WO2009147017A1 - Nucleic acids and methods for detecting turfgrass pathogenic fungi - Google Patents

Nucleic acids and methods for detecting turfgrass pathogenic fungi Download PDF

Info

Publication number
WO2009147017A1
WO2009147017A1 PCT/EP2009/056189 EP2009056189W WO2009147017A1 WO 2009147017 A1 WO2009147017 A1 WO 2009147017A1 EP 2009056189 W EP2009056189 W EP 2009056189W WO 2009147017 A1 WO2009147017 A1 WO 2009147017A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleic acid
turfgrass
sample
nucleic acids
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2009/056189
Other languages
French (fr)
Inventor
Nicola Di Maiuta
Patrick Schwarzentruber
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Omya Development AG
Original Assignee
Omya Development AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Omya Development AG filed Critical Omya Development AG
Priority to EP09757400.8A priority Critical patent/EP2297339B1/en
Priority to NZ589680A priority patent/NZ589680A/en
Priority to MX2010013252A priority patent/MX2010013252A/en
Priority to US12/737,006 priority patent/US20110152385A1/en
Priority to AU2009254097A priority patent/AU2009254097B2/en
Priority to CA2726699A priority patent/CA2726699C/en
Publication of WO2009147017A1 publication Critical patent/WO2009147017A1/en
Anticipated expiration legal-status Critical
Priority to AU2015201501A priority patent/AU2015201501B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae

Definitions

  • the present invention relates to nucleic acids and methods for detecting organic substrate pathogenic fungi.
  • fungus Disease in lawngrasses or turfgrasses develops from an interaction among a susceptible plant, an environment favorable for disease development, and a pathogenic organism, usually a fungus. Such fungi may also develop on decorative grasses, plants and crops; indeed, they may appear on any suitable organic substrate. Thus, treatment of a diseased substrate, especially turfgrass, usually consists in applying fungicides that will either kill the fungus or keep it from growing.
  • the first step in disease management, and especially turfgrass disease management should always consist in identifying the causative pathogenic agent. Indeed, it is important to have identified the disease correctly, so that an appropriate fungicide can be selected. Arbitary selection and application of fungicides without knowledge of the disease cause can do as much harm as good. Using the wrong fungicide wastes money and may involve the risk of exacerbating the disease, as well as causing other unwanted side effects.
  • Japanese patent application No. 2008005760 discloses 458 probes for detecting molds that can be found in food. These 458 probes are designed for detecting molds by a hybridization-based method involving the use of a microarray. It is therefore an object of the invention to provide a method which allows the rapid specific detection of nucleic acids from the fungi most commonly involved in turfgrass diseases.
  • the present invention arises from the identification, by the inventors, of a conserved region within the rRNA operon of the genome of pathogenic fungi generally affecting turfgrasses, but also possibly other organic substrates, which is liable to be used as a target in the frame of nucleic acid amplification-based detection method of most of such pathogenic fungi.
  • the present invention relates to the use of at least one nucleic acid comprising or consisting of:
  • R represents A or G
  • W represents A or T H represents A or C or T
  • nucleic acid (ii) a portion of SEQ ID NO: 1 , provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
  • the present invention more particularly relates to the use of at least one nucleic acid comprising or consisting of: (i) GTGARTCATCGAAWYTTTGAACGCA (SEQ ID NO: 2), wherein:
  • R represents A or G
  • nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or (iii) complementary sequences of (i) and (ii); for the detection of nucleic acids from one or more fungi in a sample.
  • the present invention also relates to a method for detecting nucleic acids from one or more fungi in a sample, wherein at least one nucleic acid comprising or consisting of:
  • R represents A or G
  • nucleic acid (ii) a portion of SEQ ID NO: 1 , provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
  • the invention more particularly relates to a method for detecting nucleic acids from one or more fungi in a sample, wherein at least one nucleic acid comprising or consisting of:
  • the present invention also relates to a method for treating a diseased organic substrate, which comprises the steps of: a) detecting the absence or the presence of nucleic acids from at least one pathogenic fungus in a sample of the substrate, with at least one nucleic acid according to the invention as defined above; b) if nucleic acids from one or more pathogenic fungi have been detected in step a), selecting one or more antifungal agents which target the one or more pathogenic fungi from which nucleic acids have been detected; c) applying the selected one or more antifungal agents of step b) to the diseased substrate.
  • the present invention also relates to a kit for the detection of fungi, comprising each one of the nucleic acids represented by:
  • R represents A or G
  • W represents A or T
  • H represents A or C or T
  • nucleic acid (ii) a portion of SEQ ID NO: 1 , provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
  • the invention more particularly relates to a kit for the detection of fungi, comprising each one of the nucleic acids represented by:
  • nucleic acid (ii) a portion of SEQ ID NO: 2, provided said nucleic acid binds under stringent cond itions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
  • the present invention also relates to a nucleic acid comprising or consisting of:
  • ATTCAGTGARTCATCGAAWYTTTGAACGCAYMTTGCRC (SEQ ID NO: 1 ), wherein: R represents A or G
  • W represents A or T H represents A or C or T (ii) a portion of SEQ ID NO: 1 , provided the said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or (iii) complementary sequences of (i) and (ii).
  • the invention more particularly relates to a nucleic acid comprising or consisting of:
  • nucleic acid (ii) a portion of SEQ ID NO: 2, provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or complementary sequences of (i) and (ii).
  • the invention more particularly relates to a nucleic acid as defined above, comprising or consisting of a sequence selected from the group consisting of SEQ ID NO: 1 to 38, or complementary sequences thereof.
  • Nucleic acids as intended herein can be of any type, however it is preferred that they be DNA.
  • stringent conditions according to the invention are constituted of an annealing temperature of 60 0 C carried out in a PCR reaction medium comprising, e.g. 50 mM KCI, 1.5 mM MgCb and 10 mM
  • a "portion" of nucleic acid preferably comprises a number of nucleotides sufficient to provide for a specific hybridisation to the nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 .
  • the portion of nucleic acid preferably comprises at least 9 nucleotides, more preferably at least 15 nucleotides, even more preferably at least 20 nucleotides, and most preferably at least 25 nucleotides.
  • the maximum length of the nucleic acids according to the invention is less than 500 nucleotides.
  • the at least one nucleic acid as defined above is used as a primer in a nucleic acid ampl ification-based detection method, such as Amplification Fragment Length Polymorphism (AFLP) or Terminal Restriction Fragment Length Polymorphism (TRFLP or T-RFLP).
  • AFLP Amplification Fragment Length Polymorphism
  • TRFLP Terminal Restriction Fragment Length Polymorphism
  • Nucleic acid amplification-based detection methods are particularly well known to one of skill in the art.
  • Term inal Restriction Fragment Length Polymorphism (TRFLP or T-RFLP), for instance, is notably described by Formey et al. (1997) Applied and Environmental Microbiology 63:4516-4522.
  • the at least one nucleic acid as defined above is used as a primer, it is preferably used in association with at least one other primer.
  • the other primer can be any primer targeting a sequence comprised within the genome of the one or more fungi. However, it is preferred that the other primer targets the 18S rDNA/ITS1 region or the ITS2/28S rDNA region of the one or more fungi.
