WO2009150431A1

WO2009150431A1 - Vector

Info

Publication number: WO2009150431A1
Application number: PCT/GB2009/001471
Authority: WO
Inventors: Venugopal Nair; Luke Lambeth
Original assignee: Institute For Animal Health
Priority date: 2008-06-13
Filing date: 2009-06-11
Publication date: 2009-12-17
Also published as: EP2303334A1; US20120076823A1; GB0810912D0; CN102131526B; CN102131526A; US8501466B2

Abstract

The present invention relates to a herpes virus vector which comprises a modified genomic sequence encoding a microRNA (miRNA) against a target sequence. The herpes virus vector may be used as or in a vaccine to prevent and/or treat a disease.

Description

VECTOR

FIELD OF THE INVENTION

The present invention relates to a herpesvirus vector. In particular, it relates to a herpesvirus vector which comprises a modified genomic sequence capable of encoding a microRNA (miRNA) against a target sequence.

BACKGROUND TO THE INVENTION

Infectious diseases caused by existing and new emerging viruses pose a major threat to human and animal health, in both developed and developing nations. Although some degree of control is achieved by using vaccines and antiviral drugs, such approaches are only effective for a small proportion of these viruses. Recent advances in medicine and molecular biology have uncovered novel approaches and technologies that could be harnessed in the fight against infectious diseases. The discovery of RNA interference (RNAi) as an evolutionarily conserved and sequence- specific gene silencing mechanism in eukaryotes (Fire, A. et al. (1998) Nature 391, 806-11) has paved way for developing RNAi as a powerful therapeutic tool against pathogenic agents such as viruses.

RNA interference (RNAi) is a naturally occurring cellular mechanism of gene suppression that functions in both plants and animals. The conserved RNAi pathway involves the processing of double stranded RNA (dsRNA) duplexes into 21-23 nucleotide (nt) molecules, known as small interfering RNAs (siRNA), to initiate gene suppression (Harmon, (2002) RNA interference. Nature 418, 244-51). In mammalian systems, the cellular processing of long dsRNA can induce an interferon (IFN) mediated antiviral defence mechanism that ultimately leads to non-specific translational shutdown and apoptosis (Stark et al., (1998) Annu Rev Biochem 67, 227-64, Williams, (1997) Biochem Soc Trans 25, 509-13). However, this nonspecific cellular activity can be circumvented by the direct transfection of in vitro synthesized siRNAs of up to 30 nucleotides (nt) in length (Elbashir et al., (2001) Nature 411, 494-8). Since this discovery, the development of DNA-based vectors for expression of short hairpin RNA (shRNA) molecules that are processed within the cell to produce active siRNA molecules has progressed rapidly (Brummelkamp et al, (2002) Science 296, 550-3, Yu et al, (2002) Proc Natl Acad Sci U S A 99, 6047- 52). Such shRNA expression vectors often feature promoters of a small class of RNA polymerase III (pol III) promoters such as U6 and 7SK. There has been a total of five separate U6 promoters described from the human genome (Domitrovich & Kunkel, Nucleic Acids Res 31, 2344-52 (2003), each loci displayed differential transcriptional activities, a finding which has also been seen for the chicken (Kudo & Sutou (2005) J Reprod Dev 51, 411-7, Wise et al, (2007) Anim Biotechnol 18, 153- 62) and the cow (Lambeth et al. , (2006) Anim Genet 37, 369-72).

While initial demonstrations of RNAi in mammalian cells showed suppression of cellular transcripts, more recently both siRNAs and shRNA have been shown to suppress replication of a number of viruses in vitro and in vivo. For example, the efficient inhibition of human pathogens such as hepatitis C virus (Randall & Rice, (2004) Virus Res 102, 19-25), human immunodeficiency virus- 1 (Coburn & Cullen,

(2002) J Virol 76, 9225-31) and influenza A (Ge et al., (2003) Proc Natl Acad Sci U S A 100, 2718-23), as well as livestock viruses such as foot and mouth disease virus (Chen et al., (2004) J Virol 78, 6900-7, Liu et al, (2005) Virology 336, 51-9) by RNAi have been described. The use of RNAi to inhibit the replication of several herpesviruses has also been reported, including murine herpesvirus 68 (Jia & Sun,

(2003) J Virol 77, 3301-6), Epstein-Barr virus (Chang et al, (2004) Gen Virol 85, 1371-9) HSV-I (Bhuyan et al, (2004) J Virol 78, 10276-81) herpesvirus-6B (Yoon et al, (2004) J Biochem MoI Biol 37, 383-5), human cytomegalovirus (Wiebusch et al, (2004) J Gen Virol 85, 179-84), Kaposi sarcoma-associated herpesvirus (Godfrey et al, (2005) Blood 105, 2510-8), duck herpesvirus (Mallanna et al, (2006) Virus Res 115, 192-7) and HSV-2 (Palliser et al, (2006) Nature 439, 89-94).

