WO2009147017A1 - Nucleic acids and methods for detecting turfgrass pathogenic fungi - Google Patents
Nucleic acids and methods for detecting turfgrass pathogenic fungi Download PDFInfo
- Publication number
- WO2009147017A1 WO2009147017A1 PCT/EP2009/056189 EP2009056189W WO2009147017A1 WO 2009147017 A1 WO2009147017 A1 WO 2009147017A1 EP 2009056189 W EP2009056189 W EP 2009056189W WO 2009147017 A1 WO2009147017 A1 WO 2009147017A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- nucleic acid
- turfgrass
- sample
- nucleic acids
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Definitions
- the present invention relates to nucleic acids and methods for detecting organic substrate pathogenic fungi.
- fungus Disease in lawngrasses or turfgrasses develops from an interaction among a susceptible plant, an environment favorable for disease development, and a pathogenic organism, usually a fungus. Such fungi may also develop on decorative grasses, plants and crops; indeed, they may appear on any suitable organic substrate. Thus, treatment of a diseased substrate, especially turfgrass, usually consists in applying fungicides that will either kill the fungus or keep it from growing.
- the first step in disease management, and especially turfgrass disease management should always consist in identifying the causative pathogenic agent. Indeed, it is important to have identified the disease correctly, so that an appropriate fungicide can be selected. Arbitary selection and application of fungicides without knowledge of the disease cause can do as much harm as good. Using the wrong fungicide wastes money and may involve the risk of exacerbating the disease, as well as causing other unwanted side effects.
- Japanese patent application No. 2008005760 discloses 458 probes for detecting molds that can be found in food. These 458 probes are designed for detecting molds by a hybridization-based method involving the use of a microarray. It is therefore an object of the invention to provide a method which allows the rapid specific detection of nucleic acids from the fungi most commonly involved in turfgrass diseases.
- the present invention arises from the identification, by the inventors, of a conserved region within the rRNA operon of the genome of pathogenic fungi generally affecting turfgrasses, but also possibly other organic substrates, which is liable to be used as a target in the frame of nucleic acid amplification-based detection method of most of such pathogenic fungi.
- the present invention relates to the use of at least one nucleic acid comprising or consisting of:
- R represents A or G
- W represents A or T H represents A or C or T
- nucleic acid (ii) a portion of SEQ ID NO: 1 , provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
- the present invention more particularly relates to the use of at least one nucleic acid comprising or consisting of: (i) GTGARTCATCGAAWYTTTGAACGCA (SEQ ID NO: 2), wherein:
- R represents A or G
- nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or (iii) complementary sequences of (i) and (ii); for the detection of nucleic acids from one or more fungi in a sample.
- the present invention also relates to a method for detecting nucleic acids from one or more fungi in a sample, wherein at least one nucleic acid comprising or consisting of:
- R represents A or G
- nucleic acid (ii) a portion of SEQ ID NO: 1 , provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
- the invention more particularly relates to a method for detecting nucleic acids from one or more fungi in a sample, wherein at least one nucleic acid comprising or consisting of:
- the present invention also relates to a method for treating a diseased organic substrate, which comprises the steps of: a) detecting the absence or the presence of nucleic acids from at least one pathogenic fungus in a sample of the substrate, with at least one nucleic acid according to the invention as defined above; b) if nucleic acids from one or more pathogenic fungi have been detected in step a), selecting one or more antifungal agents which target the one or more pathogenic fungi from which nucleic acids have been detected; c) applying the selected one or more antifungal agents of step b) to the diseased substrate.
- the present invention also relates to a kit for the detection of fungi, comprising each one of the nucleic acids represented by:
- R represents A or G
- W represents A or T
- H represents A or C or T
- nucleic acid (ii) a portion of SEQ ID NO: 1 , provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
- the invention more particularly relates to a kit for the detection of fungi, comprising each one of the nucleic acids represented by:
- nucleic acid (ii) a portion of SEQ ID NO: 2, provided said nucleic acid binds under stringent cond itions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
- the present invention also relates to a nucleic acid comprising or consisting of:
- ATTCAGTGARTCATCGAAWYTTTGAACGCAYMTTGCRC (SEQ ID NO: 1 ), wherein: R represents A or G
- W represents A or T H represents A or C or T (ii) a portion of SEQ ID NO: 1 , provided the said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or (iii) complementary sequences of (i) and (ii).
