WO2010010983A1 - Recombinant gram-negative bacteria producing outer membrane vesicles and method for preparing outer membrane vesicles tagged with foreign epitopes using the same - Google Patents

Recombinant gram-negative bacteria producing outer membrane vesicles and method for preparing outer membrane vesicles tagged with foreign epitopes using the same Download PDF

Info

Publication number
WO2010010983A1
WO2010010983A1 PCT/KR2008/004811 KR2008004811W WO2010010983A1 WO 2010010983 A1 WO2010010983 A1 WO 2010010983A1 KR 2008004811 W KR2008004811 W KR 2008004811W WO 2010010983 A1 WO2010010983 A1 WO 2010010983A1
Authority
WO
WIPO (PCT)
Prior art keywords
outer membrane
recombinant
membrane vesicles
bacteria
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2008/004811
Other languages
French (fr)
Inventor
Kyu Tae Chang
Sang Hyun Kim
Keun Su Kim
Sang Rae Lee
Ekyune Kim
Myeong Su Kim
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Research Institute of Bioscience and Biotechnology KRIBB
Original Assignee
Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Research Institute of Bioscience and Biotechnology KRIBB filed Critical Korea Research Institute of Bioscience and Biotechnology KRIBB
Publication of WO2010010983A1 publication Critical patent/WO2010010983A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/035—Fusion polypeptide containing a localisation/targetting motif containing a signal for targeting to the external surface of a cell, e.g. to the outer membrane of Gram negative bacteria, GPI- anchored eukaryote proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to recombinant gram-negative (G(-)) bacteria producing outer membrane vesicles and a method for preparing outer membrane vesicles tagged with multivalent epitopes using the recombinant bacteria, and more particularly to recombinant gram-negative G(-) bacteria producing outer membrane vesicles which are safe due to reduced endotoxicity and, at the same time, can deliver multivalent epitopes and induce adjuvanticity, and to a method for preparing outer membrane vesicles tagged with multivalent epitopes using the recombinant bacteria.
  • G(-) gram-negative
  • killed vaccines or subunit vaccines are also non-replicating acellular vaccines, but they are effective in inducing humoral immunity, and thus are not considered in diseases in which induction of cell-mediated immunity is required.
  • killed vaccines are comprised of killed whole bacteria, they comprise many kinds of intracellular proteins in addition to cell surface antigens effective in defending against infection, and thus can cause side effects such as induction of autoimmune responses.
  • Subunit vaccines usually contain only one kind of antigen and have weak immunogenicity, and it is difficult to induce cell-mediated immune responses by the subunit vaccines. To overcome such drawbacks, expensive adjuvants must be added thereto, thus causing disadvantages in terms of cost.
  • OMVs outer membrane vesicles
  • OMVs outer membrane vesicles
  • OMVs outer membrane vesicles
  • vaccines which employ outer membrane vesicles (OMVs) have not yet been commercialized worldwide, and only those produced from specific bacteria are now in clinical trials (efficacy and safety tests). The reason is because several bottlenecks to be overcome in producing and developing outer membrane vesicles (OMVs) as vaccines still remain, and the bottlenecks to be overcome can be explained in four categories.
  • OMVs outer membrane vesicles
  • LPS lipopolysaccharide
  • OMVs outer membrane vesicles
  • the amount of OMVs secreted from the outer membrane of bacteria in small amounts must be sufficiently increased.
  • recombinant outer membrane vesicles (OMVs) which have introduced thereinto selective foreign antigens for displaying multivalent antigenicity or express the foreign antigens therein, can be prepared, they will have the efficacy of mixed vaccines, because several heterogeneous antigens are contained in one outer membrane vesicle (OMV).
  • outer membrane vesicles endotoxicity of which has been removed, are isolated and newly reconstituted by inserting heterogeneous antigen or adjuvants into the lumen of the outer membrane vesicles or binding adjuvants to the surface of the outer membrane vesicles, various foreign antigens can be loaded onto one outer membrane vesicle (OMV) and delivered to the immune system, and in addition, induction of effective cell-mediated immunity or humoral immunity can be achieved depending on replication patterns of a pathogen to be prevented(intracellular or extracellular).
  • OMV outer membrane vesicle
  • outer membrane vesicles can be reconstituted using a technology of embedding a ThI adjuvant for inducing cell-mediated immunity into the outer membrane vesicles
  • the outer membrane vesicle (OMV) vaccines thus reconstituted will become ideal vaccines having necessary and sufficient conditions for next-generation vaccines.
  • OMVs outer membrane vesicles
  • methods of isolating naturally occurring OMVs methods of isolating various kinds of naturally occurring OMVs and combining them, or methods of combining isolated OMVs with artificially synthesized liposome to produce hybrids (liposome + MV) and the use thereof, have been granted.
  • vaccines developed using OMVs produced naturally from Neisseria meningitidis are currently in clinical efficacy trials for marketing approval, but safe and effective OMV vaccines prepared from gram- negative bacteria other than Neisseria meningitidis using a combination of advanced technologies overcoming the above-described four bottlenecks, have not yet been developed.
  • Korean Patent Publication No. 2002-7001441 and US Patent Publication No. 20060216307 disclose an outer membrane vesicle (OMV) vaccine containing LPS, exdotoxicity of which was reduced by producing a mutant with a deletion of msbB (ipxM) or htrB (IpxL) gene of N. meningitidis to modify the structure of lipid A.
  • OMV outer membrane vesicle
  • the present inventors have made extensive efforts to solve the above- described problems and, as a result, have found that, when the pagP gene together with the msbB gene is deleted from such /? ⁇ gP-carrying G(-) bacteria, only low endotoxic penta-acylated lipid A of LPS present in the OMVs can be produced, and when the degP gene is additionally deleted from the bacteria, the ability of the bacteria to produce OMVs can be increased, and in addition, when a specific foreign epitope is expressed as a fusion with an outer membrane protein of G(-) bacteria or when either a synthetic peptide acting as a foreign epitope or a DNA fragment encoding the synthetic peptide is loaded into the lumen of the OMVs isolated from G(-) bacteria, outer membrane vesicles (OMVs) having multivalent antigenicity can be prepared, thereby completing the present invention.
  • OMVs outer membrane vesicles
  • an object of the present invention to provide recombinant G(-) bacteria secreting outer membrane vesicles (OMVs) which are safe and, at the same time, can deliver multivalent epitopes and induce adjuvanticity, and a preparation method thereof.
  • OMVs outer membrane vesicles
  • Another object of the present invention is to provide a method for preparing outer membrane vesicles which are safe and, at the same time, can deliver multivalent epitopes and induce adjuvanticity.
  • Still another object of the present invention is to provide a method for reconstituting outer membrane vesicles (OMVs), which comprises labeling the surface of OMV as a vaccine candidate, prepared by a combination of the above- described technologies, with a fluorophore, such that the processes of cellular entry, intracellular trafficking, degradation, and bio-distribution of such OMVs as an antigen carrier in vivo can be monitored by an in vivo imaging system.
  • OMVs outer membrane vesicles
  • the present invention provides a method for preparing recombinant G(-) bacteria capable of expressing a foreign epitope in fusion with an outer membrane protein, the method comprising the steps of: (a) constructing a G(- ) bacterial mutant by deleting a gene, which is involved in lipid A biosynthesis of lipopoly saccharide (LPS) present in outer membrane vesicles (OMVs), from G(-) bacteria having the ability to produce outer membrane vesicles; (b) constructing a recombinant gene such that a foreign epitope is expressed in fusion with an outer membrane protein of the G(-) bacteria; and (c) introducing the recombinant gene, constructed in the step (b), into the G(-) bacterial mutant, constructed in the step (a).
  • LPS lipopoly saccharide
  • OMVs outer membrane vesicles
  • the present invention also provides recombinant G(-) bacteria prepared by said method, which have a deletion of a gene involved in lipid A biosynthesis of lipopolysaccharide (LPS), and have a recombinant gene, constructed such that a foreign epitope is expressed in fusion with an outer membrane protein of G(-) bacteria, introduced there into.
  • LPS lipopolysaccharide
  • the present invention also provides a method for preparing recombinant outer membrane vesicles (OMVs) tagged with a foreign epitope, the method comprising culturing said recombinant G(-) bacteria to express a foreign epitope in fusion with an outer membrane protein.
  • OMVs outer membrane vesicles
  • the present invention also provides a method for preparing recombinant engineered outer membrane vesicles (OMVs), the method comprising the steps of: (a) constructing a G(-) bacterial mutant by deleting a gene, which is involved in lipid A biosynthesis of lipopolysaccharide (LPS) present in outer membrane vesicles (OMVs), from G(-) bacteria having the ability to produce outer membrane vesicles; (b) collecting the outer membrane vesicles (OMVs) secreted from the G(-) bacterial mutant; and (c) inserting either a synthetic peptide acting as a foreign epitope or a DNA fragment encoding the synthetic peptide into the lumen of the outer membrane vesicles (OMVs) collected in the step (b).
  • LPS lipopolysaccharide
  • the present invention also provides a method for reconstituting recombinant engineered outer membrane vesicles (OMVs), the method comprising inserting an adjuvant showing an immune stimulating effect into the lumen of the recombinant outer membrane vesicles (OMVs) prepared by said method.
  • OMVs engineered outer membrane vesicles
  • the present invention also provides a method for reconstituting recombinant outer membrane vesicles (OMVs), the method comprising chemically coupling (a) an antigenic substance consisting of protein or carbohydrate or (b) a fluorescent dye to KDO (S-deoxy-D-m ⁇ nno-oct-l-ulosonic acid) of lipopolysaccharide (LPS) present in the recombinant outer membrane vesicles prepared by said method.
  • OMVs outer membrane vesicles
  • FIG. 1 shows that outer membrane vesicles are formed by the G(-) bacteria producing outer membrane vesicles described in the present invention, and are released from the outer membrane.
  • FIG. 1 also shows a basic production platform of constructing mutants according to embodiments disclosed in the present invention and producing outer membrane vesicles having multivalent antigenicity, in which endotoxicity of LPS has been reduced.
  • FIG. 2 is a schematic diagram showing methods used to construct a mutant (Sakai ⁇ msbBl/ ⁇ msbB2 mutant) according to an embodiment of the present invention and shows a basic system of selectively deleting or inactivating a target gene on the chromosome in G(-) bacteria.
  • FIG. 3 is a photograph showing the electrophoresis results of PCR products obtained by PCR performed to examine a gene mutation in the msbB genes of a Sakai AmsbBl/AmsbB2 mutant constructed according to an embodiment of the present invention (lanes M: size marker, 1 : intact msbBl, 2: AmsbBl, 3: intact msbB2, and 4: ⁇ msbB2).
  • FIG. 4 is a photograph showing the results obtained by isolating LPS from mutants (Sakai-Ml and Sakai-DM) according to an embodiment of the present invention, migrating the LPS according to molecular weight by SDS-PAGE, and then silver staining the LPS (WT: wild type Sakai, Ml: Sakai-Ml, and DM: Sakai-DM).
  • FIG. 5 is a photograph showing the results obtained by isolating lipid A labeled with [ P] from mutants (Sakai-Ml and Sakai-DM) according to an embodiment of the present invention, and then performing TLC in order to examine the acylation of the lipid A (lanes 1 : wild type Sakai, 2: Sakai-Ml, 3: and Sakai-DM).
  • FIG. 6 is a set of transmission electron microscope (TEM) photographs showing the results of observation of outer membrane vesicles (OMVs) produced from mutants constructed according to an embodiment of the present invention after the culture of the mutants (panel A: electron microscope photographs showing the observation result after collecting outer membrane vesicles released into the culture supernatant after culture of bacterial cells; and panel B: electron microscope photographs showing the observation result after fixing outer membrane vesicles released from the outer membrane of bacterial cells).
  • TEM transmission electron microscope
  • FIG. 7 is a schematic diagram showing the strategy for constructing a recombinant DNA such that a foreign antigen disclosed in an embodiment of the present invention is expressed in fusion with an outer membrane protein of G(-) bacteria, and constructing a mutant into which the recombinant DNA is introduced.
  • FIG. 8 is a TLC chromatogram showing the acylation of lipid A of mutants constructed according to an embodiment of the present invention (lanes 1 : wild type Sakai, 2: Sakai-Ml (msbBl), 3: Sak ⁇ -M2(msbB2), 4: Sakai-DM//? ⁇ g/ > ::FLAG, and 5: Sakai-DM).
  • FIG. 9 shows a chemical structure corresponding to the lipid A spot detected on the TLC plate ofFIG. 8.
  • FIG. 10 shows the topology prediction of secondary structure of a PagP::FLAG fusion protein expressed in the outer membrane of a Sakai-DM//? ⁇ gP::FLAG mutant constructed according to an embodiment of the present invention.
  • FIG. 11 is a photograph showing the results of Western blot performed to examine the expression of OmpA::FLAG in a Sakai-DM/ ⁇ mp4::FLAG mutant constructed according to an embodiment of the present invention.
  • FIG. 12 shows the topology prediction of secondary structure of an OmpA::FLAG protein according to an embodiment of the present invention in the outer membrane of a mutant.
  • the present invention relates to a method for preparing recombinant G(-) bacteria capable of expressing an outer membrane protein in fusion with a foreign epitope, the method comprising the steps of: (a) constructing a G(-) bacterial mutant by deleting a gene, which is involved in lipid A biosynthesis of lipopolysaccharide (LPS) contained in outer membrane vesicles (OMVs), from G(- ) bacteria having the ability to produce outer membrane vesicles; (b) constructing a recombinant gene such that a foreign epitope is expressed in fusion with an outer membrane protein of the G(-) bacteria; and (c) introducing the recombinant gene, constructed in the step (b), into the G(-) bacterial mutant, constructed in the step (a).
  • LPS lipopolysaccharide
  • OMVs outer membrane vesicles
  • outer membrane vesicles are nanosized membrane vesicles which are spontaneously produced from the outer membrane of G(-) bacteria and secreted in small amounts.
  • OMVs outer membrane vesicles
  • they naturally contain various antigenic components present in the outer membrane.
  • lipopolysaccharide LPS
  • LPS lipopolysaccharide
  • a mutant in which the endotoxicity of LPS has been sufficiently reduced was constructed by deleting a msbB gene involved in lipid A biosynthesis of lipopolysaccharide (LPS), and inactivating a pagP gene to block the formation of palmitated hexa-acyl lipid A occurring due to activation of an outer membrane enzyme PagP in the msbB-deletQ ⁇ mutant so as to produce only penta-acyl lipid A.
  • LPS lipopolysaccharide
  • the gene involved in lipid A biosynthesis of lipopolysaccharide is preferably one or more genes selected from the group consisting o ⁇ lpxL (htrB), ipxM (msbB) and pagP.
  • PagP is an enzymatic protein which is not present in N. meningitides, but is located in the outer membrane of E. coli, Shigella spp., Salmonella, etc., and catalyzes the lipid A palmitoylation reaction of incorporating palmitate into a lipid A molecule (Bishop, R.E., MoI. Microbiol, 57:900, 2005).
  • the PagP has very low enzymatic activity in normal strains having hexa-acyl lipid A, but when a msbB (ipxM)- deleted mutant (having penta-acyl lipid A) causing the structural weakness of the outer membrane is constructed, the PagP will be specifically activated in order to compensate for the weakness of the outer membrane structure, and thus the incorporation of palmitate instead of myristate (catalyzed by MsbB) into penta-acyl lipid A (a substrate) will be increased.
  • one or more genes selected from the group consisting of ipxXL, ipxF and ipxE, which are involved in lipid A structural modification can be cloned into an expression vector, and can be introduced and expressed in the recombinant G(-) bacteria.
  • msbB is a gene encoding an enzyme involved in incorporating fatty acid myristate into a precursor (lipid IV A ) in the final step of lipid A synthesis in the bacterial cytoplasm.