  • the fungal rRNA operon comprises the 18S rRNA gene, the Internal
  • the 18S rDNA/ITS1 and ITS2/28S rDNA regions thus relate to the regions of the genome of the one or more fungi in the vicinity respectively of the junction of the 18S rRNA gene and ITS1 , and of the junction of TIS2 and the 28S rRNA gene.
  • the primer which targets the 18S rDNA/ITS1 region or the ITS2/28S rDNA region will be a reverse primer, and vice versa.
  • sequences of the 18S rDNA/ITS1 and ITS2/28S rDNA regions are well known to one of skill in the art and can usually be accessed from public sequence databases. Where sequences of the 18S rDNA/ITS1 and ITS2/28S rDNA regions would not be publicly available for a particular fungus species, they can be routinely sequenced. Besides, it is well within the common knowledge of anyone of skill in the art to select primers within the known sequences.
  • ITS1-F primer of sequence TCCGTAGGTGAACCTGCGG (SEQ ID NO: 39).
  • ITS4 primer of sequence TCCTCCGCTTATTGATATGC (SEQ ID NO: 40).
  • Other examples of primers liable to be used with the primers according to the invention include the "ITS5 primer” of sequence GGAAGTAAAAGTCGTAACAAGG (SEQ ID NO: 41 ) and the "SR6R primer” of sequence AAGWAAAAGTCGTAACAAGG (SEQ ID NO: 42). Still other Examples are available from http://www.biology.duke.edu/fungi/mycolab/primers.htm.
  • the primers to be used may be unmodified or modified nucleic acids, in particular DNA. Where the primers are modified nucleic acids they can notably be labelled nucleic acids, in particular fluorescently labelled nucleic acids.
  • TRFLP TRFLP
  • the one of skill in the art knows how to design primers and to select restriction enzymes so that the nucleic acid generated and fragmented by the enzyme presents a fragment length that can be detected.
  • detection of a fragment is dependant on the instrumentation and detection techniques used, but in general detection is possible for sequences featuring at least 15 nucleotides.
  • the length of the fragment should preferably be such that it is distinguishable from fragment lengths generated by the same primer pair/enzyme in other fungi (in general, fragment lengths differing by more than 1 , and preferably more than 2, nucleotides are distinguished by current techniques).
  • Numerous databases and tools are available to one of skill in the art for selecting primers and restriction enzymes, such as the REBASE database.
  • nucleic acids according to the invention include nucleotides featuring a "wobble" position, that is to say they include nucleotides that may be selected from among two or more possible nucleotides
  • nucleic acids according to the invention include nucleotides featuring a "wobble" position, that is to say they include nucleotides that may be selected from among two or more possible nucleotides
  • each one of the nucleic acids represented by GTGARTCATCGAAWYTTTGAACGCA are as follows:
  • GTGAGTCATCGAAACTTTGAACGCA SEQ ID NO: 4
  • GTGAATCATCGAATCTTTGAACGCA SEQ ID NO: 5
  • GTGAATCATCGAATTTTTGAACGCA SEQ ID NO: 9
  • GTGAGTCATCGAATTTTTGAACGCA SEQ ID NO: 10
  • GTGAGTCATCGAATCTTTGAACGCA SEQ ID NO: 14
  • GTGAATCATCGAAATTTTGAACGCA SEQ ID NO: 15
  • the invention aims at the detection of nucleic acids of fungi of any type, however it is preferred that the fungus is a plant pathogenic fungus, in particular a turfgrass pathogenic fungus, such as a fungus selected from the group constituted of Ascochyta phleina,
  • Curvulaha affinis Glomerella graminicola, Thanatephorus cucumehs, Pythium ultimum, Gaeumannomyces graminis, Marasmius oreades, Corticium fuciforme, Phytophthora nicotianae. Fusa ⁇ um culmorum, Bipola ⁇ s sorokiniana,
  • Microdochium nivale Rhizoctonia cerealis, Pythium graminicola, Rhynchosporium secalis, Sclerotinia homoeocarpa, Typhula incarnate, Ustilago striiformis, Septoria macropoda.
  • the sample in which nucleic acids are to be detected can be of any type of organic substrate liable to contain nucleic acids from fungi.
  • the sample be a turfgrass sample or a soil sample.
  • the sample is a turfgrass sample, it can be a sample obtained from the turfgrass as a whole or from or a sample of a part of the turfgrass, such as the root.
  • sample is a soil sample
  • it is preferably taken directly under the diseased turfgrass or in the vicinity of the diseased turgrass.
  • the sample can be obtained directly from turfgrass or soil, or be obtained after treatment steps, such as grinding or extraction, in particular nucleic acid extraction, steps.
  • any diseased turfgrass can be subjected the use or methods as defined above.
  • Preferred turfgrasses to be considered within the frame of the present invention are notably described in http://www.ars-grin.gov/cgi- bin/npgs/html/index.pl, from the Germplasm Resources Information Network,
  • the diseased turfgrass according to the invention is selected from the group consisting of the Festaceae, Aveneae,
  • Triticeae Chlorideae, Zoysieae, Paniceae and Andropogoneae Tribe.
  • nucleic acids comprising or consisting of the sequences of SEQ ID Nos. 159, 188, 198, 221 , 263 and/or 416 of Japanese patent application No. 2008005760 are excluded from the scope of the present invention.
  • turfgrass pathogenic fungus species were sequenced by the inventors: Ascochyta phleina, Curvularia affinis, Glomerella graminicola, Thanatephorus cucumeris, Pythium ultimum, Gaeumannomyces graminis, Marasmius oreades, Corticium fuciforme, Phytophthora nicotianae.
  • ITS1 forward primer ITS1-F, TCCGTAGGTGAACCTGCGG, SEQ ID NO: 39.
  • TRFLP Terminal Restriction Fragment Length Polymorphism
  • the applied enzymes for the T-RFLP analysis were TaQl (T T CG A A) and Tsp509l ( T AATT A ).
  • the fragments yielded by the ITS1/ITSOMYAr com bi nation is usually smaller than the corresponding fragment obtained using the ITS1/ITS4 combination, the fragments can be separated with a higher resolution.
  • the ITS1 /ITSOMYAr combination provides, either in AFLP or in T-RFLP, a good alternative to the ITS1/ITS4 combination in AFLP since it notably enables to d iscrim inate between species wh ich discrimination was either impossible or very difficult to carry out with the ITS1/ITS4 combination (e.g. Ascochyta phleina, Curvularia affinis, Glomerella graminicola, Bipolaris sorokiniana, Sclerotinia homoeocarpa).
  • ITS1/ITS4 combination e.g. Ascochyta phleina, Curvularia affinis, Glomerella graminicola, Bipolaris sorokiniana, Sclerotinia homoeocarpa.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to the use of at least one nucleic acid comprising or consisting of: (i) CATCGATGAAGAACGCWGCRAAHTGCGATAMGTARTGYGAATTGCAGRATTCAGTGARTCATCGAAWYTTTGAACGCAYMTTGCRC (SEQ ID NO: 1), wherein: R represents A or G Y represents C or T M represents A or C W represents A or T H represents A or C or T (ii) a portion of SEQ ID NO: 1, provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1, or (iii) complementary sequences of (i) and (ii); for the detection of nucleic acids from one or more fungi in a sample.

