WO2009150284A9 - Conjugados de apo-a para la administración de compuestos biológicamente activos - Google Patents

Conjugados de apo-a para la administración de compuestos biológicamente activos Download PDF

Info

Publication number
WO2009150284A9
WO2009150284A9 PCT/ES2009/070224 ES2009070224W WO2009150284A9 WO 2009150284 A9 WO2009150284 A9 WO 2009150284A9 ES 2009070224 W ES2009070224 W ES 2009070224W WO 2009150284 A9 WO2009150284 A9 WO 2009150284A9
Authority
WO
Grant status
Application
Patent type
Prior art keywords
according
ifn
apo
conjugate
component
Prior art date
Application number
PCT/ES2009/070224
Other languages
English (en)
French (fr)
Other versions
WO2009150284A2 (es )
WO2009150284A3 (es )
Inventor
VALTUEÑA Jesús María PRIETO
LÓPEZ Pedro BERRAONDO
Jessica Fioravanti
Original Assignee
Proyecto De Biomedicina Cima, S.L.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/5434IL-12
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/555Interferons [IFN]
    • C07K14/56IFN-alpha
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/775Apolipopeptides

Abstract

La invención se relaciona con un conjugado que comprende una molécula de Apo A o una variante funcionalmente equivalente de la misma y un compuesto de interés terapéutico en donde ambos componentes se encuentran unidos covalentemente así como a los usos de dichos conjugados en terapia para el direccionamiento específico de dichos compuestos a aquellos tejidos que presentas sitios de unión específicos para la molécula de ApoA.

Description

CONJUGADOS PARA LA ADMINISTRACIÓN DE COMPUESTOS

BIOLÓGICAMENTE ACTIVOS

CAMPO TÉCNICO DE LA INVENCIÓN

La invención se encuadra dentro del campo de los métodos para la estabilización y el direccionamiento de compuestos de interés terapéutico de forma específica a tejidos diana. En particular, la invención se basa en la capacidad de la apolipoproteina A de dirigir compuestos de interés terapéutico a todos aquellos tejidos que presentan en su superficie sitios de unión de alta afinidad para dicha proteína.

ANTECEDENTESDELAINVENCIÓN

EI desarrollo de nuevas formas de terapia que usan macromoléculas como principios activos ha generado la necesidad de desarrollar formas efectivas de estabilizar y de dirigir dichas moléculas a sus dianas celulares apropiadas. Ejemplos de terapia que requieren el direccionamiento específico a un tejido diana incluyen terapias basadas en el uso de factores de crecimiento específicos o en el uso de genes que se usan para reemplazar genes ausentes o deficientes en el tejido diana. Los sistemas específicos de tejido que no están basados en vectores virales sufren frecuentemente el problema de su baja o nula especificidad celular.

Se han descrito distintos sistemas para el direccionamiento de compuestos terapéuticos a las células hepáticas basados en vesículas lipidíeos que contienen el compuesto terapéutico en su interior y cuyo direccionamiento viene dado por la presencia en la superficie de las vesículas de moléculas que muestran afinidad por las membranas de las células hepáticas.

Por ejemplo, WO07130873 describe métodos para el direccionamiento de microvesículas a las células hepáticas mediante la incorporación en la superficie de dichas cápsulas de un compuesto que es reconocido específicamente por los receptores de asialoglicoproteinas, de hialuronano, de N-acetil-galactosamina o de mañosa presentes en las células hepáticas. WO02086091 describe métodos para dirigir nanovesículas a las células hepáticas mediante la incorporación en dichas nanovesículas de la proteína de la cubierta del virus de la hepatitis B. WO200473684 describe un método para el direccionamiento de compuestos parcialmente hidrofóbicos a las células hepáticas basado en vesículas discoidales fosfolipídicas que comprenden ApoA-I en su superficie. Lou et al (World J. Gastroenterol., 2005, 1 1 :954-959) han descrito un método para el direccionamiento de un compuesto antitumoral lipofϊlico a las células de carcinoma hepatocelular usando lipoproteína de alta densidad (HDL) como transportador específico basándose en la capacidad de HDL de acomodar compuestos hidrofóbicos tales como el colesterol.

Por último, Kim et al (Molecular Therapy, 2007, 15:1145-1152) han descrito un método para el direccionamiento de ARN interferentes a células hepáticas basado en liposomas que engloban los ARNs interferentes y que contienen ApoA-I en su superficie. Sin embargo, estos métodos tienen la desventaja de que permiten únicamente la vehiculización de compuestos hidrofóbicos puesto que dichos compuestos van alojados en el interior de las vesículas o membranas artificiales en contacto con la fracción hidrofóbica de los fosfolípidos.

Alternativamente, es posible la vehiculización de compuestos hidrofílicos al hígado mediante el uso de conjugados de dichos compuestos a agentes que son captados de forma específica por el hígado. Por ejemplo, Kramer et al (J.Biol.Chem., 1992,

267:18598-18604) han descrito métodos para el direccionamiento de compuestos terapéuticos (el agente citostático clorambucil y el inhibidor de la prolil-4 hidroxilasa I- nitrobenzo-2-oxa-l,3-diazol-β-Ala-Phe-5-oxaproline-Gly) a las células hepáticas mediante la conjugación de dichos compuestos a ácidos biliares. Sin embargo, este tipo de conjugación permite únicamente la vehiculización al hígado lo que excluye su uso para la administración de compuestos a otros tejidos de interés terapéutico.

WO04082720 describe métodos para el direccionamiento de compuestos con actividad terapéutica a las células hepáticas mediante la incorporación de dicho compuestos en partículas pseudovirales formadas por la proteína de la cubierta del virus de la hepatitis B. Sin embargo, estos vehículos presentan el problema de que muestran una vida media en plasma reducida lo que requiere una administración continuada o a altas dosis para alcanzar niveles terapéuticos en plasma de foπna sostenida. Además, las proteínas virales que forman las partículas pseudoviraies generan una respuesta inmune humoral.

WO8702061A describe métodos para el direccionamiento de compuestos a tejidos que expresan el receptor de LDL mediante el uso de proteínas de fusión formadas por la región de unión al receptor de la apoliproteina B o E y un componente activo.

El problema de la baja vida media del interferón lia sido abordado por WO07021494, en donde se describen proteínas de fusión formadas por albúmina e interferón. Estas fusiones alcanzan vidas medias en plasma del orden de 14 días.

Por lo tanto, existe una necesidad de vehículos adecuados para el direccionamiento específico a las células hepáticas de compuestos terapéuticos y que permitan alcanzar una elevada vida media en plasma de los conjugados.

COMPENDIO DE LA INVENCIÓN

En un primer aspecto, la invención se relaciona con un conjugado que comprende

(i) una molécula de Apo A o una variante funcionalmente equivalente de la misma y

(ii) un compuesto de interés terapéutico

en donde los componentes (i) y (ii) se encuentran unidos covalentemente, En un segundo aspecto, la invención se relaciona con un polinucleótido o una construcción génica que comprende un polinucleótido que codifica un conjugado de acuerdo a la invención en donde el compuesto de interés terapéutico (ii) es un polipéptido que forma una única cadena con el componente (i). En sucesivos aspectos, la invención se relaciona con un vector que comprende un polinucleótido o una construcción génica según la invención y con una célula hospedadora que comprende un polinucleótido, una construcción génica o un vector de acuerdo a la invención o una nanolipopatícula que comprende el conjugado de la invención.

En otro aspecto, la invención se relaciona con un conjugado, un polinucleótido, una construcción génica, un vector, una célula hospedadora o una nanolipopartícula de acuerdo a la invención para su uso en medicina.

En otro aspecto, la invención se relaciona con un conjugado, un polinucleótido, una construcción génica, un vector, una célula hospedadora o una nanolipopartícula de acuerdo a la invención para el tratamiento de enfermedades hepáticas o de enfermedades asociadas con el sistema inmune.

En otro aspecto, la invención se relaciona con una composición que comprende

(a) Un primer componente seleccionado entre un conjugado, un polinucleótido, una construcción génica, un vector, una célula hospedadora según la reivindicación, una nanolipopartícula y una preparación farmacéutica de acuerdo a la invención en donde el componente (ii) es un péptido inhibidor de TGF-βl, y

(b) Un segundo componente seleccionado entre una cito quina inmuno estimuladora, un polinucleótido que codifica dicha citoquina, un vector que comprende dicho polinucleótido, un péptido inhibidor de TGF-βl, un agente citotóxico y combinaciones de los mismos.

En otro aspecto, la invención se relaciona con una combinación de la invención para su uso en medicina y, en particular, para el tratamiento del cáncer.

BREVE DESCRIPCIÓN DE LAS FIGURAS

Figura 1. Cinética de la expresión de IFNα. Ratones BALB/c recibieron una inyección hidrodinámica con los plásmidos que expresan ApoAI (Apo), IFNα (IFN), Apo-IFN (AF) o IFN- Apo (IA). A las 6 horas y a día 1, 3 6 y 9 se extrajo sangre y se analizó mediante ELISA los niveles séricos de IFNα. Se muestra la media y el error estándar de la media de un experimento representativo con cuatro animales por grupo. Los resultados se analizaron mediante ANOVA de medidas repetidas, seguido de un test de Bonferroni. Se observan diferencias significativas entre los niveles de IFNα a día 1 y 3 inducidos por los plásmidos AF e IA y los niveles inducidos por el plásmido IFN (p<0.001). Figura 2. RT-PCR cuantitativa de mRNA hepático de IFNαl. Se realizó una inyección hidrodinámica en tres ratones BALB/c por cada plásmido y día de estudio. A día 1, 3 y 6 se sacrificaron los animales y se extrajo el hígado. Se purificó el mRNA hepático y se realizó RT-PCR cuantitativa para el gen de IFNαl. Se muestra la media y el error estándar de la media de un experimento representativo. Los resultados se analizaron mediante ANOVA de medidas repetidas, seguido de un test de Bonferroni. No se observaron diferencias significativas entre los niveles de mRNA inducidos por los plásmidos IFNαl, AF e IA.

Figura 3. Niveles de neopterina sérica y temperatura corporal. Se administraron a ratones BALB/c los plásmidos que codifican las construcciones con IFNα. A día 3, se extrajo sangre y se midió mediante ELISA los niveles de neopterina sérica (A). Al mismo tiempo, se analizó la temperatura corporal (B). Se muestra la media y el error estándar de la media de dos experimentos independientes (N=6 ratones). Los datos se analizaron mediante ANOVA seguido del test de Dunnett comparando los grupos con IFNα con el grupo control con ApoAI. *** pθ.0001.

Figura 4. RT-PCR cuantitativa de mRNA hepático de genes inducibles por IFNαl.

Se realizó una inyección hidrodinámica con los plásmidos que expresan las construcciones con IFNαl en ratones BALB/c. A día 3, se sacrificaron los animales y se extrajo el hígado. Se purificó el mRNA hepático y se realizó RT-PCR cuantitativa para los genes 2'-5' OAS (A), USP18 (B), ISG15 (C) y IRFl (D). Se muestra la media y el error estándar de la media de dos experimentos independientes (N=6 ratones). Los datos se analizaron mediante ANOVA seguido del test de Dunnett comparando los grupos con IFNα con el grupo control con ApoAI. * p<0.05; *** p<0.0001.

Figura 5. Aumento del número y de la activación de esplenocitos. Ratones BALB/c recibieron por vía hidrodinámica las distintitas construcciones con IFNα y seis días después, se sacrificaron y se aislaron los bazos. Se analizó el número de esplenocitos (A) y la expresión del marcador de activación temprana CD69 en células T CD4+ (B), en células T CD8+ (C), en células B (D) y en células NK (E). Se muestra la media y el error estándar de la media de un experimento representativo con 7 animales por grupo. Los datos se analizaron mediante ANOVA seguido del test de Dunnett comparando los grupos con IFNα con el grupo control con ApoAI. * p<0.05; ** p<0.001; *** p<0.0001.

Figura 6. Aumento de la lisis específica inducida por una vacunación génica en presencia de las construcciones que expresan IFNα. Ratones BALB/c fueron inmunizados mediante inyección hidrodinámica de un plásmido que expresa β- galactosidasa y como adyuvante se co administraron plásmidos que expresan las distintas construcciones con IFNα. Siete días más tarde, se inyectaron intravenosamente células diana cargadas con un péptido citotóxico y alta concentración de CFSE y células control con baja concentración de CFSE. A las 24 horas, se sacrificó a los animales, y se analizó la proporción de células diana y células control para calcular el porcentaje de lisis específica. Se muestra un histograma representativo de cada grupo (A) y la media y el error estándar de la media de un experimento representativo con tres animales por grupo (B). Los datos se analizaron mediante ANOVA seguido del test de Dunnett comparando los grupos de Apo-IFN e IFN- Apo con el grupo con IFNα. ** p<0.001. Figura 7. Expresión de SR-BI en distintas poblaciones de células del sistema inmune. Se aislaron los esplenocitos del bazo de ratones BALB/c y se marcaron con anticuerpos anti-SR-BI y con anticuerpos para distinguir linfocitos T CD4+ (anti-CD4) (A), linfocitos CD8+ (anti-CD8) (B), c é lu l a s N K ( anti-CD49b) (C), monocitos/macró fagos (anti-CDl Ib) (D) o células dendríticas (anti-CDl Ic) (E).

Figura 8. Efecto del efecto adjuvante en un modelo de vacunación antitumoral. 11- 17 ratones BALB/c por cada grupo de tratamiento recibieron una inyección hidrodinámica con los plásmidos que expresan ApoAI (Apo), IFNα (IFN), o IFN-Apo (IA). 24 horas más tarde fueron vacunados con el péptido citotóxico AHl en adyuvante incompleto de Freund. Nueve días más tarde, se les inoculó subcutáneamente 5x106 células CT26 y se observó la aparición de tumores a lo largo del tiempo. Se representa el porcentaje de ratones libre de tumor a lo largo del tiempo. Los grupos experimentales se compararon con el grupo control mediante el test de Log-rank. ** p<0.01. Figura 9. Cinética de leucocitos y plaquetas circulantes. Se administraron a ratones BALB/c los plásmidos que codifican las construcciones con IFNα. Se extrajo sangre a día 1 a un grupo, a día 3 a otro grupo y a un último grupo a día 6 tras la injección hidrodinámica. Se cuantificó el recuento de leucocitos (A) y plaquetas (B) empleando Zl Coulter Particle Counter según instrucciones del fabricante. Se muestra la media y el error estándar de la media de dos experimentos independientes (N=4 ratones/día y grupo). Los datos se analizaron mediante ANOVA seguido del test de Dunnett comparando los grupos con IFN- Apo y con el grupo con IFN. ** p<0.01.

Figura 10. RT-PCR cuantitativa de mRNA cerebral de genes inducibles por IFNα. Se realizó una inyección hidrodinámica con los plásmidos que expresan las construcciones con IFNα en ratones BALB/c. A día 1, se sacrificaron los animales y se extrajo el cerebro. Se purificó el mRNA cerebral y se realizó RT-PCR cuantitativa para los genes USP 18 (A), ISG 15 (B), 2 '-5' OAS (C), MxI (D) e IRFl (D). Se muestra la media y el error estándar de la media de dos experimentos independientes (N=5 ratones/ grupo). Los datos se analizaron mediante ANOVA seguido del test de Dunnett comparando los grupos con IFN-Apo con el grupo con IFN. * p<0.05; ** p<0.01; *** p<0.001. Este es un experimento representativo de dos.

Figura 11. Incorporación de las proteínas de fusión en las lipoproteínas de alta densidad (HDLs) circulantes. Se administraron a ratones BALB/c los plásmidos que codifican las construcciones con IFNα. A las 24 horas, se extrajo sangre y a partir del suero obtenido, se extrajeron las HDLs mediante centrifugación diferencial en gradientes de NaBr. Se analizó la presencia de IFNα en las HDLs de los distintos grupos mediante un bioensayo de interferón, el ensayo de protección del efecto citopático (A). Con las muestras de suero libre de HDLs (HDLs -) y la fracción que contiene las HDLs (HDLs +), se realizó un western blot para determinar la presencia de apolipoproteína AI (B).

Figura 12. Efectos hematológicos de la administración de HDLs que contiene IFN- Apo. Se administraron a ratones BALB/c el equivalente a 10000 UI de IFN de HDLs que contiene IFN-Apo, 10000 UI de IFN recombinante o PBS. A los 3 días, se cuantificó el recuento de leucocitos (A) y plaquetas (B) empleando Zl Coulter Particle Counter según instrucciones del fabricante. Se muestra la media y el error estándar de la media de dos experimentos independientes (N=4-6 ratones/grupo). Los datos se analizaron mediante ANOVA seguido del test de Dunnett comparando los grupos con IFN- Apo y con el grupo con IFN. ** p<0.01; *** p<0.001.

Figura 13. Incremento de la inducción de IFNγ inducida por IL12. Se administraron mediante inyección hidrodinámica un plásmido que expresa IL 12 bajo el control de un promotor inducible por doxiciclina y otro plásmido que expresa una construcción control o una de las construcciones con un inhibidor de TGFβ pl7 (A) o el inhibidor del TGFβ pl44 (B). A los cuatro días, se analizó la concentración sérica de IFNγ mediante ELISA. Se muestra la media y el error estándar de la media de un experimento representativo con tres animales por grupo. Los datos se analizaron mediante ANOVA seguido del test de Dunnett comparando los grupos experimentales con el grupo control. ** p<0.001.

Figura 14. Protección frente al desarrollo de tumores CT26. Ratones BALB/c fueron vacunados con el péptido citotóxico AHl en adyuvante incompleto de Freund. Siete días más tarde recibieron una inyección hidrodinámica con las contrucciones que expresan inhibidores del TGFβ o ApoA-I como control. Tras siete días más, se les inoculó subcutáneamente 5x105 células CT26 y se observó la aparición de tumores a lo largo del tiempo. Se representa el porcentaje de ratones libre de tumor a lo largo del tiempo. Los grupos experimentales se compararon con el grupo control mediante el test de Log-rank. * p<0.05; ** p<0.001. Figura 15. Incorporación de las proteínas de fusión Apo-linker-P144 en las lipoproteínas de alta densidad (HDLs) circulantes. Se administraron a ratones BALB/c los plásmidos que codifican las construcciones con Apo o Apo-linker-P144. A las 24 horas, se extrajo sangre y a partir del suero obtenido, se extrajeron las HDLs mediante centrifugación diferencial en gradientes de NaBr. Con las fracciones que contienen las HDLs, se realizó un western blot para determinar la presencia de apolipoproteína AI. Figura 16. Incremento de la inducción de IFNγ inducida por IL12 tras administración de HDLs que contienen Apo-linker-P144. Se administraron mediante inyección hidrodinámica un plásmido que expresa IL 12 bajo el control de un promotor inducible por doxiciclina y otro plásmido que expresa una construcción control (Apo) o el Apo-linker-P144. A un último grupo se le administró el plásmido IL12 y una injección intraperitoneal de 14 μg/ratón de HDLs que contienen Apo-linker-P144. A los cuatro días, se analizó la concentración sérica de IFNγ mediante ELISA. Se muestra la media y el error estándar de la media de un experimento representativo con tres animales por grupo. Los datos se analizaron mediante ANOVA seguido del test de Dunnett comparando los grupos experimentales con el grupo control. ** p<0.01.

DESCRIPCIÓN DETALLADA DE LA INVENCIÓN

1. Conjugado de la invención

Los autores de la presente invención han observado que los conjugados formados por una proteína Apo A o una variante funcionalmente equivalente de la misma y una molécula de interés terapéutico muestran, tras su administración a pacientes, una vida media en suero superior a la que se observa en pacientes a los que se les ha administrado la molécula de interés terapéutico sin conjugar. Adicionalmente, los conjugados de Apo A y la molécula de interés terapéutico son específicamente vehiculizados al hígado del paciente, lo que facilita enormemente el tratamiento de enfermedades hepáticas y la reducción de efectos secundarios debidos a la acción de la molécula terapéutica en otros tejidos.

Así, en un primer aspecto, la invención se relaciona con un conjugado que comprende (i) una molécula de Apo A o una variante funcionalmente equivalente de la misma y

(ii) un compuesto de interés terapéutico

en donde los componentes (i) y (ii) se encuentran unidos covalentemente.

Sin querer estar vinculado a ninguna teoría, se piensa que la afinidad de los conjugados por el tejido hepático se debe a que dicho tejido presenta receptores específicos para las proteínas Apo A cuya función natural es capturar las HDL que presentan ApoA-I en su superficie. Por otro lado, la mayor vida media de los conjugados parece estar relacionada con la alta vida media que las moléculas de Apo A muestran en el organismo (del orden de 35 h en humanos o 10 h en ratones en el caso de Apo A-I). Además, existen otras células que expresan en su superficie receptores específicos para ApoA-I, lo que permite la vehiculización a otros tejidos.

1.1 Molécula de Apo A

Por "proteína Apo A" se entiende, en el contexto de la presente invención, cualquier miembro de la familia Apo A que forma parte de las lipoproteínas de alta densidad

(HDL) y que es capaz de interaccionar de forma específica con receptores en la superficie de las células hepáticas garantizando de esta manera su capacidad de vehiculizar a este órgano las moléculas de interés acopladas a dicha proteína Apo A.

Preferiblemente, las moléculas de Apo A que pueden ser utilizadas en la presente invención se seleccionan del grupo de ApoA-I, Apo A-II, Apo A-III, ApoA-IV y Apo A-

V o de variantes funcionalmente equivalentes de las mismas.