  • lipid A a portion of LPS, called "lipid A”, that possesses hexa-acyl chains, having laurate and myristate as an acyl-oxy-acyl form, and bis- phosphorylation in the 1 and 4'-carbon of the glucosamine.
  • lipid A a portion of LPS
  • Such specific molecular structure of lipid A is an essential element in determining endotoxicity (Alexander, C. & Rietschel, E.T., J. Endotoxin. Res., 7:167, 2001).
  • the modified lipid A structure does not act as an agonist stimulating toll-like receptor 4 (TLR4) that is an innate immunity receptor of humans or animals.
  • TLR4 toll-like receptor 4
  • pathogenic E. coli O157:H7, Shigella spp. and Salmonella do not produce only a penta-acyl lipid A species as a result of inactivation of only the MsbB enzyme, as in the case of N. meningitidis mutants.
  • mutants in which the PagP enzyme is additionally inactivated must be constructed to produce LPS having only penta-acyl lipid A. Because the LPS having such penta-acyl lipid A stimulates TLR4 receptor at a level significantly lower than that of signaling occurring through the binding of normal hexa-acyl lipid A with TLR4-MD2 receptor complex (excessive stimulation of expression of pro-inflammatory cytokines), it can eliminate endotoxic side effects caused by excessive secretion of pro-inflammatory cytokines.
  • penta-acyl lipid A produced by the msbB-delQted mutant signaling action as a danger signal stimulating the excessive expression of pro-inflammatory cytokines is suppressed, but signaling action as a co-stimulatory signal promoting the expression of B7 molecules of dendritic cells involved in adjuvanticity is maintained as it is. Therefore, penta-acyl lipid A produced by the pathogenic E. coli O157:H7 mutant disclosed in the present invention is a major constituent of OMVs, which greatly reduces endotoxic side effects caused by excessive stimulation of secretion of pro-inflammatory cytokines while maintaining adjuvanticity as it is.
  • a mutant in order to change the acylation state of lipid A from hexa- acylation to penta-acylation, a mutant was constructed by deleting msbB gene together with pagP gene from the pathogenic E. coli O157:H7 strain used as an example.
  • the endotoxicity of LPS having penta-acyl lipid A produced by this mutant was reduced sufficiently enough to be safely used as a vaccine.
  • outer membrane vesicles produced from the mutant ⁇ msbB ' lpagP ' ::FLAG contain components showing adjuvanticity, and thus might have the effect of increasing vaccine efficacy without separate addition of adjuvants.
  • an enzyme e.g., ipxF, ipxXL or ipxE
  • ipxF, ipxXL or ipxE involved in the formation of specific lipid A structures in various gram-negative bacteria can be cloned into an expression vector, and one or more genes selected among these genes can be introduced and expressed in the mutant ⁇ msbB ' lpagP ::FLAG) exemplified in the present invention.
  • the term “deletion” refers to the removal of a genetically coding region of the chromosome.
  • Various methods for removing the function of a specific gene in bacterial cells have been studied, but when a one-step PCR inactivation system (Datsenko KA & Wanner BL, PNAS, 97:6640, 2000), which is recently receiving attention as a relatively simple and efficient method, is used, a desired gene can be easily deleted by the targeted homologous recombination event (FIG. 3).
  • the method for preparing the recombinant G(-) bacteria preferably additionally comprises a step of deleting a degP gene from the G(-) bacteria mutant constructed in the step (a) in order to increase the size and production of outer membrane vesicles.
  • DegP acts as a periplasmic chaperone, and in addition, functions as a protease. If misfolded outer membrane proteins are accumulated in the periplasm without being anchored into the outer membrane, DegP shows protease activity for degrading such proteins. Therefore, in a degP gene-deleted mutant, abnormal outer membrane proteins accumulated in the periplasm are not properly removed to interfere with the growth of the bacteria, and thus such proteins are likely to be exported outside the cell by being packaged into the outer membrane vesicles. Accordingly, it is believed that the adaptation of the mutant is made in the direction in which the size or production of outer membrane vesicles are increased.
  • Deletion of the degP gene can be carried out by the genetic targeting method using homologous recombination.
  • a typical outer membrane protein can be exemplified by OmpA, which is commonly present in the outer membrane of G(-) bacteria and is abundantly expressed therein, and the three-dimensional atomic structure of which is known.
  • the outer membrane protein OmpA has a three-dimensional structure comprising an eight- stranded ⁇ -barrel arranged and folded in the reverse direction, in the same manner as the PagP outer membrane protein.
  • one or more selected from among other kinds of outer membrane proteins (OmpC, OmpF, OmpX, OmpG, and OmpT) having structural characteristics similar to those of OmpA can be used instead of OmpA as a target for the fusion and expression of foreign epitopes.
  • the foreign epitope which is used in the present invention may be selected from the group consisting of: (a) major protein antigen components of viruses or pathogenic microorganisms causing various infectious diseases in humans or animals; (b) specific cell surface markers which are expressed in immune cells (e.g., dendritic cells) or cancer cells; and (c) ligands binding to specific receptors present on the surface of immune cells or cancer cells.
  • FLAG the expression of which can be easily detected
  • an antigen of a pathogen to be prevented such as an E7 epitope of oncogenic human papillomaviruses
  • a recombinant DNA was constructed such that a FLAG sequence as a foreign epitope was fused with an OmpA protein gene.
  • the DNA fragment was introduced into the mutant ⁇ msbB ' lpagP ' ) to induce homologous recombination with the original ompA gene, thus constructing a mutant having ompAwFLAG.
  • a foreign epitope FLAG
  • outer membrane vesicles which are produced by the recombinant G(-) bacterial mutant are characterized in that they spontaneously contain the FLAG foreign epitope.
  • the recombinant gene is constructed such that a foreign epitope to be introduced is expressed as a fusion with the extracellular loop of the three-dimensional structure (beta ( ⁇ )-barrel structure) of the outer membrane protein, or localized in the periplasm.
  • outer membrane vesicles released from the outer membrane of the mutant spontaneously contain the foreign epitope, and thus can be used as a platform technology for developing multivalent epitope vaccines.
  • the G(-) bacteria are gram-negative bacteria having apagP gene or pagP orthologs, and examples thereof include Escherichia spp., Salmonella spp., Klebsiella pneumoniae, Yersinia spp., Legionella pneumophila, Bordetella spp., Shigella spp. and the like. It is preferable to use Escherichia spp., the structure and function of LPS of which were studied more than those of other bacterial strains.
  • Said Escherichia spp. can be exemplified by a serotype O157:H7 strain which has pathogenicity and contains two msbB genes in the genome.
  • the E. coli O157:H7 strain specifically has two msbB genes in the same manner as Shigella spp. causing bacterial dysentery, which includes msbBl in the chromosome and msbB2 in the plasmid (pO157) (Kim SH et al, Infect Immun., 72: 117 r 4, 2004).
  • the present invention relates to recombinant G(-) bacteria prepared by said method, which have a deletion of a gene involved in lipid A biosynthesis of LPS, and have a recombinant gene constructed such that a foreign epitope is expressed in fusion with an outer membrane protein of G(-) bacteria, introduced thereinto.
  • the genes involved in lipid A biosynthesis, the outer membrane protein, the foreign epitope, the G(-) bacteria and the like are the same as mentioned above.
  • the recombinant G(-) bacteria preferably additionally have one or more genes selected from the group consisting of ipxXL, ipxF and ipxE which are involved in the structural modification of lipid A, cloned and expressed therein.
  • the recombinant G(-) bacteria preferably have a degP gene additionally deleted in order to increase the size and production of outer membrane vesicles.
  • the present invention relates to a method for preparing outer membrane vesicles (OMVs) tagged with a foreign epitope, the method comprising culturing said recombinant G(-) bacteria to express a foreign epitope in fusion with an outer membrane protein.
  • OMVs outer membrane vesicles
  • the outer membrane vesicle (OMV) produced by the recombinant G(-) bacterial mutant according to the present invention is an antigen carrier which is safe due to low endotoxicity, can deliver various foreign epitopes and has self-adjuvanticity.
  • the outer membrane vesicle (OMV) produced in the present invention is a nanoscale membrane vesicle (average size of about 70 ⁇ 100 nm in diameter) similar to that of a common viral particle and has properties similar to those of an artificially synthesized liposome. Thus, it can be used as a vehicle that is noteworthy in the bio-nano-engineering fields.
  • the present invention relates to a method for preparing recombinant outer membrane vesicles (OMVs), the method comprising the steps of: (a) constructing a G(-) bacterial mutant by deleting a gene, which is involved in lipid A biosynthesis of LPS contained in outer membrane vesicles (OMVs), from
  • G(-) bacteria having the ability to produce outer membrane vesicles; (b) collecting the outer membrane vesicles (OMVs) secreted from the G(-) bacterial mutant; and (c) inserting either a synthetic peptide acting as a foreign epitope or a DNA fragment encoding the synthetic peptide into the lumen of the outer membrane vesicles (OMVs) collected in the step (b).
  • OMVs outer membrane vesicles
  • the gene involved in lipid A biosynthesis of liposaccharide (LPS), the outer membrane protein, the foreign epitope, the G(-) bacteria and the like are the same as mentioned above. Also, the recombinant G(-)
  • bacteria preferably additionally have one or more genes selected from the group consisting of ipxXL, ipxF and ipxE which are involved in the structural modification of lipid A, cloned and expressed therein.
  • the recombinant G(-) bacteria have a degP gene additionally deleted in order to increase the size and production of the outer membrane vesicle.
  • the outer membrane vesicle (OMV) prepared according to the above method can induce innate immunity through TLR4 and TLR2 due to pathogen-associated molecular pattern (PAMP)s such as LPS and lipoprotein which are the major constituents thereof.
  • PAMP pathogen-associated molecular pattern
  • a foreign epitope is incorporated into OMV according to the method disclosed in the present invention, and used as a vaccine, it is physically linked to PAMP, the constituent of OMV, so that an immune response to the incorporated foreign epitope can be enhanced due to the self-adjuvanticity of the outer membrane vesicle without adding a separate adjuvant.
  • the APCs e.g., dendritic cells
  • the APCs activated by uptaking the outer membrane vesicles can closely contact with helper T cells (Th cells), and strongly transmit information on the epitopes to the Th cells at high rates. This is because co-stimulatory molecules can be expressed on the surface of the antigen-presenting cells by TLR stimulation to transmit strong signals.
  • the present invention relates to a method for reconstituting outer membrane vesicles (OMVs), the method comprising inserting an adjuvant showing an immune stimulating effects into the lumen of the engineered recombinant outer membrane vesicles (OMVs) prepared by said preparation method.
  • OMVs outer membrane vesicles
  • a CpG DNA (nucleotide sequence) fragment which acts as a ThI -adjuvant for inducing cell-mediated immunity and has no methyl group attached thereto, can be loaded into the lumen of OMV and used as a vaccine for the induction of cell-mediated immunity like the case of a vaccine against viral infection.
  • the present invention relates to a method for reconstituting outer membrane vesicles (OMVs), the method comprising chemically coupling (a) an antigenic substance consisting of protein or carbohydrate or (b) a fluorescent dye to KDO (3-deoxy-D-m ⁇ /w ⁇ -oct-2-ulosonic acid) of LPS contained in the recombinant outer membrane vesicles prepared by said preparation method.
  • OMVs outer membrane vesicles
  • antigenic substance consisting of protein or carbohydrate
  • examples of the antigenic substance consisting of protein or carbohydrate include malaria merozoite surface protein (MSP), human papillomavirus oncogenic proteins (E6 or El), tumor-associated mucin glycopeptide (MUCl), blood group- related carbohydrate antigen Lewis y (Le y ) and the like
  • examples of the fluoresent dyes include fluorescein, rhodamine, Texas Red, Cy3, Cy5.5 and the like.
  • the KDO sugar has highly reactive carboxyl acid residue (COOH group) and possess aldehyde group
  • a foreign epitope consisting of protein or carbohydrate or a fluorescent dyes linked to a suitable cross-linker can be coupled to the KDO sugar by a chemical coupling method using the reactive residues.
  • cystamine (NH 2 -(CH 2 VS-S-(CH 2 VNH 2 ) is allowed to react with OMV to cause a condensation reaction, like when a carboxylic group present in the KDO and an amino group (NH 2 group) present in cystamine form a peptide bond, whereby a thiol (SH) group contained in cystamine can be incorporated into the LPS of OMV.
  • a foreign epitope (protein) to be coupled to OMV is allowed to react with N- succinimidyl bromoacetate (Br-CO-CH 2 -O-NHS) such that a spontaneous chemical coupling reaction occurs, thus producing a conjugate of protein (foreign epitope)- [NH-CO-CH 2 -Br].
  • Nr-CO-CH 2 -O-NHS N- succinimidyl bromoacetate
  • Example 1 Construction of msbB (ipxM) mutant of pathogenic E. coli O157:H7 Sakai strain (hereinafter referred to as Sakai) and analysis of the mutant phenotvpe
  • Sakai strain (KCTC 11344BP) has two msbB genes
  • the msbB genes present in the chromosome (msbB J) and the plasmid (msbB2), respectively, must be inactivated in order to prepare a completely inactivated mutant of MsbB enzyme.
  • a mutant in which msbBl and msbB2 have been inactivated was prepared according to the strategy shown in FIG. 2.
  • PCR was performed using ⁇ KD3 (SEQ ID NO: 3, GenBank accession no. AY048742, 2804 bp sequence) as a template and an Ml-Fw primer (SEQ ID NO: 1) and an Mi-Rev primer (SEQ ID NO: 2), thus preparing a PCR product containing a chloramphenicol resistance gene cassette (Cm-cassette) present in the pKD3 plasmid.
  • ⁇ KD3 SEQ ID NO: 3, GenBank accession no. AY048742, 2804 bp sequence
  • Ml-Fw primer SEQ ID NO: 1
  • an Mi-Rev primer SEQ ID NO: 2
  • PCR reaction was performed for 32 cycles, each consisting of denaturation at 94 °C for 1 min, annealing at 57 ° C for 30 seconds, and extension at 70 °C for 1 min.
  • SEQ ID NO: 1 TGTCGCTCTGCTTTCCAGAACGTAGTGAAGCTGAACGCGAGfGraGGCTGG ⁇ GCrGCTTCG
  • SEQ ID NO: 2 TCTCGACTTCTTCATTCATCCGCCGCGCAATCGTATGATCC ⁇ K4TO/( ⁇ K4rCCrCC2T4G
  • the PCR product was purified, and then electroporation was carried out in order to introduce the PCR product into a transformed Sakai strain containing pKD46 plasmid.
  • the Sakai strain was cultured, and then the bacterial cells were washed with cold 10% glycerol solution to make electro- competent cells. The cells were added to l//g of pKD46 plasmid, allowed to stand on ice for 10 minutes, transferred into an electroporation cuvette and electroporated using a GenePulser Xcell (BioRad) at 2.5 kV and 200 ⁇ , thus transforming the Sakai strain.
  • BioRad GenePulser Xcell
  • the plasmid pKD46 present in Sakai(pKD46) bacteria contains Red recombinase enzyme serving for recombination of homologous DNA fragments, between the msbBl gene present in the chromosome and the introduced targeting DNA fragment, thus preparing a Cm-resistant mutant.
  • Such Cm-resistant colonies were isolated in pure state, and whether the targeted portion of the msbBl gene has been mutated as intended was confirmed by PCR. Specifically, the genomic DNA of the mutant was isolated, primers flanking the mutation site were prepared, and the size of a DNA product amplified by PCR using the primers was analyzed (confirmed the predicted increase in size). Then, the Cm-cassette inserted into the genome was excised to remove a Cm-resistant marker. For this purpose, the mutant was cultured at a high temperature of 41 ° C to eliminate the temperature-sensitive pKD46 (Amp R ) plasmid, and then a pCP20 (Amp R ) plasmid was introduced into the mutant.
  • Amp R temperature-sensitive pKD46
  • Amp R pCP20
  • the genome of the Sakai strain has two msbB genes in the chromosome ⁇ msbBl) and the plasmid pO157 (msbB2)
  • another msbB2 gene in the AmsbBl mutant constructed according to the above-described method was inactivated to completely remove the enzymatic activity of MsbB in the Sakai strain, thus constructing a mutant from which the enzymatic activity of MsbB has been completely removed.
  • a method for mutating the msbB2 gene located on the plasmid pO157 was carried out using the same strategy as the above method of inducing the deletion of msbBl.
