate stringency conditions
- 0.1 x SSC at about 68 0 C high stringency conditions.
- the hydridization conditions can be carried out over 2 to 16 hours.
- Washing can be carried out using only one of the above conditions, for example, high stringency conditions, or each of the conditions can be used, for example, for 10-15 minutes each, in the order listed above, repeating any or all of the steps listed.
- optimal conditions will vary, depending on the particular hybridization reaction involved, and can be determined empirically.
- Sequence identity The similarity between amino acid sequences is expressed in terms of the percentage identity between the sequences. The higher the percentage, the more similar the two sequences are. Homologs or variants of a sand fly salivary gland polypeptide will possess a relatively significant high degree of sequence identity when aligned using standard methods.
- NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. MoI. Biol. 215:403, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn, and tblastx. A description of how to determine sequence identity using this program is available on the NCBI website on the internet. Homologs and variants of a sand fly salivary gland polypeptide are typically characterized by possession of at least 75%, for example at least 80%, sequence identity counted over the full length alignment with the amino acid sequence of the Lu.
- the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. When less than the entire sequence is being compared for sequence identity, homologues and, variants will typically possess at least 80% sequence identity over short windows of 10-20 amino acids, and may possess sequence identities of at least 85% or at least 90% or 95% depending on their similarity to the reference sequence.
- Specific binding agent An agent that binds substantially only to a defined target.
- a Lu. longipalpis specific binding agent is an agent that binds substantially to a Lu. longipalpis polypeptide.
- the specific binding agent is a monoclonal or polyclonal antibody that specifically binds the Lu. longipalpis polypeptide.
- T Cell A white blood cell critical to the immune response.
- T cells include, but are not limited to, CD4 + T cells and CD8 + T cells.
- CD4 + T lymphocyte is an immune cell that carries a marker on its surface known as "cluster of differentiation 4" (CD4).
- helper T cells help orchestrate the immune response, including antibody responses as well as killer T cell responses.
- ThI and Th2 cells are functional subsets of helper T cells.
- ThI cells secrete a set of cytokines, including interferon-gamma, and whose principal function is to stimulate phagocyte-mediated defense against infections, especially related to intracellular microbes.
- Th2 cells secrete a set of cytokines, including interleukin (IL)-4 and IL-5, and whose principal functions are to stimulate IgE and eosinophil/mast cell-mediated immune reactions and to downregulate ThI responses.
- CD8 + T cells carry the "cluster of differentiation 8" (CD8) marker.
- a CD8 T cell is a cytotoxic T lymphocytes.
- a CD8 cell is a suppressor T cell.
- Memory T cells are a specific type of infection-fighting T cell (also known as a T lymphocyte) that can recognize foreign invaders such as bacteria or viruses, that were encountered during a prior infection or vaccination. At a second encounter with the invader, memory T cells can reproduce to mount a faster and stronger immune response than the first time the immune system responded to the invader. This behavior is utilized in T lymphocyte proliferation assays, which can reveal exposure to specific antigens.
- Therapeutically effective molecule An agent, such as a sand fly salivary gland polypeptide or a sand fly midgut polypeptide, that causes induction of an immune response, as measured by clinical response, for example, (i) increase in a population of immune cells or production of antibody that specifically binds a salivary gland or midgut polypeptide (for example a Lu. longipalpis polypeptide), (ii) a measurable reduction in symptoms of a disease (for example, after exposure to Leishmania, toxoplasma, tuberculosis, Malaria, or hookworm), or (iii) protection from infection (for example, by Leishmania or Plasmodium).
- Therapeutically effective molecules can also be nucleic acid molecules.
- nucleic acid-based therapeutically effective molecule examples include a nucleic acid sequence that encodes a sand fly salivary gland polypeptide or a sandfly midgut polypeptide, wherein the nucleic acid sequence is operably linked to a control element such as a promoter.
- Therapeutically active agents can also include organic or other chemical compounds that mimic the effects of the sand fly salivary gland or midgut polypeptide.
- sand fly salivary gland polypeptide includes any fragment of the sand fly salivary gland or midgut polypeptide, a variant of the sand fly salivary gland or midgut polypeptide, or a fusion protein that includes a sand fly salivary gland or midgut polypeptide, that retains a function of the sand fly salivary gland or midgut polypeptide (such as immunogenicity), or retains the ability to reduce the symptoms from exposure to a disease, or to protect from infection, for example with Plasmodium or Leishmania.
- a therapeutically effective amount of a fragment of sand fly polypeptide is an amount used to generate an immune response to the polypeptide.
- a therapeutically effective amount of a fragment of a sand fly polypeptide is an amount used to prevent or treat a disease or infection (for example, by a parasite such as Plasmodium or Leishmania) in a subject. Treatment refers to a therapeutic intervention that confers resistance to infection, or a reduction in the symptoms associated with exposure to a parasite.
- a sand fly polypeptide fragment are the N-terminal half or the C-terminal half of one of the sand fly polypeptides disclosed herein.
- fusion proteins are included, such as a fusion with six histidine residues, a c-myc tag, or any other polypeptide tag. Such fusions are known to one of skill in the art, and are often used in protein purification.
- Toxoplasma A species of parasitic protozoa in the genus Toxoplasma.
- the definitive host of T. gondii is the cat, but the parasite can be carried by the vast majority of warm-blooded animals, including humans.
- Toxoplasmosis the disease of which T. gondii is the causative agent, is usually minor and self-limiting but can have serious or even fatal effects on a fetus whose mother first contracts the disease during pregnancy or In an immunocompromised human or cat.
- transduced A transduced cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques.
- transduction encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration.
- Tuberculosis A common and often deadly infectious disease caused by mycobacteria, mainly Mycobacterium tuberculosis. Tuberculosis usually attacks the lungs but can also affect the central nervous system, the lymphatic system, the circulatory system, the genitourinary system, the gastrointestinal system, bones, joints, and even the skin. Other mycobacteria such as Mycobacterium bovis, Mycobacterium africanum, Mycobacterium canetti, and Mycobacterium microti also cause tuberculosis, but these species are less common.
- a nucleic acid molecule as introduced into a host cell, thereby producing a transduced host cell.
- a vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication.
- a vector may also include one or more selectable marker genes and other genetic elements known in the art.
- Vaccine Composition that when administered to a subject, induces a decrease of the severity of the symptoms of a disorder or disease.
- a vaccine decreases the severity of the symptoms associated with infection by Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma, and/or decreases the parasitic load.
- Adjuvants are used in conjunction with an antigen to modify or augment the immunogenic effects of the antigen.
- Adjuvants function by mimicking specific sets of evolutionarily conserved molecules which include liposomes, lipopolysaccharide (LPS), components of bacterial cell walls, and endocytosed nucleic acids (such as double-stranded RNA, single-stranded DNA, and unmethylated CpG dinucleotide- containing DNA).
- LPS lipopolysaccharide
- endocytosed nucleic acids such as double-stranded RNA, single-stranded DNA, and unmethylated CpG dinucleotide- containing DNA.
- DCs dendritic cells
- lymphocytes lymphocytes
- macrophages macrophages
- adjuvant results in a more potent immune response to the antigen.
- adjuvants have a high level of toxicity and trigger severe local inflammation, as well as other undesirable side effects, there is a need to develop alternative adjuvants that are both safe and effective.
- sand fly polypeptides that surprisingly behave as potent "non-classical" adjuvants.
- these polypeptides are immunogenic.
- they are more potent immunologically than classical adjuvants and much smaller amounts of the disclosed polypeptides are required to prime or enhance an immune response against an antigen.
- classical adjuvants cause various undesirable side effects in subjects.
- non-classical adjuvant is immunogenic and can induce an immunologic response (such as a recall or T cell memory response)
- its ability to prime or enhance an immune response against an antigen is more long-lasting than that generated by classical adjuvant.
- a sand fly salivary gland or midgut polypeptide is a very potent immunogen that can elicit a strong immune response against an antigen in a subject even when administered in small quantities (for example, nanogram (ng) or microgram ( ⁇ g) quantities).
- a disclosed salivary gland polypeptide is administered to a subject in a dose ranging between 1 ng/dose and 500 mg/dose.
- classical adjuvant is typically administered in a dose ranging between 100 ⁇ g/dose and 500 ⁇ g/dose, and the salivary gland polypeptide can be administered in this dose as well.
- the immunogenic sand fly polypeptides of this disclosure can be an isolated polypeptide from any vector species of sand fly, such as a Phlebotomus or Lutzomyia sand fly, for example (but not limited to) Phlebotomus papatasi, Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P. sergenti, P. arabicus, P. tobbi, or Lutzomyia longipalpis.
- the sand fly polypeptide can be a salivary gland polypeptide or a midgut polypeptide.
- the disclosed polypeptides prime or enhance an immune response to an antigen in the subject. More specifically, the disclosed polypeptides induce a lymphocytic response to the antigen in the subject.
- the lymphocytic response can be a B lymphocyte response, a T lymphocyte response, an NKT cell response or an NK cell response, or a combination thereof.
- a T lymphocyte response can be a memory T cell response, or more specifically, a CD4 + or a CD8 + T cell response.
- Specific CD4 + T cell responses include a ThI or a Th2 response.
- Exemplary immunogenic sand fly salivary gland polypeptides include a polypeptide having an amino acid sequence as set forth as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 6.
- immunogenic sand fly polypeptides include sand fly salivary polypeptide sequences disclosed in PCT/US2003/034453 filed October 29, 2003; PCT Application No. PCT/US03/29833, filed September 18, 2003; and
- immunogenic sand fly salivary gland polypeptides include those disclosed in Kato et al, BMC Genomics, 7:226, 2006; Anderson et al, BMC Genomics, 7:52, 2006; Oliveira et al, Vaccine, 24:374-390, 2006; Valenzuela et al, J. Exp. Biol, 207:3717-3729, 2004, each of which is incorporated herein by reference.
- argentipes salivary gland polypeptides include PpSP15-like protein, apyrase, yellow protein, antigen 5-related protein, PpSP32-like ptorein, D7-related protein, and endonuclease-like protein.
- Exemplary immunogenic P. duboscqi salivary gland polypeptides include PpSP14-like proteins, PpSP15-like proteins, PpSP12-like proteins, D7-like proteins, antigen 5-related protein, apyrase-like protein, yellow- related protein.
- the immunogenic sand fly polypeptide is a sand fly midgut polypeptide disclosed in (Dillon et al., Genomics, 88:831-840, 2006; Ramalho-Ortigao et al., BMC Genomics, 9:300, 2007; Jochim et al, BMC Genomics 2008;9: 15), incorporated herein by reference.
- Exemplary immunogenic Lu Exemplary immunogenic Lu.
- longipalpis midgut polypeptides include trypsin 1, trypsin 2, trypsin 3, trypsin 4, chymotrypsin, carboxypeptidase, peritrophin, astacin, microvillar-like protein, glutathione s-transferase, catalase, peroxiredoxins, glyceraldehydes-3 -phosphate dehydrogenase, fructose-bisphosphate aldolase, and enolase.
- Exemplary immunogenic P Exemplary immunogenic P.
- papatasi midgut polypeptides include microlli protein, peritrophin, chymotrypsin, carboxypeptidase, typsin, ribosome associated membrane protein, astacin, glutathione s-transferase, and chitinase.
- Immunogenic sand fly polypeptides can be a polypeptide at least 80%, 85%, 90%, 95%, or 99% homologous to the salivary gland or midgut polypeptides disclosed herein, or a conservative variant, a homolog or an immunogenic fragment comprising at least eight or at least ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides.
- an isolated nucleic acid sequence encoding the sand fly polypeptide can be from any vector species of sand fly, such as a Phlebotomus or Lutzomyia sand fly, for example (but not limited to) Phlebotomus papatasi, Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P. sergenti, P. arabicus, P. tobbi, or Lutzomyia longipalpis.
- Phlebotomus or Lutzomyia sand fly for example (but not limited to) Phlebotomus papatasi, Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P. sergenti, P. arabicus, P. tobbi, or Lutzomyi
- Exemplary polynucleotide sequences encoding a sand fly polypeptide include the nucleic acid sequence as set forth as SEQ ID NO: 5 (the unprocessed protein is encoded by nucleic acids 16-360 of SEQ ID NO:5, and the mature protein is encoded by the nucleic acid sequence 82- 360 of SEQ ID NO:5), SEQ ID NO: 7 (the unprocessed protein is encoded by nucleic acids 20-1216 of SEQ ID NO: 7, and the mature protein is encoded by the nucleic acid sequence 74-1216 of SEQ ID NO:7), SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10.
- polynucleotide encoding a sand fly polypeptide is a polynucleotide having at least 80%, 85%, 90%, 95%, or 99% homology to one of the sequences disclosed herein.
- an isolated nucleic acid sequence encoding the sand fly polypeptide is administered to a subject in a dose ranging between 5 ⁇ g/dose and 50 ⁇ g/dose.
- classical adjuvant is typically administered in a dose ranging between 100 ⁇ g/dose and 500 ⁇ g/dose.
- the polynucleotides of the disclosure include sequences that are degenerate as a result of the genetic code.
- a recombinant vector comprises an isolated nucleic acid sequence encoding at least one sand fly salivary gland polypeptide disclosed herein.
- the two or more sand fly salivary gland polypeptide(s) are encoded by the same recombinant vector.
- the two or more polypeptide(s) are encoded by different recombinant vectors.
- the sand fly polynucleotides include a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (for example, a cDNA) independent of other sequences.
- the nucleotides can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide. The term includes single and double forms of either nucleotide.
- Recombinant vectors are also disclosed herein that include a polynucleotide encoding a polypeptide or a fragment thereof according to the disclosure. Recombinant vectors include plasmids and viral vectors and may be used for in vitro or in vivo expression.
- a plasmid may include a DNA transcription unit, for instance a nucleic acid sequence that permit it to replicate in a host cell, such as an origin of replication (prokaryotic or eukaryotic).
- a plasmid may also include one or more selectable marker genes and other genetic elements known in the art. Circular and linear forms of plasmids are encompassed in the present disclosure.
- the promoter is generally of viral or cellular origin.
- the cytomegalovirus (CMV) early promoter (CMV-IE promoter) is of use.
- the CMV-IE promoter can be of human or murine origin, or of other origin such as rat or guinea pig (see EP 0260148; EP 0323597; WO 89/01036; Pasleau et al, Gene 38:227-232, 1985; Boshart M. et al, Cell 41 :521-530, 1985). Functional fragments of the CMV-IE promoter may also be used (WO 98/00166).
- the SV40 virus early or late promoter and the Rous Sarcoma virus LTR promoter are also of use.
- Other promoters include but are not limited to, a promoter of a cytoskeleton gene, such as (but not limited to) the desmin promoter (Kwissa M. et al, Vaccine 18(22):2337-2344, 2000), or the actin promoter (Miyazaki J. et al, Gene 79(2):269-277, 1989).
- the desmin promoter Kermanent promoter
- actin promoter Miyazaki J. et al, Gene 79(2):269-277, 1989.
- the polypeptides and polynucleotides of the disclosure can be included in an immunogenic composition or a vaccine.
- the immunogenic composition or vaccine consists of the immunogenic sand fly polypeptide alone.
- the immunogenic composition or vaccine comprises the immunogenic polypeptide and an antigen.
- the antigen can be from an infectious disease or from a neoplast disease (such as a tumor). In one specific embodiment, the antigen is from an infectious disease, wherein the disease is not leishmaniasis.
- the infectious disease can have a viral, chlamydial, rickettsial, bacterial, fungal, protozoan, or helminth origin.
- the virus causes a respiratory disorder (for example, adeno, echo, rhino, coxsackie, influenza, parainfluenza, or respiratory syncytial virus), a digestive disorder (for example, rota, parvo, dane particle, or hepatitis A virus), an epidermal- epithelial disorder (for example, verruca, papilloma, molluscum, rubeola, rubella, small pox, cowpox), a herpes virus disease (for example, varicella-zoster, simplex I, or simplex II virus), an arbovirus disease (for example, dengue, yellow, or hemorrhagic fevers), a viral disease of the central nervous system (for example, polio or rabies), a viral heart disease, or acquired immune defic
- the chlamydia antigen is an antigen that causes ornithosis (C. psittac ⁇ ), chlamydial urethritis and cervicitis (C. trachomatis), inclusion conjunctivitis (C trachomatis), trachoma (C trachomatis), or lymphogranuloma venereum (C trachomatis)).
- the rickettsia antigen is an antigen that causes typhus fever (R. prowazekii), Rocky Mountain spotted fever (R. rickettsi), scrub fever (R. tsutsugamushi), or Q fever (Coxiella burnetii).
- the bacteria antigen is a Pyogenic cocci antigen and causes, for example, staphylococcal, streptococcal, pneumococcal, meningococcal, and gonococcal infections; a gram-negative rod antigen and causes, for example, E. coli, Klebsiella, enterobacter, pseudomonas, or legionella infections; a childhood bacteria and causes, for example, hemophilus influenza, bordetella pertussis, or diphtheria infections.
- enteropathic bacteria for example, S. typhi
- Clostridia for example, C. tetani or C. botulinum
- mycobacteria for example, M. tuberculosis or M. leprae.
- the fungal antigen is an antigen from Candidae (for example, C. albicans) or Aspergillis (for example, A.fumigatus).
- the protozoan antigen is from, for example, Giardia Lamblia, Trichomoniasis, Pneumocystosis, Plasmodium, Leishmania, or Toxoplasma.
- the helminth antigen is from, for example, Trichuris, Necator americanus (hookworm disease), Ancylostoma duodenale (hookworm disease), Trichinella spiralis, or S. mansoni.
- the antigen is referred to as a "target antigen," wherein the target antigen is an antigen other than a sand fly salivary gland polypeptide antigen.
- the immunogenic compositions and vaccines include a nucleic acid sequence encoding the target antigen. It will be understood that known or later discovered infectious disease- associated antigens can be used in the compositions and methods of the present invention as target antigens for treating or preventing infectious diseases.
- the disease antigen can be a tumor antigen.
- the tumor can be of any organ or tissue, including but not limited to solid organ tumors.
- the tumor can be melanoma, colon-, breast-, lung, cervical-, ovarian, endometrial-, prostate-, skin-, brain-, liver-, kidney, thyroid, pancreatic, esophageal-, or gastric cancer, leukemias, lymphomas, multiple myeloma, myelodysplastic syndrome, premalignant HPV-related lesions, intestinal polyps and other chronic states associated with increased tumor risk.
- tumor-associated antigens can be used in the compositions and methods of the present invention as target antigens for treating or preventing a tumor.
- the immune response caused by the polypeptides and polynucleotides of this disclosure can be a humoral response or a cellular response.
- the immune response is a B cell, a T cell, an NKT cell, or an NK cell response or a combination thereof.
- a T cell response can be a CD4 + T helper cell response or a memory T cell response, or more specifically, a CD4 + or a CD8 + T cell response.
- a CD4 + T helper cell response is a ThI response, in other embodiments, a CD4 + T helper cell response is a Th2 response.
- a ThI type response can allow macrophages to take up Leishmania antigens and present them to T cells in a ThI context.
- the induction the ThI response can enhance an immune response, or can prime the immune system of the mammalian host in response to a later infection.
- the T cell response can also enhance an immune response against a disease or target antigen, for example an antigen from an infectious disease or a tumor, or can prime the immune system of the mammalian host for preventative immunity against a disease antigen in response to a later infection.
- any assay known in the art can be used to test the ability of the disclosed sand fly polypeptdies to induce an immune response, or more specifically a memory T cell response.
- the proliferation of memory T cells is measured.
- an agent for example, sand fly polypeptide
- the methods include comparing the proliferation of a memory T cell contacted by a sand fly polypeptide to the proliferation of a control cell in the absence of the sand fly polypeptide.
- the expression of a cell surface marker in a cell treated with a candidate agent is compared to untreated control samples to identify a sand fly polypeptide that increases the expression of the cell surface marker in the contacted cell.
- Polypeptide expression or activity can be compared by procedures well known in the art, such as Western blotting, flow cytometry, immunocytochemistry, binding to magnetic and/or surface marker-specific antibody-coated beads, in situ hybridization, fluorescence in situ hybridization (FISH), ELISA, microarray analysis, RT-PCR, Northern blotting, or calorimetric assays, such as the Bradford Assay and Lowry Assay.
- a candidate agent for example, sand fly polypeptide
- Polypeptide expression or activity can be compared by procedures well known in the art, such as Western blotting, flow cytometry, immunocytochemistry, binding to magnetic and/or surface marker-specific antibody-coated beads, in situ hybridization, fluorescence in situ hybridization (FISH), ELISA, microarray analysis,
- the present disclosure provides methods of using a sand fly salivary gland or midgut polypeptides to prime and/or enhance an immune response against an antigen in a subject.
- the sand fly salivary gland or midgut polypeptide acts as an adjuvant for an antigen.
- the antigen can be any polypeptide other than a salivary gland polypeptide, for example, an antigen of an organism causing a disease, for example a Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma antigen, or a nucleic acid sequence encoding such polypeptides.
- the immunogenic compositions and the vaccines disclosed herein can be administered for preventative and therapeutic treatments.
- compositions are administered to a subject at risk of acquiring a disease, such as (but not limited to) diseases caused by Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma, in a therapeutically effective amount, which is an amount sufficient to prevent the disease or a sign or symptom of the disease.
- a disease such as (but not limited to) diseases caused by Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma
- compositions are administered to a subject suffering from a disease, such as (but not limited to) diseases caused by Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma, in a therapeutically effective amount, which is an amount sufficient to cure, treat, or at least partially arrest the disease or a sign or symptom of the disease. Amounts effective for this use will depend upon the severity of the disease and the general state of the subject's health.
- the immunogenic compositions and the vaccines disclosed herein can be used in a method for treatment of diseases caused, for example, by Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma.
- the methods provided herein include the administration of at least one sand fly salivary gland or midgut polypeptide to a subject.
- the methods provided herein include the administration of at least one polynucleotide encoding a sand fly salivary gland or midgut polypeptide.
- An antigen of an organism causing a disease can be administered in conjunction with (before, concurrently, or after) the administration of the sand fly polypeptide or polynucleotide.
- the sand fly polypeptides and polynucleotides can be included in an immunogenic composition or vaccine according to the disclosure.
- An antigen, a pharmaceutically acceptable carrier, and/or other agents can also be included in an immunogenic composition or vaccine containing the sand fly polypeptide or polynucleotide.
- An immunogenic composition or a vaccine according to the disclosure can be prepared in accordance with standard techniques well known to those skilled in the pharmaceutical or veterinary art. Such compositions can be administered in dosages and by techniques well known to those skilled in the medical or veterinary arts, taking into consideration such factors as the age, sex, weight, species, and condition of the particular subject, and the route of administration.
- the sand fly salivary gland or midgut polypeptides and antigen can be administered by any means known to one of skill in the art (See Banga, A., "Parenteral Controlled Delivery of Therapeutic Peptides and Proteins," Therapeutic Peptides and Proteins, Technomic Publishing Co., Inc., Lancaster, PA, 1995) such as by intramuscular (IM), intradermal (ID), subcutaneous (SC), or intravenous injection, but even oral, nasal, or anal administration is contemplated.
- administration is by subcutaneous, intradermal, or intramuscular injection using a needleless injector (BiojectorTM, Bioject, Oregon, USA).
- the sand fly protein can be provided as an implant, an oily injection, or as a particulate system.
- the particulate system can be a microparticle, a microcapsule, a microsphere, a nanocapsule, or similar particle, (see, for example, Banja, supra).
- a particulate carrier based on a synthetic polymer has been shown to provide a controlled release.
- sand fly polypeptide, disease antigen, or both can be administered concurrently (for example, different compositions given during the same period of time via the same or different routes, or at the same or different sites, or a same composition given in the same period of time via different routes), or sequentially (for example, the same or different compositions given at least two times via the same or different routes).
- Sand fly polypeptides can be administered separately, but are preferably administered together, in the same immunogenic composition or vaccine as the antigen.
- Sand fly polynucleotides are preferably administered in separate immunogenic compositions, at different sites of injection, from the polynucleotide encoding the antigen.
- sand fly polynucleotides can be administered at the same injection site and/or in the same immunogenic composition or vaccine as the antigen polynucleotide.
- the sand fly salivary gland or midgut protein is administered before the antigen against which the immune response is mounted.
- the sand fly salivary gland or midgut polypeptide can be administered one time, two times, or more before the administration of the antigen.
- the sand fly salivary gland or midgut polypeptide can be administered one time, followed by the administration of antigen one time, two times, three times, or more.
- the sand fly salivary gland or midgut polypeptide is administered concurrently with the antigen.
- the concurrent administration of sand fly salivary gland or midgut polypeptide and antigen can be done one time, two times, three times or more.
- the sand fly salivary gland or midgut polypeptide can be administered in the same immunogenic composition or vaccine as the antigen, or in separate immunogenic compositions or vaccines from the antigen.
- the sand fly salivary gland or midgut protein is administered after the antigen against which the immune response is mounted.
- the sand fly salivary gland or midgut polypeptide can be administered one time, two times, or more after the administration of the antigen.
- the antigen can be administered two times, three times, or more prior to the administration of the sand fly salivary gland or midgut polypeptide.
- the delay between two sequential administrations is no more than 1 week, no more than two weeks, no more than three weeks, no more than four weeks, nor more than five weeks, or no more than six weeks. Following vaccination, annual boost administrations may be done.
- the sand fly polypeptide or disease antigen(s) may be in admixture with a suitable vehicle or excipient such as sterile water, physiological saline, glucose, or the like.
- a suitable vehicle or excipient such as sterile water, physiological saline, glucose, or the like.
- the compositions can contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, adjuvants, gelling, or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. Standard texts, such as Remington's Pharmaceutical Science, 17th edition, 1985, incorporated herein by reference, may be consulted to prepare suitable preparations, without undue experimentation.
- the compositions can also be lyophilized.
- Suitable dosages can also be based upon the examples below.
- the route of administration can be intradermal (ID), intramuscular (IM), subcutaneous (SC), intravenous, oral, nasal, or anal.
- This administration can be made with a syringe and a needle or with a needle-less apparatus like, for example, BiojectorTM (Bioject, Oregon, USA).
- sand fly polypeptide dosages can be from about 1.0 ng/dose to about 1.0 ⁇ g/dose, from about 50 ng/dose to about 500 ng/dose, or from about 100 ng/dose to about 300 ng/dose.
- sand fly polypeptide dosages can be from about 1.0 ⁇ g/dose to about 100 ⁇ g/dose, from about 5 ⁇ g /dose to about 50 ⁇ g /dose, or from about 5 ⁇ g dose to about 10 ⁇ g /dose.
- Suitable dosages of antigen (polypeptide) in mice can be from about 1 ⁇ g/dose to about 500 ⁇ g/dose or 5 ⁇ g/dose to about 50 ⁇ g/dose.
- the antigen dose can be from about 5 ⁇ g/dose to about 750 ⁇ g/dose or from 50 ⁇ g/dose to about 500 ⁇ g/dose.
- the dose of sand fly polypeptide and antigen is administered in about a 1 :2, 1 :3, or 1 :4 ratio (sand fly polypeptide: antigen).
- the volume of a dose can be between about 1.0 ⁇ l and 1.0 ml or between about 0.1 ml and about 0.5 ml.
- using a needle-less apparatus the volume of a dose can be about 0.25 ml.
- the volumes are from about 0.1 ml to about 2 ml.
- the volumes are from about 0.5 ml to about 1 ml.
- the above volumes are used in intramuscular injections.
- the volume of an intradermal dose can be about 10 ⁇ l to about 200 ⁇ l, or about 50 ⁇ l to about 100 ⁇ l (for dogs, monkey, or humans) or 1 ⁇ l to about 50 ⁇ l or about 10 ⁇ l to about 20 ⁇ l (for mice or hamsters).
- the route of administration can be ID, IM, SC, intravenous, oral, nasal, or anal.
- This administration can be made with a syringe and a needle or with a needle-less apparatus like, for example, BiojectorTM.
- the dosage for mice is from about 1.0 ⁇ g to about 50 ⁇ g plasmid per dose.
- the plasmid encoding the sand fly salivary gland or midgut protein is present at a dosage of about 5 ⁇ g, 10 ⁇ g, 20 ⁇ g, 30 ⁇ g, or 40 ⁇ g.
- the dosage for larger mammals is about 10 ⁇ g to about 500 ⁇ g plasmid per dose, or a dosage of about 50 ⁇ g, 100 ⁇ g, 200 ⁇ g, 300 ⁇ g, or 400 ⁇ g.
- Suitable dosages of antigen (nucleic acid molecule encoding the polypeptide) in mice can be from about 5 ⁇ g/dose to about 500 ⁇ g/dose or 10 ⁇ g/dose to about 50 ⁇ g/dose.
- the antigen dose can be from about 50 ⁇ g/dose to about 750 ⁇ g/dose or from 100 ⁇ g/dose to about 500 ⁇ g/dose.
- the dose of nucleic acid encoding sand fly polypeptide and nucleic acid encoding antigen is administered in about a 1 :2, 1 :3, or 1 :4 ratio.
- the volume of a dose can be between about 0.1 ml and about 0.5 ml. In another embodiment, the volume of a dose can be about 0.25 ml.