En una forma preferida de realización, la proteína Apo A que se utiliza en la presente invención es la proteína ApoA-I. Por ApoA-I se entiende, en el contexto de la presente invención, la forma madura de la proteina pre-proApoA-I que forma parte de las lipoproteínas de alta densidad (HDL). La Apo A-I se sintetiza como un precursor (pre- proApoA-I) que contiene una secuencia señal de secreción que se elimina para dar lugar al precursor. La secuencia señal consta de 18 amino ácidos, el propéptido de 6 y la forma madura de la proteína de 243 amino ácidos. Preferiblemente se utiliza la forma madura de la proteína carente de péptido señal y procesada. En una forma preferida de realización, la proteína ApoA-I es de origen humano y su secuencia de amino ácidos es la mostrada en SEQ ID NO: 1 (número de acceso en UniProt P02647). En otra forma preferida de realización, la proteína ApoA-I es de origen murino, en particular de ratón, y su secuencia de amino ácidos es la mostrada en SEQ ID NO:2 (número de acceso en UniProt Q00623). En otra forma preferida de realización, la proteína ApoA-I es de origen murino, en particular de rata, y su secuencia de amino ácidos es la mostrada en SEQ ID NO: 3 (número de acceso en UniProt P04639). Por variante funcionalmeαte equivalente de ApoA-I se entiende todas aquellos poüpéptidos que resultan de la inserción, sustitución o deleción de uno o mas amino ácidos de la secuencia de ApoA-I humana o murina mencionada anterioπnente y que mantienen sustancialmente intacta la capacidad de interaccionar con el denominado "scavenger receptor de clase B tipo I" (SK.-B1) que forma el receptor de HDL presente en las células hepáticas. La capacidad, de interaccionar con el receptor de HDL se determina esencialmente tal y como ha sido descrito por Monaco et al (EMBO J., 1987, 6:3253-3260) bien mediante estudios de unión de ApoA-I a las membrana de hepatocitos o bien mediante la determinación de la capacidad de ApoA-I o de su variante de inhibir la unión de HDL a los receptores de las membranas de los hepatocitos. Preferiblemente, la constante de disociación de la unión de la variante de ApoA-I a las membranas de hepatocitos es de al menos 10"8 M, 10"7M, 10"6M, 10'5M o 10"4M. Variantes de ApoA-I contempladas en el contexto de la presente invención incluyen polipέptidos que muestran al menos 60%, 65%%, 70%, 72%, 74%, 76%, 78%, 80%, 90%, ó 95% de similitud o identidad con los polipéptidos de ApoA-I. El grado de identidad entre dos polipéptidos se determina usando algoritmos de ordenador y métodos que son ampliamente conocidos por los expertos en la materia. La identidad entre dos secuencias de aminoácidos se determina preferiblemente usando el algoritmo BLASTP (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, Md. 20894, AltschuL S., et al, J., 1990, Mol. Biol.215:403-410).

Preferiblemente, las variantes de ApoA-I utilizadas en el contexto de la invención presentan una vida media en suero elevada con respecto a ApoA-I nativa, lo que permite alcanzar niveles de ApoA-I en suero superiores a los que se observan con ApoA-L Métodos para determinar la vida media de una proteína en suero y, en particular de ApoA-I, son conocidos en la técnica e incluyen, entre otros, usando los métodos basados en mareajes metabólicos con proteínas marcadas descritos por Eisenberg, S. et al (JXipid Res., 1973, 14:446-458), por Blum et al. (J. Clin. Invest, 1977, 6"0t795-807) y por Graversen et al (J Cardiovasc Pharmacol., 2008, 51:170-177), Un ejemplo de dicha variantes que muestra una mayor vida media es, por ejemplo, la variante denominada Milano (que contiene la mutación Rl 73C). 1.2 Compuestos de interés terapéutico

Por "compuestos de interés terapéutico" se entiende, en el contexto de la presente invención, cualquier compuesto que es capaz de prevenir o eliminar los síntomas de una enfermedad. En principio, la invención contempla el uso de cualquier compuesto terapéutico que sea susceptible de modificación covalente sin perder sustancialmente su actividad biológica de forma que pueda ser conjugado a ApoA-I o a la variante funcionalmente equivalente del mismo. Así, la invención contempla el uso como componente terapéuticamente efectivo de pequeñas moléculas orgánicas, péptidos, peptidomiméticos, peptoides, proteínas, polipéptidos, glicoproteínas, oligosacáridos, ácidos nucleicos y similares.

A modo de ejemplo, compuestos que pueden ser conjugados a ApoA-I o a la variante funcionalmente equivalente del mismo incluyen antibióticos, agentes colinesterasa, atropina, escopolamina, drogas simpaticomiméticas, hipnóticos, sedantes, antiepilépticos, opioides, analgésicos, antiinflamatorios, histaminas, derivados lipidíeos, antiasmáticos, analgésicos antipiréticos, xantinas, diuréticos osmóticos, compuestos mercuriales, tiacidas y sulfonamidas, inhibidores de la anhidrasa carbónica, nitratos orgánicos, antihipertensivos, glucósidos cardiacos, antiarrítmicos, oxitocina, prostaglandinas, alcaloides, agentes tocolíticos, antihelmínticos, antiprotozoarios, antimaláricos, amebicidas, sulfonamidas, penicilinas, trimetropina, cefalosporinas, sulfametoxazol, antimicóticos, quinolonas, antivirales, antibióticos, aminoglucósidos, tetraciclinas, cloranfenicol, eritromicina, agentes alquilantes, hormonas, antimetabolitos, antibióticos, isótopos radioactivos, azatioprina, clorambucil, ciclofosfamida, metotrexato, anticoagulantes, trombolíticos, antiplaquetarios, adenohipoficiarias, hormonas tiroidea y antitiroidea, estrógenos y progesterona, andrógenos, adrenocorticotrófma, insulina, hormona paratifoidea, derivado esteroidíco de vitamina D, vitaminas, (hidrosolubles tales como complejo B y ác. Ascórbico o liposolubles tales como vitaminas A, D, K o E), antihistamínicos, compuestos antitumorales, antivirales, antifúngicos. Preferiblemente, se usan compuestos que son de utilidad para el tratamiento de enfermedades que afectan o que tienen su origen en el hígado. En una forma preferida de realización, el componente (ii) de los conjugados de la invención comprende una cadena polipeptídica. En una forma preferida de realización, el polipéptido ApoA-I y el polipéptido que forma el componente (ii) se encuentran formando una única cadena polipeptídica. La presente invención contempla las dos orientaciones relativas de ambos polipéptidos. Así, en una forma preferida de realización, el extremo C-terminal del componente (i) se encuentra unido al extremo N- terminal del componente (ii). En otra forma preferida de realización, el extremo N- terminal del componente (i) se encuentra unido al extremo C-terminal del componente (ii). Preferiblemente, los conjugados ApoA-I, cuando están formados por una única cadena polipeptídica, no están formados por

(i) la proteína A de S. aureus enlazada a través de su extremo C-terminal al extremo N-terminal de la proteína ApoA-I.

(ii) la proteína ApoA-I enlazada a través de su extremo c-terminal al extremo N- terminal del péptido vasointestinal (VIP-I)

(iii) el componente (ii) es la cadena pesada de las inmunoglobulinas o un fragmento de plasminógeno.

(iv) el dominio de trimerización de tetranectina (TTSE) enlazado a través de su extremo C-terminal al extremo N-terminal de la proteína ApoA-I.

Polipéptidos que pueden ser vehiculizados al hígado usando los conjugados de la invención incluyen eritropoietina (EPO), leptinas, hormona liberadora de hormona adrenocorticotropa (CRH), hormona liberadora de hormona somatotropa (GHRH), hormona liberadora de gonadotro finas (GnRH), hormona liberadora de tirotropina (TRH), hormona liberadora de prolactina (PRH), hormona liberadora de melatonina (MRH), hormona inhibidora de prolactina (PIH), somato statina, hormona adrenocorticotropa (ACTH), hormona somatotropa o del crecimiento (GH), hormona luteinizante (LH), hormona folículo estimulante (FSH), tirotropina (TSH u hormona estimulante del tiroides), prolactina, oxitocina, hormona antidiurética (ADH o vasopresina), melatonina, factor inhibidor Mülleriano, calcitonina, hormona paratifoidea, gastrina, colecisto quinina (CCK), Arg-vasopresina, hormonas tiroideas, azoximethane, triiodotironine, LIF, anfiregulina, trombomodulina soluble, SCF, proteina osteogenica 1, BMPs, MGF, MGSA, heregulinas, melanotropina, secretina, factor de crecimiento de tipo insulina tipo I (IGF-I), factor de crecimiento de tipo insulina tipo II (IGF-II), péptido natriurético atrial (PNA), gonadotrofina coriónica humana (GCH), insulina, glucagón, somatostatina, polipéptido pancreático (PP), leptina, neuropéptido Y, renina, angiotensina I, angiotensina II, factor VIII, factor IX, factor tisular, factor VII, factor X, trombina, factor V, factor XI, factor XIII, interleukina 1 (IL-I), interleuquina 2 (IL-2), interleuquina 3 (IL-3), interleuquina 4 (IL- 4), interleuquina 5 (IL-5), interleuquina 6 (IL-6), interleuquina 7 (IL-7), interleukina 8 (IL-8), interleuquina 9 (IL-9), interleuquina 10 (IL-IO), interleuquina 11 (IL-I l), interleukina 12 (IL- 12), interleuquina 13 (IL- 13), interleuquina 14 (IL- 14), interleukina 15 (IL- 15) interleukina 16 (IL- 16), interleukina 24 (IL-24), factor de necrosis tumoral Alfa (TNF-α), interferones alpha, beta, gamma, CD3, CD134, CD137, ICAM-I, LFA-I, LFA-3, quimioquinas incluyendo RANTES lα, MIP- lα, MIP- lβ, factor de crecimiento neuronal (NGF), la proteína WTl codificada por el gen supresor del tumor de Wilms, factor de crecimiento derivado de las plaquetas (PDGF), factor de crecimiento transformante beta (TGF-beta), proteínas mor fo genéticas del Hueso (BMPs), factores de crecimiento de los fibroblastos (FGF y KGF), factor de crecimiento epidérmico (EGF y relacionados), factor de crecimiento endotelial vascular (VEGF), factor estimulante de colonias de granulocitos (GM-CSF), factor de crecimiento glial, factor de crecimiento de queratinocitos, factor de crecimiento endotelial, factor de crecimiento derivado de células de la glia (GDNF), antitripsina 1 alfa, factor de necrosis tumoral, factor estimulante de colonias de granulocito y macró fagos (GM-CSF), cardiotrofina 1 (CT-I), oncostatina M (OSM), serpina (Al, A2, A3, A4, A5, A6, A7, A8, A9, AlO, AI l, A12, A13, Bl, B2, B3, B4, B5, B6, B7, B8, B9, BlO, BI l, B12, B13, Cl, Dl, El, E2, Fl, F2, G l , H l , I l e 12), ciclosporina, fibrinógeno, el dominio EDA de la fibronectina, lactoferrina, activador de plasminógeno tipo tisular (tPA), quimo tripsina, inmunoglobinas, hirudina, superoxide dismutasa, imiglucerasa, β-Glucocerebrosidase, alglucosidasa-α, α-L-iduronidasa, iduronato-2-sulfatasa, galsulfasa, α-galactosidasa A humana, inhibidor de la proteinasa α-1, lactasa, enzimas pancreáticas (lipasa, amilasa, proteasa), adenosina deaminasa, inmunoglobulinas, albúmina, toxinas botulínicas de tipo A y B, colagenasa, deoxiribonucleasa I humana, hialouronidasa, papaina, L- asparaginasa, lepirudin, estreptoquinasa, deaminasa del porfobilinógeno (PBGD), péptidos inhibidores del factor de transformación celular beta (TGF-β), inhibidores de ILlO, inhibidores de FoxP3, inhibidores de TNFα, inhibidores de VEGF, inhibidores de PD-I e inhibidores de CD 152.

En una forma de realización preferida, el componente (ii) del conjugado de la invención es un interferón (IFN). Los interferones se clasifican en interferón de tipo I, de tipo II y de tipo III. Los interferones de tipo I son una familia de polipéptidos con actividad citoquina que fueron originalmente descubiertos en virtud de su actividad inhibidora sobre la infección viral de líneas celulares in vitro (Pestka, S., Krause, CD. and Walter, M. R. 2004. Immunol Rev. 202:8-32) y que se caracterizan por que se unen al denominado receptor de IFN-α (IFNAR). En función de la homología de sus secuencias, los interferones de tipo I se clasifican en interferón-α (IFN-α), interferón-β (IFN-β) e interferón-ω (IFN-ω). IFN-α y IFN-β comparten un único receptor dimérico que se expresa en la superficie de la mayor parte de las células nucleadas. La función de estas citoquinas es de gran importancia en la respuesta inmune frente a múltiples tipos de infecciones virales, puesto que ponen en marcha mecanismos que promueven la muerte por apoptosis de las células infectadas y la inhibición de la replicación viral al tiempo que favorece la presentación antigénica. Recientemente se ha documentado experimentalmente que también ejerce sus funciones activando directamente las actividades de linfocitos T, B y NK así como de células dendríticas en la respuesta inmunitaria (Le Bon A. et al, 2003. Nat. Immunol. 4: 1009-1015; Le Bon A. et al, 2006. J. Immunol. 176:4682-4689; Le Bon A. et al, 2006. J Immunol. 176:2074-8). Los interferones de tipo II se caracterizan porque se unen al receptor de interferón gamma (IFNGR) e incluyen como único miembro al IFN-γ. Los interferones de tipo III transducen su señal a través de un complejo formado por el receptor 2 de IL-10 (IL10R2) y el receptor de IFN lambda 1 (IFNLRl) y está formado por tres interferons lambda denominados IFN-λl, IFN- λ2 e IFN- λ3.

En una forma preferida de realización, el componente (ii) es un interferón de tipo I, tal como IFN-α, IFN-β, IFN-δ, IFN-ε, IFN-K, IFN-τ e IFN-ω. En una realización particular, al menos un interferón de tipo I comprendido en la composición de la invención se selecciona del grupo que comprende el interferón-alfa (IFN-α) y el interferón-beta (IFN- β). Cuando el interferón de tipo I es IFN-α, éste puede corresponder a cualquier interferón codificado por cualquier gen miembro de la familia de genes del IFN-α humano. En una realización particular, al menos, un interferón de tipo I es un IFN-α seleccionado del grupo de IFN-α2a, IFN-α2b, IFN-α4 , IFN-α5 , IFN-α 8 y combinaciones de los mismos, incluyendo su combinación con otras sustancias en formulaciones farmacéuticas. En una realización aún más particular, el interferón es IFN-αl, preferiblemente de origen humano. En una forma preferida de realización, el interferón es IFN-α5.

Una lista de especies de interferón tipo I, particularmente IFN-α e IFN-β, que pueden emplearse de acuerdo con la invención, puede encontrarse en Bekisz et al. (Growth Factors, 2004; 22: 243-251) y en Petska et al. (Immunological Reviews, 2004; 202: 8- 32). Adicionalmente, la invención contempla el uso de combinaciones de conjugados que comprenden más de un tipo de interferón, como por ejemplo IFN-αnl (derivado linfoblastoide) o IFN-α3 (combinación de interferones producida por leucocitos humanos estimulados con el virus Sendai (u otro virus) o partículas virales).

El origen del interferón de tipo I empleado no constituye un aspecto crítico de la invención. Este puede ser de origen natural, extraído y purificado a partir de fluidos o tejidos biológicos, o producidos mediante métodos convencionales de ingeniería genética y recombinante, como los descritos en Sambrook and Russel ("Molecular Cloning: a Laboratory manual" de J. Sambrook, D. W. Russel Eds. 2001, tercera edición, CoId Spring Harbor, New York), por procedimientos de síntesis o por cualquier otra técnica convencional descrita en el estado de la técnica.

En una realización particular de la invención, al menos, un interferón de tipo I comprendido en la composición de la invención se encuentra en forma pegilada. Algunos ejemplos para la preparación de formas pegiladas de interferón pueden encontrarse en US5762923 y US5766582. Por otra parte, también es posible emplear algunas de las formas de interferón ya disponibles comercialmente, bien sean formas pegiladas o no. Entre estas se incluyen, sin que suponga limitación alguna, ROFERON- A (IFN-α2a humano recombinante) y PEGASYS (IFN-α pegilado) de Hoffmann La Roche Inc., INTRON-A (IFN-α2b humano recombinante) y PEG-INTRON (IFN-α2b pegilado) de Schering Corp., ALFERON-N (IFN-α3n, combinación de interferones de origen natural) de Interferón Sciences, o IFNERGEN (IFN-αconl) de InterMune Pharmaceuticals Inc., cuya secuencia es una secuencia consenso que no se corresponde exactamente con una secuencia natural. Se incluyen también formulaciones de IFN-β, tales como por ejemplo AVONEX (IFN-βla) de Biogen Idee, REBIF (IFN-βla) de EMD Serano, Inc, y BETASERON (IFN-βlb) de Bayer Health Care.

En una forma preferida de realización, el conjugado de la invención está formado por ApoA-I fusionada a través de su extremo C-terminal y mediante un enlazador flexible con el extremo N-terminal de una molécula de interferón αl. En otra forma preferida de realización, el conjugado de la invención está formado por una molécula de interferón αl fusionada a través de su extremo C-terminal y mediante un enlazador flexible con el extremo N-terminal de una molécula de ApoA-I.

En otra forma preferida de realización, el componente (ii) es un inhibidor de TGF-beta. Inhibidores de TGF-beta que pueden formar parte de los conjugados de acuerdo a la invención incluyen los inhibidores peptídicos seleccionados a partir de secuencias del receptor de TGF-beta 1 que se unen al sitio de unión al receptor en TGF-βl bloqueando así la unión al receptor. Este tipo de péptidos han sido descritos en WO200031135, cuyo contenido se incorpora por referencia en su totalidad. En una forma preferida de realización, el péptido inhibidor de TGF-βl deriva del receptor de TGF-βl de tipo III. En una forma de realización aún más preferida, el péptido inhibidor es el péptido pl44 que presenta la secuencia TSLDASIIWAMMQN (SEQ ID NO :4).

La invención contempla asimismo el uso de péptidos inhibidores de la interacción entre TGFβl y el receptor de TGFβl y de la señalización que ocurre en respuesta a dicha interacción identificados a partir de genotecas en fago tal y como han sido descritos en WO200519244, cuyos contenido se incorpora por referencia en su totalidad. En una forma preferida de realización, el péptido inhibidor es el péptido pl7 caracterizado por la secuencia KRIWFIPRS SWYERA (SEQ ID NO:5), así como variantes truncadas del mismo y que conservan sustancialmente la capacidad de inhibir la interacción entre TGFβl y su receptor tal y como han sido descritos en WO2007048857, cuyo contenido se incorpora en la presente invención en su totalidad. 1.3.Elemento enlazador o "linker" entre el componente ApoA y el compuesto terapéuticamente activo

Los conjugados objeto de la invención que comprenden la proteína Apo A y un segundo componente de naturaleza peptídica pueden contener un enlace que conecte de forma directa la proteína Apo A y dicho segundo componente o, alternativamente, pueden contener una secuencia de aminoácidos adicional que actúa como enlazador entre la proteína Apo A y dicho segundo componente de naturaleza peptídica. Según la invención, dicha secuencia de aminoácidos intermedia no natural actúa como una región bisagra entre dichos dominios, permitiendo que se muevan de forma independiente el uno del otro mientras mantienen la forma tridimensional de los dominios individuales. En ese sentido, una secuencia de aminoácidos intermedia no natural preferida según la invención sería una región bisagra caracterizada por una ductilidad estructural que permite este movimiento. En una forma de realización particular, dicha secuencia de aminoácidos intermedia no natural es un enlazador flexible no natural. En una forma de realización preferida, dicho enlazador flexible es un péptido enlazador flexible con una longitud de 20 aminoácidos o menos. En una forma de realización más preferida, el péptido enlazador comprende 2 aminoácidos o más seleccionados del grupo que consiste en glicina, serina, alanina y treonina. En una forma de realización preferida de la invención, dicho enlazador flexible es un enlazador de poliglicina. Los ejemplos posibles de secuencias de enlazador/espaciador incluyen SGGTSGSTSGTGST (SEQ ID NO:6), AGSSTGSSTGPGSTT (SEQ ID NO:7) O GGSGGAP (SEQ ID NO:8). Estas secuencias se han usado para la unión de hélices enrolladas diseñadas a otros dominios de proteínas (Muller, K.M., Arndt, K.M. y Alber, T., Meth. Enzimology, 2000, 328: 261-281). Preferiblemente, dicho enlazador comprende o consiste en la secuencia de aminoácidos GGGVEGGG (SEQ ID NO: 9).

El efecto de la región enlazadora es proporcionar espacio entre la proteína Apo A y el componente (ii). De este modo se asegura que la estructura secundaria de la Apo A no está afectada por la presencia del componente (ii) y viceversa. Preferiblemente, el espaciador es de naturaleza polipeptídica. El péptido enlazador preferiblemente comprende al menos dos aminoácidos al menos tres aminoácidos, al menos cinco aminoácidos, al menos diez aminoácidos, al menos 15 aminoácidos, al menos 20 aminoácidos, al menos 30 aminoácidos, al menos 40 aminoácidos, al menos 50 aminoácidos, al menos 60 aminoácidos, al menos 70 aminoácidos, al menos 80 aminoácidos, al menos 90 aminoácidos o aproximadamente 100 aminoácidos. El enlazador puede estar unido a los componentes que flanquean los dos componentes de los conjugados de la invención por medio de enlaces covalentes y preferiblemente el espaciador es esencialmente no inmunogénico y/o no comprende ningún residuo de cisteína. De forma similar, la estructura tridimensional del espaciador es preferiblemente lineal o sustancialmente lineal.

Los ejemplos preferidos de péptidos espaciadores o enlazadores incluyen aquellos que se han usado para unir proteínas sin deteriorar sustancialmente la función de las proteínas unidas o al menos sin deteriorar sustancialmente la función de una de las proteínas unidas. Más preferiblemente los espaciadores o enlazadores se han usado para unir proteínas que comprenden estructuras con hélices enrolladas.

El enlazador puede incluir los residuos 53-56 de la tetranectina, que en la tetranectina forma una lámina β, y los residuos 57-59 que forman un giro en la tetranectina (Nielsen, B.B. et al, FEBS Lett. 412: 388-396, 1997). La secuencia del segmento es GTKVHMK (SEQ ID NO: 10). Este enlazador tiene la ventaja de que cuando está presente en la tetranectina nativa, está uniendo el dominio de trimerización con el dominio CRD, y por lo tanto es adecuado para conectar el dominio de trimerización a otro dominio en general. Además no se espera que la construcción resultante sea más inmunogénica que la construcción sin un enlazador.

De forma alternativa, se puede elegir como enlazador una subsecuencia de la lámina de conexión 3 de la fibronectina humana, correspondiente a los aminoácidos 1992-2102 (numeración SWISSPROT, entrada P02751). Preferiblemente se usa la subsecuencia PGTSGQQPSVGQQ (SEQ ID NO: 11) correspondiente a los aminoácidos número 2037-2049, y dentro de esa subsecuencia el fragmento GTSGQ (SEQ ID NO:52) correspondiente a los residuos de aminoácidos 2038-2042 es más preferible. Esta construcción tiene la ventaja de que es poco propensa al corte proteolítico y es poco inmunogénica ya que la fibronectina está presente a altas concentraciones en el plasma. De forma alternativa, un péptido enlazador adecuado puede estar basado en la secuencia de 10 residuos de aminoácidos de la región bisagra superior de la IgG3 murina. Este péptido (PKPSTPPGSS, SEQ ID NO: 12) se ha usado para la producción de anticuerpos dimerizados mediante una hélice enrollada (Pack P. y Pluckthun, A., 1992, Biochemistry 31 :1579-1584) y puede ser útil como un péptido espaciador según la presente invención. Incluso más preferible puede ser una secuencia correspondiente de la región bisagra superior de la IgG3 humana. No se espera que las secuencias de la IgG3 humana sean inmunogénicas en seres humanos.