Description

NUCLEIC ACIDS AND METHODS FOR DETECTING TURFGRASS
PATHOGENIC FUNGI
Related applications The present application claims the benefit of EP patent application serial
No. 08104225.1 and US provisional application serial No. 61/059862, which are incorporated herein by reference.
Field of the invention The present invention relates to nucleic acids and methods for detecting organic substrate pathogenic fungi.
Background of the invention
Disease in lawngrasses or turfgrasses develops from an interaction among a susceptible plant, an environment favorable for disease development, and a pathogenic organism, usually a fungus. Such fungi may also develop on decorative grasses, plants and crops; indeed, they may appear on any suitable organic substrate. Thus, treatment of a diseased substrate, especially turfgrass, usually consists in applying fungicides that will either kill the fungus or keep it from growing.
However, the first step in disease management, and especially turfgrass disease management, should always consist in identifying the causative pathogenic agent. Indeed, it is important to have identified the disease correctly, so that an appropriate fungicide can be selected. Arbitary selection and application of fungicides without knowledge of the disease cause can do as much harm as good. Using the wrong fungicide wastes money and may involve the risk of exacerbating the disease, as well as causing other unwanted side effects.
Classical methods for the identification of the causative pathogenic agent essentially rely on the symptoms which can be observed on the individual plant and on the turf stand, as well as on the fungal structures, such as mycelia or spores, which can be found in the vicinity of the diseased turfgrass. However, these methods may require a long time to be implemented, since they often involve the isolation and the culture of the fungi in a laboratory. Besides, differentiating closely related fungal species can prove difficult.
Accordingly, molecular biology methods have been developped which circumvent these difficulties. One of the most popular fungal detection methods relies on the PCR amplification of the internal transcribed spacers (1 , 2) and the 5.8S rRNA gene (ITS1 -5.8S-ITS2) from the fungal rRNA operon (Goodwin et al. (1995) Plant Pathology 44:384-391 ; Ranjard et al. (2001 ) Applied and Environmental Microbiology 67:4479-4487). However, a specific primer pair is often necessary for the indentification of a given fungal species, which renders this method cumbersome where the identity of pathogenic fungus is unknown and is sought for. Furthermore, some fungal species can not be differentiated using the primers currently available which target this region. Accordingly, this method is not used in routine for determining the antifungal agent most adapted to treat a given turfgrass disease.
Japanese patent application No. 2008005760 discloses 458 probes for detecting molds that can be found in food. These 458 probes are designed for detecting molds by a hybridization-based method involving the use of a microarray. It is therefore an object of the invention to provide a method which allows the rapid specific detection of nucleic acids from the fungi most commonly involved in turfgrass diseases.
Summary of the invention The present invention arises from the identification, by the inventors, of a conserved region within the rRNA operon of the genome of pathogenic fungi generally affecting turfgrasses, but also possibly other organic substrates, which is liable to be used as a target in the frame of nucleic acid amplification-based detection method of most of such pathogenic fungi. Thus the present invention relates to the use of at least one nucleic acid comprising or consisting of:
(i) CATCGATGAAGAACGCWGCRAAHTGCGATAMGTARTGYGAATTGCAGR ATTCAGTGARTCATCGAAWYTTTGAACGCAYMTTGCRC (SEQ ID NO: 1 ), wherein:
R represents A or G
Y represents C or T M represents A or C
W represents A or T H represents A or C or T
(ii) a portion of SEQ ID NO: 1 , provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
(iii) complementary sequences of (i) and (ii); for the detection of nucleic acids from one or more fungi in a sample.
In a preferred embodiment, the present invention more particularly relates to the use of at least one nucleic acid comprising or consisting of: (i) GTGARTCATCGAAWYTTTGAACGCA (SEQ ID NO: 2), wherein:
R represents A or G
Y represents C or T W represents A or T
(ii) a portion of SEQ ID NO: 2, provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or (iii) complementary sequences of (i) and (ii); for the detection of nucleic acids from one or more fungi in a sample.
The present invention also relates to a method for detecting nucleic acids from one or more fungi in a sample, wherein at least one nucleic acid comprising or consisting of:
(i)
CATCGATGAAGAACGCWGCRAAHTGCGATAMGTARTGYGAATTGCAGR ATTCAGTGARTCATCGAAWYTTTGAACGCAYMTTGCRC (SEQ ID NO: 1 ), wherein:
R represents A or G
Y represents C or T M represents A or C W represents A or T H represents A or C or T
(ii) a portion of SEQ ID NO: 1 , provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
(iii) complementary sequences of (i) and (ii); is contacted with the sample.
In a preferred embodiment, the invention more particularly relates to a method for detecting nucleic acids from one or more fungi in a sample, wherein at least one nucleic acid comprising or consisting of:
(i) GTGARTCATCGAAWYTTTGAACGCA (SEQ ID NO: 2), wherein: R represents A or G Y represents C or T W represents A or T (ii) a portion of SEQ ID NO: 2, provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or (iii) complementary sequences of (i) and (ii); is contacted with the sample. The present invention also relates to a method for treating a diseased organic substrate, which comprises the steps of: a) detecting the absence or the presence of nucleic acids from at least one pathogenic fungus in a sample of the substrate, with at least one nucleic acid according to the invention as defined above; b) if nucleic acids from one or more pathogenic fungi have been detected in step a), selecting one or more antifungal agents which target the one or more pathogenic fungi from which nucleic acids have been detected; c) applying the selected one or more antifungal agents of step b) to the diseased substrate. The present invention also relates to a kit for the detection of fungi, comprising each one of the nucleic acids represented by:
(i) CATCGATGAAGAACGCWGCRAAHTGCGATAMGTARTGYGAATTGCAGR ATTCAGTGARTCATCGAAWYTTTGAACGCAYMTTGCRC (SEQ ID NO: 1 ), wherein:
R represents A or G
Y represents C or T M represents A or C
W represents A or T
H represents A or C or T
(ii) a portion of SEQ ID NO: 1 , provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
(iii) complementary sequences of (i) and (ii).
In a preferred embodiment, the invention more particularly relates to a kit for the detection of fungi, comprising each one of the nucleic acids represented by:
(i) GTGARTCATCGAAWYTTTGAACGCA (SEQ ID NO: 2), wherein: R represents A or G
Y represents C or T W represents A or T
(ii) a portion of SEQ ID NO: 2, provided said nucleic acid binds under stringent cond itions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
(iii) complementary sequences of (i) and (ii).
The present invention also relates to a nucleic acid comprising or consisting of:
(i) CATCGATGAAGAACGCWGCRAAHTGCGATAMGTARTGYGAATTGCAGR
ATTCAGTGARTCATCGAAWYTTTGAACGCAYMTTGCRC (SEQ ID NO: 1 ), wherein: R represents A or G
Y represents C or T M represents A or C
W represents A or T H represents A or C or T (ii) a portion of SEQ ID NO: 1 , provided the said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or (iii) complementary sequences of (i) and (ii). In a preferred embodiment, the invention more particularly relates to a nucleic acid comprising or consisting of:
(i) GTGARTCATCGAAWYTTTGAACGCA (SEQ ID NO: 2), wherein: R represents A or G Y represents C or T W represents A or T
(ii) a portion of SEQ ID NO: 2, provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or complementary sequences of (i) and (ii). In another preferred embodiment, the invention more particularly relates to a nucleic acid as defined above, comprising or consisting of a sequence selected from the group consisting of SEQ ID NO: 1 to 38, or complementary sequences thereof.
Detailed description of the invention
Nucleic acids as intended herein can be of any type, however it is preferred that they be DNA.
"Stringent conditions" can be easily be defined by the man skilled in the art using common knowledge. If necessary, guidance for defining such conditions can be found in numerous textbooks, such as Tijssen, 1993, Laboratory Techniques in
Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, Part
I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York. Preferably, stringent conditions according to the invention are constituted of an annealing temperature of 600C carried out in a PCR reaction medium comprising, e.g. 50 mM KCI, 1.5 mM MgCb and 10 mM
Tris pH 8.3.
As intended herein a "portion" of nucleic acid preferably comprises a number of nucleotides sufficient to provide for a specific hybridisation to the nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 . Thus, the portion of nucleic acid preferably comprises at least 9 nucleotides, more preferably at least 15 nucleotides, even more preferably at least 20 nucleotides, and most preferably at least 25 nucleotides. As intended herein, it is preferred that the maximum length of the nucleic acids according to the invention is less than 500 nucleotides.
Preferably, the at least one nucleic acid as defined above is used as a primer in a nucleic acid ampl ification-based detection method, such as Amplification Fragment Length Polymorphism (AFLP) or Terminal Restriction Fragment Length Polymorphism (TRFLP or T-RFLP).
