WO2010009409A1 - Systems and methods for producing plastid proteins - Google Patents

Systems and methods for producing plastid proteins Download PDF

Info

Publication number
WO2010009409A1
WO2010009409A1 PCT/US2009/051014 US2009051014W WO2010009409A1 WO 2010009409 A1 WO2010009409 A1 WO 2010009409A1 US 2009051014 W US2009051014 W US 2009051014W WO 2010009409 A1 WO2010009409 A1 WO 2010009409A1
Authority
WO
WIPO (PCT)
Prior art keywords
proteins
plastid proteins
plastid
chloroplast processing
diterpene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2009/051014
Other languages
French (fr)
Inventor
Caroline Virginia Mcneil
Alyssa Baevich
Seiichi Paul Tillich Matsuda
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
William Marsh Rice University
Original Assignee
William Marsh Rice University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by William Marsh Rice University filed Critical William Marsh Rice University
Publication of WO2010009409A1 publication Critical patent/WO2010009409A1/en
Priority to US13/008,739 priority Critical patent/US20110177552A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P15/00Preparation of compounds containing at least three condensed carbocyclic rings
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)

Definitions

  • the present invention relates generally to protein production.
  • the present invention relates to systems and methods for producing plastid proteins.
  • diterpene synthases usually contain N-terminal transit peptide signal sequences directing them to the plastids.
  • the transit sequences are cleaved to form the mature, functional diterpene synthases.
  • the initial full-length protein containing the transit peptide sequence expressed in E. coli has poor enzymatic activity, whereas removal of the signal sequence has been demonstrated to increase enzymatic activity and aid in enzyme characterization.
  • Pseudomature proteins are heterologously expressed proteins lacking the transit peptide. These enzymes are generated by making a subclone without the signal sequence, but with an artificial start site introduced at the beginning of the expected mature protein. Pseudomature proteins differ from conventional mature proteins because they retain this adventitious methionine, and pseudomature diterpene synthases often have better activity than their full- length counterparts when expressed in E. coli. (6,8,9) However, the exact location of the cleavage site may not be readily predictable, therefore extensive empirical experiments are often necessary to determine the best site for N-terminal truncation.
  • CPE chloroplast processing enzymes
  • Figure 1 shows a reaction scheme for cyclization of GGPP to abietadiene by abietadiene synthase.
  • the present invention relates generally to protein production.
  • the present invention relates to systems and methods for producing plastid proteins.
  • the present disclosure provides, in certain embodiments, a method comprising providing a system comprising one or more plastid proteins and one or more chloroplast processing enzymes; and allowing at least one of the one or more chloroplast processing enzymes to cleave at least a portion of a signal sequence from at least one of the one or more plastid proteins.
  • the present disclosure provides, in certain embodiments, a system comprising one or more plastid proteins and one or more chloroplast processing enzymes.
  • the systems and methods of the present invention may confer benefits beyond traditional methods of plastid protein production. Such traditional methods include extraction from natural sources and chemical synthesis.
  • the systems and methods of the present invention may increase the catalytic activity of the resulting plastid proteins.
  • the systems and methods of the present invention may increase the yield of a product or products produced by the resulting plastid proteins.
  • the cleavage of at least a portion of a signal sequence from at least one of the one or more plastid proteins may increase the solubility in water of the plastid protein, which may contribute in part to the increased catalytic activity of the plastid protein and/or the increase yield of a product or products produced by the resulting plastid proteins.
  • the plastid proteins useful in the systems and methods of the present invention may be any plastid protein which exhibits at least partially altered properties in an untruncated state.
  • the term "untruncated” and its derivatives mean that the plasmid protein contains one or more amino acids which must be removed to allow the protein to function as desired.
  • Such untruncated plasmid proteins may include, but are not limited to, plasmid proteins which contain a signaling sequence.
  • a signaling sequence may inhibit the ability of the plastid protein to perform a desired function, such as, but not limited to, the catalysis of a chemical reaction.
  • the plastid protein may be a diterpene synthase.
  • the chloroplast processing enzymes useful in the systems and methods of the present invention may be derived from any suitable source. Suitable sources include, but are not limited to, plants such as Arabidopsis thaliana and Abies grandis. In certain embodiments, the chloroplast processing enzyme may be derived from the same organism as the plastid proteins.
  • using chloroplast processing enzymes and plastid proteins from the same organism may increase the catalytic activity of the resulting plastid proteins and/or the yield of a product or products produced by the resulting plastid proteins when compared to the catalytic activity of the resulting plastid proteins and/or the yield of a product or products produced by the resulting plastid proteins when the chloroplast processing enzyme and plastid proteins are derived from different organisms.
  • the systems and methods of the present invention may allow for the increased yield of a product derived from the plastid proteins useful in the systems and methods of the present invention.
  • the plastid proteins may comprise one or more enzymes, and the systems and methods of the present invention may allow for the increased yield of the reaction products of the plastid protein with one or more substrates.
  • the systems and methods of the present invention may increase the yield of diterpene hydrocarbons.