These studies have involved the introduction of synthetic siRNA, or the genetic transfer of DNA expression cassettes capable of producing siRNA or shRNA in human cells. While this approach may give valuable information about the mechanism of RNAi using cells in culture, it can be difficult to achieve the same effect in vivo. There are difficulties associated with expressing the siRNA in the target cell type and achieving sufficient and sustainable levels of expression. Although the specific and effective nature of RNAi is potentially a highly powerful therapeutic tool, sustainable long-term target gene knockdown still remains a hurdle for widespread therapeutic use of RNAi. Delivery of siRNAs through the use of recombinant viral vectors such as adenoviruses, adeno-associated viruses (AAV) and lentiviruses can overcome some of these problems. However, concerns on the safety of some of these vectors and over-saturation of the RNAi pathway due to higher expression levels of siRNAs are to be tackled (Aagard and Rossi (2007) Adv. Drug Delivery Reviews 59, 75-86).

There is thus a need for an improved RNAi delivery mechanism giving sustainable long-term levels of expression of RNAi in vivo.

SUMMARY OF ASPECTS OF THE PRESENT INVENTION

The present inventors have found that it is possible to modify the endogenous miRNA cluster of herpesviruses, such as Marek's disease virus (MDV) to express miRNA against a target gene(s). As herpesvirus miRNAs are heavily expressed throughout the herpesvirus lifecycle, steady high levels of expression of the modified miRNA can also be achieved.

In a first aspect, the present invention provides a herpesvirus vector which comprises a modified genomic sequence encoding a microRNA (miRNA) against a target sequence.

The modified miRNA may be a therapeutic miRNA, and the vector useful to prevent and/or treat a disease.

The miRNA may be against a target sequence from an infectious pathogen, such as a virus. The miRNA may be capable of silencing the expression of a gene from the infectious pathogen, which may inhibit for example, replication of or infection by the infectious pathogen. The infectious pathogen may be a herpesvirus. As the herpesvirus vector is based on a herpesvirus, it is likely to follow the same route of infection and access the same tissues as the infectious pathogen. This has the advantage that the miRNA will be produced at the correct sites in the body.

If the herpesvirus vector encodes a miRNA against a target sequence from the pathogenic herpesvirus on which the vector is based, there is the added advantage that the vector may act as a traditional vaccine, such as a live attenuated vaccine stimulating an immune response against the infectious pathogen.

If the target sequence within the infectious pathogen, or a sequence having a high degree of identity thereto, occurs in the herpesvirus vector, it may be preferable to modify the herpesvirus vector so that the miRNA does not silence the vector itself.

The herpesvirus vector of the first aspect of the invention may be based on a Marek's disease virus (MDV). The present inventors have shown that there are 13 miRNAs in MDV-I (Yao et al (2008) J Virol 82: 4007-15) and 17 in MDV-2 (Yao et al (2007) J. Virol 81:7164-70), most of which are expressed as clusters. For example, the herpesvirus vector may comprise a modified miR-M7 sequence.

The vector of the first aspect of the invention may be capable of expressing a plurality of modified miRNAs. For example, the vector may comprise a plurality of modified genomic sequences each encoding a modified microRNA. The miRNAs may be against target sequences in the same target gene or different target gene. If the miRNAs are directed against a plurality of target genes, they may be genes within the same target pathogen.

In viruses such as Marek's disease virus (MDV) multiple miRNAs are expressed as polycistronic miRNA transcripts, facilitating the coexpression of multiple modified miRNAs.

The expression of multiple miRNAs is particularly advantageous for use against escape-prone viral pathogens, such as HFV. Minor sequence changes in the target sequence, sometimes even a single point mutation, can be sufficient to overcome RNAi-mediated inhibition, due to the exquisite substrate-specificity of RNAi. Hence, HIV can escape inhibition by RNAi if mutation occurs within the target sequence. This risk is greatly reduced by simultaneous expression of a plurality of miRNAs, as escape would then theroretically involve mutation of all of the target sequences.

In a second aspect, the present invention provides a method for producing a vector according to the first aspect of the invention, which comprises the step of introducing one or more mutations in the sequences encoding the strands forming the stem of the stem-loop structure of a pri-miRNA encoded by the herpesvirus vector genome.

Where the creation of the desired miRNA-encoding sequence would involve multiple point mutations, it may be simpler to replace the mi-RNA sequence with a foreign sequence.

In order to ensure the pre-miRNA is efficiently cleaved by dicer, the mutations may be designed so that the modified pre-miRNA retains the structural features of the natural pre-miRNA.

The method of the second aspect of the invention may comprise the following steps: (i) amplification of the genomic miRNA of a herpesvirus; (ii) mutation of the miRNA;

(iii) generation of a mutant clone of the herpesvirus by BAC mutagenesis to produce a herpesvirus vector which comprises a modified genomic sequence, capable of encoding a micro RNA (miRNA) against a target sequence.

In a third aspect, the present invention provides a vaccine comprising a herpesvirus vector according to the first aspect of the invention.

The vector or vaccine of the invention may be used to prevent and/or treat a disease. The disease may be a viral disease. The disease may, for example, be selected from the following group: HIV, hepatitis viruses, Respiratory Syncytial viruses (RSV), Marek's disease, avian influenza, infectious bursal disease, chicken anaemia, Newcastle disease, infectious bronchitis, Reovirus infections, infectious laryngeotracheitis and fowl pox.

Alternatively, the target sequence could be any host gene whose expression could be specifically silenced by the herpesvirus expressing the modified miRNA against that gene in a cell type-specific manner depending on the tropism of the herpesvirus. For example, neurotropic herpesviruses such as HSV-I could be used to silence genes involved in neurologic disorders, or herpesviruses expressing modified miRNAs capable of specific gene silencing could be used as therapeutic vaccines in conditions such as cancer.