Nucleic acid amplification-based detection methods are particularly well known to one of skill in the art. Term inal Restriction Fragment Length Polymorphism (TRFLP or T-RFLP), for instance, is notably described by Formey et al. (1997) Applied and Environmental Microbiology 63:4516-4522. Where the at least one nucleic acid as defined above is used as a primer, it is preferably used in association with at least one other primer. The other primer can be any primer targeting a sequence comprised within the genome of the one or more fungi. However, it is preferred that the other primer targets the 18S rDNA/ITS1 region or the ITS2/28S rDNA region of the one or more fungi. The fungal rRNA operon comprises the 18S rRNA gene, the Internal
Transcribed Spacer 1 (ITS1 ), the 5.8S rRNA gene, the Internal Transcribed Spacer 2 (ITS2), and the 28S rRNA gene. The 18S rDNA/ITS1 and ITS2/28S rDNA regions thus relate to the regions of the genome of the one or more fungi in the vicinity respectively of the junction of the 18S rRNA gene and ITS1 , and of the junction of TIS2 and the 28S rRNA gene. As will be clear to anyone of skill in the art, where the at least one nucleic acid as defined above is used as a forward primer, the primer which targets the 18S rDNA/ITS1 region or the ITS2/28S rDNA region will be a reverse primer, and vice versa. The sequences of the 18S rDNA/ITS1 and ITS2/28S rDNA regions are well known to one of skill in the art and can usually be accessed from public sequence databases. Where sequences of the 18S rDNA/ITS1 and ITS2/28S rDNA regions would not be publicly available for a particular fungus species, they can be routinely sequenced. Besides, it is well within the common knowledge of anyone of skill in the art to select primers within the known sequences.
By way of example of a primer targeting the 18S rDNA/ITS1 region, one can cite the so-called "ITS1-F primer" of sequence TCCGTAGGTGAACCTGCGG (SEQ ID NO: 39). Conversely, by way of example of a primer targeting the ITS2/28S rDNA region one can cite the so-called "ITS4 primer" of sequence TCCTCCGCTTATTGATATGC (SEQ ID NO: 40). Other examples of primers liable to be used with the primers according to the invention include the "ITS5 primer" of sequence GGAAGTAAAAGTCGTAACAAGG (SEQ ID NO: 41 ) and the "SR6R primer" of sequence AAGWAAAAGTCGTAACAAGG (SEQ ID NO: 42). Still other Examples are available from http://www.biology.duke.edu/fungi/mycolab/primers.htm.
As intended herein the primers to be used may be unmodified or modified nucleic acids, in particular DNA. Where the primers are modified nucleic acids they can notably be labelled nucleic acids, in particular fluorescently labelled nucleic acids.
Where TRFLP is used, the one of skill in the art knows how to design primers and to select restriction enzymes so that the nucleic acid generated and fragmented by the enzyme presents a fragment length that can be detected. In this regard, it should be noted that detection of a fragment is dependant on the instrumentation and detection techniques used, but in general detection is possible for sequences featuring at least 15 nucleotides. Besides, the length of the fragment should preferably be such that it is distinguishable from fragment lengths generated by the same primer pair/enzyme in other fungi (in general, fragment lengths differing by more than 1 , and preferably more than 2, nucleotides are distinguished by current techniques). Numerous databases and tools are available to one of skill in the art for selecting primers and restriction enzymes, such as the REBASE database.
In the case where nucleic acids according to the invention include nucleotides featuring a "wobble" position, that is to say they include nucleotides that may be selected from among two or more possible nucleotides, one of skill in the art knows that it is usually advantageous to use a mixture of primers such that all of the nucleotide possibilities are represented. Thus, by way of example, each one of the nucleic acids represented by GTGARTCATCGAAWYTTTGAACGCA (SEQ ID NO: 2), are as follows:
GTGAATCATCGAAACTTTGAACGCA (SEQ ID NO: 3);
GTGAGTCATCGAAACTTTGAACGCA (SEQ ID NO: 4); GTGAATCATCGAATCTTTGAACGCA (SEQ ID NO: 5);
GTGAGTCATCGAATCTTTGAACGCA (SEQ ID NO: 6);
GTGAATCATCGAAATTTTGAACGCA (SEQ ID NO: 7);
GTGAGTCATCGAAATTTTGAACGCA (SEQ ID NO: 8);
GTGAATCATCGAATTTTTGAACGCA (SEQ ID NO: 9); GTGAGTCATCGAATTTTTGAACGCA (SEQ ID NO: 10);
GTGAATCATCGAAACTTTGAACGCA (SEQ ID NO: 11 );
GTGAGTCATCGAAACTTTGAACGCA (SEQ ID NO: 12);
GTGAATCATCGAATCTTTGAACGCA (SEQ ID NO: 13);
GTGAGTCATCGAATCTTTGAACGCA (SEQ ID NO: 14); GTGAATCATCGAAATTTTGAACGCA (SEQ ID NO: 15);
GTGAGTCATCGAAATTTTGAACGCA (SEQ ID NO: 16);
GTGAATCATCGAATTTTTGAACGCA (SEQ ID NO: 17);
GTGAGTCATCGAATTTTTGAACGCA (SEQ ID NO: 18).
As intended herein, it is to be understood that the invention aims at the detection of nucleic acids of fungi of any type, however it is preferred that the fungus is a plant pathogenic fungus, in particular a turfgrass pathogenic fungus, such as a fungus selected from the group constituted of Ascochyta phleina,
Curvulaha affinis, Glomerella graminicola, Thanatephorus cucumehs, Pythium ultimum, Gaeumannomyces graminis, Marasmius oreades, Corticium fuciforme, Phytophthora nicotianae. Fusaήum culmorum, Bipolaήs sorokiniana,
Microdochium nivale, Rhizoctonia cerealis, Pythium graminicola, Rhynchosporium secalis, Sclerotinia homoeocarpa, Typhula incarnate, Ustilago striiformis, Septoria macropoda.
As intended herein the sample in which nucleic acids are to be detected can be of any type of organic substrate liable to contain nucleic acids from fungi. However, it is preferred that the sample be a turfgrass sample or a soil sample. Where the sample is a turfgrass sample, it can be a sample obtained from the turfgrass as a whole or from or a sample of a part of the turfgrass, such as the root.
Where the sample is a soil sample, it is preferably taken directly under the diseased turfgrass or in the vicinity of the diseased turgrass.
The sample can be obtained directly from turfgrass or soil, or be obtained after treatment steps, such as grinding or extraction, in particular nucleic acid extraction, steps.
As intended herein, any diseased turfgrass can be subjected the use or methods as defined above. Preferred turfgrasses to be considered within the frame of the present invention are notably described in http://www.ars-grin.gov/cgi- bin/npgs/html/index.pl, from the Germplasm Resources Information Network,
National Germplasm Resources Laboratory, Beltsville, Maryland, or in the
Compendium of Turgrass Diseases, Third Edition (2005) by the American Phytopathological Society. Most preferably, the diseased turfgrass according to the invention is selected from the group consisting of the Festaceae, Aveneae,
Triticeae, Chlorideae, Zoysieae, Paniceae and Andropogoneae Tribe.
In a specific embodiment, nucleic acids comprising or consisting of the sequences of SEQ ID Nos. 159, 188, 198, 221 , 263 and/or 416 of Japanese patent application No. 2008005760 are excluded from the scope of the present invention.
EXAMPLE
The following turfgrass pathogenic fungus species were sequenced by the inventors: Ascochyta phleina, Curvularia affinis, Glomerella graminicola, Thanatephorus cucumeris, Pythium ultimum, Gaeumannomyces graminis, Marasmius oreades, Corticium fuciforme, Phytophthora nicotianae. Fusarium culmorum, Bipolaris sorokiniana, Microdochium nivale, Rhizoctonia cerealis, Pythium graminicola, Rhynchosporium secalis, Sclerotinia homoeocarpa, Typhula incarnate, Ustilago striiformis, Septoria macropoda.
Briefly, the well-known sequencing method developed by Fred Sanger - chain termination method - was used using Applied Biosystem BigDye® Terminator Cycle Sequencing v1 or v3.1 chemistry on an Applied Biosystems Genetic Analyzer 3130. The sequences were gathered by using the ITS1 forward primer (ITS1-F, TCCGTAGGTGAACCTGCGG, SEQ ID NO: 39).
The obtained sequences are represented by SEQ ID NO: 19 to 37. From these sequences a particular consensus sequence could be determined by the inventors:
CATCGATGAAGAACGCWGCRAAHTGCGATAMGTARTGYGAATTGCAGRATTC AGTGARTCATCGAAWYTTTGAACGCAYMTTGCRC (SEQ ID NO: 1 )
The discriminative potential of this region was then evidenced by in silico Terminal Restriction Fragment Length Polymorphism (TRFLP or T-RFLP) by using the primer ITSOMYAr (TGCGTTCAAARWTTCGATGAYTCAC, SEQ ID NO: 38, the complementary of SEQ ID NO: 2), which hybridizes to the above consensus sequence, in association with the above ITS1 -F primer.
The applied enzymes for the T-RFLP analysis were TaQl (TTCGAA) and Tsp509l (TAATTA).
The following tables show the PCR fragment length of both primer combination ITS1 -F/ITS4 (full length ITS) (ITS4, TCCTCCGCTTATTGATATGC, SEQ ID NO: 40) and ITS1/ITSOMYAr (partial ITS length) (Table 1 ), as well as the corresponding in silico and in vitro digested partial ITS ( ITS 1 /ITSOMYAr) fragments by TaQl (Table 2) and Tsp509l (Table 3) (mean and standard deviation (StDev) were calculated from triplicate measurements of two independent PCR assays).
Figure imgf000013_0001
Table 1
Figure imgf000014_0001
Table 2
Figure imgf000015_0001
Table 3
In general, since the length of the fragments yielded by the ITS1/ITSOMYAr com bi nation , either in AFLP or in T-RFLP, is usually smaller than the corresponding fragment obtained using the ITS1/ITS4 combination, the fragments can be separated with a higher resolution.
Furthermore, it can be seen that the ITS1 /ITSOMYAr combination provides, either in AFLP or in T-RFLP, a good alternative to the ITS1/ITS4 combination in AFLP since it notably enables to d iscrim inate between species wh ich discrimination was either impossible or very difficult to carry out with the ITS1/ITS4 combination (e.g. Ascochyta phleina, Curvularia affinis, Glomerella graminicola, Bipolaris sorokiniana, Sclerotinia homoeocarpa).