En una forma preferida de realización, el péptido enlazador se selecciona del grupo del péptido de secuencia AP AETKAEPMT (SEQ ID NO: 13) y del péptido de secuencia GAP. Alternativamente, los dos componentes de los conjugados de la invención pueden estar conectados por un péptidos cuya secuencia contiene una diana de corte para una proteasa, permitiendo de esta manera la separación de ApoA-I del componente (ii) Los sitios de corte de proteasas adecuados para su incorporación en los polipéptidos de la invención incluyen enteroquinasa (sitio de corte DDDDK SEQ ID NO: 14), factor Xa (sitio de corte IEDGR, SEQ ID NO: 15), trombina (sitio de corte LVPRGS, SEQ ID NO: 16), proteasa TEV (sitio de corte ENLYFQG, SEQ ID NO: 17), proteasa PreScission (sitio de corte LEVLFQGP, SEQ ID NO: 18), internas y similares. En una forma preferida de realización, el sitio de corte es el de una proteasa que se expresa en tejidos tumorales, en tejidos inflamados o en hígado de forma que la separación de Apo A y del componente (ii) tenga lugar una vez que el conjugado ha llegado al hígado. En una forma preferida de realización, el enlazador contiene un sitio de reconocimiento de la metaloproteasa de matriz 9 (sitio de corte LFPTS, SEQ ID NO: 19).

2. Métodos de obtención de los conjugados de la invención

Los conjugados de la invención pueden obtenerse usando cualquier método conocido para un experto en la materia. Así, es posible obtener la proteína ApoA o la variante de dicha proteína por cualquier método estándar. Por ejemplo, la proteína ApoA-I se puede purificar a partir de muestras de suero de individuos o de animales de laboratorio (WO9807751, WO9811140, Jackson et al, 1976, Biochim Biophys Acta. 420:342-349, Borresen, A.L. y Kindt, T. J., 1978, J. Immunogenet. 5:5-12 y Forgez, P, y Chapman, M. J., 1982, J. Biochem. Biophys. Methods, 6:283-96). Alternativamente, la proteína ApoA-I puede obtenerse a partir del cDNA mediante expresión en un organismo heterólogo como, por ejemplo, E.coli, S.cerevisiae, P.pastoris, células de insecto usando métodos conocidos en la técnica tales como los descritos en WO07023476, WO9525786, WO8702062, Feng et al, (Protein. Expr. Purif., 2006, 46:337-42), PyIe et al, 1996 Biochemistry. 35:12046-52), Brissette et al, (Protein Expr. Purif. 1991, 2:296- 303) y Bonen, D.K. (J. Biol. Chem., 1997, 272:5659-67).

Una vez que se disponga de cantidad suficiente de proteína ApoA purificada, ésta debe conjugarse al compuesto terapéutico de interés. La conjugación del componente terapéuticamente activo (ii) a la molécula de Apo A puede ser llevado a cabo de distintas formas. Una posibilidad es la conjugación directa de un grupo funcional al componente terapéuticamente activo en una posición que no interfiera con la actividad de dicho componente. Grupos funcionales, según se entiende en la presente invención, se refiere a un grupo de átomos específicos en una molécula que son responsables de una reacción química característica de dicha molécula. Ejemplos de grupos funcionales incluyen, sin limitación, hidroxi, aldehido, alquilo, alquenilo, alquinilo, amida, carboxamida, aminas primarias, secundarias, terciarias y cuaternarias, aminoxi, azida, azo (diimida), bencilo, carbonato, ester, ether, glioxili, haloalquil, haloformil, imina, imida, cetona, maleimida, isocianida, isocianato, carbonilo, nitrato, nitrito, nitro, nitroso, peróxido, fenilo, fenilo, fosfino, fosfato, fosfono, piridilo, sulfuro, sulfonilo, sulfinilo, tioester, tiol y grupos 3,4-dihidroxi fenilalanina (DOPA) oxidados. Ejemplos de dichos grupos son grupos maleimida o glioxilil que reaccionan de forma específica con grupos tioles en la molécula de Apo A y grupos 3, 4-dihidroxi- fenilalanina (DOPA) oxidados que reaccionan con grupos aminos primarios en la molécula de Apo A. Otra posibilidad es conjugar el componente terapéuticamente activo (ii) a la molécula de Apo A mediante el uso de grupos homo- o heterobifuncionales. El grupo bifuncional puede ser conjugado en primer lugar al compuesto terapéuticamente activo y, a continuación, conjugado a la proteína Apo A o, alternativamente, es posible conjugar el grupo bifuncional a la proteína Apo A y, a continuación, conjugar este al compuesto terapéuticamente activo. Ejemplos ilustrativos de este tipo de conjugados incluyen los conjugados conocidos como cetona-oxima (descrito en US20050255042) en los que el primer componente del conjugado comprende un grupo aminoxi que se une a un grupo cetona presente en un grupo heterobifuncional que, a su vez, se une a un grupo amino en el segundo componente del conjugado.

En otras formas de realización, el agente que se usa para conjugar los componentes (i) y (ii) de los conjugados de la invención puede ser procesado fotolíticamente, químicamente, térmicamente o enzimáticamente. En particular, resulta de interés el uso de agentes enlazantes que pueden ser hidrolizados por enzimas que se encuentran en la célula diana, de forma que el compuesto terapéuticamente activo se libera únicamente en el interior celular. Ejemplos de tipos agentes enlazantes que pueden ser procesados intracelularmente han sido descritos en WO04054622, WO06107617, WO07046893 y WO07112193.

En una forma preferida de realización, el componente (ii) del conjugado de la invención es un compuesto de naturaleza peptídica, incluyendo tanto oligopéptidos como péptidos. Métodos para modificar químicamente una cadena polipeptídica son ampliamente conocidos para el experto en la materia e incluyen métodos basados en la conjugación a través de los grupos tioles presentes en los restos de cisterna, métodos basados en la conjugación a través de los grupos amino primario presentes en los restos de lisina (US6809186), métodos basados en la conjugación a través de los restos N- y C- terminales. Reactivos adecuados para la modificación de polipéptidos para permitir su acoplamiento a otros compuestos incluyen: glutaraldehido (permite unir compuestos al extremo N-terminal de polipéptidos), carbodiimida (permite unir el compuest al extremo C-terminal de un polipéptido), esteres de succinimida (por ejemplo MBS, SMCC) que permite activar el extremo N-terminal y restos de cisterna, bencidina (BDB), que permite activar restos de tirosina, peryodato, que permite activar restos carbohidratados en aquellas proteínas que se encuentran glicosiladas.

En el caso particular de que el componente ApoA y el compuesto terapéutico de interés formen una única cadena peptídica, es posible la expresión del conjugado en un único paso utilizando una construcción génica de la invención que codifica para dicho conjugado, para lo cual dicha construcción se introduce en un vector adecuado para su expresión en un organismo heterólogo junto con elementos de control de transcripción y, opcionalmente, de traducción. Los elementos de control de transcripción y, opcionalmente, de traducción, presentes en el cásete de expresión de la invención, incluyen promotores, que dirigen la transcripción de la secuencia de nucleótídos a la que están operativamente enlazados y otras secuencias necesarias o apropiadas para la transcripción y su regulación adecuada en tiempo y lugar, por ejemplo, señales de inicio y terminación, sitios de corte, señal de poliadenilación, origen de replicación, activadores transcripcioπales (enhancers), silenciadores transcripcionales (silencers), etc. En general, dichos elementos, así como los vectores utilizados para construir los casetes de expresión y los vectores recombinantes según la invención, se eligen en función de las células hospedadoras que se pretenden utilizar. 1. Poliπucleótidos, construcciones génicas, vectores, células hospedadoras y nauolipσpartíciilas de la invención.

En otro aspecto, la invención se relaciona con un polinucleótido que codifica un polipéptído de la invención. El experto en la materia apreciará que los poliaucleύtidos de la invención codificarán únicamente aquellos conjugados en los que el componente (ii) sea de naturaleza peptídica y en los que el polipéptído Apo A forme una única cadena peptídica, independientemente de la orientación relativa e independientemente de que ambos componentes se encuentren directamente conectados o separados por una región espadadora.

En otro aspecto, la invención se relaciona con una construcción génica que comprende un polinucleótido de la invención. Preferiblemente, la construcción comprende el polinucleótido de la invención situado bajo el control operativo de secuencias que regulan la expresión del polinucleótido de la invención. El experto en la materia apreciará que los polinudéotídos de la invención deben acceder al núcleo de un tejido diana y allí transcribirse y traducirse para dar lugar a la proteína de fusión biológicamente activa. Por este motivo, cuando el principo activo que se administra es un polinucleótido, este debe codificar preferentemente la forma precursora pre- proApoAl o la forma precursora de la variante de ApoAl, de forma que tras su expresión se secrete gracias a la secuencia señal y se procese para dar lugar a la ApoAl madura. En el caso de que se desee expresar el conjugado formado por Apo A fusionado a través de su extremo C-terminal con una molécula de interferón, es preferible que el polinucleótido que lo codifica esté precedido de una secuencia que codifica la secuencia señal de ApoAl . En el caso de que se desee expresar el conjugado formado por una molécula de interferón fusionada a través de su extremo C-terminal con el extremo N- terminal de una molécula de Apo A, es preferible que el polinucleótido que lo codifica esté precedido de una secuencia que codifica la secuencia señal de interferón αl.

En principio, cualquier promotor puede ser utilizado para las construcciones génicas de la presente invención siempre que dicho promotor sea compatible con las células en las que se desea expresar el polinucleótido. Así, promotores adecuados para la realización de la presente invención incluyen, sin estar necesariamente limitados, promotores constitutivos tales como los derivados de los genomas de virus eucariotas tales como el virus del polioma, adenovirus, SV40, CMV, virus del sarcoma aviar, virus de la hepatitis B, el promotor del gen de la metalotioneina, el promotor del gen de la timidina kinasa del virus del herpes simplex, regiones LTR de los retrovirus, el promotor del gen de la inmuno globuina, el promotor del gen de la actina, el promotor del gen EF-lalpha así como promotores inducibles en los que la expresión de la proteína depende de la adición de una molécula o de una señal exógena, tales como el sistema tetraciclina, el sistema NFκB/luz UV, el sistema Cre/Lox y el promotor de los genes de choque térmico, los promotores regulables de la ARN polimerasa II descritos en WO/2006/135436 así como promotores específicos de tejido. En una forma preferida de realización, las construcciones génicas de la invención contienen las regiones aumentadoras de la expresión presentes en las regiones promotoras de genes de expresión predominantemente hepática tales como los genes de la albúmina sérica humana, de la protrombina, de la alpha-1-microglobulina o de la aldolasa, bien en una única copia en forma de varias copias de la misma y bien de forma aislada o en combinación con otros elementos de expresión específica en hígado tales como los promotores de citomegalovirus, alpha-1 -antitripsina o albúmina. Otros ejemplos de promotores que son específicos de tejido incluyen el promotor del gen de la albúmina (Miyatake et al., 1997, J. Virol, 71:5124-32), el promotor central del virus de la hepatitis (Sandig et al, 1996, Gene Ther., 3:1002-9); el promotor del gen de la fetoproteina alfil (Arbuthnot et al., 1996, Hum.GeneTher., 7:1503-14), y el promotor del gen de Ia proteína de unión a la globulina que une tiroxina (Wang, L., et al., 1997, Proa Natt.Acad.Sci.USA 94:11563-11566).

Las polinucleótidos de la invención o las construcciones génicas que las constituyen pueden estar formando parte de un vector. Asf, en otro aspecto, la invención se relaciona con un vector que comprende un polinucleótído o una construcción génica de la invención. El experto en la materia apreciará que no existe limitación en cuanto al tipo de vector que puede ser utilizado ya que dicho vector puede ser un vector de clonaje adecuado para la propagación y para obtener los polinucleótidos o construcciones génicas adecuadas o vectores de expresión en distintos organismos heterólogos adecuados para la purificación de los conjugados. Así; vectores adecuados de acuerdo a la presente invención incluyen vectores de expresión en procariotas tales como pUC18, pUC19, Bluescript y sus derivados, mpl8, mpl9, pBR322, pMB9, CoIEl , pCRl , RP4, fagos y vectores "shuttle" tales como ρSA3 and pAT28, vectores de expresión en levaduras tales como vectores del tipo de plásmidos de 2 mieras, plásnüdos de integración, vectores YEP, plásmidos centroméricos y similares, vectores de expresión en células de insectos tales como los vectores de la serie pAC y de la serie pVL, vectores de expresión en plantas tales como vectores de la serie pIBI, pEarlβyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE y similares y vectores de expresión en células eucariotas superiores bien basados en vectores virales (adenovirus, virus asociados a los adenovirus así como retrovirus y lentivirus) así como vectores no virales tales como pSilencer 4.1-CMV (Ambion), pcDNA3, pcDNA3.1/hyg pHCMV/Zeo, pCR3.1, pEFl/His, pIND/GS, pRc/HCMV2, pSV40/Zeo2, pTRACER- HCMV, pUB6/V5-His, pVAXl, pZeoSV2, pCI, pSVL and pKSV-10, ρBPV-1, pML2d ypTDTl.

El vector de la invención puede ser utilizado para transformar, transfectar o infectar células susceptibles de ser transformadas, transfectadas o infectadas por dicho vector. Dichas células pueden ser procariotas o eucariotas. A modo de ejemplo, el vector donde se introduce dicha secuencia de ADN puede ser un plásmido o un vector que, cuando se introduce en una célula hospedadora, se integra en el genoma de dicha célula y se replica junto con el cromosoma (o cromosomas) en el que (o en los que) se ha integrado. La obtención de dicho vector puede realizarse por métodos convencionales conocidos por los técnicos en la materia (Sambrok et al., 2001, citado supra).

Por tanto, en otro aspecto, la invención se relaciona con una célula que comprende un polinucleótido, una construcción génica o un vector de la invención, para lo cual dicha célula ha podido ser transformada, transfectada o infectada con una construcción o vector proporcionado por esta invención. Células transformadas, transfectadas o infectadas pueden ser obtenidas por métodos convencionales conocidos por los expertos en la materia (Sambrok et al., 2001, citado supra). En una realización particular, dicha célula hospedadora es una célula animal transfectada o infectada con un vector apropiado.

Células huésped adecuadas para la expresión de los conjugados de la invención incluyen, sin estar limitado, células de mamíferos, plantas, insectos, de hongos y de bacterias. Células bacterianas incluyen, sin estar limitado, células de bacterias Gram positivas tales como especies del género Bacillus, Streptomyces y Staphylococcus y células de bacterias Gram negativas tales como células del género Escherichia y Pseudomonas. Células de hongos incluyen, preferiblemente, células de levaduras tales como Saccharomyces, Pichia pastoris y Hansenula polymorpha. Células de insectos incluyen, sin limitación, células de Drosophila y células Sf9. Células de plantas incluyen, entre otros, células de plantas de cultivos tales como cereales, plantas medicinales, ornamentales o de bulbos. Células de mamíferos adecuadas para en la presente invención incluyen líneas celulares epiteliales (porcinas, etc.), líneas celulares de osteosarcoma (humanas, etc.), líneas celulares de neuroblastoma (humanas, etc.), carcinomas epiteliales (humanos, etc.), células guales (murinas, etc.), líneas celulares hepáticas (de mono, etc.). células CHO (Chínese Hámster Ovary), células COS, células BHK, células HeLa, 911, AT1080, A549, 293 o PER.C6, células ECCs humana NTERA-2, células D3 de la línea de mESCs, células troncales embrionarias humanas tales como HS293 y BGVOl, SHEFl, SHEF2 y HS181, células NIH3T3, 293T, REH y MCF-7 y células hMSCs.

En otro aspecto, la invención se relaciona con una nanolipopartícula que comprendre un conjugado de la invención.

En el contexto de la presente invención, el término "nanolipopartícula" es equivalente a los términos "lipoproteína" o "partícula de lipoproteína" y pueden emplearse indistintamente. Por nanolipopartícula se entiende cualquier partícula hidrosoluble, formada por un núcleo de lípidos apolares (tales como colesterol esterificado y triglicéridos) cubiertos con una capa externa polar formada por apoproteínas, fosfolípidos y colesterol libre.

Las nanolipopartículas o lipoproteínas se clasifican en función de su densidad en quilomicrones, lipoproteínas de muy baja densidad (VLDs), lipoproteínas de densidad intermedia (IDLs), lipoproteínas de baja densidad (LDLs) y lipoproteínas de alta densidad (HDLs). Las diferentes características de las lipoproteínas se muestran en la Tabla 1. Tabla 1

Figure imgf000028_0001

En una realización particular, la nanolipopartícula es una lipoproteína de tipo HDL caracterizadas por presentar una composicióin como la indicada en la tabla anterior y porque, la apo lipoproteínas que forman la fracción proteica son la Apo A, Apo C, Apo D y Apo E Las nanolipopartículas de la invención pueden obtenerse mediante métodos convencionales conocidos por los técnicos en la materia. A modo ilustrativo, las nanolipopartículas de la invención pueden obtenerse in vitro mediante la adición de colesterol y fosfatidilcolina al conjugado de la invención tal como se describe en Lerch et al. (Vox Sang, 1996, 71 : 155-164) o in vivo mediante el empleo de un animal no- humano que expresa en el hígado el conjugado de la invención dando lugar a la formación de snanolipopartícula que son secretadas al suero, de donde pueden aisladas.

4. Usos médicos de los conjugados de la invención

Los conjugados de la invención resultan de utilidad para la vehiculización al hígado y la estabilización de compuestos de interés terapéutico. Por tanto, en otro aspecto, la invención se relaciona con una preparación farmacéutica que comprende una cantidad terapéuticamente efectiva de un conjugado, de un polinucleótido, de una construcción génica, de un vector, de una célula hospedadora o de una nanolipopartícula de acuerdo a la invención y un carrier o excipiente farmacéuticamente aceptable.

En otro aspecto, la invención se relaciona con un polipéptido de la invención, un polinucleótido de la invención, una construcción génica de la invención, un vector de la invención, una nanolipopartícula de la invención o una composición farmacéutica para su uso en medicina.

Para uso en medicina, los conjugados de la invención pueden encontrarse en forma de prodroga, sal, solvato o clatrato, bien de forma aislada o bien en combinación con agentes activos adicionales. Las combinaciones de compuestos de acuerdo con la presente invención pueden ser formuladas conjuntamente con un excipiente que sea aceptable desde el punto de vista farmacéutico. Excipientes preferidos para su uso en la presente invención incluyen azúcares, almidones, celulosas, gomas y proteínas. En una realización particular, la composición farmacéutica de la invención se formulará en una forma farmacéutica de administración sólida (por ejemplo comprimidos, cápsulas, grageas, granulos, supositorios, sólidos estériles cristalinos o amorfos que pueden reconstituirse para proporcionar formas líquidas etc.), líquida (por ejemplo soluciones, suspensiones, emulsiones, elixires, lociones, ungüentos etc.) o semisólida (geles, pomadas, cremas y similares). Las composiciones farmacéuticas de la invención pueden ser administradas por cualquier ruta, incluyendo, sin ser limitante, oral, intravenosa, intramuscular, intrarterial, intramedular, intratecal, intraveutricular, transdéπnica, subcutánea, intraperitoneal, intranasal, entérica, tópica, sublingual o rectal. Una revisión de las distintas formas de administración de principios activos, de los excipientes a utilizar y de sus procedimientos de fabricación puede encontrarse en el Tratado de Farmacia Galénica, C. fauli i Trillo, Luzán 5, S A.. de Ediciones, 1993 y en Remington's Phaπnaceutical Sciences (A.R, Gennaro, Ed.), 20a edición, Williams & Wilkins PA, USA (2000). Ejemplos de vehículos farmacéuticamente aceptables son conocidos en el estado de la técnica e incluyen soluciones salinas tamponadas con fosfato, agua, emulsiones, tales como emulsiones aceite/agua, diferentes tipos de agentes humectantes, soluciones estériles, etc. Las composiciones que comprenden dichos vehículos se pueden formular por procedimientos convencionales conocidos en el estado de la técnica.

Hn el caso de que se administren ácidos nucleicos (los polinucléotidos de la invención, los vectores o las construcciones génicas), la invención contempla composiciones farmacéuticas especialmente preparadas para la administración dichos ácidos nucleicos. Las composiciones farmacéuticas pueden comprender dichos ácidos nucleicos en forma desnuda, es decir, en ausencia de compuestos que protejan a los ácidos nucleicos de su degradación por las nucleasas del organismo, lo que conlleva la ventaja de que se elimina la toxicidad asociada a los reactivos usados para la transfeccióπ. Rutas de administración adecuadas para los compuestos desnudos incluyen intravascular, intratumoral, intracraneal, intraperitoneal, intraesplénica, intramuscular, subretinal, subcutánea, mucosa, tópica y oral (Terapleton, 2002, DNA CeIl Biol., 21:857-867). Alternativamente, los ácidos nucleicos pueden administrarse formando parte de liposomas, conjugadas a colesterol o conjugados a compuestos capaces de promover la translocación a través de membranas celulares tales como el péptído Tat derivado de la proteína TAT de HIV-I, la tercera hélice del homeodominio de la proteína Antennapedia de D.melanogaster, la proteína VP22 del virus del herpes simplex, oligómcros de arginina y péptidos tales como los descritos en WO070Ó9090 (Lindgren, A. et al., 2000, Trends Phaπnacol. Sd, 21:99-103, Schwarze, S.R. et al. , 2000, Trends Phaπnacol. ScL, 21:45-48, Lundberg, M et al., 2003, Mol. Therapy 8:143-150 y Snyder, EX. y Dowdy, S.F., 2004, Pharm. Res. 21 :389-393). Alternativamente, el polinucléotido puede administrarse formando parte de un vector plasmídico o de un vector viral, preferiblemente vectores basados en adenovirus, en virus adenoasociados o en retrovirus, tales como virus basados en el virus de la leucemia murina (MLV) o en lentivirus (HIV, FIV, EIAV).