- Administration is preferably performed using multiple points of injection. In one embodiment, for conventional injection with a syringe and a needle, the volumes are from about 0.1 to about 2 ml. In another embodiment, the volumes are from about 0.5 to about 1 ml.
- the dosages are the same as those mentioned above.
- the above volumes are used in intramuscular injections.
- the volume of an intradermal dose can be about 10 ⁇ l to about 200 ⁇ l, or about 50 ⁇ l to about 100 ⁇ l (for dogs, monkey, or humans) or 1 ⁇ l to about 50 ⁇ l or about 10 ⁇ l to about 20 ⁇ l (for mice or hamsters).
- the route of administration can be ID, IM, SC, intravenous, oral, nasal, or anal.
- This administration can be made with a syringe and a needle or with a needle-less apparatus like, for example, BiojectorTM.
- the dosage is from about 10 3 pfu to about 10 9 pfu per recombinant poxvirus vector.
- the dosage is from about 10 5 pfu to about 10 9 pfu.
- the dosage is from about 10 6 pfu to about 10 8 pfu.
- the volume of needle-less apparatus doses could be between about 0.1 ml and about 0.5 ml. In another embodiment, the volume of needle-less apparatus dose is 0.25 ml. In yet another embodiment, administration is performed using multiple points of injection. In one embodiment, for conventional injection with a syringe and a needle, the volumes are from about 0.1 to about 2 ml. In another embodiment, the volumes are from about 0.5 to about 1 ml. The dosages are the same as mentioned above. In one embodiment, when a syringe with a needle is used, the injection is IM. In specific embodiments the above volumes are used in intramuscular injections.
- the volume of an intradermal dose can be about 10 ⁇ l to about 200 ⁇ l, or about 50 ⁇ l to about 100 ⁇ l (for dogs, monkey, or humans) or 1 ⁇ l to about 50 ⁇ l or about 10 ⁇ l to about 20 ⁇ l (for mice or hamsters).
- the sand fly salivary gland or midgut polynucleotide is administered before the polynucleotide encoding the antigen against which the immune response is mounted.
- the sand fly salivary gland or midgut polynucleotide can be administered one time, two times, or more before the administration of the antigen polynucleotide.
- the sand fly salivary gland or midgut polynucleotide can be administered one time, followed by the administration of antigen polynucleotide one time, two times, three times, or more.
- the sand fly salivary gland or midgut polynucleotide is administered concurrently with the antigen polynucleotide, preferably at different injection sites.
- the concurrent administration of sand fly salivary gland or midgut polynucleotide and antigen polynucleotide can be done one time, two times, three times or more.
- At least one prime-administration can be done with a composition containing a plasmid according to the disclosure, followed by at least one booster administration done with a composition containing a recombinant viral vector according to the disclosure, on the condition that a same antigen is present twice, coded by the plasmid and by the viral vector.
- the booster administration can be done with a composition containing a polypeptide according to the disclosure, on the condition that the same antigen is present twice, coded by the prime-administration plasmid and in the booster polypeptide-based composition.
- the prime and the boost are both polypeptide- based compositions, on the condition that the same antigen is present in both steps.
- the dosage of plasmids and recombinant viral vectors are the same as above.
- the prime and boost administrations can be done with a polypeptide- based composition.
- the dosage of the sand fly polypeptide is from about 1.0 ng/dose to about 1.0 ⁇ g/dose, from about 50 ng/dose to about 500 ng/dose, or from about 100 ng/dose to about 300 ng/dose.
- U.S. Patent No. 5,880,103 describes several methods of delivery of nucleic acids encoding immunogenic peptides or other antigens to an organism. The methods include liposomal delivery of the nucleic acids (or of the synthetic peptides themselves), and immune- stimulating constructs, or ISCOMS TM, negatively charged cage-like structures of 30- 40 nm in size formed spontaneously on mixing cholesterol and Quil ATM (saponin).
- a sand fly salivary gland or midgut polypeptide, or an immunogenic fragment thereof can also be expressed by attenuated viral hosts or vectors or bacterial vectors.
- Recombinant vaccinia virus, adeno-associated virus (AAV), herpes virus, retrovirus, or other viral vectors can be used to express the peptide or protein, thereby eliciting a CTL response.
- vaccinia vectors and methods useful in immunization protocols are described in U.S. Patent No. 4,722,848.
- BCG Bacillus Calmette Guerin
- a nucleic acid encoding a sand fly salivary gland or midgut polypeptide, or an immunogenic fragment thereof is introduced directly into cells, with our without antigen.
- the nucleic acid may be loaded onto gold microspheres by standard methods and introduced into the skin by a device such as Bio-Rad's HeliosTM Gene Gun.
- a needless injector can also be utilized, such as a Bioinjector2000TM.
- the nucleic acids can be "naked," consisting of plasmids under control of a strong promoter.
- the DNA is injected into muscle, although it can also be injected directly into other sites.
- Exemplary dosages for injection are around 0.5 ⁇ g/kg to about 50 mg/kg, and typically are about 0.005 mg/kg to about 5 mg/kg (see, for example, U.S. Patent No. 5,589,466).
- a prime-boost strategy for immunization is utilized.
- compositions are administered depending on the dosage and frequency as required and tolerated by the subject.
- the dosage is administered once as a bolus, but in another embodiment can be applied periodically until a therapeutic result is achieved.
- the dose is sufficient to treat or ameliorate symptoms or signs of disease without producing unacceptable toxicity to the subject.
- the dosage of the composition varies depending on the weight, age, sex, and method of administration. The dosage can also be adjusted by the individual physician as called for based on the particular circumstances.
- the compositions can be administered conventionally as vaccines containing the active composition as a predetermined quantity of active material calculated to produce the desired therapeutic or immunologic effect in association with the required pharmaceutically acceptable carrier or diluent (for instance, carrier or vehicle).
- carrier or vehicle for instance, carrier or vehicle.
- about 50 ng of a DNA construct vaccine of the present disclosure can be injected intradermally three times at two week intervals to produce the desired therapeutic or immunologic effect.
- a about 1 mg/Kg dosage of a protein vaccine of the present disclosure can be injected intradermally three times at two week intervals to produce the desired therapeutic or immunologic effect.
- a vaccine is provided herein that includes a sand fly salivary gland or midgut polypeptide, with or without antigen.
- Other embodiments of a vaccine include sand fly salivary gland or midgut polynucleotide, with or without polynucleotide encoding antigen.
- Administration of the vaccine to a subject results in a primed or enhanced immune response against an antigen from an organism that causes disease, such as a Leishamania, Plasmodium, Mycobacterium, hookworm, or toxoplasma antigen.
- the subject is a human subject.
- the subject is a canine subject, such as a dog.
- Vector molecules relevant for such interactions include midgut and salivary proteins. These potential targets for interruption of propagation of Leishmania parasites have been poorly characterized. Transcriptomic analysis has proven to be an effective tool for identification of new sand fly molecules, providing exciting new insights into vector-based control strategies against leishmaniasis.
- Leishmaniasis is a vector-borne neglected infectious disease that afflicts 88 countries with an estimated incidence of two million new cases each year. With expanding endemicity, an estimated 350 million people at risk and 2,357,000 disability-adjusted life years lost, leishmaniasis is becoming a worldwide re-emerging public health problem.
- leishmaniasis is the wide spectrum of distinct clinical manifestations that include visceral, cutaneous, mucocutaneous, and diffuse cutaneous leishmaniasis.
- Leishmaniasis is sustained through a triad of complex interactions between Leishmania parasites, the sand fly, and the mammalian host.
- Leishmania parasites undergo a complex developmental cycle within the midgut that is necessary for generation of infectious metacyclics (vector-parasite interface).
- vector sand fly species Leishmania parasites undergo a complex developmental cycle within the midgut that is necessary for generation of infectious metacyclics (vector-parasite interface).
- the natural mode of transmission to the mammalian host is by the bite of an infective sand fly. At the bite site, sand flies release an array of pharmacologic, immunomodulatory, and immunogenic molecules that have immediate and long-lasting effects on the host (the vector-host interface).
- the Phlebotomus (Old World) and Lutzomyia (New World) genera include the majority of anthropophilic sand flies and are the most important vectors of leishmaniasis. Establishment of a transmissible Leishmania infection within the vector sand fly occurs solely within the lumen of the midgut. Once a sand fly feeds on an infectious host, it ingests a blood meal containing Leishmania-infected macrophages, beginning the life cycle in the sand fly. Amastigotes are released after rupture of the macrophage and differentiate into several developmental stages, from flagellated procyclics to infectious-stage metacyclic promastigotes.
- midgut of a sand fly is therefore a fundamental organ representing a key target for interruption of Leishmania development and transmission. Despite the importance of this organ, very few molecules in the midgut of sand flies have been characterized to date.
- Transcriptomics is a powerful tool for rapid identification of molecules expressed in a whole organism or particular tissue.
- Dillon et al. ⁇ Genomics 2006;88:831-40 generated 10,203 transcripts using whole Lutzomyia longipalpis sand flies that combined unfed, blood- fed, and flies infected with a variety of pathogens including Leishmania, providing a global descriptive repertoire of sand fly molecules. This was followed by more refined midgut-specific analysis of 2,934 transcripts from Lu.
- Midgut proteases facilitate blood-meal digestion and are likely to confer some defense against ingested organisms.
- Leishmania promastigotes in the midgut lumen of sand flies has been shown to inhibit proteolytic activity. Infections initiated with Leishmania amastigotes, a more natural mode of infection, also caused a delay in trypsin and aminopeptidase activity.
- Leishmania amastigotes a more natural mode of infection, also caused a delay in trypsin and aminopeptidase activity.
- anti-saliva immune response is not directed against Leishmania parasites.
- a DTH response to saliva affects the initial steps in establishment of Leishmania infection in the mammalian host.
- This anti-saliva immune response may alter the type and activation of macrophages or other host cells that otherwise would silently maintain the parasites. This could result in direct killing of Leishmania parasites, thus reducing the infective load.
- a ThI anti-saliva immunity may create an environment that accelerates priming of a protective ThI anti-Leishmania immunity. Under these circumstances, any protein that induces a ThI response in the dermis would affect Leishmania infection.
- the significance of anti-saliva immunity lies in the fact that, in nature, these sand fly salivary proteins will always be present at the site of Leishmania deposition during transmission. Indeed, salivary proteins can be considered "non-classical natural adjuvants.”
- Sandfly salivary gland transcriptomics Transcriptomics represent a rapid and efficient method to identify the most abundant secreted proteins from salivary glands of pertinent vectors of disease.
- Use of sand fly salivary gland transcriptomics resulted in the identification of complete sets of secreted salivary proteins from glands of several relevant vectors of cutaneous (P. papatasi, P. duboscqi) (Valenzuela et al, J Exp Med 2001; 194:331-42; Kato et al, BMC Genomics 2006;7:226) and visceral
- the salivary gland transcriptome of P. papatasi identified two DTH-inducing molecules that produced contrasting protective (PpSP 15) and exacerbative (PpSP44) outcomes of L. major infection (Oliveira et al, PLoS Negl Trop Dis 2008;2:e226). This study demonstrated that not all DTH-inducing molecules are protective and that some produce a Th2 profile that is exacerbative. It also validated the transcriptomic approach for identification of protective molecules by corroborating the protective nature of PpSP 15 against L. major infection in mice. The contrasting immune responses to PpSP 15 and PpSP44 provided the first evidence that anti-saliva immunity alters the environment in the skin hours following sand fly bites.
- Maxadilan from Lutzomyia longipalpis and PpSP 15 from Phlebotomus papatasi have shown promise as protective molecules against leishmaniasis (Morris et ah, J Immunol 167: 5226- 5230, 2001; Valenzuela et ah, J Exp Med 194: 331-342). It is proposed that immunity to maxadilan neutralizes exacerbation of L. major infection, while immunization with PpSP 15 results in protection of wild-type and B-cell deficient mice indicating that cellular immunity to PpSP 15 is sufficient for protection.
- P. papatasi Israeli strain sand flies were reared at the Walter Reed Army Medical Research Institute and at the Laboratory of Malaria and Vector Research, NIAID, NIH, as described elsewhere (Valenzuela et al, J Exp Med 194: 331-342, 2001).
- Preparation of salivary gland homogenate (SGH) and pre-exposure of mice (Charles River Laboratories Inc) to uninfected sand flies was carried out according to Valenzuela et al. (2001) and Kamhawi et al. (Science 290: 1351-1354, 2000). Experiments were performed using 6 to 8 weeks old C57BL/6 mice under pathogen free conditions. All animal studies were approved by the Animal Care and Use Committee at The National Institute of Allergy and Infectious Diseases. Construction of P. papatasi salivary DNA plasmids and immunization of mice.
- P. papatasi SGH Values are represented as ⁇ ear thickness (ear thickness of experimental groups subtracted from the mean ear thickness of na ⁇ ve mice 48 hours after injection with 0.5 pair of SGH). For measurements of Leishmania lesions, the largest diameter was recorded on a weekly basis. Ear thickness and lesion diameter were measured using a Digimatic caliper (Mitutoyo Corp.). Parasite load.
- Total genomic DNA was extracted from mice ears using the DNeasy tissue kit following the manufacturer's protocol (Qiagen). A total of 100 ng was amplified by real time PCR (LightCycler 480, Roche Diagnostics) using primers JWl 1 and JW12 (Nicolas et al, J Clin Microbiol 40: 1666-1669, 2002) and 18S primers as a housekeeping gene with the FastStart Sybr green I kit (Roche). The standard curve was generated using DNA from na ⁇ ve ears spiked with 10-fold serial dilutions of L. major DNA. Expression levels were normalized to 18S DNA and corrected for the weight of the whole ear. Values represent the relative number of parasites per ear. Intracellular Cytokines.
- Cells were recovered from the ear dermis as described previously (Belkaid et al, J Exp Med 188: 1941-1953, 1998). Cells (5xlO 6 ) were stimulated with or without 100 ⁇ g soluble Leishmania antigen (SLA) for 12 hours. The cells were then stimulated with 20 ng PMA and 500 ng ionomycin, in the presence of monensin (2 ⁇ M final concentration) for 4 hours. For surface markers, cells were washed, incubated for 15 min at 4°C with 2.4G2 mAb to block Fc ⁇ R, and stained with APC- Cy7 ⁇ CD4 (RM4-5) and APC-TCR ⁇ chain (H57-597) for 20 min at 4°C.
- SLA soluble Leishmania antigen
- the cells were fixed, permeabilized (Cytof ⁇ x/Cytoperm Plus; BD Pharmingen) and stained with PE-Cy7 ⁇ lFN- ⁇ (XMG 1.2) and PE ⁇ IL-4 (1 IBl 1).
- the data were collected using a FAC S Array (BD Biosciences) and analyzed with Flow Jo software (Tree Star).
- the lymphocytes were gated using size, granularity and surface markers. GEArray.
- RNA (6 ⁇ g) from a pool of seven ears was amplified and labeled with biotin 16-UTP (Roche Diagnostics) using the SuperArray TrueLabeling-RT Enzyme kit (Superarray).
- the resulting biotinylated cRNA was hybridized overnight to the Oligo GEArray® membrane. After washing and blocking the array membranes, alkaline phosphatase-conjugated streptavidin was added to the membrane followed by CDP-Star substrate. A chemiluminescent signal was acquired using the Image Station 2000 MM (Kodak). The data was analyzed using the GEArray Expression Analysis Suite (Superarray). Analysis parameters were set to local background correction and normalized to a set of housekeeping genes included in each membrane. Results were expressed as the fold increase in the intensity of the captured signal over the levels in na ⁇ ve ears challenged with SGH-LM. Only genes showing a four-fold or higher change in expression compared to the na ⁇ ve group in at least two of three independent experiments were considered. GEArray Validation.
- the genes that showed a four-fold or higher change in expression over control using the GEArray were validated by Real time PCR.
- Five ⁇ g of total RNA from mice ears was used for the synthesis of cDNA (Superscript III, Invitrogen) following the manufacturer's instructions.
- the cDNA was amplified with the 480 Master SYBR Green I mix (Roche Diagnostics) and gene specific primer sets for IFN- ⁇ , IL-4, IL-5, TNF- ⁇ and IL-12R ⁇ 2 (Superarray) using the LightCycler 480 (Roche Diagnostics).
- a standard curve for each set of primers was generated as recommended by the manufacturer.
- the expression levels of the genes of interest were normalized to endogenous 18S RNA levels. The results are expressed in fold change over naive ears challenged with SGH-LM. Statistical analysis.
- mice immunized with PpSP 15 showed a statistically significant (p ⁇ 0.05) DTH response 48 hours following challenge with SGH as measured by ⁇ ear thickness compared to control DNA-immunized mice (CTL DNA) (Fig. 1).
- CTL DNA DNA-immunized mice
- PpSP 12, PpSP14, PpAg5, PpSp32 and PpSP36 produced humoral responses, indicating in vivo expression of the corresponding proteins.
- PpSP 15 is a 15 kDa salivary protein of unknown function present only in sand flies.
- PpSP42 and PpSP44 are salivary proteins that belong to the Yellow family of proteins (Anderson et al, BMC Genomics 7: 52, 2006) with a predicted molecular weight of 42 and 44 kDa respectively.
- DNA immunization with distinct DTH-inducing salivary proteins can either promote or protect against L. major infection.
- Immunization with PpSP 15 DNA or protein was previously shown to produce a DTH response and to protect animals from L. major infection (Valenzuela et al, J Exp Med 194: 331-342, 2001).
- the protective nature of PpSP 15 is again disclosed herein, but the immunization with PpSP42 and PpSP44, the remaining DTH-inducing molecules, do not confer protection against L. major infection (Fig. 2).
- As predicted SGH or pre-exposure to uninfected sand fly bites also control L. major infection up to nine weeks post- challenge (Fig. 2).
- mice immunized with PpSP44 exacerbated the infection showing progressive lesions that were predominantly ulcerative.
- the lesion size in this group was not measured beyond week seven due to extensive tissue damage (Fig. 2).
- This group was chosen for comparison to protected PpSP15-immunized mice for a better understanding of the contribution of anti-saliva immunity through the course of Leishmania infection.
- PpSPIS-immunized mice show a three log reduction in parasite load compared to PpSP44-immunized mice following challenge with SGH-LM.
- the parasite load was investigated at 2, 6, 9 and 11 weeks post-infection in PpSP 15- and PpSP44- immunized mice. By 6 weeks post-infection, a significant decrease in parasite load was observed in mice immunized with PpSP 15 compared with control DNA or
- PpSP44-immunized mice PpSP15-immunized mice maintained a 3 log reduction in parasite load up to 11 weeks post-infection.
- Panels A-C show representative ears of PpSP44-, PpSP 15- and control DNA-immunized mice, respectively, 11 weeks postinfection (Fig. 3).
- the ears of PpSPl 5-immunized mice Panel B
- the ears of mice immunized with control DNA were intermediate showing ulcerated lesions with moderate tissue damage.
- the parasite loads were comparable in mice immunized with PpSP44 and control DNA, suggesting that the number of parasites in the ear of PpSp44- immunized animals was not entirely responsible for the extensive damage observed in these animals.
- PpSPIS-immunized mice produced four-fold higher IFN- ⁇ and three-fold lower IL-4 compared to PpSP44-immunized mice two weeks following challenge with SGH-LM.
- PpSP 15- and PpSP44-immunized mice correlates with the expression of IFN- ⁇ and IL-4 by CD4 + T cells recovered from the ears of these mice two weeks after challenge with SGH-LM (Fig. 4).
- SLA soluble Leishmania antigen
- 31.5% of CD4 + T cells in Pp SP 15 -immunized mice produced IFN- ⁇ compared to only 7.1% and 7.8% in mice immunized with PpSP44 and control DNA respectively (Fig. 4, top panels).
- IL-4 production was low in PpSP15-immunized mice (2.5% of CD4 + T cells).
- mice immunized with PpSP 15 and PpSP44 we compared the early mRNA expression profiles of the inflammatory cytokines in the ears of these mice two hours following challenge with SGH-LM.
- transcripts showing a four- fold or higher change in signal intensity of gene expression compared to na ⁇ ve controls were further analyzed and are presented in Table 1.
- PpSp 15 -immunized mice consistently produced high levels of IFN- ⁇ and IL-12-R ⁇ 2 and low levels of IL-4 and IL-5 (Table 1).
- PpSP44- immunized mice produced high levels of IL-4 and IL-5 and baseline levels of IFN- ⁇ transcripts.
- TNF- ⁇ transcripts were present at relatively high levels in mice immunized with PpSP15 and PpSP44 (Table 1).
- Real-time PCR was used to validate the results of the macroarray and showed that PpSP15-immunized animals induced a three-fold increase in IFN- ⁇ and IL-12-R ⁇ 2 messages compared to mice immunized with PpSP44 (p ⁇ 0.05) (Fig. 5).
- mice immunized with PpSP44 showed a 20-fold increase in the expression of IL-4 (p ⁇ 0.005) and no significant expression of IFN- ⁇ and IL-12-R ⁇ 2 (Fig. 5). No significant difference was observed in the expression of IL-5 or TNF- ⁇ .
- Table I Fold change in signal intensity of gene expression of inflammatory transcripts two hours following challenge with SGH-LM.
- mice immunized with PpSPlS and PpSP44 differentially induce IFN- ⁇ and IL-4 in response to uninfected sand fly bites.
- the amount of each salivary protein injected by sand flies during feeding is unknown. Therefore, it was investigated whether the early induction of IFN- ⁇ and IL-4 in mice immunized with PpSP 15 and PpSP44, observed by challenge with SGH-LM, is reproducible by challenge with sand fly bites.
- uninfected sand flies were used to demonstrate that this response remains unchanged in the absence of parasites.
- mice immunized with PpSP 15 showed a three-fold higher expression of IFN- ⁇ and a five-fold lower expression of IL-4 compared with PpSP44-immunized mice (Fig. 6).
- IL-12R ⁇ 2 or IL-5 There were no significant differences in the expression of IL-12R ⁇ 2 or IL-5 amongst mice immunized with PpSP 15, PpSP44 and control DNA.
- This response shows that an adaptive immune response specific to distinct salivary proteins is inducible as early as two hours following sand fly bites and that the amount of salivary protein injected by the bite of a sand fly is sufficient to produce a specific and strong recall response in immunized animals.
- ThI immune response and the production of IFN- ⁇ are correlated with protection from L. major infection in C57BL/6 mice (Heinzel et ah, Proc Natl Acad Sci USA 88: 7011-7015, 1991).
- Th2 immune response is associated with susceptibility.
- Earlier studies have demonstrated the potential of immunity to sand fly saliva in the control of Leishmania infection (Belkaid et al, J Exp Med 188: 1941-1953, 1998; Kamhawi et al, Science 290: 1351-1354, 2000; Morris et al, J Immunol 167: 5226-5230, 2001; Valenzuela et al, J Exp Med 194: 331-342, 2001).
- mice immunized with PpSP 15 controlled the infection and had significantly lower parasite load compared to na ⁇ ve mice, as previously reported (Valenzuela et al, J Exp Med 194: 331-342, 2001). In contrast, mice immunized with PpSP44 exacerbated the infection showing lesions with severe tissue erosion and maintaining a high number of parasites up to 11 weeks post-infection.
- mice protected from L. major infection through pre-exposure to sand fly bites showed an increase in the frequency of ear epidermal cells producing IFN- ⁇ and IL- 12 six hours after challenge (Kamhawi et al, Science 290: 1351-1354, 2000).
- This rapid production of IFN- ⁇ prompted an investigation of the expression profile of pro-inflammatory cytokines induced by PpSP 15 and PpSP44 at an early time point (two hours) following challenge with SGH-LM.
- Macroarray results validated by real-time PCR showed that mice immunized with PpSP 15 selectively induced transcripts associated with a ThI immune response (IFN- ⁇ and IL-12r ⁇ 2) and downregulated Th2 associated transcripts (IL-4).
- IL-12r ⁇ 2 is expressed on both activated ThI CD4 + cells and NK cells.
- NK cells could play a role in adaptive immunity and may be the source of the early IFN- ⁇ expression seen in PpSP15-immunized mice. Alternately, the possibility cannot be excluded that the up-regulation of IFN- ⁇ expression is by specific CD4 memory T cells that are rapidly recruited to the site of infection.
- PpSP44- immunized mice that exacerbated L. major infection selectively induced IL-4 (a marker of Th2 differentiation) and did not upregulate IFN- ⁇ showing the specificity of the observed immune responses to each of the salivary proteins.
- Leishmania is transmitted by sand fly bites it was investigated if the small amount of PpSP 15 or PpSP44 injected by sand flies during feeding is able to recall the same level and type of immunity observed in response to challenge with SGH-LM. Moreover, uninfected sand flies were used to investigate whether this response is specific to the salivary molecules and is not influenced by the presence of Leishmania parasites in SGH-LM. Sand fly bites induced an early up-regulation of IFN- ⁇ in PpSP15-immunized mice suggesting that this salivary protein can recall a protective ThI response by the natural route of exposure.
- PpSP44-immunized mice also reproduced the response observed following challenge with SGH-LM and maintained a high expression of IL-4 and a low expression of IFN- ⁇ (Fig. 6).
- infected flies are expected to inject more saliva as a result of difficulty in feeding and increased probing activity.
- This further confirms that an immune response specific to a salivary antigen that generates a DTH response with a ThI profile is able to confer protection against L. major infection, independent of other confounding factors present in the complex feeding behavior of the sand fly.
- Example 2 Immunity to a salivary protein of a sand fly vector protects against the fatal outcome of visceral leishmaniasis in a hamster model
- Visceral leishmaniasis is a fatal disease for humans and no vaccine is currently available.
- Sand fly salivary proteins have been associated with protection against cutaneous leishmaniasis.
- a hamster model was developed involving intradermal inoculation in the ear of 100,000 Leishmania infantum chagasi parasites together with Lutzomyia longipalpis saliva to mimic natural transmission by sand flies.
- Hamsters developed classical signs of VL rapidly, culminating in a fatal outcome five to six months postinfection. Saliva had no effect on the course of infection in this model. Immunization with 16 DNA plasmids coding for salivary proteins of Lu.
- LJM19-immunized hamsters maintained a low parasite load that correlated with an overall high IFN- ⁇ /TGF- ⁇ ratio and iNOS expression in the spleen and liver up to five months post-infection.
- a DTH response with high expression of IFN- ⁇ was also noted in the skin of LJM 19- immunized hamsters 48 hours following exposure to uninfected sand fly bites.
- salivary proteins The protective effect of salivary proteins is not exclusive to sand flies and CL. It has been demonstrated that animals pre-exposed to ticks were protected from tularemia and borreliosis and vaccination with a tick salivary cement protein protected mice against the lethal effect of tick-borne encephalitis virus. Preexposure to mosquito saliva through bites led to partial protection against Plasmodium berghei infection and immunization with the saliva of an aquatic insect (Naucoris genus) protected mice against Mycobacterium ulcerans infection.
- L. infantum chagasi is the cause of VL in Latin America and the only proven natural vector is Lu. longipalpis. Immunity to Lu. longipalpis saliva can protect against VL caused by L. infantum chagasi in a novel hamster model.
- the model of choice for the study of VL has been mostly achieved by the injection of a large number of parasites via the intravenous, intracardial or intraperitoneal route.
- these routes of infection do not mimic natural transmission by sand fly bite where the parasites are delivered into the skin of a mammalian host in the presence of saliva.
- There is no animal model for VL that combines this natural route of transmission with fatal disease progression.
- VL fatal outcome of VL in 3-4 month old na ⁇ ve hamsters following intradermal injection of parasites in the ear together with sand fly saliva. It is also disclosed herein that immunization with a defined salivary protein from the sand fly Lu. longipalpis protects hamsters from the fatal outcome of VL caused by L. infantum chagasi.
- the plasmids that were not immunogenic in hamsters were able to produce a cellular or antibody response in mice. This suggests that the absence of an immune response to some of these plasmids in hamsters may be due to host specificity. However, a dose-related effect due differential expression of plasmids following hamster immunizations cannot be excluded.
- LJM17-, LJMl 1-, and LJLl 1 -immunized hamsters showed high antibody titers comparable to those of animals immunized with SGH and considerably higher than control DNA-immunized hamsters (Fig. 8A).
- LJM 17-, LJMl 1 -and LJM19-immunized hamsters produced a DTH response comparable to that of the group immunized with SGH (Fig. 8B). This response is shown by the significant increase in ear thickness compared with negative controls (control DNA or na ⁇ ve groups) and compared to ear thickness prior to challenge (Fig. 8B).
- LJM19-immunized hamsters were the only group that produced a strong DTH response but did not produce a detectable antibody response (Fig. 8A, 8B).
- the DTH response in LJM19-immunized hamsters was characterized by a mononuclear infiltration composed mainly of macrophages and lymphocytes and a minimal number of neutrophils (Figure 8C).
- the DTH site in LJM19- immunized hamsters was representative of the DTH response observed in the other experimental groups (LJM17-, LJMl 1- and SGH-immunized hamsters).
- Lu. longipalpis salivary molecule LJM19 protects against the fatal outcome of VL caused by L. infantum chagasi.
- hamsters immunized with LJM 17, LJMl 1, LJM 19 or LJLl 1 the molecules producing immune responses in hamsters, were challenged intradermally in the ear by co- inoculation of L. infantum chagasi and SGH.