  • PCR was performed using the pKD3 template and the constructed primers.
  • the resulting PCR product was a DNA fragment for targeting msbB2 gene, which contains a Cm-cassette in the msbB2 gene.
  • SEQ ID NO: 4 GACGTGGACAGGTATCGGTATTATCTGTGTGTTTGCAATGGrG ⁇ GGCrGG/iGCrGCTTCG SEQ ID NO: 5: TCGCGCAATATGAGCATCACTCTTCTGTCGTATAGCAAGTC4 ⁇ rG ⁇ rCCrCC7 ⁇ G
  • the prepared DNA fragment for targeting msbB2 gene was inserted into the AmsbBl(pKD46) strain through the above-described electroporation method, and homologous recombination was induced, thus preparing a Cm-resistant mutant into which the mutation has been introduced by targeting the msbB2 gene.
  • the mutant was cultured at high temperature to eliminate pKD46, and a pCP20 plasmid was introduced into the mutant.
  • the FRT (FLP recognition target) sequence present in the end of the internal Cm-cassette was recognized by the FLP recombinase present in pCP20, and thus the Cm-cassette was excised by FLP. Also, msbB2 DNA having a length reduced as much as predicted was confirmed by PCR amplification.
  • the genomic DNA isolated from the mutant was used as template DNA, each of a primer set (MsbBl-Fw primer: SEQ ID NO: 6; and MsbB l-Rev primer: SEQ ID NO: 7) for confirming AmsbBl and a primer set (MsbB2-Fw primer: SEQ ID NO: 8; and MsbB2-Rev primer: SEQ ID NO: 9) for confirming AmsbB2 was added thereto at a concentration of 30 pico mole, and AccuPrime Taq DNA polymerase (Invitrogen) and a reaction buffer added to a kit were added thereto.
  • the PCR reaction was carried out for 32 cycles, each consisting of denaturation at 94 "C for 1 min, annealing at 57 °C for 30 seconds, and extension at 70 ° C for 1 min.
  • SEQ ID NO: 6 TCGCGAATTCCTCGAGCAGGCCAA
  • SEQ ID NO: 7 CTGAAGCAAGCTTGAACTTATCA
  • SEQ ID NO: 8 CTCACTGATCTCGAGACTCTTCC
  • SEQ ID NO: 9 GCTGGGTAAGCTTATTATCCTGA
  • Test Example 1 Comparison of changes in LPS phenotvpes of mutants
  • the overall LPS pattern was similar between the three strains, and the wild type Sakai strain and the Sakai-Ml strain produced the same smooth LPS.
  • the Sakai-DM strain showed a reduction in molecular weight as much as the molecular weight of a myristate group which did not attached thereto, thus confirming that the LPS band migrated slightly faster on the SDS-PAGE gel than the wild type control.
  • Test Example 2 Analysis of acylation state of lipid A of LPS
  • the phosphate of the lipid A molecule was labeled with radioactive isotope P-32, and only the lipid A portion was isolated from LPS by mild-acid hydrolysis. Then, the pure isolated lipid A was applied on a thin-layer chromatography (TLC) plate, and the changes in the acylation of the lipid A were observed through the migration pattern on TLC according to their relative hydrophobicity.
  • TLC thin-layer chromatography
  • Example 2 Construction of degP mutant from Sakai O157:H7 strain and its phenotype analysis
  • a degP gene was deleted from the strain, and the size and amount of OMVs produced by the mutant were examined.
  • a target DNA fragment was constructed according to the same strategy as in the construction of the msbB mutant and introduced into each of the Sakai(pKD46) and Sakai-DM(pKD46) strains, a homologous recombinant strain (Cm R ) was isolated, and whether the mutation has been accurately introduced into the degP gene, was confirmed by PCR. For this purpose, recombinant DNA with a mutation of the degP gene was prepared.
  • DNA fragments having a relatively long homology region (longer than 400-bp), which correspond to both ends of the degP gene, were cloned into pUC18, and then a Cm-cassette derived from pKD3 was inserted between the homologous fragments, thus preparing recombinant DNA for degP deletion.
  • the constructed DNA fragment for targeting degP gene was introduced into each of the strains by electroporation to induce homologous recombination, thus preparing Cm-resistant mutants having a degPv.Cm allele.
  • a AdegP::Cm mutant was constructed from each of the Sakai and Sakai-DM strains according to the above method, and the DNA size of PCR products, corresponding to the mutation of the AdegP::Cm gene, was analyzed.
  • PCR for confirming the AdegP::Cm mutant was performed as follows: a genomic DNA derived from each of the mutants was used as a template, each of primers (For-degP primer: SEQ ID NO: 10; Rev-degP primer: SEQ ID NO: 11) was added to a PCR reaction mixture at a concentration of 30 pico mole, and then AccuPrime Taq DNA polymerase ® (Invitrogen) and a buffer contained in a kit were added to the reaction mixture.
  • each of the mutants was cultured in 500 ml of LB broth, and then separated into cells and culture supernatant by centrifugation (at 11,00OxG for 30 min). The separated culture supernatant was filtered through a membrane filter having a pore size of 0.2 ⁇ m to remove the remaining cells and cell debris. Then, in order to collect outer membrane vesicles from the culture supernatant, ammonium sulfate was added to the filtered supernatant, and the outer membrane vesicles were precipitated at 4 0 C overnight.
  • the precipitated outer membrane vesicles were collected by centrifugation (at 11,00OxG for 30 min) and suspended in 20 ml of phosphate-buffered saline (PBS). The suspension was separated into supernatant and precipitate by low-speed centrifugation (at 16,00OxG for 15 min), and the outer membrane vesicles remaining in the supernatant were precipitated by ultra-highspeed centrifugation (at 10O 5 OOOxG for 2 hr), and the precipitate was suspended in 2 ml distilled water and stored at -20 ° C . In order to observe the separated outer membrane vesicles with an electron microscope, the outer membrane vesicle samples were negatively stained with 1% uranyl acetate on a formvar-coated grid and observed.
  • PBS phosphate-buffered saline
  • the degP- ⁇ e ⁇ ete ⁇ mutants showed increases in the amount and size of outer membrane vesicles produced, compared to those of the Sakai strain or the Sakai-DM strain from which degP was not deleted (data not shown).
  • the Sakai-DM/ ⁇ cfeg.P::Cm mutant it was observed that the production rate of outer membrane vesicles was very low and the size thereof was also small (data not shown), and this is believed to be because the outer membrane of the parental strain Sakai-DM was further weakened due to the induction of AdegP::Cm mutation. Therefore, it was found that the outer membrane vesicles produced from the Sakai-DM strain had a relatively uniform size ( ⁇ 70 nm) (FIG. 6 A).
  • Example 3 Construction of pagP ::FLAG-tagged mutant from Sakai AmsbB 11 AmsbB2 mutant (Sakai-DM) and its phenotype analysis
  • hexa-acyl lipid A from by the enzymatic activity of PagP partially appeared in a lipid A profile of the Sakai AmsbBl/AmsbB2 mutant (Sakai-DM) constructed in Example 1, in order to eliminate such hexa-acyl lipid A and produce predominant penta-acyl lipid A form, a new mutation ⁇ pagP: :FLAG) was introduced into Sakai-DM thus constructing a mutant (Sakai- OMlpagPvSLAG) introduced thereinto, from which the enzymatic activity of PagP has been removed having a FLAG sequence as a foreign epitope.
  • FLAG was selected as the epitope tag for the purpose of introducing a new pagP:: ⁇ LAG mutation into Sakai-DM to remove the enzymatic activity of PagP while fusing the foreign epitope to the outer membrane protein of the Sakai-DM to detect the expression thereof.
  • a full-length pagP gene was cloned into a pUC18 vector, and a Cm-cassette derived from pKD3 was inserted next to the pagP gene on the same plasmid.
  • the recombinant plasmid was used as template DNA for PCR based site-directed mutagenesis. As a result, as shown in FIG.
  • SEQ ID NO: 13 a 78-bp kinated mutagenic reverse primer (SEQ ID NO: 13) comprising a DNA nucleotide sequence encoding FLAG epitope of 15 amino acids (SEQ ID NO: 12), was constructed. The first PCR was carried out using the primer. SEQ ID NO: 12: DYKDHDGDYKDHDDD
  • SEQ ID NO: 13 CGGTCGCTCGTTATAATCGTCATCATGATCTTTATAATCACCGTCATGGTCTTTGTAGTC AGCGAAACGTGCATGCCA
  • the recombinant plasmid template constructed in Example 3-1 was amplified by PCR using a P2H2 reverse primer (SEQ ID NO: 14) which is homology to the base sequence downstream of the target pagP gene while containing ap ⁇ gP-FLAG-Cm cassette DNA region. Then, the PCR amplification product was purified and inserted into the Sakai-DM(pKD46) strain by electroporation, such that homologous recombination was induced in the strain. Thus, the pagP gene in the genome was replaced by the introduced pagPvSLAG-Cm. cassette DNA region using gene targeting.
  • SEQ ID NO: 14 ACACAAATGCTGTGTCGGTTACCAGTACACCAATTGTGGTACCMTMrG ⁇ r ⁇ rCCrCCrTMG 1
  • the lipid A portion was extracted from the mutant labeled with P-32 radioisotope, and spotted onto a TLC plate, which was then developed.
  • FIG. 9 shows the chemical structure of the lipid A spot on TLC.
  • FIG. 10 shows the topology prediction of secondary structure of the PagP::FLAG fusion protein which is expressed in the outer membrane of the Sakai-DM/ ⁇ gP-FLAG mutant constructed according to the embodiment of the present invention.
  • foreign epitope FLAG sequence was fused with the loop-1 portion of PagP in agreement with the reading-frame, and thus the foreign epitope to be introduced could be tagged to outer membrane vesicles, such that it protrudes into the extracellular milieu.
  • fusion protein PagP::FLAG In order to examine whether the fusion protein PagP::FLAG is expressed and detected in the Sakai-DM-derived mutant in which the FLAG epitope as a foreign epitope has been introduced into the outer membrane protein PagP, monoclonal antibody (Sigma) against the FLAG epitope was purchased, and the detection of the foreign epitope was attempted by Western blot using the antibody.
  • monoclonal antibody Sigma
  • outer membrane fractions were collected from each of the Sakai-DM strain and the Sakai-DM//? ⁇ gP::FLAG mutant, the expression of the fusion protein in the fractions was examined, and then the expression of the fusion protein in the outer membrane vesicle was also examined.
  • each of the strains was cultured, and the strain cells were collected, washed once with PBS and completely disrupted with a French press.
  • the disrupted lysate was centrifuged to remove cell debris, and then the supernatant was subjected to ultracentrifugation, thus separating into supernatant containing soluble cytoplasmic proteins and an insoluble precipitate (total membrane protein) consisting of disrupted membrane pieces.
  • a mixture of inner and outer membrane fractions of bacteria was mixed with 1% N- laurylsarcosine solution at a ratio of 1 : 1 and left to stand at room temperature for 30 minutes, and then centrifuged to separate the inner membrane proteins soluble in N-laurylsarcosine (detergent) from the outer membrane proteins insoluble in N- laurylsarcosine.
  • the content of proteins in outer membrane protein-rich fraction was quantified using the BCA kit (PIERCE), and the fraction was subjected to electrophoresis on 14% SDS-PAGE gel, followed by Western blot using anti-FLAG monoclonal antibody.
  • the presence of the PagP::FLAG fusion protein could not be detected in the outer membrane protein fraction of the mutant. This is believed to be because the PagP::FLAG fusion protein was contained in the outer membrane fraction of the mutant in an amount lower than the limit detectable by Western blot. This presumption is based on the fact that the PagP protein was not detected when it was not overexpressed, because the expression of PagP in E. coli was extremely low, and that there was no problem in the test procedure, as confirmed in Example 4 below.
  • a recombinant DNA comprising an ompA : :FL AG-Cm cassette was constructed.
  • the ompA gene was cloned into a pBlueScript SK-II vector, and a pKD3 -derived Cm-cassette was inserted next to the ompA gene of the same plasmid.
  • a 350-bp DNA fragment which is homology to the base sequence downstream of the ompA gene was linked to the Cm-cassette so as to easily induce homologous recombination, thus constructing a recombinant plasmid.
  • the recombinant plasmid DNA was used as a template for PCR-based site-directed mutagenesis.
  • the FLAG epitope amino acid sequence (D YKDHDGD YKDHDDD) was linked to the amino acid sequence of OmpA to be fused, and then subjected to the first PCR using a 78-b ⁇ kinated mutagenic reverse primer (SEQ ID NO: 15) having a DNA base sequence comprising a stop codon for translation termination.
  • SEQ ID NO: 15 78-b ⁇ kinated mutagenic reverse primer having a DNA base sequence comprising a stop codon for translation termination.
  • the resulting PCR product was used as a megaprimer for the second PCR, thus preparing a DNA fragment having a mutation introduced into a specific DNA sequence thereof.
  • SEQ ID NO: 15 GAGCCGGAGTCACTAATCGTCATCATGATCTTTATAATCACCGTCATGGTC TTTGTAGTCTTCGCCCTGACCGAAACG
  • FLAG sequence was fused to the carboxyl terminal(C-terminal) periplasmic domain (next to amino acid residue 174) linked to the ⁇ -barrel domain (amino acid residues 1-170 of mature OmpA) which transverse the outer membrane eight times when folded correctly, whereby OmpA::FLAG tagging was attempted such that the C-terminal end of OmpA was truncated by fusion with FLAG tag.
  • the FLAG sequence (D YKDHDGD YKDHDDD: GACTACAAAGACCATGACGGTGATTATAAAGATCATGATGACGAT) was sequentially linked to six amino acid residues (RFGQGE: CGTTTCGGTCAGGGCGAA; amino acid residues 169 to 174) constituting OmpA present in the outer membrane, and then a 15-bp nucleotide (TAGTGACTCCGGCTC) containing a stop codon (TAG-TGA) corresponding to amino acid residue 175 region of the OmpA (SEQ ID NO: 15).
  • PCR-based site- directed mutagenesis was performed using a 78-bp mutagenic reverse primer (SEQ ID NO: 15) constructed such that the C-terminal end of OmpA was truncated.
  • SEQ ID NO: 15 78-bp mutagenic reverse primer constructed such that the C-terminal end of OmpA was truncated.
  • the OmpA::FLAG fusion protein having the FLAG epitope consisting of 15 amino acid residues linked to the sequence of amino acid residues 1-174 comprising the beta-barrel domain of the amino acid sequence of the OmpA protein present in the outer membrane, was synthesized.
  • the foreign FLAG epitope is linked to the beta-barrel domain of OmpA and located in the periplasmic space. Therefore, when outer membrane vesicles produced from the mutant having this fusion protein expressed in the outer membrane were isolated, the introduced foreign epitope was spontaneously contained in the lumen of the outer membrane vesicles (see FIG. 12).
  • a DNA fragment consisting of ompA::FLAG-Cm cassette was amplified by PCR using the ompA:: ⁇ LAG recombinant plasmid constructed in Example 4-1, as a template, and the PCR product was purified, and then inserted into the Sakai- DM(pKD46) strain by electroporation, whereby homologous recombination was induced in the strain, such that the introduced ompA'.iFL, AG-Cm cassette targets the ompA gene in the genome.
  • the mutation site of the resulting Cm-resistant colonies was amplified by PCR, and whether the size of the PCR product was increased as expected was examined. Also, it was confirmed by DNA sequencing that the ompAr.FLAG fusion was achieved in agreement with the reading frame. 4-3: Analysis of phenotvpe of Sakai-DM/o/m4::FLAG mutant
  • the outer membrane fraction and the outer membrane vesicles were isolated in the same manner as in Example 3. Because the OmpA protein is a typical protein which is abundant in the outer membrane, it was predicted that the OmpA::FLAG fusion protein would also be abundantly present in the outer membrane of the mutant.
  • the mutant was cultured, the outer membrane fraction and the outer membrane vesicles were isolated from the culture broth, and then the proteins thereof were applied to SDS-PAGE gels and subjected to Western blot analysis using anti-FLAG monoclonal antibody. As a result, a specific band having a molecular weight of about 22 kDa corresponding to the OmpA::FLAG fusion protein in the outer membrane fraction and the outer membrane vesicles (FIG. 11), could be detected.
  • the outer membrane vesicles (OMVs) produced from the recombinant G(-) bacteria according to the present invention are safe, because they contain modified LPS whose endotoxicity is sufficiently reduced. Also, the outer membrane vesicles have the ability to deliver multivalent epitopes and contain agonists stimulating Toll-like receptors. Accordingly, the outer membrane vesicles show self-adjuvanticity without addition of exogenous adjuvants, and thus are useful as noble bio-nano particulate vaccines.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to recombinant gram-negative (G(-)) bacteria producing outer membrane vesicles and a method for preparing outer membrane vesicles tagged with multivalent epitopes using the recombinant bacteria. Outer membrane vesicles (OVMs) produced from the inventive recombinant G(-) bacteria are safer than outer membrane vesicles produced from wild-type bacteria and, at the same time, have the ability to deliver multivalent epitopes, and self- adjuvanticity. Thus, the inventive outer membrane vesicles produced from the recombinant G(-) bacteria are useful as noble bio-nano particulate vaccines.