DESCRIPTION OF THE FIGURES

Figure 1 shows the details and the names of the miRNAs encoded by different herpesviruses.

Figure IA shows the secondary structures of MDV-I pre-miRNAs predicted using the MFOLD algorithm. The mature miRNA strands are shown in red.

Figure 2 shows the genomic locations of MDV-I miRNAs. The schematic diagram shows where the MDV-I miRNAs (small arrowheads) identified in this report map. The TR_L and IR_L regions flanking the unique long region and the TRs and IRs regions flanking the unique short regions are shown. Genomic positions and orientations of MDV ORFs contained in the miRNA loci are indicated.

Figure 3 shows the nucleotide sequence of the MDV-I miR-6-7-8-10 cluster. The sequences of the miRNA strands of each of the miRNAs are shown in colour.

Figure 4 is a schematic diagram outlining the strategy for modifying the MDV-I miR-M7 sequence as siRNA against the Luciferase gene. All sequences in red are native miRNA sequences, black sequences are luciferase shRNA sequences, and blue sequences are complementary strands and are for visualisation only.

Figure 4A shows silencing of a luciferase reporter gene using MDV miR-6 and miR- 7 loci shRNA. Figure 5 is a diagrammatic representation of the structure of modified miRNAs in the modified MDV-I miRNA cluster, in which miR-M8, miR-M6 and miR-M7 have been modified.

Figure 6 shows Northern Blotting analysis showing the expression of miRNAs encoded by MDV-I .

Figure 7 shows Northern Blotting analysis showing the expression of miRNAs encoded by MDV-2.

Figure 8 shows Northern Blotting analysis showing the expression of miRNAs encoded by HVT strains of MDV.

Figure 9 shows quantitative RT-PCR measuring the levels of ICP4, Meq and miR-4, miR-8 and miR-12 transcripts in MDV-transformed cells.

DETAILED DESCRIPTION

HERPESVIRUS VECTOR

The term "vector" is used to indicate a herpesvirus which is capable of delivering a nucleotide of interest NOI) to a target cell. In the context of the present invention the NOI is, or is capable of producing an miRNA.

The NOI may be, for example, a genomic sequence capable of encoding a pri- miRNA, a priMRNA sequence, a pre-miRNA sequence, or a mature miRNA.

The herpesvirus vector may be derivable from a herpesvirus, for example, MDV, HVT, HSV- 1 , HS V-2, VZV, EBV or CMV (see below).

Where a vector is "based on" a particular herpesvirus, it indicates that the vector is derivable from the wild-type virus, but may be modified, for example to reduce its virulence. The vector may, for example, be attenuated (see below) and/or modified to increase its immunogenicity or target it to a particular tissue.

The herpesvirus expressing the modified miRNA may silence expression of a target gene in a cell type-specific manner depending on the tropism of the herpesvirus. This means that it is possible to select a herpes virus, based on its cell tropism, to silence expression of a target gene in particular cells of interest.

Table 1 shows herpesviruses which encode miRNAs and their cell tropism.

Table 1

RNAi

There are two major classes of small RNAs that are characteristic of RNAi: (i) first is the small interfering RNAs (siRNAs) which are 21-23 fully base-paired duplexes which interact with perfect base-pairing with a region of the messenger RNA transcript triggering its specific degradation through the RNA-induced silencing complex (RISC) (Rana, T. M. (2007)Nat Rev MoI Cell Biol 8, 23-36). The technology and application of silencing of specific genes and viruses using siRNAs is progressing steadily and several trials are in progress (Aagaard, L. & Rossi, J. J. (2007) Adv Drug Deliv Rev 59, 75-86; de Fougerolles et al (2007) Nat Rev Drug Discov 6, 443-53). These are usually induced by polymerase III promoters (e.g. U6, Hl etc) from short hairpin RNA (shRNA) expression vectors, (ii) Second is the microRNAs (miRNA) which are 21-23 base duplexes that are usually base-paired incompletely forming partial duplexes within the 3' untranslated region (UTR) of targeted transcripts through RISC resulting in the inhibition of translation. Several miRNAs have been identified in different species (Griffiths-Jones et al (2008) Nucleic Acids Res 36, D 154-8). These are thought to be expressed and regulated similar to the protein-coding genes from polymerase II promoters, first as long primary transcripts (pri-miRNAs) (Lagos-Quintana, M. et al. (2002) Curr Biol 12, 735-9). The pri-miRNA is cleaved by the nuclear Drosha-DGCR8 complex to produce pre-miRNA, which are further processed in the cytoplasm to mature miRNA duplex. The expression of many of these miRNAs is restricted to specific cell lineages and developmental stages, and recent data suggest that they exert profound influence on gene regulation in a wide range of conditions and diseases including cancer (Skafitnesmo et al (2007) Curr Pharm Biotechnol 8, 320-5).

miRNA

The first discovery of virus-encoded miRNAs was made in the EBV genome (Pfeffer, S. et al. (2004) Science 304, 734-6). Since then, several virus-encoded miRNAs have been identified (Pfeffer, S. et al. (2005) Nat Methods 2, 269-76; Cullen, B. R. (2006) Nat Genet 38 Suppl, S25-30; Nair, V. & Zavolan, M. (2006) Trends Microbiol 14, 169-75) with herpesviruses accounting for nearly all (124/127) virus-encoded miRNAs in miRBase (Griffiths- Jones et al (2008) Nucleic Acids Res 36, Dl 54-8). The present inventors have reported the identification of several novel miRNAs in Marek's disease virus (MDV), alphaherpesviruses belonging to the genus Mardivirus in the family Herpesviridae. These include 13 miRNAs in MDV-I (Yao, Y. et al. (2008) J Virol 82, 4007-15), 17 in MDV-2 (Yao, Y. et al. (2007) J Virol 81, 7164-70) and 11 in HVT (unpublished). Most of these miRNAs are expressed as clusters and the genomic structure of these miRNAs is provided in Figure 1. The majority of these miRNAs are expressed at very high levels in infected cells/tissues as shown by Northern blotting (Figures 6, 7, and 8), and qPCR analysis (Figure 9).