- the invention more particularly relates to a nucleic acid comprising or consisting of:
- nucleic acid (ii) a portion of SEQ ID NO: 2, provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or complementary sequences of (i) and (ii).
- the invention more particularly relates to a nucleic acid as defined above, comprising or consisting of a sequence selected from the group consisting of SEQ ID NO: 1 to 38, or complementary sequences thereof.
- Nucleic acids as intended herein can be of any type, however it is preferred that they be DNA.
- stringent conditions according to the invention are constituted of an annealing temperature of 60 0 C carried out in a PCR reaction medium comprising, e.g. 50 mM KCI, 1.5 mM MgCb and 10 mM
- a "portion" of nucleic acid preferably comprises a number of nucleotides sufficient to provide for a specific hybridisation to the nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 .
- the portion of nucleic acid preferably comprises at least 9 nucleotides, more preferably at least 15 nucleotides, even more preferably at least 20 nucleotides, and most preferably at least 25 nucleotides.
- the maximum length of the nucleic acids according to the invention is less than 500 nucleotides.
- the at least one nucleic acid as defined above is used as a primer in a nucleic acid ampl ification-based detection method, such as Amplification Fragment Length Polymorphism (AFLP) or Terminal Restriction Fragment Length Polymorphism (TRFLP or T-RFLP).
- AFLP Amplification Fragment Length Polymorphism
- TRFLP Terminal Restriction Fragment Length Polymorphism
- Nucleic acid amplification-based detection methods are particularly well known to one of skill in the art.
- Term inal Restriction Fragment Length Polymorphism (TRFLP or T-RFLP), for instance, is notably described by Formey et al. (1997) Applied and Environmental Microbiology 63:4516-4522.
- the at least one nucleic acid as defined above is used as a primer, it is preferably used in association with at least one other primer.
- the other primer can be any primer targeting a sequence comprised within the genome of the one or more fungi. However, it is preferred that the other primer targets the 18S rDNA/ITS1 region or the ITS2/28S rDNA region of the one or more fungi.
- the fungal rRNA operon comprises the 18S rRNA gene, the Internal
- the 18S rDNA/ITS1 and ITS2/28S rDNA regions thus relate to the regions of the genome of the one or more fungi in the vicinity respectively of the junction of the 18S rRNA gene and ITS1 , and of the junction of TIS2 and the 28S rRNA gene.
- the primer which targets the 18S rDNA/ITS1 region or the ITS2/28S rDNA region will be a reverse primer, and vice versa.
- sequences of the 18S rDNA/ITS1 and ITS2/28S rDNA regions are well known to one of skill in the art and can usually be accessed from public sequence databases. Where sequences of the 18S rDNA/ITS1 and ITS2/28S rDNA regions would not be publicly available for a particular fungus species, they can be routinely sequenced. Besides, it is well within the common knowledge of anyone of skill in the art to select primers within the known sequences.
- ITS1-F primer of sequence TCCGTAGGTGAACCTGCGG (SEQ ID NO: 39).
- ITS4 primer of sequence TCCTCCGCTTATTGATATGC (SEQ ID NO: 40).
- Other examples of primers liable to be used with the primers according to the invention include the "ITS5 primer” of sequence GGAAGTAAAAGTCGTAACAAGG (SEQ ID NO: 41 ) and the "SR6R primer” of sequence AAGWAAAAGTCGTAACAAGG (SEQ ID NO: 42). Still other Examples are available from http://www.biology.duke.edu/fungi/mycolab/primers.htm.
- the primers to be used may be unmodified or modified nucleic acids, in particular DNA. Where the primers are modified nucleic acids they can notably be labelled nucleic acids, in particular fluorescently labelled nucleic acids.
- TRFLP TRFLP
- the one of skill in the art knows how to design primers and to select restriction enzymes so that the nucleic acid generated and fragmented by the enzyme presents a fragment length that can be detected.
- detection of a fragment is dependant on the instrumentation and detection techniques used, but in general detection is possible for sequences featuring at least 15 nucleotides.