En otra forma de realización, las composiciones y polinucleótidos de la invención se administran mediante la llamada "administración hidrodinámica" según ha sido descrito por Liu, F., et al, (Gene Ther, 1999, 6:1258-66). Según dicho método, los compuestos se introducen en el organismo por vía intravascular a alta velocidad y volumen, lo que resulta en unos elevados niveles de transfección con una distribución más difusa. Se ha demostrado que la eficacia del acceso intracelular depende de forma directa del volumen de fluido administrado y de la velocidad de la inyección (Liu et al, 1999, Science, 305:1437-1441). En ratones, la administración se ha optimizado en valores de lml/10 g de peso corporal en un periodo de 3-5 segundos (Hodges et al, 2003, Exp.Opin.Biol.Ther, 3:91-918). El mecanismo exacto que permite la transfección celular in vivo con polinucleótidos tras su administración hidrodinámica no es del todo conocido. En el caso de ratones, se piensa que la administración por la vena de la cola tiene lugar a un ritmo que excede el ritmo cardiaco, lo que provoca que el fluido administrado se acumule en la vena cava superior. Este fluido accede posteriormente a los vasos en los órganos y, posteriormente, a través de fenestraciones en dichos vasos, accede al espacio extravascular. De esta forma, el polinucléotido entra en contacto con las células del órgano diana antes de que se mezcle con la sangre reduciendo así las posibilidades de degradación por nucleasas.

Las composiciones de la invención pueden ser administradas en dosis de menos de 10 mg por kilogramo de peso corporal, preferiblemente menos de 5, 2, 1, 0.5, 0.1, 0,05, 0,01, 0,005, 0,001, 0,0005, 0,0001, 0,00005 ó 0,00001 mg por cada kg de peso corporal y menos de 200 nmol de agente ARN, es decir, en torno a 4.4 x 1016 copias por kg de peso corporal o menos de 1500, 750, 300, 150, 75, 15, 7,5, 1,5, 0,75, 0,15 ó 0,075 nmol por Kg de peso corporal. La dosis unitaria se puede administrar por inyección, por inhalación o por administración tópica. Las composiciones y polinucleótidos bifuncionales de la invención pueden ser administradas directamente en el órgano en el que se exprese el ARNm diana en cuyo caso se administran dosis de entre 0.00001 mg a 3 mg por órgano, o preferiblemente entre 0.0001 y 0.001 mg por órgano, en torno a 0,03 y 3.0 mg por órgano, en torno a 0,1 y 3,0 mg por órgano o entre 0,3 y 3,0 mg por órgano.

La dosis depende de la severidad y respuesta de la condición a tratar y puede variar entre varios días y varios meses o hasta que se observe que la condición remite. La dosificación óptima se puede determinar realizando mediciones periódicas de las concentraciones de agente en el organismo del paciente. La dosis óptima se puede determinar a partir de los valores de EC50 obtenidos mediante ensayos previos in vitro o in vivo en modelos animales. La dosis unitaria se puede administrar una vez al día o menos de una vez al día, preferiblemente, menos de una vez cada 2, 4, 8 o 30 días. Alternativamente, es posible administrar una dosis inicial seguida de una o varias dosis de mantenimiento, generalmente de menos cantidad que la dosis inicial. El régimen de mantenimiento puede implicar tratar al paciente con dosis que oscilan entre 0,01 μg y 1,4 mg/kg de peso corporal por día, por ejemplo 10, 1, 0,1, 0,01, 0,001, o 0,00001 mg por kg de peso corporal por día. Las dosis de mantenimiento se administran, preferiblemente, como mucho una vez cada 5, 10 ó 30 días. El tratamiento se debe continuar durante un tiempo que variará según el tipo de alteración que sufra el paciente, su severidad y el estado del paciente. Tras el tratamiento, se debe monitorizar la evolución del paciente para determinar si se debe incrementar la dosis en caso de que la enfermedad no responda al tratamiento o se disminuye la dosis si se observa una mejora de la enfermedad o si se observan efectos secundarios indeseados. La dosis diaria se puede administrar en una única dosis o en dos o más dosis según las circunstancias particulares. Si se desea una administración repetida o administraciones frecuentes, es aconsejable la implantación de un dispositivo de administración tal como una bomba, un catéter semipermanente (intravenoso, intraperitoneal, intracisternal o intracapsular) o un reservorio.

Los conjugados de la invención, los polinucleótidos que los codifican, las construcciones génicas y vectores que comprenden dichos polinucleótidos y las nanolipopartículas que comprenden los conjugados de la invención pueden usarse en métodos de tratamiento terapéutico dada la capacidad de dichos conjugados de vehiculizar un compuesto de interés terapéutico a un tejido diana. El experto en la materia apreciará que las enfermedades que pueden ser tratadas con los compuestos de la invención dependerán (i) del componente activo que se encuentre asociado a Apo A y (ii) del tejido al que se vehiculicen dichos conjugados. La Tabla2 describe de forma no limitante posibles enfermedades que pueden ser tratadas con dichos conjugados y el principio activo que sería necesario incorporar al conjugado:

Figure imgf000033_0001
Figure imgf000034_0001

Los conjugados de la invención tienen la capacidad de dirigirse a aquellos órganos o tejidos en los que exista expresión de moléculas de superficie con suficiente afinidad por ApoA y con capacidad de internalizarse tras la unión con dicho polipéptido. Dichas moléculas de superficien incluyen SR-B l (scavenger receptor B type 1), SR-Al (scavenger receptor A type 1), SR- A2 (scavenger receptor A type 1) y SR-C (scavenger receptor C). De esta manera, los compuestos terapéuticamente activos pueden ser vehiculizados a dichos órganos o tejidos diana. Estos órganos incuyen no sólo el hígado, sino también todas aquellas células que expresen en su superficie cantidades suficientes del receptor SR-BI. Así, el ejemplo 7 de la presente invención ilustra la presencia del receptor SR-BI en distintas poblaciones del sistema inmune y, en particular, en linfocitos T CD4+, en linfocitos T CD8+, en linfocitos NK; en células dendríticas y en monocitos/macrófagos. Así, la invención también contempla el uso de los conjugados de la invención para el tratamiento de enfermedades asociadas con el sistema inmune. Adicionalmente, es conocida la expresión del receptor SR-BI en osteoclastos (Brodeur et al, 2008, J. Bone Miner Res. 23:326-37), en células endoteliales (Yeh et al, 2002, Atherosclerosis, 161 :95-103), epitelio intestinal (Cai, S. F. et al., 2001 , J. Lipid Res. 42:902-909), en el epitelio de la vesícula biliar (Miquel et al., Gut, 2003, 52:1017- 1024), en tejido adiposo (Acton et al., 1994, J.Biol.Chem., 269:21003-21009) y en pulmón (Acton et al, 1994, J.Biol.Chem., 269:21003-21009). Por tanto, los conjugados de la presente invención son adecuados para la vehiculización de compuestos de interés terapéutico a los compartimentos señalados anteriormente. Así, atendiendo al órgano diana, los conjugados de la invención pueden ser utilizados para el tratamiento de enfermedades hepáticas tales como colestasis intrahepática, hígado graso (hígado graso alcohólico, síndrome de reye), trombosis de la vena hepática, degeneración hepatoventricular, hepatomegalia, síndrome hepatopulmonar, síndrome hepatorrenal, hipertensión portal, abscesos hepáticos, cirrosis (alcohólica, biliar, experimental), enfermedades del hígado alcohólico (hígado graso, hepatitis, cirrosis), enfermedades parasitarias (equinococosis, fasciolasis, abscesos amebianos), ictericia (hemolítica, hepatocelular y colestática), hepatitis (hepatitis alcohólica, hepatitis crónica, autoinmune, hepatitis B, hepatitis C, hepatitis D, hepatitis inducida por drogas, hepatitis tóxica, hepatitis viral (hepatitis A, B, C, D y E), enfermedad de Wilson, hepatosis granulomatosa, cirrosis biliar secundaria, cirrosis biliar primaria, encefalopatía hepática, hipertensión portal, adenoma hepatocelular, hemangioma, cálculos biliares, neoplasmas hepáticos (angiomiolipoma, metástasis de hígado calcificadas, metástasis de hígado cístico, hepatocarcinoma fibrolamelar, hiperplasia nodular focal, adenoma hepático, cistadenoma hepatobiliar, hepatoblastoma, carcinoma hepatocelular, hepatoma, cáncer de hígado, hemangioendotelioma hepático, hiperplasia nodular regenerativa, tumores benignos de hígado, quistes hepáticos (quistes simples, quistes policísticos, cistadenoma hepatobiliar, tumores mesenquimales del hígado [hamartoma mesenquimal, hemangioendotelioma infantil, hemangioma, hepatis peliosis, lipomas, pseudotumor inflamatorio], tumores epiteliales del conducto biliar, hamartoma del conducto biliar, adenoma del conducto biliar, tumores malignos del hígado [hepatocelular, hepatoblastoma, carcinoma hepatocelular, cáncer colangiocelular, colangiocarcinoma, cistadenocarcinoma, tumores de capilares, angiosarcoma, sarcoma de Karposi, hemangioendotelioma, sarcoma embrional sarcoma, fibrosarcoma, leio mió sarcoma, rabdomiosarcoma, carcino sarcoma, teratoma, carcinoma escamoso, linfoma primario]), porfiria eritrohepática, porfiria hepática (porfiria intermitente aguda, porfiria cutánea tardía), síndrome de Zellweger.

Los conjugados de la invención pueden ser utilizados para el tratamiento de enfermedades del sistema inmune tales como: • enfermedades auto inmunes: Enfermedad de Addison, anemia hemolítica autoinmune, enfermedad por anticuerpos antimembrana basal glomerular, síndrome antifosfolípido, artritis reumatoide, enfermedades autoinmunes del sistema nervioso, dermatitis herpetiforme, diabetes mellitus Tipo 1, fiebre meditarránea familiar, glomerulonefritis por IGA, glomerulonefritis membranosa, síndrome de Goodpasture, enfermedad de Graves, hepatitis autoinmune, síndrome miasténico de Lambert-Eatón, lupus Eritematoso Sistémico, oftalmía simpática, penfigo, poliendocrinopatías autoinmune, púrpura trombocitopénica idiopática, enfermedad de Reiter y tiroiditis autoinmune),

• enfermedades por incompatibilidad de grupos sanguíneos: eritroblastosis fetal, isoinmunización Rh,

• glomerulonefritis membranoproliferativa,

• enfermedad injerto contra huésped,

• hipersensibilidad: hipersensibilidad a las drogas, enfermedades ambientales, hipersensibilidad retardada (inhibición de migración celular, encefalomielitis aguda diseminada), hipersensibilidad inmediata (anafilaxis, conjuntivitis alérgica, dermatitis atópica), enfermedades del complejo inmune (vasculitis por hipersensibilidad, reacción de Arthus, enfermedad del suero), hipersensibilidad al látex, síndrome de Wissler.

• síndromes de deficiencia inmunológica tales como disgammaglobulinemia, infecciones por HIV-I, infecciones por HTLV-I o HTL V-2, leucosis bovina enzoótica, linfopenia, disfunciones de fago tales como el síndrome de Chediak-Higashi, la enfermedad granulomatosa crónica, síndrome de Job, agammaglobulinemia, ataxia telangiectasia, inmunodeficiencia variable común, síndrome de DiGeorge, síndrome de deficiencia de adhesión del leucocito, síndrome de Wiskott-Aldrich,

• púrpura trombocitopénica,

• trastornos inmunoproliferativos: hiperglobulinemia (síndrome de Schnitzler), transtornos linfoproliferativos (granuloma, enfermedad de las cadenas pesadas, leucemia de células pilosas, leucemia linfocítica, leucemia mieloide, linfangiomioma, linfoma, sarcoidosis, agammaglobulinemia, hiperplasia de nodulo linfático gigante, linfadenopatía inmunoblástica, mononucleosis • infecciosa, granulomatosis Hnfomatoide, enfermedad dθ Marek, síndrome de Sézary, síndrome de lisis tumoral, macroglobulinemia de Waldenstrδm, enfermedad inmunoproliferativa del intestino delgado, leucemia plasmatítica, paraproteinemias y púrpura trombocitopénica), paraproteinemias.

Los conjugados de la invención pueden ser utilizados para el tratamiento de enfermedades del endotelio capilar tales como arterieesclerosis, arteriopatía obliterativa, enfermedad de Raynaud secundaria a conectivitis, hipertensión primitiva e hipertensión pulmonar secundaría, microangiopatía diabética, enfermedad de Buerger, esclerosis sistémica, vasculitis y todas las enfermedades caracterizadas por daño endotelial con la subsiguiente isquemia.

Los conjugados de la invención pueden ser utilizados para el tratamiento de enfermedades óseas tales como displasias caracterizadas por un crecimiento anormal del hueso. Ejemplos representativos de tales condiciones son acondroplasia, disostosis cleidocraneal, encondromatosis, displasia fibrosa, enfermedad de Gaucher, raquitismo hipofosíatémico, syndroiπe de Marfan, exotosis hereditaria múltiple, neurofibromatosis, osteogenesis imperfecta, osteopetrosis, osteopoiquilosis, lesiones escleróticas, fracturas, enfermedad periσdontal, seudoartrosis, osteomielitis piogenica, condiciones que resultan en osteopenia tales como estados anémicos, osteopenia ocasionada por esteoriodes y heparina, transtomos de la médula osea, escorbuto, makratrición, deficiencia en calcio, osteoporosis idiopática, osteopenia congénita, alcoholismo, enfermedad de Cushing, acromegalia, hipogonadismo, osteoporosis regional transitoria y osteomalacia.

Los conjugados de la invención pueden ser utilizados para el tratamiento de enfermedades del epitelio intestinal tales como síndromes de malabsorción, enfermedad de Cróhn, enfermedad diverticular del intestino, íleo paralítico y obstrucción intestinal.

Los conjugados de la invención pueden ser utilizados para el tratamiento de enfermedades respiratorias tales como vestibulitus nasal, rinitis no alérgica (por ejemplo, rinitis aguda, rinitis crónica, rinitis atrófica, rinitis vasomotora), pólipos nasales, sinusitis, angiofibromas juveniles, cáncer de nariz y papilomas juveniles, pólipos de las cuerdas vocales, nodulos, úlceras de con tacto, parálisis de las cuerdas vocales, laringoceles, faringitis, tonsilitis, celulitis tonsilar, abscesos parafaringeoa, laringitis, laringocele, cáncer de garganta (por ejemplo, cáncer nasofaríngeo, can cer tonsilar, cáncer de laringe), cáncer de pulmón (carcinoma de células escamosas, carcinoma microcítico, carcinoma macrocítico, adenocarcinotna), trastornos alérgicos (neumonía eosinofílica, alveolitis alérgica, neumonía intersticial alérgica, aspergilosis broncopulmonar alérgica, asma, granulomatosis de Wegener, síndrome de Goodpasture, neumonía (por ejemplo, neumonía bacteriana (por ejemplo, la causada por Streptococcus pneumoniae, por Staphylococcus aureus, por bacterias Gram-negativas tales como Klebsiella y Pseudomas spp, la causada por Mycoplasma pneumoniae, por Metnophilus influenzae, por Legionella pneumophil y por Chlamydia psittad y neumonías virales (por ejemplo, gripe o varicela), bronquiolitis, polio, Laringotraqueobrσnquitis (también llamada síndrome de croup), infección respiratoria por virus sincitiales, paperas, eritema infeccioso, roseóla infantiim, rubéola, neumonía fungica, (por ejemplo bistoplasmosis, coccidioidomicosis, blastomicosis e infecciones tungusas en pacientes inmunodeprimidos tales como criptococosis provocada por Cryptococcus neoformans\ aspergilosis provocada por Aspergillus spp.; candidiasis, provocada por Candida; y nmcormicosis), infección por Pneumocysíis carinii, neumonías atípicas (por ejemplo, las causadas por Mycoplasma and Chlamydia spp.), neumonía oportunística, neumonía nosocomial, neumonitis química y neumonía de aspiración, trastornos pleurales (por ejemplo pleuresía, efusión pleural y neumotorax (por ejemplo neumotorax simple espontaneo, neumotorax espontáneo complejo neumotorax por tensión), enfermedad obstructiva de las vías respiratorias (por ejemplo asma, enfermedad pulmonar obstructiva crónica, enfisema, bronquitis crónica o aguda), enfermedades pulmonares ocupacionales (por ejemplo silicosis, pulmón negro, asbestosis, beriliosis, asma ocupacional, bisinosis y neumoconiosis benigna), enfermedades pulmonares infiltrativas tales como fíbrosis pulmonar, alveolitis fibrosante, fibrosis pulmonar idiopáü'ca, neumonía intersticial descamativa, neumonía intersticial linfoide, histiocitosis X (por ejemplo enfermedad de Letterer-Siwe, enfermedad de Hand-Schueller-Christian, granuloma eosinófUo), hemosiderosis pulmonía idiopática, sarcoidosis y proteonosis alveolar pulmonar, síndrome de distrés respiratorio agudo, edema, embolia pulmonar, bronquitis (por ejemplo, bronquitis viral, bacterial), bronquiectasia, atelectasia, abscesos pulmonares y ñbrosis quística. En una forma preferida de realización, la invención contempla que el componente terapéuticamente activo sea un interferón. En ese caso, los conjugados o las polinucleótidos que los codifican serán de utilidad para el tratamiento de enfermedades hepáticas que respondan a interferón, tales como de hepatitis crónica C, hepatitis crónica B, hepatocarcinoma, cirrosis, fϊbrosis.

Por otro lado, dada la presencia de receptores SR-BI en células del sistema inmune, los conjugados de la invención pueden ser usados para dirigir compuestos terapéuticamente activos a dichas células. Así, en una realización preferida, los conjugados de la invención que contienen interferón como compuesto terapéuticamente activo pueden ser utilizados como adyuvante para potenciar la respuesta inmune de una vacuna. La vacuna puede ser una vacuna dirigida contra un organismo capaz de desencadenar una enfermedad infecciosa, una vacuna dirigida contra un tumor o una vacuna dirigida contra un alérgeno. Las vacunas pueden contener un componente de un agente infeccioso, un tumor o un alérgeno (péptido, polipéptido, glicopéptido, péptido multiepitópico, fragmento, etc.) o pueden ser una vacuna génica formada por un ácido nucleico que codifica un polipéptido de dicho organismo, tumor o alérgeno.

En otra forma de realización, los conjugados de la invención comprenden un péptido inhibidor de TGF-βl . Estos conjugados pueden ser utilizados en el tratamiento de enfermedades o alteraciones patológicas asociadas con una expresión en exceso o desregulada del TGF-βl, tales como (i) la fibrosis asociada con la pérdida de función de un órgano o un tejido, por ejemplo, fibrosis pulmonar, fibrosis hepática (cirrosis), fibrosis cardiaca, fibrosis renal, fibrosis corneal, etc., así como (ii) las complicaciones quirúrgicas y estéticas, por ejemplo, fibrosis asociada con la cirugía cutánea y peritoneal, fibrosis asociada con quemaduras, fibrosis osteo-articular, queloides, etc.

Los autores de la presente invención han puesto de manifiesto que la administración de los conjugados de la invención que comprenden un péptido inhibidor de TGF-βl de forma conjuntamente con IL- 12 resulta en una estimulación de la inducción de IFN- gamma mediada por IL-12. Dado que IFN-γ es un conocido agente antitumoral, el hallazgo de los inventores abre la puerta a un nuevo tratamiento antitumoral basado en la combinación de una citoquina inmunoestimuladora y un conjugado de acuerdo a la invención que comprende un péptido inhibidor de TGF-βl.

Así, en otro aspecto, la invención se relaciona con una composición que comprende

(a) un primer componente seleccionado entre un conjugado, un polinucleótido, una construcción génica, un vector, una célula hospedadora, una nanolipopartícula y una preparación farmacéutica de acuerdo a la invención, en donde el componente (ii) es un péptido inhibidor de TGF-βl, y

(b) un segundo componente seleccionado entre una citoquina inmunoestimuladora, un polinucleótido que codifica dicha citoquina, un vector que comprende dicho polinucleάtido, un péptido inhibidor de TGF-βl, un agente citotóxico y combinaciones de los mismos.

Citoquinas inmunoestimuladoras que pueden ser administradas conjuntamente con los conjugados de Apo A que comprenden, un péptido inhibidor de TGF-βl incluyen, sin limitación, 1L-12, IL-2, IL-15, IL-18, IL-24, GM-CSF, TNF-α, ligando CD40, IFN-α, IFN-β, IFN-γ. En una forma preferida de realización, la citoquina estimuladora es IL- 12. Péptidos inhibidores de TGF-βl que pueden formar parte del componente (b) de la composición de la invención incluyen esencialmente los mismos que se encuentran formando parte del conjugado de la invención tal y como se ha descrito anteriormente. Así, los péptidos inhibidores de TGF-βl pueden ser, sin limitación, el péptido pl44 (SEQ ID NO: 4) o el péptido pl7 (SEQ ID NO: 5). Los péptidos que forman parte del conjugado (componente (a) y del segundo componente de la invención pueden ser iguales o distintos.

Agentes citotóxicos, según se entiende en la presente invención, es un compuesto capaz de matar una célula selectiva- o no selectivamente o de inhibir el crecimiento de una célula. Ejemplos de agente citotóxicos incluyen paclitaxel, citocalasina B, garmicidina D, bromuro de etidio, emetina, mitomicina, ctoposido, tenoposido, vincristina, vinblastina, colchicina, doxorubicina, daunorubicina, dihidroxiantracina diona, mitoxantrone, mitramicma, antramicina, actinomicina D, 1-dehidrotestosterona, glucocorticoides, lidocaína, propranolol, puromicina, epiubicina, ciclofosfamida y homólogos y análogos de los mismos, antimetabolitos (metotrexato, 6-mercaptopurina, 6-tioguanina, citarabina, 5-fluorouracilo, decarbazina), agentes alquilantes (mecloretamina, tioepa, clorambucilo, melfalano, carmustine o BCNU y lomustina o CCNU), busulfan, dibromomanitol, estreptozotocina, mitomicina C, cisdiclorodoamina platino (II) (DDP o cisp latino), antraciclinas (daunorubicina y doxorubicina), antibióticos (dactinomicina) y bleomicina.