The present inventors have found that it is possible to modify the endogenous genomic miRNA-encoding sequence in a herpesvirus miRNA cluster so that is expresses a modified miRNA. This modified miRNA may be complementary to a target sequence of interest.

Thus in a first aspect, the present invention provides a herpesvirus vector which comprises a modified genomic sequence encoding a microRNA (miRNA) against a target sequence.

The term "modified" is used to indicate that the genomic miRNA-encoding sequence comprises one or more mutations, such that it produces a modified miRNA which is different from the miRNA sequence which would have been produced, had the genomic sequence not been mutated. The genomic miRNA-encoding sequence is endogenous, in the sense that its sequence, prior to modification, occurs naturally within the herpesvirus genome.

The "modifications" i.e. mutations in the genomic miRNA encoding sequence, are made in the sequences encoding the two strands which form the stem of the stem- loop structure. Symmetrical mutations should be made in each strand-encoding sequence, so the correct stem-loop structure is produced in the pri-miRNA.

The miRNA produced by the vector of the present invention is typically between 20 and 25, for example 21-23 base pairs in length.

TARGET SEQUENCE The target sequence may be part of a target gene.

Where the disease is an infectious disease, the target sequence or target gene may be a target sequence or target gene from an infectious pathogen.

Alternatively, the target sequence or target gene may be a host gene whose expression is desired to be reduced or silenced. For example, it may be desirable to silence expression of a particular gene associated with the pathogenic immune response generated during an allergy or autoimmune disease. Also, in cancer, it may be possible to silence expression of gene(s) involved in abnormal cell proliferation.

Herpesviruses express miRNA against host gene as part of their normal biology. In the context of the present invention, where the miRNA is against a target sequence from a host gene, the host gene is different from the gene usually silenced by that particular miRNA. The miRNA has been modified to target a selectedhost gene, not normally silenced by that miRNA.

The target sequence or target gene may alternatively be a gene of interest in an animal model. In this way, the technology may be used to investigate the effect of silencing a host gene, in order to provide information about the function of the gene.

In a mouse model, the muring herpesviruses MHV-68 and MCMV may be useful in this application as they target lymphocytes, macrophages, dendritic cells and endothelial cells and express high levels of miRNA in these cells.

The target sequence is a sequence to which the miRNA binds. The target sequence may be RNA, in particular messenger RNA (mRNA).

Where the target sequence is from an infections pathogen, the target sequence or target gene may be an essential sequence, without which the infectious pathogen cannot perform an essential function, such as replication or infection of the host. If expression (i.e. transcription or translation) of an essential target sequence is blocked, the pathogen may not be viable. In MDV, studies have shown that the gB envelope glycoprotein is essential for MDV replication (Schumacher et al., 2000), and is likely to be involved in viral spread. Another attractive candidate is the replication gene UL29 as this is a highly conserved gene that encodes the single- stranded DNA binding protein that has already proved to be an excellent candidate for RNAi directed against HSV-2 (Palliser et al., 2006).

The vector may be able to express a plurality of miRNAs each against a different target sequence. The target sequences may be different sequences within the same target gene or within different target genes. Where two or more miRNAs are expressed against the same target gene, they may have an "additive effect" causing enhanced silencing of the target gene.

The term "against" means that the miRNA specifically recognises the target sequence. The miRNA has a complementary nucleotide sequence to the target sequence. Typically the miRNA will be 100% complementary to the target sequence. However, it is thought that miRNAs, unlike siRNAs derived from long dsRNA precursors, can tolerate a degree of incomplete base pairing. Hence the miRNA may have three, two or preferably one mismatch with the target sequence.

The miRNA may silence the expression of the target sequence or target gene. The expressed miRNA is incorporated into the RNA-induced silencing complex (RISC) where it pairs with the target sequence. Where the target sequence or target gene is mRNA, the RISC may then cause post-transcriptional gene silencing, where specific base pairing causes degradation of the target sequence by argonaute, the catalytic component of the RISC complex, hi connection with this aspect, the target sequence ma be within the 3' UTR of the mRNA.

The RISC complex may alternatively or also affect transcription of a target sequence (which may therefore be a DNA sequence) by causing epigenetic changes to a gene, such as histone modification and DNA methylation, which affects the degree the gene is transcribed.

The term "silenced" indicates that expression of the target seqnence or target gene is partially or completely reduced, compared to the level of expression which would be seen in the absence of the miRNA. Expression of the target gene may be silenced by, for example at least 50, 60, 70, 80, 90 or 95%.

Once a target gene has been identified, it is possible to identify candidate miRNA sequences using techniques known in the art, such as using the siRNA design platform from Eurogenetec.