  • the systems of the present invention may comprise proteins which produce diterpene precursors.
  • Such proteins include, but are not limited to, geranylgeranyl diphosphate synthase and hydroxymethylglutaryl CoA reductase.
  • Desirable diterpenes which may be produced by such embodiments of the systems and methods of the present invention include, but are not limited to, paclitaxel.
  • the systems and methods of the present invention may be contained within a microorganism. Suitable microorganisms include, but are not limited to, E. coli.
  • the plastid proteins and/or chloroplast processing enzymes useful in the systems and methods of the present invention may be introduced into the microorganism.
  • the plastid proteins and/or chloroplast processing enzymes useful in the systems and methods of the present invention may be produced by the microorganism, for example, by introducing the genes encoding the plastid proteins and/or chloroplast processing enzymes into the genome of the microorganism.
  • additional enzymes may be added to the systems of the present invention which metabolize the products produced by the plastid proteins (such as diterpenes) further.
  • additional enzymes include, but are not limited to, P 450 -dependent oxidases.
  • the inclusion of such additional enzymes may provide a larger library of molecules that could be produced by the systems and methods of the present invention.
  • one or more competing enzymes may be suppressed.
  • the term "competing enzyme” is used herein to mean an enzyme which would hinder the production of the desired product. Such competing enzymes may hinder the production of the desired product by one or more of the traditional methods of enzymatic competition.
  • squalene synthase may be suppressed. Such suppression may hinder the consumption of carbon by squalene synthase and allow for increase diterpene production.
  • RT-PCR to obtain a cDNA mRNA from 7-day Arabidopsis seedlings (Columbia) was obtained, and reverse- transcription PCR was performed following the manufacturer's protocol to obtain a cDNA (Ambion, Austin, TX). PCR amplifica ⁇ on of CVE from cDNA
  • Arabidopsis CPE gene sequence (At5g42390) was obtained from NCBI and used to develop primers for PCR amplification from the cDNA library. Because of the length of the CPE gene (3.8 kB), it was necessary to amplify the gene in two parts: from Sal I to EcoR I, and from EcoR I to Not I.
  • the PCR mixture was as follows: 1 ⁇ L 7-day seedling cDNA, 1 ⁇ L of the forward primer pCVP18-Fl 5'- TAGTCGACAATTATGGCTTCATCG-3 ' (Sal I restriction site underlined), 1 ⁇ L of the reverse primer pCVP18-R2 5'-ACCGGAATTCCATGGCAATG-S' (ECOR I restriction site underlined), 4 ⁇ L dNTPs, 5 ⁇ L High-Fidelity buffer, 0.2 ⁇ L Triple Master polymerase, and 38 ⁇ L mqH 2 0.
  • the back fragment contained the same mixture, except the primers used were pCVP18-F7 5'- CATTGCCATGGAATTCCGGTTTACT-3 ' (EcoR I restriction site underlined) and pCVPl 8-Rl 5 '-GCGGCCGCTCAGGTTGTTGGTCTTGT-3 ' (Not I restriction site underlined).
  • the two plasmids pAMB3.0 and pAMB4.0 were digested with their corresponding restriction enzymes and ligated into pRS313GaI that had been digested with Sal I and Not I.
  • the three-piece ligation was then transformed into E. coli and plated on LB + Amp. Clones were screened for the presence of the insert, and the correct clone was sequenced to ensure the full- length gene was obtained with the correct sequence.
  • the final plasmid was named pAMB5.3.
  • EHY 18 was transformed with either the pCVP26.1 plasmid or pEH9.0, the Abies grandis abietadiene synthase in pRS426Gal. These two yeast strains, EHY18[pCVP26.1] and EHY18[pEH9.0], were selected on synthetic complete media lacking uracil and transformed with the pAMB5.3 plasmid. The final transformants were screened by growing on synthetic complete media lacking both uracil and histidine.
  • the Arabidopsis chloroplast processing enzyme (CPE, At5g42390) was PCR-amplified from a cDNA and co-expressed in EHY 18 containing either the Abies grandis (grand fir) abietadiene synthase ( ⁇ gAS) or the Arabidopsis e «£-copalyl pyrophosphate synthase (AtG Al) and e ⁇ -kaurene synthase (AtGAT) genes (Table 3.1). (13-17) Control strains expressing only diterpene synthases were grown in parallel, and the diterpene products accumulating in the cell pellets and media were analyzed. Triplicate cultures were grown and harvested to provide more accurate data.
  • Table 3.1 Summary of yeast strains with and without CPE. All yeast strains contain MATa pGALl-BTSl ::hisG pGALl-trHMGl ::LEU2 ur ⁇ 3-52 trpl- ⁇ 63 Ieu2-3,112 his3- ⁇ 200 ⁇ de2 GaI + .
  • the cell pellets from EHY18[pEH9.0] and EHY18[pEH9.0][pAMB5.3] were saponified, and the non-saponifiable lipids (NSL) contained the majority of the diterpene products (Table 3.2).
  • the NSL were thus used for quantitation, as insignificant levels of diterpene products were isolated from the media ( ⁇ 1% of the total).
  • GC-MS analysis of the NSL showed that the cultures produced abietadiene as the major diterpene product.
  • the amount of abietadiene isolated from the CPE-expressing strain increased 1.5 times in comparison to the strain without the CPE. Both strains accumulated a significant amount of abietadiene, with nearly 6 mg/L in the strain without the CPE and over 9 mg/L in the strain with the CPE. Both the control strain and the strain co-expressing the CPE produced abietadiene but did not accumulate substantial levels of the GGPP hydrolysis products geranylgeraniol or geranyllinalool.
  • the CPE co-expression greatly improved GAl and GA2 activity, as shown by the substantial difference in ent-kaurene accumulation.
  • No significant amounts of the ent-kaurene intermediates enf-copalol or e?zH ⁇ ianool/e «/-13-epimanool were observed ( ⁇ 1% of en ⁇ -kaurene), suggesting that GA2 enzymatic activity greatly increased and more efficiently cyclized ent- copalyl pyrophosphate to ent-kau ⁇ ene.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Methods and systems that include a method comprising: providing a system comprising one or more plastid proteins comprising a signal sequence and one or more chloroplast processing enzymes; and allowing at least one of the one or more chloroplast processing enzymes to cleave at least a portion of a signal sequence from at least one of the one or more plastid proteins.