- Two months post-infection no parasites were detected in the liver and spleen of animals immunized with LJMl 1 and LJM 19 (Fig. 9A).
- Parasites were detected in the spleen and liver of na ⁇ ve hamsters at two and five months post-infection. These animals showed clinical signs similar to those observed in symptomatic individuals with VL, including hepatosplenomegaly, cachexia and hyperglobulinemia.
- Hamsters infected in the absence of sand fly SGH showed comparable disease progression indicating that saliva has no exacerbative effect on the course of infection (Fig. 7).
- an infected sand fly deposits saliva and parasites into the skin of the animal while feeding.
- saliva at the feeding site is a permanent feature of natural transmission by sand fly bite.
- salivary antigens the intradermal delivery of parasites into the ear of hamsters in the presence of vector saliva where the presence of sand fly saliva is required to induce an immune response against salivary antigens.
- massive cDNA sequencing, proteomic and bioinformatic efforts targeting sand fly salivary glands permitted the identification and isolation of the most abundant salivary proteins from the sand fly Lu.
- LJM19-immunized animals maintained a controlled and low parasite load in the spleen and liver surviving up to 8 months when they were sacrificed according to the Animal Care and Use Committee protocol (Fig. 9C). Up to this point LJM19-immunized hamsters showed no outward signs of disease. It is worth noting that these hamsters also maintained a low level of anti-Leishmania IgG antibodies compared to CTL DNA-immunized group (Fig. 9D). High anti-leishmania IgG titers have been associated with active visceral leishmaniasis.
- IFN- ⁇ plays an important role in limiting the growth of Leishmania in murine and human macrophages and in limiting leishmaniasis progression (Basu et al. J Immunol 174: 7160-7171, 2005; Carvalho et al., J Infect Dis 165: 535-54, 1992). Moreover, NO generation through IFN- ⁇ is the critical macrophage effector mechanism in the control of parasite replication in mice (Murray et al., J Immunol 148: 1858-1863, 1992).
- iNOS was produced by macrophages with concomitant high levels of NO production in protected hamsters vaccinated with a kinetoplastid membrane protein- 11 (KMP- 11) and challenged intracardially with Leishmania donovani (Basu et al. J Immunol 174: 7160-7171, 2005).
- the protective immunity observed in the spleen and liver of LJM 19-immunized hamsters may be the consequence of an anti-saliva immune response initiated in the skin of challenged animals. This is supported by the DTH response and the high expression of IFN- ⁇ produced at the bite site of LJMl 9-immunized hamsters (Fig. 11).
- the presence of IL-10 together with IFN- ⁇ 48 hours following sand fly bites in LJMl 9-immunized hamsters could be a regulatory mechanism to control possible immunopathology caused by IFN- ⁇ .
- the initial anti-LJM19 immune response at the site of parasite inoculation in the ear dermis has a dual effect: 1) it creates an inhospitable environment for the establishment of Leishmania infection that may involve direct killing of the parasite, and 2) it primes the initial host immune response to Leishmania that could also have resulted in acceleration of anti- Leishmania immunity.
- mice immunized with a salivary molecule from P. papatasi (PpSP 15) primed the immune response towards a ThI type anti-Leishmania major immunity.
- Leishmania infantum chagasi promastigotes were cultured in Schneider's medium supplemented with 20% of inactivated fetal bovine serum (FBS), 2 mM L- glutamine, 100 U/ml penicillin, 100 ⁇ l/ml streptomycin and 2% sterile human urine.
- FBS inactivated fetal bovine serum
- 2 mM L- glutamine 100 U/ml penicillin
- 100 ⁇ l/ml streptomycin 100 ⁇ l/ml streptomycin
- 2% sterile human urine Three to four months old hamsters were inoculated intradermally with 10 5 stationary phase promastigotes in the absence or presence of 0.5 pairs SGH using a 29-gauge needle (BD Ultra-Fine) in a volume of 20 ⁇ l.
- BD Ultra-Fine 29-gauge needle
- DNA was extracted from 300 ⁇ l of blood and 100 mg of spleen and liver tissue from infected and control hamsters using the Wizard Genomic DNA purification kit (Promega) following manufacturer's instructions. PCR was performed with primers 5 '-GGG(GZT)AGGGGCGTTCT(GZC)CGAA-S ' (SEQ ID NO: 11) and 5'- (GZC) (GZC) (GZC) (AZT)CTAT(AZT)TTAC ACC AACCCC-3' (SEQ ID NO: 12) which amplify al20-bp conserved region of the Leishmania kDNA minicircle.
- Ear thickness and histology Ear thickness was measured 48 h following i.d. injection of Lu. longipalpis SGH or sand fly bites using a vernier caliper (Mitutoyo Corp.). For histology, the ears were fixed in 10% phosphate buffered formalin and embedded in paraffin. Five micron sections were stained with hematoxylin-eosin. Cytokine determination by semi-quantitative PCR and Real-Time PCR Total RNA was extracted from the spleen and liver of infected hamsters using Trizol reagent (Invitrogen). First strand cDNA synthesis was performed with approximately 1-2 ⁇ g of RNA using a Superscript II reverse transcriptase (Invitrogen).
- the reaction mixture was incubated at 42 0 C for 50 min.
- DNA was amplified using Taq DNA polymerase (Invitrogen) in a PTC-100 thermal cycler (MJ Research Inc.). Reaction conditions were 40 cycles of 1 min at 94 0 C, 1 min at 55 0 C, and 2 min at 72 0 C, with a final extension step of 7 min at 72 0 C.
- the band intensity of the amplified products was analyzed using EagleSight, version 3.2 software (Stratagene). The results are expressed as the ratio of cytokine over HPRT.
- tissue was homogenized on a Magna lyser (Roche) with three cycles at 7000 rpm, 60 seconds each.
- First strand cDNA synthesis was performed with approximately 1-2 ⁇ g of RNA in a total volume of 20 ⁇ l using the SuperscriptTM III reverse transcriptase.
- DNA was amplified using the LightCycler 480 Probes Master kit (Roche). Amplification conditions consisted of an initial pre-incubation at 95°C for 10 min, followed by amplification of the target DNA for 40 cycles of 95°C for 15 s and 60 0 C for 1 min using the LightCycler 480 (Roche Diagnostics). A standard curve was generated for each set of primers and efficiency of each reaction determined. The expression levels of genes of interest were normalized to HPRT levels. The results are expressed in fold change over control.
- Oligonucleotide primers and probes Oligonucleotide primers and probes. Oligonucleotide primers used for semiquantitative PCR were: HPRT (reverse (SEQ ID NO: 13), TGT TTC ACC AAC AAG TTT GCA ATC; forward (SEQ ID NO: 14), ATG GTA GAG ATG GGA GGC CAT CAC), IFN- ⁇ (reverse (SEQ ID NO: 15), TCA AAT ATT GCT GGC AAG AAT ATT CTT; forward (SEQ ID NO: 16), ATG CAC ACC ACA CGT TGC ATC TTG), IL-4 (reverse (SEQ ID NO: 17), TCA CAT TGC AGC TCT TCT GAG GAA3; forward (SEQ ID NO: 18), ACG GAG AA A GAC CTC ATT TGC AG), IL-10 (reverse (SEQ ID NO: 19), TCA CAG GGG AGA AAT CGA TGA CA; forward (SEQ ID NO
- Oligonucleotide primers used for real time PCR were: HPRT (reverse (SEQ ID NO: 25), GGG AGT GGA TCT ATC ACA ATT TCT; forward (SEQ ID NO: 26), CCA TCA CAT TAT GGC CCT CT), IFN- ⁇ (reverse (SEQ ID NO: 27), CAG GTC TGC CTT GAT GGT G; forward (SEQ ID NO: 28), GAA GCC TTG AAG GAC AAC CA) TGF- ⁇ (reverse (SEQ ID NO: 29), TGG TTG TAG AGG GCA AGG AC; forward (SEQ ID NO: 30) GGC CCT GTC CCT ACA TTT G), IL-IO (reverse (SEQ ID NO: 31), TCC AGC TGG TCC TTC TTT TG; forward (SEQ ID NO: 32), ACA TGC T
- Recombinant sand fly polypeptide and disease antigen are generated using standard methods. Mice are immunized intradermally in the right ear three times at two week intervals with recombinant sand fly polypeptide and disease antigen using one or more of the following immunization protocols:
- Injection 1 Sand fly polypeptide and disease antigen
- Injection 2 Sand fly polypeptide and disease antigen
- Injection 3 Sand fly polypeptide and disease antigen. Protocol 2
- Injection 1 Sand fly polypeptide and disease antigen
- Injection 2 Disease antigen
- Injection 3 Disease antigen. Protocol 3
- Injection 1 Sand fly polypeptide
- Injection 1 Sand fly polypeptide
- Injection 2 Sand fly polypeptide and disease antigen
- Injection 1 Sand fly polypeptide
- Injection 2 Sand fly polypeptide and disease antigen
- Injection 1 Disease antigen.
- Injection 2 Disease antigen.
- Injection 3 Disease antigen.
- L. major is used by way of example and this example is not in any way limited to the use of this disease-causing parasite).
- MHOM/IL/80/Friedlin is cultured in 199 medium with 10% heat-inactivated fetal bovine serum (HyClone), 100 U/ml penicillin, 100 ⁇ g/ml streptomycin, 2 mM L- glutamine and 40 mM Hepes. If midgut polypeptide is used in the immunizations, the animals are challenged with midgut homogenate rather than salivary gland homogenate.
- the ear thickness is measured 48 hours following intradermal injection of sand fly homogenate. Values are represented as ⁇ ear thickness (ear thickness of experimental groups subtracted from the mean ear thickness of na ⁇ ve mice 48 hours after injection with 0.5 pair of SGH). For measurements of Leishmania lesions, the largest diameter is recorded on a weekly basis. Ear thickness and lesion diameter are measured using a Digimatic caliper.
- mice immunized with sand fly polypeptide have reduced parasite load, compared to mice immunized with disease antigen alone (protocol 5).
- Example 4 Production of an Enhanced Immune Response in Dogs Sand flies (for example, but not limited to, P Phlebotomus papatasi,
- Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P. sergenti, P. arabicus, P. tobbi, or Lutzomyia longipalpis) are reared at the Walter Reed Army Medical Research Institute and at the Laboratory of Malaria and Vector Research, NIAID, NIH, as described elsewhere (Valenzuela et al, J Exp Med 194: 331-342, 2001).
- Preparation of salivary gland homogenate (or midgut homogenate) and pre-exposure of dogs to uninfected sand flies is carried out according to known methods under pathogen free conditions. All animal studies are approved by the Animal Care and Use Committee at The National Institute of Allergy and Infectious Diseases.
- Recombinant sand fly polypeptide and disease antigen are generated using standard methods. Dogs are immunized intradermally three times at two week intervals with recombinant sand fly polypeptide and disease antigen using one or more of the immunization protocols described in Example 4.
- L. major clone Vl (MHOM/IL/80/Friedlin) is cultured in 199 medium with 10% heat-inactivated fetal bovine serum (HyClone), 100 U/ml penicillin, 100 ⁇ g/ml streptomycin, 2 mM L- glutamine and 40 mM Hepes. If midgut polypeptide is used in the immunizations, the animals are challenged with midgut homogenate.
- the ear thickness is measured 48 hours following intradermal injection of sand fly homogenate. Values are represented as ⁇ ear thickness (ear thickness of experimental groups subtracted from the mean ear thickness of na ⁇ ve dogs 48 hours after injection with 0.5 pair of SGH). For measurements of Leishmania lesions, the largest diameter is recorded on a weekly basis. Ear thickness and lesion diameter are measured using a caliper.
- parasite burden is determined by PCR. DNA is extracted from blood, spleen and liver tissue from infected and control animals using known methods and amplified by real time PCR. Measured values represent the relative number of parasites per sample. Dogs immunized with sand fly polypeptide (protocols 1, 2, 3, or 4) have reduced parasite load, compared to dogs immunized with disease antigen alone (protocol 5).
- Sand flies for example, but not limited to, Phlebotomus papatasi, Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P. sergenti, P. arabicus, P. tobbi, or Lutzomyia longipalpis
- Phlebotomus papatasi Phlebotomus ariasi
- Phlebotomus perniciosus Phlebotomus argentipes
- Phlebotomus duboscqi P. sergenti, P. arabicus, P. tobbi, or Lutzomyia longipalpis
- Recombinant sand fly polypeptide and disease antigen are generated using standard methods. Monkeys are immunized intradermally three times at two week intervals with recombinant sand fly polypeptide and disease antigen using one or more of the immunization protocols described in Example 4.
- L. major is used herein by way of example and this method is not in any way limited to the use of this disease-causing parasite).
- MHOM/IL/80/Friedlin is cultured in 199 medium with 10% heat-inactivated fetal bovine serum (HyClone), 100 U/ml penicillin, 100 ⁇ g/ml streptomycin, 2 mM L- glutamine and 40 mM Hepes.
- HyClone heat-inactivated fetal bovine serum
- penicillin 100 U/ml penicillin
- 100 ⁇ g/ml streptomycin 100 ⁇ g/ml streptomycin
- 2 mM L- glutamine 20 mM L- glutamine
- 40 mM Hepes heat-inactivated fetal bovine serum
- ⁇ ear thickness ear thickness of experimental groups subtracted from the mean ear thickness of na ⁇ ve dogs 48 hours after injection with 0.5 pair of SGH.
- Leishmania lesions the largest diameter is recorded on a weekly basis. Ear thickness and lesion diameter are measured using a caliper.
- parasite burden is determined by PCR.
- DNA is extracted from blood, spleen and liver tissue from infected and control animals using known methods and amplified by real time PCR. Measured values represent the relative number of parasites per sample. Monkeys immunized with sand fly polypeptide (protocols 1, 2, 3, or 4) have reduced parasite load, compared to monkeys immunized with disease antigen alone (protocol 5).
- This Example demonstrates a method of administering a sand fly salivary gland polypeptide (or midgut polypeptide) as an adjuvant and a disease antigen other than a sand fly polypeptide (for example, but not limited to, a Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma antigen,) to a subject for the treatment, amelioration, or prevention of a disease (for example, but not limited to, Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma) in the subject.
- a disease antigen other than a sand fly polypeptide for example, but not limited to, a Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma
- a suitable subject for receiving the sand fly polypeptide and disease antigen is one who is at risk for exposure to the disease or who is suffering from the disease (for example, a mouse, hamster, dog, monkey, or human).
- the sand fly polypeptide is administered to the subject once, twice, three times or more, alone or in combination with the disease antigen, as described in the immunization protocols in Example 4.
- the sand fly polypeptide and the disease antigen are provided in the same or different pharmaceutical compositions, and are administered subcutaneously or intradermally.
- the second, third, or more doses are administered in the same fashion at regular intervals after the first dose, and the efficacy of protection against the disease or treatment of the disease is assessed by measuring antibody titers or parasite load using standard laboratory protocols.
- Mycobacterial antigens can be found in U.S. Patent Nos. 6,045,798; 5,504, 005; 7,288,261, which are incorporated by reference.
- Toxoplasmosis antigens that can be used in the vaccines disclosed herein are found for example in U.S. Patent No. 6,902,926, which is incorporated by reference.
- Examples of Plasmodium antigens are found in U.S. Patent Nos. 7,563,883; 6,828,416; 5,609,872; 4,957,758, which are incorporated by reference.
- hookworm antigens are found in U.S. Patent Nos. 7,303,752 and 5,753,787, which are also incorporated by reference.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Communicable Diseases (AREA)
- Pulmonology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The disclosure relates to methods of using insect proteins, or recombinant vectors expressing these proteins, to prime or enhance an immune response against an antigen. More specifically, this disclosure relates to sand fly salivary proteins or sand fly midgut proteins that act as an adjuvant to prime or enhance an immune response.
Description
INSECT PROTEINS AS ADJUVANTS TO ACCELERATE THE IMMUNE
RESPONSE
FIELD OF THE DISCLOSURE
The disclosure relates to methods of using insect proteins, or recombinant vectors expressing these proteins, to prime or enhance an immune response against an antigen. More specifically, this disclosure relates to sand fly salivary proteins and sand fly midgut proteins that act as adjuvants to prime or enhance an immune response.
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No. 61/089,884, filed August 18, 2008, the disclosure of which is incorporated herein in its entirety.
BACKGROUND
A particular challenge in medicine is the development of an effective treatment, such as a vaccine, that provides a sufficiently strong and long lasting immune response in a subject. Vaccines are not available for many human or animal diseases (for example, malaria, tuberculosis, and leishmaniasis). Preventative (or prophylactic) drugs can be taken continuously to reduce the risk of infection and therapeutic drugs, taken once a person is already infected, are also available. However, the continuous administration of these drugs is expensive, particularly for those living in endemic areas. Diseases such as malaria and leishmaniasis are commonly associated with poverty, but they are also a cause of poverty and a major hindrance to economic development. Thus, a method which produces a potent protective immune response against these diseases would be advantageous.
SUMMARY OF THE DISCLOSURE
Disclosed herein are sand fly polypeptides that surprisingly behave as potent "non-classical" adjuvants. In contrast to "classical" adjuvants, these polypeptides
are immunogenic. Thus, they are more potent immunologically than classical adjuvants and much smaller amounts of the disclosed polypeptides are required to prime or enhance an immune response against an antigen. This is advantageous, as classical adjuvants, which include large amounts of lipid, lipopolysaccaride, or nucleic acid, cause undesirable side effects in subjects as a result of their high level of toxicity and their ability to cause severe local inflammation. In addition, as a non- classical adjuvant is immunogenic and can induce an immunologic response (such as a recall or T cell memory response), its ability to prime or enhance an immune response against an antigen is more long-lasting than that generated by a classical adjuvant.
In one embodiment, an immune response to a disease antigen can be primed or enhanced in a subject by administering to the subject (a) a therapeutically effective amount of an adjuvant comprising a sand fly salivary gland polypeptide that induces a T cell response in the subject, and (b) a disease antigen, wherein the disease antigen is other than a sand fly salivary gland antigen. In other embodiments, a subject is administered adjuvant comprising a nucleic acid molecule encoding the sand fly polypeptide and a nucleic acid molecule encoding the disease antigen.
Also provided herein are compositions comprising an adjuvant comprising a sand fly salivary gland polypeptide in combination with a disease antigen (target antigen), wherein the disease antigen is an antigen other than a sand fly salivary gland antigen. The compositions can also comprise an adjuvant comprising a nucleic acid molecule encoding a sand fly salivary gland polypeptide in combination with a nucleic acid molecule encoding a disease antigen, wherein the disease antigen is an antigen other than a sand fly salivary gland antigen.
The disease antigen in the disclosed methods and compositions can be, for example, an antigen of an organism causing a disease, for example a neoplastic disease (such as a tumor) or infectious disease (such as a viral, chlamydial, rickettsial, bacterial, fungal, protozoan, or helminth disease) for example, a Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma antigen. Thus, subjects at risk of developing, or suffering from, such diseases can be
administered the adjuvant and antigen disclosed herein to prime or enhance an immune response to the disease antigen.
The foregoing and other features and advantages of the invention will become more apparent from the following detailed description of several embodiments which proceeds with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 is a graph demonstrating that DNA immunization with PpSP 15,
PpSP42 and PpSP44 induces a DTH response after challenge with salivary gland homogenate (SGH). C57BL/6 mice were immunized three times at two week intervals with DNA plasmids coding for ten Phlebotomus papatasi salivary proteins, SGH and CTL DNA in the right ear. Two weeks later the left ear was challenged intradermally with 0.5 pairs of SGH. The DTH response was assessed using Δ ear thickness (ear thickness of experimental groups subtracted from the mean ear thickness of naϊve mice) 48 hours after injection with 0.5 pairs of SGH. Bars represent the mean Δ ear thickness for 15 mice per group ± the SEM. Asterisks indicate statistical differences (p < 0.05) compared to CTL DNA-immunized mice. Figure 2 is a graph demonstrating that DNA immunization with distinct
DTH-inducing salivary proteins modulates the course of infection with L. major. Mice immunized in the right ear with CTL DNA (•), PpSP 15 (o), PpSP42 (D), PpSP44 (■), SGH (A) or pre-exposed to bites of uninfected sand flies (T) were challenged in the left ear with 500 L. major metacyclics and 0.5 pairs of SGH. Due to the extensive ulceration of the ears in mice immunized with PpSP44, lesion size measurements could not be performed beyond seven weeks after challenge. The symbols represent the mean ± the SEM for ten mice per group. Asterisks indicate statistical significance (p < 0.05) compared to mice immunized with CTL DNA. Data are representative of three different experiments. Figure 3 is a graph and a series of images demonstrating protection or exacerbation of L. major infection in mice immunized with PpSP 15 or PpSP44.
Mice immunized with PpSP15, PpSP44 or CTL DNA were challenged with 500 L. major metacyclics and 0.5 pairs of SGH. The graph shows the number of parasites per ear at 11 weeks post-challenge as measured by Real time PCR. This result is representative of the parasite load at six and nine weeks post-challenge. Bars represent the mean ± the SEM for ten mice per group. Figures 3A-3C reflect the pathology of the ears 11 weeks post-challenge in mice previously immunized with PpSP44 (Fig. 3A), PpSP 15 (Fig. 3B) and CTL DNA (Fig. 3C). Asterisks indicate significance compared to mice immunized with CTL DNA (p < 0.05). Data are representative of three independent experiments. Figures 4A - 4F is a series of graphs demonstrating the frequency of CD4+-T cells producing IFN-γ or IL-4 in mice immunized with PpSP 15 or PpSP44. Mice immunized in the right ear with CTL DNA, PpSP44 or PpSP 15 were challenged in the left ear with 500 L. major metacyclics and 0.5 pairs of SGH. Two weeks after challenge, the percentage of CD4+ T cells producing IFN-γ or IL-4 were determined in cells recovered from the ear dermis (pools of three to five ears). Twelve hours after stimulation with soluble Leishmania antigen (SLA), cells were incubated for four hours with monensin, PMA and ionomycin and stained with CD4, TCRβ, IFN-γ and IL-4. The numbers represent the percentage of positive events. Data are representative of three independent experiments. Figures 5A - 5E is a series of graphs demonstrating the early expression of cytokines after challenge with SGH-LM in CTL DNA, PpSP 15- or PpSP44- immunized mice. Two hours after challenge with 500 L. major metacyclics and 0.5 pairs of SGH, expression of IFN-γ (Fig. 5A) and IL-12Rβ2 (Fig. 5B) was induced in mice immunized with PpSP15. In contrast, mice immunized with PpSP44 induced the expression of IL-4 (Fig. 5C). Relative mRNA expression was determined by real time PCR and normalized to thel8S housekeeping gene. Values represent the fold increase over naϊve mice after challenge with SGH-LM. Bars represent the mean ± the SEM for 24 mice per group. Asterisks indicate statistical significance (p < 0.05) between the PpSP 15 and the PpSP44 experimental groups. Data represent the combined outcome of three independent experiments.
Figures 6A and 7B are a series of graphs demonstrating that sand fly bites efficiently recall the immune response in mice immunized with PpSP 15 or PpSP44. Two hours after challenge with sand fly bites, expression of IFN-γ (Fig. 6A) and IL- 4 (Fig. 6B) was compared in mice immunized with CTL DNA, PpSP 15 or PpSP44. Relative mRNA expression was determined by real time PCR and normalized to thel8S housekeeping gene. Values represent the fold increase over naϊve mice after sand fly bites. Bars represent the mean ± the SEM for 16 mice per group. Asterisks indicate significance (p < 0.05).
Figures 7A and 7B are a series of graphs and images illustrating parasite burden following challenge with 105 stationary phase L. infantum chagasi promastigotes in the presence or absence of 0.5 salivary gland pairs. Fig. 7A shows PCR amplification of Leishmania DNA from hamster blood, spleen and liver 15 days post-infection with Leishmania alone (L. i.e.), Leishmania and SGH (L. i.e. +SGH), non-infected hamsters (-). Fig. 7B shows the parasite burden in the spleen and liver of hamsters (six animals/group) two and five months post-infection using the limiting dilution assay. The bars represent the mean number of parasites per organ ± SEM.
Figure 8 is a graph and a series of histology images demonstrating the immune response to Lu. longipalpis salivary proteins. Fig. 8A shows antibody titers to Lu. longipalpis salivary gland homogenate (SGH) and DNA plasmids coding for CTL DNA, LJM17, LJMl 1, LJLl 1 and LJM19 using ELISA (six hamsters/group). The cutoff was determined using sera from non-infected hamsters (Mean + 2 SD). Fig. 8B shows ear thickness prior to (0 h) and 48 h after challenge with SGH in hamsters immunized with LJM 17, LJMl 1, LJM 19, CTL DNA or SGH. * indicate significance at/?<0.005. Fig. 8C shows cellular infiltration in representative ears of hamsters immunized with LJM 19 or CTL DNA 48 h after challenge with SGH in the contralateral ear (six animals/group, H&E staining).
Figures 9A - 9D is a series of graphs demonstrating that DNA immunization with LJM 19 protects hamsters from the fatal outcome of VL. Parasite burden at two (Fig. 9A) and five (Fig. 9B) months post-infection in hamsters immunized with
LJMl 1, LJM 19, LJM 17, LJLl 1 and CTL DNA following intradermal challenge in
the ear with 105 stationary phase L. infantum chagasi promastigotes in the presence of 0.5 pairs of SGH. Parasite burden was determined by limiting dilution assay (six hamsters/group). Fig. 9C shows the percent survival of hamsters immunized with LJM 19 and CTL DNA following intradermal challenge with L. infantum chagasi and SGH (12 hamsters/group). Fig. 9D shows anti-Leishmania antibodies detected by ELISA in hamsters immunized with LJM 19 and CTL DNA two and five months after intradermal challenge with L. infantum chagasi and SGH (six hamsters/group). * indicates significance at/?<0.05. Data representative of three independent experiments with the exception of Fig. 9C, where a fourth experiment was carried out to follow the survival of LJM 19 immunized hamsters.
Figure 10 is a series of graphs demonstrating that the protection against the fatal outcome of VL correlates with hepatic and splenic IFN-γ and iNOS expression. Ratio of IFN-γ/TGF-β mRNA in the spleen (Fig. 10A) and liver (Fig. 10B) of hamsters immunized with LJM 19 and CTL DNA plasmids two and five months after intradermal challenge with 105 stationary phase L. infantum chagasi promastigotes in the presence of 0.5 pairs of SGH. mRNA iNOS expression in the spleen (Fig. 10C) and liver (Fig. 10D) two and five months after intradermal challenge with L. infantum chagasi and SGH. All cytokine expression levels were normalized to HPRT mRNA expression levels. * indicates significance at/?<0.05 (Six animals/group).
Figure 11 is a series of graphs and histology images demonstrating the immune response in the ear tissue of hamsters immunized with LJM 19 and CTL DNA following uninfected sand fly bites. Fig. 1 IA shows cellular infiltration in representative ears of hamsters immunized with LJM 19 or CTL DNA 48 h after challenge with uninfected sand fly bites in the contralateral ear (six animals/group, H&E staining). Fig. 1 IB shows IFN-γ and IL-10 mRNA expression in hamsters immunized with LJM 19 and CTL DNA 48 h after uninfected sand fly bites. The data were normalized to HPRT expression. * indicates significance at/?<0.05.
SEQUENCE LISTING
The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. §1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing:
SEQ ID NOs: 1, 2, and 3 show the amino acid sequence of Phlebotomus papatasi salivary gland polypeptides (PpSP 15, PpSP42, and PpSP44, respectively).
SEQ ID NO: 4 shows the amino acid sequence of a Lutzomyia longipalpis salivary gland polypeptide (LJM 19).
SEQ ID NO: 5 shows the nucleic acid sequence encoding a Lutzomyia longipalpis salivary gland polypeptide (LJM 19). SEQ ID NO: 6 shows the amino acid sequence encoding a Lutzomyia longipalpis salivary gland polypeptide (LJMl 1).
SEQ ID NO: 7 shows the nucleic acid sequence encoding a Lutzomyia longipalpis salivary gland polypeptide (LJMl 1).
SEQ ID NOs: 8, 9, and 10 show the nucleic acid sequence encoding Phlebotomus papatasi salivary gland polypeptides (PpSP15, PpSP42, and PpSP44, respectively).
SEQ ID NOs: 11-34 show the nucleic acid sequences of oligonucleotide primers.
DETAILED DESCRIPTION OF SEVERAL EMBODIMENTS
/. General Overview
It is disclosed herein that sand fly molecules, such as salivary gland or midgut polypeptides, or nucleic acids encoding these polypeptides, can be used as adjuvants to prime or enhance an immune response to a disease antigen (target
antigen) in a subject. In one embodiment, an immune response to a disease antigen can be primed or enhanced in a subject by administering to the subject (a) a therapeutically effective amount of an adjuvant comprising a sand fly salivary gland polypeptide to induce a T cell response in the subject, wherein the therapeutically effective amount of adjuvant is below the amount required for a classical adjuvant, and (b) a disease antigen, wherein the disease antigen is other than a sand fly salivary gland antigen, thereby priming or enhancing an immune response in the subject. The T cell response can be a CD4 T helper cell response, wherein the CD4 T helper cell response is a ThI cell response. In some embodiments, the antigen is administered to the subject simultaneously with the administration of the sand fly salivary gland. In other embodiments, the antigen is administered to the subject after the administration of the sand fly salivary gland polypeptide and within a sufficient amount of time to induce the immune response. The antigen can be, for example, an antigen of an organism causing a disease, for example a Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma antigen. In particular embodiments, the adjuvant comprises a sand fly midgut polypeptide. In other embodiments, a subject is administered adjuvant comprising a nucleic acid molecule encoding the sand fly polypeptide and a nucleic acid molecule encoding the disease antigen.