One of the advantages of the vector of the present invention is that the miRNA is produced from the herpesvirus vector genome in the same way as an endogenous miRNA sequence, and can then silence the target gene using the regluatory mechanisms of the natural herpesvirus loci.

In the natural miRNA maturation pathway, the primary miRNA (pri-miRNA) is transcribed from its genomic location and cleaved by the microprocessor complex, which comprises Drosha and DGCR8. The resulting pre-miRNA is actively transported to the cytoplasm by transportin 5, where the pre-miRNA undergoes further processing into the mature miRNA by Dicer and its co-factors, PACT and TAR RNA binding protein TBRP. The mature niRNA is then loaded on to the RISC complex.

Modification of the miRNA encoding sequence should be designed to retain any sequence and structural features needed for efficient recognition by Drosha, DGCR8, transportin 5, Dicer and its co-factors, or the RISC complex. For example, hi order to ensure the pre-miRNA is efficiently cleaved by dicer, deliberate mismatches may be included in the sequences encoding the two strands of the basepaired stem may be modified to mimic structural features of the natural pre-miRNA.

hi the context of the present invention the "natural" pri-miRNA, pre-miRNA or miRNA sequence is that which would have been produced by the herpesvirus hi the absence of any modification.

VACCINE The present invention also relates to a vaccine. A vaccine is an antigenic preparation used to establish immunity to a disease.

The herpesvirus vector itself will induce an immunological response when administered to a subject. This immune response may also be valuable in treating or preventing the disease. For example, where the disease is an infectious disease, the immune response may also help to control or eliminate infection by the pathogen.

The herpesvirus vector of the first aspect on the invention may be based on a herpesvirus which is already used as a vaccine.

It may be based on an attenuated herpesvirus i.e. a herpesvirus which has been cultivated under conditions that reduce its virulence.

Viruses may be attenuated by passage of the virus through a foreign host, such as by tissue culture or passage through embryonated eggs or live animals. In such methods, the initial viral population is applied to the foreign host. There is selection pressure for any mutant having an increased capacity to infect the new host. This mutant will normally have a lower virulence in the original host, but retains the capacity of the original virus to induce an immune response, making it an attractive vaccine candidate.

It has been found that the miRNA clusters of herpesviruses are conserved in the attenuated vaccine strains.

Live attenuated vaccines are widely used for immunisation against many viral infections, particularly in veterinary medicine, such as against Marek's disease (see below).

In live vaccination it is also possible to use a microorganism which does not give rise to the target disease, but which causes the generation of a protective immune response to the target disease. The classical observation by Jenner in 1796 that exposure to cowpox provided protection against smallpox was based on this type of immune response. In Marek's disease, herpes virus of turkey (HVT) can be used to induce an immune response which will protect against Marek's disease virus (MDV).

The herpesvirus-based vaccine of the present invention will induce an anti-vector immune response. Where the vector is based on or highly similar to the target infectious pathogen, this anti-vector immune response may be directly relevant to protection against the infectious pathogen.

Where the target infectious pathogen is dissimilar to the herpesvirus vector (for example where the infectious pathogen is a different type of virus, or even a non- viral pathogen) the non-adaptive portion of the anti-vector immune response may still be useful for pathogen clearance.

MODIFICATION OF ESTABLISHED VACCINES

The virus vaccine may be based on an established live vaccine already proposed or in use in the treatment and/or prevention of a disease.

Established live vaccines include the MMR vaccine which is a mixture of three live attenuated viruses, for immunization against measles, mumps and rubella.

Established vaccines for the treatment of herpes virus infections include Varivax , a live- varicella virus vaccine against chicken pox and vaccination with live attenuated strains of MDV against MD. A live herpesvirus vaccine has also been used with some success against equine herpesvirus infections (Patel et ah, (2003) Vet. Microbiology 20;92(l-2):l-17).

MD VACCINES

In the 1970's MD control was achieved predominantly by vaccination with herpesvirus of turkey (HVT, serotype 3). This was to some extent supplanted with the development of serotype 2 vaccines in the 1980s, such as SB-I and 301B/1. More recently, serotype 1 vaccines have been developed such as attenuated HPRS- 16 and CVI988 (Rispens vaccine) strains. Rispens vaccine, produced from a natural isolate of low oncogenicity, has been widely used, in particular because it has been found to be highly effective against very virulent strains of the MDV virus.

For the purposes of the present invention, vaccines based on the original HVT vaccine have some advantages. For example, unlike serotype 1 and 2 strains, HVT can be produced in a cell free system. Also, as the HVT genome shows a relatively low degree of sequence identity with the MDV genome (about 70%), there is a good chance that an miRNA sequence targeting a site on the MDV genome will not significantly affect replication of an HVT-based virus vaccine.

On the other hand, serotype 1 strains, such as the Rispens vaccine induce a more effective immune response, particularly against MDV strains of high virulence. An anti-MD virus of the present invention based on an established MD vaccine has the advantage that it combines induction of an anti-MD immune response with inhibition of MDV replication via RNAi. In order to maximise the former effect, it may be desirable to use a serotype 1 vaccine.