Description

Recombinant Gram-negative Bacteria Producing Outer Membrane
Vesicles and Method for Preparing Outer Membrane Vesicles
Tagged with Foreign Epitopes Using the Same
TECHNICAL FIELD
The present invention relates to recombinant gram-negative (G(-)) bacteria producing outer membrane vesicles and a method for preparing outer membrane vesicles tagged with multivalent epitopes using the recombinant bacteria, and more particularly to recombinant gram-negative G(-) bacteria producing outer membrane vesicles which are safe due to reduced endotoxicity and, at the same time, can deliver multivalent epitopes and induce adjuvanticity, and to a method for preparing outer membrane vesicles tagged with multivalent epitopes using the recombinant bacteria.
BACKGROUND ART
Conventional vaccines against infectious diseases are roughly classified into killed vaccines obtained by killing infection-causing bacteria and live-attenuated vaccines obtained by attenuating virulence in bacteria. This classification is made according to differential induction of immune responses to defend a host against pathogens depending on infection of the host with the pathogens and replication pattern of the pathogens. Thus, for vaccines against infectious diseases caused by intracellular pathogens, live-attenuated vaccines or DNA vaccines that promote the induction of effective cell-mediated immunity are developed, and for defense against pathogens which replicate outside host cells, since induction of humoral immunity by antibodies that are secreted in body fluids is necessary, killed vaccines comprising killed bacteria or subunit vaccines prepared by extracting only major cell surface antigens from bacteria, are generally developed.
However, in the development of such vaccines, problems associated with efficacy and safety always act as obstacles. A typical problem is a safety concern that always arises in the development of live-attenuated vaccines. Live-attenuated vaccine candidates are living pathogens, even though their virulence was attenuated. Thus, there is a risk that living bacteria used as vaccine strains upon in vivo vaccination replicate and are activated, thus causing symptoms similar to those of natural infections. For this reason, even though live-attenuated vaccines can effectively stimulate cell-mediated immunity, it is difficult to develop and obtain marketing authorization approval due to safety concerns. Thus, there is a great need to develop non-replicating acellular vaccines which eliminate side effects caused by live-attenuated vaccine strains while showing the effects of inducing cell- mediated immunity similar to those of live-attenuated vaccines. Moreover, killed vaccines or subunit vaccines are also non-replicating acellular vaccines, but they are effective in inducing humoral immunity, and thus are not considered in diseases in which induction of cell-mediated immunity is required. In addition, because killed vaccines are comprised of killed whole bacteria, they comprise many kinds of intracellular proteins in addition to cell surface antigens effective in defending against infection, and thus can cause side effects such as induction of autoimmune responses. Subunit vaccines usually contain only one kind of antigen and have weak immunogenicity, and it is difficult to induce cell-mediated immune responses by the subunit vaccines. To overcome such drawbacks, expensive adjuvants must be added thereto, thus causing disadvantages in terms of cost.
One of the next generation acellular vaccine candidates which overcome the drawbacks of such non-replicating acellular vaccines is outer membrane vesicles (OMVs). Even though outer membrane vesicles (OMVs) are bio-nanoparticles which can receive attention as next-generation vaccines, vaccines which employ outer membrane vesicles (OMVs) have not yet been commercialized worldwide, and only those produced from specific bacteria are now in clinical trials (efficacy and safety tests). The reason is because several bottlenecks to be overcome in producing and developing outer membrane vesicles (OMVs) as vaccines still remain, and the bottlenecks to be overcome can be explained in four categories. First, endotoxicity caused by lipopolysaccharide (LPS) contained in outer membrane vesicles (OMVs) must be reduced. Second, the amount of OMVs secreted from the outer membrane of bacteria in small amounts must be sufficiently increased. Third, if recombinant outer membrane vesicles (OMVs), which have introduced thereinto selective foreign antigens for displaying multivalent antigenicity or express the foreign antigens therein, can be prepared, they will have the efficacy of mixed vaccines, because several heterogeneous antigens are contained in one outer membrane vesicle (OMV). Fourth, if outer membrane vesicles, endotoxicity of which has been removed, are isolated and newly reconstituted by inserting heterogeneous antigen or adjuvants into the lumen of the outer membrane vesicles or binding adjuvants to the surface of the outer membrane vesicles, various foreign antigens can be loaded onto one outer membrane vesicle (OMV) and delivered to the immune system, and in addition, induction of effective cell-mediated immunity or humoral immunity can be achieved depending on replication patterns of a pathogen to be prevented(intracellular or extracellular). For example, since outer membrane vesicles (OMVs) can be reconstituted using a technology of embedding a ThI adjuvant for inducing cell-mediated immunity into the outer membrane vesicles, the outer membrane vesicle (OMV) vaccines thus reconstituted will become ideal vaccines having necessary and sufficient conditions for next-generation vaccines.
According to a brief analysis of worldwide trends in production and use of outer membrane vesicles (OMVs) to date, international patents relating to methods of isolating naturally occurring OMVs, methods of isolating various kinds of naturally occurring OMVs and combining them, or methods of combining isolated OMVs with artificially synthesized liposome to produce hybrids (liposome + MV) and the use thereof, have been granted. Also, vaccines developed using OMVs produced naturally from Neisseria meningitidis are currently in clinical efficacy trials for marketing approval, but safe and effective OMV vaccines prepared from gram- negative bacteria other than Neisseria meningitidis using a combination of advanced technologies overcoming the above-described four bottlenecks, have not yet been developed.
Meanwhile, Korean Patent Publication No. 2002-7001441 and US Patent Publication No. 20060216307 disclose an outer membrane vesicle (OMV) vaccine containing LPS, exdotoxicity of which was reduced by producing a mutant with a deletion of msbB (ipxM) or htrB (IpxL) gene of N. meningitidis to modify the structure of lipid A. However, the development of such OMV vaccines is limited to N. meningitidis from which a significant amount of OMVs were naturally produced and secreted.
Also, common gram-negative bacteria such as E. coli or Salmonella, which cause intestinal tract infections, secrete a very small amount of naturally occurring OMVs unlike N. meningitidis, and for this reason, the production of OMVs from these bacteria needs to be sufficiently increased in order to produce these OVMs for vaccines. Moreover, in the case of E. coli or Salmonella, there is a problem in that OMVs having penta-acyl lipid A cannot be produced only by msbB or IpxL mutation by which the lipid A structure of LPS is modified as disclosed in the above-described patent document.
Accordingly, the present inventors have made extensive efforts to solve the above- described problems and, as a result, have found that, when the pagP gene together with the msbB gene is deleted from such /?αgP-carrying G(-) bacteria, only low endotoxic penta-acylated lipid A of LPS present in the OMVs can be produced, and when the degP gene is additionally deleted from the bacteria, the ability of the bacteria to produce OMVs can be increased, and in addition, when a specific foreign epitope is expressed as a fusion with an outer membrane protein of G(-) bacteria or when either a synthetic peptide acting as a foreign epitope or a DNA fragment encoding the synthetic peptide is loaded into the lumen of the OMVs isolated from G(-) bacteria, outer membrane vesicles (OMVs) having multivalent antigenicity can be prepared, thereby completing the present invention.
SUMMARY OF INVENTION
It is, therefore, an object of the present invention to provide recombinant G(-) bacteria secreting outer membrane vesicles (OMVs) which are safe and, at the same time, can deliver multivalent epitopes and induce adjuvanticity, and a preparation method thereof.
Another object of the present invention is to provide a method for preparing outer membrane vesicles which are safe and, at the same time, can deliver multivalent epitopes and induce adjuvanticity.
Still another object of the present invention is to provide a method for reconstituting outer membrane vesicles (OMVs), which comprises labeling the surface of OMV as a vaccine candidate, prepared by a combination of the above- described technologies, with a fluorophore, such that the processes of cellular entry, intracellular trafficking, degradation, and bio-distribution of such OMVs as an antigen carrier in vivo can be monitored by an in vivo imaging system.
To achieve the above object, the present invention provides a method for preparing recombinant G(-) bacteria capable of expressing a foreign epitope in fusion with an outer membrane protein, the method comprising the steps of: (a) constructing a G(- ) bacterial mutant by deleting a gene, which is involved in lipid A biosynthesis of lipopoly saccharide (LPS) present in outer membrane vesicles (OMVs), from G(-) bacteria having the ability to produce outer membrane vesicles; (b) constructing a recombinant gene such that a foreign epitope is expressed in fusion with an outer membrane protein of the G(-) bacteria; and (c) introducing the recombinant gene, constructed in the step (b), into the G(-) bacterial mutant, constructed in the step (a).
The present invention also provides recombinant G(-) bacteria prepared by said method, which have a deletion of a gene involved in lipid A biosynthesis of lipopolysaccharide (LPS), and have a recombinant gene, constructed such that a foreign epitope is expressed in fusion with an outer membrane protein of G(-) bacteria, introduced there into.
The present invention also provides a method for preparing recombinant outer membrane vesicles (OMVs) tagged with a foreign epitope, the method comprising culturing said recombinant G(-) bacteria to express a foreign epitope in fusion with an outer membrane protein.
The present invention also provides a method for preparing recombinant engineered outer membrane vesicles (OMVs), the method comprising the steps of: (a) constructing a G(-) bacterial mutant by deleting a gene, which is involved in lipid A biosynthesis of lipopolysaccharide (LPS) present in outer membrane vesicles (OMVs), from G(-) bacteria having the ability to produce outer membrane vesicles; (b) collecting the outer membrane vesicles (OMVs) secreted from the G(-) bacterial mutant; and (c) inserting either a synthetic peptide acting as a foreign epitope or a DNA fragment encoding the synthetic peptide into the lumen of the outer membrane vesicles (OMVs) collected in the step (b).
The present invention also provides a method for reconstituting recombinant engineered outer membrane vesicles (OMVs), the method comprising inserting an adjuvant showing an immune stimulating effect into the lumen of the recombinant outer membrane vesicles (OMVs) prepared by said method. The present invention also provides a method for reconstituting recombinant outer membrane vesicles (OMVs), the method comprising chemically coupling (a) an antigenic substance consisting of protein or carbohydrate or (b) a fluorescent dye to KDO (S-deoxy-D-mαnno-oct-l-ulosonic acid) of lipopolysaccharide (LPS) present in the recombinant outer membrane vesicles prepared by said method.
Other features and aspects of the present invention will be apparent from the following detailed description and the appended claims.
BRIEF DESCRIPTION OF DRAWINGS
FIG. 1 shows that outer membrane vesicles are formed by the G(-) bacteria producing outer membrane vesicles described in the present invention, and are released from the outer membrane. FIG. 1 also shows a basic production platform of constructing mutants according to embodiments disclosed in the present invention and producing outer membrane vesicles having multivalent antigenicity, in which endotoxicity of LPS has been reduced.
FIG. 2 is a schematic diagram showing methods used to construct a mutant (Sakai ΔmsbBl/ΔmsbB2 mutant) according to an embodiment of the present invention and shows a basic system of selectively deleting or inactivating a target gene on the chromosome in G(-) bacteria.
FIG. 3 is a photograph showing the electrophoresis results of PCR products obtained by PCR performed to examine a gene mutation in the msbB genes of a Sakai AmsbBl/AmsbB2 mutant constructed according to an embodiment of the present invention (lanes M: size marker, 1 : intact msbBl, 2: AmsbBl, 3: intact msbB2, and 4: ΔmsbB2).
FIG. 4 is a photograph showing the results obtained by isolating LPS from mutants (Sakai-Ml and Sakai-DM) according to an embodiment of the present invention, migrating the LPS according to molecular weight by SDS-PAGE, and then silver staining the LPS (WT: wild type Sakai, Ml: Sakai-Ml, and DM: Sakai-DM).
FIG. 5 is a photograph showing the results obtained by isolating lipid A labeled with [ P] from mutants (Sakai-Ml and Sakai-DM) according to an embodiment of the present invention, and then performing TLC in order to examine the acylation of the lipid A (lanes 1 : wild type Sakai, 2: Sakai-Ml, 3: and Sakai-DM).
FIG. 6 is a set of transmission electron microscope (TEM) photographs showing the results of observation of outer membrane vesicles (OMVs) produced from mutants constructed according to an embodiment of the present invention after the culture of the mutants (panel A: electron microscope photographs showing the observation result after collecting outer membrane vesicles released into the culture supernatant after culture of bacterial cells; and panel B: electron microscope photographs showing the observation result after fixing outer membrane vesicles released from the outer membrane of bacterial cells).
FIG. 7 is a schematic diagram showing the strategy for constructing a recombinant DNA such that a foreign antigen disclosed in an embodiment of the present invention is expressed in fusion with an outer membrane protein of G(-) bacteria, and constructing a mutant into which the recombinant DNA is introduced.
FIG. 8 is a TLC chromatogram showing the acylation of lipid A of mutants constructed according to an embodiment of the present invention (lanes 1 : wild type Sakai, 2: Sakai-Ml (msbBl), 3: Sakή-M2(msbB2), 4: Sakai-DM//?αg/>::FLAG, and 5: Sakai-DM).
FIG. 9 shows a chemical structure corresponding to the lipid A spot detected on the TLC plate ofFIG. 8. FIG. 10 shows the topology prediction of secondary structure of a PagP::FLAG fusion protein expressed in the outer membrane of a Sakai-DM//?αgP::FLAG mutant constructed according to an embodiment of the present invention.
FIG. 11 is a photograph showing the results of Western blot performed to examine the expression of OmpA::FLAG in a Sakai-DM/ømp4::FLAG mutant constructed according to an embodiment of the present invention.
FIG. 12 shows the topology prediction of secondary structure of an OmpA::FLAG protein according to an embodiment of the present invention in the outer membrane of a mutant.
DETAILED DESCRIPTION OF THE INVENTION, AND PREFERRED EMBODIMENTS
In one aspect, the present invention relates to a method for preparing recombinant G(-) bacteria capable of expressing an outer membrane protein in fusion with a foreign epitope, the method comprising the steps of: (a) constructing a G(-) bacterial mutant by deleting a gene, which is involved in lipid A biosynthesis of lipopolysaccharide (LPS) contained in outer membrane vesicles (OMVs), from G(- ) bacteria having the ability to produce outer membrane vesicles; (b) constructing a recombinant gene such that a foreign epitope is expressed in fusion with an outer membrane protein of the G(-) bacteria; and (c) introducing the recombinant gene, constructed in the step (b), into the G(-) bacterial mutant, constructed in the step (a).