En otro aspecto, la invención se relaciona con el uso de las una composición de la invención para el tratamiento del cáncer, como por ejemplo, el tratamiento de distintos tipos de tumores que incluyen, sin limitación cánceres hematológicos (leucemias o linfomas, por ejemplo), tumores neurológicos (astrocitomas o glioblastomas, por ejemplo), melanoma, cáncer de mama, cáncer de pulmón, cáncer de cabeza y cuello, tumores gastrointestinales (cáncer de estómago, páncreas o colon, por ejemplo), cáncer de hígado (por ejemplo, carcinoma hepatocelular), cáncer de células renales, tumores genitourinarios (cáncer de ovario, cáncer de vagina, cáncer cervical, cáncer de vejiga, cáncer de testículo, cáncer de próstata, por ejemplo) tumores de hueso y tumores vasculares. Así, en otro aspecto, la invención se relaciona con una composición de la invención para el tratamiento del cáncer. En otro aspecto, la invención se relaciona con un método para el tratamiento del cáncer que comprende administrar a un sujeto una composición de la invención. En otro aspecto, la invención se relaciona con el uso de una composición de la invención para la preparación de un medicamento para el tratamiento del cáncer.

Las cantidades terapéuticamente efectivas de los componentes de la composición de la invención según se describe en la presente invención dependerá, por ejemplo, de los objetivos terapéuticos, de la ruta de administración y la condición del paciente. Así, es preferible que el médico ajuste el título de la dosis y modifique la vía de administración según la necesidad para obtener el efecto terapéutico máximo. Una dosis típica puede oscilar entre O.Olmg/kg hasta 250mg/kg o más diaria, cada 2 días, cada 3 días, cada 4 días, cada 5 días, cada 6 días o semanalmente. La administración de la composición de la invención puede tener lugar de distintas formas. Por ejemplo, los componentes (a) y (b) de la composición se pueden administrar secuencialmente,, separadamente y/o simultáneamente. En una forma de realización, los componentes (a) y (b) se pueden admiπsitrar simultáneamente (opcionalmente de forma repetida). En otra forma de realización! los componentes se administran secuencialmente (opcionalmente de forma repetida). En otra forma de realización,lo$ componentes se administrar separadamente (opcionalmente de forma repetida). Bl experto en la materia apreciará que cuando los componentes (a) y (b) se van a administrar secuencialmente o seriadamente, es posible administrar el compoβnte (a) seguido por el componetne (b) o el componente (b) seguido por el componente (a). En otra forma de realización, las formulaciones separadas de los componentes (a) y (b) pueden ser administrada usando patrones de dosificación alternantes Si la administración de los componentes (a) y (b) se lleva a cabo de forma secuencial o separada, el intervalo entre la administración del segundo componente no debe ser tan alto como para que se pierda el efecto de la terapia de combinación.

La invención se ilustra a continuación en base a los siguientes ejemplos que se proporcionan a modo ilustrativo y no limitativo del alcance de la invención.

EJEMPLOS

EJEMPLO 1

Materiales y métodos:

.1. Construcción de los vectores de expresión:

1.1 Extracción de RlVJA;

El RNA total de hígado de ratón o cerebro de ratones tratados fue aislado de muestras individuales usando TEI reagent (Sigma, Madrid» España). La concentración y pureza de las muestras rué determinada por la absorbencia a 260 y 280nm con corrección de fondo a 320nm en espectrofotómetro (Biophotometer, Eppendorf).

1.2 RT-PCR síntesis de cDNA total: El RNA total (3μg) fue tratado con DNasa I y retrotranscrito a cDNA con M-MLV RT en la presencia de RNase OUT (todos los reactivos de Invitrogen, Carlsbed, CA). Se obtuvieron 25 μl de cDNA total de hígado. La reacción fue incubada 1 h a 37°C, desnaturalizada 1 min a 95°C y llevada a 4°C . Las muestras fueron usadas inmediatamente para PCR o almacenadas a -200C.

1.3 Obtención y clonaje de cDNA de la Apolipoproteína Al murina (mApoAl):

Se diseñó el cebador sentido 5'-ATGAAAGCTGTGGTGCTGGC-3' (FwATGmApoAl) ( S E Q I D N O : 2 0 ) y e l c eb ador antis enti do 5 '- TCACTGGGCAGTCAGAGTCT-3 ' (RvT GAmApo Al) ( S EQ ID NO : 2 1 ). Se amplificó el cDNA de mApoAl (795 nucleótidos totales, 72 nucleótidos codificantes para el péptido señal y 723 nucleótidos codificantes para la proteína nativa) mediante PCR sobre el cDNA total de hígado, usando BioTaq DNA polimerase (Bioline, Londres, Reino Unido): 5 min 94°C, 30 ciclos de 40 seg a 94°C, 40 seg a 55°C y 40 seg a 72°C, seguido de 7 min a 72°C en termociclador 2720 Thermal cycler (Applied Biosystems, Foster City, EE.UU.). El producto de PCR fue migrado en gel de agarosa 1% Agarose D-I low EEO (Pronadisa, Madrid, España), y purificado el fragmento de gel mediante QIAquick Gel Extraction KH (Qiagen, Valencia, CA). El cDNA purificado de mApoAl fue clonado, siguiendo las instrucciones provistas por el fabricante, en el vector de expresión pcDNA™3.1/V5-His TOPO® TA (Invitrogen, Carlsbed, CA), que denominaremos pCMV-mApoAl. Finalmente, se confirmó la secuencia obtenida mediante secuenciación.

1.4 Obtención y clonaje de cDNA de Interferón alfa 1 murino (mlFNαl):

Se diseñó el cebador sentido 5'-ATGGCTAGGCTCTGTGCTTT-3' (FwATGmIFNaI) (SEQ ID NO : 22) y el cebador antisentido 5 '-TCATTTCTCTTCTCTCAGTC-3' (RvTGAmIFNaI) (SEQ ID NO :23). Se amplificó el cDNA de mlFNαl (570 nucleótidos totales, 69 nucleótidos codificantes para el péptido señal y 501 nucleótidos codificantes para la proteína nativa) mediante PCR sobre el cDNA total de hígado, usando BioTaq DNA polimerasa (Bioline, Londres, Reino Unido). Las condiciones de amplificación fueron: 5 min 94°C, 30 ciclos de 40 seg a 94°C, 40 seg a 55°C y 40 seg a 72°C, seguido de 7 min a 72°C en termociclador 2720 Thermal cycler (Applied Biosystems Foster City, EE.UU.). El producto de PCR fue migrado en gel de agarosa 1% Agarose D-I low EEO (Pronadisa, Madrid, España), y purificado el fragmento de gel mediante QIAquick Gel Extraction KH (Qiagen, Valencia, CA). El cDNA purificado de mlFNαl fue clonado, siguiendo las instrucciones provistas, en el vector de expresión pcDNA™3.1/V5-His TOPO® TA (Invitrogen, Carlsbed, CA), que denominaremos pCMV-mIFNal . Finalmente, se confirmó la secuencia obtenida mediante secuenciación.

1.5 Diseño de la fusión génica:

1.5.1 Fusión C terminal al gen mApoAl del gen mlFNal : Apo-IFN

Se diseñó el cebador antisentido 5 '-GGCGCGCCCTGGGCAGTCAGAGTCTCGC-S ' (RvAscImApoAl) (SEQ ID NO:24), que introduce la secuencia de 9 nucleótidos (GGCGCGCCC) que constituye un sitio de restricción para la enzima AscI en 3' del gen ApoAl y elimina el codón de terminación. Esta secuencia de restricción añadida se traducirá en un péptido de unión corto GAP, que dará cierta movilidad a las proteínas constituyentes. Se diseñó el cebador sentido 5 'GGCGCGCCCTGTGACCTGCC TCAGACTCA-3' (FwAscImIFNαl) (SEQ ID NO:25) que introduce la secuencia de restricción de AscI en 5' de la secuencia codificante para la proteína madura de mlFNαl (es decir, eliminación de la secuencia del péptido señal).

Se amplificó por PCR, usando como molde el pCMV-mApoAl , y los cebadores FwATGmApoAl y RvAscImApoAl, con la enzima BioTaq DNA polimerase (Bioline,

Londres, Reino Unido), 5 min 94°C, 30 ciclos de 40 seg a 94°C, 40 seg a 57°C y 40 seg a 72°C, seguido de 7 min a 72°C en termociclador 2720 Thermal cycler (Applied

Biosystems Foster City, EE.UU.). El producto de PCR (804 nucleótidos) fue migrado en gel de agarosa 1% Agarose D-I low EEO (Pronadisa, Madrid, España), y purificado el fragmento de gel mediante QIAquick Gel Extraction KH (Qiagen, Valencia, CA). El

DNA purificado de mApoAl-Ascí fue clonado, siguiendo las instrucciones provistas, en el vector de expresión pcDNA™3.1/V5-His TOPO® TA (Invitrogen, Carlsbed, CA), que denominaremos pCMV-mApo Al- AscI . Finalmente, se confirmó la secuencia obtenida mediante secuenciación.

Paralelamente se amplificó por PCR usando como molde el pCMV-mIFNal y los cebadores FwAscImIFNαl y RvTGAmIFNaI . Se usó la enzima BioTaq DNA polimerase (Bioline, Londres, Reino Unido) y las condiciones de amplificación siguientes: 5 min 94°C, 30 ciclos de 40 seg a 94°C, 40 seg a 57°C y 40 seg a 72°C, seguido de 7 min a 72°C en termociclador 2720 Thermal cycler (Applied Biosystems Foster City, EE.UU.). El producto de PCR (510 nucleótidos) fue migrado en gel de agarosa 1% Agarose D-I low EEO (Pronadisa, Madrid, España), y purificado el fragmento de gel mediante QIAquick Gel Extraction KH (Qiagen, Valencia, CA). El DNA purificado de AscI-mIFNαl fue clonado, siguiendo las instrucciones provistas, en el vector de expresión pcDNA™3.1/V5-His TOPO® TA (Invitrogen, Carlsbed, CA), que denominaremos pCMV-AscI-mIFNal . Finalmente, se confirmó la secuencia obtenida mediante secuenciación.

Para realizar la fusión génica los plásmidos pCMV-mApoAl-Ascí y pCMV-Asd- mlFNal fueron digeridos independientemente 1,5 h a 37°C con las enzimas Ascl/Pmel, IxBSA y Buffer 4 (New England Biolabs), aprovechando el sitio de restricción Pmel presente en el esqueleto del pcDNA 3.1 V5-His TOPO® TA. Ambas digestiones se migraron en gel de agarosa 1% y se purificaron las bandas correspondientes al vector abierto pCMV-mApoAl-Ascí y al inserto del pCMV-AscI-mIFNal . Se ligó el producto en un ratio 1 :3 (vector: inserto) usando la ligasa T4 DNA ligase High Concentration y como solución tampón el 2X Rapid Ligation Buffer (Promega Madison, Wl, U. S. A), incubando la mezcla 10 min a temperatura ambiente. Se transformaron posteriormente bacterias ToplO (Invitrogen, Carlsbed, C A). Las bacterias transformadas se seleccionaron por su crecimiento en placas de Petri con medio LB con ampicilina, ya que el vector contiene un gen de resistencia a este antibiótico. Se extrajo el ADN plasmídico de las bacterias positivas mediante la técnica de MiniPrep (Qiagen, Alemania) para, posteriormente, digerir 2 μg de dicho plásmido con las enzimas Ascl/Pmel (New England Biolabs) y separar por electroforesis el resultado de dicha digestión en un gel de agarosa al 1% para comprobar la presencia del inserto. El plásmido resultante de 6825 nts se denominará en adelante pCMV-Apo-IFN (pCMV- AF). 1.5.2 Fusión N terminal al gen mApoAl del gen mlFNal: IFN- Apo

Se diseñó el cebador antisentido 5 '-GGGCGCGCCTTTCTCTTCTCTCAGTCTTC-S ' (RvAscImIFNαl) (SEQ ID NO:26), que introduce la secuencia de 9 nucleótidos (GGCGCGCCC) que constituye un sitio de restricción para la enzima AscI en 3 ' del gen mlFNαl y elimina el codón de terminación. Se diseñó el cebador sentido 5 '- CCAGGCGCGCCGGATGAACCCCAGTCCCAATG-3' (FwAscImApoAl) (SEQ ID NO:27) que introduce la secuencia de restricción de AscI en 5 ' de la secuencia codificante para la proteína madura de mApoAl (es decir, eliminación de la secuencia del péptido señal). Este cebador incluye 3 nucleótidos en 5' para permitir el corte con AscI.

Se amplificó por PCR usando como molde el pCMV-mApoAl, y los cebadores FwAscImApoAl y RvTGAmApoAl, con la enzima BioTaq DNA polimerase (Bioline, Londres, Reino Unido), utilizando las condiciones de amplificación siguientes: 5 min 94°C, 30 ciclos de 40 seg a 94°C, 40 seg a 57°C y 40 seg a 72°C, seguido de 7 min a 72°C en termociclador 2720 Thermal cycler (Applied Biosystems Foster City, EE.UU.). El producto de PCR (732 nucleótidos) fue migrado en gel de agarosa 1% Agarose D-I low EEO (Pronadisa, Madrid, España), y purificado el fragmento de gel mediante QIAquick Gel Extraction Kit (Qiagen, Valencia, CA). El DNA purificado de AscI-mApoAl fue clonado, siguiendo las instrucciones provistas, en el vector de expresión pcDNA™3.1/V5-His TOPO® TA (Invitrogen. Carlsbed, CA), que denominaremos pCMV-AscI-mApoAl . Finalmente, se confirmó la secuencia obtenida mediante secuenciación.

Paralelamente, se amplificó por PCR usando como molde el pCMV-mIFNal y los cebadores FwATGmIFNaI y RvAscImIFNαl con la enzima BioTaq DNA polimerase (Bioline, Londres, Reino Unido) y las condiciones siguientes: 5 min 94°C, 30 ciclos de 40 seg a 94°C, 40 seg a 57°C y 40 seg a 72°C, seguido de 7 min a 72°C en termociclador 2720 Thermal cycler (Applied Biosystems Foster City, EE.UU.). El producto de PCR (576 nucleótidos) fue migrado en gel de agarosa 1% Agarose D-I low EEO (Pronadisa, Madrid, España), y purificado el fragmento de gel mediante QIAquick Gel Extraction Kit (Qiagen, Valencia, CA). El DNA purificado de mlFNαl-Ascí fue clonado, siguiendo las instrucciones provistas, en el vector de expresión pcDNA™3.1/V5-His TOPO® TA (Invitrogen, Carlsbed, CA), que denominaremos pCMV-mIFNal-AscI. Finalmente, se confirmó la secuencia obtenida mediante secuenciación. Para realizar la fusión génica, los plásmidos pCMV-Asd-mApoAl y pCMV-mlFNal- Ascl fueron digeridos independientemente 1,5 h a 37°C con las enzimas Ascl/Pmel, IxBSA y Buffer 4 (New England Biolabs), aprovechando el sitio de restricción Pmel presente en el esqueleto del pcDNA 3.1 V5-His TOPO® TA. Ambas digestiones se migraron en gel de agarosa 1% y se purificaron las bandas correspondientes al vector abierto pCMV-mIFNal-Ascí y al inserto del pCMV-Asd-mApoAl . Se ligó el producto en un ratio 1 :3 (vector: inserto) usando la ligasa T4 DNA ligase High Concentration y como solución tampón el 2X Rapid Ligation Buffer (Promega Madison, Wl, USA), incubando la mezcla 10 min a temperatura ambiente. Se transformaron posteriormente bacterias ToplO (Invitrogen, Carlsbed, C A). Las bacterias transformadas se seleccionaron por su crecimiento en placas de Petri con medio LB con ampicilina, ya que el vector contiene un gen de resistencia a este antibiótico. Se extrajo el ADN plasmídico de las bacterias positivas mediante la técnica de MiniPrep (Qiagen, Alemania) para, posteriormente, digerir 2 μg de dicho plásmido con las enzimas Ascl/Pmel (New England Biolabs) y separar por electro foresis el resultado de dicha digestión en un gel de agarosa al 1% para comprobar la presencia del inserto. El plásmido resultante de 6822 nucleótidos se denominará en adelante pCMV-IFN-Apo (pCMV-IA). 1.5.3 Fusión C terminal al gen mApoA 1 del péptido pl 7:

Se diseñó el cebador 5'-

TCACGCACGCTCATACCAAGAACTCCTAGGAATAAACCAAATACGCTTGG GCGCGCCCTGGGC-3' (RvmApoAlpl7) (SEQ ID NO:28). Se amplificó por PCR, con la enzima Easy-A High Fidelity PCR cloning enzyme (Stratagene, La Jolla, CA) usando como molde el pCMV-mApoAl-Ascí, y los cebadores FwATGmApoAl y RvmApoAlpl7. Se usaron las condiciones : 1 min 95°C, 30 ciclos de 40 seg a 95°C, 40 seg a 600C y lmin a 72°C, seguido de 7 min a 72°C en termociclador 2720 Thermal cycler (Applied Biosystems Foster City, EE.UU.). El producto de PCR fue migrado en gel de agarosa 1% Agarose D-I low EEO (Pronadisa, Madrid, España), y purificado el fragmento de gel mediante QIAquick Gel Extraction KH (Qiagen, Valencia, CA). El DNA purificado de mApoAl-AscI-pl7 fue clonado, siguiendo las instrucciones provistas, en el vector de expresión pcDNA™3.1/V5-His TOPO® TA (Invitrogen, Carlsbed, CA), que denominaremos pCMV- mApoAl-Asd-pl7. Finalmente, se confirmó la secuencia obtenida mediante secuenciación.

1.5.4 Fusión C terminal al gen mApoAl del péptido pl44:

Se diseñó el cebador 5'-

TCAATTCTGCATCATGGCCCAGATTATCGAGGCGTCCAGCGAGGTGG GCGCGCCCTGGGC-3' (RvmApoAlpl44) (SEQ ID NO:29). Se amplificó por PCR, con la enzima Easy-A High Fidelity PCR cloning enzyme (Stratagene, La Jolla, CA) usando como molde el pCMV-mApoAl-Ascí, y los cebadores FwATGmApoAl y RvmApoAlpl44. Las condiciones utilizadas fueron: 1 min 95°C, 30 ciclos de 40 seg a 95°C, 40 seg a 65°C y 1 min a 72°C, seguido de 7 min a 72°C en termociclador 2720 Thermal cycler (Applied Biosystems Foster City, EE.UU.). El producto de PCR fue migrado en gel de agarosa 1% Agarose D-I low EEO (Pronadisa, Madrid, España), y purificado el fragmento de gel mediante QIAquick GeI Extraction KH (Qiagen, Valencia, CA). El DNA purificado de mApoAl-AscI-pl44 fue clonado, siguiendo las instrucciones provistas, en el vector de expresión pcDNA™3.1/V5-His TOPO® TA (Invitrogen, Carlsbed, CA), que denominaremos pCMV- mApoAl-AscI-pl44. Finalmente, se confirmó la secuencia obtenida mediante secuenciación. 1.5.5 Clonaje de la secuencia génica del péptido señal de mApoAl:

Para construir los plásmidos que servirán de control en los experimentos de fusión mApoAl y péptidos, realizamos la fusión génica de la secuencia del péptido señal de mApoAl (SPmApoAl) con los péptidos pl7 y pl44 (sin la adición de la secuencia para AscI), y asegurar así que la secreción del péptido sea la misma que la de la mApoAl- péptidos. Se diseñó el cebador 5 '-TTGCTGCC ATACGTGCCAAG-3' (RvSPmApoAl) (SEQ ID NO:30), que junto con el cebador FwATGmApoAl se usa para amplificar el SPmApoAl, usando como molde el pCMV- mApoAl. El producto de PCR (72 nucleótidos) fue migrado en gel de agarosa 1% Agarose D-I low EEO (Pronadisa, Madrid, España), y purificado el fragmento de gel mediante QIAquick Gel Extraction KH (Qiagen, Valencia, CA). El DNA purificado de SPmApoAl fue clonado, siguiendo las instrucciones provistas, en el vector de expresión pcDNA™3.1/V5-His TOPO® TA (Invitrogen, Carlsbed, CA), que denominaremos pCMV- SPmApoAl. Finalmente, se confirmó la secuencia obtenida mediante secuenciación. 1.5.6 Fusión C terminal a la secuencia génica del péptido señal de mApoAl delpéptido pl7:

S e d i s e ñ ó e l c e b a d o r 5'- TCACGCACGCTCATACCAAGAACTCCTAGGAATAAACCAAATACGCTTT TGCTGCCAGAAATGCCG-3' (RvSPmApoAlpl7) (SEQ ID NO:31), que junto con el cebador FwATGmApoAl se usó para amplificar el SPmApoAl-pl7, partiendo del molde pCMV- mApoAl. El producto de PCR (120 nucleótidos) fue migrado en gel de agarosa 1% Agarose D-I low EEO (Pronadisa, Madrid, España), y purificado el fragmento de gel mediante QIAquick GeI Extraction KH (Qiagen, Valencia, CA). El DNA purificado de SPmApoAl-pl7 fue clonado, siguiendo las instrucciones provistas, en el vector de expresión pcDNA™3.1/V5-His TOPO® TA (Invita) gen. Carlsbed, CA), que denominaremos pCMV- SPmApoAl-pl7. Finalmente, se confirmó la secuencia obtenida mediante secuenciación.