- the length of the fragment should preferably be such that it is distinguishable from fragment lengths generated by the same primer pair/enzyme in other fungi (in general, fragment lengths differing by more than 1 , and preferably more than 2, nucleotides are distinguished by current techniques).
- Numerous databases and tools are available to one of skill in the art for selecting primers and restriction enzymes, such as the REBASE database.
- nucleic acids according to the invention include nucleotides featuring a "wobble" position, that is to say they include nucleotides that may be selected from among two or more possible nucleotides
- nucleic acids according to the invention include nucleotides featuring a "wobble" position, that is to say they include nucleotides that may be selected from among two or more possible nucleotides
- each one of the nucleic acids represented by GTGARTCATCGAAWYTTTGAACGCA are as follows:
- GTGAGTCATCGAAACTTTGAACGCA SEQ ID NO: 4
- GTGAATCATCGAATCTTTGAACGCA SEQ ID NO: 5
- GTGAATCATCGAATTTTTGAACGCA SEQ ID NO: 9
- GTGAGTCATCGAATTTTTGAACGCA SEQ ID NO: 10
- GTGAGTCATCGAATCTTTGAACGCA SEQ ID NO: 14
- GTGAATCATCGAAATTTTGAACGCA SEQ ID NO: 15
- the invention aims at the detection of nucleic acids of fungi of any type, however it is preferred that the fungus is a plant pathogenic fungus, in particular a turfgrass pathogenic fungus, such as a fungus selected from the group constituted of Ascochyta phleina,
- Curvulaha affinis Glomerella graminicola, Thanatephorus cucumehs, Pythium ultimum, Gaeumannomyces graminis, Marasmius oreades, Corticium fuciforme, Phytophthora nicotianae. Fusa ⁇ um culmorum, Bipola ⁇ s sorokiniana,
- Microdochium nivale Rhizoctonia cerealis, Pythium graminicola, Rhynchosporium secalis, Sclerotinia homoeocarpa, Typhula incarnate, Ustilago striiformis, Septoria macropoda.
- the sample in which nucleic acids are to be detected can be of any type of organic substrate liable to contain nucleic acids from fungi.
- the sample be a turfgrass sample or a soil sample.
- the sample is a turfgrass sample, it can be a sample obtained from the turfgrass as a whole or from or a sample of a part of the turfgrass, such as the root.
- sample is a soil sample
- it is preferably taken directly under the diseased turfgrass or in the vicinity of the diseased turgrass.
- the sample can be obtained directly from turfgrass or soil, or be obtained after treatment steps, such as grinding or extraction, in particular nucleic acid extraction, steps.
- any diseased turfgrass can be subjected the use or methods as defined above.
- Preferred turfgrasses to be considered within the frame of the present invention are notably described in http://www.ars-grin.gov/cgi- bin/npgs/html/index.pl, from the Germplasm Resources Information Network,
- the diseased turfgrass according to the invention is selected from the group consisting of the Festaceae, Aveneae,
- Triticeae Chlorideae, Zoysieae, Paniceae and Andropogoneae Tribe.
- nucleic acids comprising or consisting of the sequences of SEQ ID Nos. 159, 188, 198, 221 , 263 and/or 416 of Japanese patent application No. 2008005760 are excluded from the scope of the present invention.
- turfgrass pathogenic fungus species were sequenced by the inventors: Ascochyta phleina, Curvularia affinis, Glomerella graminicola, Thanatephorus cucumeris, Pythium ultimum, Gaeumannomyces graminis, Marasmius oreades, Corticium fuciforme, Phytophthora nicotianae.
- ITS1 forward primer ITS1-F, TCCGTAGGTGAACCTGCGG, SEQ ID NO: 39.
- TRFLP Terminal Restriction Fragment Length Polymorphism
- the applied enzymes for the T-RFLP analysis were TaQl (T T CG A A) and Tsp509l ( T AATT A ).
- the fragments yielded by the ITS1/ITSOMYAr com bi nation is usually smaller than the corresponding fragment obtained using the ITS1/ITS4 combination, the fragments can be separated with a higher resolution.