Description

SYSTEMS AND METHODS FOR PRODUCING PLASTID PROTEINS
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Patent Application Serial Number 61/081,792, filed July 18, 2008, the entire disclosure of which is incorporated by reference. BACKGROUND
The present invention relates generally to protein production. In particular, the present invention relates to systems and methods for producing plastid proteins.
Biosynthesis of diterpenes in plants occurs in plastids, and therefore diterpene synthases usually contain N-terminal transit peptide signal sequences directing them to the plastids. (1-4) Once in the organelle, the transit sequences are cleaved to form the mature, functional diterpene synthases. The initial full-length protein containing the transit peptide sequence expressed in E. coli has poor enzymatic activity, whereas removal of the signal sequence has been demonstrated to increase enzymatic activity and aid in enzyme characterization. (5-7)
Pseudomature proteins are heterologously expressed proteins lacking the transit peptide. These enzymes are generated by making a subclone without the signal sequence, but with an artificial start site introduced at the beginning of the expected mature protein. Pseudomature proteins differ from conventional mature proteins because they retain this adventitious methionine, and pseudomature diterpene synthases often have better activity than their full- length counterparts when expressed in E. coli. (6,8,9) However, the exact location of the cleavage site may not be readily predictable, therefore extensive empirical experiments are often necessary to determine the best site for N-terminal truncation. (6,8,10,11) Moreover, one may not be certain that the introduced methionine in the pseudomature protein will not alter catalysis in some manner. However, plants encode proteins known as chloroplast processing enzymes (CPE), which cleave transit peptides once proteins enter the plastid. (12) While much of the description and examples herein pertains to the use of the systems and methods of the present invention for diterpene production, such is not intended to limit the scope of the present invention. Rather, the systems and methods disclosed herein may be applicable to any suitable compound which may be produced by one or more plastid proteins.
DRAWINGS Some specific example embodiments of the disclosure may be understood by referring, in part, to the following description and the accompanying drawings. Figure 1 shows a reaction scheme for cyclization of GGPP to abietadiene by abietadiene synthase.
While the present disclosure is susceptible to various modifications and alternative forms, specific example embodiments have been shown in the figures and are herein described in more detail. It should be understood, however, that the description of specific example embodiments is not intended to limit the invention to the particular forms disclosed, but on the contrary, this disclosure is to cover all modifications and equivalents as illustrated, in part, by the appended claims.
DESCRIPTION The present invention relates generally to protein production. In particular, the present invention relates to systems and methods for producing plastid proteins.
The present disclosure provides, in certain embodiments, a method comprising providing a system comprising one or more plastid proteins and one or more chloroplast processing enzymes; and allowing at least one of the one or more chloroplast processing enzymes to cleave at least a portion of a signal sequence from at least one of the one or more plastid proteins.
The present disclosure provides, in certain embodiments, a system comprising one or more plastid proteins and one or more chloroplast processing enzymes.
In certain embodiments, the systems and methods of the present invention may confer benefits beyond traditional methods of plastid protein production. Such traditional methods include extraction from natural sources and chemical synthesis. In certain embodiments, the systems and methods of the present invention may increase the catalytic activity of the resulting plastid proteins. In certain embodiments, the systems and methods of the present invention may increase the yield of a product or products produced by the resulting plastid proteins. In certain embodiments, the cleavage of at least a portion of a signal sequence from at least one of the one or more plastid proteins may increase the solubility in water of the plastid protein, which may contribute in part to the increased catalytic activity of the plastid protein and/or the increase yield of a product or products produced by the resulting plastid proteins.
The plastid proteins useful in the systems and methods of the present invention may be any plastid protein which exhibits at least partially altered properties in an untruncated state. As used herein, the term "untruncated" and its derivatives mean that the plasmid protein contains one or more amino acids which must be removed to allow the protein to function as desired. Such untruncated plasmid proteins may include, but are not limited to, plasmid proteins which contain a signaling sequence. In certain embodiments, such a signaling sequence may inhibit the ability of the plastid protein to perform a desired function, such as, but not limited to, the catalysis of a chemical reaction. In certain embodiments, the plastid protein may be a diterpene synthase.