1.5.7 Fusión C terminal a la secuencia génica del péptido señal de mApoAl delpéptido pl44:

Se diseñó el cebador 5'-

TCATTCTGCATCATGGCCCAGATTATCGAGGCGTCCAGCGAGGTTT GCTGCCAGAAATGCCG-3' (RvSPmApoAlpl44) (SEQ ID NO:32), que junto con el cebador FwATGmApoAl se usó para amplificar el SPmApoAl-pl44, partiendo del molde pCMV- mApoAl . El producto de PCR (117 nucléotiodos) fue migrado en gel de agarosa 1% Agarose D-I low EEO (Pronadisa, Madrid, España), y purificado el fragmento de gel mediante QIAquick Gel Extraction KH (Qiagen, Valencia, CA). El DNA purificado de SPmApoAl-p l44 fue clonado, siguiendo las instrucciones provistas, en el vector de expresión pcDNA™3.1/V5-His TOPO® TA (Invita) gen, Carlsbed, CA), que denominaremos pCMV- SPmApoAl-pl44. Finalmente, se confirmó la secuencia obtenida mediante secuenciación. 1.5.8 Introducción de secuencia MMP9 en pCMV-mApoAl-AscI-pl44:

Con el fin de dotar a la proteína de fusión generada a partir de este gen la posibilidad de liberación por escisión del péptido pl44, se estudió mediante la base de datos MEROPS (http://merops.sanger.ac.uk/) las proteasas capaces de cortar la secuencia aminoacídica de la proteína de fusión, liberando el p 144 completo. El resultado de la búsqueda dio como una candidata la metaloproteasa 9 (MMP9), que realizaba el corte dejando un aminoácido S en la secuencia del pl44. El uso de esta proteasa confería además a la construcción de capacidad de liberación de este inhibidor de TGF-β en los lugares donde es necesaria su inhibición (inhibición localizada, y no sistémica), ya que se ha descrito su presencia en carcinomas. La secuencia de DNA CTTTTCCCGACGTCT [SEQ ID NO: 51] (aminoácidos: LFPTS [SEQ ID NO: 19]) se traducirá en dicha secuencia de corte: LFPT-S TSLDASIIWAMMQN [SEQ ID NO: 4]. Se diseñaron los cebadores 5'-

CCAGGCGCGCCGCTTTTCCCGACGTCTACCTCGCTGGACGCCTC -3 '

(FwMMp9AscIpl44) (SEQ ID NO :33) y 5 '-TC AATTCTGC ATC ATGGCCC A-3' (RvMMp9AscIpl44) (SEQ ID NO:34). Se amplificó por PCR, mediante la enzima Easy-A High Fidelity PCR cloning enzyme (Stratagene, La Jolla, CA), usando como molde el pCMV-SPmApoAl-pl44. La PCR se realizó con las condiciones siguientes: 2 min a 94°C, 30 ciclos de 40 seg a 94°C, 45 seg a 54°C y 40 seg a 72°C, seguido de 7 min a 72°C en termociclador 2720 Thermal cycler (Applied Biosystems Foster City, EE.UU.). El producto de PCR fue migrado en gel de agarosa 1% Agarose D-I low EEO (Pronadisa, Madrid, España), y purificado el fragmento de gel (70 nucleótidos) PerfectPrep DNA Cleanup (Eppendorf, Alemania). El DNA purificado de DNA Ascl- MMP9-pl44 fue clonado, siguiendo las instrucciones provistas por el fabricante, en el vector de expresión pcDNA™3.1/V5-His TOPO® TA (Invitrogen, Carlsbed, CA), que denominaremos pCMV-Asd-MMP9-pl 44. Finalmente, se confirmó la secuencia obtenida mediante secuenciación.

Para realizar la fusión génica, los plásmidos pCMV-mApoAl-Asd-pl44 y pCMV-Asd- MMp9-pl44 fueron digeridos independientemente con las enzimas de restricción Ascl/Pmel, esta última presente en el esqueleto del pcDNA 3.1 V5-His TOPO® TA. La digestión se realizó 1,5 h a 37°C con las enzimas Ascl/Pmel, IxBSA y Buffer 4 (New England Biolabs, Beverly, EE.UU.). Ambas digestiones se migraron en gel de agarosa 1% y se purificaron las bandas correspondientes al vector abierto pCMV-mApoAl-Asd- pl44 y al inserto del pCMV-Asd-MMp9-pl 441. Se ligó el producto en un ratio 1 :3 (vector: inserto) usando la ligasa T4 DNA ligase High Concentration y como solución tampón el 2X Rapid Ligation Buffer (Promega Madison, Wl, U. S. A), incubando la mezcla 10 min a temperatura ambiente. Se transformaron posteriormente bacterias ToplO (Invitrogen, Carlsbed, CA). Las bacterias transformadas se seleccionaron por su crecimiento en placas de Petri con medio LB con ampicilina, ya que el vector contiene un gen de resistencia a este antibiótico. Se extrajo el ADN plasmídico de las bacterias positivas mediante la técnica de MiniPrep (Qiagen, Alemania) para, posteriormente, digerir 2 μg de dicho plásmido con las enzimas AccI/Pmel (New England Biolabs) y separar por electro foresis el resultado de dicha digestión en un gel de agarosa al 1% para comprobar la presencia del inserto. El plásmido resultante de 6324 nucleótidos se denominará en adelante pCMV-m,ApoAl-Asd-MMP9-p 144.

1.5.9 Introducción de secuencia linker en pCMV-mApoAl-pl44:

Con el fin de dotar a la proteína de fusión generada a partir de este gen la posibilidad de movimientos entre la proteína y el péptido pl44 se introdujo la secuencia de DNA (GCACCAGCAGAAACAAAAGCAGAACCAATGAC, SEQ ID NO:53) codificante para un linker extendido flexible cuya secuencia traducida a aminoácidos es APAETKAEPMT (SEQ ID NO: 13), que adopta una estructura de CCCCCCCCCCC (coil), y existe como péptido de unión en la piruvato ferredoxina oxidoreductasa nativa (lb0pA_2).

Se diseñaron los cebadores 5'-

CGCGCCGGCACCAGCAGAAACAAAAGCAGAACCAATGACAACC TCGCTGGACGCCTCGATAATCTGGGCCATGATGCAGAATTGAGC-S'

(FwLINKERpl44) ( S E Q I D N O : 3 5 ) y 5'-

GGCCGCTCAATTCTGCATCATGGCCCAGATTATCGAGGCGTCCAGCGAGGTT GTCATTGGTTCTGCTTTTGTTTCTGCTGGTGCCGG-3' (RvLINKERpl44) (SEQ ID NO: 36) a una concentración 100 mM de cada uno. Se mezclaron 10 μl de cada cebador y se hibridaron en termociclador: 2 min 95°C, 10 min 52°C y llevados a 4°C. La hibridación de estos cebadores es completa en la secuencia correspondiente al linker y a p 144, pero deja extremos cohesivos compatibles con el corte por AscI en 5 ', y compatible con Notl en 3 ' .

Se digirió el plásmido pCMV-mApoAl-Asd-pl44 con AscI (Buffer 4, New England Biolabs), se purificó el DNA PerfectPrep DNA Cleanup (Eppendorf, Alemania), y se digirió posteriormente con Notl (Buffer 3 y BSA, New England Biolabs), debido a incompatibilidad de tampones de digestión. Se migró un gel 1% de agarosa, se purificó el vector abierto con PerfectPrep DNA Cleanup (Eppendorf, Alemania). Se ligó el producto en un ratio 1 :3 (vector: inserto) usando la ligasa T4 DNA ligase High Concentration y como solución tampón el 2X Rapid Ligation Buffer (Promega Madison, Wl, USA), incubando la mezcla 10 min a temperatura ambiente. Se transformaron posteriormente bacterias ToplO (Invitrogen, Carlsbed, CA). Las bacterias transformadas se seleccionaron por su crecimiento en placas de Petri con medio LB con ampicilina, ya que el vector contiene un gen de resistencia a este antibiótico. El plásmido resultante de 6373 nucleótidos se denominará en adelante pCMV-mApoAl-AscI-LINKER-pl44. Finalmente, se confirmó la secuencia obtenida mediante secuenciación.

2. Experimentos:

2.1 Animales:

Los experimentos han sido realizados en ratones inmunocompetentes BALB/c y C57BL/6 hembras entre 5-7 semanas (Harían, Barcelona, Spain). Los animales fueron tratados según las indicaciones y normas éticas del Centro de Investigación Médica Aplicada (CIMA, Pamplona, España), bajo condiciones específicas libres de patógenos externos.

2.2 Manipulación animal y modelos tumorales:

Cada plásmido de DNA (20 μg) fue resuspendido en 1 ,8 mi de suero salino 0,9% (Braun) introducido por la vena de la cola mediante inyección hidrodinámica (Liu et al., 1999, Gene Ther., 6: 1258-1266), usando agujas 27.5G y jeringuillas 2.5ml (Becton- Dickinson, España). Se obtuvieron muestras de sangre por vía retroorbital, previa anestesia vía inhalatoria con isofluorano (Forane, Abbott). El suero fue recuperado mediante dos centrifugaciones consecutivas a 9,lxg durante 5 minutos y almacenados a -200C. La anestesia parenteral se realizó por inyección intraperitoneal de 200 μl/raton con una mezcla 9:1 de ketamina (Imalgene) y xilacina (Rompun). Las temperaturas se midieron por contacto abdominal con el termómetro ThermoKlinik (Artsana, Grandate,Italy).

2.2.1 Análisis de sangre: Se extrajo sangre a ratones en tubos con 0.5% heparina (Mayne) de concentración final. Para la determinación de: i) glóbulos blancos totales se realizó una dilución 1 :1000 de la sangre completa en cubetas con 20ml de solución Isoton II Diluent y 3 gotas de Zap- Oglobin II Lytic Reagent fueron añadidas 2 min. antes de su medición, ii) glóbulos rojos totales se realizó dilución 1 :50000 de la sangre completa en cubetas con 1OmI de solución Isoton II Diluent iii) plaquetas se diluyó 1 :25 la sangre completa en un tubo con 500μl de solución Isoton II Diluent, se centrifugó 1.5 min. 60Og a 40C, y se transfirió sobrenadante en dilución 1 : 400 a una cubeta con 20 mi de Isoton II Diluent las muestras fueron analizadas en Zl Coulter Particle Counter con los reglajes recomendados para cada caso por el fabricante (todo el material y reactivos de Beckman Coulter).

2.2.2 Modelos de vacunación frente a CT26:

Para analizar la eficacia antitumoral de la transferencia génica, se realizaron dos protocolos: A) un protocolo de vacunación con 50 μg/ratón de péptido AH-I de secuencia aminoacídica SPSYVYHQF (SEQ ID NO: 54) (Proimmune Ltd., Oxford, United Kingdom) disuelto en 100 μl/ratón de suero fisiológico 0,9% y con 100 μl/ratón de adyuvante incompleto de Freunds (IFA, SIGMA, Madrid, España). La mezcla fue sonicada en Branson SONIFIER 250. Se vacunó a cada animal con 200 μl de la mezcla con aguja 25G y jeringuilla de 1 mi (Becton-Dickinson, España), de los cuales 100 μl se introdujeron subcutáneamente en el flanco izquierdo de los ratones y 50 μl plantar. Siete días más tarde, se administró mediante inyección hidrodinámica las distintas construcciones (Liu et al, 1999, Gene Ther., 6:1258-1266). A los 7 días posthidrodinámica, se establecieron tumores mediante la inyección subcutánea, con jeringas de insulina (Becton-Dickinson, España), de 5x105 células de adeno carcinoma de colon CT26 resuspendidas en 200 μl de HBSS (Gibco-BRL, Paisley, UK) en el flanco derecho de ratones singénicos BALB/c. B) Se administraron mediante inyección hidrodinámica las construcciones génicas. Un día post-hidrodinámica se realizó la vacunación con el péptido AH-I como se ha descrito anteriormente. A los 9 días se inocularon mediante inyección subcutánea 5x106 células de adenocarcinoma de colon CT26.). El seguimiento tumoral se realizó con calibre de precisión digital.

2.3 Descripción detallada de lineas celulares usadas: La línea celular CT26, deriva de un adeno carcinoma colorectal de ratón BALB/c y fue inducida por el carcinógeno N-nitroso-N-metil-uretano, cultivadas en medio RPMI- 1640 completo (Gibco-BRL, Paisley, UK), suplementado con suero de ternera fetal al 10 % (FCS) inactivado a 56°C, glutamina 2 mM, estreptomicina 100 U/ml, penicilina 100 mg/ml, 1 % β-mercaptoetanol 5.10-3. Las líneas celulares MC38 (células de adenocarcinoma murino), L929 (células derivadas de fibroblastos de ratón) y 293 (células embrionarias de riñon humano transfectadas de forma estable con la región El perteneciente al adenovirus humano tipo 5, ECACC N° 85120602) cultivadas en DMEM completo (suplementado con suero de ternera fetal al 10 % (FCS) inactivado a 56°C, glutamina 2 mM, estreptomicina 100 U/ml, penicilina 100 mg/ml).

Las células descritas fueron cultivadas en cámaras incubadoras humidificadas a 37°C y en una atmósfera al 5% de CO2. Las placas y botellas de cultivo son de Greiner Bio-one (Essen, Alemania). 2.4 Determinación de mlFNαl, IFNγ, y Neopterina:

Los niveles de mlFNαl se midieron por ELISA en placas 96 pocilios planos NUNC maxisorp. El anticuerpo anti-mIFNαl neutralizing Ab (RMMA-I , PBL) se diluyó 1/1000 en PBS Ix, se plaqueó lOOμl/pocillo y se incubó O/N a 4°C en ambiente húmedo. Tras cinco lavados en PBS lx-0.1%Tween-20 (pH 12-1 A) se bloqueó la placa con 300 μl/pocillo de la solución PBS Ix 1%BSA durante 1 h a temperatura ambiente. Las muestras de suero se diluyeron 1/100 en solución PBS Ix 1%BSA y se incubaron 1 h a temperatura ambiente. Tras cinco lavados en PBS lx-0.1%Tween-20, se incubó durante 1 h con lOOμl/ pocilio de anticuerpo de Rabbit polyclonal anti-IFNα (PBL), diluido 1/1000 en solución PBS Ix 1 %BSA. Tras cinco lavados en PBS I x- 0.1%Tween-20, se añadieron 100 μl/pocillo de Donkey α-rabbit IgG HRP conjugada (Southern Biotech, Birmingham, CA, USA) dilución 1/4000 en solución PBS Ix 1%BSA, 1 h a temperatura ambiente. Tras cinco lavados en PBS lx-0.1%Tween-20, se añadió 100 μl/pocillo de solución sustrato BD OptEIA (BD), tras 15 min a temperatura ambiente y en oscuridad se añadió 50 μl de H2SO4 2N. Finalmente, se midió la absorbancia a 450 nm, y se corrigió a 540 nm. Los niveles de IFNγ en suero se midieron con IFN-γ ELISA Set (BD Biosciences, San Diego, CA). Los niveles de neopterina en suero se midieron con Neopterin ELISA (IBL, Hamburg), según las instrucciones provistas por el fabricante. 2.5 PCR cuantitativa:

2 μl de cDNA se incubaron con los cebadores específicos Tabla 3 usando iQ SYBR Green Supermix (Bio-Rad, Hercules, CA). La actina murina fue usada para normalizar la expresión génica, pues su expresión no se ve afectada por mlFNαl o mApoAl. Los valores de RNAm fueron representados por la fórmula 2ΔCt, donde ΔCt indica la diferencia en el ciclo umbral entre mActina y los genes diana.

Figure imgf000056_0001
Figure imgf000057_0001

Tabla 3.3 Listado de cebadores usados.

2.6 In Vivo Killing

Ratones hembra BALB/c (N=3/grupo), fueron inmunizados mediante inyección hidrodinámica como se ha descrito anteriormente, a día O con 20μg de pCMV-LacZ y con 20μg de cada construcción a estudiar: i) pCMV-mApoAl ii) pCMV-IFNal iii) pCMV-mApo-IFN iv) pCMV-mIFN-ApoAl disueltos en suero fisiológico 0,9% (Braun). A día 7, se aislaron esplenocitos de bazo de ratones BALB/c sin inmunizar y se usaron los eritrocitos con solución ACK (Cambrex, Walkersville, MD). Los esplenocitos obtenidos fueron divididos en dos grupos y se incubó uno de ellos 30 min a 37°C con medio RPMI 1640 y 9 μM de péptido TPHPARIGL (epítopo citotóxico derivado de la β-galactosidasa, Proimmune Ltd., Oxford, United Kingdom). El segundo grupo recibió el mismo tratamiento sin el péptido. Los esplenocitos cargados con el péptido se marcaron con 2,5 μM CFSE (CFSEalt0) (Molecular Probes, Eugene, OR). Los esplenocitos control se marcaron con 0,25 μM CFSE (CFSEbaj0). Finalmente, se mezclaron ambas poblaciones en un ratio 1 : 1 y 1 07 células se inyectaron intravenosamente a ratones naϊve o a los ratones inmunizados. Tras 24h, se sacrificaron los animales. Los bazos extraídos se disgregaron y se analizó el ration de células CFSEalta y CFSEbaja mediante citometría de flujo usando FACSalibur (Becton Dickinson, Mountain View, Calif, USA). El porcentaje de lisis específica se calculó según la siguiente fórmula:

%CFSEa "inmunizados

%CFSEbaj0 inmunizados

Lisis = 100 - 10Ox-

( %CFSEa"°control λ

%CFSEbaj0 control

2. 7 Medida de expresión de SRBl :

Se aislaron esplenocitos de bazo de ratones C57BL/6. Los bazos extraídos y disgregados se dividieron en 8 grupos, de los cuales cuatro grupos fueron incubados 10 min con anticuerpo Rabbit Polyclonal anti-SR-Bl (Novus Biologicals Littleton, CO) y con los anticuerpos de BD Pharmigen: i) R-PE-Conjugated Rat Anti-Mouse CD4 (L3T4) Monoclonal Antibody para definir las poblaciones celulares CD4+ y APC- Conjugated Rat Anti-Mouse CD8a (Ly-2) Monoclonal Antibody, para definir las CD8+. ii) APC-Conjugated Mouse Anti-Mouse NK- 1.1 (NKR-PlB y NKR-PlC) Monoclonal Antibody para definir la población celular NK. iii) APC-Rat Anti-Mouse CDl Ib para definir la población celular de monocitos iv) APC- CDl Ic para definir la población de células dendríticas. Los otros cuatro grupos se usaron de control, incubándose 10 min con los anticuerpos respectivos, sin anti-SRBl. Los esplenocitos marcados se lavaron en PBS y 5% suero bovino fetal y se incubaron 10 min FITC-Conjugated Donkey Anti- Rabbit IgG Antibody (Jackson Immuno Research, West Grove, PA). Las muestras así teñidas se estudiaron por citometría de flujo usando el FACSalibur (Becton Dickinson, Mountain View, Calif, USA).

2.8 Aislamiento de HDLs por ultracentrifugación diferencial en gradiente de bromuro sódico:

24h. tras inyección hidrodinámica con los plásmidos mApoAl, IFNαl, Apo-IFN, IFN- Apo o ApoAI-linker-P144, se extrajo sangre a ratones en tubos con 0.5% heparina (Mayne) de concentración final, e inmediatamente se extrajo el plasma por centrifugación (500Og, 20min.).

Las soluciones de bromuro sódico (NaBr) a diferentes densidades se prepararon en un volumen final de 25mL en agua destilada. Se añadió EDTA a una concenración final de 0.05% (w/v). Se añadió NaBr (Fluka) para obtener las soluciones: 0.225g (p= 1.006g/ml), 1.431g (p= 1.04g/ml), 7.085g (p= 1.21g/ml) y 13.573g (p= 1.4g/ml). Al ser el NaBr una sal altamente higroscópica, la densidad se verificó y corrigió por adición de agua destilada cuando fue necesario.

El método de separación secuencial de lipoproteínas por flotación tras ultracentrifugación se realizó con pequeñas modificaciones del protocolo descrito por Rodriguez-Sureda et al (Analytical Biochemistry 303, 73-77 (2002)) en Ultracentrífuga Óptima MAX, con rotor TLAl 00.4 (Beckman Coulter), a partir de 2-4mL de plasmas de ratón (unificadas en función de las muestras) a las siguientes densidades: VLDL < 1.006g/mL, LDL 1.006-1.04 g/mL y HDL 1.04-1.21g/mL. i) Aislamiento de VLDL: se transfirieron 400μl de plasma de ratón a tubos de 3ml de policarbonato y se añadió HOOμl de solución p= 1.006g/ml de NaBr. Las muestras se centrifugaron 2h., 40C, 33600Og. Se recogieron aproximadamente 650 μl de sobrenadante con pipeta y se almacenó a -2O0C. ii) Aislamiento de LDL: El volumen remanente de sedimento se llevó a densidad 1.04 por adición del volumen calculado por la fórmula de la solución de NaBr p= 1.4g/ml:

p = m/V

V NaBri.4 = Vbf (d-dbf) / 1 '4 - d V NaBri.4 = Vol de solución 1 '4 a añadir

V bf = VoI del sedimento

d bf = densidad del sedimento

El volumen fue llevado a 1.5ml con la solución NaBr p= 1.04g/ml y las muestras se centrifugaron 2.5h, 40C, 33600Og. Se recogieron 300-400μl de sobrenadante con pipeta y se almacenó a -2O0C. iii) Aislamiento de HDL: Se transfieron aproximadamente 800μl de sedimento a un nuevo tubo, y se ajustó la densidad a 1.21g/mL como ya se ha descrito, y se llevó a volumen de 1.5mL con la solución de NaBr p= 1.21g/ml. Las muestras se centrifugaron 3.5h, 40C, 33600Og, y se recogió una fracción del sobrenadante de aproximadamente 400ul correspondiente a HDL, y la fracción de sedimento correspondiente al plasma libre de lipoproteínas (LDP) y se conservaron a - 2O0C.

2.9 Electroforesis e inmunoblotting frente mApo Al :

25 μl de fracción de HDL o LDP por cada una de las muestras fueron separadas en geles de gradiente 4-20% Tris-hepes PAGE LongLife iGels (Nusep), transferidas a membrana de nitrocelulosa (Whatman). La proteína se detectó con el anticuerpo policlonal de cabra frente a mApoAl, dilución 1 :200 (Goat polyclonal anti-Apolipoprotein Al, Santa

Cruz Biotechnology) y anticuerpo frente a IgG de cabra, dilución 1 : 20000 (Anti-goat

IgG (whole molecule)- HRP conjugated, Sigma-Aldrich). Se reveló la membrana con ECL Plus Western Blotting Detection Reagent (Amersham).

2.10 Bioensayo de actividad de IFN: Cytopathic effect (CPE):

Se calculó las unidades de actividad de IFN de las fracciones de HDLs aisladas de plasma de ratón conteniendo Apo-IFN e IFN-Apo mediante bioensayo de actividad, midiendo la capacidad de IFN para proteger las células frente a la actividad citopática del virus lítico de la encéfalo miocarditis (EMCV) sobre un amplio rango de concentraciones de IFN plaqueado por dilución sucesiva de las muestras. Sobre esta dilución se plaquearon 3.105 células L929/pocillo en placa de 96 pocilios de cultivo celular Cellstar (Greiner bio-one) y se incubó O/N a 370C 5% CO2 para conseguir la monocapa de células adherentes. Seguidamente se añadió la misma cantidad de pfu/pocillo de EMCV y se incubó 24h hasta conseguir la lisis de las células sin tratar usadas como control. En este punto las células viables protegidas por efecto de IFN se miden por luminometría con la solución de revelado ViaLight Plus KH (Lonza) siguiendo las instrucciones del fabricante. La lectura es graneada para generar una curva dosis-respuesta (Prism 5, GraphPad Software, Inc.) desde la cual la potencia de las preparaciones de IFN en términos de unidades de actividad antiviral pueden ser calculadas referidas a las diluciones de un estándar de proteína recombinante rIFNα (PBL) usado en cada ensayo. 2.11 Experimentos con rIFN y fracciones aisladas de HDL IFN- Apo:

Se inyectó via retroorbital a los ratones 10000UI de rIFN alpha de ratón (CHO derived mouse, Hycult Biotechnol) o 10000UI de HDL IFN- Apo medido por bioensayo de actividad. 2.12 Análisis estadístico de los datos:

El análisis estadístico de los datos se realizó usando el programa informático Prism 5 (GraphPad Software, Inc.). Los datos de aparición tumoral se representaron en gráficos de Kaplan-Meier y se analizaron mediante el test Log-rank. Los datos estudiados a distintos tiempos se analizaron mediante ANOVA de medidas repetidas seguido del test de Bonferroni. El resto de parámetros se analizaron mediante ANOVA y seguido del análisis post hoc Dunnett para realizar comparaciones múltiples. Se consideraron valores significativos p<0,05.