Also provided herein are compositions comprising an adjuvant comprising a sand fly salivary gland polypeptide in combination with a disease antigen (target antigen), wherein the disease antigen is an antigen other than a sand fly salivary gland antigen. The compositions can also comprise an adjuvant comprising nucleic acid molecule encoding a sand fly salivary gland polypeptide in combination with a nucleic acid molecule encoding a disease antigen (target antigen), wherein the disease antigen is an antigen other than a sand fly salivary gland antigen. It is also contemplated that in particular embodiments the sand fly polypeptide, or the nucleic acid molecule encoding this polypeptide, is from the midgut of a sand fly. The antigen can be of any disease-causing organism. In particular embodiments, the disease causing organism is Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma. Also disclosed herein are methods of priming or enhancing an immune response to an antigen in a subject using the compositions provided herein.
In some embodiments of the disclosed methods, the sand fly salivary gland polypeptide is a polypeptide obtained from the salivary gland from any vector species of sand fly, such as a Phlebotomus or Lutzomyia sand fly, for example (but not limited to) Phlebotomus papatasi, Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P. sergenti, P. arabicus, P. tobbi, or Lutzomyia longipalpis. More specifically, the sand fly salivary gland polypeptide can comprise the amino acid sequences set forth as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 6. More specifically, the nucleic acid molecule encoding the sand fly polypeptide can comprise SEQ ID NO: 5 or SEQ ID NOs 7-10.
The subject can be a human or a non-human veterinary subject, such as a dog, a mouse, or a monkey.
//. Abbreviations
CD cluster of differentiation
CDR Complementarity determining region
CH Constant heavy domain
CL Constant light domain
CL Cutaneous leishmaniasis
CTL Cytotoxic T lymphocyte
CTL DNA Control DNA
DC Dendritic cell
DTH Delayed Type Hypersensitivity
Ifn-γ Interferon-gamma iNOS Inducible Nitric Oxide Synthase
H Heavy chain
ID Intradermal
IL Interleukin
IM Intramuscular
L Light chain
PM Peritrophic matrix
PMA Phorbol 12-myristate 13 -acetate
SC Subcutaneous
SGH Salivary gland homogenate
SGH-LM SGH and L .major metacyclics
SLA Soluble leishmania antigen
TCRβ Tcell receptor beta
VH Variable heavy domain
VL Variable light domain
VL Visceral leishmaniasis
//. Terms Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19- 854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:
Adjuvant: A substance distinct from antigen that enhances T cell activation by promoting the innate immune response leading to the accumulation and activation of other leukocytes (accessory cells) at the site of antigen exposure. Adjuvants enhance accessory cell expression of T cell-activating co-stimulators and cytokine and may also prolong the expression of peptide-MHC complexes on the surface of antigen-presenting cells. A classical adjuvant (such as liposomes, lipopolysaccharide (LPS), components of bacterial cell walls, and endocytosed nucleic acids) is not immunogenic and does not generate an immune response against itself. Thus, repeated exposure to classical adjuvants does not lead to enhanced immune responses against the adjuvant (i.e. immunologic memory). Large amounts of classical adjuvant are required to prime or enhance an immune response, leading to undesirable side effects in the subject. In contrast, a non-classical adjuvant is itself immunogenic. Thus, it is more potent than a classical adjuvant and much smaller amounts of non-classical adjuvants are required to prime or enhance an immune response against an antigen. Also, as a non-classical adjuvant is immunogenic and can induce an immunologic response (such as a recall or T cell memory response), its ability to prime or enhance an immune response against an antigen is more long-lasting than that generated by a classical adjuvant.
Amplification of a nucleic acid molecule (for example, a DNA or RNA molecule): A technique that increases the number of copies of a nucleic acid molecule in a specimen. An example of amplification is the polymerase chain reaction, in which a biological sample collected from a subject is contacted with a pair of oligonucleotide primers, under conditions that allow for the hybridization of the primers to a nucleic acid template in the sample. The primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid. The product of amplification may be characterized by electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing using standard techniques. Other examples of amplification include strand displacement amplification, as disclosed in U.S. Patent No. 5,744,311; transcription-free isothermal amplification, as disclosed in U.S. Patent No. 6,033,881; repair chain reaction amplification, as disclosed in WO 90/01069; ligase chain reaction amplification, as disclosed in EP 0320308; gap filling ligase chain reaction amplification, as disclosed in U.S. Patent No. 5,427,930; and NASBA™ RNA transcription-free amplification, as disclosed in U.S. Patent No. 6,025,134.
Animal: Living multi-cellular vertebrate organisms, a category that includes, for example, mammals and birds. The term mammal includes both human and non- human mammals. Similarly, the term "subject" includes both human and veterinary subjects, such as dogs, monkeys, mice, and hamsters.
Antibody: immunoglobulin molecules and immunologically active portions of immunoglobulin molecules. For instance, molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen. A naturally occurring antibody (for example, IgG, IgM, IgD) includes four polypeptide chains, two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. However, it has been shown that the antigen-binding function of an antibody can be performed by fragments of a naturally occurring antibody. Thus, these antigen-binding fragments are also intended to be designated by the term "antibody." Specific, non-limiting examples of binding fragments encompassed within the term antibody include (i) an Fab fragment consisting of the VL, VH, CL,
and CHl domains; (ii) an Fd fragment consisting of the VH and CHl domains; (iii) an Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (iv) a dAb fragment (Ward et al, Nature 341 : 544-546, 1989) which consists of a VH domain; (v) an isolated complimentarity determining region (CDR); and (vi) an F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region.
Immunoglobulins and certain variants thereof are known and many have been prepared in recombinant cell culture (for example, see U.S. Patent No. 4,745,055; U.S. Patent No. 4,444,487; WO 88/03565; EP 0256654; EP 0120694; EP 0125023; Faoulkner et al, Nature 298:286, 1982; Morrison, J. Immunol. 123:793, 1979; Morrison et al., Ann Rev. Immunol 2:239, 1984).
Antigen: A substance against which an immune response is desired. An antigen can be a disease antigen or a target antigen. For example, a disease or target antigen is an antigen from a pathogen that confers immune protection agasint a disease.
Conservative variants: Conservative amino acid substitution tables providing functionally similar amino acids are well known to one of ordinary skill in the art. The following six groups are examples of amino acids that are considered to be conservative substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T);
2) Aspartic acid (D), Glutamic acid (E);
3) Asparagine (N), Glutamine (Q);
4) Arginine (R), Lysine (K);
5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
A non-conservative amino acid substitution can result from changes in: (a) the structure of the amino acid backbone in the area of the substitution; (b) the charge or hydrophobicity of the amino acid; or (c) the bulk of an amino acid side chain. Substitutions generally expected to produce the greatest changes in protein properties are those in which: (a) a hydrophilic residue is substituted for (or by) a hydrophobic residue; (b) a proline is substituted for (or by) any other residue; (c) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine; or (d) a residue having an electropositive side
chain, e.g., lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl.
Thus, in one embodiment, non-conservative substitutions are those that reduce an activity or antigenicity. cDNA (complementary DNA): A piece of DNA lacking internal, non- coding segments (introns) and expression control sequences. cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells. Degenerate variant: A polynucleotide encoding a sand fly salivary gland or midgut polypeptide that includes a sequence that is degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the disclosure as long as the amino acid sequence of the sand fly salivary gland polypeptide or the sand fly midgut polypeptide encoded by the nucleotide sequence is unchanged. Delayed-type hypersensitivity (DTH): An immune reaction in which T cell-dependent macrophage activation and inflammation cause tissue injury, resulting from the reaction to the subcutaneous injection of antigen (for example, a bacterial or viral antigen). The antigen can be administered with or without adjuvant in order to generate a DTH reaction. When small quantities of antigen are injected dermally, a hallmark response is elicited which includes induration, swelling, and monocyte infiltration into the site of the lesion within 24 to 72 hours after exposure to the antigen. This reaction has been shown to be absolutely dependent on the presence of memory T cells. Both the CD4+ and CD8+ fractions of T cells have been shown to modulate a response. A DTH reaction is often used as an assay for cell- mediated immunity.
Epitope: An antigenic determinant. There are particular chemical groups or peptide sequences on a molecule that are antigenic, for instance, that elicit a specific immune response. An antibody specifically binds a particular antigenic epitope on a polypeptide. Specific, non-limiting examples of an epitope include a tetra- to penta- peptide sequence in a polypeptide, a tri- to penta-glycoside sequence in a polysaccharide. In the animal most antigens will present several or even many
antigenic determinants simultaneously. Such a polypeptide may also be qualified as an immunogenic polypeptide and the epitope may be identified.
Expression Control Sequences: Nucleic acid sequences that control and regulate the expression of a nucleic acid sequence, such as a heterologous nucleic acid sequence, to which it is operably linked. Expression control sequences are operably linked to a nucleic acid sequence when the expression control sequences control and regulate the transcription and, as appropriate, translation of the nucleic acid sequence. Thus expression control sequences can include appropriate promoters, enhancers, transcription terminators, polyA signals, a start codon (for instance, ATG) in front of a protein-encoding polynucleotide sequence, splicing signal for introns, maintenance of the correct reading frame of that gene to permit proper translation of mRNA, and stop codons. The term "control sequences" is intended to include, at a minimum, components whose presence can influence expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences. Expression control sequences can include a promoter.
A promoter is a minimal sequence sufficient to direct transcription of a nucleic acid. Promoters may be cell-type specific or tissue specific. A promoter includes necessary nucleic acid sequences near the start site of transcription, such as a TATA element. A promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription. Both constitutive and inducible promoters are included (see for example, Bitter et ah, Methods in Enzymology 153:516-544, 1987).
For example, when cloning in bacterial systems, inducible promoters such as pL of bacteriophage lambda, plac, ptrp, ptac (ptrp-lac-hybrid promoter) and the like may be used. In one embodiment, when cloning in mammalian cell systems, promoters derived from the genome of mammalian cells (for example, metallothionein promoter) or from mammalian viruses (for example, the retrovirus long terminal repeat; the adenovirus late promoter; the vaccinia virus 7.5K promoter) can be used. Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for transcription of the nucleic acid
sequences. A polynucleotide can be inserted into an expression vector that contains a promoter sequence which facilitates the efficient transcription of the inserted genetic sequence of the host. The expression vector typically contains an origin of replication, a promoter, as well as specific nucleic acid sequences that allow phenotypic selection of the transformed cells. In one embodiment, the promoter is a cytomegalovirus promoter.
Hookworm: The hookworm is a parasitic nematode worm that lives in the small intestine of its host, which may be a mammal such as a dog, cat, or human. Two species of hookworms commonly infect humans, Ancylostoma duodenale and Necator americanus. Necator americanus predominates in the Americas, Sub-
Saharan Africa, Southeast Asia, China, and Indonesia, while Ancylostoma duodenale predominates in the Middle East, North Africa, India, parts of South America and (formerly) in southern Europe.
Host cells: Cells in which a vector can be propagated and its DNA expressed. The cell may be prokaryotic or eukaryotic. The term also includes any progeny of the subject host cell. It is understood that all progeny may not be identical to the parental cell since there may be mutations that occur during replication. However, such progeny are included when the term "host cell" is used. Also includes the cells of the subject. Immune response: A response of a cell of the immune system, such as a B cell, T cell, or monocyte, to a stimulus. An immune response can be a cellular response or a humoral response. In one embodiment, the response is specific for a particular antigen (an "antigen-specific response"). The response can also be a nonspecific response (not targeted specifically to salivary polypeptides) such as production of lymphokines. In one embodiment, an immune response is a T cell response, such as a CD4+ response or a CD8+ response. In another embodiment, the response is a ThI or a Th2 (subsets of helper T cells) response. In yet another embodiment, the response is a B cell response, and results in the production of specific antibodies. In other embodiments, the immune response can be a lymphocyte response, such as a NK cell or NKT cell response.
Immunogenic composition: A composition comprising an immunogenic
sand fly polypeptide (for example, a salivary gland polypeptide or a midgut polypeptide) that induces an immune response (such as a T cell response) against a disease, for example Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma. In one embodiment, the immunogenic composition consists of the immunogenic sand fly polypeptide alone. In an alternative embodiment, the immunogenic composition comprises the immunogenic polypeptide and an antigen (for example a Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma antigen). The immunogenic composition can also include a pharmaceutically acceptable carrier and/or other agents. Immunogenic polypeptide: A polypeptide which comprises an allele- specifϊc motif, an epitope or other sequence such that the polypeptide will bind an MHC molecule and induce a cytotoxic T lymphocyte ("CTL") response, and/or a B cell response (for example, antibody production), and/or T-helper lymphocyte response, and/or a delayed type hypersensitivity (DTH) response against the antigen from which the immunogenic polypeptide is derived.
In one embodiment, immunogenic polypeptides are identified using sequence motifs or other methods known in the art. Typically, algorithms are used to determine the "binding threshold" of polypeptides to select those with scores that give them a high probability of binding at a certain affinity and will be immunogenic. The algorithms are based either on the effects on MHC binding of a particular amino acid at a particular position, the effects on antibody binding of a particular amino acid at a particular position, or the effects on binding of a particular substitution in a motif- containing polypeptide. Within the context of an immunogenic polypeptide, a "conserved residue" is one which appears in a significantly higher frequency than would be expected by random distribution at a particular position in a polypeptide. In one embodiment, a conserved residue is one where the MHC structure may provide a contact point with the immunogenic polypeptide.
Infectious agent: An agent that can infect a subject, including, but not limited to, viruses, bacteria, fungi, protozoa, and helminths. In one embodiment, an infectious agent is opportunistic.
Examples of infectious virus include: Retroviridae (for example, human immunodeficiency viruses, such as HIV-I (also referred to as HTLV-III, LAV or HTLV-III/LAV, or HIV-III) and other isolates, such as HIV-LP; Picornaviridae (for example, polio viruses, hepatitis A virus; enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (such as strains that cause gastroenteritis); Togaviridae (for example, equine encephalitis viruses, rubella viruses); Flaviridae (for example, dengue viruses, encephalitis viruses, yellow fever viruses); Coronaviridae (for example, coronaviruses); Rhabdoviridae (for example, vesicular stomatitis viruses, rabies viruses); Filoviridae (for example, ebola viruses); Paramyxoviridae (for example, parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (for example, influenza viruses); Bungaviridae (for example, Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (for example, reoviruses, orbiviurses and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV)-I and HSV-2, varicella zoster virus, cytomegalovirus (CMV), herpes viruses); Poxviridae (variola viruses, vaccinia viruses, pox viruses); and Iridoviridae (such as African swine fever virus); and unclassified viruses (for example, the etiological agents of Spongiform encephalopathies, the agent of delta hepatitis
(thought to be a defective satellite of hepatitis B virus), the agents of non-A, non-B hepatitis (class l=internally transmitted; class 2=parenterally transmitted (for example, Hepatitis C); Norwalk and related viruses, and astroviruses).
Examples of infectious bacteria include: Helicobacter pylons, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (such as. M. tuberculosis, M. avium, M. intracellular, M. kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (yiridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus
antracis, corynebacterium diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringers, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidium, Treponema pertenue, Leptospira, and Actinomyces israelii.
Examples of infectious fungi include, but are not limited to, Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans.
Other infectious organisms (such as protists) include: Plasmodium falciparum and Toxoplasma gondii.
Isolated: An "isolated" biological component (such as a nucleic acid or protein or organelle) has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, for instance, other chromosomal and extra-chromosomal DNA and RNA, proteins, and organelles. Nucleic acids and proteins that have been "isolated" include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant technology as well as chemical synthesis.
Label: A detectable compound or composition that is conjugated directly or indirectly to another molecule to facilitate detection of that molecule. Specific, non- limiting examples of labels include fluorescent tags, enzymatic linkages, and radioactive isotopes.
Leishmaniasis: A parasitic disease spread by the bite of infected sand flies. The trypanosomatid parasite of the genus Leishmania is the etiological agent of a variety of disease manifestations, which are collectively known as leishmaniasis. Leishmaniasis is prevalent through out the tropical and sub-tropical regions of Africa, Asia, the Mediterranean, Southern Europe (old world), and South and Central America (new world). The old world species are transmitted by the sand fly vector Phlebotomus sp. Humans, wild animals and domestic animals (such as dogs) are known to be targets of these sand flies and to act as reservoir hosts or to develop leishmaniasis.
Cutaneous leishmaniasis starts as single or multiple nodules that develop into ulcers in the skin at the site of the bite. The chiclero ulcer typically appears as a notch- like loss of tissue on the ear lobe. The incubation period ranges from days to months, even a year in some cases. The sores usually last months to a few years, with most cases healing on their own. The mucocutaneous type can develop into erosive lesions in the nose, mouth, or throat and can lead to severe disfigurement. Visceral leishmaniasis often has fever occurring in a typical daily pattern, abdominal enlargement with pain, weakness, widespread swelling of lymph nodes, and weight loss, as well as superimposed infections because of a weakened immune system. Visceral leishmaniasis (VL) can result in high death rates. The onset of symptoms can be sudden, but more often tends to be insidious.
Lutzomyia longipalpis (Lu. longipalpis): A species of sand fly endogenous to the New World (South and Central America). This sand fly is the principal vector of American visceral leishmaniasis, a potentially fatal disease that primarily affects children in several countries of South and Central America.
Lymphocytes: A type of white blood cell that is involved in the immune defenses of the body. There are two main types of lymphocytes: B cells and T cells. A lymphocyte can also be referred to as a leukocyte.
Malaria: Malaria is caused by protozoan parasites of the genus Plasmodium (phylum Apicomplexa). In humans malaria is caused by P. falciparum, P. malariae, P. ovale, P. vivax and P. knowlesi. P. falciparum is the most common cause of infection and is responsible for about 80% of all malaria cases, and is also responsible for about 90% of the deaths from malaria. Parasitic Plasmodium species also infect birds, reptiles, monkeys, chimpanzees and rodents. There have been documented human infections with several simian species of malaria, namely P. knowlesi, P. inui, P. cynomolgi, P. simiovale, P. brazilianum, P. schwetzi and P. simium; however, with the exception of P. knowlesi, these are mostly of limited public health importance.
Mammal: This term includes both human and non-human mammals. Similarly, the term "subject" includes both human and veterinary subjects.
NK Cells: A type of cytotoxic lymphocyte that constitute a major component of the innate immune system. NK cells play a major role in the rejection of tumors and cells infected by viruses. The cells kill by releasing small cytoplasmic granules of proteins called perform and granzyme that cause the target cell to die by apoptosis or necrosis. NK-cells are defined as large granular lymphocytes (LGL) and constitute the third kind of cells differentiated from the common lymphoid progenitor generating B and T lymphocytes. They do not express T-cell antigen receptors (TCR) or Pan T marker CD3 or surface immunoglobulins (Ig) B cell receptor but that usually express the surface markers CD 16 (FcγRIII) and CD56 in humans, and NKl.l/NK1.2 in certain strains of mice. Up to 80% ofNK cells also express CD8.
Natural Killer T cells (NKT cells): A heterogeneous group of T cells that share properties of both T cells and natural killer (NK) cells. Many of these cells recognize the non-polymorphic CDId molecule, an antigen-presenting molecule that binds self- and foreign lipids and glyco lipids. They constitute only 0.2% of all peripheral blood T cells. NKT cells are a subset of T cells that co-express an αβ T cell receptor (TCR), but also express a variety of molecular markers that are typically associated with NK cells, such as NKl .1. They differ from conventional αβ T cells in that their TCRs are far more limited in diversity and in that they recognize lipids and glyco lipids presented by CDId molecules, a member of the CDl family of antigen presenting molecules, rather than peptide-MHC complexes. NKT cells include both NKl. I+ and NKl.1", as well as CD4+, CD4 , CD8+ and CD8 cells. Natural Killer T cells share other features with NK cells as well, such as CD 16 and CD56 expression and granzyme production. Oligonucleotide: A linear polynucleotide sequence of up to about 100 nucleotide bases in length.
Open reading frame (ORF): A nucleic acid sequence having a series of nucleotide triplets (codons), starting with a start codon and ending with a stop codon, coding for amino acids without any internal termination codons. These sequences are usually translatable into a polypeptide.
Operably linked: A first nucleic acid sequence is operably linked with a
second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.
Polypeptide Modifications: Sand fly salivary gland polypeptides include synthetic embodiments of polypeptides described herein. In addition, analogues (non-peptide organic molecules), derivatives (chemically functionalized peptide molecules obtained starting with the disclosed polypeptide sequences) and variants (homo logs) of these proteins can be utilized in the methods described herein. Each polypeptide of the disclosure is comprised of a sequence of amino acids, which may be either L- and/or D- amino acids, naturally occurring and otherwise.
Polypeptides may be modified by a variety of chemical techniques to produce derivatives having essentially the same activity as the unmodified polypeptides, and optionally having other desirable properties. For example, carboxylic acid groups of the protein, whether carboxyl-terminal or side chain, may be provided in the form of a salt of a pharmaceutically-acceptable cation or esterified to form a Ci-Ci6 ester, or converted to an amide of formula NRiR2 wherein Ri and R2 are each independently H or C1-C16 alkyl, or combined to form a heterocyclic ring, such as a 5- or 6- membered ring. Amino groups of the peptide, whether amino-terminal or side chain, may be in the form of a pharmaceutically-acceptable acid addition salt, such as the HCl, HBr, acetic, benzoic, toluene sulfonic, maleic, tartaric, and other organic salts, or may be modified to Ci-Ci6 alkyl or dialkyl amino or further converted to an amide.
Hydroxyl groups of the peptide side chains maybe converted to Ci-Ci6 alkoxy or to a Ci-Ci6 ester using well-recognized techniques. Phenyl and phenolic rings of the peptide side chains may be substituted with one or more halogen atoms, such as fluorine, chlorine, bromine, or iodine, or with Ci-Ci6 alkyl, Ci-Ci6 alkoxy, carboxylic acids and esters thereof, or amides of such carboxylic acids. Methylene groups of the peptide side chains can be extended to homologous C2-C4 alkylenes.
Thiols can be protected with any one of a number of well-recognized protecting groups, such as acetamide groups. Those skilled in the art will also recognize methods for introducing cyclic structures into the peptides of this disclosure to select and provide conformational constraints to the structure that result in enhanced stability.
Peptidomimetic and organomimetic embodiments are envisioned, whereby the three-dimensional arrangement of the chemical constituents of such peptido- and organomimetics mimic the three-dimensional arrangement of the peptide backbone and component amino acid side chains, resulting in such peptido- and organomimetics of a L. longipalpis polypeptide having measurable or enhanced ability to generate an immune response. For computer modeling applications, a pharmacophore is an idealized, three-dimensional definition of the structural requirements for biological activity. Peptido- and organomimetics can be designed to fit each pharmacophore with current computer modeling software (using computer assisted drug design or CADD). See Walters, "Computer- Assisted Modeling of Drugs," Klegerman & Groves (eds.), 1993, Pharmaceutical Biotechnology, Interpharm Press: Buffalo Grove, IL, pp. 165-174 and Principles of Pharmacology Munson (ed.) 1995, Ch. 102, for descriptions of techniques used in CADD. Also included are mimetics prepared using such techniques. Pharmaceutically acceptable vehicles or excipients: The pharmaceutically acceptable vehicles or excipients of use are conventional. Remington 's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the polypeptides, plasmids, viral vectors herein disclosed. In general, the nature of the vehicle or excipient will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, freeze-dried pastille, powder, pill, tablet, or capsule forms), conventional non-toxic solid vehicles or excipients can include, for example, pharmaceutical
grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral vehicles or excipients, immunogenic compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
Phlebotomus ariasi (P. ariasi): A species of Phlebotomus (sand flies) genus endogenous to the Old World, in particular to southern Europe and Mediterranean countries, more particularly to Spain and France. This sand fly is a proven vector of visceral leishmaniasis. P. ariasi is a member of the subgenera of Phlebotomus Larroussius.
Phlebotomus papatasi (P. papatasi): A species of Phlebotomus (sand flies) genus endogenous to the Old World, in particular to southern Europe, and Mediterranean countries, more particularly to France, Italy, Greece, Morocco, and Spain. This sand fly is a proven vector of the visceral leishmaniasis. Phlebotomus perniciosus (P. perniciosus): A species of Phlebotomus (sand flies) genus endogenous to the Old World, in particular to southern Europe, and Mediterranean countries, more particularly to France, Italy, Greece, Morocco, and Spain. This sand fly is a proven vector of the visceral leishmaniasis. P. perniciosus is a member of the subgenera of Phlebotomus Larroussius . Polynucleotide: The term polynucleotide or nucleic acid sequence refers to a polymeric form of nucleotide at least 10 bases in length, thus including oligonucleotides and genes. A recombinant polynucleotide includes a polynucleotide that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (for example, a cDNA) independent of other sequences. The polynucleotides can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide. The term includes single -and double -stranded forms of DNA.
Polypeptide: Any chain of amino acids, regardless of length (thus encompassing oligopeptides, peptides, and proteins) or post-translational modification (for example, glycosylation, phosphorylation, or acylation). A polypeptide encompasses also the precursor, as well as the mature protein. In one embodiment, the polypeptide is a polypeptide isolated from Lu. longipalpis, or encoded by a nucleic acid isolated from Lu. longipalpis, such as the Lu. longipalpis polypeptides disclosed herein.
Probes and primers: A probe comprises an isolated polynucleotide attached to a detectable label or reporter molecule. Primers are short polynucleotides. In one embodiment, polynucleotides are 15 nucleotides or more in length. Primers may be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, for example, by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods known in the art. One of skill in the art will appreciate that the specificity of a particular probe or primer increases with its length. Thus, for example, a primer comprising 20 consecutive nucleotides will anneal to a target with a higher specificity than a corresponding primer of only 15 nucleotides. Thus, in order to obtain greater specificity, probes and primers may be selected that comprise at least 15, 20, 25, 30, 35, 40, 50 or more consecutive nucleotides.
Protein Purification: The sand fly salivary gland polypeptides disclosed herein can be purified by any of the means known in the art. See, for example, Guide to Protein Purification, Deutscher (ed.), Meth. Enzymol. 185, Academic Press, San Diego, 1990; and Scopes, Protein Purification: Principles and Practice, Springer Verlag, New York, 1982. Substantial purification denotes purification from other proteins or cellular components. A substantially purified protein is at least 60%, 70%, 80%, 90%, 95%, or 98% pure. Thus, in one specific, non-limiting example, a substantially purified protein is 90% free of other proteins or cellular components.
Purified: The term purified does not require absolute purity; rather, it is
intended as a relative term. Thus, for example, a purified polypeptide preparation is one in which the polypeptide is more enriched than the polypeptide is in its natural environment. A polypeptide preparation is substantially purified such that the polypeptide represents several embodiments at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98%, of the total polypeptide content of the preparation. The same applies for polynucleotides. The polypeptides disclosed herein can be purified by any of the means known in the art (see, for example, Guide to Protein Purification, Deutscher (ed.), Meth. Enzymol. 185, Academic Press, San Diego, 1990; and Scopes, Protein Purification: Principles and Practice, Springer Verlag, New York, 1982).
Recombinant: A recombinant polynucleotide is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, for example, by genetic engineering techniques. A recombinant polynucleotide encodes a recombinant polypeptide. In one specific, non-limiting embodiment, a recombinant polynucleotide encodes a fusion protein.
Selectively hybridize: Hybridization under moderately or highly stringent conditions that excludes non-related nucleotide sequences. In nucleic acid hybridization reactions, the conditions used to achieve a particular level of stringency will vary, depending on the nature of the nucleic acids being hybridized. For example, the length, degree of complementarity, nucleotide sequence composition (for example, GC versus AT content), and nucleic acid type (for example, RNA versus DNA) of the hybridizing regions of the nucleic acids can be considered in selecting hybridization conditions. An additional consideration is whether one of the nucleic acids is immobilized, for example, on a filter.
A specific, non-limiting example of progressively higher stringency conditions is as follows: 2 x SSC/0.1% SDS at about room temperature (hybridization conditions); 0.2 x SSC/0.1% SDS at about room temperature (low stringency conditions); 0.2 x SSC/0.1% SDS at about 420C (moderate stringency
conditions); and 0.1 x SSC at about 680C (high stringency conditions). One of skill in the art can readily determine variations on these conditions (for example, Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). The hydridization conditions can be carried out over 2 to 16 hours. Washing can be carried out using only one of the above conditions, for example, high stringency conditions, or each of the conditions can be used, for example, for 10-15 minutes each, in the order listed above, repeating any or all of the steps listed. However, as mentioned above, optimal conditions will vary, depending on the particular hybridization reaction involved, and can be determined empirically.