Although serotype 1 vaccines such as Rispens have a higher degree of sequence identity to MDV than HVT, it is still possible to design a vaccine expressing an miRNA molecule that blocks replication of MD, but not the vaccine. For example, once the target sequence on an MDV gene has been selected, the corresponding sequence in the vaccine genome can be mutated to decrease the degree of identity with the MDV gene. This makes it less likely that the miRNA sequence will recognise the vaccine genome sequence. Site directed mutagenesis can be used to alter bases in any part of the vaccine genome which has a high degree of identity to the target sequence.

In order to avoid the mutations having any effect on the vaccine itself, silent mutations can be introduced which alter the DNA sequence, but do not affect the amino acid sequence of the translated protein. Such mutations are possible due to the degeneracy of the genetic code. DISEASE

The modified herpesvirus vector of the present invention may be used for treating and/or preventing a disease.

'Treating' as used herein refers to treatment of a subject having a disease in order to ameliorate, cure or reduce the symptoms of the disease, or reduce or halt the progression of the disease.

The term 'preventing' is intended to refer to averting, delaying, impeding or hindering the contraction of a disease. For example, the vaccine of the present invention may be used to prevent an autoimmune disease or an allergic reaction in a subject.

The disease may be an infectious disease, such as an infectious viral disease. Infectious viral diseases of mammalians subject, such as humans include, but are not limited to, AIDS, chickenpox (varicella), common cold, dengue fever, herpes simplex, herpes roster, influenza, measles, infectious mononucleosis (glandular fever), mumps, norovirus, poliomyelitis (polio), rabies, rubella, SARS, viral encephalitis, viral gastroenteritis, viral meningitis, viral pneumonia, west Nile disease and yellow fever.

Infectious diseases of avian subject, such as chickens include, but are not limited to: avian influenza, infectious bursal disease, chicken anaemia, Newcastle disease, infectious bronchitis, Reovirus infection, infectious laryngeotracheitis, fowl pox.

In particular, the disease may be caused by a herpesvirus.

The family Herpesviridae include eight distinct viruses known to cause disease in humans, as shown in the following table:

Human Herpesvirus (HHV) classification

nimal virology the most important herpesviruses can be summarised as follows:

• Subfamily Alphaherpesvirinae

o Genus Simplexvirus

■ Bovine herpesvirus 2 causes bovine mammillitis and pseudo- lumpyskin disease.

■ Cercopithecine herpesvirus 1, also known as Herpes B virus, causes a Herpes simplex-like disease in Macaques.

^■ Ateline herpesvirus 1, Spider monkey herpesvirus.

o Genus Varicellovirus

■ Bovine herpesvirus 1 causes infectious bovine rhinotracheitis, vaginitis, balanoposthitis, and abortion in cattle.

^■ Bovine herpesvirus 5 causes encephalitis in cattle.

^■ Caprine herpesvirus 1 causes conjunctivitis and respiratory disease in goats.

^■ Porcine herpesvirus 1 causes pseudorabies.

^■ Equine herpesvirus 1 causes abortion in horses.

■ Equine herpesvirus 3 causes coital exanthema in horses.

^■ Equine herpesvirus 4 causes rhinopneumonitis in horses.

■ Canine herpesvirus 1 causes a severe hemorrhagic disease in puppies.

^■ Feline herpesvirus 1 causes feline viral rhinotracheitis and keratitis in cats.

^■ Duck herpesvirus 1 causes duck plague.

o Genus Mardivirus ^■ Gallid herpesvirus 2 causes Marek's disease.

- Gallid herpesvirus 3 (GaHV-3 or MDV-2)

■ Herpesvirus of turkeys (HVT)

o Genus Htovirus

■ Gallid herpesvirus 1 causes infectious laryngotracheitis in birds.

• Subfamily Betaherpesvirinae

o Porcine herpesvirus 2 causes inclusion body rhinitis in swine.

• Subfamily Gammaherpesvirinae

o Genus Rhadinovirus

■ Alcelaphine herpesvirus 1 causes bovine malignant catarrhal fever.

■ Bovine herpesvirus 4

■ Equine herpesvirus 2 causes equine cytomegalovirus infection.

■ Equine herpesvirus 5

Alternatively, the disease may be an allergy, autoimmune disease, neurological disorder, hypertension or cancer.

A list of potential herpervirus miRNA-based applications is given in Table 2. Table 2

SUBJECT

The subject may be a mammalian subject, such as a human.

Alternatively the subject may be an avian subject, such as a poultry subject, in particular a chicken.

The technology may also be used in model animals, such as mouse models of a disease.

ADMINISTRATION The choice of delivery system may depend of the number and type of subjects to be treated. The method and pharmaceutical composition of the invention may be used to treat a human or animal subject. Typically, a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular subject.

Mammalian Subjects

The routes for administration (delivery) in mammalian subjects may include, but are not limited to, one or more of oral (e.g. as a tablet, capsule, or as an ingestable solution), topical, mucosal (e.g. as a nasal spray or aerosol for inhalation), nasal, parenteral (e.g. by an injectable form), gastrointestinal, intraspinal, intraperitoneal, intramuscular, intravenous, intrauterine, intraocular, intradermal, intracranial, intratracheal, intraturnoural, intravaginal, intracerebroventricular, intracerebral, subcutaneous, ophthalmic (including intravitreal or intracameral), transdermal, rectal, buccal, vaginal, epidural, sublingual or systemic.

The composition administered may optionally comprise a pharmaceutically acceptable carrier, diluent, excipient or adjuvant. The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise as (or in addition to) the carrier, excipient or diluent, any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents known in the art.