- the ITS1 /ITSOMYAr combination provides, either in AFLP or in T-RFLP, a good alternative to the ITS1/ITS4 combination in AFLP since it notably enables to d iscrim inate between species wh ich discrimination was either impossible or very difficult to carry out with the ITS1/ITS4 combination (e.g. Ascochyta phleina, Curvularia affinis, Glomerella graminicola, Bipolaris sorokiniana, Sclerotinia homoeocarpa).
- ITS1/ITS4 combination e.g. Ascochyta phleina, Curvularia affinis, Glomerella graminicola, Bipolaris sorokiniana, Sclerotinia homoeocarpa.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP09757400.8A EP2297339B1 (en) | 2008-06-02 | 2009-05-20 | Nucleic acids and methods for detecting turfgrass pathogenic fungi |
| NZ589680A NZ589680A (en) | 2008-06-02 | 2009-05-20 | Nucleic acids and methods for detecting turfgrass pathogenic fungi |
| MX2010013252A MX2010013252A (en) | 2008-06-02 | 2009-05-20 | Nucleic acids and methods for detecting turfgrass pathogenic fungi. |
| US12/737,006 US20110152385A1 (en) | 2008-06-02 | 2009-05-20 | Nucleic acids and methods for detecting turfgrass pathogenic fungi |
| AU2009254097A AU2009254097B2 (en) | 2008-06-02 | 2009-05-20 | Nucleic acids and methods for detecting turfgrass pathogenic fungi |
| CA2726699A CA2726699C (en) | 2008-06-02 | 2009-05-20 | Nucleic acids and methods for detecting turfgrass pathogenic fungi |
| AU2015201501A AU2015201501B2 (en) | 2008-06-02 | 2015-03-23 | Nucleic acids and methods for detecting turfgrass pathogenic fungi |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP08104225.1 | 2008-06-02 | ||
| EP08104225A EP2130928A1 (en) | 2008-06-02 | 2008-06-02 | Nucleic acids and methods for detecting turfgrass pathogenic fungi |
| US5986208P | 2008-06-09 | 2008-06-09 | |
| US61/059,862 | 2008-06-09 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2009147017A1 true WO2009147017A1 (en) | 2009-12-10 |
Family
ID=39841191
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2009/056189 Ceased WO2009147017A1 (en) | 2008-06-02 | 2009-05-20 | Nucleic acids and methods for detecting turfgrass pathogenic fungi |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US20110152385A1 (en) |
| EP (3) | EP2130928A1 (en) |
| AU (1) | AU2009254097B2 (en) |
| CA (1) | CA2726699C (en) |
| HK (1) | HK1211625A1 (en) |
| MX (1) | MX2010013252A (en) |
| NZ (1) | NZ589680A (en) |
| TW (1) | TWI537390B (en) |
| WO (1) | WO2009147017A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2871243A1 (en) | 2013-11-06 | 2015-05-13 | Omya International AG | Nucleic acids and methods for detecting pathogens and beneficial microorganisms |
| WO2019149963A1 (en) | 2018-02-05 | 2019-08-08 | Syngenta Participations Ag | Methods for detecting fungi in turf grass with a lamp assay having novel primer sets |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011098907A2 (en) * | 2010-02-15 | 2011-08-18 | Council Of Scientific & Industrial Research | Method for detecting fungal pathogens |
| CN105547788B (en) * | 2016-02-23 | 2019-06-04 | 蒋丹 | Qualitative standard sample of Fusarium moniliformes in soybean flour and preparation method thereof |
| CN109111514B (en) * | 2018-09-06 | 2020-07-28 | 中国农业科学院作物科学研究所 | Method for cultivating transgenic wheat with resistance to sheath blight and root rot and related biological material thereof |
| CN110305912B (en) * | 2019-05-09 | 2022-08-12 | 云南中烟工业有限责任公司 | Method for extracting spice from Coprinus jasmine strain and use of extracted spice in tobacco |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0859061A2 (en) * | 1996-11-01 | 1998-08-19 | Novartis AG | Detection of maize fungal pathogens using the polymerase chain reaction |
| WO2004040017A2 (en) * | 2002-11-01 | 2004-05-13 | Carrotech As | Assay method for detecting fungal infection of soil or vegetables |
| JP2008005760A (en) * | 2006-06-29 | 2008-01-17 | National Institute Of Advanced Industrial & Technology | Mold detection method, microarray used therefor and mold detection kit |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5780271A (en) * | 1996-11-13 | 1998-07-14 | North Carolina State University | PCR assays for phytophthora species |