The chloroplast processing enzymes useful in the systems and methods of the present invention may be derived from any suitable source. Suitable sources include, but are not limited to, plants such as Arabidopsis thaliana and Abies grandis. In certain embodiments, the chloroplast processing enzyme may be derived from the same organism as the plastid proteins. In certain embodiments, using chloroplast processing enzymes and plastid proteins from the same organism may increase the catalytic activity of the resulting plastid proteins and/or the yield of a product or products produced by the resulting plastid proteins when compared to the catalytic activity of the resulting plastid proteins and/or the yield of a product or products produced by the resulting plastid proteins when the chloroplast processing enzyme and plastid proteins are derived from different organisms.
In certain embodiments, the systems and methods of the present invention may allow for the increased yield of a product derived from the plastid proteins useful in the systems and methods of the present invention. In certain embodiments, the plastid proteins may comprise one or more enzymes, and the systems and methods of the present invention may allow for the increased yield of the reaction products of the plastid protein with one or more substrates. For example, in certain embodiments where the plastid proteins comprise one or more diterpene synthases, the systems and methods of the present invention may increase the yield of diterpene hydrocarbons. In such embodiments, the systems of the present invention may comprise proteins which produce diterpene precursors. Such proteins include, but are not limited to, geranylgeranyl diphosphate synthase and hydroxymethylglutaryl CoA reductase. Desirable diterpenes which may be produced by such embodiments of the systems and methods of the present invention include, but are not limited to, paclitaxel.
In certain embodiments, the systems and methods of the present invention may be contained within a microorganism. Suitable microorganisms include, but are not limited to, E. coli. In certain embodiments, the plastid proteins and/or chloroplast processing enzymes useful in the systems and methods of the present invention may be introduced into the microorganism. In certain embodiments, the plastid proteins and/or chloroplast processing enzymes useful in the systems and methods of the present invention may be produced by the microorganism, for example, by introducing the genes encoding the plastid proteins and/or chloroplast processing enzymes into the genome of the microorganism. In certain embodiments, additional enzymes may be added to the systems of the present invention which metabolize the products produced by the plastid proteins (such as diterpenes) further. Such additional enzymes include, but are not limited to, P450-dependent oxidases. In certain embodiments, the inclusion of such additional enzymes may provide a larger library of molecules that could be produced by the systems and methods of the present invention.
In certain embodiments, one or more competing enzymes may be suppressed. The term "competing enzyme" is used herein to mean an enzyme which would hinder the production of the desired product. Such competing enzymes may hinder the production of the desired product by one or more of the traditional methods of enzymatic competition. In certain embodiments where the systems and methods of the present invention are used to produce diterpenes, squalene synthase may be suppressed. Such suppression may hinder the consumption of carbon by squalene synthase and allow for increase diterpene production.
As previously stated, while much of the description and examples herein pertains to the use of the systems and methods of the present invention for diterpene production, such is not intended to limit the scope of the present invention. Rather, the systems and methods disclosed herein may be applicable to any suitable compound which may be produced by one or more plastid proteins. For example, many monoterpenes also may be produced in the plastids and a large number of monoterpene synthases contain a signaling sequence. Co-expression of a chloroplast processing enzyme with a monoterpene synthase may increase monoterpene yields in vivo.
To facilitate a better understanding of the present invention, the following examples of specific embodiments are given. In no way should the following examples be read to limit or define the entire scope of the invention.
EXAMPLES Experimental Procedures
RT-PCR to obtain a cDNA mRNA from 7-day Arabidopsis seedlings (Columbia) was obtained, and reverse- transcription PCR was performed following the manufacturer's protocol to obtain a cDNA (Ambion, Austin, TX). PCR amplificaήon of CVE from cDNA