In the present invention, as shown in FIG. 1, outer membrane vesicles (OMVs) are nanosized membrane vesicles which are spontaneously produced from the outer membrane of G(-) bacteria and secreted in small amounts. Thus, they naturally contain various antigenic components present in the outer membrane. Among such antigenic components, lipopolysaccharide (LPS) has endotoxicity, and for this reason, in order to develop a safe vaccine having no side effect of endotoxicity, the structure of LPS must be modified such that the endotoxicity is sufficiently reduced.
Accordingly, in the present invention, a mutant in which the endotoxicity of LPS has been sufficiently reduced was constructed by deleting a msbB gene involved in lipid A biosynthesis of lipopolysaccharide (LPS), and inactivating a pagP gene to block the formation of palmitated hexa-acyl lipid A occurring due to activation of an outer membrane enzyme PagP in the msbB-deletQά mutant so as to produce only penta-acyl lipid A. In the present invention, the gene involved in lipid A biosynthesis of lipopolysaccharide (LPS) is preferably one or more genes selected from the group consisting oϊ lpxL (htrB), ipxM (msbB) and pagP.
PagP is an enzymatic protein which is not present in N. meningitides, but is located in the outer membrane of E. coli, Shigella spp., Salmonella, etc., and catalyzes the lipid A palmitoylation reaction of incorporating palmitate into a lipid A molecule (Bishop, R.E., MoI. Microbiol, 57:900, 2005). The PagP has very low enzymatic activity in normal strains having hexa-acyl lipid A, but when a msbB (ipxM)- deleted mutant (having penta-acyl lipid A) causing the structural weakness of the outer membrane is constructed, the PagP will be specifically activated in order to compensate for the weakness of the outer membrane structure, and thus the incorporation of palmitate instead of myristate (catalyzed by MsbB) into penta-acyl lipid A (a substrate) will be increased.
If the endotoxicity of LPS is not sufficiently reduced even when the enzymatic genes involved in lipid A synthesis are inactivated, one or more genes selected from the group consisting of ipxXL, ipxF and ipxE, which are involved in lipid A structural modification, can be cloned into an expression vector, and can be introduced and expressed in the recombinant G(-) bacteria. In other words, when a ipxE gene (lipid A-I phosphatase) from Brucella abortus or Helicobacter pylori is cloned into an expression vector, and is expressed in a mutant (msbB'/pagP") constructed in an embodiment of the present invention, in addition to the penta-acyl lipid A background, mono-phosphoryl lipid A (penta- acyl) from which phosphate linked to the C 1 carbon of the proximal glucosamine of the lipid A molecule has additionally been removed can be synthesized, thus completely eliminating endotoxicity.
Among the above genes, msbB is a gene encoding an enzyme involved in incorporating fatty acid myristate into a precursor (lipid IVA) in the final step of lipid A synthesis in the bacterial cytoplasm. Thus, it was reported that LPS produced from a mutant (AmsbB mutant), in which the gene has been inactivated, has very low or no endotoxicity, unlike LPS of the wild-type strain (Raetz, CRH & Whitfield, C., Annu. Rev. Biochem., 71 :635, 2002).
It was already found that the endotoxicity of LPS is attributable to the specific molecular structure of a portion of LPS, called "lipid A", that possesses hexa-acyl chains, having laurate and myristate as an acyl-oxy-acyl form, and bis- phosphorylation in the 1 and 4'-carbon of the glucosamine. Such specific molecular structure of lipid A is an essential element in determining endotoxicity (Alexander, C. & Rietschel, E.T., J. Endotoxin. Res., 7:167, 2001). Therefore, in the case of a lipid A molecule produced from the msbB-deϊeted mutant, since fatty acid myristate is not incorporated there into, and thus a lipid A structure having penta-acyl chains is produced, the modified lipid A structure does not act as an agonist stimulating toll-like receptor 4 (TLR4) that is an innate immunity receptor of humans or animals. However, pathogenic E. coli O157:H7, Shigella spp. and Salmonella do not produce only a penta-acyl lipid A species as a result of inactivation of only the MsbB enzyme, as in the case of N. meningitidis mutants. Thus, in the case of these strains, mutants in which the PagP enzyme is additionally inactivated must be constructed to produce LPS having only penta-acyl lipid A. Because the LPS having such penta-acyl lipid A stimulates TLR4 receptor at a level significantly lower than that of signaling occurring through the binding of normal hexa-acyl lipid A with TLR4-MD2 receptor complex (excessive stimulation of expression of pro-inflammatory cytokines), it can eliminate endotoxic side effects caused by excessive secretion of pro-inflammatory cytokines. What is interesting is that, in the case of penta-acyl lipid A produced by the msbB-delQted mutant, signaling action as a danger signal stimulating the excessive expression of pro-inflammatory cytokines is suppressed, but signaling action as a co-stimulatory signal promoting the expression of B7 molecules of dendritic cells involved in adjuvanticity is maintained as it is. Therefore, penta-acyl lipid A produced by the pathogenic E. coli O157:H7 mutant disclosed in the present invention is a major constituent of OMVs, which greatly reduces endotoxic side effects caused by excessive stimulation of secretion of pro-inflammatory cytokines while maintaining adjuvanticity as it is.
In the present invention, in order to change the acylation state of lipid A from hexa- acylation to penta-acylation, a mutant was constructed by deleting msbB gene together with pagP gene from the pathogenic E. coli O157:H7 strain used as an example. Preferably, the endotoxicity of LPS having penta-acyl lipid A produced by this mutant was reduced sufficiently enough to be safely used as a vaccine.
Furthermore, outer membrane vesicles produced from the mutant {msbB'lpagP' ::FLAG) contain components showing adjuvanticity, and thus might have the effect of increasing vaccine efficacy without separate addition of adjuvants. In addition, in order to increase the structural variability of lipid A contained in outer membrane vesicles, an enzyme (e.g., ipxF, ipxXL or ipxE) involved in the formation of specific lipid A structures in various gram-negative bacteria can be cloned into an expression vector, and one or more genes selected among these genes can be introduced and expressed in the mutant {msbB'lpagP ::FLAG) exemplified in the present invention. For example, when IpxE is cloned and expressed in G(-) bacteria such as Brucella abortus, one phosphate group of lipid A having two phosphate groups attached thereto is detached, and thus a penta-acyl lipid A species having a single phosphate group can be produced. Through the remodeling of lipid A molecular structure, a specific lipid A structure which is safer and shows adjuvanticity can be created, thus making it possible to produce outer membrane vesicles comprising a novel lipid A species having a structure different from that of a lipid A structure produced in the msbB mutant of N. meningitidis disclosed in prior patent documents.
As used herein, the term "deletion" refers to the removal of a genetically coding region of the chromosome. Various methods for removing the function of a specific gene in bacterial cells have been studied, but when a one-step PCR inactivation system (Datsenko KA & Wanner BL, PNAS, 97:6640, 2000), which is recently receiving attention as a relatively simple and efficient method, is used, a desired gene can be easily deleted by the targeted homologous recombination event (FIG. 3).
The method for preparing the recombinant G(-) bacteria preferably additionally comprises a step of deleting a degP gene from the G(-) bacteria mutant constructed in the step (a) in order to increase the size and production of outer membrane vesicles.
DegP acts as a periplasmic chaperone, and in addition, functions as a protease. If misfolded outer membrane proteins are accumulated in the periplasm without being anchored into the outer membrane, DegP shows protease activity for degrading such proteins. Therefore, in a degP gene-deleted mutant, abnormal outer membrane proteins accumulated in the periplasm are not properly removed to interfere with the growth of the bacteria, and thus such proteins are likely to be exported outside the cell by being packaged into the outer membrane vesicles. Accordingly, it is believed that the adaptation of the mutant is made in the direction in which the size or production of outer membrane vesicles are increased.
Deletion of the degP gene can be carried out by the genetic targeting method using homologous recombination.
In the present invention, a typical outer membrane protein can be exemplified by OmpA, which is commonly present in the outer membrane of G(-) bacteria and is abundantly expressed therein, and the three-dimensional atomic structure of which is known. The outer membrane protein OmpA has a three-dimensional structure comprising an eight- stranded β-barrel arranged and folded in the reverse direction, in the same manner as the PagP outer membrane protein. In addition, one or more selected from among other kinds of outer membrane proteins (OmpC, OmpF, OmpX, OmpG, and OmpT) having structural characteristics similar to those of OmpA can be used instead of OmpA as a target for the fusion and expression of foreign epitopes.
Moreover, the foreign epitope which is used in the present invention may be selected from the group consisting of: (a) major protein antigen components of viruses or pathogenic microorganisms causing various infectious diseases in humans or animals; (b) specific cell surface markers which are expressed in immune cells (e.g., dendritic cells) or cancer cells; and (c) ligands binding to specific receptors present on the surface of immune cells or cancer cells. In an embodiment of the present invention, FLAG, the expression of which can be easily detected, was used as a foreign epitope, and when actually developing OMV vaccines, an antigen of a pathogen to be prevented, such as an E7 epitope of oncogenic human papillomaviruses, may be contained in outer membrane vesicles by fusing it with the outer membrane protein. In an embodiment of the present invention, in order to introduce a foreign epitope into outer membrane vesicles, a recombinant DNA was constructed such that a FLAG sequence as a foreign epitope was fused with an OmpA protein gene. The DNA fragment was introduced into the mutant {msbB'lpagP') to induce homologous recombination with the original ompA gene, thus constructing a mutant having ompAwFLAG. In the outer membrane of the ompA::¥LAG mutant, a foreign epitope (FLAG) is abundantly expressed in fusion with OmpA. Thus, outer membrane vesicles which are produced by the recombinant G(-) bacterial mutant are characterized in that they spontaneously contain the FLAG foreign epitope.
In the present invention, preferably the recombinant gene is constructed such that a foreign epitope to be introduced is expressed as a fusion with the extracellular loop of the three-dimensional structure (beta (β)-barrel structure) of the outer membrane protein, or localized in the periplasm.
Thus, when a foreign epitope is expressed in fusion with an outer membrane protein as described above, outer membrane vesicles released from the outer membrane of the mutant spontaneously contain the foreign epitope, and thus can be used as a platform technology for developing multivalent epitope vaccines.
In the present invention, the G(-) bacteria are gram-negative bacteria having apagP gene or pagP orthologs, and examples thereof include Escherichia spp., Salmonella spp., Klebsiella pneumoniae, Yersinia spp., Legionella pneumophila, Bordetella spp., Shigella spp. and the like. It is preferable to use Escherichia spp., the structure and function of LPS of which were studied more than those of other bacterial strains.
Said Escherichia spp. can be exemplified by a serotype O157:H7 strain which has pathogenicity and contains two msbB genes in the genome. The E. coli O157:H7 strain specifically has two msbB genes in the same manner as Shigella spp. causing bacterial dysentery, which includes msbBl in the chromosome and msbB2 in the plasmid (pO157) (Kim SH et al, Infect Immun., 72: 117 r4, 2004).
In another aspect, the present invention relates to recombinant G(-) bacteria prepared by said method, which have a deletion of a gene involved in lipid A biosynthesis of LPS, and have a recombinant gene constructed such that a foreign epitope is expressed in fusion with an outer membrane protein of G(-) bacteria, introduced thereinto.
The genes involved in lipid A biosynthesis, the outer membrane protein, the foreign epitope, the G(-) bacteria and the like are the same as mentioned above. Also, the recombinant G(-) bacteria preferably additionally have one or more genes selected from the group consisting of ipxXL, ipxF and ipxE which are involved in the structural modification of lipid A, cloned and expressed therein. Furthermore, the recombinant G(-) bacteria preferably have a degP gene additionally deleted in order to increase the size and production of outer membrane vesicles.
In still another aspect, the present invention relates to a method for preparing outer membrane vesicles (OMVs) tagged with a foreign epitope, the method comprising culturing said recombinant G(-) bacteria to express a foreign epitope in fusion with an outer membrane protein.
The outer membrane vesicle (OMV) produced by the recombinant G(-) bacterial mutant according to the present invention is an antigen carrier which is safe due to low endotoxicity, can deliver various foreign epitopes and has self-adjuvanticity. Also, the outer membrane vesicle (OMV) produced in the present invention is a nanoscale membrane vesicle (average size of about 70 ~ 100 nm in diameter) similar to that of a common viral particle and has properties similar to those of an artificially synthesized liposome. Thus, it can be used as a vehicle that is noteworthy in the bio-nano-engineering fields.
In yet still another aspect, the present invention relates to a method for preparing recombinant outer membrane vesicles (OMVs), the method comprising the steps of: (a) constructing a G(-) bacterial mutant by deleting a gene, which is involved in lipid A biosynthesis of LPS contained in outer membrane vesicles (OMVs), from
G(-) bacteria having the ability to produce outer membrane vesicles; (b) collecting the outer membrane vesicles (OMVs) secreted from the G(-) bacterial mutant; and (c) inserting either a synthetic peptide acting as a foreign epitope or a DNA fragment encoding the synthetic peptide into the lumen of the outer membrane vesicles (OMVs) collected in the step (b).
In the method for preparing the recombinant outer membrane vesicle (OMV) according to the present invention, the gene involved in lipid A biosynthesis of liposaccharide (LPS), the outer membrane protein, the foreign epitope, the G(-) bacteria and the like are the same as mentioned above. Also, the recombinant G(-
) bacteria preferably additionally have one or more genes selected from the group consisting of ipxXL, ipxF and ipxE which are involved in the structural modification of lipid A, cloned and expressed therein. In addition, the recombinant G(-) bacteria have a degP gene additionally deleted in order to increase the size and production of the outer membrane vesicle.