| AU733810B2 (en) * | 1997-05-02 | 2001-05-24 | Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The | Nucleic acids for detecting (aspergillus) species and other filamentous fungi |
| US7772155B2 (en) * | 2001-05-30 | 2010-08-10 | Her Majesty The Queen In Right Of Canada, As Represented By The Minister Of Agriculture And Agri-Food | Fungal isolates and biological control compositions for the control of weeds |
-
2008
- 2008-06-02 EP EP08104225A patent/EP2130928A1/en not_active Withdrawn
-
2009
- 2009-05-20 EP EP09757400.8A patent/EP2297339B1/en not_active Not-in-force
- 2009-05-20 AU AU2009254097A patent/AU2009254097B2/en not_active Ceased
- 2009-05-20 CA CA2726699A patent/CA2726699C/en not_active Expired - Fee Related
- 2009-05-20 NZ NZ589680A patent/NZ589680A/en not_active IP Right Cessation
- 2009-05-20 WO PCT/EP2009/056189 patent/WO2009147017A1/en not_active Ceased
- 2009-05-20 EP EP15150835.5A patent/EP2881473A1/en not_active Withdrawn
- 2009-05-20 US US12/737,006 patent/US20110152385A1/en not_active Abandoned
- 2009-05-20 MX MX2010013252A patent/MX2010013252A/en active IP Right Grant
- 2009-05-27 TW TW098117660A patent/TWI537390B/en not_active IP Right Cessation
-
2015
- 2015-12-10 HK HK15112217.5A patent/HK1211625A1/en unknown
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0859061A2 (en) * | 1996-11-01 | 1998-08-19 | Novartis AG | Detection of maize fungal pathogens using the polymerase chain reaction |
| WO2004040017A2 (en) * | 2002-11-01 | 2004-05-13 | Carrotech As | Assay method for detecting fungal infection of soil or vegetables |
| JP2008005760A (en) * | 2006-06-29 | 2008-01-17 | National Institute Of Advanced Industrial & Technology | Mold detection method, microarray used therefor and mold detection kit |
Non-Patent Citations (2)
| Title |
|---|
| DATABASE GENBANK 1992, MITCHELL, WHITE, TAYLOR: "Filobasidium uniguttulatum 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence", XP002500784, retrieved from NCBI Database accession no. M94520 * |
| DATABASE GENBANK 2003, GATHMAN: "Expressed sequence tags from Schizophyllum commune nitrogen-replete and nitrogen-limited libraries", XP002500783, retrieved from NCBI Database accession no. cf800463 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2871243A1 (en) | 2013-11-06 | 2015-05-13 | Omya International AG | Nucleic acids and methods for detecting pathogens and beneficial microorganisms |
| JP2016534756A (en) * | 2013-11-06 | 2016-11-10 | オムヤ インターナショナル アーゲー | Nucleic acids and methods for detecting pathogens and beneficial microorganisms |
| US10415098B2 (en) | 2013-11-06 | 2019-09-17 | Omya International Ag | Nucleic acids and methods for detecting pathogens and beneficial microorganisms |
| WO2019149963A1 (en) | 2018-02-05 | 2019-08-08 | Syngenta Participations Ag | Methods for detecting fungi in turf grass with a lamp assay having novel primer sets |
| US11634783B2 (en) | 2018-02-05 | 2023-04-25 | Syngenta Participations Ag | Methods for detecting fungi in turf grass with a lamp assay having novel primer sets |
| EP4368731A2 (en) | 2018-02-05 | 2024-05-15 | Syngenta Participations Ag | Methods for detecting fungi in turf grass with a lamp assay having novel primer sets |
| EP4368731A3 (en) * | 2018-02-05 | 2024-11-27 | Syngenta Crop Protection AG | Methods for detecting fungi in turf grass with a lamp assay having novel primer sets |
| US12545966B2 (en) | 2018-02-05 | 2026-02-10 | Syngenta Crop Protection Ag | Methods for detecting fungi in turf grass with a lamp assay having novel primer sets |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2009254097A1 (en) | 2009-12-10 |
| EP2297339A1 (en) | 2011-03-23 |
| US20110152385A1 (en) | 2011-06-23 |
| MX2010013252A (en) | 2010-12-21 |
| AU2009254097B2 (en) | 2015-04-09 |
| CA2726699A1 (en) | 2009-12-10 |
| EP2881473A1 (en) | 2015-06-10 |
| TWI537390B (en) | 2016-06-11 |
| CA2726699C (en) | 2018-04-10 |
| NZ589680A (en) | 2012-10-26 |