The full-length Arabidopsis CPE gene sequence (At5g42390) was obtained from NCBI and used to develop primers for PCR amplification from the cDNA library. Because of the length of the CPE gene (3.8 kB), it was necessary to amplify the gene in two parts: from Sal I to EcoR I, and from EcoR I to Not I. For the first fragment, the PCR mixture was as follows: 1 μL 7-day seedling cDNA, 1 μL of the forward primer pCVP18-Fl 5'- TAGTCGACAATTATGGCTTCATCG-3 ' (Sal I restriction site underlined), 1 μL of the reverse primer pCVP18-R2 5'-ACCGGAATTCCATGGCAATG-S' (ECOR I restriction site underlined), 4 μL dNTPs, 5 μL High-Fidelity buffer, 0.2 μL Triple Master polymerase, and 38 μL mqH20. The back fragment contained the same mixture, except the primers used were pCVP18-F7 5'- CATTGCCATGGAATTCCGGTTTACT-3 ' (EcoR I restriction site underlined) and pCVPl 8-Rl 5 '-GCGGCCGCTCAGGTTGTTGGTCTTGT-3 ' (Not I restriction site underlined).
Construction of the full-length CFΕ-containing plasmid The two CPE fragments, Sal I to EcoR I, and EcoR I to Not I, were ligated into TOPO-
TA vector, and clones containing the inserts were sequenced. Large-scale cultures of clones with the correct sequences were grown and DNA isolated, yielding two plasmids pAMB3.0 and pAMB4.0, corresponding to the front and back pieces of the CPE, respectively.
The two plasmids pAMB3.0 and pAMB4.0 were digested with their corresponding restriction enzymes and ligated into pRS313GaI that had been digested with Sal I and Not I. The three-piece ligation was then transformed into E. coli and plated on LB + Amp. Clones were screened for the presence of the insert, and the correct clone was sequenced to ensure the full- length gene was obtained with the correct sequence. The final plasmid was named pAMB5.3.
Subcloning GAl and GA2 into one plasmid A plasmid containing both Arabidopsis GAl and GA2 was constructed. First, GA2 and a bi-directional galactose (BiGaI) promoter were subcloned into pRS426 with BamH I and Not I to give the plasmid pCVP6.3. GAl was PCR-amplifϊed to insert new restriction sites using the primers GA1F4 5'- TACCGCGGAATTATGTCTCTTCAGTATCATG-3' and GAlNotIR 5'- GCGGCCGCCTAGACTTTTTGAAACAAG -3'. The gel-purified PCR product was cloned into pCVP6.3 with Sac II and Not I, resulting in the final plasmid pCVP26.1.
Construction of yeast strains
Two control strains were first constructed. EHY 18 was transformed with either the pCVP26.1 plasmid or pEH9.0, the Abies grandis abietadiene synthase in pRS426Gal. These two yeast strains, EHY18[pCVP26.1] and EHY18[pEH9.0], were selected on synthetic complete media lacking uracil and transformed with the pAMB5.3 plasmid. The final transformants were screened by growing on synthetic complete media lacking both uracil and histidine.
Identification and quantitation of products generated in yeast strains All strains were grown to saturation in inducing medium and harvested by centrifugation. The cell pellets were saponified and extracted with 3 x 15 mL hexanes, with 100 μL of the internal standard epicoprostanol (2.5 mg in 1 rtiL ethanol) added prior to saponification. The non-saponifiable lipids (NSL) were partitioned between one-half volume water and 3 x 15 mL hexanes, and solvent was evaporated in vacuo and residues transferred to GC vials with CH2Cl2. Samples were analyzed on GC-FID and GC-MS.
Results
The Arabidopsis chloroplast processing enzyme (CPE, At5g42390) was PCR-amplified from a cDNA and co-expressed in EHY 18 containing either the Abies grandis (grand fir) abietadiene synthase (^gAS) or the Arabidopsis e«£-copalyl pyrophosphate synthase (AtG Al) and eπ^-kaurene synthase (AtGAT) genes (Table 3.1). (13-17) Control strains expressing only diterpene synthases were grown in parallel, and the diterpene products accumulating in the cell pellets and media were analyzed. Triplicate cultures were grown and harvested to provide more accurate data.
Table 3.1: Summary of yeast strains with and without CPE. All yeast strains contain MATa pGALl-BTSl ::hisG pGALl-trHMGl ::LEU2 urα3-52 trpl-Δ63 Ieu2-3,112 his3-Δ200 αde2 GaI+.
Figure imgf000007_0001
The cell pellets from EHY18[pEH9.0] and EHY18[pEH9.0][pAMB5.3] were saponified, and the non-saponifiable lipids (NSL) contained the majority of the diterpene products (Table 3.2). The NSL were thus used for quantitation, as insignificant levels of diterpene products were isolated from the media (<1% of the total). GC-MS analysis of the NSL showed that the cultures produced abietadiene as the major diterpene product. Abietadiene synthase was previously reported to catalyze cyclization of geranylgeranyl pyrophosphate (GGPP) to the intermediate (+)-copalyl pyrophosphate, which is then cyclized further to (-)-abieta-7(8),13(14)-diene (Figure
Table 3.2: GC-FID quantitation of EHY18[pEH9.0] NSL with and without CPE co-expression. Peak areas were compared to that of the internal standard epicoprostanol.
Figure imgf000008_0001
The amount of abietadiene isolated from the CPE-expressing strain increased 1.5 times in comparison to the strain without the CPE. Both strains accumulated a significant amount of abietadiene, with nearly 6 mg/L in the strain without the CPE and over 9 mg/L in the strain with the CPE. Both the control strain and the strain co-expressing the CPE produced abietadiene but did not accumulate substantial levels of the GGPP hydrolysis products geranylgeraniol or geranyllinalool.