Claims

1. The use of at least one nucleic acid comprising or consisting of:
(i) CATCGATGAAGAACGCWGCRAAHTGCGATAMGTARTGYGAATTGCAGR
ATTCAGTGARTCATCGAAWYTTTGAACGCAYMTTGCRC (SEQ ID NO: 1 ), wherein:
R represents A or G
Y represents C or T M represents A or C
W represents A or T
H represents A or C or T
(ii) a portion of SEQ ID NO: 1 , provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
(iii) complementary sequences of (i) and (ii); as a primer for the detection by a nucleic acid amplification-based detection method of nucleic acids from one or more fungi in a sample.
2. The use according to claim 1 , of at least one nucleic acid comprising or consisting of:
(i) GTGARTCATCGAAWYTTTGAACGCA (SEQ ID NO: 2), wherein: R represents A or G
Y represents C or T W represents A or T
(ii) a portion of SEQ ID NO: 2, provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or
(iii) complementary sequences of (i) and (ii).
3. The use according to claim 1 or 2, wherein the fungus is selected from the group constituted of Ascochyta phleina, Curvulaήa affinis, Glomerella graminicola, Thanatephorus cucumeήs, Pythium ultimum, Gaeumannomyces graminis, Marasmius oreades, Corticium fuciforme, Phytophthora nicotianae. Fusarium culmorum, Bipolahs sorokiniana, Microdochium nivale, Rhizoctonia cerealis, Pythium graminicola, Rhynchosporium secalis, Sclerotinia homoeocarpa, Typhula incarnate, Ustilago striiformis, Septoria macropoda.
4. The use according to any of claims 1 to 3, wherein the sample is a turfgrass or a soil sample.
5. The use according to claim 4, wherein the sample is a turfgrass root sample.
6. The use according to claim 4 or 5, wherein the turfgrass is selected from the group consisting of the Festaceae, Aveneae, Triticeae, Chlorideae, Zoysieae, Paniceae and Andropogoneae Tribe.
7. The use according to any one of the preceding claims, wherein the nucleic acid amplification-based detection method is Ampl ification Fragment Length Polymorphism (AFLP) or Terminal Restriction Fragment Length Polymorphism (T- RFLP).
8. The use according to any one of the preceding claims, wherein the at least one nucleic acid is used in association with at least one other primer which targets the 18S rDNA/ITS1 region or the ITS2/28S rDNA region.
9. The use according to claim 8, wherein the other primer is selected from the list constituted of SEQ ID NO: 39 to 42.
10. A method for treating a diseased turfgrass, which comprises the steps of: a) detecting by a nucleic acid amplification-based detection method the absence or the presence of nucleic acids from at least one pathogenic fungus in a sample of soil in which the diseased turfgrass is growing, or in a sample of the diseased turfgrass, with at least one nucleic acid as defined in claim 1 or 2 as a primer; b) If nucleic acids from one or more pathogenic fungi have been detected in step a), selecting one or more antifungal agents which target the one or more pathogenic fungi from which nucleic acids have been detected; c) Applying the selected one or more antifungal agents of step b) to the diseased turfgrass.
11. The method according to claim 10, wherein the fungus is selected from the group constituted of Ascochyta phleina, Curvulaήa affinis, Glomerella graminicola, Thanatephorus cucumeris, Pythium ultimum, Gaeumannomyces graminis, Marasmius oreades, Corticium fuciforme, Phytophthora nicotianae. Fusarium culmorum, Bipolahs sorokiniana, Microdochium nivale, Rhizoctonia cerealis, Pythium graminicola, Rhynchosporium secalis, Sclerotinia homoeocarpa, Typhula incarnate, Ustilago striiformis, Septoria macropoda.
12. The method according to claim 10 or 11 , wherein the diseased turfgrass is selected from the group consisting of the Festaceae, Aveneae, Triticeae, Chlorideae, Zoysieae, Paniceae and Andropogoneae Tribe.
13. The method according to any one of claims 10 to 12, wherein the nucleic acid amplification-based detection method is Amplification Fragment Length
Polymorphism (AFLP) or Terminal Restriction Fragment Length Polymorphism (T- RFLP).
14. The method according to any one of claims 10 to 13, wherein the at least one nucleic acid as defined in claim 1 or 2 is used, in association with at least one other primer which targets 18S rDNA/ITS1 region or the ITS2/28S rDNA region.
15. The method according to claim 14, wherein the other primer is selected from the list constituted of SEQ ID NO: 39 to 42.
16. A kit for the detection of fungi, comprising each one of the nucleic acids represented by: (i)
CATCGATGAAGAACGCWGCRAAHTGCGATAMGTARTGYGAATTGCAGR ATTCAGTGARTCATCGAAWYTTTGAACGCAYMTTGCRC (SEQ ID NO: 1 ), wherein: R represents A or G
Y represents C or T M represents A or C W represents A or T H represents A or C or T (ii) a portion of SEQ ID NO: 1 , provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or complementary sequences of (i) and (ii).
17. The kit according to claim 16, comprising the nucleic acids represented by the following sequences:
GTGAATCATCGAAACTTTGAACGCA (SEQ ID NO: 3);
GTGAGTCATCGAAACTTTGAACGCA (SEQ ID NO: 4);
GTGAATCATCGAATCTTTGAACGCA (SEQ ID NO: 5); GTGAGTCATCGAATCTTTGAACGCA (SEQ ID NO: 6);
GTGAATCATCGAAATTTTGAACGCA (SEQ ID NO: 7);
GTGAGTCATCGAAATTTTGAACGCA (SEQ ID NO: 8);
GTGAATCATCGAATTTTTGAACGCA (SEQ ID NO: 9);
GTGAGTCATCGAATTTTTGAACGCA (SEQ ID NO: 10); GTGAATCATCGAAACTTTGAACGCA (SEQ ID NO: 11);
GTGAGTCATCGAAACTTTGAACGCA (SEQ ID NO: 12);
GTGAATCATCGAATCTTTGAACGCA (SEQ ID NO: 13);
GTGAGTCATCGAATCTTTGAACGCA (SEQ ID NO: 14);
GTGAATCATCGAAATTTTGAACGCA (SEQ ID NO: 15); GTGAGTCATCGAAATTTTGAACGCA (SEQ ID NO: 16);
GTGAATCATCGAATTTTTGAACGCA (SEQ ID NO: 17);
GTGAGTCATCGAATTTTTGAACGCA (SEQ ID NO: 18); or their complementary sequences.
18. A nucleic acid comprising or consisting of:
(i)
CATCGATGAAGAACGCWGCRAAHTGCGATAMGTARTGYGAATTGCAGR ATTCAGTGARTCATCGAAWYTTTGAACGCAYMTTGCRC (SEQ ID NO: 1 ), wherein:
R represents A or G
Y represents C or T
M represents A or C W represents A or T
H represents A or C or T
(ii) a portion of SEQ ID NO: 1 , provided the said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1 , or (iii) complementary sequences of (i) and (ii).
19. A nucleic acid according to claim 18, comprising or consisting of a sequence selected from the group consisting of SEQ ID NO: 1 to 38, or complementary sequences thereof.
PCT/EP2009/056189 2008-06-02 2009-05-20 Nucleic acids and methods for detecting turfgrass pathogenic fungi Ceased WO2009147017A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP09757400.8A EP2297339B1 (en) 2008-06-02 2009-05-20 Nucleic acids and methods for detecting turfgrass pathogenic fungi
NZ589680A NZ589680A (en) 2008-06-02 2009-05-20 Nucleic acids and methods for detecting turfgrass pathogenic fungi
MX2010013252A MX2010013252A (en) 2008-06-02 2009-05-20 Nucleic acids and methods for detecting turfgrass pathogenic fungi.
US12/737,006 US20110152385A1 (en) 2008-06-02 2009-05-20 Nucleic acids and methods for detecting turfgrass pathogenic fungi
AU2009254097A AU2009254097B2 (en) 2008-06-02 2009-05-20 Nucleic acids and methods for detecting turfgrass pathogenic fungi
CA2726699A CA2726699C (en) 2008-06-02 2009-05-20 Nucleic acids and methods for detecting turfgrass pathogenic fungi
AU2015201501A AU2015201501B2 (en) 2008-06-02 2015-03-23 Nucleic acids and methods for detecting turfgrass pathogenic fungi