In the present invention, the outer membrane vesicle (OMV) prepared according to the above method can induce innate immunity through TLR4 and TLR2 due to pathogen-associated molecular pattern (PAMP)s such as LPS and lipoprotein which are the major constituents thereof. Thus, when a foreign epitope is incorporated into OMV according to the method disclosed in the present invention, and used as a vaccine, it is physically linked to PAMP, the constituent of OMV, so that an immune response to the incorporated foreign epitope can be enhanced due to the self-adjuvanticity of the outer membrane vesicle without adding a separate adjuvant. The reason is because the major components of the outer membrane vesicles acting as TLR agonists are linked to the incorporated foreign epitope, and easily engulfed by antigen-presenting cells (APCs). The APCs (e.g., dendritic cells) activated by uptaking the outer membrane vesicles can closely contact with helper T cells (Th cells), and strongly transmit information on the epitopes to the Th cells at high rates. This is because co-stimulatory molecules can be expressed on the surface of the antigen-presenting cells by TLR stimulation to transmit strong signals.
In yet still another aspect, the present invention relates to a method for reconstituting outer membrane vesicles (OMVs), the method comprising inserting an adjuvant showing an immune stimulating effects into the lumen of the engineered recombinant outer membrane vesicles (OMVs) prepared by said preparation method. For example, a CpG DNA (nucleotide sequence) fragment, which acts as a ThI -adjuvant for inducing cell-mediated immunity and has no methyl group attached thereto, can be loaded into the lumen of OMV and used as a vaccine for the induction of cell-mediated immunity like the case of a vaccine against viral infection.
In yet still another aspect, the present invention relates to a method for reconstituting outer membrane vesicles (OMVs), the method comprising chemically coupling (a) an antigenic substance consisting of protein or carbohydrate or (b) a fluorescent dye to KDO (3-deoxy-D-mα/wø-oct-2-ulosonic acid) of LPS contained in the recombinant outer membrane vesicles prepared by said preparation method.
Examples of the antigenic substance consisting of protein or carbohydrate include malaria merozoite surface protein (MSP), human papillomavirus oncogenic proteins (E6 or El), tumor-associated mucin glycopeptide (MUCl), blood group- related carbohydrate antigen Lewisy (Ley) and the like, and examples of the fluoresent dyes include fluorescein, rhodamine, Texas Red, Cy3, Cy5.5 and the like.
"When the recombinant outer membrane vesicle (OMV) having a fluoresent dyes chemically coupled thereto is used, a process, in which the outer membrane vesicles are taken up by dendritic cells in vivo and the epitopes are delivered, can be observed by conventional fluorescent microscopy and in vivo imaging apparatus.
In the method for reconstituting the outer membrane vesicle (OMV) according to the present invention, 3-deoxy-D-mα««ø-oct-2-ulosonic acid (KDO) which is a specific sugar present commonly in almost all LPS molecules is preferably used.
Because the KDO sugar has highly reactive carboxyl acid residue (COOH group) and possess aldehyde group, a foreign epitope consisting of protein or carbohydrate or a fluorescent dyes linked to a suitable cross-linker can be coupled to the KDO sugar by a chemical coupling method using the reactive residues.
Chemical coupling methods using such residues were reported in several scientific papers (Verheul et al., Infect. Immun., 59:843, 1991). Namely, because the KDO sugar is commonly present in LPS which is the major constituent of OMV, cystamine (NH2-(CH2VS-S-(CH2VNH2) is allowed to react with OMV to cause a condensation reaction, like when a carboxylic group present in the KDO and an amino group (NH2 group) present in cystamine form a peptide bond, whereby a thiol (SH) group contained in cystamine can be incorporated into the LPS of OMV. Also, a foreign epitope (protein) to be coupled to OMV is allowed to react with N- succinimidyl bromoacetate (Br-CO-CH2-O-NHS) such that a spontaneous chemical coupling reaction occurs, thus producing a conjugate of protein (foreign epitope)- [NH-CO-CH2-Br]. When such a foreign epitope containing a bromoacetyl group is coupled to an OMV having a thiol group added thereto, the thiol group added to KDO of LPS of the OMV is chemically coupled to the bromoacetyl group of the foreign epitope, thereby creating a conjugate of the OMV and the foreign epitope, which were linked by a stable thioether bond.
Examples
Hereinafter, the present invention will be described in further detail with reference to examples. It is to be understood, however, that these examples are for illustrative purposes and are not to be construed to limit the scope of the present invention, because these examples can be modified into other various forms.
Example 1 : Construction of msbB (ipxM) mutant of pathogenic E. coli O157:H7 Sakai strain (hereinafter referred to as Sakai) and analysis of the mutant phenotvpe
Because Sakai strain (KCTC 11344BP) has two msbB genes, the msbB genes present in the chromosome (msbB J) and the plasmid (msbB2), respectively, must be inactivated in order to prepare a completely inactivated mutant of MsbB enzyme. For this purpose, a mutant in which msbBl and msbB2 have been inactivated was prepared according to the strategy shown in FIG. 2.
1-1: Construction of single msbBl gene-deleted mutant (ΔmsbBl mutant)
In order to delete the msbBl gene from the chromosome, PCR was performed using ρKD3 (SEQ ID NO: 3, GenBank accession no. AY048742, 2804 bp sequence) as a template and an Ml-Fw primer (SEQ ID NO: 1) and an Mi-Rev primer (SEQ ID NO: 2), thus preparing a PCR product containing a chloramphenicol resistance gene cassette (Cm-cassette) present in the pKD3 plasmid. In the PCR, pKD3 was used as a template DNA, each of Ml-Fw and Mi-Rev primers was added to PCR reaction mixture at a concentration of 30 pico mole, and then AccuPrime Taq DNA polymerase (Invitrogen) and a reaction buffer added to a kit were added thereto. Using the PCR reaction mixture, PCR reaction was performed for 32 cycles, each consisting of denaturation at 94 °C for 1 min, annealing at 57 °C for 30 seconds, and extension at 70 °C for 1 min.
SEQ ID NO: 1 : TGTCGCTCTGCTTTCCAGAACGTAGTGAAGCTGAACGCGAGfGraGGCTGG^GCrGCTTCG SEQ ID NO: 2: TCTCGACTTCTTCATTCATCCGCCGCGCAATCGTATGATCC^K4TO/(^K4rCCrCC2T4G
Then, the PCR product was purified, and then electroporation was carried out in order to introduce the PCR product into a transformed Sakai strain containing pKD46 plasmid. For electroporation, the Sakai strain was cultured, and then the bacterial cells were washed with cold 10% glycerol solution to make electro- competent cells. The cells were added to l//g of pKD46 plasmid, allowed to stand on ice for 10 minutes, transferred into an electroporation cuvette and electroporated using a GenePulser Xcell (BioRad) at 2.5 kV and 200 Ω, thus transforming the Sakai strain.
Because the plasmid pKD46 present in Sakai(pKD46) bacteria contains Red recombinase enzyme serving for recombination of homologous DNA fragments, between the msbBl gene present in the chromosome and the introduced targeting DNA fragment, thus preparing a Cm-resistant mutant.
Because such gene targeting occurs by homologous recombination, mutation does not occur at sites other than the homologous region (msbBl) in the genome of the Sakai strain. Thus, if a specific gene was to be artificially mutated, a DNA fragment homologous to the gene was constructed (in the case of the msbBl gene, it was constructed as shown in FIG. 2 such that the middle portion of the DNA sequence thereof was deleted and a DNA fragment containing a Cm-cassette derived from pKD3 was created). When the constructed DNA fragment was delivered into the strain, the target gene was replaced with the introduced DNA fragment, and the msbBl gene mutant formed colonies on an LB-Cm plate. Such Cm-resistant colonies were isolated in pure state, and whether the targeted portion of the msbBl gene has been mutated as intended was confirmed by PCR. Specifically, the genomic DNA of the mutant was isolated, primers flanking the mutation site were prepared, and the size of a DNA product amplified by PCR using the primers was analyzed (confirmed the predicted increase in size). Then, the Cm-cassette inserted into the genome was excised to remove a Cm-resistant marker. For this purpose, the mutant was cultured at a high temperature of 41 °C to eliminate the temperature-sensitive pKD46 (AmpR) plasmid, and then a pCP20 (AmpR) plasmid was introduced into the mutant. As a result, because the FRT (FLP recognition target) sequence present in the end of the internal Cm-cassette was recognized by the FLP recombinase present in pCP20, it was suggested that an enzymatic reaction in which the Cm-cassette was excised by FLP occurred. The Sakai AmsbBl mutant, from which the Cm-cassette has been removed was, confirmed again by PCR (confirmed the predicted decrease in size), and the mutant was used as a parental strain for new msbB2-άeleted mutants.
1-2: Construction of mutant with deletion of msbBl and msbB2 genes (AmsbBl / AmsbB2 double mutant)
Because the genome of the Sakai strain has two msbB genes in the chromosome {msbBl) and the plasmid pO157 (msbB2), another msbB2 gene in the AmsbBl mutant constructed according to the above-described method was inactivated to completely remove the enzymatic activity of MsbB in the Sakai strain, thus constructing a mutant from which the enzymatic activity of MsbB has been completely removed. A method for mutating the msbB2 gene located on the plasmid pO157 was carried out using the same strategy as the above method of inducing the deletion of msbBl. A M2-Fw primer (SEQ ID NO: 4) and a M2-Rev primer (SEQ ID NO: 5), each consisting of 40-bp base sequence of msbB2, were constructed in such a way that they have short homologies to the terminal region of the target msbB2 gene. PCR was performed using the pKD3 template and the constructed primers. The resulting PCR product was a DNA fragment for targeting msbB2 gene, which contains a Cm-cassette in the msbB2 gene.
SEQ ID NO: 4: GACGTGGACAGGTATCGGTATTATCTGTGTGTTTGCAATGGrGΩGGCrGG/iGCrGCTTCG SEQ ID NO: 5: TCGCGCAATATGAGCATCACTCTTCTGTCGTATAGCAAGTC4ΩrG^ΩrCCrCC7ΩG
Then, the prepared DNA fragment for targeting msbB2 gene was inserted into the AmsbBl(pKD46) strain through the above-described electroporation method, and homologous recombination was induced, thus preparing a Cm-resistant mutant into which the mutation has been introduced by targeting the msbB2 gene. In order to excise and remove the Cm-cassette inserted into the msbB2 gene, the mutant was cultured at high temperature to eliminate pKD46, and a pCP20 plasmid was introduced into the mutant. As a result, the FRT (FLP recognition target) sequence present in the end of the internal Cm-cassette was recognized by the FLP recombinase present in pCP20, and thus the Cm-cassette was excised by FLP. Also, msbB2 DNA having a length reduced as much as predicted was confirmed by PCR amplification.
In the PCR reaction for confirming the Sakai AmsbBl/AmsbB2 mutant, the genomic DNA isolated from the mutant was used as template DNA, each of a primer set (MsbBl-Fw primer: SEQ ID NO: 6; and MsbB l-Rev primer: SEQ ID NO: 7) for confirming AmsbBl and a primer set (MsbB2-Fw primer: SEQ ID NO: 8; and MsbB2-Rev primer: SEQ ID NO: 9) for confirming AmsbB2 was added thereto at a concentration of 30 pico mole, and AccuPrime Taq DNA polymerase (Invitrogen) and a reaction buffer added to a kit were added thereto. Using the PCR reaction mixture, the PCR reaction was carried out for 32 cycles, each consisting of denaturation at 94 "C for 1 min, annealing at 57 °C for 30 seconds, and extension at 70 °C for 1 min.
SEQ ID NO: 6: TCGCGAATTCCTCGAGCAGGCCAA
SEQ ID NO: 7: CTGAAGCAAGCTTGAACTTATCA
SEQ ID NO: 8: CTCACTGATCTCGAGACTCTTCC SEQ ID NO: 9: GCTGGGTAAGCTTATTATCCTGA As a result, as shown in FIG. 3, when the Sakai AmsbBl/AmsbB2 double mutant (hereinafter referred to as Sakai-DM; KCTC 11346BP) was confirmed by PCR, it could be seen that the mutation of ΔmsbBl and AmsbB2 in the mutant was accurately achieved as expected.
Test Example 1 : Comparison of changes in LPS phenotvpes of mutants
In order to compare the changes in the LPS phenotypes of the Sakai AmsbBl mutant (Sakai-Ml) and AmsbBl I AmsbB2 double mutant (Sakai-DM) constructed in Example 1, LPS was isolated from each of wild type, Sakai-Ml and Sakai-DM, run on 16% SDS-PAGE gel and stained with silver nitrate.
As a result, as shown in FIG. 4, the overall LPS pattern was similar between the three strains, and the wild type Sakai strain and the Sakai-Ml strain produced the same smooth LPS. However, the Sakai-DM strain showed a reduction in molecular weight as much as the molecular weight of a myristate group which did not attached thereto, thus confirming that the LPS band migrated slightly faster on the SDS-PAGE gel than the wild type control.
Test Example 2: Analysis of acylation state of lipid A of LPS
In order to observe the change in the acylation of lipid A of LPS, the phosphate of the lipid A molecule was labeled with radioactive isotope P-32, and only the lipid A portion was isolated from LPS by mild-acid hydrolysis. Then, the pure isolated lipid A was applied on a thin-layer chromatography (TLC) plate, and the changes in the acylation of the lipid A were observed through the migration pattern on TLC according to their relative hydrophobicity.
As a result, as shown in FIG. 5, the attachment of myristate according to the presence or absence of the enzymatic activity of MsbB led to changes in hydrophobicity, and thus a lipid A spot showing a change in the migration pattern on TLC could be observed. In the Sakai wild type (lane 1), typical hexa-acyl lipid A molecules were mainly produced, but the Sakai-DM (lane 3), in which the enzymatic activity of MsbB was completely lost, penta-acyl lipid A molecules mainly produced penta-acyl lipid A molecules with partial production of palmitoylated hexa-acyl lipid A by PagP, thus making it possible to confirm the predicted phenotype of the msb-S-inactivated mutant.
Particularly interestingly, from the lipid A acylation pattern in the Sakai -Ml (lane 2), it could be seen that a significant amount of penta-acyl lipid A was produced due to the deletion mutation of AmsbBL This suggests that, with only msbB2 gene present in the plasmid, enzymatic activity of MsbB converting a penta-acyl lipid A precursor to a hexa-acyl lipid A species by adding myristate thereto is relatively low in the AmsbBl mutant. Through the results of lipid A analysis of the Sakai mutant strains, it could be seen that complete hexa-acylation of lipid A did not occur by the expression of the msbB2 gene alone remained in pO157. Moreover, when considering the intensity of the produced lipid A spot, it could be seen that the MsbB2 exhibited about 70% activity for adding myristate (conversion from a penta-acyl form to a hexa-acyl form) compared to MsbBl. In addition, in the case of the Sakai-DM (lane 3) of FIG. 5, it could be seen that, about 30% of lipid is palmitoylated by PagP, thus producing palmitoylated hexa-acyl lipid A in the bacterial outer membrane.
Example 2: Construction of degP mutant from Sakai O157:H7 strain and its phenotype analysis
In order to increase the production and size of outer membrane vesicles (OMVs) in the Sakai O157:H7 strain, a degP gene was deleted from the strain, and the size and amount of OMVs produced by the mutant were examined. To construct a degP mutant, a target DNA fragment was constructed according to the same strategy as in the construction of the msbB mutant and introduced into each of the Sakai(pKD46) and Sakai-DM(pKD46) strains, a homologous recombinant strain (CmR) was isolated, and whether the mutation has been accurately introduced into the degP gene, was confirmed by PCR. For this purpose, recombinant DNA with a mutation of the degP gene was prepared. Specifically, DNA fragments having a relatively long homology region (longer than 400-bp), which correspond to both ends of the degP gene, were cloned into pUC18, and then a Cm-cassette derived from pKD3 was inserted between the homologous fragments, thus preparing recombinant DNA for degP deletion. The constructed DNA fragment for targeting degP gene was introduced into each of the strains by electroporation to induce homologous recombination, thus preparing Cm-resistant mutants having a degPv.Cm allele. A AdegP::Cm mutant was constructed from each of the Sakai and Sakai-DM strains according to the above method, and the DNA size of PCR products, corresponding to the mutation of the AdegP::Cm gene, was analyzed. PCR for confirming the AdegP::Cm mutant was performed as follows: a genomic DNA derived from each of the mutants was used as a template, each of primers (For-degP primer: SEQ ID NO: 10; Rev-degP primer: SEQ ID NO: 11) was added to a PCR reaction mixture at a concentration of 30 pico mole, and then AccuPrime Taq DNA polymerase® (Invitrogen) and a buffer contained in a kit were added to the reaction mixture. Using the PCR reaction mixture, the PCR reaction was performed for 32 cycles, each consisting of denaturation at 94 °C for 1 min, annealing at 57 °C for 30 sec, and extension at 70 °C for 1 min. SEQ IDNO: 10: TGGGTTCCGGCGTCATCATTGAT SEQ ID NO: 11 : CGATCTGCGCAGCCGGAGTGCC