| EP2297339B1 (en) | 2017-04-12 |
| EP2130928A1 (en) | 2009-12-09 |
| TW201000637A (en) | 2010-01-01 |
| HK1211625A1 (en) | 2016-05-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Daverdin et al. | Genome structure and reproductive behaviour influence the evolutionary potential of a fungal phytopathogen | |
| Gachon et al. | Real-time PCR: what relevance to plant studies? | |
| Tollenaere et al. | SNP design from 454 sequencing of Podosphaera plantaginis transcriptome reveals a genetically diverse pathogen metapopulation with high levels of mixed-genotype infection | |
| Ocaña et al. | Large-scale transcriptome analysis in faba bean (Vicia faba L.) under Ascochyta fabae infection | |
| HK1211625A1 (en) | Nucleic acids and methods for detecting turfgrass pathogenic fungi | |
| Yang et al. | Rapid development of molecular markers by next-generation sequencing linked to a gene conferring phomopsis stem blight disease resistance for marker-assisted selection in lupin (Lupinus angustifolius L.) breeding | |
| CN102971436B (en) | Method for detecting fungal pathogens | |
| Brylińska et al. | Evaluation of PCR markers for Phytophthora infestans mating type determination | |
| Pintye et al. | Improved DNA extraction and quantitative real-time PCR for genotyping Erysiphe necator and detecting the DMI fungicide resistance marker A495T, using single ascocarps | |
| Durai et al. | Genetic diversity analysis and development of SCAR marker for detection of Indian populations of Fusarium oxysporum f. sp. ciceris causing chickpea wilt | |
| WO2015067635A2 (en) | Nucleic acids and methods for detecting pathogens and beneficial microorganisms | |
| US9458514B2 (en) | Nucleic acids probes for detection of yeast and fungal | |
| Cakir et al. | Mapping and QTL analysis of the barley population Tallon× Kaput | |
| Lee et al. | Identification and characterization of simple sequence repeat markers for Pythium aphanidermatum, P. cryptoirregulare, and P. irregulare and the potential use in Pythium population genetics | |
| Paolinelli-Alfonso et al. | Quantitative real-time PCR normalization for gene expression studies in the plant pathogenic fungi Lasiodiplodia theobromae | |
| CN111607664B (en) | Application of SNP molecular marker on 1DS chromosome related to wheat stripe rust | |
| Mendoza-Rodríguez et al. | Early regulation of primary metabolism, antioxidant, methyl cycle and phenylpropanoid pathways during the Mycosphaerella fijiensis-Musa spp. interaction | |
| Vyhnánek et al. | SSR loci survey of technical hemp cultivars: The optimization of a cost-effective analyses to study genetic variability | |
| US20130116344A1 (en) | Nucleic acids and methods for detecting turfgrass pathogenic fungi | |
| Peng et al. | Draft genome sequence resource for Blumeriella jaapii, the cherry Leaf spot pathogen | |
| AU2015201501B2 (en) | Nucleic acids and methods for detecting turfgrass pathogenic fungi | |
| Grundy et al. | A molecular approach to explore the extent of the threatened fungus Hypocreopsis rhododendri within wood | |
| Prospero et al. | Eight microsatellite markers for Armillaria cepistipes and their transferability to other Armillaria species | |
| HK1138890A (en) | Nucleic acids and methods for detecting turfgrass pathogenic fungi | |
| Mesapogu et al. | Rapid detection and quantification of Fusarium udum in soil and plant samples using real-time PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09757400 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2726699 Country of ref document: CA Ref document number: 2009254097 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 589680 Country of ref document: NZ Ref document number: MX/A/2010/013252 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2009254097 Country of ref document: AU Date of ref document: 20090520 Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2009757400 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009757400 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12737006 Country of ref document: US |