Because the yeast strains have intact sterol biosynthetic pathways, squalene was also isolated but at much higher levels than the diterpene products. In the strain without the CPE, approximately 14 mg/L of squalene was accumulated, suggesting that the amount of carbon flux was too great for the enzymes in the sterol pathway to process it efficiently. The strain with the co-expressed CPE, however, demonstrated a large decrease in squalene accumulation, with only 8.3 mg/L recovered.
Usually, most FPP funnels through the sterol biosynthetic pathway instead of being used for GGPP production. Over-expression of GGPP synthase shunted more FPP to GGPP biosynthesis and therefore provided more substrate for diterpene synthesis, decreasing the amount of carbon routed towards sterol biosynthesis. (13)
More dramatic changes were observed in the strains co-expressing GAl and GA2 with the CPE (Table 3.3). As seen in the strains containing abietadiene synthase, almost all of the enϊ-kaurene was isolated from the cell pellets, with less than 1% of the e«/-kaurene found in the media. From these results, the amount of en^-kaurene accumulating in the CPE co-expression strain was 10 times higher than that observed in the strain without the CPE. The parent strain accumulated approximately 0.25 mg/L en^-kaurene, while the strain with the CPE accumulated approximately 2.5 mg/L. Table 3.3: GC-FID quantitation of EHY18[pCVP26.1] NSL with and without CPE co- expression. Peak areas were compared to that of the internal standard epicoprostanol.
Figure imgf000008_0002
Figure imgf000009_0001
The CPE co-expression greatly improved GAl and GA2 activity, as shown by the substantial difference in ent-kaurene accumulation. No significant amounts of the ent-kaurene intermediates enf-copalol or e?zHτianool/e«/-13-epimanool were observed (<1% of en^-kaurene), suggesting that GA2 enzymatic activity greatly increased and more efficiently cyclized ent- copalyl pyrophosphate to ent-kauτene.
In addition to ent-kanrene, a considerable amount of geranylgeraniol was also isolated, with approximately 3.0 mg/L accumulating in both EHY18[pCVP26.1] and the CPE-expressing strain. The large amount of geranylgeraniol isolated suggests that the GAl and GA2 enzymes were not as efficient as the abietadiene synthase. As observed in the abietadiene strains, the amount of squalene accumulation was substantial, with over 8 mg/L of squalene isolated from EHY18[pCVP26.1]. The amount of squalene decreased significantly to 6 mg/L when the CPE was expressed. ent-Kaurem production increased at the same rate that squalene accumulation decreased, again consistent with CPE increasing GAl and GA2 activity. Co-expressing Arαbidopsis CPE improved abietadiene production somewhat less than it did in the e«/-kaurene-producing strains, consistent with better cleavage when CPE and cyclase both come from Arαbidopsis than when they are from different organisms. This difference may reflect the evolutionary distance between A. grαndis and Arαbidopsis. The CPE substrate recognition sites may not be similar enough to efficiently cleave the transit peptide from the other organism.
Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements.
Therefore, the present invention is well adapted to attain the ends and advantages mentioned as well as those that are inherent therein. While numerous changes may be made by those skilled in the art, such changes are encompassed within the spirit of this invention as illustrated, in part, by the appended claims. References:
The following references are all incorporated by reference to the extent they provide information available to one of ordinary skill in the art regarding the implementation of the technical teachings of the invention 1. Dudley, M. W.; Dueber, M T., West, C. A. Plant Physiol 1986, 81, 335-342. 2 Moore, T. C ; Coolbaugh, R. C. Phy to chemistry 1976, 75, 1241-1247.
3. Railton, I D.; Fellows, B., West, C. A. Phytochemistry 1984, 23, 1261-1267
4. Bohlmann, J.; Meyer-Gauen, G , Croteau, R. Proc Natl Acad Sa U S A 1998, 95, 4126-4133. 5. LaFever, R. E ; Stofer Vogel, B.; Croteau, R. Arch Bwchem. Biophys 1994, 313, 139- 149.
6. Williams, D C; Wildung, M. R ; Jin, A. Q.; Dalai, D ; Oliver, J. S ; Coates, R. M.; Croteau, R Arch Bwchem Biophys. 2000, 379, 137-146.
7. Huang, K. X., Huang, Q. L ; Wildung, M. R.; Croteau, R.; Scott, A. I. Protein Expr
Figure imgf000010_0001
8. Peters, R J., Flory, J. E , Jetter, R , Ravn, M. M., Lee, H.-J., Coates, R. M., Croteau, R. B Biochemistry 2000, 39, 15592 -15602
9. Cyr, A., Wilderman, P. R , Determan, M.; Peters, R. J. / Am Chem Soc 2007, 129, 6684-6685 10. Pπsic, S.; Peters, R. J. Plant Physiol 2007, 144, 445-454
11. Smith, M. W.; Yamaguchi, S.; Ait-Ah, T.; Kamiya, Y Plant Physiol 1998, 775, 141 1- 1419.
12. Richter, S ; Lamppa, G. K. Proc Natl Acad Sa. U S A 1998, 95, 7463-7468.
13. Hart, E A , Rice University Houston, TX, 2001 , p 144 14 Matsuda, S. P T., Hart, E A. U S Patent 7,238,514 2004.
15. Stofer Vogel, B ; Wildung, M. R.; Vogel, G , Croteau, R. J Biol Chem 1996, 277,
23262-23268.
16 Sun, T. P ; Kamiya, Y. Plant Cell 1994, 6, 1509-1518 17. Yamaguchi, S , Sun, T P K., H., Kamiya, Y. Plant Physiol 1998, 116, 1271-1278.