In order to collect outer membrane vesicles produced from such degP mutants, and observe the collected outer membrane vesicles with an electron microscope, each of the mutants was cultured in 500 ml of LB broth, and then separated into cells and culture supernatant by centrifugation (at 11,00OxG for 30 min). The separated culture supernatant was filtered through a membrane filter having a pore size of 0.2μm to remove the remaining cells and cell debris. Then, in order to collect outer membrane vesicles from the culture supernatant, ammonium sulfate was added to the filtered supernatant, and the outer membrane vesicles were precipitated at 40C overnight. The precipitated outer membrane vesicles were collected by centrifugation (at 11,00OxG for 30 min) and suspended in 20 ml of phosphate-buffered saline (PBS). The suspension was separated into supernatant and precipitate by low-speed centrifugation (at 16,00OxG for 15 min), and the outer membrane vesicles remaining in the supernatant were precipitated by ultra-highspeed centrifugation (at 10O5OOOxG for 2 hr), and the precipitate was suspended in 2 ml distilled water and stored at -20 °C . In order to observe the separated outer membrane vesicles with an electron microscope, the outer membrane vesicle samples were negatively stained with 1% uranyl acetate on a formvar-coated grid and observed.
As a result, as shown in FIG. 6, the degP-άe\eteά mutants (Sakai-degP) showed increases in the amount and size of outer membrane vesicles produced, compared to those of the Sakai strain or the Sakai-DM strain from which degP was not deleted (data not shown). However, in the case of the Sakai-DM/Δcfeg.P::Cm mutant, it was observed that the production rate of outer membrane vesicles was very low and the size thereof was also small (data not shown), and this is believed to be because the outer membrane of the parental strain Sakai-DM was further weakened due to the induction of AdegP::Cm mutation. Therefore, it was found that the outer membrane vesicles produced from the Sakai-DM strain had a relatively uniform size (~70 nm) (FIG. 6 A).
Meanwhile, in order to observe the outer membrane vesicles released from each of the strains, the colony of each of the mutants formed in an agar medium was fixed with a fixation solution containing 2.5% paraformaldehyde-glutaraldehyde, and then with 1% osmium tetroxide. Then, the fixed colonies were dehydrated in ethanol and embedded in Epon-812 resin. The embedded samples were cut with an ultramicrotome and stained with uranyl acetate, and then the outer membrane vesicles released from the mutants were observed with a transmission electron microscope (TEM). As a result, it was confirmed that outer membrane vesicles the same as were released from the outer membrane of the strain cells, the outer membrane vesicles observed using an electron microscope by collecting them from the culture supernatant (FIG. 6B).
Example 3 : Construction of pagP ::FLAG-tagged mutant from Sakai AmsbB 11 AmsbB2 mutant (Sakai-DM) and its phenotype analysis
Because hexa-acyl lipid A from by the enzymatic activity of PagP (lipid A palmitoylation) partially appeared in a lipid A profile of the Sakai AmsbBl/AmsbB2 mutant (Sakai-DM) constructed in Example 1, in order to eliminate such hexa-acyl lipid A and produce predominant penta-acyl lipid A form, a new mutation {pagP: :FLAG) was introduced into Sakai-DM thus constructing a mutant (Sakai- OMlpagPvSLAG) introduced thereinto, from which the enzymatic activity of PagP has been removed having a FLAG sequence as a foreign epitope.
3-1 : Construction of recombinant pagP::FLAG gene
FLAG was selected as the epitope tag for the purpose of introducing a new pagP::¥LAG mutation into Sakai-DM to remove the enzymatic activity of PagP while fusing the foreign epitope to the outer membrane protein of the Sakai-DM to detect the expression thereof. First, a full-length pagP gene was cloned into a pUC18 vector, and a Cm-cassette derived from pKD3 was inserted next to the pagP gene on the same plasmid. The recombinant plasmid was used as template DNA for PCR based site-directed mutagenesis. As a result, as shown in FIG. 7, a 78-bp kinated mutagenic reverse primer (SEQ ID NO: 13) comprising a DNA nucleotide sequence encoding FLAG epitope of 15 amino acids (SEQ ID NO: 12), was constructed. The first PCR was carried out using the primer. SEQ ID NO: 12: DYKDHDGDYKDHDDD
SEQ ID NO: 13: CGGTCGCTCGTTATAATCGTCATCATGATCTTTATAATCACCGTCATGGTCTTTGTAGTC AGCGAAACGTGCATGCCA
It was seen that, in the resulting PCR product (a mega-primer for the second PCR), 8 amino acids (YDKEKTDR) constituting the loop-1 of the folded three- dimensional structure of the PagP protein were removed, and substituted with 15 amino acids FLAG, suggesting that a pagP::¥LAG fusion has been made. Namely, the original sequence of the loop-1 of PagP had an amino acid sequence of WHARFA-(YDKEKTDR)-YNERP, but the eight amino acids (YDKEKTDR) were removed by site-directed mutagenesis in this Example and substituted with the FLAG sequence as a foreign epitope. As a result, a mutation of WHARFA- (DYKDHDGDYKDHDDD)-YNERP could be introduced.
3-2: Construction of/?αgF::FLAG mutant from Sakai-DM (AmsbBllAmsbBD
The recombinant plasmid template constructed in Example 3-1 was amplified by PCR using a P2H2 reverse primer (SEQ ID NO: 14) which is homology to the base sequence downstream of the target pagP gene while containing apαgP-FLAG-Cm cassette DNA region. Then, the PCR amplification product was purified and inserted into the Sakai-DM(pKD46) strain by electroporation, such that homologous recombination was induced in the strain. Thus, the pagP gene in the genome was replaced by the introduced pagPvSLAG-Cm. cassette DNA region using gene targeting.
SEQ ID NO: 14: ACACAAATGCTGTGTCGGTTACCAGTACACCAATTGTGGTACCMTMrG^^r^rCCrCCrTMG1 The region of the resulting Cm-resistant colonies, into which mutation has been introduced, was amplified by PCR to examine whether the size of the PCR product was increased as expected. Also, it was confirmed by DNA sequencing that the pagPyJFL AG fusion was achieved in agreement with the translation frame. In order to analyze changes in the phenotype of the obtained Sakai-OM/pagP::¥LAG mutant, the lipid A portion was extracted from the mutant labeled with P-32 radioisotope, and spotted onto a TLC plate, which was then developed. As a result, it was found that, due to the inactivation of PagP enzyme, partial hexa-acylation of lipid A by palmitoylation did not occur in the Sakai-DM/pαgP-FLAG mutant (FIG. 8).
FIG. 9 shows the chemical structure of the lipid A spot on TLC. FIG. 10 shows the topology prediction of secondary structure of the PagP::FLAG fusion protein which is expressed in the outer membrane of the Sakai-DM/^αgP-FLAG mutant constructed according to the embodiment of the present invention. As can be seen in FIG 10, foreign epitope, FLAG sequence was fused with the loop-1 portion of PagP in agreement with the reading-frame, and thus the foreign epitope to be introduced could be tagged to outer membrane vesicles, such that it protrudes into the extracellular milieu.
3-3: Expression of PagP::FLAG fusion protein in Sakai-DM/pαgP-FLAG mutant
In order to examine whether the fusion protein PagP::FLAG is expressed and detected in the Sakai-DM-derived mutant in which the FLAG epitope as a foreign epitope has been introduced into the outer membrane protein PagP, monoclonal antibody (Sigma) against the FLAG epitope was purchased, and the detection of the foreign epitope was attempted by Western blot using the antibody. First, outer membrane fractions were collected from each of the Sakai-DM strain and the Sakai-DM//?αgP::FLAG mutant, the expression of the fusion protein in the fractions was examined, and then the expression of the fusion protein in the outer membrane vesicle was also examined. Each of the strains was cultured, and the strain cells were collected, washed once with PBS and completely disrupted with a French press. The disrupted lysate was centrifuged to remove cell debris, and then the supernatant was subjected to ultracentrifugation, thus separating into supernatant containing soluble cytoplasmic proteins and an insoluble precipitate (total membrane protein) consisting of disrupted membrane pieces. A mixture of inner and outer membrane fractions of bacteria was mixed with 1% N- laurylsarcosine solution at a ratio of 1 : 1 and left to stand at room temperature for 30 minutes, and then centrifuged to separate the inner membrane proteins soluble in N-laurylsarcosine (detergent) from the outer membrane proteins insoluble in N- laurylsarcosine. The content of proteins in outer membrane protein-rich fraction was quantified using the BCA kit (PIERCE), and the fraction was subjected to electrophoresis on 14% SDS-PAGE gel, followed by Western blot using anti-FLAG monoclonal antibody. As a result, the presence of the PagP::FLAG fusion protein could not be detected in the outer membrane protein fraction of the mutant. This is believed to be because the PagP::FLAG fusion protein was contained in the outer membrane fraction of the mutant in an amount lower than the limit detectable by Western blot. This presumption is based on the fact that the PagP protein was not detected when it was not overexpressed, because the expression of PagP in E. coli was extremely low, and that there was no problem in the test procedure, as confirmed in Example 4 below.
Example 4: Construction of owpJ::FLAG-tagged mutant from Sakai-DM and its phenotype analysis
According to the strategy described in Example 3, in order for the foreign FLAG epitope to be fused and expressed in the outer membrane of Sakai-DM, a new ompAr.FLAG mutant was constructed using the OmpA protein abundant in the outer membrane, as a fusion partner. 4- 1 : Construction of ompA : ;FLAG recombinant gene
In order by introducing a new mutation (ompAyJFLAG) into Sakai-DM to prepare a mutant in which the foreign FLAG epitope is expressed in fusion with the outer membrane protein OmpA which is abundant in the outer membrane by introducing a new mutation (ompAy.FLAG) into Sakai-DM, a recombinant DNA comprising an ompA : :FL AG-Cm cassette was constructed. For this purpose, the ompA gene was cloned into a pBlueScript SK-II vector, and a pKD3 -derived Cm-cassette was inserted next to the ompA gene of the same plasmid. Then, a 350-bp DNA fragment which is homology to the base sequence downstream of the ompA gene was linked to the Cm-cassette so as to easily induce homologous recombination, thus constructing a recombinant plasmid. The recombinant plasmid DNA was used as a template for PCR-based site-directed mutagenesis. As described in Example 3, the FLAG epitope amino acid sequence (D YKDHDGD YKDHDDD) was linked to the amino acid sequence of OmpA to be fused, and then subjected to the first PCR using a 78-bρ kinated mutagenic reverse primer (SEQ ID NO: 15) having a DNA base sequence comprising a stop codon for translation termination. The resulting PCR product was used as a megaprimer for the second PCR, thus preparing a DNA fragment having a mutation introduced into a specific DNA sequence thereof.
SEQ ID NO: 15: GAGCCGGAGTCACTAATCGTCATCATGATCTTTATAATCACCGTCATGGTC TTTGTAGTCTTCGCCCTGACCGAAACG
More specifically, FLAG sequence was fused to the carboxyl terminal(C-terminal) periplasmic domain (next to amino acid residue 174) linked to the β-barrel domain (amino acid residues 1-170 of mature OmpA) which transverse the outer membrane eight times when folded correctly, whereby OmpA::FLAG tagging was attempted such that the C-terminal end of OmpA was truncated by fusion with FLAG tag. Namely, the FLAG sequence (D YKDHDGD YKDHDDD: GACTACAAAGACCATGACGGTGATTATAAAGATCATGATGACGAT) was sequentially linked to six amino acid residues (RFGQGE: CGTTTCGGTCAGGGCGAA; amino acid residues 169 to 174) constituting OmpA present in the outer membrane, and then a 15-bp nucleotide (TAGTGACTCCGGCTC) containing a stop codon (TAG-TGA) corresponding to amino acid residue 175 region of the OmpA (SEQ ID NO: 15). PCR-based site- directed mutagenesis was performed using a 78-bp mutagenic reverse primer (SEQ ID NO: 15) constructed such that the C-terminal end of OmpA was truncated. When an OmpA::FLAG fusion protein was expressed according to the above- described method, the OmpA::FLAG fusion protein having the FLAG epitope consisting of 15 amino acid residues linked to the sequence of amino acid residues 1-174 comprising the beta-barrel domain of the amino acid sequence of the OmpA protein present in the outer membrane, was synthesized. Thus, the foreign FLAG epitope is linked to the beta-barrel domain of OmpA and located in the periplasmic space. Therefore, when outer membrane vesicles produced from the mutant having this fusion protein expressed in the outer membrane were isolated, the introduced foreign epitope was spontaneously contained in the lumen of the outer membrane vesicles (see FIG. 12).
4-2: Construction of ompA::¥LAG mutant from Sakai-DM
A DNA fragment consisting of ompA::FLAG-Cm cassette was amplified by PCR using the ompA::¥LAG recombinant plasmid constructed in Example 4-1, as a template, and the PCR product was purified, and then inserted into the Sakai- DM(pKD46) strain by electroporation, whereby homologous recombination was induced in the strain, such that the introduced ompA'.iFL, AG-Cm cassette targets the ompA gene in the genome. The mutation site of the resulting Cm-resistant colonies was amplified by PCR, and whether the size of the PCR product was increased as expected was examined. Also, it was confirmed by DNA sequencing that the ompAr.FLAG fusion was achieved in agreement with the reading frame. 4-3: Analysis of phenotvpe of Sakai-DM/o/m4::FLAG mutant
In order to examine whether the introduced FLAG foreign epitope is correctly expressed in the outer membrane fraction of the Sakai-DM/omp^::FLAG mutant constructed as described above and the outer membrane vesicles collected from the mutant, the outer membrane fraction and the outer membrane vesicles were isolated in the same manner as in Example 3. Because the OmpA protein is a typical protein which is abundant in the outer membrane, it was predicted that the OmpA::FLAG fusion protein would also be abundantly present in the outer membrane of the mutant. The mutant was cultured, the outer membrane fraction and the outer membrane vesicles were isolated from the culture broth, and then the proteins thereof were applied to SDS-PAGE gels and subjected to Western blot analysis using anti-FLAG monoclonal antibody. As a result, a specific band having a molecular weight of about 22 kDa corresponding to the OmpA::FLAG fusion protein in the outer membrane fraction and the outer membrane vesicles (FIG. 11), could be detected.
Thus, it could be seen that, although the PagP::FLAG fusion protein expressed in the outer membrane at a very low level was not detectable as described in Example 3, the OmpA::FLAG fusion protein abundantly expressed in the outer membrane was easily detectable.
INDUSTRIAL APPLICABILITY
As described above in detail, the outer membrane vesicles (OMVs) produced from the recombinant G(-) bacteria according to the present invention are safe, because they contain modified LPS whose endotoxicity is sufficiently reduced. Also, the outer membrane vesicles have the ability to deliver multivalent epitopes and contain agonists stimulating Toll-like receptors. Accordingly, the outer membrane vesicles show self-adjuvanticity without addition of exogenous adjuvants, and thus are useful as noble bio-nano particulate vaccines.
Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only for a preferred embodiment and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