EJEMPLO 2

La administración hidrodinámica de las construcciones quiméricas Apo AI - IFNα aumentan los niveles de IFN sérico

Para comparar los niveles de niveles séricos de IFNα murino, se administraron a grupos de cuatro ratones mediante inyección hidrodinámica los plásmidos que expresan apolipoproteína AI (ApoAI), interferón alfa 1 murino (IFNαl), Apo-IFN (fusión de ApoAI e IFNαl) o IFN- Apo (fusión de IFNαl y ApoAI). Se analizaron mediante un ELISA sandwich sueros obtenidos a las 6 horas y a día 1, 3, 6 y 9. Los sueros de los ratones que recibieron el plásmido control que expresa la ApoAI no presentaron niveles detectables de IFNα, indicando que la administración hidrodinámica per se o la expresión de ApoAI no inducen la expresión del IFNα endógeno (Figura 1). Los ratones que fueron inyectados con el plásmido que expresa IFNαl presentaron niveles altos de IFNα a las 6 horas y disminuían rápidamente (Figura 1). Los ratones que recibieron los plásmidos que codifican para el Apo-IFN o el IFN-Apo presentaron niveles más altos de interferón sérico a día 1. Además, a día 3 se podía detectar niveles elevados de IFNα, a diferencia de los ratones inyectados con el plásmido IFNαl (Figura 1). Por lo tanto, las construcciones que expresan las proteínas de fusión ApoAI e IFNα presentan niveles mayores y más sostenidos de IFNα sérico. EJEMPLO 3

La cinética del ARN mensajero no varía en las construcciones quiméricas ApoAI - IFNα

La diferencia en los niveles séricos de IFNα puede ser explicada por el aumento de la vida media plasmática de las proteínas de fusión respecto al IFNα o por el aumento de la expresión de estas proteínas. Para distinguir entre estas dos alternativas, se analizó la cinética del ARN mensajero (ARNm) de estas construcciones. Para ello se recogieron los hígados de los ratones que habían recibido una inyección hidrodinámica con los plásmidos que expresan ApoAI, IFNαl, Apo-IFN e IFN-Apo a día 0, 1 , 3 y 6. Se extrajo el ARN de estas muestras y se realizó una RT-PCR cuantitativa. Como se puede observar en la Figura 2, se detectaron niveles de ARNm de IFNαl a día 1 en las muestras de IFNαl, Apo-IFN e IFN-Apo pero no en las muestras de ApoAI. Los niveles de ARNm no presentaban diferencias significativas entre los grupos con alguna construcción con IFNα. A día 3 y 6 no se detectaron niveles de ARNm de IFNαl en ninguna muestra. Por lo tanto, la cinética de ARNm es similar en todos los grupos que recibieron una construcción que contenía IFNαl, pudiéndose descartar la hipótesis del aumento de expresión en las construcciones quiméricas ApoAI - IFNαl. EJEMPLO 4

Los ratones inyectados con las construcciones quiméricas ApoAI - IFNα tienen niveles más altos de neopterina sérica y de temperatura corporal

Para comprobar i) que las proteínas quiméricas mantenían la actividad biológica del IFNα y ii) que los niveles más sostenidos se correlacionaban con una mayor actividad biológica, se analizaron dos parámetros que aumentan tras la administración de IFNα. Estos parámetros se estudiaron a los tres días de la administración de los plásmidos, momento en el que ya no se detecta IFNα producido por la construcción con IFNαl pero sí el producido por las construcciones quiméricas. En primer lugar, se analizaron los niveles séricos de neopterina. La neopterina es un catabolito producto del GTP, sintetizado por los macró fagos estimulados por interferones de tipo I y II. Los tres plásmidos que contenían la secuencia del IFNα aumentaron los niveles séricos de neopterina pero sólo las construcciones quiméricas aumentaron de forma significativa (Figura 3 A). En segundo lugar, se midió la temperatura corporal en la zona abdominal de los ratones inyectados. Se observaron niveles elevados con las tres construcciones, destacando los niveles obtenidos tras la administración de las construcciones quiméricas (Figura 3 B). Por lo tanto, las proteínas quiméricas son capaces de aumentar dos parámetros biológicos inducidos por interferón, demostrándose que retienen la actividad biológica y que esta actividad se correlaciona con los niveles de IFNα séricos a día 3.

EJEMPLO 5

Las construcciones quiméricas ApoAI - IFNα aumentan los niveles de expresión hepáticos de genes inducibles por interferón

La actividad de los interferones de tipo I está mediada por proteínas codificadas por genes inducibles por interferón (ISGs). Tras la unión del IFNα a su receptor de membrana se activa una cascada de señalización que desemboca en la activación de la transcripción de los ISGs. Para comprobar si las construcciones quiméricas también inducían estos genes, se analizó los niveles de ARNm de cuatro de estos genes a día 3 tras la administración hidrodinámica. Los genes que se analizaron son IRFl, 2'-5' OAS, USP18, ISG15, MxI . Como se puede observar en la Figura 4, las construcciones quiméricas aumentan los niveles de ARNm de los ISGs estudiados. También se puede detectar un aumento inducido por el plásmido que expresa IFNα a pesar de que a día 3 ya no se detectaban niveles séricos de IFNα. EJEMPLO 6

Las construcciones con IFNα aumentan el número y la activación de los esplenocitos

Para explorar la actividad inmuno estimuladora de las construcciones, en primer lugar se analizó el aumento del número y actividad de células del bazo. Para ello, se inyectaron los plásmidos mediante inyección hidrodinámica y seis días después, se disgregaron los bazos, se contaron las células totales y, tras marcar los esplenocitos con anticuerpos para identificar las principales poblaciones linfocitarias y con un marcador de activación (CD69), se analizaron mediante citometría de flujo. La inyección de construcciones con IFNα aumentó el número de esplenocitos significativamente. La construcción que codifica para el IFN- Apo destaca notablemente en este ensayo (Figura 5 A). Para marcar distintas poblaciones de esplenocitos, se utilizó anticuerpos anti-CD4, como marcador de linfocitos T CD4+; anti-CD8, como marcador de linfocitos T CD8+; anti- CD 19, como marcador de células B; y anti-CD49b, como marcador de linfocitos NK Respecto a los linfocitos T CD4+, las construcciones quiméricas aumentaron el porcentaje de células CD4+ activadas, a diferencia del IFNα (Figura 5 B). Sin embargo, el IFNα sí que aumentó el porcentaje de células CD8+ aunque no de forma significativa. El aumento fue mayor, y significativo, con el Apo-IFN y especialmente alto con el IFN- Apo (Figura 5 C). El porcentaje de células B activadas sigue el mismo perfil que el de CD8+. En este caso, sólo el IFN-Apo produjo un aumento significativo (Figura 5 D). Por último, las células NK prestaron una gran activación con el plásmido de IFNα, no siendo superado este parámetro por las construcciones quiméricas (Figura 5 E). Estos datos sugieren que el IFN-Apo puede poseer un potente efecto adyuvante.

EJEMPLO 7

El IFN-Apo aumenta la lisis específica inducida por linfocitos citotóxicos

Para comprobar el efecto adyuvante del IFN-Apo, se analizó el aumento de la actividad citotóxica inducida por una vacuna DNA en presencia de las distintas construcciones. Como antígeno modelo, se escogió el gen LacZ que codifica para la proteína inmunogénica β-galactosidasa. El plásmido que codifica esta proteína se inyectó junto con los plásmidos que codifican para ApoAl, IFNαl, Apo-IFN o IFN-Apo. A los siete días tras la vacunación génica, se inyectaron por vía intravenosa esplenocitos marcados con 2,5 μM CFSE y cargados con el epítopo citotóxico H2Kd TPHPARIGL, derivado de la proteína β-galactosidasa. Como control interno, se inyectaron esplenocitos con 0,25 μM CFSE sin péptido. Veinticuatro horas después se cuantificó por citometría de flujo la lisis específica de los esplenocitos cargados con el epítopo citotóxico. En la Figura 6, se observa una lisis mayor respecto al ApoAI con el IFNα, seguida del Apo- IFN y por el IFN- Apo, construcción con la que se obtiene lo valores más altos de lisis específica. Estos resultados se correlacionan con los resultados del porcentaje de activación de células T CD8+ y permiten concluir que el IFN-Apo es la construcción con mayor efecto adyuvante en un modelo de vacunación génica.

EJEMPLO 8

Expresión de SR-BI

El incremento en la actividad adyuvante puede ser debido a la incremento en la estabilidad del IFNα o porque la fracción ApoAI del IFN-Apo permite una mayor interacción del IFNα con las células del sistema inmune. Para explorar esta última hipótesis, se analizó la presencia del principal receptor para el ApoAI, el SR-BI, en distintas poblaciones del sistema inmune. Se aislaron esplenocitos de un ratón naϊve y se marcaron con un anticuerpo anti-SRB-I y con un anticuerpo para definir la población. Se utilizaron los siguiente anticuerpos: anti-CD4, como marcador de linfocitos T CD4+; anti-CD8, como marcador de linfocitos T CD8+; anti-CD49b, como marcador de linfocitos NK; anti-CDl lb, como marcador de monocitos/macrófagos; y anti-CDl lc, como marcador de células dendríticas. El receptor SRB-I se detectó en todas las poblaciones analizadas. En las células efectoras del sistema inmune (T CD4+, T CD8+ y NK) el porcentaje de células que expresan este receptor oscila entre el 15% y el 28%. Este porcentaje se eleva hasta más del 50% en células con capacidad de presentación antigénica como monocitos y células dendríticas (Figura 7). Este resultado sugiere que uno de los posibles mecanismos de aumento de la capacidad adyuvante puede ser una mayor maduración de las células presentadoras de antígeno. EJEMPLO 9

El IFN-Apo mejora la encada de un protocolo de vacunación antitumoral.

Tras demostrar que el IFN-Apo presenta una actividad adjuvante mayor que el IFN, se evaluó si este efecto se traducía en una mayor eficacia antitumoral en un protocolo de vacunación. Para ello, ratones BALB/c recibieron una inyección hidrodinámica con los plásmidos de Apo, IFN o IFN-Apo y al día siguiente fueron vacunados con el péptido citotóxico AH-I en adjuvante incompleto de Freunds. Este péptido es presentado por la línea tumoral CT26, que se inoculó a los distintos grupos experimentales 9 días tras la vacunación. La mayoría de los ratones del grupo control, que recibieron la vacunación más la hidrodinámica con el plásmido de Apo, desarrollaron un tumor subcutáneo en el lugar de la inoculación de las células tumorales CT26. Los ratones que recibieron IFN además de la vacunación presentan un comportamiento que no difiere significativamente al del grupo control. Sin embargo» alrededor del 60 % de los ratones que recibieron la vacunación y el plásmido dθ IFN-Apo fueron capaces de rechazar las células tumorales y no presentaron tumor a lo largo de los 30 días del experimento (Figura 8). Por lo tanto, el mayor efecto adyuvante del ΪFN-Apo provoca un aumento de la eficacia de un protocolo de vacunación. EJEMPLO 10

El IFN-Apo presenta menor toxicidad hematológica que el HFN.

Una de las limitaciones del IFN es su importante toxicidad hematológica, que puede llevar a la suspensión del tratamiento en ciertos pacientes que desarrollan una profunda leucopenia y/o trombocitopenia. A continuación se analizó la evolución, después de la administración hidrodinámica de las distintas contrucciones, de los leucocitos y plaquetas en sangre. Se observa en la figura 9 A que todas las contrucciones que llevan interferón presentaron unos niveles sanguíneos inferiores de leucocitos a día 1 tras la administración hidrodinámica de los plásmidos. Este efecto temprano puede ser mediado por un bloqueo de la salida de leucocitos de los órganos ünfoides secundarios descrito para el IFN (Shiow LR et al. Nature. 440(7083):540-4 (2006)). Sin embargo, a día 3, cuando se puede evidenciar el efecto tóxico debido a las propiedades antiproliferativas del IFN, sólo los ratones tratados con IFN presentaron niveles bajos. En los ratones tratados con IFN-Apo los leucocitos sanguíneos se recuperaron a valores normales. Respecto a las plaquetas (Figura 9 B), se observó un descenso a día 3 en aquellos animales tratados con IFN, Este descenso fue significativamente menor en los ratones tratados con IFN-Apo. Por lo tanto, el IFN-Apo reduce la disminución inducida por IFN tanto de leucocitos como de plaquetas. EJEMPLO 11

£1 IFN-Apo aumenta menos que el IFN los genes inducidos por interferón en el cerebro.

Otro de los principales efectos adversos del IPN, que llega a limitar su uso en ciertos pacientes, son alteraciones neuro-psiquiátricas. Para estudiar el efecto de las nuevas moléculas de fusión en el sistema nervioso central, se inyectaron ratones BALB/c con los plásmidos que codifican las distintas construcciones y a las 24 horas, fueron sacrificados los ratones y se les extrajo el cerebro. Se analizó mediante RT-PCR cuantitativa el aumento en los genes inducidos por interferón (ISGs) en los distintos grupos (Figura 10). A pesar de que los niveles plasmáticos de las proteínas de fusión son mayores que los de IFN (Figura 1), el aumento de ISGs fue significativamente mayor en. el IFN que en las moléculas de ΪFN-Apo. Estos datos indican que la fusión de la molécula de Apo al IFN modifica el paso de la barrera hematoencefálica (BHE). El 0.02%-0.1S% del interferón alfa, plasmático atraviesa la BHE mediante difusión pasiva (Greig, N.H., et al. J Pharmacol Exp Ther, 245(2): 574-80 (1988); Greischel, A., et al. Arz-αeiπúttelforscnung, 38(10): 1539-43 (1988); Smith, R.A., et al. Clin Pharmacol Ther. 37(1): 85-8. (1985)). Por lo tanto, la concentración a nivel cerebral va a ser proporcional a la concentración plasmática. En cambio el paso de la BHE de las HDLs se produce mediante transporte activo mediado por SR-BI, manteniéndose niveles muy regulados y bajos (Karasinska, J.M., et al. J Neurosci. 29(11): 3579-89 (2009)). Nuestros resultados sugieren que la unión de compuestos biológicamente activos a la apolipoproteína AI obliga a estas moléculas quiméricas a seguir el meconismo de transporte a través de la BHE de las HDLs. EJEMPLO 12

La proteína de fusión EFN-Apo circula incorporada a las lipoproteínas de alta densidad (HDLs).

Alrededor del 97% de la apolipoproteína AI presente en la sangre, circula en forma de un complejo macromolecular lipoproteico denominado lipoproteínas de alta densidad. Para estudiar si la proteína de fusión era capaz de incorporarse a las HDLs, 24 h tras injectar los plásmidos que codifican el IFN y las moléculas de IFN-Apo por vía hidrodinámica, se aislaron las HDLs del suero mediante centrifugación diferencial en gradiente de NaBr. Con estas fracciones se realizó un bioensayo de IFN, es decir, un ensayo de protección del efecto citopático de un virus, en el cual se enfrentan células previamente incubadas con las muestras con IFN en diluciones sucesivas, con un virus citopático. Si en las muestras hay interferón, el virus no será capaz de lisar a Jas células pretratadas. Las HDLs obtenidas de ratones que recibieron el plásmido que codifica IFN no fueron capaces de proteger a las células del efecto citopático del virus de la encefalomielitis, indicando que el IFN no circula unido a las HDLs. En cambio, las dos moléculas de IFN- Apo si que pudieron ser detectadas por esta técnica en las HDLs (Figura 11 A). A continuación, se realizó un western blot para detectar apolipoproteína AI en las fracciones de suero libre de HDLs (HDLs -) y la fracción de HDLs (HDLs+) de cada grupo experimental. No se detecto apolipoproteína AI en ninguna fracción depleccionada de HDLs, indicando el correcto aislamiento de las HDLs. Tanto en el grupo que recibió el plásmido de Apo, como en el que recibió el de IFN, se detectó una única banda en la fracción de HDLs, que corresponde a la altura de la apolipoproteína AI endógena. En cambio, se detectó una banda de más altura en el grupo con la molécula Apo-IFN, que corresponde a la molécula de fusión. En el caso de la molécula IFN-Apo, se detectaron dos bandas además de la ApoAI endógena, indicando la formación de dimeros en parte de la proteína quimérica (Figura 11 B). Este fenómeno puede deberse a que el extremo C terminal se encuentra libre en esta construcción permitiendo la interacción con otras moléculas de ApoAI. Estos datos indican que las moléculas de fusión son capaces de incorporarse en las lípoproteínas de alta densidad. Por lo tanto, la biodistribución de estas moléculas va a estar gobernada por las leyes que rijan la biodistribución de las HDLs, lo cual puede explicar, al menos parcialmente, el cambio drástico observado en algunas de las actividades del IFN. EJEMPLO 13

La re-administración de UDLs que contiene IFN-Apo mantiene las propiedades observadas tras la administración hidrodinámica.

La posibilidad de purificar HDLs que contienen IFN-Apo a partir de los sueros de ratones a los que se les ha administrado el plásmido que codifica el IFN-Apo, permite disponer de nanolipopartículas fisiológicas de IFN-Apo para estudiar sus propiedades tanto in vitro como in vivo, Se purificaron HDL con IFN-Apo y se administraron el equivalente a 10000 Ul de IFN por ratón. A día 3, se analizó el recuento de leucocitos y plaquetas en sangre (Figura 12 A y 12 B). La dosis administrada de IFN recombinante no fue capaz de provocar un descenso de estos parámetros. Pero los ratones que recibieron las HDLs de TFN-Apo presentaron niveles significativamente mayores (Figura 12 A). Este fenómeno puede deberse a que el IFN-Apo estimula la proliferación de células hematopoyéticas durmientes más eficazmente que el IFN (Essers MA, et al. Nature. Feb 11 (2009)). A día 1, se determinó en estos ratones el estado de depresión inducida por IFN. Nuevamente, existe una diferencia significativa entre los ratones que recibieron IFN recombinate y los que recibieron una dosis equivalente de HDLs de IFN- Apo, reproduciéndose los datos obtenidos tras la administración hidrodinámica.

EJEMPLO 14

La construcción ApoAI-linker-P144 aumenta la inducción de IFNγ mediada por IL12

La interleuquina 12 (IL12) es una citoquina inmunoestimuladora con una potente actividad antitumoral. Su actividad está mediada fundamentalmente por IFNγ. La producción de este mediador está regulada por el TGFβ, así que su bloqueo mediante los péptidos inhibidores pl7 o pl44 puede aumentar la inducción de IFNγ y, por tanto, la actividad antitumoral de la IL12. Para estudiar si construcciones quiméricas formadas por la ApoAI y los péptidos inhibidores del TGFβ, unidos mediante distintas secuencias peptidicas, pueden mejorar la inducción de IFNγ mediada por IL12, se administró mediante inyección hidrodinámica un plasmado que codifica para la ILl 2 murina y plasmados que codifican para las distintas construcciones. Se empleó como control la ApoAI. Con el pl7 se generaron dos construcciones: i) sρP17, que contiene la secuencia codificante del péptido ρl7 precedida del péptido señal de la ApoAI, consiguiéndose la liberación al medio extracelular del péptido pl 7. ii) ApoAI-P 17, que contiene el gen que codifica para la ApoAI seguido dé tres aminoácidos de unión (OAP), y de la secuencia codificante de pl7. Con el pl44 se generaron las construcciones spP144 y AρoAI-P144, substituyendo la secuencia codificante del pl7 por la del pl44. Además se generaron otras dos construcciones: i) ApoAI-MMP9-P144, que contiene como péptido de unión una secuencia diana para la metaloproteinasa 9 (MMP9). ii) ApoAI-linker-PI44, que contiene como péptido de unión una secuencia con conformación extendida. Cuatro días tras la inyección hidrodinámica, se analizó mediante ELISA los niveles séricos de ΪFNγ. La inyección de los plasmados que codifican para la IL12 y ApoAI generó unos niveles detectables de JJFNγ. La inyección de las construcciones con ρl7 no incrementaron estos niveles (Figura 13 A). Sin embargo, la administración de la construcción que genera el ρl44 aumentó de forma significativa los niveles de HFNγ (Figura 13 B). La construcción AρoAI-linker-Pl44 generó los niveles πiás altos, significativamente superiores a los inducidos por el pl44 por sí solo (Figura 8 B). Curiosamente, las construcciones ApoAI-P144 y ApoAI-MMP9-P144 no incrementaron la inducción de EFNγ, indicando que la secuencia peptídica de unión puede tener una gran influencia en la actividad de la construcción quimérica. La construcción ApoAI' MMP9-P144 constituye un ejemplo de un inhibidor latente que sólo sería activo en . presencia de MMP9, que al cortar la secuencia de unión a la ApoAI liberará el péptido ρl44 activo en el lugar donde se exprese la MMP9. Esta proteasa es expresada por muchos tipos de tumores, incluyendo hepatocarcinomas, y por las células mieloides supresoras, que invaden el estroma tumoral. De forma que está construcción permitirá liberar el ρl44 en el lugar donde tiene que actuar principalmente, limitando los efectos adversos de la inhibición sistémica del TGFβ.