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP08104225.1 2008-06-02
EP08104225A EP2130928A1 (en) 2008-06-02 2008-06-02 Nucleic acids and methods for detecting turfgrass pathogenic fungi
US5986208P 2008-06-09 2008-06-09
US61/059,862 2008-06-09

Publications (1)

Publication Number Publication Date
WO2009147017A1 true WO2009147017A1 (en) 2009-12-10

Family

ID=39841191

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2009/056189 Ceased WO2009147017A1 (en) 2008-06-02 2009-05-20 Nucleic acids and methods for detecting turfgrass pathogenic fungi

Country Status (9)

Country Link
US (1) US20110152385A1 (en)
EP (3) EP2130928A1 (en)
AU (1) AU2009254097B2 (en)
CA (1) CA2726699C (en)
HK (1) HK1211625A1 (en)
MX (1) MX2010013252A (en)
NZ (1) NZ589680A (en)
TW (1) TWI537390B (en)
WO (1) WO2009147017A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2871243A1 (en) 2013-11-06 2015-05-13 Omya International AG Nucleic acids and methods for detecting pathogens and beneficial microorganisms
WO2019149963A1 (en) 2018-02-05 2019-08-08 Syngenta Participations Ag Methods for detecting fungi in turf grass with a lamp assay having novel primer sets

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011098907A2 (en) * 2010-02-15 2011-08-18 Council Of Scientific & Industrial Research Method for detecting fungal pathogens
CN105547788B (en) * 2016-02-23 2019-06-04 蒋丹 Qualitative standard sample of Fusarium moniliformes in soybean flour and preparation method thereof
CN109111514B (en) * 2018-09-06 2020-07-28 中国农业科学院作物科学研究所 Method for cultivating transgenic wheat with resistance to sheath blight and root rot and related biological material thereof
CN110305912B (en) * 2019-05-09 2022-08-12 云南中烟工业有限责任公司 Method for extracting spice from Coprinus jasmine strain and use of extracted spice in tobacco

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0859061A2 (en) * 1996-11-01 1998-08-19 Novartis AG Detection of maize fungal pathogens using the polymerase chain reaction
WO2004040017A2 (en) * 2002-11-01 2004-05-13 Carrotech As Assay method for detecting fungal infection of soil or vegetables
JP2008005760A (en) * 2006-06-29 2008-01-17 National Institute Of Advanced Industrial & Technology Mold detection method, microarray used therefor and mold detection kit