Sequence identity: The similarity between amino acid sequences is expressed in terms of the percentage identity between the sequences. The higher the percentage, the more similar the two sequences are. Homologs or variants of a sand fly salivary gland polypeptide will possess a relatively significant high degree of sequence identity when aligned using standard methods.
Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman, Adv. Appl. Math. 2:482, 1981; Needleman and Wunsch, J. MoI. Biol. 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins and Sharp, Gene 73:237, 1988; Higgins and Sharp, CABIOS 5:151, 1989; Corpet et al, Nucleic Acids Research 16:10881, 1988; and Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988. Altschul et al, Nature Genet. 6:119, 1994 presents a detailed consideration of sequence alignment methods and identity calculations.
The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. MoI. Biol. 215:403, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn, and tblastx. A description of how to determine sequence identity using this program is available on the NCBI website on the internet. Homologs and variants of a sand fly salivary gland polypeptide are typically characterized by possession of at least 75%, for example at least 80%, sequence
identity counted over the full length alignment with the amino acid sequence of the Lu. longipalpis polypeptide using the NCBI Blast 2.0, gapped blastp set to default parameters. The comparison between the sequences is made over the full length alignment with the amino acid sequence given in this present disclosure, employing the Blast 2 sequences function using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1).
When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. When less than the entire sequence is being compared for sequence identity, homologues and, variants will typically possess at least 80% sequence identity over short windows of 10-20 amino acids, and may possess sequence identities of at least 85% or at least 90% or 95% depending on their similarity to the reference sequence. Methods for determining sequence identity over such short windows are available at the NCBI website on the internet. One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is entirely possible that strongly significant homologues could be obtained that fall outside of the ranges provided.
Specific binding agent: An agent that binds substantially only to a defined target. Thus, for example, a Lu. longipalpis specific binding agent is an agent that binds substantially to a Lu. longipalpis polypeptide. In one embodiment, the specific binding agent is a monoclonal or polyclonal antibody that specifically binds the Lu. longipalpis polypeptide.
Subject: Living multi-cellular vertebrate organisms, a category that includes both human veterinary subjects, including human and non-human mammals. In one embodiment, the subject is a member of the canine family, such as a dog. In another embodiment, the subject is a human. T Cell: A white blood cell critical to the immune response. T cells include, but are not limited to, CD4+ T cells and CD8+ T cells. A CD4+ T lymphocyte is an immune
cell that carries a marker on its surface known as "cluster of differentiation 4" (CD4). These cells, also known as helper T cells, help orchestrate the immune response, including antibody responses as well as killer T cell responses. ThI and Th2 cells are functional subsets of helper T cells. ThI cells secrete a set of cytokines, including interferon-gamma, and whose principal function is to stimulate phagocyte-mediated defense against infections, especially related to intracellular microbes. Th2 cells secrete a set of cytokines, including interleukin (IL)-4 and IL-5, and whose principal functions are to stimulate IgE and eosinophil/mast cell-mediated immune reactions and to downregulate ThI responses. CD8+ T cells carry the "cluster of differentiation 8" (CD8) marker. In one embodiment, a CD8 T cell is a cytotoxic T lymphocytes. In another embodiment, a CD8 cell is a suppressor T cell.
Memory T cells are a specific type of infection-fighting T cell (also known as a T lymphocyte) that can recognize foreign invaders such as bacteria or viruses, that were encountered during a prior infection or vaccination. At a second encounter with the invader, memory T cells can reproduce to mount a faster and stronger immune response than the first time the immune system responded to the invader. This behavior is utilized in T lymphocyte proliferation assays, which can reveal exposure to specific antigens. Therapeutically effective molecule: An agent, such as a sand fly salivary gland polypeptide or a sand fly midgut polypeptide, that causes induction of an immune response, as measured by clinical response, for example, (i) increase in a population of immune cells or production of antibody that specifically binds a salivary gland or midgut polypeptide (for example a Lu. longipalpis polypeptide), (ii) a measurable reduction in symptoms of a disease (for example, after exposure to Leishmania, toxoplasma, tuberculosis, Malaria, or hookworm), or (iii) protection from infection (for example, by Leishmania or Plasmodium). Therapeutically effective molecules can also be nucleic acid molecules. Examples of a nucleic acid-based therapeutically effective molecule include a nucleic acid sequence that encodes a sand fly salivary gland polypeptide or a sandfly midgut polypeptide, wherein the nucleic acid sequence is operably linked to a control element such as a promoter. Therapeutically active agents can also include
organic or other chemical compounds that mimic the effects of the sand fly salivary gland or midgut polypeptide.
The terms "therapeutically effective fragment of a sand fly salivary gland polypeptide" includes any fragment of the sand fly salivary gland or midgut polypeptide, a variant of the sand fly salivary gland or midgut polypeptide, or a fusion protein that includes a sand fly salivary gland or midgut polypeptide, that retains a function of the sand fly salivary gland or midgut polypeptide (such as immunogenicity), or retains the ability to reduce the symptoms from exposure to a disease, or to protect from infection, for example with Plasmodium or Leishmania. Thus, in one embodiment, a therapeutically effective amount of a fragment of sand fly polypeptide (such as a salivary gland or midgut polypeptide) is an amount used to generate an immune response to the polypeptide. In another embodiment, a therapeutically effective amount of a fragment of a sand fly polypeptide is an amount used to prevent or treat a disease or infection (for example, by a parasite such as Plasmodium or Leishmania) in a subject. Treatment refers to a therapeutic intervention that confers resistance to infection, or a reduction in the symptoms associated with exposure to a parasite. Specific, non- limiting examples of a sand fly polypeptide fragment are the N-terminal half or the C-terminal half of one of the sand fly polypeptides disclosed herein. It should be noted that fusion proteins are included, such as a fusion with six histidine residues, a c-myc tag, or any other polypeptide tag. Such fusions are known to one of skill in the art, and are often used in protein purification.
Toxoplasma: A species of parasitic protozoa in the genus Toxoplasma. The definitive host of T. gondii is the cat, but the parasite can be carried by the vast majority of warm-blooded animals, including humans. Toxoplasmosis, the disease of which T. gondii is the causative agent, is usually minor and self-limiting but can have serious or even fatal effects on a fetus whose mother first contracts the disease during pregnancy or In an immunocompromised human or cat.
Transduced: A transduced cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques. As used herein, the term transduction encompasses all techniques by which a nucleic acid molecule might be
introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration.
Tuberculosis: A common and often deadly infectious disease caused by mycobacteria, mainly Mycobacterium tuberculosis. Tuberculosis usually attacks the lungs but can also affect the central nervous system, the lymphatic system, the circulatory system, the genitourinary system, the gastrointestinal system, bones, joints, and even the skin. Other mycobacteria such as Mycobacterium bovis, Mycobacterium africanum, Mycobacterium canetti, and Mycobacterium microti also cause tuberculosis, but these species are less common.
Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transduced host cell. A vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. A vector may also include one or more selectable marker genes and other genetic elements known in the art.
Vaccine: Composition that when administered to a subject, induces a decrease of the severity of the symptoms of a disorder or disease. In one specific, non-limiting embodiment, a vaccine decreases the severity of the symptoms associated with infection by Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma, and/or decreases the parasitic load.
Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Hence "comprising A or B" means including A, or B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present
disclosure, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. All sequence database references are incorporated by reference as of the date of the filing of this application. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
Sand Fly Polypeptides as Adjuvants A. Overview
Adjuvants are used in conjunction with an antigen to modify or augment the immunogenic effects of the antigen. Adjuvants function by mimicking specific sets of evolutionarily conserved molecules which include liposomes, lipopolysaccharide (LPS), components of bacterial cell walls, and endocytosed nucleic acids (such as double-stranded RNA, single-stranded DNA, and unmethylated CpG dinucleotide- containing DNA). As immune systems have evolved to recognize these specific moieties, the presence of adjuvant mimics a natural infection and augments the activities of dendritic cells (DCs), lymphocytes, and macrophages, thereby increasing the innate immune response to the antigen. Thus, the presence of adjuvant results in a more potent immune response to the antigen. However, as such adjuvants have a high level of toxicity and trigger severe local inflammation, as well as other undesirable side effects, there is a need to develop alternative adjuvants that are both safe and effective.
Disclosed herein are sand fly polypeptides that surprisingly behave as potent "non-classical" adjuvants. In contrast to "classical" adjuvants, these polypeptides are immunogenic. Thus, they are more potent immunologically than classical adjuvants and much smaller amounts of the disclosed polypeptides are required to prime or enhance an immune response against an antigen. This is advantageous, as classical adjuvants cause various undesirable side effects in subjects. In addition, as a non-classical adjuvant is immunogenic and can induce an immunologic response (such as a recall or T cell memory response), its ability to prime or enhance an
immune response against an antigen is more long-lasting than that generated by classical adjuvant.
B. Sand fly polypeptides as adjuvants
It is surprisingly disclosed herein that a sand fly salivary gland or midgut polypeptide is a very potent immunogen that can elicit a strong immune response against an antigen in a subject even when administered in small quantities (for example, nanogram (ng) or microgram (μg) quantities). In a specific, non-limiting embodiment, a disclosed salivary gland polypeptide is administered to a subject in a dose ranging between 1 ng/dose and 500 mg/dose. In contrast, classical adjuvant is typically administered in a dose ranging between 100 μg/dose and 500 μg/dose, and the salivary gland polypeptide can be administered in this dose as well. The immunogenic sand fly polypeptides of this disclosure can be an isolated polypeptide from any vector species of sand fly, such as a Phlebotomus or Lutzomyia sand fly, for example (but not limited to) Phlebotomus papatasi, Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P. sergenti, P. arabicus, P. tobbi, or Lutzomyia longipalpis. The sand fly polypeptide can be a salivary gland polypeptide or a midgut polypeptide. When administered to a subject the disclosed polypeptides prime or enhance an immune response to an antigen in the subject. More specifically, the disclosed polypeptides induce a lymphocytic response to the antigen in the subject. The lymphocytic response can be a B lymphocyte response, a T lymphocyte response, an NKT cell response or an NK cell response, or a combination thereof. A T lymphocyte response can be a memory T cell response, or more specifically, a CD4+ or a CD8+ T cell response. Specific CD4+T cell responses include a ThI or a Th2 response. Exemplary immunogenic sand fly salivary gland polypeptides include a polypeptide having an amino acid sequence as set forth as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 6.
Other immunogenic sand fly polypeptides include sand fly salivary polypeptide sequences disclosed in PCT/US2003/034453 filed October 29, 2003; PCT Application No. PCT/US03/29833, filed September 18, 2003; and
PCT/US02/19663, filed June 18, 2002, each of which is incorporated herein by
reference. Further immunogenic sand fly salivary gland polypeptides include those disclosed in Kato et al, BMC Genomics, 7:226, 2006; Anderson et al, BMC Genomics, 7:52, 2006; Oliveira et al, Vaccine, 24:374-390, 2006; Valenzuela et al, J. Exp. Biol, 207:3717-3729, 2004, each of which is incorporated herein by reference. Exemplary immunogenic Lu. longipalpis . P. ariasi, P. perniciosus, and P. argentipes salivary gland polypeptides include PpSP15-like protein, apyrase, yellow protein, antigen 5-related protein, PpSP32-like ptorein, D7-related protein, and endonuclease-like protein. Exemplary immunogenic P. duboscqi salivary gland polypeptides include PpSP14-like proteins, PpSP15-like proteins, PpSP12-like proteins, D7-like proteins, antigen 5-related protein, apyrase-like protein, yellow- related protein. In further embodiments, the immunogenic sand fly polypeptide is a sand fly midgut polypeptide disclosed in (Dillon et al., Genomics, 88:831-840, 2006; Ramalho-Ortigao et al., BMC Genomics, 9:300, 2007; Jochim et al, BMC Genomics 2008;9: 15), incorporated herein by reference. Exemplary immunogenic Lu. longipalpis midgut polypeptides include trypsin 1, trypsin 2, trypsin 3, trypsin 4, chymotrypsin, carboxypeptidase, peritrophin, astacin, microvillar-like protein, glutathione s-transferase, catalase, peroxiredoxins, glyceraldehydes-3 -phosphate dehydrogenase, fructose-bisphosphate aldolase, and enolase. Exemplary immunogenic P. papatasi midgut polypeptides include microlli protein, peritrophin, chymotrypsin, carboxypeptidase, typsin, ribosome associated membrane protein, astacin, glutathione s-transferase, and chitinase.
Immunogenic sand fly polypeptides can be a polypeptide at least 80%, 85%, 90%, 95%, or 99% homologous to the salivary gland or midgut polypeptides disclosed herein, or a conservative variant, a homolog or an immunogenic fragment comprising at least eight or at least ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides.
In other embodiments, an isolated nucleic acid sequence encoding the sand fly polypeptide (for example, a salivary gland polypeptide or a midgut polypeptide) can be from any vector species of sand fly, such as a Phlebotomus or Lutzomyia sand fly, for example (but not limited to) Phlebotomus papatasi, Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P.
sergenti, P. arabicus, P. tobbi, or Lutzomyia longipalpis. Exemplary polynucleotide sequences encoding a sand fly polypeptide include the nucleic acid sequence as set forth as SEQ ID NO: 5 (the unprocessed protein is encoded by nucleic acids 16-360 of SEQ ID NO:5, and the mature protein is encoded by the nucleic acid sequence 82- 360 of SEQ ID NO:5), SEQ ID NO: 7 (the unprocessed protein is encoded by nucleic acids 20-1216 of SEQ ID NO: 7, and the mature protein is encoded by the nucleic acid sequence 74-1216 of SEQ ID NO:7), SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10. Other specific non-limiting examples of a polynucleotide encoding a sand fly polypeptide is a polynucleotide having at least 80%, 85%, 90%, 95%, or 99% homology to one of the sequences disclosed herein. In a specific, non-limiting embodiment, an isolated nucleic acid sequence encoding the sand fly polypeptide is administered to a subject in a dose ranging between 5 μg/dose and 50 μg/dose. In contrast, classical adjuvant is typically administered in a dose ranging between 100 μg/dose and 500 μg/dose. The polynucleotides of the disclosure include sequences that are degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the disclosure as long as the amino acid sequence of the sand fly salivary gland or midgut polypeptide encoded by the nucleotide sequence is functionally unchanged. In one embodiment, a recombinant vector comprises an isolated nucleic acid sequence encoding at least one sand fly salivary gland polypeptide disclosed herein. In one embodiment, the two or more sand fly salivary gland polypeptide(s) are encoded by the same recombinant vector. In another embodiment, the two or more polypeptide(s) are encoded by different recombinant vectors. The sand fly polynucleotides include a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (for example, a cDNA) independent of other sequences. The nucleotides can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide. The term includes single and double forms of either nucleotide. Recombinant vectors are also disclosed herein that include a polynucleotide
encoding a polypeptide or a fragment thereof according to the disclosure. Recombinant vectors include plasmids and viral vectors and may be used for in vitro or in vivo expression.
A plasmid may include a DNA transcription unit, for instance a nucleic acid sequence that permit it to replicate in a host cell, such as an origin of replication (prokaryotic or eukaryotic). A plasmid may also include one or more selectable marker genes and other genetic elements known in the art. Circular and linear forms of plasmids are encompassed in the present disclosure.
For in vivo expression, the promoter is generally of viral or cellular origin. In one embodiment, the cytomegalovirus (CMV) early promoter (CMV-IE promoter), including the promoter and enhancer, is of use. The CMV-IE promoter can be of human or murine origin, or of other origin such as rat or guinea pig (see EP 0260148; EP 0323597; WO 89/01036; Pasleau et al, Gene 38:227-232, 1985; Boshart M. et al, Cell 41 :521-530, 1985). Functional fragments of the CMV-IE promoter may also be used (WO 98/00166). The SV40 virus early or late promoter and the Rous Sarcoma virus LTR promoter are also of use. Other promoters include but are not limited to, a promoter of a cytoskeleton gene, such as (but not limited to) the desmin promoter (Kwissa M. et al, Vaccine 18(22):2337-2344, 2000), or the actin promoter (Miyazaki J. et al, Gene 79(2):269-277, 1989). When several genes are present in the same plasmid, they may be provided in the same transcription unit or in different units.
The polypeptides and polynucleotides of the disclosure can be included in an immunogenic composition or a vaccine. In one embodiment, the immunogenic composition or vaccine consists of the immunogenic sand fly polypeptide alone. In an alternative embodiment, the immunogenic composition or vaccine comprises the immunogenic polypeptide and an antigen. The antigen can be from an infectious disease or from a neoplast disease (such as a tumor). In one specific embodiment, the antigen is from an infectious disease, wherein the disease is not leishmaniasis.
In particular embodiments, the infectious disease can have a viral, chlamydial, rickettsial, bacterial, fungal, protozoan, or helminth origin. In some embodiments, the virus causes a respiratory disorder (for example, adeno, echo,
rhino, coxsackie, influenza, parainfluenza, or respiratory syncytial virus), a digestive disorder (for example, rota, parvo, dane particle, or hepatitis A virus), an epidermal- epithelial disorder (for example, verruca, papilloma, molluscum, rubeola, rubella, small pox, cowpox), a herpes virus disease (for example, varicella-zoster, simplex I, or simplex II virus), an arbovirus disease (for example, dengue, yellow, or hemorrhagic fevers), a viral disease of the central nervous system (for example, polio or rabies), a viral heart disease, or acquired immune deficiency (AIDS). In particular embodiments, the chlamydia antigen is an antigen that causes ornithosis (C. psittacϊ), chlamydial urethritis and cervicitis (C. trachomatis), inclusion conjunctivitis (C trachomatis), trachoma (C trachomatis), or lymphogranuloma venereum (C trachomatis)). In particular embodiments, the rickettsia antigen is an antigen that causes typhus fever (R. prowazekii), Rocky Mountain spotted fever (R. rickettsi), scrub fever (R. tsutsugamushi), or Q fever (Coxiella burnetii). In particular embodiments, the bacteria antigen is a Pyogenic cocci antigen and causes, for example, staphylococcal, streptococcal, pneumococcal, meningococcal, and gonococcal infections; a gram-negative rod antigen and causes, for example, E. coli, Klebsiella, enterobacter, pseudomonas, or legionella infections; a childhood bacteria and causes, for example, hemophilus influenza, bordetella pertussis, or diphtheria infections. Also encompassed in this disclosure are bacterial antigens from enteropathic bacteria (for example, S. typhi), Clostridia (for example, C. tetani or C. botulinum)), and mycobacteria (for example, M. tuberculosis or M. leprae).
In particular embodiments, the fungal antigen is an antigen from Candidae (for example, C. albicans) or Aspergillis (for example, A.fumigatus). In other embodiments, the protozoan antigen is from, for example, Giardia Lamblia, Trichomoniasis, Pneumocystosis, Plasmodium, Leishmania, or Toxoplasma. In further embodiments, the helminth antigen is from, for example, Trichuris, Necator americanus (hookworm disease), Ancylostoma duodenale (hookworm disease), Trichinella spiralis, or S. mansoni. In some embodiments, the antigen is referred to as a "target antigen," wherein the target antigen is an antigen other than a sand fly salivary gland polypeptide antigen. In other embodiments, the immunogenic compositions and vaccines include a nucleic acid sequence encoding the target
antigen. It will be understood that known or later discovered infectious disease- associated antigens can be used in the compositions and methods of the present invention as target antigens for treating or preventing infectious diseases.
In further embodiments, the disease antigen can be a tumor antigen. The tumor can be of any organ or tissue, including but not limited to solid organ tumors. For example, the tumor can be melanoma, colon-, breast-, lung, cervical-, ovarian, endometrial-, prostate-, skin-, brain-, liver-, kidney, thyroid, pancreatic, esophageal-, or gastric cancer, leukemias, lymphomas, multiple myeloma, myelodysplastic syndrome, premalignant HPV-related lesions, intestinal polyps and other chronic states associated with increased tumor risk. It will be understood that known or later discovered tumor-associated antigens can be used in the compositions and methods of the present invention as target antigens for treating or preventing a tumor.
The immune response caused by the polypeptides and polynucleotides of this disclosure, can be a humoral response or a cellular response. In some embodiment, the immune response is a B cell, a T cell, an NKT cell, or an NK cell response or a combination thereof. A T cell response can be a CD4+ T helper cell response or a memory T cell response, or more specifically, a CD4+ or a CD8+ T cell response. In some embodiments, a CD4+ T helper cell response is a ThI response, in other embodiments, a CD4+ T helper cell response is a Th2 response. For example, a ThI type response can allow macrophages to take up Leishmania antigens and present them to T cells in a ThI context. The induction the ThI response can enhance an immune response, or can prime the immune system of the mammalian host in response to a later infection. The T cell response can also enhance an immune response against a disease or target antigen, for example an antigen from an infectious disease or a tumor, or can prime the immune system of the mammalian host for preventative immunity against a disease antigen in response to a later infection.
Any assay known in the art can be used to test the ability of the disclosed sand fly polypeptdies to induce an immune response, or more specifically a memory T cell response. In one embodiment, the proliferation of memory T cells is measured. One skilled in the art appreciates that the effects of an agent (for
example, sand fly polypeptide) on a cell is typically compared to a corresponding control cell not contacted with the agent. Thus, the methods include comparing the proliferation of a memory T cell contacted by a sand fly polypeptide to the proliferation of a control cell in the absence of the sand fly polypeptide. In other embodiments, the expression of a cell surface marker in a cell treated with a candidate agent (for example, sand fly polypeptide) is compared to untreated control samples to identify a sand fly polypeptide that increases the expression of the cell surface marker in the contacted cell. Polypeptide expression or activity can be compared by procedures well known in the art, such as Western blotting, flow cytometry, immunocytochemistry, binding to magnetic and/or surface marker-specific antibody-coated beads, in situ hybridization, fluorescence in situ hybridization (FISH), ELISA, microarray analysis, RT-PCR, Northern blotting, or calorimetric assays, such as the Bradford Assay and Lowry Assay. Once identified, such sand fly polypeptides may be used to increase an innate immune response in a subject in need thereof, or to increase memory T cell proliferation.
Therapeutic and Preventative Methods, and Pharmaceutical Compositions
The present disclosure provides methods of using a sand fly salivary gland or midgut polypeptides to prime and/or enhance an immune response against an antigen in a subject. In this manner, the sand fly salivary gland or midgut polypeptide acts as an adjuvant for an antigen. The antigen can be any polypeptide other than a salivary gland polypeptide, for example, an antigen of an organism causing a disease, for example a Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma antigen, or a nucleic acid sequence encoding such polypeptides. The immunogenic compositions and the vaccines disclosed herein can be administered for preventative and therapeutic treatments. In preventative treatments, compositions are administered to a subject at risk of acquiring a disease, such as (but not limited to) diseases caused by Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma, in a therapeutically effective amount, which is an amount sufficient to prevent the disease or a sign or symptom of the disease.
Amounts effective for this use will depend upon the disease and the general state of
the subject's health. In therapeutic applications, compositions are administered to a subject suffering from a disease, such as (but not limited to) diseases caused by Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma, in a therapeutically effective amount, which is an amount sufficient to cure, treat, or at least partially arrest the disease or a sign or symptom of the disease. Amounts effective for this use will depend upon the severity of the disease and the general state of the subject's health. Thus, the immunogenic compositions and the vaccines disclosed herein can be used in a method for treatment of diseases caused, for example, by Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma. The methods provided herein include the administration of at least one sand fly salivary gland or midgut polypeptide to a subject. In another embodiment, the methods provided herein include the administration of at least one polynucleotide encoding a sand fly salivary gland or midgut polypeptide. An antigen of an organism causing a disease (disease antigen) can be administered in conjunction with (before, concurrently, or after) the administration of the sand fly polypeptide or polynucleotide. The sand fly polypeptides and polynucleotides can be included in an immunogenic composition or vaccine according to the disclosure. An antigen, a pharmaceutically acceptable carrier, and/or other agents can also be included in an immunogenic composition or vaccine containing the sand fly polypeptide or polynucleotide. An immunogenic composition or a vaccine according to the disclosure can be prepared in accordance with standard techniques well known to those skilled in the pharmaceutical or veterinary art. Such compositions can be administered in dosages and by techniques well known to those skilled in the medical or veterinary arts, taking into consideration such factors as the age, sex, weight, species, and condition of the particular subject, and the route of administration.
The sand fly salivary gland or midgut polypeptides and antigen can be administered by any means known to one of skill in the art (See Banga, A., "Parenteral Controlled Delivery of Therapeutic Peptides and Proteins," Therapeutic Peptides and Proteins, Technomic Publishing Co., Inc., Lancaster, PA, 1995) such as by intramuscular (IM), intradermal (ID), subcutaneous (SC), or intravenous
injection, but even oral, nasal, or anal administration is contemplated. In one embodiment, administration is by subcutaneous, intradermal, or intramuscular injection using a needleless injector (Biojector™, Bioject, Oregon, USA).
To extend the time during which the sand fly salivary gland or midgut polypeptide (with or without antigen) is available to stimulate a response, the sand fly protein can be provided as an implant, an oily injection, or as a particulate system. The particulate system can be a microparticle, a microcapsule, a microsphere, a nanocapsule, or similar particle, (see, for example, Banja, supra). A particulate carrier based on a synthetic polymer has been shown to provide a controlled release. If more than one administration is required of the sand fly polypeptide, disease antigen, or both, they can be administered concurrently (for example, different compositions given during the same period of time via the same or different routes, or at the same or different sites, or a same composition given in the same period of time via different routes), or sequentially (for example, the same or different compositions given at least two times via the same or different routes). Sand fly polypeptides can be administered separately, but are preferably administered together, in the same immunogenic composition or vaccine as the antigen. Sand fly polynucleotides are preferably administered in separate immunogenic compositions, at different sites of injection, from the polynucleotide encoding the antigen. Optionally sand fly polynucleotides can be administered at the same injection site and/or in the same immunogenic composition or vaccine as the antigen polynucleotide.
In one embodiment, the sand fly salivary gland or midgut protein is administered before the antigen against which the immune response is mounted. Alternatively, the sand fly salivary gland or midgut polypeptide can be administered one time, two times, or more before the administration of the antigen. In other embodiments, the sand fly salivary gland or midgut polypeptide can be administered one time, followed by the administration of antigen one time, two times, three times, or more. In further embodiments, the sand fly salivary gland or midgut polypeptide is administered concurrently with the antigen. The concurrent administration of sand fly salivary gland or midgut polypeptide and antigen can be done one time, two
times, three times or more. When administered concurrently, the sand fly salivary gland or midgut polypeptide can be administered in the same immunogenic composition or vaccine as the antigen, or in separate immunogenic compositions or vaccines from the antigen. In another embodiment, the sand fly salivary gland or midgut protein is administered after the antigen against which the immune response is mounted. The sand fly salivary gland or midgut polypeptide can be administered one time, two times, or more after the administration of the antigen. In other embodiments, the antigen can be administered two times, three times, or more prior to the administration of the sand fly salivary gland or midgut polypeptide. In one embodiment, the delay between two sequential administrations is no more than 1 week, no more than two weeks, no more than three weeks, no more than four weeks, nor more than five weeks, or no more than six weeks. Following vaccination, annual boost administrations may be done.
In such compositions the sand fly polypeptide or disease antigen(s) may be in admixture with a suitable vehicle or excipient such as sterile water, physiological saline, glucose, or the like. The compositions can contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, adjuvants, gelling, or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. Standard texts, such as Remington's Pharmaceutical Science, 17th edition, 1985, incorporated herein by reference, may be consulted to prepare suitable preparations, without undue experimentation. The compositions can also be lyophilized.
Suitable dosages can also be based upon the examples below. For polypeptide-based compositions, the route of administration can be intradermal (ID), intramuscular (IM), subcutaneous (SC), intravenous, oral, nasal, or anal. This administration can be made with a syringe and a needle or with a needle-less apparatus like, for example, Biojector™ (Bioject, Oregon, USA). In several embodiments regarding the administration of sand fly polypeptide in mice, sand fly polypeptide dosages can be from about 1.0 ng/dose to about 1.0 μg/dose, from about 50 ng/dose to about 500 ng/dose, or from about 100 ng/dose to about 300 ng/dose. In several embodiments regarding the administration of sand fly polypeptide in
larger mammals, such as dogs, sand fly polypeptide dosages can be from about 1.0 μg/dose to about 100 μg/dose, from about 5 μg /dose to about 50 μg /dose, or from about 5 μg dose to about 10 μg /dose. Suitable dosages of antigen (polypeptide) in mice can be from about 1 μg/dose to about 500 μg/dose or 5 μg/dose to about 50 μg/dose. In larger mammals the antigen dose can be from about 5 μg/dose to about 750 μg/dose or from 50 μg/dose to about 500 μg/dose. In specific, non-limiting embodiments, the dose of sand fly polypeptide and antigen is administered in about a 1 :2, 1 :3, or 1 :4 ratio (sand fly polypeptide: antigen). In another embodiment, using a needle-less apparatus the volume of a dose can be between about 1.0 μl and 1.0 ml or between about 0.1 ml and about 0.5 ml. In yet another embodiment, using a needle-less apparatus the volume of a dose can be about 0.25 ml. In one embodiment, for conventional injection with a syringe and a needle, the volumes are from about 0.1 ml to about 2 ml. In another embodiment, for conventional injection with a syringe and a needle, the volumes are from about 0.5 ml to about 1 ml. In specific embodiments the above volumes are used in intramuscular injections. In other specific embodiments, the volume of an intradermal dose can be about 10 μl to about 200 μl, or about 50 μl to about 100 μl (for dogs, monkey, or humans) or 1 μl to about 50 μl or about 10 μl to about 20 μl (for mice or hamsters).