Claims

THE CLAIMS
What is claimed is:
L A method for preparing recombinant G(-) bacteria capable of expressing a foreign epitope in fusion with an outer membrane protein, the method comprising the steps of:
(a) constructing a G(-) bacterial mutant by deleting a gene, which is involved in lipid A biosynthesis of lipopolysaccharide (LPS) present in outer membrane vesicles (OMVs), from G(-) bacteria having the ability to produce outer membrane vesicles;
(b) constructing a recombinant gene such that a foreign epitope is expressed in fusion with an outer membrane protein of the G(-) bacteria; and
(c) introducing the recombinant gene, constructed in the step (b), into the G(- ) bacterial mutant, constructed in the step (a).
2. The method for preparing recombinant G(-) bacteria according to claim 1, wherein the gene involved in the lipid A biosynthesis of lipopolysaccharide (LPS) is one or more genes selected from the group consisting of ipxL (htrB), ipxM (msbB) mάpagP.
3. The method for preparing recombinant G(-) bacteria according to claim 1, wherein one or more genes selected from the group consisting of ipxXL, ipxF and ipxE which are involved in lipid A structural modification, are additionally introduced and expressed in the recombinant G(-) bacteria.
4. The method for preparing recombinant G(-) bacteria according to claim 1, which additionally comprises a step of deleting a degP gene from the G(-) bacterial mutant constructed in the step (a) in order to increase the size and production of outer membrane vesicles.
5. The method for preparing recombinant G(-) bacteria according to claim 1, wherein the outer membrane protein for introduction of foreign epitopes is selected from the group consisting of OmpA, OmpC, OmpF, OmpX, OmpG, OmpT, and mixture thereof.
6. The method for preparing recombinant G(-) bacteria according to claim 1, wherein the recombinant gene is constructed such that a foreign epitope to be introduced is expressed as a fusion with the extracellular loop of the outer membrane protein or localized in the periplasm thereof.
7. The method for preparing recombinant G(-) bacteria according to claim 1, wherein the foreign epitope is selected from the group consisting of: (a) major protein antigen components of viruses or pathogenic microorganisms causing various infectious diseases in humans or animals; (b) specific cell surface markers which are expressed in immune cells (e.g., dendritic cells) or cancer cells; and (c) ligands binding to specific receptors present on the surface of immune cells or cancer cells.
8. The method for preparing recombinant G(-) bacteria according to claim 1, wherein the G(-) bacteria are selected from the group consisting of Escherichia spp., Salmonella spp., Klebsiella pneumoniae, Yersinia spp., Legionella pneumophila, Bordetella spp., and Shigella spp., having apagP gene.
9. The method for preparing recombinant G(-) bacteria according to claim 8, wherein said Escherichia spp. is a serotype O157:H7 strain which has pathogenicity and contains two msbB genes in the genome.
10. Recombinant G(-) bacteria prepared by the method of claim 1, which have a deletion of a gene involved in the lipid A biosynthesis of lipopolysaccharide (LPS), and have a recombinant gene constructed such that a foreign epitope is expressed in fusion with an outer membrane protein of G(-) bacteria, introduced thereinto.
11. The recombinant G(-) bacteria according to claim 10, in which one or more 5 genes selected from the group consisting of ipxXL, ipxF and ipxE which are involved in lipid A structural modification are additionally introduced and expressed.
12. The recombinant G(-) bacteria according to claim 10, in which a degP gene is 10 additionally deleted in order to increase the size and production of outer membrane vesicles.
13. A method for preparing outer membrane vesicles (OMVs) tagged with a foreign epitope, the method comprising culturing said recombinant G(-) bacteria of claim
15 10 to express a foreign epitope in fusion with an outer membrane protein.
14. A method for preparing recombinant outer membrane vesicles (OMVs), the method comprising the steps of:
(a) constructing a G(-) bacterial mutant by deleting a gene, which is involved 20 in lipid A biosynthesis of lipopolysaccharide (LPS) present in outer membrane vesicles (OMVs), from G(-) bacteria having the ability to produce outer membrane vesicles;
(b) collecting the outer membrane vesicles (OMVs) released from the G(-) bacterial mutant; and 5 (c) inserting either a synthetic peptide acting as a foreign epitope or a DNA fragment encoding the synthetic peptide into the lumen of the outer membrane vesicles (OMVs) collected in the step (b).
15. The method for preparing recombinant outer membrane vesicles (OMVs) 0 according to claim 14, wherein the gene involved in the lipid A biosynthesis of lipopoly saccharide (LPS) is one or more genes selected from the group consisting of ipxL (htrB), ipxM (msbB) andpagP.
16. The method for preparing recombinant outer membrane vesicles (OMVs) 5 according to claim 14, wherein one or more genes selected from the group consisting of ipxXL, ipxF and ipxE which are involved in lipid A structural modification, are additionally introduced and expressed in the recombinant G(-) bacteria.
10 17. The method for preparing recombinant outer membrane vesicles (OMVs) according to claim 14, which additionally comprises a step of deleting a degP gene from the G(-) bacterial mutant constructed in the step (a) in order to increase the size and production of outer membrane vesicles.
15 18. The method for preparing recombinant outer membrane vesicles (OMVs) according to claim 14, wherein the G(-) bacteria are selected from the group consisting of Escherichia spp., Salmonella spp., Klebsiella pneumoniae, Yersinia spp., Legionella pneumophila, Bordetella spp., and Shigella spp., having a pagP gene.
20
19. A method for reconstituting recombinant outer membrane vesicles (OMVs), the method comprising inserting an adjuvant showing an immune stimulating effect into the lumen of the recombinant outer membrane vesicles (OMVs) prepared by the method of claim 13 or 14. 5
20. A method for reconstituting recombinant outer membrane vesicles (OMVs), the method comprising chemically coupling (a) an antigenic substance consisting of protein or carbohydrate or (b) a fluorescent dye to KDO (3-deoxy-D-mα««o-oct-2- ulosonic acid) of lipopolysaccharide (LPS) present in the recombinant outer 0 membrane vesicles prepared by the method of claim 13 or 14.
21. The method for reconstituting recombinant outer membrane vesicles (OMVs) according to claim 20, wherein the antigenic substance consisting of protein or carbohydrate is selected from the group consisting of malaria merozoite surface protein (MSP), human papillomavirus oncogenic protein (E6 or E7), tumor- associated mucin glycopeptide (MUCl), blood group-related carbohydrate antigen Lewisy (Ley) and mixture thereof.
22. The method for reconstituting recombinant outer membrane vesicles (OMVs) according to claim 20, wherein the fluorescent dye is selected from the group consisting of fluorescein, rhodamine, Texas Red, Cy3, Cy5.5 and mixture thereof.
PCT/KR2008/004811 2008-07-25 2008-08-19 Recombinant gram-negative bacteria producing outer membrane vesicles and method for preparing outer membrane vesicles tagged with foreign epitopes using the same Ceased WO2010010983A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2008-0072858 2008-07-25
KR20080072858A KR101042541B1 (en) 2008-07-25 2008-07-25 Recombinant Ｇ (-) bacteria producing the outer membrane body and a method for producing the outer membrane body containing the polyvalent antigen using the same

Publications (1)

Publication Number Publication Date
WO2010010983A1 true WO2010010983A1 (en) 2010-01-28

Family

ID=41570435

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2008/004811 Ceased WO2010010983A1 (en) 2008-07-25 2008-08-19 Recombinant gram-negative bacteria producing outer membrane vesicles and method for preparing outer membrane vesicles tagged with foreign epitopes using the same

Country Status (2)

Country Link
KR (1) KR101042541B1 (en)
WO (1) WO2010010983A1 (en)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103079592A (en) * 2010-07-01 2013-05-01 浦项工科大学校产学协力团 Methods of treating and diagnosing cancer using microvesicles derived from cells
EP2617833A1 (en) * 2012-01-18 2013-07-24 Centre National de la Recherche Scientifique (CNRS) A method for specifically detecting living bacteria
US20150056246A1 (en) * 2012-04-06 2015-02-26 Cornell University Subunit vaccine delivery platform for robust humoral and cellular immune responses
US9764027B2 (en) 2012-09-18 2017-09-19 Glaxosmithkline Biologicals Sa Outer membrane vesicles
WO2020146390A1 (en) * 2019-01-09 2020-07-16 Exocure Biosciences, Inc. Bacteria-derived vesicles and uses thereof
US20210030813A1 (en) * 2018-07-11 2021-02-04 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
WO2022011014A1 (en) * 2020-07-09 2022-01-13 Exocure Biosciences, Inc. Bacteria-derived vesicles and use thereof for generating immune response to sars-cov-2
US11561223B2 (en) 2017-09-15 2023-01-24 Exocure Biosciences Inc. Method and system for identifying membrane proteins on extracellular vesicles
US12024709B2 (en) 2019-02-27 2024-07-02 Actym Therapeutics, Inc. Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment
US20250263447A1 (en) * 2020-09-04 2025-08-21 Intravacc B.V. Ompa mutations enhance omv production in bordetella pertussis
US12553047B2 (en) 2017-07-11 2026-02-17 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
US12564608B2 (en) 2019-09-13 2026-03-03 Exocure Sweden Ab Use of ghost nanovesicles as therapeutics

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101715366B1 (en) * 2014-09-04 2017-03-14 한국과학기술연구원 Composition and kit for dephosphorylating lipid, and method for the production of dephosphorylated lipid using the same
KR101632962B1 (en) 2015-07-29 2016-06-23 한국생명공학연구원 Anti-infective immunostimulatory composition comprising modified outer membrane vesicle
KR101856736B1 (en) * 2016-02-29 2018-05-11 (주)비손바이오로직스 Endotoxin-reduced Salmonella trivalent inactivated vaccine composition for preventing fowl typhoid and Salmonellosis
CN111454979B (en) * 2020-04-03 2023-06-06 江苏省农业科学院 A method for increasing the production of bacterial outer membrane vesicles and its application
CN113755514B (en) * 2021-09-08 2023-06-16 西北农林科技大学 Construction method of escherichia coli mutant and preparation method of outer membrane vesicle

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050028051A (en) * 2002-08-02 2005-03-21 글락소스미스클라인 바이오로지칼즈 에스.에이. Vaccine composition comprising transferrin binding protein and hsf from gram negative bacteria
EP1208214B1 (en) * 1999-08-03 2006-11-15 GlaxoSmithKline Biologicals S.A. Genetically engineered bleb vaccine

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1208214B1 (en) * 1999-08-03 2006-11-15 GlaxoSmithKline Biologicals S.A. Genetically engineered bleb vaccine
KR20050028051A (en) * 2002-08-02 2005-03-21 글락소스미스클라인 바이오로지칼즈 에스.에이. Vaccine composition comprising transferrin binding protein and hsf from gram negative bacteria

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LEE SANG-RAE ET AL.: "Low Endotoxic and Immunogenic Outer Membrane Vesicle Vaccine Platform Derived from an MsbB-Deficient Salmonella enteritidis Mutant", LABORATORY ANIMAL RESEARCH, vol. 24, no. 4, December 2008 (2008-12-01), pages 649 - 657 *
MAKDA FISSEHA ET AL.: "Characterization of native outer membrane vesicles from lpxL mutant strains of Neisseria meningitidis for use in parenteral vaccination", INFECT IMMUN, vol. 73, no. 7, July 2005 (2005-07-01), pages 4070 - 4080 *

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2589391A4 (en) * 2010-07-01 2014-03-05 Postech Acad Ind Found METHOD OF DIAGNOSING AND TREATING CANCER WITH CELLULAR MICROVESICLES
CN103079592A (en) * 2010-07-01 2013-05-01 浦项工科大学校产学协力团 Methods of treating and diagnosing cancer using microvesicles derived from cells
US9066971B2 (en) 2010-07-01 2015-06-30 Postech Academy-Industry Foundation Method for treating and diagnosing cancer by using cell-derived microvesicles
US9493809B2 (en) 2012-01-18 2016-11-15 Centre National De La Recherche Scientifique (Cnrs) Method for specifically labeling living bacteria
WO2013107759A1 (en) * 2012-01-18 2013-07-25 Centre National De La Recherche Scientifique (Cnrs) A method for specifically labeling living bacteria
EP2617833A1 (en) * 2012-01-18 2013-07-24 Centre National de la Recherche Scientifique (CNRS) A method for specifically detecting living bacteria
US20150056246A1 (en) * 2012-04-06 2015-02-26 Cornell University Subunit vaccine delivery platform for robust humoral and cellular immune responses
US9808517B2 (en) * 2012-04-06 2017-11-07 Cornell University Subunit vaccine delivery platform for robust humoral and cellular immune responses
US10537627B2 (en) 2012-04-06 2020-01-21 Cornell University Subunit vaccine delivery platform for robust humoral and cellular immune responses
US10918706B2 (en) 2012-04-06 2021-02-16 Cornell University Subunit vaccine delivery platform for robust humoral and cellular immune responses
US9764027B2 (en) 2012-09-18 2017-09-19 Glaxosmithkline Biologicals Sa Outer membrane vesicles
EP3400960A1 (en) 2012-09-18 2018-11-14 GlaxoSmithKline Biologicals S.A. Outer membrane vesicles
US12553047B2 (en) 2017-07-11 2026-02-17 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
US11561223B2 (en) 2017-09-15 2023-01-24 Exocure Biosciences Inc. Method and system for identifying membrane proteins on extracellular vesicles
US12226439B2 (en) * 2018-07-11 2025-02-18 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
US12201653B2 (en) 2018-07-11 2025-01-21 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
AU2024200578B2 (en) * 2018-07-11 2025-12-04 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
US20230072505A1 (en) * 2018-07-11 2023-03-09 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
US12357661B2 (en) * 2018-07-11 2025-07-15 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
US20210030813A1 (en) * 2018-07-11 2021-02-04 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
US11779612B2 (en) 2019-01-08 2023-10-10 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
US20220080035A1 (en) * 2019-01-09 2022-03-17 Exocure Biosciences, Inc. Bacteria-derived vesicles and uses thereof
US12397047B2 (en) 2019-01-09 2025-08-26 Exocure Sweden Ab Bacteria-derived vesicles and uses thereof
WO2020146390A1 (en) * 2019-01-09 2020-07-16 Exocure Biosciences, Inc. Bacteria-derived vesicles and uses thereof
US12024709B2 (en) 2019-02-27 2024-07-02 Actym Therapeutics, Inc. Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment
US12564608B2 (en) 2019-09-13 2026-03-03 Exocure Sweden Ab Use of ghost nanovesicles as therapeutics
WO2022011014A1 (en) * 2020-07-09 2022-01-13 Exocure Biosciences, Inc. Bacteria-derived vesicles and use thereof for generating immune response to sars-cov-2
US20250263447A1 (en) * 2020-09-04 2025-08-21 Intravacc B.V. Ompa mutations enhance omv production in bordetella pertussis

Also Published As

Publication number Publication date
KR101042541B1 (en) 2011-06-17
KR20100011581A (en) 2010-02-03

Similar Documents

Publication Publication Date Title
WO2010010983A1 (en) Recombinant gram-negative bacteria producing outer membrane vesicles and method for preparing outer membrane vesicles tagged with foreign epitopes using the same
EP1066375B1 (en) $i(LACTOBACILLI) HARBORING AGGREGATION AND MUCIN BINDING GENES AS VACCINE DELIVERY VEHICLES
CN101969990B (en) Compositions and methods for enhancing the immune response against Eimeria
JP3380559B2 (en) Helicobacter pylori antigen and vaccine composition
EP2214840B1 (en) Compositions and methods of enhancing immune responses to flagellated bacterium
US20100172938A1 (en) Modified bacterial surface layer proteins
EA015561B1 (en) A NOVEL SURFACE EXPOSED HAEMOPHILUS INFLUENZAE PROTEIN (PROTEIN E; pE)
JP2777622B2 (en) Antigenic gene vaccine and method for producing the same
TW202227128A (en) Multivalent vaccine compositions and uses thereof
JP5745731B2 (en) Salmonella vaccine
KR20150048771A (en) A novel live attenuated shigella vaccine
CZ20003470A3 (en) Bacterium attenuated by a non-reverting mutation, vaccine in which the bacterium is comprised and use thereof
US5098998A (en) Cholera vaccines and peptides
WO2007125535A1 (en) Recombinant flagellin gene and uses thereof
ES2473605T3 (en) Nonhemolytic ClyA for protein excretion
US20040086524A1 (en) Vaccines and agents for inducing immunity in fish against rickettsial diseases, and associated preventative therapy
EA027463B1 (en) Polyvalent fusion protein vaccine against influenza
CN103917244B (en) For improve the ETEC CS6 antigen presentation of cell surface method and can by the product of its acquisition
EP0358692B1 (en) Cholera vaccines
GB2356632A (en) OspA lipoproteins
CN121320211A (en) Brucella melitensis mutant, construction method, outer membrane vesicle and application thereof
KR101713635B1 (en) Recombinant Protein Derived Cysteine Protease Domain Derived from Vibrio vulnificus and Use Thereof
CA2281913A1 (en) A vaccine against piscirickettsia salmonis based on a recombinant 17 kd protein
CA2339327A1 (en) Vaccines and agents for inducing immunity in fish against rickettsial diseases, and associated preventative therapy
HK1146644B (en) Compositions and methods of enhancing immune responses to flagellated bacterium

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08793324

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08793324

Country of ref document: EP

Kind code of ref document: A1