Vaccines are conventionally administered to mammalian subjects parenterally, by injection, for example, either subcutaneously or intramuscularly.

For parenteral administration, the compositions are best used in the form of a sterile aqueous solution which may contain other agents, for example enough salts or monosaccharides to make the solution isotonic with blood.

Avian Subjects For large numbers of birds, individual administration systems may not by practicable, so application by spray, or via feed or drinking water may be more appropriate.

For smaller numbers of birds, it may be possible to treat each bird individually, which usually results in a more uniform dosage. Individual administration methods include eye drop administration, intranasal administration and parenteral delivery.

There may be different composition/formulation requirements dependent on the different delivery systems. By way of example, the composition of the present invention may be formulated to be delivered by an oral route (e.g. in drinking water or feed, or by spray application) by a mucosal route, or parenterally in which the composition is formulated by an injectable form, for delivery, by, for example, an intravenous, intramuscular or subcutaneous route.

The composition may be formulated for in ovo or post-hatch delivery.

The term "in ovo", means into a bird egg containing a live, developing embryo.

The term "administering in ovo" or "in ovo administration", means administering the vaccine to a bird egg containing a live, developing embryo by any means of penetrating the shell of the egg and introducing the vaccine. Such means of administration include, but are not limited to, injection of the vaccine.

Various in ovo administration method are known in the art. An injection method may include the steps of making a hole is made in the egg shell at the large end of the egg using an appropriate needle to expose the egg's air cell, inserting a needle connected to a syringe through the hole and through the membrane of the air cell, and then injecting the vaccine into the egg. The site of injection can be within any region of the egg or embryo. Preferably, injection is done axially through the centre of the large end of the egg into the amnion.

An automated egg injection system can be used. Such systems known in the art (see for example U.S. Pat. Nos. 4,681,063, 4,040,388, 4,469,047, and 4,593,646). Post-hatch vaccination systems for birds include spray applications and administration via feed or drinking water.

For spray applications a special cabinet may be used. Chicks can be vaccinated in the hatchery because the sprayer enables uniform distribution. A certain amount of spray (such as 20 ml) is delivered for each box of 100 chicks. Chicks "preen" to clean and dry their feathers and ingest the vaccine. Red dye mixed in with the vaccine gets their attention and stimulates preening, and also indicates which boxes of chicks have been vaccinated.

Administration via feed/drinking water is less uniform that spraying due to differences in uptake between birds. There is also a possible contamination problem. However, this type of administration is possible for older birds (i.e. when hatchery application is not possible).

Where the composition is to be delivered mucosally through the gastrointestinal mucosa, it should be able to remain stable during transit though the gastrointestinal tract; for example, it should be resistant to proteolytic degradation, stable at acid pH and resistant to the detergent effects of bile.

METHOD

In a second aspect, the present invention provides a method for producing a vector according to the first aspect of the invention, which comprises the step of introducing one or more mutations in the genomic miRNA encoding sequence of a herpesvirus.

In order that the pri-miRNA forms a stem-loop structure, symmetrical mutations may be made in the sequences encoding the strands forming the stems of the stem-loop structure.

The mutation may be an addition, substitution or deletion. Single i.e. point mutations may be made, for example by site-directed mutagenesis. If, on the other hand, multiple mutations would need to be made in order to arrive at the desired sequence, it may be simpler to excise and ligate in a foreign sequence.

The term "foreign" indicates a miRNA-encoding sequence which is different from the endogenous sequence, and which produces a different, heterologous, miRNA.

The foreign sequences substituted in for each strand-encoding sequence may include deliberate mismatches so that the modified pre-miRNA mimics the structural features of the natural pre-miRNA.

In one embodiment the method of the invention involves the following: (i) amplification of the miRNA sequence of a herpesvirus; (ii) mutation of the miRNA;

(iii) generation of a mutant herpesvirus vector which comprises a genomic sequence encoding the modified miRNA.

Mutant clones may be generated by methods known in the art, such as BAC mutagenesis.

The invention will now be further described by way of Examples, which are meant to serve to assist one of ordinary skill in the art in carrying out the invention and are not intended in any way to limit the scope of the invention.

EXAMPLES

Example 1 - Modification of the MDVl-miR-M8-13-6-7-10 cluster

Marek's disease virus type 1 (MDV-I) encodes thirteen miRNAs clustered in the MEQ and LAT regions of the viral genome (Yao et al (2008) J. Virol 82:4007-4015). The predicted secondary structures of all thirteen MDV pre-miRNAs are shown in Figure 1. The genomic location of each miRNA is given in Figure 2. These include the MDVl-miR-M8-13-6-7-10 cluster located between the 'a-like' sequence and the ICP4 within the large intron of the LAT. Of the five miRNAs encoded from this cluster, miR-M13 and miR-M10 are expressed at very low levels. The complete sequence of the cluster with the miRNA sequences are shown in Figure 3.

The cluster region is amplified by PCR and cloned into a vector to facilitate manipulation. The MDV-I miR-M7 microRNA was mutated to modify it into a luciferase siRNA as shown in Figure 4. Similar mutagenesis was also carried out for miR-M6.

Example 2 - Silencing of a reporter gene

Mutant clones of MDV were generated by BAC mutagenesis and the silencing effect of the modified miRNAs on expression of Luciferase was tested. A similar procedure was repeated independently for miR-M6. Preliminary results using this modified miR-M7 and miR-M6 have shown that miR-7-hRluc-22 and miR6-hRlucl9 constructs are functional in silencing the luciferase reporter gene (Fig 4A).