For plasmid-based compositions, the route of administration can be ID, IM, SC, intravenous, oral, nasal, or anal. This administration can be made with a syringe and a needle or with a needle-less apparatus like, for example, Biojector™. The dosage for mice is from about 1.0 μg to about 50 μg plasmid per dose. In other embodiments for mice, the plasmid encoding the sand fly salivary gland or midgut protein is present at a dosage of about 5 μg, 10 μg, 20 μg, 30 μg, or 40 μg. In other embodiments, the dosage for larger mammals, such as dogs, is about 10 μg to about 500 μg plasmid per dose, or a dosage of about 50 μg, 100 μg, 200 μg, 300 μg, or 400 μg. Suitable dosages of antigen (nucleic acid molecule encoding the polypeptide) in mice can be from about 5 μg/dose to about 500 μg/dose or 10 μg/dose to about 50 μg/dose. In larger mammals the antigen dose can be from about 50 μg/dose to about 750 μg/dose or from 100 μg/dose to about 500 μg/dose. In specific, non- limiting embodiments, the dose of nucleic acid encoding sand fly
polypeptide and nucleic acid encoding antigen is administered in about a 1 :2, 1 :3, or 1 :4 ratio. In one embodiment, using a needle-less apparatus, the volume of a dose can be between about 0.1 ml and about 0.5 ml. In another embodiment, the volume of a dose can be about 0.25 ml. Administration is preferably performed using multiple points of injection. In one embodiment, for conventional injection with a syringe and a needle, the volumes are from about 0.1 to about 2 ml. In another embodiment, the volumes are from about 0.5 to about 1 ml. The dosages are the same as those mentioned above. In specific embodiments the above volumes are used in intramuscular injections. In other specific embodiments, the volume of an intradermal dose can be about 10 μl to about 200 μl, or about 50 μl to about 100 μl (for dogs, monkey, or humans) or 1 μl to about 50 μl or about 10 μl to about 20 μl (for mice or hamsters).
For recombinant viral vector-based compositions, the route of administration can be ID, IM, SC, intravenous, oral, nasal, or anal. This administration can be made with a syringe and a needle or with a needle-less apparatus like, for example, Biojector™. The dosage is from about 103 pfu to about 109 pfu per recombinant poxvirus vector. In one embodiment, when the vector is a canarypox virus, the dosage is from about 105 pfu to about 109 pfu. In another embodiment, the dosage is from about 106 pfu to about 108 pfu. In one embodiment, the volume of needle-less apparatus doses could be between about 0.1 ml and about 0.5 ml. In another embodiment, the volume of needle-less apparatus dose is 0.25 ml. In yet another embodiment, administration is performed using multiple points of injection. In one embodiment, for conventional injection with a syringe and a needle, the volumes are from about 0.1 to about 2 ml. In another embodiment, the volumes are from about 0.5 to about 1 ml. The dosages are the same as mentioned above. In one embodiment, when a syringe with a needle is used, the injection is IM. In specific embodiments the above volumes are used in intramuscular injections. In other specific embodiments, the volume of an intradermal dose can be about 10 μl to about 200 μl, or about 50 μl to about 100 μl (for dogs, monkey, or humans) or 1 μl to about 50 μl or about 10 μl to about 20 μl (for mice or hamsters).
In one embodiment, the sand fly salivary gland or midgut polynucleotide is
administered before the polynucleotide encoding the antigen against which the immune response is mounted. Alternatively, the sand fly salivary gland or midgut polynucleotide can be administered one time, two times, or more before the administration of the antigen polynucleotide. In other embodiments, the sand fly salivary gland or midgut polynucleotide can be administered one time, followed by the administration of antigen polynucleotide one time, two times, three times, or more. In further embodiments, the sand fly salivary gland or midgut polynucleotide is administered concurrently with the antigen polynucleotide, preferably at different injection sites. The concurrent administration of sand fly salivary gland or midgut polynucleotide and antigen polynucleotide can be done one time, two times, three times or more.
In a prime-boost vaccination schedule, at least one prime-administration can be done with a composition containing a plasmid according to the disclosure, followed by at least one booster administration done with a composition containing a recombinant viral vector according to the disclosure, on the condition that a same antigen is present twice, coded by the plasmid and by the viral vector. Alternatively, the booster administration can be done with a composition containing a polypeptide according to the disclosure, on the condition that the same antigen is present twice, coded by the prime-administration plasmid and in the booster polypeptide-based composition. In another embodiment, the prime and the boost are both polypeptide- based compositions, on the condition that the same antigen is present in both steps. The dosage of plasmids and recombinant viral vectors are the same as above. Optionally, the prime and boost administrations can be done with a polypeptide- based composition. In this case, the dosage of the sand fly polypeptide is from about 1.0 ng/dose to about 1.0 μg/dose, from about 50 ng/dose to about 500 ng/dose, or from about 100 ng/dose to about 300 ng/dose.
Immunization by nucleic acid constructs is well known in the art and taught, for example, in U.S. Patent No. 5,643,578 (which describes methods of immunizing vertebrates by introducing DNA encoding a desired antigen to elicit a cell-mediated or a humoral response) and U.S. Patent No. 5,593,972 and U.S. Patent No.
5,817,637 (which describe operably linking a nucleic acid sequence encoding an
antigen to regulatory sequences enabling expression). U.S. Patent No. 5,880,103 describes several methods of delivery of nucleic acids encoding immunogenic peptides or other antigens to an organism. The methods include liposomal delivery of the nucleic acids (or of the synthetic peptides themselves), and immune- stimulating constructs, or ISCOMS ™, negatively charged cage-like structures of 30- 40 nm in size formed spontaneously on mixing cholesterol and Quil A™ (saponin). Protective immunity has been generated in a variety of experimental models of infection, including toxoplasmosis and Epstein-Barr virus-induced tumors, using ISCOMS ™ as the delivery vehicle for antigens (Mowat and Donachie, Immunol. Today 12:383, 1991). '
In another approach to using nucleic acids for immunization, a sand fly salivary gland or midgut polypeptide, or an immunogenic fragment thereof, can also be expressed by attenuated viral hosts or vectors or bacterial vectors. Recombinant vaccinia virus, adeno-associated virus (AAV), herpes virus, retrovirus, or other viral vectors can be used to express the peptide or protein, thereby eliciting a CTL response. For example, vaccinia vectors and methods useful in immunization protocols are described in U.S. Patent No. 4,722,848. BCG (Bacillus Calmette Guerin) provides another vector for expression of the peptides (see Stover, Nature 351 :456-460, 1991). In one embodiment, a nucleic acid encoding a sand fly salivary gland or midgut polypeptide, or an immunogenic fragment thereof, is introduced directly into cells, with our without antigen. For example, the nucleic acid may be loaded onto gold microspheres by standard methods and introduced into the skin by a device such as Bio-Rad's Helios™ Gene Gun. A needless injector can also be utilized, such as a Bioinjector2000™. The nucleic acids can be "naked," consisting of plasmids under control of a strong promoter. Typically, the DNA is injected into muscle, although it can also be injected directly into other sites. Exemplary dosages for injection are around 0.5 μg/kg to about 50 mg/kg, and typically are about 0.005 mg/kg to about 5 mg/kg (see, for example, U.S. Patent No. 5,589,466). In one embodiment, a prime-boost strategy for immunization is utilized.
Single or multiple administrations of the compositions are administered
depending on the dosage and frequency as required and tolerated by the subject. In one embodiment, the dosage is administered once as a bolus, but in another embodiment can be applied periodically until a therapeutic result is achieved. Generally, the dose is sufficient to treat or ameliorate symptoms or signs of disease without producing unacceptable toxicity to the subject.
As noted above, the dosage of the composition varies depending on the weight, age, sex, and method of administration. The dosage can also be adjusted by the individual physician as called for based on the particular circumstances. The compositions can be administered conventionally as vaccines containing the active composition as a predetermined quantity of active material calculated to produce the desired therapeutic or immunologic effect in association with the required pharmaceutically acceptable carrier or diluent (for instance, carrier or vehicle). For example, about 50 ng of a DNA construct vaccine of the present disclosure can be injected intradermally three times at two week intervals to produce the desired therapeutic or immunologic effect. In another embodiment, a about 1 mg/Kg dosage of a protein vaccine of the present disclosure can be injected intradermally three times at two week intervals to produce the desired therapeutic or immunologic effect.
A vaccine is provided herein that includes a sand fly salivary gland or midgut polypeptide, with or without antigen. Other embodiments of a vaccine include sand fly salivary gland or midgut polynucleotide, with or without polynucleotide encoding antigen. Administration of the vaccine to a subject, such as a human or veterinary subject, results in a primed or enhanced immune response against an antigen from an organism that causes disease, such as a Leishamania, Plasmodium, Mycobacterium, hookworm, or toxoplasma antigen. In one embodiment, the subject is a human subject. In another embodiment, the subject is a canine subject, such as a dog.
The subject matter of the present disclosure is further illustrated by the following non-limiting Examples.
Sand Flies, Leishmania, and Transcriptome-Borne Solutions
Sand fly-parasite and sand fly-host interactions play an important role in the transmission of leishmaniasis. Vector molecules relevant for such interactions include midgut and salivary proteins. These potential targets for interruption of propagation of Leishmania parasites have been poorly characterized. Transcriptomic analysis has proven to be an effective tool for identification of new sand fly molecules, providing exciting new insights into vector-based control strategies against leishmaniasis.
Leishmaniasis is a vector-borne neglected infectious disease that afflicts 88 countries with an estimated incidence of two million new cases each year. With expanding endemicity, an estimated 350 million people at risk and 2,357,000 disability-adjusted life years lost, leishmaniasis is becoming a worldwide re-emerging public health problem. One intriguing aspect of leishmaniasis is the wide spectrum of distinct clinical manifestations that include visceral, cutaneous, mucocutaneous, and diffuse cutaneous leishmaniasis.
Leishmaniasis is sustained through a triad of complex interactions between Leishmania parasites, the sand fly, and the mammalian host. In vector sand fly species, Leishmania parasites undergo a complex developmental cycle within the midgut that is necessary for generation of infectious metacyclics (vector-parasite interface). In addition, the natural mode of transmission to the mammalian host is by the bite of an infective sand fly. At the bite site, sand flies release an array of pharmacologic, immunomodulatory, and immunogenic molecules that have immediate and long-lasting effects on the host (the vector-host interface). The availability of high-throughput approaches, mainly tissue-specific transcriptomes, has facilitated the identification of pertinent vector molecules that affect the development of the Leishmania parasite, its transmission, and its establishment in the mammalian host. This information can lead to novel strategies for the control of leishmaniasis.
The sand fly-Leishmania molecular interface
The Phlebotomus (Old World) and Lutzomyia (New World) genera include
the majority of anthropophilic sand flies and are the most important vectors of leishmaniasis. Establishment of a transmissible Leishmania infection within the vector sand fly occurs solely within the lumen of the midgut. Once a sand fly feeds on an infectious host, it ingests a blood meal containing Leishmania-infected macrophages, beginning the life cycle in the sand fly. Amastigotes are released after rupture of the macrophage and differentiate into several developmental stages, from flagellated procyclics to infectious-stage metacyclic promastigotes.
Within the sand fly midgut are numerous natural barriers to parasite development, including resistance to digestive enzymes, escaping the peritrophic matrix (PM), and binding to the midgut epithelium. The midgut of a sand fly is therefore a fundamental organ representing a key target for interruption of Leishmania development and transmission. Despite the importance of this organ, very few molecules in the midgut of sand flies have been characterized to date.
Transcriptomics meets biology
Transcriptomics is a powerful tool for rapid identification of molecules expressed in a whole organism or particular tissue. Dillon et al. {Genomics 2006;88:831-40) generated 10,203 transcripts using whole Lutzomyia longipalpis sand flies that combined unfed, blood- fed, and flies infected with a variety of pathogens including Leishmania, providing a global descriptive repertoire of sand fly molecules. This was followed by more refined midgut-specific analysis of 2,934 transcripts from Lu. longipalpis (Jochim et al, BMC Genomics 2008;9:15) and 1,382 transcripts from Phlebotomus papatasi (Ramalho-Ortigao et al., BMC Genomics 2007;8:300), offering a better characterization of midgut molecules and revealing for the first time the ability of Leishmania parasites to modulate vector midgut transcripts. The following is an account of molecules identified through tissue-specific transcriptomic analysis.
Midgut proteases. Midgut proteases facilitate blood-meal digestion and are likely to confer some defense against ingested organisms. The presence of Leishmania
promastigotes in the midgut lumen of sand flies has been shown to inhibit proteolytic activity. Infections initiated with Leishmania amastigotes, a more natural mode of infection, also caused a delay in trypsin and aminopeptidase activity. Until recently, it has been unclear which specific proteolytic enzymes are regulated by the presence of the parasite, and knowledge of the full repertoire of sand fly midgut proteases was not available.
Cellular immunity
In humans, the presence of a DTH response to bites of sand flies has been well documented (Theodor, Trans Roy Soc Trop MedHyg 1935;29:273-84). The significance of this DTH response in protection from leishmaniasis was first demonstrated in murine models of cutaneous leishmaniasis and was correlated with the production of IL-12 and IFN-γ (Kamhawi et al., Science 2000;290:1351-4; Valenzuela et al, J Exp Med 2001 ;l94:33l-42). Recently, a subset of human volunteers repeatedly exposed to Lu. longipalpis produced a DTH response at the bite site. Peripheral blood mononuclear cells isolated from these individuals induced IFN-γ upon stimulation with sand fly SGH and controlled parasite growth in vitro (Vinhas et al., Eur J Immunol 2007;37:3111-21). This suggests that the correlates of protection from Leishmania infection demonstrated for rodent models may apply to humans as well. Nevertheless, outbred populations including humans probably recognize and mount immunity to different proteins within the saliva. Therefore, identification of immunodominant salivary proteins that can elicit a ThI -type DTH response should lead to the discovery of a protective salivary molecule to control Leishmania infection. Challenged in the absence of saliva, animals immunized with sand fly salivary proteins do not control Leishmania infection. These data suggest that the anti-saliva immune response is not directed against Leishmania parasites. We believe that a DTH response to saliva affects the initial steps in establishment of Leishmania infection in the mammalian host. This anti-saliva immune response may alter the type and activation of macrophages or other host cells that otherwise would silently maintain the parasites. This could result in direct killing of Leishmania
parasites, thus reducing the infective load. Additionally, a ThI anti-saliva immunity may create an environment that accelerates priming of a protective ThI anti-Leishmania immunity. Under these circumstances, any protein that induces a ThI response in the dermis would affect Leishmania infection. The significance of anti-saliva immunity lies in the fact that, in nature, these sand fly salivary proteins will always be present at the site of Leishmania deposition during transmission. Indeed, salivary proteins can be considered "non-classical natural adjuvants."
Sandfly salivary gland transcriptomics Transcriptomics represent a rapid and efficient method to identify the most abundant secreted proteins from salivary glands of pertinent vectors of disease. Use of sand fly salivary gland transcriptomics resulted in the identification of complete sets of secreted salivary proteins from glands of several relevant vectors of cutaneous (P. papatasi, P. duboscqi) (Valenzuela et al, J Exp Med 2001; 194:331-42; Kato et al, BMC Genomics 2006;7:226) and visceral
(P. argentipes, P. ariasi, P. perniciosus, and Lu. longipalpis) leishmaniasis (Anderson et al, BMC Genomics 2006;7:52; Oliveira et al, Vaccine 2006;24:374-90; Valenzuela et al, J Exp Biol 2004;207:3717-29). This is of particular significance since the sequence of the sand fly genome is not yet available.
Transcriptomics and anti-saliva immunity
The potential of anti-saliva immunity in protecting against leishmaniasis represents an untapped approach to produce better vaccines. Through transcriptomic analysis, customized bioinformatics, and high-throughput DNA vaccination, we were able to screen complete repertoires of highly abundant salivary proteins in search of ThI DTH-inducing molecules (Oliveira et al, Vaccine 2006;24:374-90; Oliveira et al, PLoS Negl Trop Dis 2008;2:e226; Gomes et al, Proc Natl Acad Sd £/S.4 2008;105:7845-50).
The salivary gland transcriptome of P. papatasi identified two DTH-inducing molecules that produced contrasting protective (PpSP 15) and exacerbative (PpSP44) outcomes of L. major infection (Oliveira et al, PLoS Negl Trop Dis 2008;2:e226).
This study demonstrated that not all DTH-inducing molecules are protective and that some produce a Th2 profile that is exacerbative. It also validated the transcriptomic approach for identification of protective molecules by corroborating the protective nature of PpSP 15 against L. major infection in mice. The contrasting immune responses to PpSP 15 and PpSP44 provided the first evidence that anti-saliva immunity alters the environment in the skin hours following sand fly bites. This could favor or hinder the establishment of Leishmania parasites, depending on the nature of the salivary protein. Another testament to the value of transcriptomics is the demonstration that immunity to a defined salivary protein (LJM 19), identified from the salivary transcriptome of Lu. longipalpis (Valenzuela et ah, J Exp Biol 2004;207:3717-29), protected from the fatal outcome of visceral leishmaniasis in hamsters (Gomes et ah, Proc Natl Acad Sci USA 2008;105:7845-50). The systemic protection from L. infantum chagasi conferred by immunization with LJM 19 further alludes to the effect of anti-saliva immunity on priming a ThI anti-Leishmania immune response.
Comparative salivary gland transcriptomics
Comparative transcriptomic analysis of salivary glands from different sand fly species revealed the presence of both common proteins and genus-specific salivary molecules (Anderson et ah, BMC Genomics 2006;7:52). Among the salivary proteins shared by at least by five different sand fly species, including two different genera (Phlebotomus and Lutzomyia), are the PpSP15-like proteins, apyrases, yellow-related proteins, antigen 5-related proteins, PpSP32-like proteins, 33-kDa proteins, D7-related proteins, and an endonuclease. The level of similarity between these proteins among different species indicates that salivary vaccines may work at the species level or even within a single genus. This is further supported by the high level of conservation observed in salivary proteins from P. duboscqi sand flies at the ends of its geographic distribution (Mali to the west and Kenya to the east). Conserved regions included the predicted MHC class II T cell epitopes of PpSP15-like, D7-related, PpSP32-like, antigen 5-related, apyrase, and yellow-related salivary proteins.
EXAMPLES
Example 1
Immunity to distinct sand fly salivary proteins primes the anti-Leishmania immune response towards protection or exacerbation of disease.
Immunization with two salivary proteins from P. papatasi, PpSP 15 and PpSP44, produced distinct immune profiles that correlated with resistance or susceptibility to Leishmania infection. The demonstration for the first time that immunity to a defined salivary protein (PpSP44) results in disease enhancement stresses the importance of the proper selection of vector-based vaccine candidates.
To date, only two sand fly salivary proteins, Maxadilan from Lutzomyia longipalpis and PpSP 15 from Phlebotomus papatasi, have shown promise as protective molecules against leishmaniasis (Morris et ah, J Immunol 167: 5226- 5230, 2001; Valenzuela et ah, J Exp Med 194: 331-342). It is proposed that immunity to maxadilan neutralizes exacerbation of L. major infection, while immunization with PpSP 15 results in protection of wild-type and B-cell deficient mice indicating that cellular immunity to PpSP 15 is sufficient for protection. Moreover, the protection observed by immunization with PpSP 15 was associated with a DTH response. More recently, Oliveira et al. {Vaccine 24: 374-390, 2006) investigated the IgG isotypes produced by DNA immunization with plasmids encoding distinct DTH-inducing sand fly salivary proteins and showed that some molecules produce IgG2a antibodies indicative of a ThI response while others surprisingly produced IgGl, a marker for Th2 response in mice. Two additional DTH-inducing salivary proteins in P. papatasi are identified herein, PpSP42 and PpSP44. Mice immunized with either of these molecules were not protected against L. major infection. Moreover, PpSP44-immunized mice showed aggravated lesions. This allowed the exploration as to how immunity to specific salivary proteins could affect the outcome of L. major infection. It is disclosed herein that an early adaptive immune response specific to a salivary protein is able to prime the anti-Leishmania immune response leading to protection
or exacerbation of L. major infection. More importantly, this adaptive response is efficiently elicited by sand fly bites, the natural route of transmission.
Methods Sand fly rearing and exposure to animals.
P. papatasi Israeli strain sand flies were reared at the Walter Reed Army Medical Research Institute and at the Laboratory of Malaria and Vector Research, NIAID, NIH, as described elsewhere (Valenzuela et al, J Exp Med 194: 331-342, 2001). Preparation of salivary gland homogenate (SGH) and pre-exposure of mice (Charles River Laboratories Inc) to uninfected sand flies was carried out according to Valenzuela et al. (2001) and Kamhawi et al. (Science 290: 1351-1354, 2000). Experiments were performed using 6 to 8 weeks old C57BL/6 mice under pathogen free conditions. All animal studies were approved by the Animal Care and Use Committee at The National Institute of Allergy and Infectious Diseases. Construction of P. papatasi salivary DNA plasmids and immunization of mice.
Ten DNA plasmids encoding to P. papatasi salivary gland-secreted proteins were cloned into the VR2001-TOPO vector and purified as previously described (Oliveira et al, Vaccine 24: 374-390, 2006). Mice were immunized intradermally in the right ear three times at two weeks intervals with 5 μg of DNA plasmid in 10 μl sterile water or with the equivalent of 0.5 sand fly salivary gland pairs in 10 μl PBS. Intradermal challenge with SGH and Leishmania parasites.
Two weeks after the last DNA immunization, animals were challenged intradermally in the left ear with P. papatasi SGH (0.5 salivary gland pair/10 μl) to test for DTH inducing salivary proteins. For infection, a mixture of 0.5 pairs SGH and 500 L .major metacyclics in 10 μl (SGH-LM) was used to mimic the natural route of transmission. L. major clone Vl (MHOM/IL/80/Friedlin) was cultured in 199 medium with 10% heat-inactivated fetal bovine serum (HyClone), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L-glutamine and 40 mM Hepes. Ear thickness and lesion size. The ear thickness was measured 48 hours following intradermal injection of
P. papatasi SGH. Values are represented as Δ ear thickness (ear thickness of
experimental groups subtracted from the mean ear thickness of naϊve mice 48 hours after injection with 0.5 pair of SGH). For measurements of Leishmania lesions, the largest diameter was recorded on a weekly basis. Ear thickness and lesion diameter were measured using a Digimatic caliper (Mitutoyo Corp.). Parasite load.
Total genomic DNA was extracted from mice ears using the DNeasy tissue kit following the manufacturer's protocol (Qiagen). A total of 100 ng was amplified by real time PCR (LightCycler 480, Roche Diagnostics) using primers JWl 1 and JW12 (Nicolas et al, J Clin Microbiol 40: 1666-1669, 2002) and 18S primers as a housekeeping gene with the FastStart Sybr green I kit (Roche). The standard curve was generated using DNA from naϊve ears spiked with 10-fold serial dilutions of L. major DNA. Expression levels were normalized to 18S DNA and corrected for the weight of the whole ear. Values represent the relative number of parasites per ear. Intracellular Cytokines. Cells were recovered from the ear dermis as described previously (Belkaid et al, J Exp Med 188: 1941-1953, 1998). Cells (5xlO6) were stimulated with or without 100 μg soluble Leishmania antigen (SLA) for 12 hours. The cells were then stimulated with 20 ng PMA and 500 ng ionomycin, in the presence of monensin (2 μM final concentration) for 4 hours. For surface markers, cells were washed, incubated for 15 min at 4°C with 2.4G2 mAb to block FcγR, and stained with APC- Cy7 αCD4 (RM4-5) and APC-TCRβ chain (H57-597) for 20 min at 4°C. The cells were fixed, permeabilized (Cytofϊx/Cytoperm Plus; BD Pharmingen) and stained with PE-Cy7 αlFN-γ (XMG 1.2) and PE αIL-4 (1 IBl 1). The data were collected using a FAC S Array (BD Biosciences) and analyzed with Flow Jo software (Tree Star). The lymphocytes were gated using size, granularity and surface markers. GEArray.
Expression profile of cytokines, chemokines, and related inflammatory genes was generated using the mouse inflammatory cytokines and receptor Oligo GEArray (OMM-011; Superarray). This array contains 112 genes representing cytokines, receptors and housekeeping genes. Two hours after challenge, total RNA was isolated from the left ears using QIAshredder (Qiagen) and RNeasy Mini Kit
(Qiagen) following the manufacturer's instructions. RNA (6 μg) from a pool of seven ears was amplified and labeled with biotin 16-UTP (Roche Diagnostics) using the SuperArray TrueLabeling-RT Enzyme kit (Superarray). The resulting biotinylated cRNA was hybridized overnight to the Oligo GEArray® membrane. After washing and blocking the array membranes, alkaline phosphatase-conjugated streptavidin was added to the membrane followed by CDP-Star substrate. A chemiluminescent signal was acquired using the Image Station 2000 MM (Kodak). The data was analyzed using the GEArray Expression Analysis Suite (Superarray). Analysis parameters were set to local background correction and normalized to a set of housekeeping genes included in each membrane. Results were expressed as the fold increase in the intensity of the captured signal over the levels in naϊve ears challenged with SGH-LM. Only genes showing a four-fold or higher change in expression compared to the naϊve group in at least two of three independent experiments were considered. GEArray Validation.
The genes that showed a four-fold or higher change in expression over control using the GEArray were validated by Real time PCR. Five μg of total RNA from mice ears was used for the synthesis of cDNA (Superscript III, Invitrogen) following the manufacturer's instructions. The cDNA was amplified with the 480 Master SYBR Green I mix (Roche Diagnostics) and gene specific primer sets for IFN-γ, IL-4, IL-5, TNF-α and IL-12Rβ2 (Superarray) using the LightCycler 480 (Roche Diagnostics). A standard curve for each set of primers was generated as recommended by the manufacturer. The expression levels of the genes of interest were normalized to endogenous 18S RNA levels. The results are expressed in fold change over naive ears challenged with SGH-LM. Statistical analysis.
Statistical evaluation of the means of experimental groups was done using one-way analysis of variance followed by the Tukey-Kramer post-test. Data from parasite numbers were log transformed before conducting statistical tests. Significance was determined as/?<0.05. All statistical tests and graphs were done using Prism-GraphPad version 5 (GraphPad Software Inc.).
Results
Immunization with PpSPlS, PpSP42 and PpSP44 salivary proteins induces a specific DTH response. Of 10 different DNA plasmids coding for the most abundant P. papatasi salivary proteins (Valenzuela et al, J Exp Med 194: 331-342, 2001; Anderson et al, BMC Genomics 7: 52, 2006), PpSP 12 (12-kDa protein; AF335485), PpSP14 (14-kDa protein; AF335486), PpSP15 (15-kDa protein; AF335487), PpSP28 (28-kDa protein; AF335488), PpAg5 (29-kDa protein; ABA54266), PpSP30 (30-kDa protein; AF335489), PpSP32 (32-kDa protein; AF335490), PpSP36 (36-kDa protein; AF261768), PpSP42 (42-kDa protein;
AF335491), and PpSP44 (44-kDa protein; AF335492), only mice immunized with PpSP 15, PpSP42 and PpSP44 DNA plasmids showed a statistically significant (p < 0.05) DTH response 48 hours following challenge with SGH as measured by Δ ear thickness compared to control DNA-immunized mice (CTL DNA) (Fig. 1). However, immunization with PpSP12, PpSP14, PpAg5, PpSp32 and PpSP36 produced humoral responses, indicating in vivo expression of the corresponding proteins. PpSP 15 is a 15 kDa salivary protein of unknown function present only in sand flies. PpSP42 and PpSP44 are salivary proteins that belong to the Yellow family of proteins (Anderson et al, BMC Genomics 7: 52, 2006) with a predicted molecular weight of 42 and 44 kDa respectively.
DNA immunization with distinct DTH-inducing salivary proteins can either promote or protect against L. major infection. Immunization with PpSP 15 DNA or protein was previously shown to produce a DTH response and to protect animals from L. major infection (Valenzuela et al, J Exp Med 194: 331-342, 2001). The protective nature of PpSP 15 is again disclosed herein, but the immunization with PpSP42 and PpSP44, the remaining DTH-inducing molecules, do not confer protection against L. major infection (Fig. 2). As predicted SGH or pre-exposure to uninfected sand fly bites also control L. major infection up to nine weeks post- challenge (Fig. 2). Mice immunized with PpSP44 exacerbated the infection showing progressive lesions that were predominantly ulcerative. The lesion size in this group
was not measured beyond week seven due to extensive tissue damage (Fig. 2). This group was chosen for comparison to protected PpSP15-immunized mice for a better understanding of the contribution of anti-saliva immunity through the course of Leishmania infection.