Claims

CLAIMSWhat is claimed is:
1. A method comprising: providing one or more plastid proteins comprising a signal sequence and one or more chloroplast processing enzymes; and allowing at least one of the one or more chloroplast processing enzymes to cleave at least a portion of a signal sequence from at least one of the one or more plastid proteins.
2. The method of claim 1 wherein at least one of the one or more plastid proteins is an untruncated protein.
3. The method of claim 1 wherein at least one of the one or more plastid proteins is a diterpene synthase.
4. The method of claim 1 wherein the step of allowing at least one of the one or more chloroplast processing enzymes to cleave at least a portion of a signal sequence from at least one of the one or more plastid proteins increases the solubility in water of the at least one of the one or more plastid proteins.
5. The method of claim 1 wherein the system comprises a geranylgeranyl diphosphate synthase, a hydroxymethylglutaryl CoA reductase, a diterpene synthase, and a chloroplast processing enzyme.
6. The method of claim 1 wherein the chloroplast processing enzyme is derrived from a source selected from the group consisting of an Arabidopsis thaliana and Abies grandis.
7. The method of claim 1 wherein the chloroplast processing enzyme and the one or more plastid proteins are derived from the same organism.
8. The method of claim 1 further comprising allowing the at least one of the one or more plastid proteins to catalyze a reaction.
9. The method of claim 1 further comprising allowing an increased yield of product to be derrived from the plastid proteins.
10. The method of claim 8 wherein the reaction synthesizes one or more diterpene hydrocarbons.
11. The method of claim 10 wherein at least one of the one or more diterpene hydrocarbons is paclitaxel.
12. The method of claim 1 further comprising allowing one or more competing enzymes to be suppressed.
13. A system comprising: one or more plastid proteins; and one or more chloroplast processing enzymes.
14. The system of claim 13 wherein at least one of the one or more plastid proteins comprises a signal sequence.
15. The system of claim 13 wherein at least one of the one or more plastid proteins is an untruncated protein.
16. The system of claim 13 wherein at least one of the one or more plastid proteins is a diterpene synthase.
17. The system of claim 13 wherein the system comprises a geranylgeranyl diphosphate synthase, a hydroxymethylglutaryl CoA reductase, a diterpene synthase, and a chloroplast processing enzyme.
18. The system of claim 13 wherein the chloroplast processing enzyme is derrived from a source selected from the group consisting of an Arabidopsis thaliana and Abies grandis
19. The system of claim 13 wherein the chloroplast processing enzyme and the one or more plastid proteins are derived from the same organism.
20. The system of claim 13 wherein the system further comprises P450-dependent oxidases.
PCT/US2009/051014 2008-07-18 2009-07-17 Systems and methods for producing plastid proteins Ceased WO2010009409A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/008,739 US20110177552A1 (en) 2008-07-18 2011-01-18 Systems and methods for producing plastid proteins