Methods

Constructs for the luciferase assays with luciferase shRNA at the miR-7 locus

The synthetic miR-LAT sequence featured two BsmBl restriction sites, each on opposite strands of the DNA, to permit the insertion of annealed DNA oligonucleotides for the replacement of miR-6. For replacement of miR-7, two Aarl restriction sites, also on opposing strands of the DNA, were utilised for the insertion of annealed DNA oligonucleotides. The shRNAs constructs are cloned into pEGFP vector to drive the expression from the pCMV promoter.

Briefly, the miR-LAT-HPC vector was digested with Aarl, gel purified and used in a ligation reaction with the annealed complimentary DNA oligonucleotides encoding the Renilla luciferase shRNAs (see below). All recombinant plasmids were DNA sequenced to verify the luciferase inserts.

pNl-miR-IAT-HPC miR-7 locus

BamHI Aarl AACGCTCCAAGIGAGA ACTGGCAGGTGCGGATCCGCACCTGCAGTT I TTTG GGGGA TTGCGAGGTTC CTCT I TGACCGTCCACGCCTAGGCGTGGACGTCAA AAAC I CCCCT Aarl Oligonucleotides for the generation of luciferase shRNA

5'-GRGAAC GTTGATGAAGGAGTCCAGCTCG TCTCTCCTACCAGCAAC CGAACTGGACTACTTCATGAAC GTT -3' 5'-CAAAAAC GTTCATGAAGTAGTCCAGTTCG GTTGCTGGTAGGAGAGA CGAGCTGGACTCCTTCATCAAC GT -3'

Note: underlined sequences in the oligonucleotides represent overhangs required for insertion into the Aarl site.

DNA transfections and luciferase assays

Line 0 chicken embryo fibroblast (CEF)-derived DF-I cell line was grown in DMEM medium supplemented with 10% fetal calf serum (FCS) and 1% sodium puruvate.

Transfection into DF-I cells for luciferase reporter assays was carried out in 24-well plates with Lipofectamine 2000 (Invitrogen) according to the manufacture's protocols. Briefly, 24-well plates were seeded (1.1 x 10^s cells/well) 24 hours before transfection, and 500 ng of shRNA expression constructs (and mutant control vectors) were co-transfected with 500 ng psiCHECK™-2 vectors (Promega). Firefly and Renilla luciferase activities were measured consecutively with the Dual-

Luciferase^® Reporter Assay System (Promega) using the Lucy 1 luminometer

(Anthos Labtec). In all cases, a constitutively expressed Firefly luciferase activity in psiCHECK™-2 vector served as a normalisation control for transfection efficiency.

All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in cellular studies using flow cytometry or related fields are intended to be within the scope of the following claims.

Claims

1. A herpesvirus vector which comprises a modified genomic sequence encoding a microRNA (miRNA) against a target sequence.

2. A herpesvirus vector according to claim 1, for treating and/or preventing a disease.

3. A herpesvirus vector according to claim 2, for treating an infectious disease, an allergy, a neurological disorder, hypertension, autoimmunity, or a cancer.

4. A herpesvirus vector according to claim 1, wherein the miRNA is against a target sequence from a host gene.

5. A herpesvirus vector according to claim 4, for silencing expression of a host gene in an animal model.

6. A herpesvirus vector according to claim 1, wherein the miRNA is against a target sequence from an infectious pathogen.

7. A herpesvirus vector according to claim 6, wherein the infectious pathogen is a virus.

8. A herpesvirus vector according to claim 7, wherein the infectious pathogen is a herpesvirus.

9. A herpesvirus vector according to claim 8, which is based on a pathogenic herpesvirus.

10. A herpesvirus vector according to claim 9, which encodes a miRNA against a target sequence from the pathogenic herpesvirus on which the vector is based.

11. A herpesvirus vector according to claim 10, wherein the target sequence encoding portion of the vector genome is modified, such that it is not itself silenced by the miRNA.

12. A herpesvirus vector according to any preceding claim which is based on a Marek's disease virus.

13. A herpesvirus vector according to any preceding claim, capable of expressing a plurality of modified miRNAs.

14. A method for producing a vector according to any preceding claim, which comprises the step of introducing one or more mutations in the sequences encoding the strands forming the stems of the stem-loop structure of a pri-miRNA encoded by the herpesvirus vector genome.

15. A method according to claim 14, which comprises the step of replacement of the endogenous strand-encoding sequences with foreign sequences, to produce a modified miRNA.

16. A method according to claim 15, in which the foreign sequences include deliberate mismatches so that the modified pre-miRNA mimics the structural features of the natural pre-miRNA.

17. A method according to any of claims 14 to 16, which comprises the following steps:

(i) amplification of the miRNA sequence of a herpesvirus; (ii) mutation of the miRNA;

(iii) generation of a mutant clone of the herpesvirus by BAC mutagenesis to produce a herpesvirus vector which comprises a modified genomic sequence, capable of encoding a microRNA (miRNA) against a target sequence.

18. A vaccine comprising a herpesvirus vector according to any of claims 1 to 13.

19. The use of a herpesvirus vector according to any of claims 1 to 13 in the manufacture of a medicament for use in treating and/or preventing a disease.