PpSPIS-immunized mice show a three log reduction in parasite load compared to PpSP44-immunized mice following challenge with SGH-LM. The parasite load was investigated at 2, 6, 9 and 11 weeks post-infection in PpSP 15- and PpSP44- immunized mice. By 6 weeks post-infection, a significant decrease in parasite load was observed in mice immunized with PpSP 15 compared with control DNA or
PpSP44-immunized mice. PpSP15-immunized mice maintained a 3 log reduction in parasite load up to 11 weeks post-infection. Panels A-C show representative ears of PpSP44-, PpSP 15- and control DNA-immunized mice, respectively, 11 weeks postinfection (Fig. 3). Overall, the ears of PpSPl 5-immunized mice (Panel B) showed little to no tissue damage while those of PpSP44-immunized mice showed severe tissue erosion (Panel A). The ears of mice immunized with control DNA (Panel C) were intermediate showing ulcerated lesions with moderate tissue damage. Interestingly, the parasite loads were comparable in mice immunized with PpSP44 and control DNA, suggesting that the number of parasites in the ear of PpSp44- immunized animals was not entirely responsible for the extensive damage observed in these animals.
PpSPIS-immunized mice produced four-fold higher IFN-γ and three-fold lower IL-4 compared to PpSP44-immunized mice two weeks following challenge with SGH-LM. The observed protection and exacerbation of L. major infection in
PpSP 15- and PpSP44-immunized mice, respectively, correlates with the expression of IFN-γ and IL-4 by CD4+ T cells recovered from the ears of these mice two weeks after challenge with SGH-LM (Fig. 4). Following in vitro stimulation with soluble Leishmania antigen (SLA), 31.5% of CD4+ T cells in Pp SP 15 -immunized mice produced IFN-γ compared to only 7.1% and 7.8% in mice immunized with PpSP44 and control DNA respectively (Fig. 4, top panels). IL-4 production was low in
PpSP15-immunized mice (2.5% of CD4+ T cells). In comparison, 8.2% and 6.3% of CD4+ T cells produced IL-4 in mice immunized with PpSP44 and control DNA, respectively (Fig. 4, bottom panels). These data suggest that the immune response to distinct salivary proteins has a polarizing effect on the outcome of Leishmania infection.
Differential induction of inflammatory transcripts in the ear of animals immunized with PpSPlS and PpSP44 two hours following challenge with SGH-
LM. To understand the basis of the different outcomes of L. major infection in mice immunized with PpSP 15 and PpSP44 we compared the early mRNA expression profiles of the inflammatory cytokines in the ears of these mice two hours following challenge with SGH-LM. Using the "Inflammatory Cytokines and Receptors" macroarray, transcripts showing a four- fold or higher change in signal intensity of gene expression compared to naϊve controls were further analyzed and are presented in Table 1. PpSp 15 -immunized mice consistently produced high levels of IFN-γ and IL-12-Rβ2 and low levels of IL-4 and IL-5 (Table 1). In contrast, PpSP44- immunized mice produced high levels of IL-4 and IL-5 and baseline levels of IFN-γ transcripts. TNF-α transcripts were present at relatively high levels in mice immunized with PpSP15 and PpSP44 (Table 1). Real-time PCR was used to validate the results of the macroarray and showed that PpSP15-immunized animals induced a three-fold increase in IFN-γ and IL-12-Rβ2 messages compared to mice immunized with PpSP44 (p < 0.05) (Fig. 5). Conversely, mice immunized with PpSP44 showed a 20-fold increase in the expression of IL-4 (p< 0.005) and no significant expression of IFN-γ and IL-12-Rβ2 (Fig. 5). No significant difference was observed in the expression of IL-5 or TNF-α.
Table I. Fold change in signal intensity of gene expression of inflammatory transcripts two hours following challenge with SGH-LM.
Transcripts PpSP 15 PpSP44
Expl Exp2 Exp3 Expl Exp2 Exp 3
IFN-γ 5.73 10.5 2.55 1.02 1.00 1.36
IL-12Rβ2 6.26 1.72 4.02 1.17 1.00 1.00
TNF 8.71 1.68 11.95 6.91 3.72 1.42
IL-4 0.33 0.33 0.17 4.84 1.15 9.14
IL-5 0.64 0.53 0.19 2.9 5.2 3.49
Mice immunized with PpSPlS and PpSP44 differentially induce IFN-γ and IL-4 in response to uninfected sand fly bites. The amount of each salivary protein injected by sand flies during feeding is unknown. Therefore, it was investigated whether the early induction of IFN-γ and IL-4 in mice immunized with PpSP 15 and PpSP44, observed by challenge with SGH-LM, is reproducible by challenge with sand fly bites. In addition, uninfected sand flies were used to demonstrate that this response remains unchanged in the absence of parasites. Two hours following uninfected sand fly bites, mice immunized with PpSP 15 showed a three-fold higher expression of IFN- γ and a five-fold lower expression of IL-4 compared with PpSP44-immunized mice (Fig. 6). There were no significant differences in the expression of IL-12Rβ2 or IL-5 amongst mice immunized with PpSP 15, PpSP44 and control DNA. This response shows that an adaptive immune response specific to distinct salivary proteins is inducible as early as two hours following sand fly bites and that the amount of salivary protein injected by the bite of a sand fly is sufficient to produce a specific and strong recall response in immunized animals. It is established that a ThI immune response and the production of IFN-γ are correlated with protection from L. major infection in C57BL/6 mice (Heinzel et ah, Proc Natl Acad Sci USA 88: 7011-7015, 1991). Conversely, a Th2 immune response is associated with susceptibility. Earlier studies have demonstrated the
potential of immunity to sand fly saliva in the control of Leishmania infection (Belkaid et al, J Exp Med 188: 1941-1953, 1998; Kamhawi et al, Science 290: 1351-1354, 2000; Morris et al, J Immunol 167: 5226-5230, 2001; Valenzuela et al, J Exp Med 194: 331-342, 2001). It is disclosed herein that DTH-inducing P. papatasi sand fly salivary molecules are not universally protective against L. major infection and that immunity to some can result in its exacerbation. Mice immunized with PpSP 15 controlled the infection and had significantly lower parasite load compared to naϊve mice, as previously reported (Valenzuela et al, J Exp Med 194: 331-342, 2001). In contrast, mice immunized with PpSP44 exacerbated the infection showing lesions with severe tissue erosion and maintaining a high number of parasites up to 11 weeks post-infection. Protection in PpSP15-immunized mice and exacerbation in PpSP44-immunized mice were correlated with an anti- Leishmania ThI and Th2 immune response, respectively (Fig. 4). The anti- Leishmania immune response was characterized by a considerable increase in IFN-γ producing CD4+ T cells in Pp SP 15 -immunized mice (over four- fold higher compared to control DNA- and PpSP44-immunized mice) and over three-fold lower IL-4 producing CD4+ T cells compared to PpSP44-immunized mice (Fig. 4). At this time point a small increase in the percent of CD4+ T cells producing IL-4 in PpSP44- immunized mice was detected compared to controls. Nevertheless, there is clear exacerbation both in lesion size and tissue pathology in PpSP44-immunized mice (Figs 2, 3). It is believed that the polarization of anti-Leishmania immunity towards a ThI or Th2 response in these mice is the result of their prior immunization with DNA encoding the respective salivary proteins. Earlier studies have hypothesized that anti-saliva immunity leads to protection from L. major by the creation of a hostile environment that kills the parasite, acceleration and priming of the anti- Leishmania immunity, or a combination of both (Kamhawi et al, Science 290: 1351- 1354, 2000; Valenzuela et al, J Exp Med 194: 331-342, 2001). Indeed, mice protected from L. major infection through pre-exposure to sand fly bites showed an increase in the frequency of ear epidermal cells producing IFN-γ and IL- 12 six hours after challenge (Kamhawi et al, Science 290: 1351-1354, 2000).
This rapid production of IFN-γ prompted an investigation of the expression profile of pro-inflammatory cytokines induced by PpSP 15 and PpSP44 at an early time point (two hours) following challenge with SGH-LM. Macroarray results validated by real-time PCR showed that mice immunized with PpSP 15 selectively induced transcripts associated with a ThI immune response (IFN-γ and IL-12rβ2) and downregulated Th2 associated transcripts (IL-4). IL-12rβ2 is expressed on both activated ThI CD4+ cells and NK cells. Recently, it has been shown that NK cells could play a role in adaptive immunity and may be the source of the early IFN-γ expression seen in PpSP15-immunized mice. Alternately, the possibility cannot be excluded that the up-regulation of IFN-γ expression is by specific CD4 memory T cells that are rapidly recruited to the site of infection. PpSP44- immunized mice that exacerbated L. major infection selectively induced IL-4 (a marker of Th2 differentiation) and did not upregulate IFN-γ showing the specificity of the observed immune responses to each of the salivary proteins. It should be noted that neither IFN-γ nor IL-4 were induced in the CTL DNA-immunized mice. Enhancement of Leishmania infection in mice pre-exposed to sand fly saliva was recently demonstrated for Lu. intermedia and L. braziliensis in a BALB/c model of infection (de Moura et al, PLoS Negl Trop Dis 1 : e84, 2007). Mice immunized with SGH of Lu. intermedia showed a low IFN-γ to IL-4 ratio that correlated with an enhanced disease profile. It is possible that the immunodominant protein in the salivary repertoire of Lu. intermedia induces an immune response similar to that of PpSP44 resulting in the exacerbation of L. braziliensis infection in BALB/c mice. This is in contrast to the protection from L. major infection observed in BALB/c mice pre- exposed to P. papatasi bites or SGH (Belkaid et al, J Exp Med 188: 1941-1953, 1998; Kamhawi et al, Science 290: 1351-1354, 2000).
Since Leishmania is transmitted by sand fly bites it was investigated if the small amount of PpSP 15 or PpSP44 injected by sand flies during feeding is able to recall the same level and type of immunity observed in response to challenge with SGH-LM. Moreover, uninfected sand flies were used to investigate whether this response is specific to the salivary molecules and is not influenced by the presence of Leishmania parasites in SGH-LM. Sand fly bites induced an early up-regulation
of IFN-γ in PpSP15-immunized mice suggesting that this salivary protein can recall a protective ThI response by the natural route of exposure. PpSP44-immunized mice also reproduced the response observed following challenge with SGH-LM and maintained a high expression of IL-4 and a low expression of IFN-γ (Fig. 6). Despite the fact that the above responses were elicited by uninfected sand fly bites, infected flies are expected to inject more saliva as a result of difficulty in feeding and increased probing activity. This further confirms that an immune response specific to a salivary antigen that generates a DTH response with a ThI profile is able to confer protection against L. major infection, independent of other confounding factors present in the complex feeding behavior of the sand fly.
Recently, Vinhas et al. (Eur J Immunol 37: 3111-3121, 2007) demonstrated that PBMCs from normal volunteers pre-exposed to the bites of uninfected Lu. longipalpis produced IFN-γ following stimulation with SGH. IFN-γ production was also correlated with killing of L. chagasi parasites in a macrophage-lymphocyte autologous culture. This demonstrates that humans can mount an anti-saliva cellular immune response that correlates with protection from Leishmania infection. The early induction of a distinct ThI -type immune response by salivary proteins is important for priming a protective immune response against Leishmania infection. Iimmunization with a particular salivary protein can have a profound modulatory effect on Leishmania infection and this immunization may act through the differential priming of anti-Leishmania immunity resulting in protection or susceptibility to disease.
Example 2 Immunity to a salivary protein of a sand fly vector protects against the fatal outcome of visceral leishmaniasis in a hamster model
Visceral leishmaniasis (VL) is a fatal disease for humans and no vaccine is currently available. Sand fly salivary proteins have been associated with protection against cutaneous leishmaniasis. To test whether vector salivary proteins can protect against VL, a hamster model was developed involving intradermal inoculation in the ear of 100,000 Leishmania infantum chagasi parasites together with Lutzomyia
longipalpis saliva to mimic natural transmission by sand flies. Hamsters developed classical signs of VL rapidly, culminating in a fatal outcome five to six months postinfection. Saliva had no effect on the course of infection in this model. Immunization with 16 DNA plasmids coding for salivary proteins of Lu. longipalpis resulted in the identification of LJM 19, a novel 11-kDa protein, that protected hamsters against the fatal outcome of VL. LJM19-immunized hamsters maintained a low parasite load that correlated with an overall high IFN-γ/TGF-β ratio and iNOS expression in the spleen and liver up to five months post-infection. Importantly, a DTH response with high expression of IFN-γ was also noted in the skin of LJM 19- immunized hamsters 48 hours following exposure to uninfected sand fly bites.
Induction of IFN-γ at the site of bite could partly explain the protection observed in the viscera of LJM19-immunized hamsters through direct parasite killing and/or priming of anti-Leishmania immunity.
The protective effect of salivary proteins is not exclusive to sand flies and CL. It has been demonstrated that animals pre-exposed to ticks were protected from tularemia and borreliosis and vaccination with a tick salivary cement protein protected mice against the lethal effect of tick-borne encephalitis virus. Preexposure to mosquito saliva through bites led to partial protection against Plasmodium berghei infection and immunization with the saliva of an aquatic insect (Naucoris genus) protected mice against Mycobacterium ulcerans infection.
L. infantum chagasi is the cause of VL in Latin America and the only proven natural vector is Lu. longipalpis. Immunity to Lu. longipalpis saliva can protect against VL caused by L. infantum chagasi in a novel hamster model. To date progressive disease in hamsters, the model of choice for the study of VL, has been mostly achieved by the injection of a large number of parasites via the intravenous, intracardial or intraperitoneal route. However, these routes of infection do not mimic natural transmission by sand fly bite where the parasites are delivered into the skin of a mammalian host in the presence of saliva. There is no animal model for VL that combines this natural route of transmission with fatal disease progression. Disclosed herein is the fatal outcome of VL in 3-4 month old naϊve hamsters following intradermal injection of parasites in the ear together with sand fly saliva.
It is also disclosed herein that immunization with a defined salivary protein from the sand fly Lu. longipalpis protects hamsters from the fatal outcome of VL caused by L. infantum chagasi.
Results
A model of VL in hamsters to test salivary vaccine candidates. To date, no information exists regarding the effect of vaccination with sand fly salivary proteins on the outcome of VL. To test whether Lu. longipalpis salivary proteins can protect against VL, a model that mimics the outcome of the disease and represents a more natural route of parasite inoculation in the skin in the presence of sand fly saliva was developed. Male hamsters, aged 3-5 months, were infected intradermally in the ear with 105 stationary phase parasites and 0.5 pairs of SGH. Parasites were detectable in the blood as well as in the spleen and liver 15 days post infection (Fig. 7A). Thereafter, the parasite load increased exponentially to 106 and 1011 parasites per organ at two and five months post-infection, respectively, in both spleen and liver (Fig. 7B). Importantly, a similar progression of disease was noted in hamsters challenged with Leishmania in the absence of SGH (Fig. 7). Anti-Leishmania antibodies were detected at two and five months post-infection. Infected hamsters presented clinical and pathological signs of parasite visceralization including hepatosplenomegaly, hypergammaglobulinemia and cachexia. All animals, challenged in the presence or absence of SGH, died of VL five to six months postinfection.
Screening of Lu. longipalpis sand fly salivary proteins for vaccine candidates. There is no information regarding the immune responses produced by Lu. longipalpis salivary proteins in hamsters and the consequences of these responses on the visceral form of leishmaniasis. Hamsters were immunized intradermally in the ear with DNA plasmids coding for the most abundant secreted proteins from Lu. longipalpis. Among the 16 plasmids tested, four (LJM 17, LJM 19, LJMl 1 and LJLl 1) induced an antibody response, a DTH response or both responses in immunized hamsters (Table 2). Notably, the plasmids that were not immunogenic in
hamsters were able to produce a cellular or antibody response in mice. This suggests that the absence of an immune response to some of these plasmids in hamsters may be due to host specificity. However, a dose-related effect due differential expression of plasmids following hamster immunizations cannot be excluded.
Table 2. Immune response in hamsters by immunization with plasmids coding for the most abundant salivary proteins of Lu. Longipalpis
Sequence Predicted Best match to NCBI Antibody DTHa name molecular Non-redundant Accession response response weight protein database Number
NCBI
LJL08 6.9 Maxadilan M77090 + -
LJS201 8.6 Unknown AY455919 - -
LJM 19 10.7 Unknown AY438271 - +++
LJM04 13.8 Unknown AF132517 + -
LJL 18 16.3 c-type lectin DQ 190947 - -
LJL91 16.3 c-type lectin AY445934 - -
LJL 15 16.5 c-type lectin DQ 190946 - -
LJMlO 16.6 c-type lectin AAD33512 - -
LJS 142 16.6 c-type lectin AY445934 - -
LJL 13 26.4 D7 protein AF420274 + -
LJL34 28.8 Ag5 protein AF131933 - -
LJL23 35.0 Apyrase AF131933 - -
LJMl I l 43.0 Yellow protein DQ192488 + -
LJMI l 43.2 Yellow protein AY445935 +++ +++
LJM 17 45.2 Yellow protein AF132518 +++ +++
LJLI l 60.6 5 '-nucleotidase AF132510 +++ -
SGHb +++ +++
CTL DNAC - - Delayed-Type Hypersensitivity Salivary Gland Homogenate Control DNA plasmid - Negative response + Weak response +++ Strong response
LJM17-, LJMl 1-, and LJLl 1 -immunized hamsters showed high antibody titers comparable to those of animals immunized with SGH and considerably higher than control DNA-immunized hamsters (Fig. 8A). Moreover, 48 hrs after the challenge with SGH, LJM 17-, LJMl 1 -and LJM19-immunized hamsters produced a
DTH response comparable to that of the group immunized with SGH (Fig. 8B). This response is shown by the significant increase in ear thickness compared with negative controls (control DNA or naϊve groups) and compared to ear thickness prior to challenge (Fig. 8B). LJM19-immunized hamsters were the only group that produced a strong DTH response but did not produce a detectable antibody response (Fig. 8A, 8B). The DTH response in LJM19-immunized hamsters was characterized by a mononuclear infiltration composed mainly of macrophages and lymphocytes and a minimal number of neutrophils (Figure 8C). The DTH site in LJM19- immunized hamsters was representative of the DTH response observed in the other experimental groups (LJM17-, LJMl 1- and SGH-immunized hamsters).
Lu. longipalpis salivary molecule LJM19 protects against the fatal outcome of VL caused by L. infantum chagasi. In three independent experiments, hamsters immunized with LJM 17, LJMl 1, LJM 19 or LJLl 1, the molecules producing immune responses in hamsters, were challenged intradermally in the ear by co- inoculation of L. infantum chagasi and SGH. Two months post-infection, no parasites were detected in the liver and spleen of animals immunized with LJMl 1 and LJM 19 (Fig. 9A). There was no significant difference in the parasite load in the spleen of LJM 17- and LJLl 1 -immunized animals compared with control DNA- immunized hamsters (Fig. 9A). Five months post-infection, however, only the group immunized with LJM 19 had a significantly lower number of parasites in the spleen and the liver compared with the other immunized groups including LJMl 1 (Fig. 9B) and showed no clinical signs of VL. All remaining experimental groups, including control DNA-immunized animals showed progressive cachexia and hepatosplenomegaly, classical signs of disease, and died five to six months postinfection. To establish the durability of protection, a fourth experiment followed the survival of 12 LJM19-immunized hamsters for a period of eight months when they had to be sacrificed according to the Animal Care and Use Committee protocol (Fig. 9C). LJM19-immunized hamsters survived the fatal progression of disease and showed no clinical signs of VL. Hamsters immunized with LJM19, maintained a
low anti-Leishmania IgG antibody level throughout the course of infection compared with control DNA-immunized hamsters (Fig. 9D).
Expression of cytokines in the spleen and liver of protected LJM19-immunized hamsters following challenge with L. infantum chagasi plus SGH. Expression of IFN-γ, IL-4 and TGF-β mRNA in the spleen and liver of LJM19-immunized hamsters was evaluated at two and five months post infection. In the spleen, the ratio of IFN-γ/TGF-β expression levels was significantly higher in LJM 19- compared with control DNA-immunized hamster two months post-infection (Fig. 10A). IL-4 expression was only detectable at five months post-infection but there was no difference observed in the IFN-γ/IL-4 ratio in LJM 19 and control DNA- immunized hamsters. In the liver, there was a consistently higher ratio of IFN- γ/TGF-β expression in LJM 19- compared with control DNA-immunized hamsters at two and five months (Fig. 10B). Moreover, there was a considerable increase in the ratio of IFN-γ/TGF-β expression from two to five months post-infection in the LJM19-immunized animals (Fig. 10B).
It is established that Leishmania killing by macrophages is mediated by nitric oxide. As predicted, the expression of iNOS in the spleen and liver of LJM 19- immunized hamsters was considerably higher at two and five months post-infection compared with control DNA-immunized hamsters (Fig. 1OC and 10D).
Immunity to LJM19 at the site of sand fly bites. Having observed a strong ThI immunity associated with parasite killing and protection of LJM19-immunized hamsters, we investigated whether LJM19-immunized animals are able to mount a similar immune profile in the skin following sand fly bites. A DTH response characterized by mononuclear cell infiltration similar to that observed following the injection of SGH was detected in the skin of LJM19-immunized hamsters 48 hrs following sand fly bites (Fig. 1 IA). Moreover, at this time point a significantly higher level of IFN-γ and IL-10 expression was observed at the bite site in LJM 19- compared with control DNA-immunized hamsters (Fig. 1 IB). No difference was observed in IL-4 and TGF-β expression in these groups.
There are no known studies pertaining to the potential role of sand fly salivary proteins in protection from the most aggressive and fatal form of visceral leishmaniasis. Furthermore, there are no animal models that incorporate sand fly saliva, and inherent component of natural transmission, to permit the evaluation of such vaccines.
Disclosed herein is a model that mimics the natural course of VL infection in hamsters by the intradermal inoculation of 105 parasites in the presence of sand fly saliva. Parasites were detected in the spleen and liver of naϊve hamsters at two and five months post-infection. These animals showed clinical signs similar to those observed in symptomatic individuals with VL, including hepatosplenomegaly, cachexia and hyperglobulinemia. Hamsters infected in the absence of sand fly SGH showed comparable disease progression indicating that saliva has no exacerbative effect on the course of infection (Fig. 7).
A significant improvement of the hamster model with this approach was that adult hamsters (age 3-4 months old) reproducibly died of VL five to six months post-infection. Clinical symptoms of VL in hamsters were only observed 10 months following intradermal inoculation of L. donovani in the abdomen (Wilson et ah, J Parasitol 73: 55-631987). Moreover, it has been established that adult hamsters (3- 4 months old) are less susceptible to VL infection. For the purpose of this study it was important to establish disease in older hamsters to account for the vaccination schedule. In the current model, the rapid onset of clinical symptoms in older hamsters could be the result of the inoculation of parasites in a highly vascularized tissue (the ear) facilitating visceralization and establishment of disease. An additional factor in the success of the current model is the use male hamsters. It was previously demonstrated that host gender has a significant influence on the clinical evolution and immunological response to Leishmania (Viannia) infection. Taken together, the rapid onset of progressive disease in 3-4 months old hamsters was reliably and reproducibly brought about.
In nature, an infected sand fly deposits saliva and parasites into the skin of the animal while feeding. The presence of saliva at the feeding site is a permanent feature of natural transmission by sand fly bite. To mimic this mode of transmission
and to permit testing of the hypothesis that immunity to sand fly salivary molecules protects against VL, the intradermal delivery of parasites into the ear of hamsters in the presence of vector saliva where the presence of sand fly saliva is required to induce an immune response against salivary antigens. In recent years, massive cDNA sequencing, proteomic and bioinformatic efforts targeting sand fly salivary glands permitted the identification and isolation of the most abundant salivary proteins from the sand fly Lu. longipalpis (Valenzuela et al., J Exp Biol 207: 3717-3729, 2004). This provided the opportunity to investigate whether the protection observed by P. papatasi saliva in CL (Belkaid et al., J Exp Med 188: 1941-1953, 1998; Kamhawi et al, Science 290: 1351-1354, 2000;
Valenzuela et al., J Exp Med 194: 331-342, 2001) could be achieved against VL using salivary molecules from a natural vector. A powerful protection was observed against the fatal outcome of infection with L. infantum chagasi in hamsters immunized with the plasmid coding for the Lu. longipalpis salivary protein LJM 19. Interestingly, this was the only molecule that produced a DTH and no detectable antibodies following DNA immunization. This reinforces the importance of cellular immunity to sand fly salivary antigens for protection from leishmaniasis including the visceral form of disease. Induction of humoral response by these molecules does not seem to be a pre-requisite for protection. LJM19-immunized animals maintained a controlled and low parasite load in the spleen and liver surviving up to 8 months when they were sacrificed according to the Animal Care and Use Committee protocol (Fig. 9C). Up to this point LJM19-immunized hamsters showed no outward signs of disease. It is worth noting that these hamsters also maintained a low level of anti-Leishmania IgG antibodies compared to CTL DNA-immunized group (Fig. 9D). High anti-leishmania IgG titers have been associated with active visceral leishmaniasis.
The protection from VL observed in LJM19-immunized hamsters was associated with a considerably higher IFN-γ/TGF-β ratio and iNOS expression in their spleen and liver compared with control DNA-immunized hamsters (Fig. 10). In the spleen, the level of TGF-β increased significantly at 5 months post infection while that of IFN-γ was sustained accounting for the decrease in the IFN-γ/TGF-β ratio (Fig 10A).
The level of TGF-β probably increased to serve a protective function to counteract possible excessive immonopathology caused by sustained IFN-γ production. This was not noted in the liver (Fig 10B) supporting the observation that the liver and spleen show organ specific immunity reaching a fine balance between parasite clearance and parasite pathology. IFN-γ plays an important role in limiting the growth of Leishmania in murine and human macrophages and in limiting leishmaniasis progression (Basu et al. J Immunol 174: 7160-7171, 2005; Carvalho et al., J Infect Dis 165: 535-54, 1992). Moreover, NO generation through IFN-γ is the critical macrophage effector mechanism in the control of parasite replication in mice (Murray et al., J Immunol 148: 1858-1863, 1992). Recently, it was reported that iNOS was produced by macrophages with concomitant high levels of NO production in protected hamsters vaccinated with a kinetoplastid membrane protein- 11 (KMP- 11) and challenged intracardially with Leishmania donovani (Basu et al. J Immunol 174: 7160-7171, 2005). The protective immunity observed in the spleen and liver of LJM 19-immunized hamsters may be the consequence of an anti-saliva immune response initiated in the skin of challenged animals. This is supported by the DTH response and the high expression of IFN-γ produced at the bite site of LJMl 9-immunized hamsters (Fig. 11). The presence of IL-10 together with IFN-γ 48 hours following sand fly bites in LJMl 9-immunized hamsters could be a regulatory mechanism to control possible immunopathology caused by IFN-γ.
To explain the protection observed in LJMl 9-immunized hamsters against a visceral infection, we propose that the initial anti-LJM19 immune response at the site of parasite inoculation in the ear dermis has a dual effect: 1) it creates an inhospitable environment for the establishment of Leishmania infection that may involve direct killing of the parasite, and 2) it primes the initial host immune response to Leishmania that could also have resulted in acceleration of anti- Leishmania immunity. In a cutaneous model of infection, mice immunized with a salivary molecule from P. papatasi (PpSP 15) primed the immune response towards a ThI type anti-Leishmania major immunity. Analysis of early time points in the skin at the site of challenge will elucidate the contribution of direct parasite killing
versus the indirect effect on the acceleration of anti-Leishmania immunity. In humans, exposure to Lu. longipalpis sand flies in an endemic area for VL was correlated with the appearance of anti-Leishmania DTH, indicative of protection against VL (Barral et al, Am J Trop Med Hyg 62: 740-745, 2000; Gomes et al, J Infect Dis 186: 1530-1534, 2002).
In summary, disclosed herein is the ability of a defined salivary protein from Lu. longipalpis (LJM 19) to confer powerful protection against the fatal outcome of L. infantum chagasi infection in a novel hamster model. These data reinforce the concept of using components of arthropod saliva in vaccination strategies against vector-borne diseases including VL and underscores the importance of the salivary molecules for the induction of immunity irrespective of any exacerbative role.
Materials and Methods
Animals. Two month old male Syrian golden hamsters (Mesocricetus auratus) were obtained from the Centra de Pesquisas Goncalo Moniz/FIOCRUZ animal facility and from Taconic (Rockville, MD). The experimental procedures used in this study were reviewed and approved by the Animal Care and Use Committee of the CPqGM/FIOCRUZ and of the National Institute of Allergy and Infectious Diseases. Sand flies and preparation of SGH. Lu. longipalpis, Cavunge strain (captured at Cavunge in Bahia, northeastern Brazil), was reared in the laboratory as previously described (Modi, et al., JMedEntomol 20: 568-569, 1983) at the Laboratόrio de Imunoparasitologia/CPqGM and the Laboratory of Malaria and Vector Research, NIAID. Salivary glands were dissected from 5- to 7-day-old females and stored in PBS at -7O0C. Before use, salivary glands were sonicated and centrifuged at 12,000-g for 2 min. The supernatant was collected and used immediately. Intradermal challenge with parasites plus SGH. Leishmania infantum chagasi (MHOM/BROO/MER/ STRAIN2) promastigotes were cultured in Schneider's medium supplemented with 20% of inactivated fetal bovine serum (FBS), 2 mM L- glutamine, 100 U/ml penicillin, 100 μl/ml streptomycin and 2% sterile human urine. Three to four months old hamsters were inoculated intradermally with 105 stationary
phase promastigotes in the absence or presence of 0.5 pairs SGH using a 29-gauge needle (BD Ultra-Fine) in a volume of 20 μl.