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US8179208P 2008-07-18 2008-07-18
US61/081,792 2008-07-18

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/008,739 Continuation US20110177552A1 (en) 2008-07-18 2011-01-18 Systems and methods for producing plastid proteins

Publications (1)

Publication Number Publication Date
WO2010009409A1 true WO2010009409A1 (en) 2010-01-21

Family

ID=41550733

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/051014 Ceased WO2010009409A1 (en) 2008-07-18 2009-07-17 Systems and methods for producing plastid proteins

Country Status (2)

Country Link
US (1) US20110177552A1 (en)
WO (1) WO2010009409A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6117666A (en) * 1995-08-01 2000-09-12 Arch Development Corporation Plastid proteolytic processing enzyme that cleaves precursor polypeptides
US20040072323A1 (en) * 2001-01-05 2004-04-15 Matsuda Seiichi P.T. Diterpene-producing unicellular organism
JP2005021105A (en) * 2003-07-04 2005-01-27 Sumika Chemical Analysis Service Ltd Method for selecting drug and/or drug metabolite effectively utilized in method for obtaining drug metabolite produced by microorganism

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6117666A (en) * 1995-08-01 2000-09-12 Arch Development Corporation Plastid proteolytic processing enzyme that cleaves precursor polypeptides
US20040072323A1 (en) * 2001-01-05 2004-04-15 Matsuda Seiichi P.T. Diterpene-producing unicellular organism
JP2005021105A (en) * 2003-07-04 2005-01-27 Sumika Chemical Analysis Service Ltd Method for selecting drug and/or drug metabolite effectively utilized in method for obtaining drug metabolite produced by microorganism

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CRESTEIL, T. ET AL.: "Regioselective Metabolism of Taxoids by Human CYP3A4 and 2C8: Structure-Activity Relationship.", DRUG METABOLISM AND DISPOSITION., vol. 30, no. 4, April 2002 (2002-04-01), pages 438 - 445 *
RICHTER, S. ET AL.: "A chloroplast Processing Enzyme Functions as the General Stromal Processing Peptidase.", PNAS., vol. 95, no. 13, June 1998 (1998-06-01), pages 7463 - 7468 *
WILLIAMS, D. C. ET AL.: "Heterologous Expression and Characterization of a ''Pseudomature'' Form of Taxadiene Synthase Involved in Paclitaxel (Taxol) Biosynthesis and Evaluation of a Potential Intermediate and Inhibitors of the Multistep Diterpene Cyclization Reaction.", ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS., vol. 379, no. 1, July 2000 (2000-07-01), pages 137 - 146 *

Also Published As

Publication number Publication date
US20110177552A1 (en) 2011-07-21

Similar Documents

Publication Publication Date Title
JP7617858B2 (en) Methods and cells for the production of phytocannabinoids and phytocannabinoid precursors
CN110651047B (en) Methods and cell lines for the production of phytocannabinoids and phytocannabinoid analogs in yeast
Yamagami et al. Biochemical diversity among the 1-amino-cyclopropane-1-carboxylate synthase isozymes encoded by the Arabidopsis gene family
CN102812129B (en) For producing the microbial project of chemistry and pharmaceutical prod from Isoprenoid pathway
Campbell et al. Engineering of a nepetalactol-producing platform strain of Saccharomyces cerevisiae for the production of plant seco-iridoids
EP2376643B1 (en) Method for producing beta-santalene
US8703454B2 (en) Method for producing (+)-zizaene
EP2742142A2 (en) Recombinant production of steviol glycosides
CA2924541A1 (en) Method for producing fragrant alcohols
JP2002529077A (en) Nucleic acids encoding yew geranylgeranyl diphosphate synthase and methods of use.
EP3140409B1 (en) Drimenol synthase and method for producing drimenol
Souret et al. The mevalonate-independent pathway is expressed in transformed roots of Artemisia annua and regulated by light and culture age
EP2540826B1 (en) Method for producing glucuronic acid conjugate using saccharomyces cerevisiae
CN107849586B (en) Production of aromatic compounds
JP7026671B2 (en) Vetiver
WO2010009409A1 (en) Systems and methods for producing plastid proteins
EP1231266B1 (en) Arabidopsis-origin gdp-4-keto-6-deoxy-d-mannose-3,5-epimerase-4-reductase gene
KR20220079579A (en) Sustainable Generation of Cannabinoids from Simple Precursor Feedstocks Using Saccharomyces cerevisiae
AU2017202313B2 (en) Method for producing beta-santalene
AU2009323128B2 (en) Farmesene synthase
WO2023021392A1 (en) Heterologous production of cytokinins in yeasts

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09798812

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09798812

Country of ref document: EP

Kind code of ref document: A1