EJEMPLO 15

Las construcciones que expresan p!7 y el ApoAI-linker-P144 aumentan el porcentaje de ratones vacunados libres de tumor

Para comprobar la actividad biológica de las construcciones con los péptidos inhibidores de TGFβ en un modelo experimental independiente, se vacunaron ratones BALB/c con el epítopo citotóxico H2Kd AHl (SPSYVYHQF, SEQ ID NO:54) con adyuvante incompleto de Freunds. Siete días más tarde, se administraron mediante inyección hidrodinámica las distintas construcciones. Tras otros siete días, se inocularon subcutáneamente 5x105 células CT26. Se analizó a lo largo del tiempo el porcentaje de animales libre de tumor. En el grupo que habían recibido la vacuna y la construcción control que expresa ApoAI, todos los ratones desarrollaron un tumor subcutáneo en el lugar de inoculación de las células CT26. Sin embargo, más del 50% de los ratones que habían recibido una de las dos construcciones que expresan pl7 permanecieron libres de tumor al final del experimento (Figura 14). En el caso de las construcciones con pl44, la construcción que expresa el péptido ρl44, la construcción AρoAI-Pl44 y la construcción ApoAI-linker-P144 fue capaz de prevenir la aparición de tumores en más del 85% de los ratones.

EJEMPLO 16

La proteína ApoAI-linker-P144 circula incorporada a las lipoproteínas de alta densidad

Para estudiar si la proteína ApoAI-linker-P144 se acompleja con las HDLs, se aisló la fracción que contiene las HDLs a partir de un suero de un ratón al que se le había administrado el plasmido que codifica el ApoAI-linker-P144 por vía hidrodinámica. Para ello se sometió el suero a una centrifugación diferencial en gradiente de NaBr. Una vez purificadas las HDLs, se realizó un western blot para detectar apolipoproteína AI. Además de la banda mayoritaria que corresponde a la apolipoproteína AI endógena, se detectó una banda de más altura que corresponde a la molécula ApoAI-linker-P144 (Figura 15). Por lo tanto, la apolipoproteína AI que lleva fusionados péptidos terapéuticos es capaz de incorporarse y circular en forma de nanolipopartícula fisiológica.

EJEMPLO 17

Las HDLs que contienen ApoAI-linker-P144 aumentan el IFNγ inducido por IL- 12.

La purificación de HDLs que contienen ApoAI-linker-P144 permite la obtención de nanolipopartículas fisiológicas con capacidad de inhibir la actividad del TGFβ. Para demostrar su actividad in vivo, se inocularon HDLs, purificadas de un animal que expresa ApoAI-linker-P144, a ratones a los que se les administra simultáneamente una injección hidrodinámica con un plasmido que expresa interleuquina 12 en respuesta a la administración de doxiciclina. Como control positivo, se coadministró el plasmido ApoAI-linker-P144. Los niveles de IFNγ obtenidos tras la administración de las HDLs son similares a los obtenidos tras la injección hidrodinámica (Figura 16). En ambos casos, son significativamente superiores a los obtenidos tras la inducción del plasmido de IL-12 sin la presencia de un inhibidor de TGFβ. Por lo tanto, el péptido P144 presente en las HDLs es capaz de bloquear el TGFβ in vivo, permitiendo una mayor inducción del IFNγ. Por lo tanto, la incorporación de péptidos a las HDLs a través de su fusión con la apoliproteína AI representa una atractiva estrategia para formular nuevos péptidos terapéuticos.

Claims

REIVINDICACIONES
1. Un conjugado que comprende
(i) una molécula de Apo A o una variante funcionalmente equivalente de la misma y
(ii) un compuesto de interés terapéutico
en donde los componentes (i) y (ii) se encuentran unidos covalentemente.
2. Un conjugado según la reivindicación 1 en donde la molécula de Apo A se selecciona del grupo de ApoA-I, ApoA-II, ApoA-III, ApoA-IV y ApoA-V o una variante funcionalmente equivalente de los mismos.
3. Un conjugado según las reivindicaciones 1 ó 2 en donde la molécula de Apo A se selecciona del grupo de Apo A humana y murina.
4. Un conjugado según cualquiera de las reivindicaciones 1 a 3 en donde el componente (ii) es un polipéptido.
5. Un conjugado según la reivindicación 4 en donde los componentes (i) y (ii) forman una única cadena polipeptídica.
6. Un conjugado según la reivindicación 5 en donde el extremo C-terminal del componente (i) se encuentra unido al extremo N-terminal del componente (ii) o donde el extremo N-terminal del componente (i) se encuentra unido al extremo C-terminal del componente (ii).
7. Un conjugado según cualquiera de las reivindicaciones 4 a 6 en donde el componente (ii) es un interferón.
8. Un conjugado según la reivindicación 7 en donde el interferón es interferón αl o interferón α5 humano o de ratón.
9. Un conjugado según cualquiera de las reivindicaciones 4 a 6 en donde el componente (ii) es un inhibidor de TGF-beta.
10. Un conjugado según la reivindicación 9 en donde el inhibidor de TGF-beta se selecciona del grupo de SEQ ID NO: 4 (P144) y SEQ ID NO:5 (Pl 7) o variantes n cionalmente equivalente de los mismos.
11. Un conjugado según cualquiera de las reivindicaciones 4 a 10 en donde los componentes (i) y (ii) están conectados por un enlazador peptídico.
12. Un conjugado según la reivindicación U en donde el enlazador peptídico es un péptido flexible y/o contiene un $itio de reconocimiento de unaproteasa.
13. Un conjugado según la reivindicación 12 en donde el enlazador se selecciona del grupo de SEQ ID NO:13 (AP AETKAEPMT), GAP o un sitio de reconocimiento de lametaloproteasa da matriz 9 (SEQ ID NO: 19),
14. Un polinucleótido o una construcción génica que comprende un polinucleótido que codifica un polipéptido según cualquiera de las reivindicaciones S a 13.
15. Un vector que comprende un polinucleótido o una construcción génica según la reivindicación 14.
16. Una célula hospedadora que comprende un polinucleótido o una construcción génica según la reivindicación 14 o un vector según la reivindicación 15.
17. Una nanolipoparticula que comprende un conjugado según cualquiera de las reivindicaciones 1 a 14.
18. Una nanolipoparticula según la reivindicación 17 en donde dicha nanolipoparticula es una lipoproteina de alta densidad (HDL).
19. Una preparación farmacéutica que comprende una cantidad terapéuticamente efectiva de un conjugado según cualquiera de las reivindicaciones 1 a 13, un polüiucleótidα o una construcción génica según la reivindicación 14, un vector según la reivindicación 15 o una célula hospedadora según la reivindicación 16 o una nanolipopartícula según las reivindicaciones 17 ó 18 y un carrier o excipiente farmacéuticamente aceptable.
20. Un conjugado según cualquiera de las reivindicaciones 1 a 13, un polinucleótido o una construcción génica según la reivindicación 14, un vector según la reivindicación 15, una célula hospedadora según la reivindicación 16, una nanolipopartícula según las reivindicaciones 17 ó 18 o una preparación farmacéutica según la reivindicación 19 para su uso en medicina.
21. Un conjugado según cualquiera de las reivindicaciones 1 a 13, un polinucleótido o una construcción génica según la reivindicación 14, un vector según la reivindicación 15, una célula hospedadora según la reivindicación 16, una nanolipopartícula según la reivindicación 17 ó 1 8 o una preparación farmacéutica según la reivindicación 19 para el tratamiento de enfermedades hepáticas o de enfermedades asociadas con el sistema inmune.
22. Un conjugado según cualquiera de las reivindicaciones 1 a 13, un polinucleótido o una construcción génica según la reivindicación 14, un vector según la reivindicación 15, una célula hospedadora según la reivindicación 16, una nanolipopartícula según las reivindicaciones 17 ó 18 o una preparación farmacéutica según la reivindicación 19 para el tratamiento de una enfermedad seleccionada del grupo de hepatitis crónica C, hepatitis crónica B, hepatocarcinoma, enfermedad de Parkinson, porfiria aguda intermitente, fibrosis pulmonar, metástasis a hueso, esclerosis sistémica, morfea, cáncer de piel, queratosis actínica, cicatrices queloideas, quemaduras, fibrosis cardíaca, fibrosis renal, infecciones virales, infecciones bacterianas, infecciones parasitarias, artritis reumatoide y linfoma no Hodgking.
23. Un conjugado según cualquiera de las reivindicaciones 1 a 13, un polinucleótido o una construcción génica según la reivindicación 14, un vector según la reivindicación 15, una célula hospedadora según la reivindicación 16, una nanolipopartícula según las reivindicaciones 17 ó 18 o una preparación farmacéutica según la reivindicación 19 para su uso como adyuvante de vacunas, como adyuvante en inmunoterapia, como adyuvante en el tratamiento del cáncer de colon, como antiangiogénico, como protector hepático o renal.
24. Una combinación que comprende
(a) Un primer componente seleccionado entre un conjugado según cualquiera de las reivindicaciones 1 a 13, un polinucleótido o una construcción génica según la reivindicación 14, un vector según la reivindicación 15, una célula hospedadora según la reivindicación 16, una nanolipopartícula según las reivindicaciones 17 ó 18 y una preparación farmacéutica según la reivindicación 19 en donde el componente (ii) es un péptido inhibidor de TGF-βl, y
(b) Un segundo componente seleccionado entre una cito quina inmuno estimuladora, un polinucleótido que codifica dicha citoquina, un vector que comprende dicho polinucleótido, un péptido inhibidor de
TGF-βl, un agente citotóxico y combinaciones de los mismos.
25. Una combinación según la reivindicación 24 en donde el péptido inhibidor de TGF-βl del componente (a) o el componente (b) se selecciona entre el péptido p 144 y el péptido p 17.
26. Una combinación según las reivindicaciones 24 ó 25 en donde la citoquina inmunoestimuldora del componente (b) es IL- 12.
27. Una combinación según cualquiera de las reivindicaciones 24 a 26 para el tratamiento del cáncer.
PCT/ES2009/070224 2008-06-13 2009-06-12 Conjugados de apo-a para la administración de compuestos biológicamente activos WO2009150284A9 (es)

Priority Applications (2)

Application Number Priority Date Filing Date Title
ESP200801796 2008-06-13
ES200801796 2008-06-13

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US12997829 US20110293557A1 (en) 2008-06-13 2009-06-12 Conjugates for the administration of biologically active compounds
JP2011513010A JP5685529B2 (ja) 2008-06-13 2009-06-12 生物学的活性を有する化合物の投与のための複合体
EP20090761841 EP2305309A2 (en) 2008-06-13 2009-06-12 Conjugates for the administration of biologically active compounds
RU2011100801A RU2567667C2 (ru) 2008-06-13 2009-06-12 Конъюгаты для введения биологически активных соединений
CA 2727811 CA2727811A1 (en) 2008-06-13 2009-06-12 Conjugates for the administration of biologically active compounds
CN 200980131382 CN102123737B (zh) 2008-06-13 2009-06-12 用于生物活性化合物施用的轭合物
US14947164 US20160074475A1 (en) 2008-06-13 2015-11-20 Conjugates for the administration of biologically active compounds

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US99782910 A-371-Of-International 2010-12-13 2010-12-13
US14947164 Division US20160074475A1 (en) 2008-06-13 2015-11-20 Conjugates for the administration of biologically active compounds

Publications (3)

Publication Number Publication Date
WO2009150284A2 true WO2009150284A2 (es) 2009-12-17
WO2009150284A3 true WO2009150284A3 (es) 2010-12-09
WO2009150284A9 true true WO2009150284A9 (es) 2011-02-03

Family

ID=41338617

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2009/070224 WO2009150284A9 (es) 2008-06-13 2009-06-12 Conjugados de apo-a para la administración de compuestos biológicamente activos

Country Status (7)

Country Link
US (2) US20110293557A1 (es)
EP (1) EP2305309A2 (es)
JP (2) JP5685529B2 (es)
CN (1) CN102123737B (es)
CA (1) CA2727811A1 (es)
RU (1) RU2567667C2 (es)
WO (1) WO2009150284A9 (es)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2347627B1 (es) * 2009-03-06 2011-10-10 Isdin, S.A. Peptido para el tratamiento profilactico o terapeutico de tumores de la piel en estadios iniciales.
WO2011070214A8 (es) 2009-12-11 2011-09-29 Proyecto De Biomedicina Cima S.L. Conjugados y composiciones para inmunoterapia y tratamiento anti-tumoral
EP2535057A2 (en) 2010-02-09 2012-12-19 Proyecto de Biomedicina Cima, S.L. Compositions for the treatment of infectious and tumoural diseases
WO2011159771A3 (en) * 2010-06-15 2012-04-19 The Cleveland Clinic Foundation Compositions and methods for treating cancer
EP2767546A1 (en) * 2011-02-07 2014-08-20 Cerenis Therapeutics Holding SA Lipoprotein complexes and manufacturing and uses therof
JP2014132832A (ja) * 2011-05-10 2014-07-24 Sekisui Chem Co Ltd 医薬、機能性食品、目的蛋白質の安定化方法、融合蛋白質、核酸、並びに、組換え体
RU2014108240A (ru) * 2011-08-25 2015-09-27 Ф. Хоффманн-Ля Рош Аг Укороченный тетранектин-аполипопротеин а-i гибридный белок, содержащая его липидная частица и их применения
CN103073646A (zh) * 2012-03-13 2013-05-01 华中科技大学 一种运载蜂毒肽的多肽、运载蜂毒肽的纳米颗粒及其应用
ES2427854B1 (es) * 2012-03-29 2014-09-15 Universidad De Valladolid Sensores de calcio y métodos para la detección de calcio libre intracelular
EP2735874A1 (en) 2012-11-21 2014-05-28 Fundación Para La Investigación Biomédica Del Hospital Universitario Puerta De Hierro Methods of diagnosing and therapeutic agents for use in the treatment of prostate cancer
KR101656929B1 (ko) * 2014-06-02 2016-09-13 씨제이제일제당 (주) 반추동물의 메탄 생성 저감용 사료 첨가제 조성물

Family Cites Families (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0238645A1 (en) * 1985-10-03 1987-09-30 Biotechnology Research Partners, Ltd. Novel lipoprotein-based drug-delivery systems
EP0239631A4 (en) 1985-10-04 1989-01-12 Biotech Res Partners Ltd Recombinant apolipoproteins and methods.
US5643757A (en) 1994-03-21 1997-07-01 American Cyanamid Company High yield production of human apolipoprotein A1 in E. coli.
US5766582A (en) 1994-10-11 1998-06-16 Schering Corporation Stable, aqueous alfa interferon solution formulations
JP2758154B2 (ja) 1995-04-06 1998-05-28 エフ・ホフマン−ラ ロシユ アーゲー インターフェロンを含む液体製剤
WO1998007751A1 (en) 1996-08-23 1998-02-26 Pharmacia & Upjohn Ab A process for purifying apolipoprotein a or apolipoprotein e from human plasma
WO1998011140A1 (en) 1996-09-11 1998-03-19 Pharmacia & Upjohn Ab A process for purifying apolipoproteins and a composition for use in the process
US6046166A (en) * 1997-09-29 2000-04-04 Jean-Louis Dasseux Apolipoprotein A-I agonists and their use to treat dyslipidemic disorders
ES2146552B1 (es) 1998-11-24 2001-04-16 Inst Cientifico Tecnol Navarra Peptidos inhibidores de tgf/31
US6809186B1 (en) 1999-01-22 2004-10-26 Martek Biosciences Corporation Simple method for labeled conjugate production
EP1276754A4 (en) * 2000-04-14 2005-04-06 Nuvelo Inc Materials and methods relating to lipid metabolism
WO2002086091A3 (en) 2001-04-25 2003-02-27 Univ California Method to treat hemophilia by hepatic gene transfer of factor viii/ix with vesicle vector
EP1558275A4 (en) * 2002-10-30 2009-06-24 Us Health Scavenger receptor b1 (cla-1) targeting for the treatment of infection, sepsis and inflammation
JP4959136B2 (ja) 2002-12-13 2012-06-20 イミューノメディクス、インコーポレイテッドImmunomedics, Inc. 細胞内で開裂可能な結合を有する免疫接合体
US8877901B2 (en) 2002-12-13 2014-11-04 Immunomedics, Inc. Camptothecin-binding moiety conjugates
US7824709B2 (en) * 2003-02-14 2010-11-02 Children's Hospital And Research Center At Oakland Lipophilic drug delivery vehicle and methods of use thereof
JP2004277355A (ja) 2003-03-17 2004-10-07 Beacle Inc 血友病治療用薬剤及びそれを用いた血友病治療方法
ES2304069B1 (es) 2003-08-22 2009-08-12 Proyecto De Biomedicina Cima, S.L. Peptidos con capacidad de unirse al factor transformante de crecimiento beta 1 (tgf-b1).
US7431915B2 (en) * 2003-10-31 2008-10-07 The Regents Of The University Of California Peptides whose uptake by cells is controllable
US20050255042A1 (en) 2003-11-24 2005-11-17 The Regents Of The University Of California Office Of Technology Transfer, University Of California On-demand cleavable linkers for radioconjugates for cancer imaging and therapy
WO2005070400A1 (en) * 2004-01-15 2005-08-04 Mount Sinai School Of Medicine Methods and compositions for imaging
CA2553955C (en) * 2004-02-10 2012-08-28 Zystor Therapeutics, Inc. Acid alpha-glucosidase and fragments thereof
US20060051859A1 (en) * 2004-09-09 2006-03-09 Yan Fu Long acting human interferon analogs
WO2006135436A3 (en) 2004-10-22 2009-06-04 Alfred S Lewin Inhibition of gene expression and therapeutic uses thereof
WO2007046893A3 (en) 2005-10-19 2009-04-23 Chien Hsing Chang Methods for generating bioactive assemblies and uses thereof
EP1874824A4 (en) 2005-04-06 2009-12-30 Ibc Pharmaceuticals Inc Methods for generating stably linked complexes composed of homodimers, homotetramers or dimers of dimers and uses
JP2009504157A (ja) 2005-08-12 2009-02-05 ヒューマン ジノーム サイエンシーズ, インコーポレイテッドHuman Genome Sciences, Inc. アルブミン融合タンパク質
EP1917278A2 (en) 2005-08-26 2008-05-07 Cerenis Therapeutics Holding SA Compositions and methods for producing apolipoprotein gene products in lactic acid bacteria
CA2627298A1 (en) 2005-10-24 2007-05-03 Proyecto De Biomedicina Cima, S.L. Use of tgf-.beta.1 inhibitor peptides in the preparation of an immune response modulating agent
CA2632451C (en) 2005-12-06 2015-11-03 Centre National De La Recherche Scientifique Cell penetrating peptides for intracellular delivery of molecules
WO2007130873A3 (en) 2006-04-28 2008-12-04 Betsy T Kren Liver-specific nanocapsules and methods of using
US20080206142A1 (en) * 2006-06-16 2008-08-28 Lipid Sciences, Inc. Novel Peptides That Promote Lipid Efflux
WO2008007146A1 (en) * 2006-07-13 2008-01-17 Upperton Limited Process for preparing particles of proteinaceous material
KR100817024B1 (ko) * 2006-11-09 2008-03-26 재단법인 목암생명공학연구소 핵산 또는 약물을 간에 특이적으로 전달하는 복합체 및이를 포함하는 약학적 조성물
US20090110739A1 (en) * 2007-05-15 2009-04-30 University Of North Texas Health Science Center At Forth Worth Targeted cancer chemotherapy using synthetic nanoparticles
US20110178029A1 (en) * 2007-09-14 2011-07-21 Ambrx, Inc. Modified Human Apolipoprotein A-1 and Their Uses

Also Published As

Publication number Publication date Type
CA2727811A1 (en) 2009-12-17 application
WO2009150284A2 (es) 2009-12-17 application
US20110293557A1 (en) 2011-12-01 application
WO2009150284A3 (es) 2010-12-09 application
JP2015038124A (ja) 2015-02-26 application
CN102123737A (zh) 2011-07-13 application
US20160074475A1 (en) 2016-03-17 application
RU2567667C2 (ru) 2015-11-10 grant
RU2011100801A (ru) 2012-07-20 application
JP5685529B2 (ja) 2015-03-18 grant
EP2305309A2 (en) 2011-04-06 application
CN102123737B (zh) 2014-01-01 grant
JP2011523857A (ja) 2011-08-25 application

Similar Documents

Publication Publication Date Title
US20050107297A1 (en) Novel poly(ethylene glycol) modified compounds and uses thereof
EP0442724A2 (en) Modified hIL-6
US20090156478A1 (en) Acylated GLP-1 Compounds
US20030219402A1 (en) Chimeric molecules for cleavage in a treated host
US20060228332A1 (en) Assembly and folding of Fc-interferon-beta fusion proteins
WO1991011461A1 (en) C4 binding protein fusion proteins
WO2004108071A2 (en) Targeting polypeptides to the central nervous system
WO2008077616A1 (en) Modified coagulation factors with prolonged in vivo half-life
Jones et al. The development of a modified human IFN-α2b linked to the Fc portion of human IgG1 as a novel potential therapeutic for the treatment of hepatitis C virus infection
US20070032408A1 (en) Novel spacer moiety for poly (ethylene glycol) modified peptide based compounds
WO2004085471A2 (en) Glp-2 derivatives
Ahrens et al. Peptides and peptide conjugates: therapeutics on the upward path
WO2000040615A2 (en) EXPRESSION AND EXPORT OF ANTI-OBESITY PROTEINS AS Fc FUSION PROTEINS
WO2004019872A2 (en) Oral delivery of modified transferrin fusion proteins
WO2013107791A1 (en) Targeted mutant alpha-helical bundle cytokines
JP2007531513A (ja) 薬物のキャリアとして有用なIgGFc断片およびその製造方法
WO1996017625A1 (en) Modulating the immune response
WO2009117117A1 (en) T cell receptor fusions and conjugates and methods of use there of
WO1997030089A1 (en) Novel antibody-cytokine fusion protein, and methods of making and using the same
WO2004020454A2 (en) Modified transferrin fusion proteins comprising duplicate transferrin amino or carboxy terminal domains
US20140134128A1 (en) Multimeric il-15 soluble fusion molecules and methods of making and using same
WO2011070214A2 (es) Conjugados y composiciones para inmunoterapia y tratamiento anti-tumoral
WO2012007324A2 (en) Stabilized factor viii variants
US5587457A (en) Neutrophil stimulating peptides
US20100261637A1 (en) Peptides derivatized with a-b-c-d- and their therapeutical use

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09761841

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2011513010

Country of ref document: JP

Ref document number: 12997829

Country of ref document: US

Ref document number: 2727811

Country of ref document: CA

NENP Non-entry into the national phase in:

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2011100801

Country of ref document: RU

ENP Entry into the national phase in:

Ref document number: 2011100801

Country of ref document: RU

Kind code of ref document: A

ENP Entry into the national phase in:

Ref document number: 2009256547

Country of ref document: AU

Date of ref document: 20090612

Kind code of ref document: A

ENP Entry into the national phase in:

Ref document number: PI0915093

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20101213