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5780271A (en) * 1996-11-13 1998-07-14 North Carolina State University PCR assays for phytophthora species
AU733810B2 (en) * 1997-05-02 2001-05-24 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Nucleic acids for detecting (aspergillus) species and other filamentous fungi
US7772155B2 (en) * 2001-05-30 2010-08-10 Her Majesty The Queen In Right Of Canada, As Represented By The Minister Of Agriculture And Agri-Food Fungal isolates and biological control compositions for the control of weeds

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0859061A2 (en) * 1996-11-01 1998-08-19 Novartis AG Detection of maize fungal pathogens using the polymerase chain reaction
WO2004040017A2 (en) * 2002-11-01 2004-05-13 Carrotech As Assay method for detecting fungal infection of soil or vegetables
JP2008005760A (en) * 2006-06-29 2008-01-17 National Institute Of Advanced Industrial & Technology Mold detection method, microarray used therefor and mold detection kit

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK 1992, MITCHELL, WHITE, TAYLOR: "Filobasidium uniguttulatum 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence", XP002500784, retrieved from NCBI Database accession no. M94520 *
DATABASE GENBANK 2003, GATHMAN: "Expressed sequence tags from Schizophyllum commune nitrogen-replete and nitrogen-limited libraries", XP002500783, retrieved from NCBI Database accession no. cf800463 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2871243A1 (en) 2013-11-06 2015-05-13 Omya International AG Nucleic acids and methods for detecting pathogens and beneficial microorganisms
JP2016534756A (en) * 2013-11-06 2016-11-10 オムヤ インターナショナル アーゲー Nucleic acids and methods for detecting pathogens and beneficial microorganisms
US10415098B2 (en) 2013-11-06 2019-09-17 Omya International Ag Nucleic acids and methods for detecting pathogens and beneficial microorganisms
WO2019149963A1 (en) 2018-02-05 2019-08-08 Syngenta Participations Ag Methods for detecting fungi in turf grass with a lamp assay having novel primer sets
US11634783B2 (en) 2018-02-05 2023-04-25 Syngenta Participations Ag Methods for detecting fungi in turf grass with a lamp assay having novel primer sets
EP4368731A2 (en) 2018-02-05 2024-05-15 Syngenta Participations Ag Methods for detecting fungi in turf grass with a lamp assay having novel primer sets
EP4368731A3 (en) * 2018-02-05 2024-11-27 Syngenta Crop Protection AG Methods for detecting fungi in turf grass with a lamp assay having novel primer sets
US12545966B2 (en) 2018-02-05 2026-02-10 Syngenta Crop Protection Ag Methods for detecting fungi in turf grass with a lamp assay having novel primer sets

Also Published As

Publication number Publication date
AU2009254097A1 (en) 2009-12-10
EP2297339A1 (en) 2011-03-23
US20110152385A1 (en) 2011-06-23
MX2010013252A (en) 2010-12-21
AU2009254097B2 (en) 2015-04-09
CA2726699A1 (en) 2009-12-10
EP2881473A1 (en) 2015-06-10
TWI537390B (en) 2016-06-11
CA2726699C (en) 2018-04-10
NZ589680A (en) 2012-10-26
EP2297339B1 (en) 2017-04-12
EP2130928A1 (en) 2009-12-09
TW201000637A (en) 2010-01-01
HK1211625A1 (en) 2016-05-27

Similar Documents

Publication Publication Date Title
Daverdin et al. Genome structure and reproductive behaviour influence the evolutionary potential of a fungal phytopathogen
Gachon et al. Real-time PCR: what relevance to plant studies?
Tollenaere et al. SNP design from 454 sequencing of Podosphaera plantaginis transcriptome reveals a genetically diverse pathogen metapopulation with high levels of mixed-genotype infection
Ocaña et al. Large-scale transcriptome analysis in faba bean (Vicia faba L.) under Ascochyta fabae infection
HK1211625A1 (en) Nucleic acids and methods for detecting turfgrass pathogenic fungi
Yang et al. Rapid development of molecular markers by next-generation sequencing linked to a gene conferring phomopsis stem blight disease resistance for marker-assisted selection in lupin (Lupinus angustifolius L.) breeding
CN102971436B (en) Method for detecting fungal pathogens
Brylińska et al. Evaluation of PCR markers for Phytophthora infestans mating type determination
Pintye et al. Improved DNA extraction and quantitative real-time PCR for genotyping Erysiphe necator and detecting the DMI fungicide resistance marker A495T, using single ascocarps
Durai et al. Genetic diversity analysis and development of SCAR marker for detection of Indian populations of Fusarium oxysporum f. sp. ciceris causing chickpea wilt
WO2015067635A2 (en) Nucleic acids and methods for detecting pathogens and beneficial microorganisms
US9458514B2 (en) Nucleic acids probes for detection of yeast and fungal
Cakir et al. Mapping and QTL analysis of the barley population Tallon× Kaput
Lee et al. Identification and characterization of simple sequence repeat markers for Pythium aphanidermatum, P. cryptoirregulare, and P. irregulare and the potential use in Pythium population genetics
Paolinelli-Alfonso et al. Quantitative real-time PCR normalization for gene expression studies in the plant pathogenic fungi Lasiodiplodia theobromae
CN111607664B (en) Application of SNP molecular marker on 1DS chromosome related to wheat stripe rust
Mendoza-Rodríguez et al. Early regulation of primary metabolism, antioxidant, methyl cycle and phenylpropanoid pathways during the Mycosphaerella fijiensis-Musa spp. interaction
Vyhnánek et al. SSR loci survey of technical hemp cultivars: The optimization of a cost-effective analyses to study genetic variability
US20130116344A1 (en) Nucleic acids and methods for detecting turfgrass pathogenic fungi
Peng et al. Draft genome sequence resource for Blumeriella jaapii, the cherry Leaf spot pathogen
AU2015201501B2 (en) Nucleic acids and methods for detecting turfgrass pathogenic fungi
Grundy et al. A molecular approach to explore the extent of the threatened fungus Hypocreopsis rhododendri within wood
Prospero et al. Eight microsatellite markers for Armillaria cepistipes and their transferability to other Armillaria species
HK1138890A (en) Nucleic acids and methods for detecting turfgrass pathogenic fungi
Mesapogu et al. Rapid detection and quantification of Fusarium udum in soil and plant samples using real-time PCR

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09757400

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2726699

Country of ref document: CA

Ref document number: 2009254097

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 589680

Country of ref document: NZ

Ref document number: MX/A/2010/013252

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2009254097

Country of ref document: AU

Date of ref document: 20090520

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2009757400

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2009757400

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 12737006

Country of ref document: US