Construction of DNA plasmids coding for Lu. longipalpis salivary proteins and immunization of hamsters. Sixteen DNA plasmids coding for Lu. longipalpis salivary proteins were cloned into the VR2001-TOPO vector and purified as previously described (Oliveira et at., Vaccine 24: 374-39, 2006). Two month old hamsters were immunized intradermally in the right ear three times at two weeks intervals with 20 μg of DNA plasmid or with the equivalent of 0.5 salivary gland pairs in 20 μl of saline. Parasite burden. For early time points parasite burden was determined by PCR. DNA was extracted from 300μl of blood and 100 mg of spleen and liver tissue from infected and control hamsters using the Wizard Genomic DNA purification kit (Promega) following manufacturer's instructions. PCR was performed with primers 5 '-GGG(GZT)AGGGGCGTTCT(GZC)CGAA-S ' (SEQ ID NO: 11) and 5'- (GZC) (GZC) (GZC) (AZT)CTAT(AZT)TTAC ACC AACCCC-3' (SEQ ID NO: 12) which amplify al20-bp conserved region of the Leishmania kDNA minicircle. Conditions were as follows: 940C for 3 min, 30 cycles at 940C for 30 sec, 550C at 30 sec and 940C for 45 sec with a final extension of 720C for 10 min. For later time points, the parasite burden was evaluated from the spleen and liver using the quantitative limiting dilution assay, as previously described . (Lima et al, Parasitol Today 13: 80-82, 1997) briefly, organs were aseptically excised and homogenized with a tissue glass grinder in 2 ml of Schneider's medium (Sigma, St. Louis, MO). The homogenates were serially diluted in 96-well plates containing biphasic blood agar medium. Antibody detection. Total IgG responses to L. infantum chagasi or Lu longipalpis DNA plasmids were measured by ELISA.
Ear thickness and histology. Ear thickness was measured 48 h following i.d. injection of Lu. longipalpis SGH or sand fly bites using a vernier caliper (Mitutoyo Corp.). For histology, the ears were fixed in 10% phosphate buffered formalin and embedded in paraffin. Five micron sections were stained with hematoxylin-eosin.
Cytokine determination by semi-quantitative PCR and Real-Time PCR Total RNA was extracted from the spleen and liver of infected hamsters using Trizol reagent (Invitrogen). First strand cDNA synthesis was performed with approximately 1-2 μg of RNA using a Superscript II reverse transcriptase (Invitrogen). The reaction mixture was incubated at 420C for 50 min. DNA was amplified using Taq DNA polymerase (Invitrogen) in a PTC-100 thermal cycler (MJ Research Inc.). Reaction conditions were 40 cycles of 1 min at 940C, 1 min at 550C, and 2 min at 720C, with a final extension step of 7 min at 720C. The band intensity of the amplified products was analyzed using EagleSight, version 3.2 software (Stratagene). The results are expressed as the ratio of cytokine over HPRT. For isolation of RNA from ears, tissue was homogenized on a Magna lyser (Roche) with three cycles at 7000 rpm, 60 seconds each. Total RNA was isolated using QIAshreder (Qiagen) and RNeasy Mini Kit (Qiagen) following the manufacturer's instructions. First strand cDNA synthesis was performed with approximately 1-2 μg of RNA in a total volume of 20 μl using the Superscript™ III reverse transcriptase. DNA was amplified using the LightCycler 480 Probes Master kit (Roche). Amplification conditions consisted of an initial pre-incubation at 95°C for 10 min, followed by amplification of the target DNA for 40 cycles of 95°C for 15 s and 600C for 1 min using the LightCycler 480 (Roche Diagnostics). A standard curve was generated for each set of primers and efficiency of each reaction determined. The expression levels of genes of interest were normalized to HPRT levels. The results are expressed in fold change over control.
Oligonucleotide primers and probes. Oligonucleotide primers used for semiquantitative PCR were: HPRT (reverse (SEQ ID NO: 13), TGT TTC ACC AAC AAG TTT GCA ATC; forward (SEQ ID NO: 14), ATG GTA GAG ATG GGA GGC CAT CAC), IFN-γ (reverse (SEQ ID NO: 15), TCA AAT ATT GCT GGC AAG AAT ATT CTT; forward (SEQ ID NO: 16), ATG CAC ACC ACA CGT TGC ATC TTG), IL-4 (reverse (SEQ ID NO: 17), TCA CAT TGC AGC TCT TCT GAG GAA3; forward (SEQ ID NO: 18), ACG GAG AA A GAC CTC ATT TGC AG), IL-10 (reverse (SEQ ID NO: 19), TCA CAG GGG AGA AAT CGA TGA CA; forward (SEQ ID NO: 20), TGG ACA ACA TAC TAC TCA GTC ATC), iNOS
(reverse (SEQ ID NO: 21), CTCGAYCTGGT AGTAGT AGAA; forward (SEQ ID NO: 22), GCAGAATGTGACCATCATGG) and TGF-β ( reverse (SEQ ID NO: 23) , CTT GGG CTT GCG ACC CAC GTA GTA; forward (SEQ ID NO: 24), TTC AGC TCC ACG GAG AAG AAC TGC). These primers were obtained from NCI/SIAC Research Technology Program (Frederick, Maryland, USA) and Operon Biotechnologies (Maryland, USA). Oligonucleotide primers used for real time PCR were: HPRT (reverse (SEQ ID NO: 25), GGG AGT GGA TCT ATC ACA ATT TCT; forward (SEQ ID NO: 26), CCA TCA CAT TAT GGC CCT CT), IFN-γ (reverse (SEQ ID NO: 27), CAG GTC TGC CTT GAT GGT G; forward (SEQ ID NO: 28), GAA GCC TTG AAG GAC AAC CA) TGF-β (reverse (SEQ ID NO: 29), TGG TTG TAG AGG GCA AGG AC; forward (SEQ ID NO: 30) GGC CCT GTC CCT ACA TTT G), IL-IO (reverse (SEQ ID NO: 31), TCC AGC TGG TCC TTC TTT TG; forward (SEQ ID NO: 32), ACA TGC TCC GAG AGC TGA G), IL-4 (reverse (SEQ ID NO: 33), CGG TAC ATG CTA GAA GGC AGA; forward (SEQ ID NO: 34), GAG ATC TAT TGA TGG GTC TCA GG). Primers were obtained from Operon and probes for IL4, ILlO, TGF-β, IFN-γ and HPRT from Roche Diagnostics.
Exposure of immunized hamsters to sand fly bites. Immunized hamsters were exposed to 15 uninfected Lu. longipalpis bites in the left ear according to Kamhawi et al. {Science 290: 1351-1354, 2000) and Valenzuela et al. (J Exp Med 194: 331- 342, 2001).
Statistical analysis. Statistical tests were performed using Graph Pad 4.0 Prism Software. One-way nonparametric analysis of variance was performed followed by the Dunn post-test. Dual comparisons were made with the Mann- Whitney test.
Example 3
Production of an Enhanced Immune Response in Mice Sand flies (for example, but not limited to, Phlebotomus papatasi, Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P. sergenti, P. arabicus, P. tobbi, or Lutzomyia longipalpis) are reared at the Walter Reed Army Medical Research Institute and at the Laboratory
of Malaria and Vector Research, NIAID, NIH, as described elsewhere (Valenzuela et al, J Exp Med 194: 331-342, 2001). Preparation of salivary gland homogenate (or midgut homogenate) and pre-exposure of mice (Charles River Laboratories Inc) to uninfected sand flies is carried out according to Valenzuela et al. {J Exp Med 194: 331-342, 2001) and Kamhawi et al. (Science 290: 1351-1354, 2000). Experiments are performed using 6 to 8 week old mice under pathogen free conditions. All animal studies are approved by the Animal Care and Use Committee at The National Institute of Allergy and Infectious Diseases.
Recombinant sand fly polypeptide and disease antigen (for example, but not limited to, a Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma antigen) are generated using standard methods. Mice are immunized intradermally in the right ear three times at two week intervals with recombinant sand fly polypeptide and disease antigen using one or more of the following immunization protocols:
Protocol 1
Injection 1 : Sand fly polypeptide and disease antigen; Injection 2: Sand fly polypeptide and disease antigen; Injection 3: Sand fly polypeptide and disease antigen. Protocol 2
Injection 1 : Sand fly polypeptide and disease antigen; Injection 2: Disease antigen; Injection 3: Disease antigen. Protocol 3
Injection 1 : Sand fly polypeptide;
Injection 2: Sand fly polypeptide
Injection 3: Sand fly polypeptide and disease antigen. Protocol 4
Injection 1 : Sand fly polypeptide;
Injection 2: Sand fly polypeptide and disease antigen;
Injection 3: Sand fly polypeptide and disease antigen. Protocol 5
Injection 1 : Sand fly polypeptide;
Injection 2: Sand fly polypeptide and disease antigen;
Injection 3: Disease antigen.
Protocol 6
Injection 1 : Disease antigen. Injection 2: Disease antigen. Injection 3: Disease antigen.
Two weeks after the last immunization, animals are challenged intradermally in the left ear with sand fly salivary gland or a mixture of 0.5 pairs SGH and 500 L .major metacyclics or by the appropriate sand fly vector species infected with the parasite (L. major is used by way of example and this example is not in any way limited to the use of this disease-causing parasite). L. major clone Vl
(MHOM/IL/80/Friedlin) is cultured in 199 medium with 10% heat-inactivated fetal bovine serum (HyClone), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L- glutamine and 40 mM Hepes. If midgut polypeptide is used in the immunizations, the animals are challenged with midgut homogenate rather than salivary gland homogenate.
The ear thickness is measured 48 hours following intradermal injection of sand fly homogenate. Values are represented as Δ ear thickness (ear thickness of experimental groups subtracted from the mean ear thickness of naϊve mice 48 hours after injection with 0.5 pair of SGH). For measurements of Leishmania lesions, the largest diameter is recorded on a weekly basis. Ear thickness and lesion diameter are measured using a Digimatic caliper.
In order to measure the parasite load, total genomic DNA is extracted from mice ears using known methods. A total of 100 ng is amplified by real time PCR. Measured values represent the relative number of parasites per ear. Mice immunized with sand fly polypeptide (protocols 1, 2, 3, or 4) have reduced parasite load, compared to mice immunized with disease antigen alone (protocol 5).
Example 4 Production of an Enhanced Immune Response in Dogs Sand flies (for example, but not limited to, P Phlebotomus papatasi,
Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P. sergenti, P. arabicus, P. tobbi, or Lutzomyia longipalpis) are reared at the Walter Reed Army Medical Research Institute and at the Laboratory
of Malaria and Vector Research, NIAID, NIH, as described elsewhere (Valenzuela et al, J Exp Med 194: 331-342, 2001). Preparation of salivary gland homogenate (or midgut homogenate) and pre-exposure of dogs to uninfected sand flies is carried out according to known methods under pathogen free conditions. All animal studies are approved by the Animal Care and Use Committee at The National Institute of Allergy and Infectious Diseases.
Recombinant sand fly polypeptide and disease antigen (for example, but not limited to, a Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma antigen) are generated using standard methods. Dogs are immunized intradermally three times at two week intervals with recombinant sand fly polypeptide and disease antigen using one or more of the immunization protocols described in Example 4.
Two weeks after the last immunization, animals are challenged intradermally with sand fly salivary gland or a mixture of 0.5 pairs SGH and 500 L .i. chagasi metacyclics or by the appropriate sand fly vector species infected with the parasite (L J. chagasi is used herein by way of example and this example is not in any way limited to the use of this disease-causing parasite). L. major clone Vl (MHOM/IL/80/Friedlin) is cultured in 199 medium with 10% heat-inactivated fetal bovine serum (HyClone), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L- glutamine and 40 mM Hepes. If midgut polypeptide is used in the immunizations, the animals are challenged with midgut homogenate.
The ear thickness is measured 48 hours following intradermal injection of sand fly homogenate. Values are represented as Δ ear thickness (ear thickness of experimental groups subtracted from the mean ear thickness of naϊve dogs 48 hours after injection with 0.5 pair of SGH). For measurements of Leishmania lesions, the largest diameter is recorded on a weekly basis. Ear thickness and lesion diameter are measured using a caliper.
In order to measure the parasite load, parasite burden is determined by PCR. DNA is extracted from blood, spleen and liver tissue from infected and control animals using known methods and amplified by real time PCR. Measured values represent the relative number of parasites per sample. Dogs immunized with sand
fly polypeptide (protocols 1, 2, 3, or 4) have reduced parasite load, compared to dogs immunized with disease antigen alone (protocol 5).
Example 5 Production of an Enhanced Immune Response in Monkeys
Sand flies (for example, but not limited to, Phlebotomus papatasi, Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P. sergenti, P. arabicus, P. tobbi, or Lutzomyia longipalpis) are reared at the Walter Reed Army Medical Research Institute and at the Laboratory of Malaria and Vector Research, NIAID, NIH, as described elsewhere (Valenzuela et al, J Exp Med 194: 331-342, 2001). Preparation of salivary gland homogenate (or midgut homogenate) and pre-exposure of monkeys to uninfected sand flies is carried out according to known methods under pathogen free conditions. All animal studies are approved by the Animal Care and Use Committee at The National Institute of Allergy and Infectious Diseases.
Recombinant sand fly polypeptide and disease antigen (for example, but not limited to, a Leishmania, Plasmodium, hookworm, mycobacterium, or toxoplasma antigen) are generated using standard methods. Monkeys are immunized intradermally three times at two week intervals with recombinant sand fly polypeptide and disease antigen using one or more of the immunization protocols described in Example 4.
Two weeks after the last immunization, animals are challenged intradermally with sand fly salivary gland or a mixture of 0.5 pairs SGH and 500 L .major metacyclics (L. major is used herein by way of example and this method is not in any way limited to the use of this disease-causing parasite). L. major clone Vl
(MHOM/IL/80/Friedlin) is cultured in 199 medium with 10% heat-inactivated fetal bovine serum (HyClone), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L- glutamine and 40 mM Hepes. If midgut polypeptide is used in the immunizations, the animals are challenged with midgut homogenate. The ear thickness is measured 48 hours following intradermal injection of sand fly homogenate. Values are represented as Δ ear thickness (ear thickness of
experimental groups subtracted from the mean ear thickness of naϊve dogs 48 hours after injection with 0.5 pair of SGH). For measurements of Leishmania lesions, the largest diameter is recorded on a weekly basis. Ear thickness and lesion diameter are measured using a caliper. In order to measure the parasite load, parasite burden is determined by PCR.
DNA is extracted from blood, spleen and liver tissue from infected and control animals using known methods and amplified by real time PCR. Measured values represent the relative number of parasites per sample. Monkeys immunized with sand fly polypeptide (protocols 1, 2, 3, or 4) have reduced parasite load, compared to monkeys immunized with disease antigen alone (protocol 5).
Example 6 Administration of Sand Fly Polypeptides as Adjuvant to a Subject
This Example demonstrates a method of administering a sand fly salivary gland polypeptide (or midgut polypeptide) as an adjuvant and a disease antigen other than a sand fly polypeptide (for example, but not limited to, a Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma antigen,) to a subject for the treatment, amelioration, or prevention of a disease (for example, but not limited to, Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma) in the subject. A suitable subject for receiving the sand fly polypeptide and disease antigen is one who is at risk for exposure to the disease or who is suffering from the disease (for example, a mouse, hamster, dog, monkey, or human). The sand fly polypeptide is administered to the subject once, twice, three times or more, alone or in combination with the disease antigen, as described in the immunization protocols in Example 4. When administered concurrently, the sand fly polypeptide and the disease antigen are provided in the same or different pharmaceutical compositions, and are administered subcutaneously or intradermally. The second, third, or more doses are administered in the same fashion at regular intervals after the first dose, and the efficacy of protection against the disease or treatment of the disease is assessed by measuring antibody titers or parasite load using standard laboratory protocols.
Example 7 Antigens
This example describes specific antigens. Mycobacterial antigens can be found in U.S. Patent Nos. 6,045,798; 5,504, 005; 7,288,261, which are incorporated by reference. Toxoplasmosis antigens that can be used in the vaccines disclosed herein are found for example in U.S. Patent No. 6,902,926, which is incorporated by reference. Examples of Plasmodium antigens are found in U.S. Patent Nos. 7,563,883; 6,828,416; 5,609,872; 4,957,758, which are incorporated by reference. Examples of hookworm antigens are found in U.S. Patent Nos. 7,303,752 and 5,753,787, which are also incorporated by reference.
In view of the many possible embodiments to which the principles of our invention may be applied, it should be recognized that illustrated embodiments are only examples of the invention and should not be considered a limitation on the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.
Claims
1. A method of priming or enhancing an immune response to a disease antigen in a subject, comprising: administering to the subject
(a) a therapeutically effective amount of an adjuvant comprising a sand fly salivary gland polypeptide to induce a T cell response in the subject, and
(b) the disease antigen against which the immune response is directed, wherein the disease antigen is other than a sand fly salivary gland polypeptide and wherein the disease antigen is other than a Leishmania antigen, such as a Plasmodium, hookworm, mycobacterium, or toxoplasma antigen, thereby priming or enhancing an immune response to the disease antigen in a subject.
2. A method of priming or enhancing an immune response to a disease antigen in a subject, comprising: administering to the subject
(a) a therapeutically effective amount of an adjuvant comprising a sand fly salivary gland polypeptide to induce a T cell response in the subject, and
(b) the disease antigen against which the immune response is directed, wherein the disease antigen is other than a sand fly salivary gland polypeptide, thereby priming or enhancing an immune response to the disease antigen in a subject.
3. The method of claim 1 , wherein the T cell response is a CD4+ T helper cell response.
4. The method of claim 3, wherein the CD4 T helper cell response is a ThI cell response.
5. The method of claim 1 , wherein the disease antigen is administered to the subject simultaneously with the administration of the sand fly salivary gland polypeptide.
6. The method of claim 1 , wherein the disease antigen is administered to the subject after the administration of the sand fly salivary gland polypeptide and within a sufficient amount of time to induce the immune response.
7. The method of claim 1 , wherein the subject is a human.
8. The method of claim 1 , wherein the subject is a non-human veterinary subject.
9. The method of claim 8, wherein the subject is a dog.
10. The method of claim 1 , wherein the sand fly salivary gland polypeptide is a polypeptide obtained from the salivary gland of a P. papatasi, P. duboscqi, P. sergenti, P. ariasi, P. perniciousus, P. arabicus, P. tobbi, or Lu. longipalpis sand fly.
11. The method of claim 10, wherein the sand fly salivary gland polypeptide comprises SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 6.
12. The method of claim 1 , wherein the therapeutically effective amount of adjuvant is less than the amount required for a classical adjuvant to mount an immune response to an antigen.
13. A salivary gland polypeptide in combination with a disease antigen for use in a method for treatment or prevention of the disease, wherein the disease antigen is other than a sand fly salivary gland antigen and wherein the salivary gland polypeptide induces a T cell response in the subject, thereby priming or enhancing an immune response to the disease antigen in a subject.
14. A method of priming or enhancing an immune response to a disease antigen in a subject, comprising: administering to the subject
(a) a therapeutically effective amount of an adjuvant comprising a nucleic acid molecule encoding a sand fly salivary gland polypeptide to induce a T cell response in the subject, wherein the therapeutically effective amount of adjuvant is below the amount required for a classical adjuvant, and
(b) a nucleic acid molecule encoding the disease antigen against which the immune response is directed, wherein the disease antigen is other than a sand fly salivary gland polypeptide, thereby priming or enhancing an immune response to the disease antigen in a subject.
15. The method of claim 14, wherein the disease antigen is a disease antigen other than a Leishmania antigen, such as a Plasmodium, hookworm, mycobacterium, or toxoplasma antigen.
16. The method of claim 14, wherein the T cell response is a CD4+ T helper cell response.
17. The method of claim 16, wherein the CD4+ T helper cell response is a ThI cell response.
18. The method of claim 14, wherein the disease antigen is administered to the subject simultaneously with the administration of the nucleic acid molecule encoding the sand fly salivary gland polypeptide.
19. The method of claim 14, wherein the antigen is administered to the subject after the administration of the nucleic acid molecule encoding the sand fly salivary gland polypeptide and within a sufficient amount of time to induce the immune response.
20. The method of claim 14, wherein the subject is a human.
21. The method of claim 14, wherein the subject is a non-human veterinary subject.
22. The method of claim 21 , wherein the subject is a dog.
23. The method of claim 14, wherein the nucleic acid molecule encoding a sand fly salivary gland polypeptide is an isolated Phlebotomus papatasi, Phlebotomus ariasi, Phlebotomus perniciosus, Phlebotomus argentipes, Phlebotomus duboscqi, P. sergenti, P. arabicus, P. tobbi, or Lutzomyia longipalpis nucleic acid molecule.
24. The method of claim 22, wherein the nucleic acid molecule comprises SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 8.
25. A composition, comprising an adjuvant comprising a sand fly salivary gland polypeptide and a disease antigen, wherein the disease antigen is other than a sand fly salivary gland antigen.
26. The composition of claim 25, wherein the disease antigen is a Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma antigen.
27. A method of priming or enhancing an immune response to an antigen in a subject, comprising the composition of claim 25.
28. A composition, comprising an adjuvant comprising a nucleic acid molecule encoding a sand fly salivary gland polypeptide and a nucleic acid molecule encoding a disease antigen, wherein the disease antigen is other than a sand fly salivary gland antigen.
29. The composition of claim 28, wherein the disease antigen is a Leishmania, Plasmodium, hookworm, mycobacterium, or Toxoplasma antigen.
30. A method of priming or enhancing an immune response to an antigen in a subject, comprising the composition of claim 28.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US8988408P | 2008-08-18 | 2008-08-18 | |
| US61/089,884 | 2008-08-18 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010021940A1 true WO2010021940A1 (en) | 2010-02-25 |
Family
ID=41101030
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2009/053941 Ceased WO2010021940A1 (en) | 2008-08-18 | 2009-08-14 | Insect proteins as adjuvants to accelerate the immune response |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2010021940A1 (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004039958A2 (en) * | 2002-10-29 | 2004-05-13 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Lutzomyia longipalpis polypeptides and methods of use |
| US20040171821A1 (en) * | 2001-06-19 | 2004-09-02 | Valenzuela Jesus G. | Anti-arthropod vector vaccines method of selecting and uses thereof |
-
2009
- 2009-08-14 WO PCT/US2009/053941 patent/WO2010021940A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040171821A1 (en) * | 2001-06-19 | 2004-09-02 | Valenzuela Jesus G. | Anti-arthropod vector vaccines method of selecting and uses thereof |
| WO2004039958A2 (en) * | 2002-10-29 | 2004-05-13 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Lutzomyia longipalpis polypeptides and methods of use |
Non-Patent Citations (11)
| Title |
|---|
| DATABASE UniProt [online] 1 December 2001 (2001-12-01), "SubName: Full=15 kDa salivary protein; Flags: Precursor;", XP002548390, retrieved from EBI accession no. UNIPROT:Q95WE3 Database accession no. Q95WE3 * |
| DATABASE UniProt [online] 1 December 2001 (2001-12-01), "SubName: Full=42 kDa salivary protein; Flags: Precursor;", XP002548391, retrieved from EBI accession no. UNIPROT:Q95WD9 Database accession no. Q95WD9 * |
| DATABASE UniProt [online] 1 December 2001 (2001-12-01), "SubName: Full=44 kDa salivary protein; Flags: Precursor;", XP002548392, retrieved from EBI accession no. UNIPROT:Q95WD8 Database accession no. Q95WD8 * |
| GARCIA ET AL: "Epidemiological monitoring of American tegumentary leishmaniasis: molecular characterization of a peridomestic transmission cycle in the Amazonian lowlands of Bolivia", TRANSACTIONS OF THE ROYAL SOCIETY OF TROPICAL MEDICINE AND HYGIENE, ELSEVIER, GB, vol. 101, no. 12, 18 October 2007 (2007-10-18), pages 1208 - 1213, XP022327568, ISSN: 0035-9203 * |
| GOMES REGIS ET AL: "Immunity to a salivary protein of a sand fly vector protects against the fatal outcome of visceral leishmaniasis in a hamster model", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 105, no. 22, June 2008 (2008-06-01), pages 7845 - 7850, XP009123467, ISSN: 0027-8424 * |
| KAMHAWI S ET AL: "Protection against cutaneous leishmaniasis resulting from bites of uninfected sand flies", SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, WASHINGTON, DC, vol. 290, no. 5495, 17 November 2000 (2000-11-17), pages 1351 - 1354, XP002329857, ISSN: 0036-8075 * |
| MORRIS R V ET AL: "Sandfly maxadilan exacerbates infection with Leishmania major and vaccinating against it protects against L. major infection.", JOURNAL OF IMMUNOLOGY (BALTIMORE, MD. : 1950) 1 NOV 2001, vol. 167, no. 9, 1 November 2001 (2001-11-01), pages 5226 - 5230, XP009123538, ISSN: 0022-1767 * |
| OLIVEIRA F ET AL: "From transcriptome to immunome: Identification of DTH inducing proteins from a Phlebotomus ariasi salivary gland cDNA library", VACCINE, BUTTERWORTH SCIENTIFIC. GUILDFORD, GB, vol. 24, no. 3, 16 January 2006 (2006-01-16), pages 374 - 390, XP025151083, ISSN: 0264-410X, [retrieved on 20060116] * |
| OLIVEIRA F ET AL: "Sand flies, Leishmania, and transcriptome-borne solutions", PARASITOLOGY INTERNATIONAL, ELSEVIER SCIENCE, AMSTERDAM, NL, vol. 58, no. 1, 16 August 2008 (2008-08-16), pages 1 - 5, XP025913918, ISSN: 1383-5769, [retrieved on 20080816] * |
| OLIVEIRA FABIANO ET AL: "Immunity to Distinct Sand Fly Salivary Proteins Primes the Anti-Leishmania Immune Response towards Protection or Exacerbation of Disease.", PLOS NEGLECTED TROPICAL DISEASES 2008, vol. 2, no. 4, April 2008 (2008-04-01), pages e226, XP009123512, ISSN: 1935-2735 * |
| VALENZUELA J G ET AL: "Toward a defined anti-Leishmania vaccine targeting vector antigens: characterization of a protective salivary protein", JOURNAL OF EXPERIMENTAL MEDICINE, ROCKEFELLER UNIVERSITY PRESS, JP, vol. 194, no. 3, 6 August 2001 (2001-08-06), pages 331 - 342, XP002329854, ISSN: 0022-1007 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5404990B2 (en) | How to vaccinate against malaria | |
| Brodskyn et al. | Vaccines in leishmaniasis: advances in the last five years | |
| Picchio et al. | Vaccine potential of antigen cocktails composed of recombinant Toxoplasma gondii TgPI-1, ROP2 and GRA4 proteins against chronic toxoplasmosis in C3H mice | |
| JP2010142226A (en) | Lutzomyia longipalpis polypeptides and methods of use | |
| JP5875987B2 (en) | Use of L3 and / or L5 sources as vaccines or diagnostics against parasitic diseases | |
| US8206725B2 (en) | Immunogenic agent and pharmaceutical composition for use against homologous and heterologous pathogens including plasmodium SPP | |
| EP1425301B1 (en) | Therapeutic vaccine mixture for preventing and treating disorders in mammals | |
| IL175412A (en) | Use of certain histones to treat parasitic diseases | |
| CN101977930B (en) | Vaccine comprising a ribosomal protein extract (rpe) and optionally a th1-promoting adjuvant | |
| FR3014103B1 (en) | VACCINE COMPOSITION FOR THE PREVENTION AND / OR TREATMENT OF LEISHMANIOSES, IMMUNOGENIC PEPTIDES AND METHOD OF OBTAINING | |
| US20190351035A1 (en) | Vaccine against trypanosoma cruzi infection | |
| EP1858549B1 (en) | Composition comprising the n-terminal region of leishmania histone h2b, use thereof for inducing an immune response | |
| EP2288619B1 (en) | Cyclized non-native synthetic peptide and complex of peptides comprising said cyclized peptide, intended to induce and to characterize the prevention or treatment of conditions in mammals | |
| KR20100098602A (en) | Compositions for eliciting an immune response against mycobacterium avium subspecies paratuberculosis | |
| da Silva Pissarra | Development of a multi-epitope peptide vaccine against human leishmaniases | |
| FR2719313A1 (en) | Leishmania major protein, nucleic acid encoding this protein and their applications. | |
| Carroll | Babesia microti Recombinant DNA Vaccine as a Model for Babesia bovis Prevention | |
| Ejazi et al. | Visceral Leishmaniasis: Immune Mechanisms and New Insights in Vaccine Development and Control | |
| HK1145638A (en) | Compositions for eliciting an immune response against mycobacterium avium subspecies paratuberculosis | |
| FR2844511A1 (en) | PEPTIDE COMPOUNDS FOR THE PREVENTION AND TREATMENT OF CONDITIONS IN MAMMALS | |
| AU2004266028A1 (en) | Immunogenic agent and pharmaceutical composition for use against homologous and heterologous pathogens including Plasmodium spp |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09791547 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |