WO2009100161A2 - Epigenetic silencing of mir-342 in colorectal cancer - Google Patents

Epigenetic silencing of mir-342 in colorectal cancer Download PDF

Info

Publication number
WO2009100161A2
WO2009100161A2 PCT/US2009/033119 US2009033119W WO2009100161A2 WO 2009100161 A2 WO2009100161 A2 WO 2009100161A2 US 2009033119 W US2009033119 W US 2009033119W WO 2009100161 A2 WO2009100161 A2 WO 2009100161A2
Authority
WO
WIPO (PCT)
Prior art keywords
evl
mir
colorectal cancer
methylation
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2009/033119
Other languages
French (fr)
Other versions
WO2009100161A3 (en
Inventor
Muneesh Tewari
William Grady
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fred Hutchinson Cancer Center
Original Assignee
Fred Hutchinson Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fred Hutchinson Cancer Center filed Critical Fred Hutchinson Cancer Center
Publication of WO2009100161A2 publication Critical patent/WO2009100161A2/en
Publication of WO2009100161A3 publication Critical patent/WO2009100161A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • colon cancer is a deadly disease afflicting nearly 130,000 new patients yearly in the United States.
  • Colon cancer is the only cancer that occurs with approximately equal frequency in men and women.
  • risk factors for the development of colon and/or rectal cancer include older age, excessive alcohol consumption, sedentary lifestyle (Reddy, Cancer Res., 41 :3700-05 (1981)), and genetic predisposition (Potter, Natl Cancer Institute, 91:916-32 (1999)).
  • microRNAs are dysregulated in human malignancies and it has been proposed that some microRNAs may have oncogenic or tumor suppressor functions (Zhang, et al. (2007) Dev Biol 302:1-12). Both overexpression and silencing of specific microRNAs have been described in a number of cancer types, including colorectal cancer (Bandres, et al (2006) MoI Cancer 5:29; Cummins, et al.( 2006) ProcNatl Acad Sci USA 103:3687-92; Volinia, et al. (2006) Proc Natl Acad Sd USA 103:2257-61; Wijnhoven, et al. (2007) Br J Surg 94:23-30).
  • MicroRNAs are small (typically 22 nucleotides in length) RNAs that influence gene expression networks by repressing target messenger RNAs (mRNAs) via specific base-pairing interactions (B artel, (2004) Cell 116:281-97; He, et al. (2004)
  • microRNA dysregulation can provide a means to diagnose and treat cancer. Identification of specific diagnostic biomarkers and therapeutic targets is needed to provide new and useful tools for improving management of disease.
  • the identification of an miR-342 and/or EVL gene as a biomarker for colorectal cancer provides a novel diagnostic tool for the identification of colorectal cancer or risk of colorectal cancer.
  • Determination of the presence or absence and/or amount of methylation of nucleic acid sequence that comprises at least a portion of a GC rich region of an EVL gene, for example of CpG sites present in a CpG dense region (CpG island) positioned in a regulatory region of the gene such as a 5' or 3' regulatory region, is useful for the detection, classification, diagnosis, or prognosis of colorectal cancer in the individual.
  • a diagnostic method comprises detecting the presence or absence and/or amount of methylation of a nucleic acid sequence in a sample obtained from an individual, the nucleic acid sequence comprising at least a portion of a GC rich region of an EVL gene. Increased methylation of the nucleic acid sequence is diagnostic of the presence of colorectal cancer or risk of developing colorectal cancer in the individual.
  • the nucleic acid sequence analyzed for methylation contains at least a portion of a GC rich sequence located 5' of the EVL transcription initiation site.
  • the nucleic acid sequence comprises at least a portion of a CpG island located at least partially in the EVL promoter region.
  • the nucleic acid sequence analyzed for methylation comprises at least a portion of a CpG island designated by the UCSC Genome Browser (http://genome.ucsc.edu) in the 5' aspect of EVL, for example, the CpG island 128.
  • CpG-128, found in the 5' aspect of EVL has the following coordinates on the + strand of the March 2006 UCSC assembly of the human genome: 99507135 to 99508616 and the sequence of SEQ ID NO:11.
  • the nucleic acid sequence analyzed for methylation contains at least a portion of a GC rich sequence located 3' of the EVL transcription termination site. In one example, the nucleic acid sequence comprises at least a portion of a GC rich sequence located at least partially at the 3 1 end of the transcribed EVL sequence. In a specific embodiment, the
  • 1161036vl - 2 - nucleic acid sequence analyzed for methylation contains at least a portion of a CpG island designated by the UCSC Genome Browser in the 3 1 aspect of EVL, for example, CpG islands 21, 41, 133, 30, 57, 77, and 256.
  • CpG-21 found in the 3' aspect of EVL, has the following coordinates on the + strand of the March 2006 UCSC assembly of the human genome: 99680160 to 99680444 and the sequence of SEQ ID NO: 12. Coordinates and sequences of additional EVL CpG islands can be readily obtained from genomic databases, for example, the UCSC Genome Browser.
  • Methylation can be detected and/or quantified by one of many known methods and systems.
  • methylation of a nucleic acid sequence can be determined by modifying the sequence, for example, by treating the sequence with bisulfite to alter nonmethylated cytosine (C) to thymine (T), and comparing the modified sequence to the unmodified sequence.
  • the comparison can include one or more of sequencing, single nucleotide primer extension, digestion with methylation-sensitive restriction enzymes, Southern blotting, methylation-specific PCR, methylation-specific immunoprecipitation or immunoassay, and the like.
  • detecting methylation of a nucleic acid sequence comprises the steps of modifying the nucleic acid sequence with bisulfite to convert unmethylated C to T 3 amplification of the nucleic acid sequence with specific primers designed to amplify methylated alleles of the nucleic acid sequence, and optionally sequencing of the amplified sequence to detect modifications.
  • Amplification of a nucleic acid sequence can utilize one or more primer pair that is specifically designed to amplify methylated alleles and/or one or more primer pair specifically designed to amplify unmethylated alleles of EVL including all or a portion of a GC rich region 5 1 of the EVL transcription start site and/or 3 1 of the transcription termination site.
  • the primer pair amplifies a sequence of EVL comprising at least a portion of CpG 128, SEQ ID NO:11.
  • the primer pair amplifies at least a portion of CpG 21, SEQ ID NO: 12.
  • colorectal cancer or risk of colorectal cancer in an individual can be detected by analyzing expression of one or more o ⁇ miR-342 and EVL.
  • Reduced expression of mlR-342 and/or EVL versus a control indicates presence of colorectal cancer or risk of colorectal cancer.
  • expression reduced by at least 20% to 100% compared with a non-cancer control indicates the presence or risk of colorectal cancer.
  • Expression of miR-342 or EVL can be determined by known methods, for example, by quantitative reverse-transcription PCR.
  • the diagnostic kit contains one or more agent designed to detect reduced expression ofmiR-342 and/or EVL.
  • the kit may contain primers designed to amplify and/or analyze expression of miR-342 and EVL.
  • the diagnostic kit contains one or more agent designed to detect the presence and/or amount of methylation in the at least a portion of the EVL gene.
  • the kit may contain, for example, primers designed to amplify and/or detect methylation of the EVL gene, particularly methylation of a GC-rich region of the EVL gene.
  • the kit contains specific primers to amplify at least a portion of a GC-rich region positioned 5' in the EVL promoter region, for example at least a portion of CpG 128 (SEQ ID NO: 11) positioned in the 5' aspect of EVL. In one embodiment, the kit contains specific primers to amplify at least a portion of a GC-rich region positioned 3' in an EVL regulatory region, for example at least a portion of CpG 21 (SEQ ID NO: 12) positioned in the 3 1 aspect of EVL.
  • the diagnostic kit includes one or more primers designed to amplify methylated or unmethylated GC rich sequences in the 5' promoter region of EVL.
  • the kit includes one or more first primer pair designed to specifically amplify methylated DNA of EVL or a portion thereof, for example, one or more first forward primer:
  • MB-S 1 GTTTTTTTTAAAGTTTYGTTTTTTAG-3' (SEQ ID NO:6) ; and one or more first reverse primer:
  • the kit may comprise at least one second primer pair designed to specifically amplify unmethylated DNA of an EVL gene or portion thereof, for example:
  • the diagnostic kit may comprise one or more of a bisulfite reagent, a methylation- specific antibody, a methylation-specific restriction enzyme, and one or more sequencing reagent useful to detect methylation of a GC rich region of EVL.
  • miR-342 is a specific suppressor of colorectal cancer cell growth.
  • Administration of miR-342 to colorectal cancer cells results in apoptosis.
  • 1161036vl - 4 - colorectal cancer cells are provided by administering to colorectal cancer cells miR-342 or EVL protein.
  • a method for treating or preventing colorectal cancer includes administering miR-342 or a mimic thereof to induce apoptosis of colorectal cancer cells; administering EVL protein or a portion thereof to induce apoptosis of said cancer cells; or both.
  • treating or preventing colorectal cancer includes administering one or more demethylation agent such as 5-aza-cytidine and the like to reduce and/or remove methylation from at least a portion of the EVL gene, including from GC-rich regions in the 5' and 3' aspects of the gene.
  • miR-342 or mimic thereof, EVL protein or a portion thereof, or one or more demethylation agent may be administered alone or in various combinations, hi addition, one or more cytotoxic and/or cytostatic chemotherapeutic agents or other anti-cancer therapy can be administered in combination with miR-342 or mimic thereof, EVL protein or a portion thereof, one or more demethylation agent, or combination of these.
  • microRNAs that undergo silencing in colorectal cancer, and these represent candidate tumor suppressors.
  • one mode of transcriptional silencing of microRNAs may be epigenetic mechanisms related to the aberrant DNA methyl ation of 5' regulatory regions, as has been observed for many 'conventional 1 tumor suppressor genes (Kim, et al. (2006) Genes Chromosomes Cancer 45:781- 89; Kondo, et al (2004) Cancer Metastasis Rev 23:29-39; Toyota, et al (1999) Cancer Res 59:2307-12).
  • microRNAs are encoded in introns of protein-encoding genes (and subsequently excised from a primary transcript in common with the host gene) (Rodriguez, et al (2004). Genome Res 14:1902-10; Kim, etal. (2001).EMBO J 26:775-83; Saini, et al. (2007) Proc Natl Acad Sci U S A 104 : 17719-24). It is possible that they are susceptible to transcriptional repression via aberrant methylation of a CpG island located in the host gene 5' promoter region. We looked for examples of transcriptional regulation of microRNA gene expression might be achieved by epigenetic alterations of host gene regulatory elements, which could be located far from the microRNA locus itself.
  • MicroRNAs are small, noncoding RNAs that influence gene regulatory networks by post- transcriptional regulation of specific messenger RNA targets. MicroRNA expression is dysregulated in human malignancies, frequently leading to loss of expression of certain
  • Silencing of miR-342 is confirmed herein to be a common event in colorectal cancer.
  • Evidence is provided for coordinate epigenetic silencing of an intronic microRNA and its host gene in human cancer. Given that roughly half of microRNA genes are located in introns (Rodriguez (2004) ob cit.; Kim (2007) ob cit; Saini (2007) ob cit.) this mode of coordinate silencing may represent a more general mechanism of microRNA suppression in human cancer.
  • methylation of EVL/miR-342 is an early event in colorectal carcinogenesis, given that it is detectable in 67% of adenomas, as well as in 56% of histologically normal colorectal mucosal specimens from patients with concurrent colorectal cancer. Based on these observations, the methylated DNA corresponding to EVL/miR-342 is useful as a biomarker for non-invasive disease detection or risk prediction for colorectal cancer, especially in light of its apparent specificity for colorectal cancer.
  • EVL is a member of the Ena/VASP protein family, actin-associated proteins involved in a variety of processes related to cytoskeleton remodeling and cell polarity such as axon guidance and lamellipodial and filopodial dynamics in migrating cells (Krause, et al. (2003) Annu Rev CellDev Biol 19:541-64). EVL may function as a tumor suppressor through effects on cell shape or motility.
  • the Examples provide results showing that miR-342 can induce apoptosis in colorectal cancer cells. Reconstituting miR-342 activity in the HT-29 colorectal cancer cell line causes apoptosis. This causal relation provides a plausible basis for why silencing of this microRNA would promote the formation of colorectal cancer. These pro-apoptotic effects are consistent with miR-342 microRNA as a tumor suppressor in colorectal cancer.
  • the microRNA miR-342 is encoded in an intron of the gene EVL, between exons 3 and 4.
  • Human miR-342 has the sequence: 5'-UCUCAC ACAGAA AUCGC ACCCGUC-3' (SEQ ID NO:9) or S'-UCUCACACAGAAAUCGCACCCGU -3' (SEQ ID NO:10).
  • the structure of miR- 342 is provided in the Sanger MicroRNA Registry. Its symbol is HGNC:MIRN342, and its coordinates are: 14; 99645745-99645843 [+].
  • microRNAs are encoded by genes that are transcribed from DNA but not are not translated into protein); instead they are processed from primary transcripts known as pri-miRNA to short stem-loop structures called pre-miRNA and finally to functional rm ' RNA.
  • pri-miRNA sequence is
  • the pri-miRNA is processed in the nucleus by the proteins Drosha and Pasha to the pre- miRNA that has a stem and loop structure with flanking sequences.
  • the pre-miRNA will generally have about 60 bases to 70 bases. The pre-miRNA is then actively transported into the pre- miRNA
  • RNA- induced silencing complex RISC
  • miRNA guiding strand guides the RISC to the cognate messenger RNA (mRNA) target for translational repression or degradation of the mRNA.
  • mRNA messenger RNA
  • Mature miRNA molecules are partially complementary to one or more messenger RNA (mRNA) molecules, and one of their known functions is to downregulate gene expression.
  • Intronic miR-342 is silenced in a majority of colorectal cancers by methylation of its host gene, EVL, for example at a CpG island positioned at least in part in the 5' aspect or 3' aspect of EVL.
  • EVL its host gene
  • the Examples below show specific methylation of EVLi 'miR-342 DNA samples obtained from colorectal carcinoma cells and from colorectal adenoma cells versus samples from non-cancer control cells. These results show that 86% of colorectal tumors and 67% of colorectal adenomas carried methylated EVL/miR-342. In contrast, 12% of mucosal tissue from cancer free controls carried methylated EVL/miR-342. Notably, 56% of normal mucosal samples obtained from individuals with colorectal cancer carried the methylated gene.
  • miR-342 mimics miRNA mimics are synthetically produced molecules designed to mimic or inhibit the activities of a natural miRNA. Such mimics are commercially available for use by one of skill in the art. See, for example, www. dharmacon, com/microrna for a description of mimics that are double stranded RNA oligonucleotides, including a mimic for human miR-342 having the catalog number C-300186-01, and others as shown in the following table.
  • hsa-miR-342-3p/hsa-mir-342 tniRIDIAN Hairpin Inhibitor Mature hsa-miR-342-3p
  • Organism Human - Homo sapiens
  • Organism Human - Homo sapiens
  • Organism Human - Homo sapiens
  • the EVL gene encodes Enabled/Vasodilator-Stimulated Phosphoprotein-Like protein (EVL), also (Ena/VASP-like).
  • EVL proteins are actin-associated proteins involved in a range of processes dependent on cyto skeleton remodeling and cell polarity such as axon guidance and lamellipodial and filopodial dynamics in migrating cells. EVL enhances actin nucleation and polymerization.
  • the term "EVL gene” is intended to include coding and non-coding sequences, and to particularly include 5' and 3' aspects of the gene extending about 100,000 base pairs 5 1 from the EVL transcription initiation site, including a 5' promoter region.
  • the 3' aspect of the EVL gene extends about 100,000 base pairs 3 1 from the EVL termination sequence.
  • These 5' and 3' aspects of the gene include multiple GC-rich regions, such as CpG islands identified, for example, in the UCSC genome browser, including CpG-128, CpG-21, CpG 41, CpG-133, CpG- 30, CpG-57, CpG-77 and CpG-256.
  • the genomic DNA sequence of EVL/miR-342 is positioned in Chromosome 14. As shown in the UCSC Genome Browser, human EVL spans coordinate positions chrl4:99601504 to 99680326 (SEQ ID NO: 8), with 5' and 3' aspects of the gene extending the EVL sequence about 100,000 base pairs in each direction. CpG islands are found in these 5' and 3' aspects of the gene.
  • a "GC-rich" sequence is one that contains a higher count of G and C nucleotides than the average content of the human genome, for example, greater than about 45% G + C content, and preferably at least 50% G + C.
  • a CpG-dense region is a selected sequence having a greater frequency of CpG dinucleotides than expected, for example, greater than 10%, and preferably greater than 20% of the sequence.
  • CpG dinucleotides are rare in the human genome, and occur with much less frequency than would occur randomly. In general, the expected frequency of this dinucleotide pair is only about 0.01 (1%). The low frequency of CpG dinucleotides is thought to be due to a higher susceptibility to C-methylation transition mutations.
  • CpG islands were proposed by Gardiner-Garden, et al (1987). JMoI. Biol. 196:201-82. This publication classified CpG-rich regions as "stretches of DNA where both the moving average of % G + C was greater than 50%, and the moving average of Obs/Exp CpG was greater than 0.8.
  • the observed/ expected CpG ratio was calculated as equal to the number of CpG sites divided by the (number of C nucleotides plus the number of G nucleotides) times the total number of nucleotides in the sequence being analyzed.
  • the UCSC Genome Browser uses slightly different criteria to define a CpG island. According to the UCSC, a CpG island sequence has a length of at least 200 base pairs, a % G + C content of at least 50% and an Observed/Expected CpG ratio of at least 0.6.
  • CpG dinucleotides The Cs of most CpG dinucleotides in the human genome are methylated. CpG dinucleotides occur about five times less frequently than expected ( Bird (1980) Nucleic Acids Res 8:1499-1594; Jones, et al. (1992) BioEssays 14, 33-36). CpG islands are unmethylated regions of the genome that are associated with the 5' ends of most house-keeping genes and many regulated genes ( Bird (1986) Nature 321:209-13; Larsen, et al. (1992) Genomics 13:1095-1107). The absence of methylation slows CpG decay, and so CpG islands can be detected in a DNA sequence as regions where CpG pairs occur at close to the expected frequency. CpG islands can overlap the promoter and extend into the transcription unit. CpG islands tend to be unique sequences.
  • CpG islands associated with the EVL gene are found in both the 5' and 3 1 aspects of the gene.
  • ETL gene we define the term "EVL gene" to include 5' and 3 1 aspects of the gene, for example, extending about 100,000 base pair 5' of the transcription initiation site and about 100,000 base pair 3' of the transcription termination site.
  • the EVL gene extending from human genome positions chrl4: 99601504 and 3' CpG extending to chrl4:99680326, associated with CpG islands that impact expression and activity of EVL and miR-342.
  • the Dukes' staging system based on the pathological spread of disease through the bowel wall, to lymph nodes, and to distant organ sites such as the liver, has remained the most popular. Despite providing only a relative estimate for cure for any individual patient, the Dukes' staging system remains the standard for predicting colon cancer prognosis, and is the primary means for directing adjuvant therapy.
  • the Dukes' staging system has only been found useful in predicting the behavior of a population of patients, rather than an individual. For this reason, any patient with a Dukes A, B, or C lesion would be predicted to be alive at 36 months while a patient staged as Dukes D would be predicted to be dead. Unfortunately, application of this staging system results in the potential over-treatment or under-treatment of a significant number of patients. Further, Dukes' staging can only be applied after complete surgical resection rather than after a pre- surgical biopsy.
  • Colorectal cancer is a disease that shows slow progression from polyps of the colon or benign adenomas to progressive carcinoma.
  • the sequence of progression can take about 10 years. Diagnosis often occurs late in the progression, after the start of progressive cancer.
  • colonal cancer is intended to mean cancer of the colon and/or rectum.
  • the term includes “colorectal adenocarcinoma.”
  • colonal adenoma is intended to mean benign tumors of the colon and/or rectum. Colorectal adenomas may progress to form colorectal adenocarcinomas.
  • the diagnostic methods described herein provide a rapid and sensitive assay for detecting the presence of colorectal cancer in an individual, and also provide early detection of cancerous cells and determination of an individual's risk of developing colorectal cancer.
  • Methylation-induced silencing of miR-342 and EVL can be detected and quantified by determining in a sample obtained from an individual, the presence or absence of methylation and/or determining an increased amount of methylation in a GC rich region of the EVL gene, as compared with a control sample that may be obtained from a cancer free control, from normal colorectal mucosal tissue, or from a sample obtained from the individual at an earlier time period.
  • DNA from frozen primary tissue specimens were extracted using previously published protocols (Meltzer, et al. (1994) Cancer Res., 54:3379-82 and Sato, et al (2002) Cancer Res. 62:6820-2)). Briefly, cell line DNAs were purified with Proteinase K and extracted onto silica- gel membranes using DNeasy (Qiagen, Valencia, Calif.). Cell line RNA was isolated with phenol-chloroform and guanidine isothiocyanate according to the manufacturer's specifications (Trizol, Invitrogen, Carlsbad, Calif.) (See Chomczynski, et al. (1987) Anal Biochem. 162:156- 92).
  • MSP distinguishes methylated alleles of a given gene based on DNA sequence alterations after bisulfite treatment of DNA. Bisulfite treatment converts unmethylated but not methylated cytosines to uracils. Subsequent PCR using primers and probe specific to the corresponding methylated DNA sequence is then performed.. A normalized MSP value can be calculated by dividing the ratio of the qMSP value for each sample by the ratio of the qMSP value for
  • At least a portion of a GC rich sequence positioned in the 5' aspect of EVL is analyzed for methylation status.
  • at least a portion of a GC rich sequence positioned in the 3' aspect of EVL for example at the end of the transcription sequence and/or extending 5' of the termination sequence.
  • at least a portion of the 5' CpG-128 is analyzed; in other embodiments, at least a portion of the 3' CpG-21 is analyzed.
  • a sensitive assay for the detection, classification, diagnosis, or prognosis of colorectal cancer is provided by analyzing methylation status of the EVL gene.
  • the presence of methylation in a normally non-methylated region of the EVL gene, including 5 ' or 3' aspects of the gene and/or an increased amount of methylation in the sample versus a control sample, is indicative of colorectal cancer or risk thereof.
  • the Examples below demonstrate that the methylation status of EVL provides a method for detection of colorectal cancer risk or of colorectal cancer in samples with no histological evidence of disease.
  • Colorectal cancer is diagnosed by measuring the level of EVL or miR-342 CpG methylation or expression of from a test population of cells, ⁇ i.e., a patient derived biological sample).
  • the test cell population contains an epithelial cell, e.g., a cell obtained from colon tissue.
  • Gene methylation or expression is also measured from e.g., blood, urine, sputum, ascites, stool, gastric juice, or bile.
  • Levels of EVL or miR-342 CpG methylation or expression is determined in the test cell or biological sample and compared to the levels in a normal control.
  • the normal control level is an amount typically found in a population known not to be suffering from colorectal cancer.
  • An increase of the level of methylation or expression in the patient derived tissue sample of colorectal cancer indicates that the subject is suffering from or is at risk of developing colorectal cancer.
  • the DNA used for measuring methylation can be cellular (cell-associated) or acellular (cell-free).
  • the diagnostic method includes determining the presence or absence, and/or amount of methylation present in a GC-rich region of the EVL gene in a sample obtained from an individual.
  • Methylation status can be determined using a variety of methods. One method includes distinguishing methylated from unmethylated DNA using methylation sensitive restriction enzyme digestion of DNA, followed by detection, for example, by Southern blot, PCR, methylated CpG island amplification (MCA), and the like.
  • MCA methylated CpG island amplification
  • 1161036vl - 14 - Methylation sensitive restriction enzymes cleave DNA at specific methylated-cytosine residues.
  • DNA is first digested by methylation-sensitive restriction enzymes followed by precipitation by methyl-binding domain polypeptides immobilized on a magnetic solid matrix and then by real time PCR. See, for example, Yegnasubramanian, et al., (2006). Nucleic Acids Research 34:el9.
  • Bisulfite (BiS) modification of a GC-rich region followed by comparison of the BS treated sample with a non- treated control can also be used to determine methylation status of the DNA sequence.
  • Application of bisulfite converts non-methylated C to T, providing a difference in treated versus untreated samples that can be measured.
  • differences can be determined using a variety of known methods, for example, DNA sequencing, methylation-specific PCR (MSP), restriction analysis, and PCR followed by single- nucleotide primer extension (Ms-SNuPE).
  • Methylation specific PCR is a highly sensitive method for detecting methylation.
  • Methylation-specific primers can be designed to amplify either the methylated strand or unmethylated strand, and electrophoresis can be used to view the results. See, for example, the methylation specific primers and unmethylated specific primers described in the Examples below for the specific amplification of methylated or unmethylated GC rich regions of the EVL gene.
  • the present invention provides methods for predicting the responsiveness of a subject to a therapeutic regimen.
  • "predicting" indicates that the methods described herein are designed to provide information to a health care provider or computer, to enable the health care provider or computer to determine the likely effectiveness of a proposed therapeutic regimen for the subject.
  • Examples of health care providers include but are not limited to, an attending physician, oncologist, physician's assistant, pathologists, laboratory technician, etc.
  • the information may also be provided to a computer, where the computer comprises a memory unit and machine executable instructions that are configured to execute at least one algorithm designed to determine the likely effectiveness of a proposed therapeutic regimen for the subject. Accordingly, the invention also provides devices for predicting the responsiveness of a subject to a therapeutic regimen comprising a computer with machine executable instructions for predicting the responsiveness of a subject to a therapeutic regimen.
  • the term "subject” is used interchangeably with the term “patient,” and is used to mean an animal, in particular a mammal, and even more particularly a non-human or human primate.
  • a “therapeutic regimen” is a plan for treating a subject in need of treatment for a particular disease state.
  • the term “treat” is used to indicate a procedure which is designed to ameliorate one or more causes, symptoms, or untoward effects of an abnormal condition in a subject.
  • the therapeutic regimen can, but need not, cure the subject, i.e., remove the cause(s), or remove entirely the symptom(s) and/or untoward effect(s) of the abnormal condition in the subject.
  • the phrase “therapeutic regimen” is also used to indicate a procedure which is designed to inhibit growth and accelerate cell aging, induce apoptosis and cell death of neoplastic tissue within a subject.
  • therapeutic regimen means to reduce, stall, or inhibit the growth of or proliferation of tumor cells, including but not limited to carcinoma cells.
  • the therapeutic regimen may or may not be employed prior to performing the methods of the present invention.
  • the invention is not limited by the therapeutic regimen contemplated.
  • therapeutic regimens include but are not limited to chemotherapy (pharmaceuticals), radiation therapy, surgical intervention, cell therapy, stem cell therapy, gene therapy and any combination thereof, hi one embodiment, the therapeutic regimen comprises chemotherapy, hi another embodiment, the therapeutic regimen comprises radiation therapy. In yet another embodiment, the therapeutic regimen comprises surgical intervention. In still another embodiment, the therapeutic regimen comprises a combination of chemotherapy and radiation therapy.
  • abnormal condition is used to mean a disease, or aberrant cellular or metabolic condition.
  • abnormal conditions in which the methods can be used include but are not limited to, dysplasia, neoplastic growth and abnormal cell proliferation.
  • the abnormal condition comprises neoplastic growth.
  • the abnormal condition comprises neoplastic growth.
  • the 116103 ⁇ vl - 16 - condition comprises a carcinoma.
  • the abnormal condition comprises colorectal cancer cells, or their precursors, including adenomas or normal cells expressing the biomarker.
  • the methods comprise determining the methylation status of the EVL/miR-342 gene in the test subject.
  • methylation status is used to indicate the presence or absence or the level or extent of methyl group modification in the polynucleotide of at least one gene, determining said methylation status comprises using an assay selected from the group consisting of Southern blotting, single nucleotide primer extension, methylation-specific polymerase chain reaction (MSPCR), restriction landmark genomic scanning for methylation (RLGS-M), CpG island micro array, SNUPE, and COBRA. These methods well known to those skilled in the art are hereby incorporated by reference.
  • a small increase in methylation e.g., about 10%, 12%, 14%, 16%, 18%, or 20% over a non-cancer control may be diagnostic of a risk of colorectal disease. Higher amounts of methylation are correlated with advancing or advanced colorectal cancer.
  • DNA samples obtained from individuals suffering from colorectal cancer demonstrated at least 50% and up to 100% of CpGs in the interrogated EVL DNA were methylated. Accordingly, a high amount of methylation, for example, at least about 20%, 35%, 50%, 75%, or 90% CpG methylation detected in the assayed region of EVL by any one of a variety of methylation assays, is indicative of colorectal cancer.
  • methylation was present with greater frequency than seen in cancer free controls but with less frequency than that in colorectal cancer samples.
  • methylation of, for example, at least about 20%, 30%, 40%, or 50% of CpG sites within a tested sequence is indicative of risk of colorectal cancer in the individual, providing, for example, an indication that adenoma is progressing to adenocarcinoma, or providing early warning of the disease or risk of developing the disease.
  • 1161036vl - 17 - controls very high methylation, e.g., at least about 50%,60%, 70%, 80%, 90% or 100%, in colorectal cancer samples, and a medium amount of methylation, e.g., about 20%, 30%, 40%, or 50% suggestive of risk of disease and/or early stage of disease.
  • very high methylation e.g., at least about 50%,60%, 70%, 80%, 90% or 100%
  • a medium amount of methylation e.g., about 20%, 30%, 40%, or 50% suggestive of risk of disease and/or early stage of disease.
  • the epigenetic approach taken with respect to EVL can be complemented by analysis of to other genes associated with colorectal cancer, including KPNBl, karyopherin (importin) beta ⁇ ; ID4, inhibitor of DNA binding 4, dominant negative helix-loop-helix protein, PTGER4, prostaglandin E receptor 4 (subtype EP4); SETD7, SET domain containing (lysine methyltransferase) 7; RASAJ, RAS p21 protein activator (GTPase activating protein) 1 ; GRINl, glutamate receptor, iono tropic, N-methyl D -aspartate 1; NHLH2, nescient helix loop helix 2; EFTUD i, elongation factor Tau GTP binding domain containing 1; BMPR2, bone morphogenetic protein receptor, type II (serine/threonine kinase); SOX6, SRY (sex determining region Y)-box 6;
  • methylation patterns of CpG islands associated with these genes or the expression levels of the genes may be used as coordinated biomarkers for diagnosis, prognosis an categorization of colorectal cancer. Because the expression of these genes was identified a regulatory targets of miR-342, a diagnostic for miR-342 expression will be useful in satisfying statistical certainty of any analytical outcome.
  • kits adapted for the determination of colorectal cancer in an individual and/or risk of colorectal cancer are provided herein. Such kits include materials and reagents adapted to specifically determine the presence and/or amount of methylation in a sample selected to be diagnostic of colorectal cancer.
  • a diagnostic kit may contain, for example, forward and reverse primers designed to amplify methylated DNA from a specific region of the EFZ, gene determined to be diagnostic of the presence or risk of colorectal cancer.
  • the primers are designed to amplify a GC-rich region of a 5' or 3' aspect of EVL, such as a portion of a CpG island of the gene.
  • the primers amplify all or a portion of an EVL CpG island and may amplify, for example, all or a portion of the CpG-128 (SEQ ID NO: 11) or CpG-21 (SEQ ID NO: 12), for example.
  • the diagnostic kits may include, for example, one or more primer specifically designed to amplify a GC-rich nucleic acid sequence of EVL, for example a nucleic acid sequence that includes a portion of CpG-128 (SEQ ID NO:11), e.g. aportion of about 200 to 600 base pairs.
  • Exemplary amplification primers useful in diagnostic kits for the detection of methylated EVL include one or more forward primer selected from SEQ ID NO: 1 or 6 and one or more reverse primer selected from SEQ ID NO: 2 or 7. These primers are specifically designed to amplify methylated DNA in a GC-rich region of the 5' aspect of EVL.
  • a particularly useful primer pair is the combination of SEQ ID NO: 6 and 7, adapted for use in an MSP assay.
  • Forward and reverse primers SEQ ID NO: 3 and 4 are designed to amplify non-methylated DNA of the same GC-rich region.
  • One or all of the primers may include a GC-rich tail of approximately 15-25 nucleotides.
  • PCR primers may be designed and adapted to produce a sequence of a desired length and position in the EVL gene, as well as specificity for methylated DNA.
  • kits may contain one or more of the following agents: a bisulfite reagent, a methylation-specific restriction enzyme, a methylation-specific antibody, apparatus and reagents for Southern analysis or for sequencing, and the like.
  • silencing of miR-342 and/or silencing of EVL results removal of tumor suppression. Reconstitution of the activities of these molecules thus provides a therapeutic protocol for the associated disorder, colorectal cancer, and a potential for preventing development of the disease.
  • the subject invention allows for improved prediction of the modulation of mRNA expression with miR-342.
  • An aspect of this embodiment is modifying the sequence of mature or pri-miRNA miR-342 to alter the expression of one or more genes selected from the group consisting of: KPNBl, ID4, PTGER4, SETD7, RASAl, GRINl, NHLH2, EFTUDl, BMPR2, SOX6, and E2F3.
  • a change in phenotype indicates that the subject miR-342 precursors have an effect in the degradation or storage of the target mRNA(s).
  • Most of the loop sequence need not be complementary, desirably up to 6 nt, where bulges of 1 to 3 nt and mismatches are permitted.
  • the miR-342 will then also be known.
  • the sequence of an mRNA complementary to at least the seed sequence of a stem sequence of a mature miR-342 where the seed sequence will generally be of from about 6 to 10 nucleotides of the 5 1 strand.
  • the complementary nucleotides in the loop and the mRNA will be equally spaced apart, so that there will be no bulges, although there may be mismatches.
  • the phenotype of a cell can be modified with greater specificity by employing a particular precursor miR-342 that acts on a single target in a pathway of interest, acts on a plurality of targets while excluding other targets, or acts with greater efficiency on one or more targets, particularly where the targets may be in single or related pathways.
  • a particular precursor miR-342 that acts on a single target in a pathway of interest, acts on a plurality of targets while excluding other targets, or acts with greater efficiency on one or more targets, particularly where the targets may be in single or related pathways.
  • loop sequences that bind to selected target(s), particular a single target the modulation of the cellular pathway can be more precisely controlled.
  • the miR-342 pre-microRNA can be matched with a particular mRNA or small number of mRNAs, usually not more than 5, more usually, not more than 3, mRNAs.
  • modified precursor miR-342 may be as to sequence, backbone, chemical conjugation, use of unnatural bases, deletions, insertions, etc.
  • the purpose(s) of the modifications may be to enhance affinity, reduce degradation by nucleases, prevent or enhance cross-reactivity, permit ready identification of hybridization, etc.
  • the modifications will usually be limited to sequence modifications, rather than modifications involving substitution of bases with entities that bind to the same complementary base.
  • sequence modifications may take many forms. Where the pre- miRNA is produced by cellular expression, then differences will be as to the sequence, which will involve deletions, insertions and substitutions. Modifications can be selected to allow for greater or lesser complementarity between the two sequences of the stem. With 6 to 8 nucleotides of the guide sequence complementary to the target mRNA, the binding of a second portion of the same strand to the mRNA is not required for repression. However, for fewer nucleotides than 6 complementary to the mRNA, then the second portion will usually be involved.
  • the miR-342 guide sequence Once the mRNA sequence that binds the miR-342 guide sequence is known, one can enhance affinity by providing for greater complementarity between the guide sequence and the mRNA sequence, up to perfect complementarity. Where the miR-342 pre-miRNA is synthesized,
  • 1161036vl - 21 - one may use modified nucleotides that provide for higher affinity between the guide sequence and the mRNA sequence.
  • modified nucleotides that provide for higher affinity between the guide sequence and the mRNA sequence.
  • Various unnatural bases may be used, such as phosphorothioates, phosphorodithioates, polyamido(peptide) or polyamino backbones, modified sugars, e.g. LNA, modified bases, and others known to one of ordinary skill in the art.
  • the mimetic (“mimic”) molecules may be varied in different manners.
  • the seed sequence and the complementary sequence in the loop will usually have a linking group of up to 20 nucleotide units, more usually not more than about 18 nucleotide units, and at least about 16 nucleotide units.
  • other than nucleotides or nucleotide mimics may be employed as the linker, where there will generally be from about 54 to 120 atoms in the chain, usually from about 60 to about 108 atoms in the chain, where a ribose phosphate is counted as 6 atoms, an amide as 3 atoms, etc.
  • the particular spacer will be selected to provide the optimum activity of the pre-miRNA in repressing translation.
  • the linking group may be a naturally occurring linking group from a naturally occurring pre-miRNA binding to the target mRNA, a truncated naturally occurring linking group, truncated by from 1 to 6 nucleotides, may be a poly- U or -A or combination thereof, random, alternating or block, abasic nucleotides, or portions of one with another.
  • the linker may be varied widely providing for minimal interference with the binding of the pre-miRNA with the target mRNA, minimizing cross-reactivity with non-target mRNA, avoiding false positives and negatives, and providing for optimum binding of the seed sequence and the loop sequence with the target mRNA.
  • Reconstituting the activity of miR-342 and/or of EVL maybe accomplished by administering one or both of these agents and/or their encoded RNA and protein products.
  • a mimic of miR-342 or a portion of EVL may be administered. Administration can be by injection of the miR-342 or mimic and/or EVL protein or portion, reconstituting these agents by administering miR-342 and/or of EVL by gene therapy, and the like.
  • miR-342 or mimic can be administered to an individual having colorectal cancer, alone, or in combination with EVL protein or an active portion thereof. Treatment of colorectal cancer with miR-342 or mimic is useful to induce apoptosis of the cancer cells.
  • RNA can be formulated in buffer solutions such as phosphate buffered saline solutions, liposomes, micellar structures, and capsids. Formulation of RNA it cationic lipids may be used to facilitate entry of RNA into cells.
  • the method of introducing RNA into the environment of the cell will depend on the type of cell. Lipid formulations may be administered by intravenous, intra muscular, or intraperitoneal injection, orally, or by inhalation or other methods known in the art.
  • one or more therapeutic compound designed to emethylate the DNA can be administered.
  • agents useful to remove methylation and reconstitute silenced genes include 5-aza-cytidine, 5-aza-2- deoxycytidine, procainamide, arsenic trioxides, and others. See, for example, a review of de-methylating agents and their therapeutic use, in: Methods in Molecular Biology, v.361, Sioud (Ed.) Humana Press, Totowa.
  • a preferred therapeutic combination includes administering to an individual suffering from colorectal cancer or at risk of developing colorectal cancer a de-methylation agent, miR-342 or a mimic thereof, EVL protein or active fragment thereof, individually or in combination.
  • Administration of these therapeutic agents is preferably in a pharmaceutical carrier, e.g., orally, by injection, or by gene therapy methods, and may also be combined with the administration of known chemotherapeutic agents, such as chemotoxic and chemotherapeutic agents.
  • chemotherapeutic agents such as chemotoxic and chemotherapeutic agents.
  • Therapeutic kits comprising one or more of a de-methylation agent, miR-342 or mimic, and EVL protein or portion can be prepared.
  • Methylation analysis was conducted on 42 colorectal cancers, nine colorectal adenomas and 16 samples of grossly normal mucosa in patients with and without colorectal cancer. None of the patients had a clinically apparent polyposis syndrome or hereditary nonpolyposis colorectal cancer.
  • Genomic DNA from the cultured cells and frozen tissues was extracted using Puregene DNA Purification Kit (Gentra, Minneapolis, Minnesota). DNA was extracted from the microdissected epithelial layer of formalin-fixed, paraffin- embedded tissue sections using InstaGene Matrix (Bio-Rad, Hercules, CA). The histological diagnosis of each case was confirmed by an experienced pathologist. Normal colorectal specimens resected for benign disease were obtained from the Vanderbilt University Medical Center pathology archives. DNA was extracted from formalin-fixed tissues as previously described (Grady, et al. (1998). Cancer Res 58:3101-04).
  • qRT-PCR Quantitative Reverse-Transcription PCR
  • Expression was normalized using TaqMan microRNA endogenous control assay RNU24 for hsa-miR-342 and TaqMan endogenous control assay GAPDH for EVL and pl6/CDKN2 'A.
  • Real-time PCR was carried out on an Applied Biosystems 7900HT using TaqMan Universal PCR Master Mix, No AmpErase UNG. Data was analyzed with SDS Relative Quantification software (Applied Biosystems Inc.).
  • MSP Methylation specific PCR
  • Genomic DNA was modified with sodium bisulfite as previously described ( Grady WM, et al. (2001). Cancer Res 61 :900-02). Positive and negative controls, consisting of methylated
  • Primer pairs were designed using MethPrimer (http://www.urogen.org/methprimer/indexl.html) to amplify specifically the methylated or unmethylated alleles of a portion of CpG-128 positioned in the 5' aspect of EVL with at least a portion of the CpG island positioned within the promoter region of the EVL gene:
  • Each PCR reaction mix consisted of a total volume of 20 ⁇ L containing 1OX PCR buffer (Qiagen, Valencia, CA, USA), 125 ⁇ M of deoxynucleotide triphosphate mix (Invitrogen, Carlsbad, CA), 500 nM of each primer (Operon Biotechnologies, Huntsville, AL, USA), 1 unit of HotStart Taq enzyme (Qiagen), and bisulfite-modified DNA.
  • PCR conditions were: 95°C for 15 minutes (92°C for 30 seconds 64 0 C for 45 seconds 72 0 C for 30 seconds) x 45 cycles, followed by a final extension at 72°C for 10 minutes in a standard thermal cycler (GeneAmp® PCR System 9700, Applied Biosystems Inc.). Controls were incorporated into each MSP assay for both methylated and unmethylated reactions, including:
  • PCR products were subjected to gel electrophoresis through a 2.5% agarose gel and were visualized by ethidium bromide staining and UV transillumination. All sodium bisulfite treatments and MSP assays were repeated to obtain a minimum of two replicates to validate the results.
  • the portion of CpG-128 amplified is a 192 base pair sequence of the 5' aspect of EVL spanning nucleotide coordinates 99507481 to 99507673 of chromosome 14, + strand.
  • methylation detection methods include the commercially available platforms from Illumina, including “GoldenGate(R) Methylation” and “VeraCode(R) Methylation” platforms. Illumina is developing these platforms for clinical use. Both of these platforms rely on bisulfite-conversion cytosine, with differing methods of detection (see: http://www.illumina.com/downloads/DNAMetliylationAnalvsis DataSheet.pdf).
  • the VeraCode platform is a variation that incorporates beads for the detection step using beads that are holographically "bar-coded” (so many "assays" can be performed in the same "tube”.
  • a high-throughput MALDI-TOF MS platform may be used for methylation analysis (http://www. well.ox.ac.uk/genomi cs/Research/Research DNA methylation analysis.shtml http://www.well.ox.ac.uk/genomics/Facilities/Facilities EpiTYPER.shtml; http://www.sequenom. com/Genetic-Anal vsis/Applications/EpiTYPER-DNA-Methylation- Analysis/EpiTYPER-Qverview.aspx
  • BS-F S'-GTTTTTTTTAAAGTTTYGTTTTTTAG-S ' (SEQ ID N0:6) and
  • BS-R 5 p -AACTAATCTCAACACAACAACC-3 1 (SEQ ID N0:7).
  • thermocycler conditions were as follows: 95°C for 15 minutes, (92°C for 30 seconds, 54 0 C for 45 seconds, 72 0 C for 30 seconds) x 45 cycles, and 72 0 C for 10 minutes.
  • the PCR products were cloned using the One Shot® TOPlO kit (Invitrogen) and individual clones were sequenced using Sanger sequencing ⁇
  • CpG-128 amplified is a 253 base pair sequence of the 5 1 aspect of EVL spanning nucleotide coordinates 99507450 to 99507703 of chromosome 14, + strand.
  • the DNA of interest is extracted and treated with bisulphite to convert unmethylated cytosines into uracils. After PCR amplification by which all uracils result in thymidine, the sample is denatured to form single-stranded DNA (ssDNA). Following hybridisation of a sequencing primer to the ssDNA, the complementary strand is synthesised in the presence of adenosine-5'-phosphosulphate (APS), luciferin and the enzymes DNA polymerase, ATP sulfurylase, luciferase and apyrase.
  • APS adenosine-5'-phosphosulphate
  • luciferin enzymes DNA polymerase
  • ATP adenosine-5'-phosphosulphate
  • the pyrosequencing process is initiated by addition of one of the four d ⁇ oxynucleotide triphosphates (dNTPs). If it is complementary to the first unpaired base in the template strand, DNA polymerase catalyses its incoiporation into the DNA strand, releasing pyrophosphate (PPi) in a quantity equmio ⁇ ar to the amount of incorporated nucleotide.
  • dNTPs d ⁇ oxynucleotide triphosphates
  • ATP sulfurylase quantitatively converts the released PPi to ATP, which drives the luciferase-catalysed conversion of luciferin to oxyluciferin.
  • a visible light signal proportional to the amount of ATP is generated aad can be detected by a camera. The resulting peaks, corresponding to the numbers of nucleotides incorporated.
  • Apyrase a nucleotide-degrading enzyme, continuously degrades ATP and unincorporated dNTPs, "switching off the light and regenerating the reaction solution.
  • the reaction steps 2 and 3 can restart with the next dNTP.
  • dNTPs are added one at a time.
  • deoxyadenosine-aJpha-thio- tripliosphate dATPaS
  • dATPaS deoxyadenosine-aJpha-thio- tripliosphate
  • dATP deoxyadenosine triphosphate
  • miR-342 is encoded in an intron of the EVL gene and is commonly silenced in colorectal cancer.
  • the intronic microRNA, miR-342 was found to be under- expressed in colorectal cancer in a global screen for microRNA dysregulation based on deep sequencing of microRNA 1161036vl - 28 - populations from colorectal cancer and matched normal colorectal epithelial tissues (et al Cummins, et al. (2006). Proc Natl Acad Sd USA 103:3687-92).
  • miR-342 captured our attention because of the presence of a dense CpG island in the 5' aspect of its host gene, EVL .
  • the miR- 342 gene is embedded on the sense strand, in the center of a 25.9 kb intron located between the third and fourth exons of the EVL gene on chromosome 14.
  • a dense CpG island, CpG-128, is located just upstream of the transcriptional start site (TSS) of EVL.
  • RNA used for expression analysis was extracted from fresh frozen tissue samples from 19 cases of colorectal cancer and matched normal tissue obtained from the same resection specimens.
  • RNAs were measured across a panel of 28 cancer cell lines.
  • Expression of EVL and miR-342 was measured by TaqMan qRT-PCR in 28 human cancer cell lines and expressed as delta cycle threshold ( ⁇ Ct) values obtained by normalization using RNU24 (a small nucleolar RNA) as an endogenous (normal) control.
  • ⁇ Ct delta cycle threshold
  • Most colorectal cancer cell lines had suppressed levels of EVL/hsa-miR-342 relative to other human cancer cell lines.
  • the one colorectal cancer cell line that had levels of miR-342 similar to that of non- colorectal cancer cell lines (VACO400) was subsequently found to be unmethylated at the EVL/ miR-342 promoter region.
  • RNAs i.e., microRNAs and snoRNAs
  • Pearson's coefficient of correlation was calculated between miR- 342 expression values and EVL expression values across the 28 cell lines. Computation of the correlation coefficient and assignment of a p-value for the correlation was performed using standard statistical methods (Motulsky (1995) Intuitive Biostatistics Oxford U. Press: NY).
  • Repression of miR-342 and EVL is associated with aberrant meihylation of the EVL/miR-342 promoter
  • MSP methylation-specific PCR
  • colorectal cancer cell lines Six of the seven colorectal cancer cell lines were found to carry methylated EVL, and two of the three colorectal adenoma cell lines (RG/C2 and VACO235) were found to have methylated EVL.
  • the single colorectal cancer cell line (VACO400) that was unmethylated was also the one that did not show suppression of EVL and miR-342 expression.
  • colorectal cancer lines showing methylation at the EVL CpG island with the exception of AA/C1/SB10 and VACO703, there were no unmethylated alleles detected.
  • Bisulfite sequencing of EVL in VACO411 and AA/C1/SB10 confirmed dense methylation in the EVL/miR-342 promoter in VACO411 and a mixture of methylated and unmethylated clones in AA/C1/SB10.
  • the PBL sample contains DNA from peripheral blood leukocytes (PBL) and was used as a control for unmethylated EVL/hsa-miR-342.
  • the VACO411 and AA/Cl/SBIO samples are DNA from those respective cell lines.
  • DNA methylation at the EVL/hsa-miR-342 locus is infrequent in non-colorectal cancer cell lines
  • EVL/miR-342 is frequently methylated in colorectal adenocarcinomas and colorectal adenomas
  • miR-342 reconstitution induces apoptosis in colorectal cancer cells
  • miR-342 silencing is associated with development of colorectal cancer, then this microRNA likely functions as a tumor suppressor in colon cells.
  • the biological consequence of methylation of the EVL/ miR-342 locus was examined by transfecting a synthetic miR-342 mimic into the colorectal cancer cell lines, which possess a densely methylated EVL/hsa-miR-342 locus. The effects on cell proliferation and cellular apoptosis were evaluated.
  • Colorectal adenoma cell lines AAICl, RG/C2, and VACO235 were cultured as previously described (Markowitz, et al. (1994) J CHn Invest 93:1005-13; Williams, et al. (1990) Cancer Res 50:4724-30). Colorectal cancer cell lines HT-29, SW48, and RKO were cultured as recommended by the ATCC.
  • AA/Cl/SBIO was cultured in DMEM (G ⁇ bco-BRL) supplemented with 20% FBS, 0.2 units/mL insulin (Sigma-Aldrich Co.), 1 ⁇ g/ml hydrocortisone, 100 units/ml penicillin and 100 ⁇ g/ml streptomycin.
  • VACO411 was maintained in MEM (Gibco-BRL) supplemented with 2% FBS, 1% MEM non-essential amino acids (Mediatech Inc., Herndon, VA, USA), 1% insulin-transferrin selenium- X (Invitrogen), 1 ⁇ g/ml hydrocortisone (Sigma- Aldrich Co.), 100 units/ml penicillin and 100 ⁇ g/ml streptomycin (Gibco-BRL).
  • VACO400 and VACO703 were cultured in DMEM (Gibco-BRL) supplemented with 10% FBS.
  • miRIDIAN microRNA mimic corresponding to human miR-342 (item #C-300186-01; Dharmacon Research, Lafayette, CO, USA) and microRNA mimic negative controls #1 (item #CN-001000-01) and #2 (item #CN-002000-01), designed after C elegans microRNAs cel-miR- 67 and cel-miR-239b, respectively, were transfected at 500 nM final concentration.
  • HT-29 cells were cultured in 96-well plates (Costar, Corning, NY) at 5,000 cells/well for 48 hours pre- transfection under standard conditions (37°C with 5% CO2). Each transfection used 0.4 ⁇ l Oha ⁇ maFECTW transfection reagent (Dharmacon Research) in 100 ⁇ l total reaction volume, following the manufacturer's protocol.
  • the Cell Proliferation ELISA BrdU Assay (Roche Diagnostics Corp., Indianapolis, IN, USA) was used following the manufacturer's protocol to measure cellular proliferation in HT-29 cells 72 hours post-transfection with hs ⁇ -miR-342 mimic or microRNA mimic negative control #2 (designed after cel-miR-239b). Assays were carried out in black-walled, optical-bottom 96- well plates (item #604285; NalgeNunc International, Rochester, NY, USA). Briefly, cells were pulse labeled for two hours with 10 ⁇ M BrdU, then fixed for 30 minutes at room temperature, followed by a 90-minute incubation with 100 ⁇ L anti-BrdU peroxidase-labeled antibody. Light
  • 1161036vl - 34 - emission was assessed using a microplate luminometer (Veritas, Turner BioSystems, Sunnyvale, CA, USA).
  • apoptosis was quantified using a Cell Death Detection ELISA Kit (Roche Diagnostics Corp.) following the manufacturer's protocol. This immunoassay quantitatively detects histone-associated DNA fragments in mono- and oligonucleosomes that are released during apoptosis.
  • Results of the cell proliferation assay reflect data from three biological replicates. No statistically significant difference was seen between groups using Student's t-test and a p-value threshold of p ⁇ 0.05. As stated above, the data showed no effect o ⁇ miR-342 reconstitution on cell proliferation.
  • Apoptosis was measured by an assay based on cytoplasmic histone-associated DNA fragments (Cytodeath ELISA, Roche) 72 hours after transfection with microRNA. Results of testing six biological replicates showed a significant difference between the negative control microRNA, mock-transfected cells and miR-342 transfected cells (p ⁇ 0.001; Student's t-test).
  • miR-342 reconstitution resulted in a marked increase in apoptosis.
  • Transfection of negative control microRNA mimics had no effect.
  • Apoptosis was also detected using a terminal deoxynucleotidyl transferase biotindUTP Nick End Labeling (TUNEL) assay in 96- well black-walled, optical-bottom plates (item #604285; Nalge Nunc International), performed in duplicate on HT-29 cells 48 hours post- transfection, with hsa-miR-342 mimic or microRNA mimic negative controls.
  • TUNEL terminal deoxynucleotidyl transferase biotindUTP Nick End Labeling
  • apoptotic HT-29 cells were generated by treating for 12 hours with 5 ⁇ g/mL TNF- ⁇ ( Sigma- Aldrich Co.) and 10 ng/mL cycloheximide (Sigma- Aldrich Co.).
  • 1161036vl - 35 - Confocal sections were acquired on a Zeiss LSM 510 META NLO confocal and twophoton microscope, fitted with a Zeiss PlanApochromat 20x/0.75 objective, and zoom factor of 1.
  • the acquisition software was Zeiss LSM confocal software. Data was acquired at 8-bit per channel. Pixel dimensions were 0.45 micron in x and y. Pinhole was set at 1.8 Airy units, resulting in 3.3 micron optical slices for the red tetramethylrhodamine (TMR) channnel.
  • TMR red tetramethylrhodamine
  • TMR was excited with a 543 nm HeNe laser; Hoechst was excited in two photon mode with a Coherent Chameleon Ti:Sa laser tuned at 780 nm. Kalman averaging was used to reduce image noise during acquisition, with typically 2-4 images averaged in line mode. In some cases, a median filter (2 pixel neighborhood) was applied after acquisition to further reduce noise. LSM data files were converted to TIFF (8-bit per channel) and pseudocolored with Zeiss LSM software.
  • Results showed microRNA mimic negative control transfected cells and were distinguished from cells treated with hsa-miR-342 mimic and from positive controls, i.e., cells were treated with TNF- ⁇ and cycloheximide for 12 hours before TUNEL and Hoechst staining. These results were consistent with those obtained from apoptosis measured from cytoplasmic histone-associated DNA fragments, showing that reconstituting miR-342 expression results in apoptosis in colorectal cancer cells.
  • the colorectal cancer cell line VACO411 was treated with a regimen of 5- aza-2'-deoxycytidine (5-aza-2-dC) and Trichostatin A (TSA) followed by measurement of EVL and miR-342 expression by TaqMan-based qRT-PCR.
  • 5- aza-2'-deoxycytidine 5-aza-2-dC
  • TSA Trichostatin A
  • VACO411 colonal cancer cells were grown for 48 hours before treatment with the demethylation agent 5-aza-2'-deoxycytidine (5-aza-2-dC) (Sigma-Aldrich Co.) dissolved in DMSO. The cells were treated with 5-aza-2-dC (200 nM final concentration) for 48 hours and then Tricho statin- A (TSA, Sigma-Aldrich Co.) was added to the media at 300 nM final concentration. The cells were then incubated for an additional 24 hours before harvesting. DNA was extracted and analyzed by bisulfite treatment followed by MSP using the EVL/miR-342
  • the EVL/miR-342 MSP assay was performed using primers that specifically amplify methylated (M) or unmethylated (U) alleles after mock treatment with 5-aza-2-dC and Trichostatin A.
  • the results show that treatment of VACO411 colorectal cancer cells with 5-aza- 2-dC (200 nM) in combination with Trichostatin A (TSA; 300 nM) caused a decrease in the amount of methyl ation of E VL/miR-342.
  • EVL CpG island Reduction of methylation in the EVL CpG island induces expression of both EVL and miR-342 in the VACO411 cell line (values reflect the average of three biological replicates, ⁇ standard error of the mean).
  • pl6/CDKN2A used here as a positive control gene known to be methylated in colorectal cancer, was also induced (value reflects the average of two biological replicates, ⁇ standard error of the mean).
  • EVL, miR-342 and pl6/CDKN2A RNA levels were measured using TaqMan-based qRT-PCR assays.
  • Intersection of miR-S 42 predicted target lists generated by miRanda, TargetScan and PicTar algorithms.
  • Oncomine cancer profiling research database www.Oncomine.org
  • These identified targets represent potential targets for further diagnostic and therapeutic agents for colorectal cancer.
  • 1161036vl - 38 - miR-342 predicted targets that are over-expressed in colorectal cancer based on Oncomine database analysis.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Hospice & Palliative Care (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Novel tools and methods for the detection and treatment of colorectal cancer are provided. Expression of miR-342 and/or EVL are reduced or absent in colorectal cancer, due to methylation-induced silencing. Detection of specific methylation of the EVL gene is provided as a method for detecting the presence or risk of colorectal cancer. Therapeutic administration of miR-342 and/or EVL and/or administration of demethylation agents to restore activity of miR- 342 and EVL are provided as methods for treating or preventing colorectal cancer.

Description

EPIGENETIC SILENCING OF MIR-342 IN COLORECTAL CANCER
TECHNICAL FIELD
BACKGROUND
Ranked as the third most commonly diagnosed cancer and the second leading cause of cancer deaths in the United States (American Cancer Society, "Cancer facts and figures," Washington, D.C.: ACS (2000)), colon cancer is a deadly disease afflicting nearly 130,000 new patients yearly in the United States. Colon cancer is the only cancer that occurs with approximately equal frequency in men and women. There are several potential risk factors for the development of colon and/or rectal cancer. Known factors for the disease include older age, excessive alcohol consumption, sedentary lifestyle (Reddy, Cancer Res., 41 :3700-05 (1981)), and genetic predisposition (Potter, Natl Cancer Institute, 91:916-32 (1999)).
Several molecular pathways have been linked to the development of colon cancer (see, for example, Leeman, et al. (2003) J Pathol., 201 :528-34; Kanazawa, et al. (2003) Tumori., 89:408-11; and Notarnicola, et al. (2003) Oncol Rep., 10:1987-91), and the expression of key genes in any of these pathways may be affected by inherited or acquired mutation or by hypermethylation. A great deal of research has been performed with regard to identifying genes for which changes in expression may provide an early indicator of colon cancer or a predisposition for the development of colon cancer. Unfortunately, no research has yet been conducted on identifying specific genes associated with colorectal cancer and specific outcomes to provide an accurate prediction of prognosis.
A growing body of literature indicates that microRNAs are dysregulated in human malignancies and it has been proposed that some microRNAs may have oncogenic or tumor suppressor functions (Zhang, et al. (2007) Dev Biol 302:1-12). Both overexpression and silencing of specific microRNAs have been described in a number of cancer types, including colorectal cancer (Bandres, et al (2006) MoI Cancer 5:29; Cummins, et al.( 2006) ProcNatl Acad Sci USA 103:3687-92; Volinia, et al. (2006) Proc Natl Acad Sd USA 103:2257-61; Wijnhoven, et al. (2007) Br J Surg 94:23-30). MicroRNAs are small (typically 22 nucleotides in length) RNAs that influence gene expression networks by repressing target messenger RNAs (mRNAs) via specific base-pairing interactions (B artel, (2004) Cell 116:281-97; He, et al. (2004)
1161036vl - 1 - Nat Rev Genet 5:522-31 ). A growing need exists for determining how microRNA dysregulation can provide a means to diagnose and treat cancer. Identification of specific diagnostic biomarkers and therapeutic targets is needed to provide new and useful tools for improving management of disease.
SUMMARY
The identification of an miR-342 and/or EVL gene as a biomarker for colorectal cancer provides a novel diagnostic tool for the identification of colorectal cancer or risk of colorectal cancer. Reduced expression of miR-342 and/or EVL versus a control, for example at least 20% reduction in expression, correlates with the presence or risk of colorectal cancer. Determination of the presence or absence and/or amount of methylation of nucleic acid sequence that comprises at least a portion of a GC rich region of an EVL gene, for example of CpG sites present in a CpG dense region (CpG island) positioned in a regulatory region of the gene such as a 5' or 3' regulatory region, is useful for the detection, classification, diagnosis, or prognosis of colorectal cancer in the individual.
In one embodiment, a diagnostic method comprises detecting the presence or absence and/or amount of methylation of a nucleic acid sequence in a sample obtained from an individual, the nucleic acid sequence comprising at least a portion of a GC rich region of an EVL gene. Increased methylation of the nucleic acid sequence is diagnostic of the presence of colorectal cancer or risk of developing colorectal cancer in the individual.
In one embodiment, the nucleic acid sequence analyzed for methylation contains at least a portion of a GC rich sequence located 5' of the EVL transcription initiation site. In one example, the nucleic acid sequence comprises at least a portion of a CpG island located at least partially in the EVL promoter region. In a specific embodiment, the nucleic acid sequence analyzed for methylation comprises at least a portion of a CpG island designated by the UCSC Genome Browser (http://genome.ucsc.edu) in the 5' aspect of EVL, for example, the CpG island 128. CpG-128, found in the 5' aspect of EVL, has the following coordinates on the + strand of the March 2006 UCSC assembly of the human genome: 99507135 to 99508616 and the sequence of SEQ ID NO:11.
In one embodiment, the nucleic acid sequence analyzed for methylation contains at least a portion of a GC rich sequence located 3' of the EVL transcription termination site. In one example, the nucleic acid sequence comprises at least a portion of a GC rich sequence located at least partially at the 31 end of the transcribed EVL sequence. In a specific embodiment, the
1161036vl - 2 - nucleic acid sequence analyzed for methylation contains at least a portion of a CpG island designated by the UCSC Genome Browser in the 31 aspect of EVL, for example, CpG islands 21, 41, 133, 30, 57, 77, and 256. CpG-21, found in the 3' aspect of EVL, has the following coordinates on the + strand of the March 2006 UCSC assembly of the human genome: 99680160 to 99680444 and the sequence of SEQ ID NO: 12. Coordinates and sequences of additional EVL CpG islands can be readily obtained from genomic databases, for example, the UCSC Genome Browser.
Methylation can be detected and/or quantified by one of many known methods and systems. For example, methylation of a nucleic acid sequence can be determined by modifying the sequence, for example, by treating the sequence with bisulfite to alter nonmethylated cytosine (C) to thymine (T), and comparing the modified sequence to the unmodified sequence. The comparison can include one or more of sequencing, single nucleotide primer extension, digestion with methylation-sensitive restriction enzymes, Southern blotting, methylation-specific PCR, methylation-specific immunoprecipitation or immunoassay, and the like.
In one embodiment, detecting methylation of a nucleic acid sequence comprises the steps of modifying the nucleic acid sequence with bisulfite to convert unmethylated C to T3 amplification of the nucleic acid sequence with specific primers designed to amplify methylated alleles of the nucleic acid sequence, and optionally sequencing of the amplified sequence to detect modifications.
Amplification of a nucleic acid sequence can utilize one or more primer pair that is specifically designed to amplify methylated alleles and/or one or more primer pair specifically designed to amplify unmethylated alleles of EVL including all or a portion of a GC rich region 51 of the EVL transcription start site and/or 31 of the transcription termination site. In one embodiment, the primer pair amplifies a sequence of EVL comprising at least a portion of CpG 128, SEQ ID NO:11. In another embodiment, the primer pair amplifies at least a portion of CpG 21, SEQ ID NO: 12.
In an alternative embodiment, colorectal cancer or risk of colorectal cancer in an individual can be detected by analyzing expression of one or more oϊmiR-342 and EVL. Reduced expression of mlR-342 and/or EVL versus a control indicates presence of colorectal cancer or risk of colorectal cancer. For example, expression reduced by at least 20% to 100% compared with a non-cancer control indicates the presence or risk of colorectal cancer. Expression of miR-342 or EVL can be determined by known methods, for example, by quantitative reverse-transcription PCR.
1161036vl - 3 - Diagnostic kits and methods for detecting colorectal cancer and/or risk of colorectal cancer are provided. In one embodiment, the diagnostic kit contains one or more agent designed to detect reduced expression ofmiR-342 and/or EVL. The kit may contain primers designed to amplify and/or analyze expression of miR-342 and EVL. In one embodiment, the diagnostic kit contains one or more agent designed to detect the presence and/or amount of methylation in the at least a portion of the EVL gene. The kit may contain, for example, primers designed to amplify and/or detect methylation of the EVL gene, particularly methylation of a GC-rich region of the EVL gene. In one embodiment, the kit contains specific primers to amplify at least a portion of a GC-rich region positioned 5' in the EVL promoter region, for example at least a portion of CpG 128 (SEQ ID NO: 11) positioned in the 5' aspect of EVL. In one embodiment, the kit contains specific primers to amplify at least a portion of a GC-rich region positioned 3' in an EVL regulatory region, for example at least a portion of CpG 21 (SEQ ID NO: 12) positioned in the 31 aspect of EVL.
In one example, the diagnostic kit includes one or more primers designed to amplify methylated or unmethylated GC rich sequences in the 5' promoter region of EVL. In a particular embodiment, the kit includes one or more first primer pair designed to specifically amplify methylated DNA of EVL or a portion thereof, for example, one or more first forward primer:
MF-51- TATTTTCGTTCGTTTCGTTTTTC - 3'(SEQ ID NO:1), or
MB-S1 GTTTTTTTTAAAGTTTYGTTTTTTAG-3' (SEQ ID NO:6); and one or more first reverse primer:
MR-51- AAATACGCGCGTTACTATTCG - 3'(SEQ ID NO: 2), or
MR-5'-AACTAATCTCAACACAACAACC-3' (SEQ ID NO:7).
The kit may comprise at least one second primer pair designed to specifically amplify unmethylated DNA of an EVL gene or portion thereof, for example:
UF-51- TATTTTTGTTTGTTTTGTTTTTTGT - 3' (SEQ ID NO: 3), or
UR-5r-TAAAATACACACATTACTATTCACC -31 (SEQ ID NO: 4).
The diagnostic kit may comprise one or more of a bisulfite reagent, a methylation- specific antibody, a methylation-specific restriction enzyme, and one or more sequencing reagent useful to detect methylation of a GC rich region of EVL.
As described and exemplified below, miR-342 is a specific suppressor of colorectal cancer cell growth. Administration of miR-342 to colorectal cancer cells results in apoptosis. Specific methods for promoting apoptosis of colorectal cancer and/or suppressing growth of
1161036vl - 4 - colorectal cancer cells are provided by administering to colorectal cancer cells miR-342 or EVL protein.
A method for treating or preventing colorectal cancer is provided that includes administering miR-342 or a mimic thereof to induce apoptosis of colorectal cancer cells; administering EVL protein or a portion thereof to induce apoptosis of said cancer cells; or both. In one embodiment, treating or preventing colorectal cancer includes administering one or more demethylation agent such as 5-aza-cytidine and the like to reduce and/or remove methylation from at least a portion of the EVL gene, including from GC-rich regions in the 5' and 3' aspects of the gene. miR-342 or mimic thereof, EVL protein or a portion thereof, or one or more demethylation agent may be administered alone or in various combinations, hi addition, one or more cytotoxic and/or cytostatic chemotherapeutic agents or other anti-cancer therapy can be administered in combination with miR-342 or mimic thereof, EVL protein or a portion thereof, one or more demethylation agent, or combination of these.
BRIEF DESCRIPTION OF THE SEQUENCES
1161036vl - 5 -
Figure imgf000007_0001
*Human Genomic Sequence positions are shown as provided in the UCSC Genome Browser.
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS Identification of microRNA silencing in colorectal cancer
As a first step toward understanding dysregulation of the microRNA regulatory network in cancer, we describe herein the identification and assessment of microRNAs that undergo silencing in colorectal cancer, and these represent candidate tumor suppressors. We hypothesized that one mode of transcriptional silencing of microRNAs may be epigenetic mechanisms related to the aberrant DNA methyl ation of 5' regulatory regions, as has been observed for many 'conventional1 tumor suppressor genes (Kim, et al. (2006) Genes Chromosomes Cancer 45:781- 89; Kondo, et al (2004) Cancer Metastasis Rev 23:29-39; Toyota, et al (1999) Cancer Res 59:2307-12). Examples of DNA methylation-based regulation of microRNA genes via proximal CpG islands have recently been described (Brueckner, et al. (2007) Cancer Res 67:1419-23; Lujambio, et al. (2007) Cancer Res 67): 1424-29; Saito, et al. (2006) Cell Cycle 5:2220-22.
Many microRNAs, however, are encoded in introns of protein-encoding genes (and subsequently excised from a primary transcript in common with the host gene) (Rodriguez, et al (2004). Genome Res 14:1902-10; Kim, etal. (2001).EMBO J 26:775-83; Saini, et al. (2007) Proc Natl Acad Sci U S A 104 : 17719-24). It is possible that they are susceptible to transcriptional repression via aberrant methylation of a CpG island located in the host gene 5' promoter region. We looked for examples of transcriptional regulation of microRNA gene expression might be achieved by epigenetic alterations of host gene regulatory elements, which could be located far from the microRNA locus itself. The results shown in the Examples, below, show that the intronic microRNA miR-342 is silenced in the majority of colorectal cancers by methylation of a CpG island in the 5' aspect of its host gene, Ena/Vasp-like (EVL). The results further show that reconstitution of miR-342 activity induces apoptosis in colorectal cancer cells, suggesting a possible tumor suppressor role for this microRNA in colorectal cancer.
MicroRNAs are small, noncoding RNAs that influence gene regulatory networks by post- transcriptional regulation of specific messenger RNA targets. MicroRNA expression is dysregulated in human malignancies, frequently leading to loss of expression of certain
1161036vl - 6 - microRNAs. We have discovered that expression of human miR-342, which encodes a microRNA, and which is located in an intron of the gene EVL, is commonly suppressed in human colorectal cancer. As shown in the Examples below, miR-342 expression is coordinated with that of EVL. The results discussed below indicate the mechanism of silencing is CpG island methylation upstream of EVL. Methylation of GC rich sequences in the 5' promoter region of EVL/miR-342 was found in 86% of colorectal adenocarcinomas and in 67% of colorectal adenomas, indicating that this specific methylation is an early event in colorectal carcinogenesis. In addition, a higher frequency of methylation (56%) was observed in histologically normal colorectal mucosa from individuals with concurrent colorectal cancer compared to mucosa from individuals without colorectal cancer ("cancer free controls") (12%), suggesting the existence of a 'field defect' involving methylated EVL/miR-342. Furthermore, reconstitution of miR-342 in the colorectal cancer cell line HT-29 induced apoptosis, suggesting this microRNA is a pro- apoptotic tumor suppressor. In aggregate, these results support a novel mechanism for silencing intronic microRNAs in cancer via epigenetic alterations of cognate host genes.
Silencing of miR-342 is confirmed herein to be a common event in colorectal cancer. Evidence is provided for coordinate epigenetic silencing of an intronic microRNA and its host gene in human cancer. Given that roughly half of microRNA genes are located in introns (Rodriguez (2004) ob cit.; Kim (2007) ob cit; Saini (2007) ob cit.) this mode of coordinate silencing may represent a more general mechanism of microRNA suppression in human cancer.
The data shown below also suggest that methylation of EVL/miR-342 is an early event in colorectal carcinogenesis, given that it is detectable in 67% of adenomas, as well as in 56% of histologically normal colorectal mucosal specimens from patients with concurrent colorectal cancer. Based on these observations, the methylated DNA corresponding to EVL/miR-342 is useful as a biomarker for non-invasive disease detection or risk prediction for colorectal cancer, especially in light of its apparent specificity for colorectal cancer.
With respect to carcinogenesis, the data suggest a model in which aberrant methylation of EVL/miR-342 precedes histologically apparent neoplastic alterations in the colon and leads to an early expansion of precancerous progenitor cells carrying methylated CpG islands at EVL/miR- 342. The presence of methylation of EVL/miR-342 in normal appearing colorectal mucosa may reflect an acquired, early epigenetic change in the pathogenesis of colorectal cancer. Alternatively, it could also be the consequence of clonal expansion of rare, normal colorectal epithelial cells that carry a methylated EVL/miR-342 as part of their normal physiological state (Ohm, et al. (2007) Cell Cycle 6:1040-43; Widschwendter, et al. (2007) Nat Genet 39:157-58).
1161036vl - 7 - Given that EVL and miR-342 are coordinately silenced in cancer cells, EVL, miR-342, or both are potential biomarkers for colorectal carcinogenesis. EVL is a member of the Ena/VASP protein family, actin-associated proteins involved in a variety of processes related to cytoskeleton remodeling and cell polarity such as axon guidance and lamellipodial and filopodial dynamics in migrating cells (Krause, et al. (2003) Annu Rev CellDev Biol 19:541-64). EVL may function as a tumor suppressor through effects on cell shape or motility.
The Examples provide results showing that miR-342 can induce apoptosis in colorectal cancer cells. Reconstituting miR-342 activity in the HT-29 colorectal cancer cell line causes apoptosis. This causal relation provides a plausible basis for why silencing of this microRNA would promote the formation of colorectal cancer. These pro-apoptotic effects are consistent with miR-342 microRNA as a tumor suppressor in colorectal cancer.
As shown in the Examples below, survey of EVL/miR-342 methylation in a large cancer cell line panel indicates that methylation at this locus is largely restricted to colorectal cancer. The results show that miR-342 is widely expressed in diverse, non-colorectal cancer cell types without apparent deleterious effects. This supports the conclusion that expression of miR-342 has a synthetic lethal genetic interaction with other alteration(s) associated with colorectal carcinogenesis. Although the mRNA targets of miR-342 are not known, the identification and validation of such targets would be useful for determining the potential value of delivery of miR- 342 to colorectal cancers as a cancer-specific therapeutic strategy.
miR-342
The microRNA miR-342 is encoded in an intron of the gene EVL, between exons 3 and 4. Human miR-342 has the sequence: 5'-UCUCAC ACAGAA AUCGC ACCCGUC-3' (SEQ ID NO:9) or S'-UCUCACACAGAAAUCGCACCCGU -3' (SEQ ID NO:10). The structure of miR- 342 is provided in the Sanger MicroRNA Registry. Its symbol is HGNC:MIRN342, and its coordinates are: 14; 99645745-99645843 [+]. All microRNAs are encoded by genes that are transcribed from DNA but not are not translated into protein); instead they are processed from primary transcripts known as pri-miRNA to short stem-loop structures called pre-miRNA and finally to functional rm'RNA. The pri-miRNA sequence is
GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGACAUGGUUAAUG GAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUA (SEQ ID NO: 19) The pri-miRNA is processed in the nucleus by the proteins Drosha and Pasha to the pre- miRNA that has a stem and loop structure with flanking sequences. The pre-miRNA will generally have about 60 bases to 70 bases. The pre-miRNA is then actively transported into the
1161036vl - 8 - cytoplasm by exporting 5 and Ran-GTP. In the cytoplasm, the pre-miRNA is then further processed into small RNA duplexes of approximately 22 nucleotides by the proteins Dicer and Loquacious. The functional or guiding strand of the miRNA duplex is then loaded into the RNA- induced silencing complex (RISC). Finally, the miRNA guiding strand guides the RISC to the cognate messenger RNA (mRNA) target for translational repression or degradation of the mRNA. Mature miRNA molecules are partially complementary to one or more messenger RNA (mRNA) molecules, and one of their known functions is to downregulate gene expression.
Expression of intronic miR-342 is silenced in a majority of colorectal cancers by methylation of its host gene, EVL, for example at a CpG island positioned at least in part in the 5' aspect or 3' aspect of EVL. In particular, the Examples below show specific methylation of EVLi 'miR-342 DNA samples obtained from colorectal carcinoma cells and from colorectal adenoma cells versus samples from non-cancer control cells. These results show that 86% of colorectal tumors and 67% of colorectal adenomas carried methylated EVL/miR-342. In contrast, 12% of mucosal tissue from cancer free controls carried methylated EVL/miR-342. Notably, 56% of normal mucosal samples obtained from individuals with colorectal cancer carried the methylated gene.
miR-342 mimics miRNA mimics are synthetically produced molecules designed to mimic or inhibit the activities of a natural miRNA. Such mimics are commercially available for use by one of skill in the art. See, for example, www. dharmacon, com/microrna for a description of mimics that are double stranded RNA oligonucleotides, including a mimic for human miR-342 having the catalog number C-300186-01, and others as shown in the following table.
hsa-miR-342-3p/hsa-mir-342 tniRIDIAN Hairpin Inhibitor Mature: hsa-miR-342-3p Organism: Human - Homo sapiens
(MMATQ0Q0753)
Stem-loop: hsa-mir-342 Catalog Number: IH-300696-06
Figure imgf000010_0001
hsa-miR-342-3p/hsa-mir-342 miRIDIAN Mimic
Mature: hsa-miR-342-3p Organism: Human - Homo sapiens
(MIMAT00007531
Stem-loop: hsa-mir-342 Catalog Number: C-300696-05
(MI00008051
Iisa-miR-342-5p/hsa-mir-342 miRIDIAN Hairpin Inhibitor
1161036vl - 9 - Mature: hsa-miR-342-5p Organism: Human - Homo sapiens
(MIMAT000469Φ Stem-loop: hsa-mir-342 Catalog Number: IH-301083-02
(MI0000805) hsa-miR-342-5p/hsa-mir-342 miRIDIAN Mimic
Mature: hsa-miR-342-5p Organism: Human - Homo sapiens
(MIMAT0004694) Stem-loop: hsa-mir-342 Catalog Number: C-301083-01 fMI0000805)
EVL
The EVL gene encodes Enabled/Vasodilator-Stimulated Phosphoprotein-Like protein (EVL), also (Ena/VASP-like). EVL proteins are actin-associated proteins involved in a range of processes dependent on cyto skeleton remodeling and cell polarity such as axon guidance and lamellipodial and filopodial dynamics in migrating cells. EVL enhances actin nucleation and polymerization.
As used herein the term "EVL gene" is intended to include coding and non-coding sequences, and to particularly include 5' and 3' aspects of the gene extending about 100,000 base pairs 51 from the EVL transcription initiation site, including a 5' promoter region. The 3' aspect of the EVL gene extends about 100,000 base pairs 31 from the EVL termination sequence. These 5' and 3' aspects of the gene include multiple GC-rich regions, such as CpG islands identified, for example, in the UCSC genome browser, including CpG-128, CpG-21, CpG 41, CpG-133, CpG- 30, CpG-57, CpG-77 and CpG-256.
The genomic DNA sequence of EVL/miR-342 is positioned in Chromosome 14. As shown in the UCSC Genome Browser, human EVL spans coordinate positions chrl4:99601504 to 99680326 (SEQ ID NO: 8), with 5' and 3' aspects of the gene extending the EVL sequence about 100,000 base pairs in each direction. CpG islands are found in these 5' and 3' aspects of the gene.
GC-Rich and CpG-Dense
As used herein, a "GC-rich" sequence is one that contains a higher count of G and C nucleotides than the average content of the human genome, for example, greater than about 45% G + C content, and preferably at least 50% G + C. A CpG-dense region is a selected sequence having a greater frequency of CpG dinucleotides than expected, for example, greater than 10%, and preferably greater than 20% of the sequence.
1161036vl - 10 - The CpG dinucleotides are rare in the human genome, and occur with much less frequency than would occur randomly. In general, the expected frequency of this dinucleotide pair is only about 0.01 (1%). The low frequency of CpG dinucleotides is thought to be due to a higher susceptibility to C-methylation transition mutations.
CpG islands
A definition of CpG islands was proposed by Gardiner-Garden, et al (1987). JMoI. Biol. 196:201-82. This publication classified CpG-rich regions as "stretches of DNA where both the moving average of % G + C was greater than 50%, and the moving average of Obs/Exp CpG was greater than 0.8. The observed/ expected CpG ratio was calculated as equal to the number of CpG sites divided by the (number of C nucleotides plus the number of G nucleotides) times the total number of nucleotides in the sequence being analyzed. The UCSC Genome Browser uses slightly different criteria to define a CpG island. According to the UCSC, a CpG island sequence has a length of at least 200 base pairs, a % G + C content of at least 50% and an Observed/Expected CpG ratio of at least 0.6.
The Cs of most CpG dinucleotides in the human genome are methylated. CpG dinucleotides occur about five times less frequently than expected ( Bird (1980) Nucleic Acids Res 8:1499-1594; Jones, et al. (1992) BioEssays 14, 33-36). CpG islands are unmethylated regions of the genome that are associated with the 5' ends of most house-keeping genes and many regulated genes ( Bird (1986) Nature 321:209-13; Larsen, et al. (1992) Genomics 13:1095-1107). The absence of methylation slows CpG decay, and so CpG islands can be detected in a DNA sequence as regions where CpG pairs occur at close to the expected frequency. CpG islands can overlap the promoter and extend into the transcription unit. CpG islands tend to be unique sequences.
CpG islands associated with the EVL gene, for example, those identified in the UCSC Genome browser, are found in both the 5' and 31 aspects of the gene. As used herein, we define the term "EVL gene" to include 5' and 31 aspects of the gene, for example, extending about 100,000 base pair 5' of the transcription initiation site and about 100,000 base pair 3' of the transcription termination site. The EVL gene extending from human genome positions chrl4: 99601504 and 3' CpG extending to chrl4:99680326, associated with CpG islands that impact expression and activity of EVL and miR-342. These examples of CpG islands are summarized in the table, below.
1161036vl - 11 -
Figure imgf000013_0001
*CpG Ratio = Obs/Exp CpG = Number of CpG * N / (Number of C * Number of G)
Colorectal Cancer
Survival of patients with colon and/or rectal cancer depends to a large extent on the stage of the disease at diagnosis. Devised nearly seventy years ago (Dukes (1932) J Pathol Bacteriol 35:323), the modified Dukes' staging system for colon cancer, discriminates four stages (A, B, C, and D), primarily based on clinicopathologic features such as the presence or absence of lymph node or distant metastases. Specifically, colonic tumors are classified by four Dukes' stages: A, tumor within the intestinal mucosa; B, tumor into muscularis mucosa; C, metastasis to lymph nodes and D, metastasis to other tissues. Of the systems available, the Dukes' staging system, based on the pathological spread of disease through the bowel wall, to lymph nodes, and to distant organ sites such as the liver, has remained the most popular. Despite providing only a relative estimate for cure for any individual patient, the Dukes' staging system remains the standard for predicting colon cancer prognosis, and is the primary means for directing adjuvant therapy.
The Dukes' staging system, however, has only been found useful in predicting the behavior of a population of patients, rather than an individual. For this reason, any patient with a Dukes A, B, or C lesion would be predicted to be alive at 36 months while a patient staged as Dukes D would be predicted to be dead. Unfortunately, application of this staging system results in the potential over-treatment or under-treatment of a significant number of patients. Further, Dukes' staging can only be applied after complete surgical resection rather than after a pre- surgical biopsy.
Colorectal cancer is a disease that shows slow progression from polyps of the colon or benign adenomas to progressive carcinoma. The sequence of progression can take about 10 years. Diagnosis often occurs late in the progression, after the start of progressive cancer.
1161036vl - 12 - As used herein, the term "colorectal cancer" is intended to mean cancer of the colon and/or rectum. The term includes "colorectal adenocarcinoma." The term "colorectal adenoma" is intended to mean benign tumors of the colon and/or rectum. Colorectal adenomas may progress to form colorectal adenocarcinomas.
Diagnosis
Currently recommended screening for colorectal cancer includes annual diagnostic palpation methods, barium enema or flexible sigmoidoscopy about every 5 years, and total colonoscopy every 10 years. Such methods are geared to late stage diagnosis.
The diagnostic methods described herein provide a rapid and sensitive assay for detecting the presence of colorectal cancer in an individual, and also provide early detection of cancerous cells and determination of an individual's risk of developing colorectal cancer.
As described in the Examples below, a new biomarker for colorectal cancer has been determined. Reduced expression of miR-342 and its host gene EVL has now been correlated with colorectal cancer. Methylation-induced silencing of miR-342 and its host gene, EVL, is diagnostic of the presence or risk of colorectal cancer.
Methylation-induced silencing of miR-342 and EVL can be detected and quantified by determining in a sample obtained from an individual, the presence or absence of methylation and/or determining an increased amount of methylation in a GC rich region of the EVL gene, as compared with a control sample that may be obtained from a cancer free control, from normal colorectal mucosal tissue, or from a sample obtained from the individual at an earlier time period.
DNA from frozen primary tissue specimens were extracted using previously published protocols (Meltzer, et al. (1994) Cancer Res., 54:3379-82 and Sato, et al (2002) Cancer Res. 62:6820-2)). Briefly, cell line DNAs were purified with Proteinase K and extracted onto silica- gel membranes using DNeasy (Qiagen, Valencia, Calif.). Cell line RNA was isolated with phenol-chloroform and guanidine isothiocyanate according to the manufacturer's specifications (Trizol, Invitrogen, Carlsbad, Calif.) (See Chomczynski, et al. (1987) Anal Biochem. 162:156- 92).
MSP distinguishes methylated alleles of a given gene based on DNA sequence alterations after bisulfite treatment of DNA. Bisulfite treatment converts unmethylated but not methylated cytosines to uracils. Subsequent PCR using primers and probe specific to the corresponding methylated DNA sequence is then performed.. A normalized MSP value can be calculated by dividing the ratio of the qMSP value for each sample by the ratio of the qMSP value for
1161036vl - 13 - Universal Methylated DNA (See Sato, ob cit.; and Shibata, et al (2002) Cancer Res. 62:5637- 40). Qualitative MSP status was determined by analyzing the normalized MSP value.
In one embodiment, at least a portion of a GC rich sequence positioned in the 5' aspect of EVL, for example, 5 ' of the EVL transcription initiation site, is analyzed for methylation status. In another embodiment, at least a portion of a GC rich sequence positioned in the 3' aspect of EVL, for example at the end of the transcription sequence and/or extending 5' of the termination sequence. In some embodiments, at least a portion of the 5' CpG-128 is analyzed; in other embodiments, at least a portion of the 3' CpG-21 is analyzed.
A sensitive assay for the detection, classification, diagnosis, or prognosis of colorectal cancer is provided by analyzing methylation status of the EVL gene. The presence of methylation in a normally non-methylated region of the EVL gene, including 5 ' or 3' aspects of the gene and/or an increased amount of methylation in the sample versus a control sample, is indicative of colorectal cancer or risk thereof. The Examples below demonstrate that the methylation status of EVL provides a method for detection of colorectal cancer risk or of colorectal cancer in samples with no histological evidence of disease.
Colorectal cancer is diagnosed by measuring the level of EVL or miR-342 CpG methylation or expression of from a test population of cells, {i.e., a patient derived biological sample). Preferably, the test cell population contains an epithelial cell, e.g., a cell obtained from colon tissue. Gene methylation or expression is also measured from e.g., blood, urine, sputum, ascites, stool, gastric juice, or bile.
Levels of EVL or miR-342 CpG methylation or expression is determined in the test cell or biological sample and compared to the levels in a normal control. The normal control level is an amount typically found in a population known not to be suffering from colorectal cancer. An increase of the level of methylation or expression in the patient derived tissue sample of colorectal cancer indicates that the subject is suffering from or is at risk of developing colorectal cancer. The DNA used for measuring methylation can be cellular (cell-associated) or acellular (cell-free).
In general, the diagnostic method includes determining the presence or absence, and/or amount of methylation present in a GC-rich region of the EVL gene in a sample obtained from an individual. Methylation status can be determined using a variety of methods. One method includes distinguishing methylated from unmethylated DNA using methylation sensitive restriction enzyme digestion of DNA, followed by detection, for example, by Southern blot, PCR, methylated CpG island amplification (MCA), and the like.
1161036vl - 14 - Methylation sensitive restriction enzymes cleave DNA at specific methylated-cytosine residues. In one method, DNA is first digested by methylation-sensitive restriction enzymes followed by precipitation by methyl-binding domain polypeptides immobilized on a magnetic solid matrix and then by real time PCR. See, for example, Yegnasubramanian, et al., (2006). Nucleic Acids Research 34:el9.
Bisulfite (BiS) modification of a GC-rich region followed by comparison of the BS treated sample with a non- treated control can also be used to determine methylation status of the DNA sequence. Application of bisulfite converts non-methylated C to T, providing a difference in treated versus untreated samples that can be measured. Following bisulfite conversion of DNA, differences can be determined using a variety of known methods, for example, DNA sequencing, methylation-specific PCR (MSP), restriction analysis, and PCR followed by single- nucleotide primer extension (Ms-SNuPE).
Methylation specific PCR (MSP) is a highly sensitive method for detecting methylation. Methylation-specific primers can be designed to amplify either the methylated strand or unmethylated strand, and electrophoresis can be used to view the results. See, for example, the methylation specific primers and unmethylated specific primers described in the Examples below for the specific amplification of methylated or unmethylated GC rich regions of the EVL gene.
Additional methods for determining the presence or amount of methylation of a particular DNA sequence are known are known to those skilled in the art. See, for example, Shen, et al. (2007) Curr Opin Clin Nutr Metav Care 10:576-81. See also, www.protocol-online.org and www.mdanderson.org/departments/methylation for a discussion of various assays known to those skilled in the art, and incorporated by reference.
Determination of Methylation Status provides Indication of Disease
The data presented in the Examples below demonstrate a direct correlation between detection of the presence and/or amount of methylation in a GC rich region the EVL gene with the detection, classification, diagnosis, or prognosis of colorectal cancer in an individual. Depending upon the sensitivity of the assay used, reported numerical data may vary.
The present invention provides methods for predicting the responsiveness of a subject to a therapeutic regimen. As used herein, "predicting" indicates that the methods described herein are designed to provide information to a health care provider or computer, to enable the health care provider or computer to determine the likely effectiveness of a proposed therapeutic regimen for the subject. Examples of health care providers include but are not limited to, an attending physician, oncologist, physician's assistant, pathologists, laboratory technician, etc.
1161036vl - 15 - The information may also be provided to a computer, where the computer comprises a memory unit and machine executable instructions that are configured to execute at least one algorithm designed to determine the likely effectiveness of a proposed therapeutic regimen for the subject. Accordingly, the invention also provides devices for predicting the responsiveness of a subject to a therapeutic regimen comprising a computer with machine executable instructions for predicting the responsiveness of a subject to a therapeutic regimen.
As used herein, the term "subject" is used interchangeably with the term "patient," and is used to mean an animal, in particular a mammal, and even more particularly a non-human or human primate.
As used herein, a "therapeutic regimen" is a plan for treating a subject in need of treatment for a particular disease state. Furthermore, the term "treat" is used to indicate a procedure which is designed to ameliorate one or more causes, symptoms, or untoward effects of an abnormal condition in a subject. The therapeutic regimen can, but need not, cure the subject, i.e., remove the cause(s), or remove entirely the symptom(s) and/or untoward effect(s) of the abnormal condition in the subject. More particularly, the phrase "therapeutic regimen" is also used to indicate a procedure which is designed to inhibit growth and accelerate cell aging, induce apoptosis and cell death of neoplastic tissue within a subject. Additionally, "therapeutic regimen" means to reduce, stall, or inhibit the growth of or proliferation of tumor cells, including but not limited to carcinoma cells. The therapeutic regimen may or may not be employed prior to performing the methods of the present invention. The invention is not limited by the therapeutic regimen contemplated. Examples of therapeutic regimens include but are not limited to chemotherapy (pharmaceuticals), radiation therapy, surgical intervention, cell therapy, stem cell therapy, gene therapy and any combination thereof, hi one embodiment, the therapeutic regimen comprises chemotherapy, hi another embodiment, the therapeutic regimen comprises radiation therapy. In yet another embodiment, the therapeutic regimen comprises surgical intervention. In still another embodiment, the therapeutic regimen comprises a combination of chemotherapy and radiation therapy.
Of course, the therapeutic regimen that is being employed or contemplated will depend on the abnormal condition that the subject has or is suspected of having. As used herein, an "abnormal condition" is used to mean a disease, or aberrant cellular or metabolic condition. Examples of abnormal conditions in which the methods can be used include but are not limited to, dysplasia, neoplastic growth and abnormal cell proliferation. In one embodiment, the abnormal condition comprises neoplastic growth. In a more specific embodiment, the abnormal
116103όvl - 16 - condition comprises a carcinoma. In an even more specific embodiment, the abnormal condition comprises colorectal cancer cells, or their precursors, including adenomas or normal cells expressing the biomarker.
The methods comprise determining the methylation status of the EVL/miR-342 gene in the test subject. As used herein, "methylation status" is used to indicate the presence or absence or the level or extent of methyl group modification in the polynucleotide of at least one gene, determining said methylation status comprises using an assay selected from the group consisting of Southern blotting, single nucleotide primer extension, methylation-specific polymerase chain reaction (MSPCR), restriction landmark genomic scanning for methylation (RLGS-M), CpG island micro array, SNUPE, and COBRA. These methods well known to those skilled in the art are hereby incorporated by reference.
In assays interrogating a sequence of DNA dense with CpG dinucleotides where methylation is very low, a small increase in methylation, e.g., about 10%, 12%, 14%, 16%, 18%, or 20% over a non-cancer control may be diagnostic of a risk of colorectal disease. Higher amounts of methylation are correlated with advancing or advanced colorectal cancer.
In the Examples below, DNA samples obtained from individuals suffering from colorectal cancer demonstrated at least 50% and up to 100% of CpGs in the interrogated EVL DNA were methylated. Accordingly, a high amount of methylation, for example, at least about 20%, 35%, 50%, 75%, or 90% CpG methylation detected in the assayed region of EVL by any one of a variety of methylation assays, is indicative of colorectal cancer.
In EVL DNA samples obtained from individuals diagnosed with the benign colorectal adenoma, methylation was present with greater frequency than seen in cancer free controls but with less frequency than that in colorectal cancer samples. In general, methylation of, for example, at least about 20%, 30%, 40%, or 50% of CpG sites within a tested sequence, is indicative of risk of colorectal cancer in the individual, providing, for example, an indication that adenoma is progressing to adenocarcinoma, or providing early warning of the disease or risk of developing the disease.
The percentage numbers recited above are provided for guidance. Differing assay methods may provide varied numerical results. Because methylation of CpG dinucleotides in GC-rich sequences, and particularly in all or a portion of a CpG island is rare, the presence of any methylation in the EFL gene, and particularly of an increased amount versus a non-cancer control, is highly likely to be indicative of disease. Results may be viewed as a scale of methylation related to a scale of disease progression; with little or no methylation in cancer free
1161036vl - 17 - controls; very high methylation, e.g., at least about 50%,60%, 70%, 80%, 90% or 100%, in colorectal cancer samples, and a medium amount of methylation, e.g., about 20%, 30%, 40%, or 50% suggestive of risk of disease and/or early stage of disease. Some level of methylation may be seen in patients having been treated for colorectal cancer, and changes from a patient's reference sample may be monitored for potential recurrence and prognosis.
As is shown in the Examples below, the epigenetic approach taken with respect to EVL can be complemented by analysis of to other genes associated with colorectal cancer, including KPNBl, karyopherin (importin) beta \; ID4, inhibitor of DNA binding 4, dominant negative helix-loop-helix protein, PTGER4, prostaglandin E receptor 4 (subtype EP4); SETD7, SET domain containing (lysine methyltransferase) 7; RASAJ, RAS p21 protein activator (GTPase activating protein) 1 ; GRINl, glutamate receptor, iono tropic, N-methyl D -aspartate 1; NHLH2, nescient helix loop helix 2; EFTUD i, elongation factor Tau GTP binding domain containing 1; BMPR2, bone morphogenetic protein receptor, type II (serine/threonine kinase); SOX6, SRY (sex determining region Y)-box 6; E2F3, E2F transcription factor 3. That is, methylation patterns of CpG islands associated with these genes or the expression levels of the genes may be used as coordinated biomarkers for diagnosis, prognosis an categorization of colorectal cancer. Because the expression of these genes was identified a regulatory targets of miR-342, a diagnostic for miR-342 expression will be useful in satisfying statistical certainty of any analytical outcome.
Diagnostic Kits
Diagnostic kits adapted for the determination of colorectal cancer in an individual and/or risk of colorectal cancer are provided herein. Such kits include materials and reagents adapted to specifically determine the presence and/or amount of methylation in a sample selected to be diagnostic of colorectal cancer.
A diagnostic kit may contain, for example, forward and reverse primers designed to amplify methylated DNA from a specific region of the EFZ, gene determined to be diagnostic of the presence or risk of colorectal cancer. In one embodiment, the primers are designed to amplify a GC-rich region of a 5' or 3' aspect of EVL, such as a portion of a CpG island of the gene. In specific embodiments, the primers amplify all or a portion of an EVL CpG island and may amplify, for example, all or a portion of the CpG-128 (SEQ ID NO: 11) or CpG-21 (SEQ ID NO: 12), for example.
1161036vl - 18 - The diagnostic kits may include, for example, one or more primer specifically designed to amplify a GC-rich nucleic acid sequence of EVL, for example a nucleic acid sequence that includes a portion of CpG-128 (SEQ ID NO:11), e.g. aportion of about 200 to 600 base pairs. Exemplary amplification primers useful in diagnostic kits for the detection of methylated EVL include one or more forward primer selected from SEQ ID NO: 1 or 6 and one or more reverse primer selected from SEQ ID NO: 2 or 7. These primers are specifically designed to amplify methylated DNA in a GC-rich region of the 5' aspect of EVL. A particularly useful primer pair is the combination of SEQ ID NO: 6 and 7, adapted for use in an MSP assay. Forward and reverse primers SEQ ID NO: 3 and 4 are designed to amplify non-methylated DNA of the same GC-rich region. One or all of the primers may include a GC-rich tail of approximately 15-25 nucleotides.
Many different PCR primers may be designed and adapted to produce a sequence of a desired length and position in the EVL gene, as well as specificity for methylated DNA.
Reagents and materials for the analysis and detection of methylation can be provided in a diagnostic kit. For example, the kit may contain one or more of the following agents: a bisulfite reagent, a methylation-specific restriction enzyme, a methylation-specific antibody, apparatus and reagents for Southern analysis or for sequencing, and the like.
Therapeutic compositions and methods
As described in the Examples below, silencing of miR-342 and/or silencing of EVL results removal of tumor suppression. Reconstitution of the activities of these molecules thus provides a therapeutic protocol for the associated disorder, colorectal cancer, and a potential for preventing development of the disease.
Libraries of random modifications of wild-type precursor miR-342 microRNA (GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGACAUGGUUAAUG GAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUA (SEQ ID NO: 19)) are prepared, where the libraries are used in assays to detect changes in phenotype of cells, as arrays to identify mRNAs that bind, or identification of genomic sequences having the same sequence as the library member. These libraries will generally be limited to modifications in the loop sequence, the stem sequence or both. In addition to the random modifications, changes are made in the sequence to maintain the complementarity or lack of complementarity in the wild-type sequence. For example, where the modification in the loop results in there being complementarity between pairs of nucleotides on opposite sides of the loop, which complementarity did not previously exist, then the wild-type sequence would be further changed
1161036vl - 19 - to remove the complementarity. In the stem, one will usually maintain the same level of complementarity between the 5'-seed sequence and complementary 3'-sequence, although maintaining the same complementarity or varying the complementarity is permissible. The number of permutations is not great and is readily achieved as shown in the Experimental section. Where one has a phenotype associated with a family of isoforms, by screening cells from which the wild-type miR-342 (including precursors) has been identified, the ability to modify the phenotype of the cells can be evaluated, hi one application, one modifies the seed sequence to have identical complementarity with the mRNA and randomly modifies the loop, using single or double replacements.
The subject invention allows for improved prediction of the modulation of mRNA expression with miR-342. By including complementarity between the stem and a portion of the loop with the candidate mRNA, one will be able to better predict whether the miR-342 will affect the expression of the mRNA. One may include the sequence of the loop as a modification of the algorithm or use the presently available or future algorithms and then compare the adjacent nucleotides of the mRNA with the nucleotides of the loop sequence. See, for example, U.S. Patent application nos. 2007/0100563 and 2007/0099196, for methods of designing miR- 342 molecules and predicting mRNA targets, the disclosure of which is specifically incorporated herein by reference. Greater homology between indicated portions of the loop sequence and the nucleotides in the mRNA proximal to the sequence complementary to the seed sequence will indicate the greater likelihood of regulation of the mRNA by the miR-342 pre-microRNA. An aspect of this embodiment is modifying the sequence of mature or pri-miRNA miR-342 to alter the expression of one or more genes selected from the group consisting of: KPNBl, ID4, PTGER4, SETD7, RASAl, GRINl, NHLH2, EFTUDl, BMPR2, SOX6, and E2F3.
One can define a particular RNA sequence based on algorithm predictions, where both the stem and the loop sequences are included in the analysis. By introducing such subject miR- 342 precursors into cells as the precursor or the gene, one can determine the effect on the phenotype of the cell. A change in phenotype indicates that the subject miR-342 precursors have an effect in the degradation or storage of the target mRNA(s). In addition, one may search the sequence database for mRNA sequences, particularly 3'-UTR sequences, that have substantial complementarity to the seed sequence and at least 2, preferably at least 3, nt of the loop sequence to identify mRNAs that are likely to be regulated by the subject miR-342 precursors. Most of the loop sequence need not be complementary, desirably up to 6 nt, where bulges of 1 to 3 nt and mismatches are permitted. Where the function of the mRNAs is known, the regulatory effect of
1161036vl - 20 - the miR-342 will then also be known. Thus, one determines the sequence of an mRNA complementary to at least the seed sequence of a stem sequence of a mature miR-342, where the seed sequence will generally be of from about 6 to 10 nucleotides of the 51 strand. One would also include in the analysis a sequence of at least 2, preferably 8, nucleotides of the loop sequence for complementation of the first two and last two of the 8 nt to a sequence of at least a comparable number of nucleotides of said mRNA sequence that is proximal to said mRNA seed complementarity sequence. Desirably, the complementary nucleotides in the loop and the mRNA will be equally spaced apart, so that there will be no bulges, although there may be mismatches.
The phenotype of a cell can be modified with greater specificity by employing a particular precursor miR-342 that acts on a single target in a pathway of interest, acts on a plurality of targets while excluding other targets, or acts with greater efficiency on one or more targets, particularly where the targets may be in single or related pathways. Using loop sequences that bind to selected target(s), particular a single target, the modulation of the cellular pathway can be more precisely controlled. The miR-342 pre-microRNA can be matched with a particular mRNA or small number of mRNAs, usually not more than 5, more usually, not more than 3, mRNAs.
Of particular interest is the use of modified precursor miR-342. The modifications may be as to sequence, backbone, chemical conjugation, use of unnatural bases, deletions, insertions, etc. The purpose(s) of the modifications may be to enhance affinity, reduce degradation by nucleases, prevent or enhance cross-reactivity, permit ready identification of hybridization, etc. Where the precursor miR-342 is naturally cellularly expressed, then the modifications will usually be limited to sequence modifications, rather than modifications involving substitution of bases with entities that bind to the same complementary base.
As indicated above, the sequence modifications may take many forms. Where the pre- miRNA is produced by cellular expression, then differences will be as to the sequence, which will involve deletions, insertions and substitutions. Modifications can be selected to allow for greater or lesser complementarity between the two sequences of the stem. With 6 to 8 nucleotides of the guide sequence complementary to the target mRNA, the binding of a second portion of the same strand to the mRNA is not required for repression. However, for fewer nucleotides than 6 complementary to the mRNA, then the second portion will usually be involved. Once the mRNA sequence that binds the miR-342 guide sequence is known, one can enhance affinity by providing for greater complementarity between the guide sequence and the mRNA sequence, up to perfect complementarity. Where the miR-342 pre-miRNA is synthesized,
1161036vl - 21 - one may use modified nucleotides that provide for higher affinity between the guide sequence and the mRNA sequence. Various unnatural bases may be used, such as phosphorothioates, phosphorodithioates, polyamido(peptide) or polyamino backbones, modified sugars, e.g. LNA, modified bases, and others known to one of ordinary skill in the art.
The mimetic ("mimic") molecules may be varied in different manners. The seed sequence and the complementary sequence in the loop will usually have a linking group of up to 20 nucleotide units, more usually not more than about 18 nucleotide units, and at least about 16 nucleotide units. In some instances other than nucleotides or nucleotide mimics may be employed as the linker, where there will generally be from about 54 to 120 atoms in the chain, usually from about 60 to about 108 atoms in the chain, where a ribose phosphate is counted as 6 atoms, an amide as 3 atoms, etc. The particular spacer will be selected to provide the optimum activity of the pre-miRNA in repressing translation. The linking group may be a naturally occurring linking group from a naturally occurring pre-miRNA binding to the target mRNA, a truncated naturally occurring linking group, truncated by from 1 to 6 nucleotides, may be a poly- U or -A or combination thereof, random, alternating or block, abasic nucleotides, or portions of one with another. The linker may be varied widely providing for minimal interference with the binding of the pre-miRNA with the target mRNA, minimizing cross-reactivity with non-target mRNA, avoiding false positives and negatives, and providing for optimum binding of the seed sequence and the loop sequence with the target mRNA. Reconstituting the activity of miR-342 and/or of EVL maybe accomplished by administering one or both of these agents and/or their encoded RNA and protein products. A mimic of miR-342 or a portion of EVL may be administered. Administration can be by injection of the miR-342 or mimic and/or EVL protein or portion, reconstituting these agents by administering miR-342 and/or of EVL by gene therapy, and the like. In one embodiment, miR-342 or mimic can be administered to an individual having colorectal cancer, alone, or in combination with EVL protein or an active portion thereof. Treatment of colorectal cancer with miR-342 or mimic is useful to induce apoptosis of the cancer cells.
Methods of delivery of RNA are known in the art. The RNA can be formulated in buffer solutions such as phosphate buffered saline solutions, liposomes, micellar structures, and capsids. Formulation of RNA it cationic lipids may be used to facilitate entry of RNA into cells. The method of introducing RNA into the environment of the cell will depend on the type of cell. Lipid formulations may be administered by intravenous, intra muscular, or intraperitoneal injection, orally, or by inhalation or other methods known in the art.
1161036vl - 22 - In an alternative embodiment, one or more therapeutic compound designed to emethylate the DNA can be administered. Known agents useful to remove methylation and reconstitute silenced genes include 5-aza-cytidine, 5-aza-2- deoxycytidine, procainamide, arsenic trioxides, and others. See, for example, a review of de-methylating agents and their therapeutic use, in: Methods in Molecular Biology, v.361, Sioud (Ed.) Humana Press, Totowa.
One or more such therapeutic agent can be used in combination. For example, a preferred therapeutic combination includes administering to an individual suffering from colorectal cancer or at risk of developing colorectal cancer a de-methylation agent, miR-342 or a mimic thereof, EVL protein or active fragment thereof, individually or in combination. Administration of these therapeutic agents is preferably in a pharmaceutical carrier, e.g., orally, by injection, or by gene therapy methods, and may also be combined with the administration of known chemotherapeutic agents, such as chemotoxic and chemotherapeutic agents. Various methods of delivering these agents to the target cancer cells are known and can be applied. Therapeutic kits comprising one or more of a de-methylation agent, miR-342 or mimic, and EVL protein or portion can be prepared.
As is shown below, the epigenetic approach taken with respect to EVL and KPNBl, karyopherin (importin) beta 1; ID4, inhibitor of DNA binding 4, dominant negative helix-loop- helix protein, PTGER4, prostaglandin E receptor 4 (subtype EP4); SETD7, SET domain containing (lysine methyltransferase) 7; RASAl, PvAS p21 protein activator (GTP ase activating protein) 1; GRINl, glutamate receptor, ionotropic, N-methyl D-aspartate 1; NHLH2, nescient helix loop helix 2; EFTUDl, elongation factor Tu GTP binding domain containing 1; BMPR2, bone morphogenetic protein receptor, type II (serine/threonine kinase); S 0X6, SRY (sex determining region Y)-box 6; E2F3,E2F transcription factor 3
1161036vl - 23 - EXAMPLES
The invention is further described by reference to the following Examples. These are intended as exemplifying embodiments of the invention, and are not to limit the invention. All citations to methods and materials in the Examples, and in the description, above, are hereby incorporated by reference in their entirety.
Materials and Methods
Clinical materials
Normal or colorectal tumor samples were collected from patients treated at Vanderbilt University Medical Center (Nashville, TN) and Case Western Reserve University/University Hospitals of Cleveland (Cleveland, OH), as well as from the Cooperative Human Tissue Network (CHTN) as either paraffin-embedded, formalin-fixed tissues or fresh frozen tissues. The studies were conducted using protocols approved by the IRB of each institution.
Methylation analysis was conducted on 42 colorectal cancers, nine colorectal adenomas and 16 samples of grossly normal mucosa in patients with and without colorectal cancer. None of the patients had a clinically apparent polyposis syndrome or hereditary nonpolyposis colorectal cancer.
Extraction of DNA and RNA
Genomic DNA from the cultured cells and frozen tissues was extracted using Puregene DNA Purification Kit (Gentra, Minneapolis, Minnesota). DNA was extracted from the microdissected epithelial layer of formalin-fixed, paraffin- embedded tissue sections using InstaGene Matrix (Bio-Rad, Hercules, CA). The histological diagnosis of each case was confirmed by an experienced pathologist. Normal colorectal specimens resected for benign disease were obtained from the Vanderbilt University Medical Center pathology archives. DNA was extracted from formalin-fixed tissues as previously described (Grady, et al. (1998). Cancer Res 58:3101-04).
RNA was extracted using the røzWana miRNA Isolation Kit (Ambion, Austin, TX). Samples were first homogenized using a Qiagen Tissuelyzer device, followed by total RNA isolation from frozen tissue as recommended by the manufacturer's protocol. Cell line RNAs were purchased from Ambion, Inc.
A listing of commercial cell line RNAs used in this study is shown in the Table below:
1161036vl - 24 - Cancer cell RNA panel used for qRT-PCR analysis of EVL and miR-342 expression.
Figure imgf000026_0001
Quantitative Reverse-Transcription PCR (qRT-PCR) for EVL, pl6/CDKN2A And miR-342
Total RNA was reverse transcribed using the TaqMan miRNA Reverse Transcription Kit (for human miR-342) or the High Capacity cDNA Reverse Transcription Kit (for EVL and pl6/CDKN2A) following the manufacturer's protocol (Applied Biosystems, Inc., Foster City, CA). miR-342 and EVL expression was quantified using commercially available TaqMan assay (Applied Biosystems, Inc., Foster City, CA, USA), targeting sequence spanning exons 3 and 4 of the mRNA. pl6/CDKN2A was quantified using TaqMan assay. Expression was normalized using TaqMan microRNA endogenous control assay RNU24 for hsa-miR-342 and TaqMan endogenous control assay GAPDH for EVL and pl6/CDKN2 'A. Real-time PCR was carried out on an Applied Biosystems 7900HT using TaqMan Universal PCR Master Mix, No AmpErase UNG. Data was analyzed with SDS Relative Quantification software (Applied Biosystems Inc.).
Methylation specific PCR (MSP)
Genomic DNA was modified with sodium bisulfite as previously described ( Grady WM, et al. (2001). Cancer Res 61 :900-02). Positive and negative controls, consisting of methylated
1161036vl - 25 - DNA obtained from colorectal cancer cell lines and unmethylated DNA obtained from normal human peripheral blood lymphocytes (PBL) were included with each round of bisulfite treatment and subsequent methylation specific PCR (MSP) analysis and bisulfite genomic sequencing.
Primer pairs were designed using MethPrimer (http://www.urogen.org/methprimer/indexl.html) to amplify specifically the methylated or unmethylated alleles of a portion of CpG-128 positioned in the 5' aspect of EVL with at least a portion of the CpG island positioned within the promoter region of the EVL gene:
MF (S'-TATTTTCGTTCGTTTCGTTTTTC-S ') (SEQ ID NO: 1) and
MR (5'-AAATACGCGCGTTACTATTCG-S') (SEQ ID NO: 2),
UF (5t-TATTTTTGTTTGTTTTGTTTTTTGT-3I) (SEQ ID NO: 3),
UR (5'-TAAAATACACACATTACTATTCACC-31) (SEQ ID NO: 4). All the primers were modified to contain a 20-bp GC-rich tail at their 5' ends:
(5'-GCGGTCCCAAAAGGGTCAGT-3r) (SEQ ID NO: 5).
Each PCR reaction mix consisted of a total volume of 20 μL containing 1OX PCR buffer (Qiagen, Valencia, CA, USA), 125 μM of deoxynucleotide triphosphate mix (Invitrogen, Carlsbad, CA), 500 nM of each primer (Operon Biotechnologies, Huntsville, AL, USA), 1 unit of HotStart Taq enzyme (Qiagen), and bisulfite-modified DNA.
PCR conditions were: 95°C for 15 minutes (92°C for 30 seconds 640C for 45 seconds 720C for 30 seconds) x 45 cycles, followed by a final extension at 72°C for 10 minutes in a standard thermal cycler (GeneAmp® PCR System 9700, Applied Biosystems Inc.). Controls were incorporated into each MSP assay for both methylated and unmethylated reactions, including:
(i) DNA from peripheral blood leukocytes (unmethylated control);
(ii) DNA extracted from colorectal cancer cell lines known to be methylated for the target genes (methylated control) and
(iii) a control containing water only (no template).
Following amplification, PCR products were subjected to gel electrophoresis through a 2.5% agarose gel and were visualized by ethidium bromide staining and UV transillumination. All sodium bisulfite treatments and MSP assays were repeated to obtain a minimum of two replicates to validate the results.
The portion of CpG-128 amplified is a 192 base pair sequence of the 5' aspect of EVL spanning nucleotide coordinates 99507481 to 99507673 of chromosome 14, + strand.
1161036vl - 26 - DNA methylation analysis
Examples of methylation detection methods include the commercially available platforms from Illumina, including "GoldenGate(R) Methylation" and "VeraCode(R) Methylation" platforms. Illumina is developing these platforms for clinical use. Both of these platforms rely on bisulfite-conversion cytosine, with differing methods of detection (see: http://www.illumina.com/downloads/DNAMetliylationAnalvsis DataSheet.pdf).
For the GoldenGate method: Bisulfite- converted DNAs are biotinylated and immobilized on paramagnetic beads. Query oligonucleotides are hybridized to the DNA and then washed to remove excess or mishybridized oligonucleotides. The hybridized oligos are then extended and ligated to create amplifϊable templates. The PCR that follows uses fluorescently labeled universal PCR primers. Methylation status of the interrogated CpG sites is determined by comparing the ratio of the fluorescent signal from the methylated allele to the sum of the fluorescent signals of both methylated and unmethylated alleles. Using this platform, up to 1536 independent CpG sites can be assessed across 96 samples in one run.
The VeraCode platform is a variation that incorporates beads for the detection step using beads that are holographically "bar-coded" (so many "assays" can be performed in the same "tube".
A high-throughput MALDI-TOF MS platform may be used for methylation analysis (http://www. well.ox.ac.uk/genomi cs/Research/Research DNA methylation analysis.shtml http://www.well.ox.ac.uk/genomics/Facilities/Facilities EpiTYPER.shtml; http://www.sequenom. com/Genetic-Anal vsis/Applications/EpiTYPER-DNA-Methylation- Analysis/EpiTYPER-Qverview.aspx
Bisulfite genomic sequencing
Following sodium bisulfite treatment, the 5' region of EVL was PCR amplified using the following primers:
BS-F: S'-GTTTTTTTTAAAGTTTYGTTTTTTAG-S ' (SEQ ID N0:6) and
BS-R: 5p-AACTAATCTCAACACAACAACC-31 (SEQ ID N0:7).
The thermocycler conditions were as follows: 95°C for 15 minutes, (92°C for 30 seconds, 540C for 45 seconds, 720C for 30 seconds) x 45 cycles, and 720C for 10 minutes. The PCR products were cloned using the One Shot® TOPlO kit (Invitrogen) and individual clones were sequenced using Sanger sequencing^
1161036vl - 27 - The portion of CpG-128 amplified is a 253 base pair sequence of the 51 aspect of EVL spanning nucleotide coordinates 99507450 to 99507703 of chromosome 14, + strand.
Pyrosequencing:
The DNA of interest is extracted and treated with bisulphite to convert unmethylated cytosines into uracils. After PCR amplification by which all uracils result in thymidine, the sample is denatured to form single-stranded DNA (ssDNA). Following hybridisation of a sequencing primer to the ssDNA, the complementary strand is synthesised in the presence of adenosine-5'-phosphosulphate (APS), luciferin and the enzymes DNA polymerase, ATP sulfurylase, luciferase and apyrase.
The pyrosequencing process is initiated by addition of one of the four dεoxynucleotide triphosphates (dNTPs). If it is complementary to the first unpaired base in the template strand, DNA polymerase catalyses its incoiporation into the DNA strand, releasing pyrophosphate (PPi) in a quantity equmioϊar to the amount of incorporated nucleotide.
With APS as a substrate, ATP sulfurylase quantitatively converts the released PPi to ATP, which drives the luciferase-catalysed conversion of luciferin to oxyluciferin. By this reaction, a visible light signal proportional to the amount of ATP is generated aad can be detected by a camera. The resulting peaks, corresponding to the numbers of nucleotides incorporated.
Apyrase, a nucleotide-degrading enzyme, continuously degrades ATP and unincorporated dNTPs, "switching off the light and regenerating the reaction solution. The reaction steps 2 and 3 can restart with the next dNTP.
The dNTPs are added one at a time. It should be noted that deoxyadenosine-aJpha-thio- tripliosphate (dATPaS) is used as a substitute for the natural deoxyadenosine triphosphate (dATP) since it is efficiently used by the DNA polymerase, but not recognised by the luciferase. As the process continues, the complementary DNA strand is built up and the nucleotide sequence is determined from the signal peaks in the pyrogram.
Example 1
miR-342 is encoded in an intron of the EVL gene and is commonly silenced in colorectal cancer.
The intronic microRNA, miR-342, was found to be under- expressed in colorectal cancer in a global screen for microRNA dysregulation based on deep sequencing of microRNA 1161036vl - 28 - populations from colorectal cancer and matched normal colorectal epithelial tissues (et al Cummins, et al. (2006). Proc Natl Acad Sd USA 103:3687-92). miR-342 captured our attention because of the presence of a dense CpG island in the 5' aspect of its host gene, EVL . The miR- 342 gene is embedded on the sense strand, in the center of a 25.9 kb intron located between the third and fourth exons of the EVL gene on chromosome 14. A dense CpG island, CpG-128, is located just upstream of the transcriptional start site (TSS) of EVL.
Expression of miR-342 was assessed using quantitative reverse-transcription PCR (qRT- PCR) in primary colorectal cancers and matched normal colorectal mucosa samples (N=I 9) that represented tissue collections from two independent sources. TaqMan qRT-PCR demonstrated suppression of miR-342 and EVL expression in a subset of colorectal cancers. RNA used for expression analysis was extracted from fresh frozen tissue samples from 19 cases of colorectal cancer and matched normal tissue obtained from the same resection specimens.
Suppression of hsa-miR-34 '2 expression (defined as >20% decreased expression in the primary cancer vs. the normal mucosa) was found in 58% of the cancers (N= 11/19). The other cancers either showed minimal change in hsa-miR-342 expression (21%, N=4/19) or in a few cases showed an increase in expression of >20% in the cancer (21%, N=4/19).
Having confirmed that expression of hsa-miR-342 is suppressed in a large subset (58%) of colorectal cancers, expression of its host gene, EVL, was measured in the same samples to determine whether there maybe coordinate regulation of silencing. EVL expression was found to be suppressed in the majority (14 out of 19) of cancer samples relative to matched normal mucosa. There was a positive correlation between suppression of EVL and suppression of miR- 342 expression in cancer samples (Pearson's correlation coefficient = +0.41; p-value = 0.075).
As an additional approach for testing for a correlation between EVL and miR-342 expression, the levels of both RNAs was measured across a panel of 28 cancer cell lines. Expression of EVL and miR-342 was measured by TaqMan qRT-PCR in 28 human cancer cell lines and expressed as delta cycle threshold (ΔCt) values obtained by normalization using RNU24 (a small nucleolar RNA) as an endogenous (normal) control. The ΔCt values obtained from real-time PCR experiments are inversely related to expression levels. Most colorectal cancer cell lines had suppressed levels of EVL/hsa-miR-342 relative to other human cancer cell lines. The one colorectal cancer cell line that had levels of miR-342 similar to that of non- colorectal cancer cell lines (VACO400) was subsequently found to be unmethylated at the EVL/ miR-342 promoter region.
1161036vl - 29 - Expression of EVL and miR-342 was examined for correlation. Relative expression was calculated by comparing normalized expression values in each cell line to those obtained in the VACO411 colorectal cancer cell line (the cell line with the lowest expression of EVL). The range of values is different between the x- and y- axes because miR-342 expression data were normalized using RNU24 snoRNA as an endogenous control, whereas EVL expression data were normalized using GAPDH as an endogenous control. The use of a distinct normalization control for the miR-342 qRT-PCR assay is dictated by the unique design of qRT-PCR TaqMan assays for small RNAs (i.e., microRNAs and snoRNAs) as compared to qRT-PCR TaqMan assays designed to measure mRNAs. Pearson's coefficient of correlation was calculated between miR- 342 expression values and EVL expression values across the 28 cell lines. Computation of the correlation coefficient and assignment of a p-value for the correlation was performed using standard statistical methods (Motulsky (1995) Intuitive Biostatistics Oxford U. Press: NY).
The data demonstrate that expression of EVL and miR-342 was positively correlated (Pearson's correlation coefficient = +0.547; p-value = 0.003). Moreover, in five out of six colorectal cancer cell lines, EVL and miR-342 expression were substantially suppressed (reflected by higher normalized cycle threshold (i.e., ΔCt) values) relative to cell lines derived from other types of cancer. The average normalized Ct for EVL was 15.85 in colorectal cancer lines versus 4.48 in non-colorectal cancer lines (p-value = 0.002; Student's t-test). For miR-342, the corresponding average normalized Ct values were 10.36 and 1.90 (p-value = 0.004; Student's t-test), respectively. Together, these results support a model in which expression of EVL and miR-342 is coordinately suppressed in colorectal cancer.
Example 2
Repression of miR-342 and EVL is associated with aberrant meihylation of the EVL/miR-342 promoter
In order to determine the mechanism responsible for EVL/hsa-miR-342 suppression in colorectal cancer, we used methylation-specific PCR (MSP) to assess the methylation status of the CpG island immediately upstream of the EVL gene in a panel of seven colorectal cancer cell lines (VACO411, AA/C1/SB10, HT-29, RKO, SW48, VACO703 and VACO400) and three colorectal adenoma cell lines (AA/C1, RG/C2, VACO235).
The results of EVL/ 'miR-342 MSP assay using primers that amplify methylated or unmethylated alleles specifically showed that methylation of the EVL/miR-342 locus occurred in six out of seven colorectal cancer lines tested. DNA from VACO411, HT-29, RKO5 and SW48 1161036vl - 30 - cell lines showed only methylated EVL, whereas AA/C1/SB10 and VACO703 cell lines showed both methylated and unmethylated EVL. VACO400 was unmethylated at the EVL/hsa-miR-342 locus. Peripheral blood leukocyte DNA was used as the unmethylated control. Methylase Sssl- treated DNA was used as the methylated DNA control.
Six of the seven colorectal cancer cell lines were found to carry methylated EVL, and two of the three colorectal adenoma cell lines (RG/C2 and VACO235) were found to have methylated EVL. The single colorectal cancer cell line (VACO400) that was unmethylated was also the one that did not show suppression of EVL and miR-342 expression. Furthermore, in colorectal cancer lines showing methylation at the EVL CpG island, with the exception of AA/C1/SB10 and VACO703, there were no unmethylated alleles detected.
Bisulfite sequencing of EVL in VACO411 and AA/C1/SB10 confirmed dense methylation in the EVL/miR-342 promoter in VACO411 and a mixture of methylated and unmethylated clones in AA/C1/SB10. The PBL sample contains DNA from peripheral blood leukocytes (PBL) and was used as a control for unmethylated EVL/hsa-miR-342. The VACO411 and AA/Cl/SBIO samples are DNA from those respective cell lines.
None of the PBL controls showed methylation of any of the CpG sites (100% of the clones showed 0% methylated CpGs). For the VACO 411 colorectal cancer samples, only 6 of the possible 42 sites were not methylated (71% of the clones showed 100% methylated CpGs; 31% showed 95% methylated CpGs). In the sample of AA/C1/SB10 colorectal adenoma, significant methylation was shown. Approximately 50% of the clones showed at least 50% of the CpGs methylated. The other 50% of clones showed a range of 0-25% CpGs methylated.
Example 3
DNA methylation at the EVL/hsa-miR-342 locus is infrequent in non-colorectal cancer cell lines
We next assessed whether aberrant methylation of EVL/miR-342 is present in other tumor types by examining DNA isolated from a panel of forty additional cancer cell lines derived from a variety of non-colorectal cancer types. Cell line details are shown in the Table below. DNA from the colorectal cancer cell lines SW48 was used as a positive control, and peripheral blood lymphocyte DNA was used as a negative control for methylation.
Remarkably, only one out of forty non-colorectal cancer derived lines showed any evidence of methylation (NCI-H358 lung carcinoma in the Table below), and in this case, only partial methylation was present. 1161036vl - 31 - Cell line panel for MSP analysis of methylation at the EVL/hsa-miR-342 locus.
Figure imgf000033_0001
Example 4
EVL/miR-342 is frequently methylated in colorectal adenocarcinomas and colorectal adenomas
The methylation status of E 'VL/hsa-miR-342 in primary colorectal adenocarcinomas and adenomas, as well as in normal colorectal mucosa, was next analyzed. The detection of an unmethylated EVL miR-342 allele in colorectal cancers in which the methylated allele is also present likely represents contamination by normal tissue elements.
Bisulfite genomic sequencing results for the EVL/miR-342 CpG island were obtained from
(i) normal colorectal mucosa from four individuals without cancer;
(ii) colorectal cancer tissue from three individuals; and
(iii) normal appearing colorectal mucosa from two patients with concurrent colorectal cancer.
Sixty-seven percent (N=6/9) of colorectal adenomas were found to carry methylated EVL/miR-342. Pn primary colorectal adenocarcinomas, 86% (N=36/42) of the tumors were found to carry methylated EVL/ miR-342. The incidence of methylated EVL/ miR-342 in normal mucosa varied depending on whether the normal sample was derived from cancer-affected colon or from colorectal biopsies taken from individuals with colonoscopically normal colons (referred to here as 'cancer- free controls'). Using an MSP-based assay, methylated EVL/miR-342 was found in 12% (N=2/16) of normal mucosa from cancer-free controls. In sharp contrast, 56% (N=9/16) of histologically normal colorectal mucosa from individuals with concurrent colorectal adenocarcinoma had MSP-detectable
Figure imgf000034_0001
methylation (p-value = 0.023, Fisher's exact test). These results support the conclusion that a colorectal mucosal 'field defect' related to aberrant methylation.
Bisulfite sequencing of 'the EVL/ miR-342 locus in representative samples revealed little methylation in the DNA from normal colorectal mucosa from cancer-free controls, and dense methylation in the cancer DNA. None of the clones from the normal samples showed dense methylation (defined as >50% of CpGs methylated). The histologically normal colorectal mucosa from individuals with colorectal cancer showed an intermediate proportion of methylated CpGs, which was consistent with the MSP assay results.
1161036vl - 33 - Example 5
miR-342 reconstitution induces apoptosis in colorectal cancer cells
Since miR-342 silencing is associated with development of colorectal cancer, then this microRNA likely functions as a tumor suppressor in colon cells. The biological consequence of methylation of the EVL/ miR-342 locus was examined by transfecting a synthetic miR-342 mimic into the colorectal cancer cell lines, which possess a densely methylated EVL/hsa-miR-342 locus. The effects on cell proliferation and cellular apoptosis were evaluated.
Colorectal adenoma cell lines AAICl, RG/C2, and VACO235 were cultured as previously described (Markowitz, et al. (1994) J CHn Invest 93:1005-13; Williams, et al. (1990) Cancer Res 50:4724-30). Colorectal cancer cell lines HT-29, SW48, and RKO were cultured as recommended by the ATCC. AA/Cl/SBIO was cultured in DMEM (Gϊbco-BRL) supplemented with 20% FBS, 0.2 units/mL insulin (Sigma-Aldrich Co.), 1 μg/ml hydrocortisone, 100 units/ml penicillin and 100 μg/ml streptomycin. VACO411 was maintained in MEM (Gibco-BRL) supplemented with 2% FBS, 1% MEM non-essential amino acids (Mediatech Inc., Herndon, VA, USA), 1% insulin-transferrin selenium- X (Invitrogen), 1 μg/ml hydrocortisone (Sigma- Aldrich Co.), 100 units/ml penicillin and 100 μg/ml streptomycin (Gibco-BRL). VACO400 and VACO703 were cultured in DMEM (Gibco-BRL) supplemented with 10% FBS. miRIDIAN microRNA mimic corresponding to human miR-342 (item #C-300186-01; Dharmacon Research, Lafayette, CO, USA) and microRNA mimic negative controls #1 (item #CN-001000-01) and #2 (item #CN-002000-01), designed after C elegans microRNAs cel-miR- 67 and cel-miR-239b, respectively, were transfected at 500 nM final concentration. HT-29 cells were cultured in 96-well plates (Costar, Corning, NY) at 5,000 cells/well for 48 hours pre- transfection under standard conditions (37°C with 5% CO2). Each transfection used 0.4 μl OhaτmaFECTW transfection reagent (Dharmacon Research) in 100 μl total reaction volume, following the manufacturer's protocol.
The Cell Proliferation ELISA BrdU Assay (Roche Diagnostics Corp., Indianapolis, IN, USA) was used following the manufacturer's protocol to measure cellular proliferation in HT-29 cells 72 hours post-transfection with hsα-miR-342 mimic or microRNA mimic negative control #2 (designed after cel-miR-239b). Assays were carried out in black-walled, optical-bottom 96- well plates (item #604285; NalgeNunc International, Rochester, NY, USA). Briefly, cells were pulse labeled for two hours with 10 μM BrdU, then fixed for 30 minutes at room temperature, followed by a 90-minute incubation with 100 μL anti-BrdU peroxidase-labeled antibody. Light
1161036vl - 34 - emission was assessed using a microplate luminometer (Veritas, Turner BioSystems, Sunnyvale, CA, USA).
Seventy-two hours post-transfection of HT-29 cells with hsa-miR-342 mimic or microRNA mimic negative control #2 (designed after cel-miR-239b), apoptosis was quantified using a Cell Death Detection ELISA Kit (Roche Diagnostics Corp.) following the manufacturer's protocol. This immunoassay quantitatively detects histone-associated DNA fragments in mono- and oligonucleosomes that are released during apoptosis.
Results of the cell proliferation assay reflect data from three biological replicates. No statistically significant difference was seen between groups using Student's t-test and a p-value threshold of p<0.05. As stated above, the data showed no effect oϊ miR-342 reconstitution on cell proliferation.
Apoptosis was measured by an assay based on cytoplasmic histone-associated DNA fragments (Cytodeath ELISA, Roche) 72 hours after transfection with microRNA. Results of testing six biological replicates showed a significant difference between the negative control microRNA, mock-transfected cells and miR-342 transfected cells (p<0.001; Student's t-test).
Surprisingly, miR-342 reconstitution resulted in a marked increase in apoptosis. Transfection of negative control microRNA mimics had no effect. These results suggest that the targets of miR-342 may be anti-apoptotic factors and that silencing of miR-342 expression may promote colorectal cancer formation by enhancing anti-apoptotic pathways.
Apoptosis was also detected using a terminal deoxynucleotidyl transferase biotindUTP Nick End Labeling (TUNEL) assay in 96- well black-walled, optical-bottom plates (item #604285; Nalge Nunc International), performed in duplicate on HT-29 cells 48 hours post- transfection, with hsa-miR-342 mimic or microRNA mimic negative controls. For use as a positive control, apoptotic HT-29 cells were generated by treating for 12 hours with 5 μg/mL TNF-α ( Sigma- Aldrich Co.) and 10 ng/mL cycloheximide (Sigma- Aldrich Co.). Cells were fixed with 50 μL Bouin's Fixative Solution (Ricca Chemical Co., Arlington, TX, USA) and permeabilised with 50 μL 0.1% Triton-X 100 (USB, Cleveland, OH, USA) in 0.1% sodium citrate (Fisher BioReagents, Fairlawn, NJ, USA) in DPBS (Gibco-BRL). Labeling of DNA fragments generated by apoptosis was achieved using the in situ Cell Death Detection Assay Kit (Roche Diagnostics Corp.). Following TUNEL staining for apoptotic cells, cells were counterstained with 50 μL (20 pg/μl) Hoechst 33342 dye (Sigma-Aldrich Co.) for 10 minutes at room temperature to identify nuclei. Imaging was performed using confocal microscopy in the FHCRC Scientific Imaging Shared Resource Facility.
1161036vl - 35 - Confocal sections were acquired on a Zeiss LSM 510 META NLO confocal and twophoton microscope, fitted with a Zeiss PlanApochromat 20x/0.75 objective, and zoom factor of 1. The acquisition software was Zeiss LSM confocal software. Data was acquired at 8-bit per channel. Pixel dimensions were 0.45 micron in x and y. Pinhole was set at 1.8 Airy units, resulting in 3.3 micron optical slices for the red tetramethylrhodamine (TMR) channnel. TMR was excited with a 543 nm HeNe laser; Hoechst was excited in two photon mode with a Coherent Chameleon Ti:Sa laser tuned at 780 nm. Kalman averaging was used to reduce image noise during acquisition, with typically 2-4 images averaged in line mode. In some cases, a median filter (2 pixel neighborhood) was applied after acquisition to further reduce noise. LSM data files were converted to TIFF (8-bit per channel) and pseudocolored with Zeiss LSM software.
Results showed microRNA mimic negative control transfected cells and were distinguished from cells treated with hsa-miR-342 mimic and from positive controls, i.e., cells were treated with TNF-α and cycloheximide for 12 hours before TUNEL and Hoechst staining. These results were consistent with those obtained from apoptosis measured from cytoplasmic histone-associated DNA fragments, showing that reconstituting miR-342 expression results in apoptosis in colorectal cancer cells.
Example 6
Inhibition of DNA meihylation induces the expression of hsa-miR-342 and EVL
To determine whether methylation of the EVL CpG island mediates silencing of miR-342 and EVL expression, the colorectal cancer cell line VACO411 was treated with a regimen of 5- aza-2'-deoxycytidine (5-aza-2-dC) and Trichostatin A (TSA) followed by measurement of EVL and miR-342 expression by TaqMan-based qRT-PCR.
VACO411 (colorectal cancer) cells were grown for 48 hours before treatment with the demethylation agent 5-aza-2'-deoxycytidine (5-aza-2-dC) (Sigma-Aldrich Co.) dissolved in DMSO. The cells were treated with 5-aza-2-dC (200 nM final concentration) for 48 hours and then Tricho statin- A (TSA, Sigma-Aldrich Co.) was added to the media at 300 nM final concentration. The cells were then incubated for an additional 24 hours before harvesting. DNA was extracted and analyzed by bisulfite treatment followed by MSP using the EVL/miR-342
1161036vl - 36 - primers as described above. RNA was isolated from identically treated cultures for qRT-PCR analysis. The control samples were treated with the DMSO vehicle only.
The EVL/miR-342 MSP assay was performed using primers that specifically amplify methylated (M) or unmethylated (U) alleles after mock treatment with 5-aza-2-dC and Trichostatin A. The results show that treatment of VACO411 colorectal cancer cells with 5-aza- 2-dC (200 nM) in combination with Trichostatin A (TSA; 300 nM) caused a decrease in the amount of methyl ation of E VL/miR-342.
Reduction of methylation in the EVL CpG island induces expression of both EVL and miR-342 in the VACO411 cell line (values reflect the average of three biological replicates, ± standard error of the mean). pl6/CDKN2A, used here as a positive control gene known to be methylated in colorectal cancer, was also induced (value reflects the average of two biological replicates, ± standard error of the mean). EVL, miR-342 and pl6/CDKN2A RNA levels were measured using TaqMan-based qRT-PCR assays.
Treatment with low-dose 5-aza-2-dC (200 nM) and TSA (300 nM) led to the appearance of unmethylated EVL/miR-342 as detected by MSP assay This decrease was associated with induction of expression of both miR-342 and EVL transcripts in three independent experiments. The p 16/CDKN2 'A gene promoter, known to be methylated in colorectal cancer and used here as a positive control ( Myohanen, et al. (1998). Cancer Res 58:591-93), was also induced. These results are consistent with the conclusion that DNA methylation of the EVL upstream region represses the expression of both EVL and miR-342,
Example 7
Candidate gene targets of miR-342 derived from computational predictions Given that miR-342 is silenced in colorectal cancer, and that reconstitution of miR-342 activity induces apoptosis in the HT-29 cell line, we reasoned that its target(s) might be over- expressed in colorectal cancer and have function related to anti-apoptotic pathways. We predicted targets and assembled a list of the predicted targets in common to miR-342 target outputs using three microRNA target prediction algorithms: miRanda (Griffiths- Jones, et al. (2006). Nucleic Acids Res 34:D140-D144e* β0, TargetScan (Lewis, et al. (2005) Cell 120: 15- 2Oe; al) and PicTar (Krek, et al (2005) Nat Genet 37:495-500e? at).
A literature survey was conducted to determine whether the 13 targets predicted in common by all three computational algorithms were known to be over-expressed in colorectal
1161036vl - 37 - cancer or had roles consistent with anti-apoptotic activity. The table below lists the predicted targets. Platelet-derived growth factor receptor, alpha polypeptide (PDGFRA) and RAS p21 protein activator (GTPase activating protein) 1 (RASAl) satisfied both these criteria and represent specific candidate targets oϊmiR-342.
Intersection of miR-S 42 predicted target lists generated by miRanda, TargetScan and PicTar algorithms.
Figure imgf000039_0001
*Gene symbols in bold correspond to genes reported to be over-expressed in colorectal cancer. Gene symbols in italics denote genes with molecular functions consistent with anti-apoptotic activity.
As a complementary approach for identifying regulatory targets of miR-342, the Oncomine cancer profiling research database (www.Oncomine.org) ( Rhodes, et al. (2007). Neoplasia 9:166-80.) was queried to identify genes that (a) are over-expressed in colorectal cancer based on results from three relevant gene expression profiling studies and (b) are PicTar- predicted targets of hsa-miR-34 '2. Eleven genes satisfied these criteria and are presented in the table below. These identified targets represent potential targets for further diagnostic and therapeutic agents for colorectal cancer. 1161036vl - 38 - miR-342 predicted targets that are over-expressed in colorectal cancer based on Oncomine database analysis.
Figure imgf000040_0001
1161036vl - 39 -

Claims

What is claimed:
1. A method for diagnosing colorectal cancer in a human patient comprising: a.) obtaining a first biological sample comprising normal human cells, b.) obtaining a second biological sample comprising test cells from the patient, c.) isolating DNA from each sample, d.) measuring the amount of methylation in a nucleic acid sequence of the EVL gene or its 5' or 31 aspects in the DNA of each sample, e.) providing a diagnosis of colorectal cancer in those patients with test cells that show an increase in the amount of DNA methylation compared to the normal cells, and f.) providing a therapeutic regimen to the patient based on the diagnosis.
2. A method for prognosing a patient's response to a therapeutic regimen comprising: a.) obtaining a first biological sample comprising colorectal cancer cells from a cancer patient before administering the therapeutic regimen, b.) obtaining a second biological sample comprising colorectal cancer cells from a cancer patient after administering the therapeutic regimen, c.) isolating DNA from each sample, d.) measuring the amount of methylation in a nucleic acid sequence of the EVL gene or its 5' or 3' aspects in the DNA of each sample, e.) providing a prognosis that is indicative of the patient's response to the drug by comparing the first, pretreatment measurement with the second, posttreatment measurement, and f.) adjusting the therapeutic regimen based on the prognosis.
3. A method for predicting a patient's response with colorectal cancer to a therapeutic regimen comprising: a.) obtaining a first biological sample comprising colorectal cancer cells from a cancer patient before administering the therapeutic regimen, b.) obtaining a second biological sample comprising colorectal cancer cells from a cancer patient after administering the therapeutic regimen, c.) isolating DNA from each sample, d.) measuring the amount of methylation in a nucleic acid sequence of the EVL gene or its 5 ' or 3' aspects in the DNA of each sample,
116103όvl - 40 - e.) providing a comparison that is indicative of the patient's response to the therapeutic regimen by comparing the first, pretreatment measurement with the second, posttreatment measurement, and, f.) selecting the therapeutic regimen based on results of the comparison.
4. The method of claims 1, 2 or 3, wherein said nucleic acid sequence comprises at least a portion of a GC-rich region positioned at least partially in a 5' or 3' aspect of the EVL gene.
5. The method of claims 1, 2 or 3, wherein said nucleic acid sequence comprises at least a portion of a CpG island positioned at least partially in a 5' or 3' aspect of the EVL gene.
6. The method of claims 1, 2 or 3, wherein said nucleic acid sequence comprises at least a portion of a CpG island positioned at least partially in the 5' promoter region of the EVL gene.
7. The method of claims 1, 2 or 3, wherein nucleic acid sequence comprises at least a portion of a CpG island positioned at least partially in the 3 'aspect of the EVL gene.
8. The method of claims 1, 2 or 3, wherein said nucleic acid sequence comprises at least a portion of at least one nucleic acid sequence selected from the group consisting of SEQ ID NO:11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18.
9. The method of claims 1 , 2 or 3, wherein said measuring the amount of methylation in a nucleic acid sequence comprises isolated DNA with bisulfite.
10. The method of claim 9, further comprising: sequencing the modified nucleic acid sequence.
11. The method of claim 10, wherein sequencing is performed by pyrosequencing.
12. The method of claim 9, further comprising: single nucleotide primer extension analysis of the nucleic acid sequence.
13. The method of claim 9, further comprising: PCR amplifying the nucleic acid sequence with methylation-specific primers.
14. The method of claim 12, wherein said detecting comprises: amplifying the nucleic acid sequence with one or more primer comprising the sequence of SEQ ID NO: 1, 2, 3, 4, 6, or 7.
15. The method of claim 12, wherein one or more of said primer further comprises a 5r GC rich tail of approximately 15-25 nucleotides, wherein about 30-60% of the nucleotides are G or C.
1161036vl - 41 -
16. The method of claim 12, wherein one or more of each primer further comprises a 5' GC rich tail comprising the sequence: 5'- GCGGTCCCAAAAGGGTCAGT -3' (SEQ ID NO:
5).
17. The method of claims 1, 2 or 3, wherein said detecting comprises: digesting the nucleic acid sequence with a methylation sensitive restriction enzyme; and measuring the result of such restriction enzyme digest.
18. The method of claims 1, 2 or 3, wherein said nucleic acid sequence comprises a sense strand, an antisense strand, or both sense and antisense strands.
19. The method of claims 1, 2 or 3, wherein the colorectal cancer being tested is a serrated adenoma, a villous adenoma or a tubular adenoma.
20. The method of claims 1, 2 or 3, wherein methylation of at least 20% of CpG dinucleotides of the nucleic acid sequence indicates risk of colorectal cancer in the individual.
21. The method of claims 1, 2 or 3, wherein methylation of at least 50% of CpG dinucleotides of the nucleic acid sequence indicates colorectal cancer in the individual.
22. The method of claims 1 , 2 or 3, wherein methylation of at least 75% of CpG dinucleotides of the nucleic acid sequence indicates colorectal cancer in the individual.
23. The method of claims 1, 2 or 3, wherein methylation of at least 50 to about 100% of CpG dinucleotides of the nucleic acid sequence indicates colorectal cancer in the individual.
24. The method of claims 2 or 3, wherein the therapeutic regimen comprises chemotherapy.
25. The method of claims 2 or 3, wherein said therapeutic regimen comprises radiation therapy.
26. The method of claims 2 or 3, wherein said therapeutic regimen comprises a therapeutic drug.
27. The method of any of claims 1-26, comprising the additional step of: measuring the amount of expression or the amount of methylation of one or more genes selected from the group consisting of: KPNBl, ID4, PTGER4, SETD7, RASAl, GRINl, NHLH2, EFTUDl, BMPR2, SOX6, and E2F3.
28. A method for detecting colorectal cancer or risk of colorectal cancer in an individual comprising: a. detecting expression of miR-342 and/or EVL in a sample obtained from the individual; and b. identifying samples having reduced expression of miR-342 and/or EVL versus a
1161036vl - 42 - non-cancer control as indicative of colorectal cancer or risk of colorectal cancer in the individual.
29. The method of claim 28, wherein said expression of miR-342 and/or EVL is reduced at least 20% to 100% compared with a non-cancer control.
30. The method of claim 28, wherein said detecting is by quantitative reverse transcription PCR.
31. The method of claim 28, wherein said detecting comprises monitoring disease burden and/or monitoring response to colorectal cancer therapy.
32. The method of any of claims 28-32, comprising the additional step of: detecting the amount of expression of one or more genes selected from the group consisting of: KPNBl, ID4, PTGER4, SETD7, RASAl, GRINl, NHLH2, EFTUDl, BMPR2, SOX6, and E2F3.
33. A method for treating or preventing colorectal cancer, comprising restoring the activity of miR-342 and/or EVL in the individual by one or more of: a. administering miR-342 or a mimetic (mimic) thereof to induce apoptosis of said cancer cells; b. administering EVL protein or a portion thereof to induce apoptosis of said cancer cells; c. administering one or more demethylation agent to the individual to reduce and/or remove methylation from methylated portions of miR-342 and/or EVL.
34. The method of claim 33, wherein the miR-342 comprises the nucleic acid sequence: GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGACAUGGUU AAUGGAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUA (SEQ ID NO: 19).
35. The method of claim 33, wherein the miR-342 comprises the nucleic acid sequence: UCUCACACAGAAAUCGCACCCGU (SEQ ID NO:9).
36. The method of claim 33, wherein the miR-342 mimetic comprises the nucleic acid sequence of
GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGACAUGGUU AAUGGAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUA (SEQ ID NO: 19) or UCUCACACAGAAAUCGCACCCGU (SEQ ID NO:9), which nucleic acid sequence is modified to alter the expression of one or more genes selected
1161036vl - 43 - from the group consisting of: KPNBl, ID4, PTGER4, SETD7, RASAl, GRINl, NHLH2, EFTUDl, BMPR2, SOX6, and E2F3.
37. The method of any of claims 33-36, wherein the miR-342 or a mimic thereof is in a formulation comprising an aqueous buffer and an excipient selected from the group consisting of liposomes, micellar structures, and capsids.
38. The method of claims 37 wherein the excipient comprises a cationic lipid.
39. The method of any of claims 33-38, wherein the formulation is administered by a method selected from the group consisting of intravenous, intra muscular, or intraperitoneal injection, orally, and inhalation.
40. The method of claim 39, wherein the formulation is administered by an intravenous method.
41. A diagnostic kit for detecting colorectal cancer or risk of colorectal cancer, the kit comprising: a. at least one forward amplification primer; and b. at least one reverse amplification primer, wherein said primers form at least one first primer pair designed to specifically amplify methylated DNA of an EVL gene or portion thereof.
42. The diagnostic kit of claim 41, further comprising at least one second primer pair that comprises at least one forward primer and at least one reverse primer, wherein said second primer pair is designed to specifically amplify unmethylated DNA of an EVL gene or portion thereof.
43. The diagnostic kit of claim 41 or 42, wherein said one or more first or second forward or reverse primer further comprises a 5' GC rich tail comprising approximately 15-25 nucleotides, wherein about 30-60% of the nucleotides are G or C.
44. The diagnostic kit of claim 41 or 42, wherein said one or more first forward primer comprises the sequence: 5'-TATTTTCGTTCGTTTCGTTTTTC - 3'(SEQ ID NO:1) or 5' GTTTTTTTTAAAGTTTYGTTTTTTAG-3' (SEQ ID NO:6)
45. The diagnostic kit of claim 41 or 42, wherein said one or more first reverse primer comprises the sequence: 5'- AAATACGCGCGTTACTATTCG - 3'(SEQ ID NO: 2) or AACTAATCTCAACACAACAACC-3' (SEQ ID NO:7).
46. The diagnostic kit of claim 42, wherein said one or more second forward primer comprises the sequence: 51- TATTTTTGTTTGTTTTGTTTTTTGT - 3' (SEQ ID NO: 3).
1161036vl - 44 -
47. The diagnostic kit of claim 42, wherein said one or more second reverse primer comprises the sequence: 5'-TAAAATACACACATTACTATTCACC -3' (SEQ ID NO: 4)
48. The diagnostic kit of claim 42, wherein said primers are designed to amplify a portion of a CpG island of the EVL gene.
49. The diagnostic kit of claim 42, wherein said primers are designed to amplify a portion of SEQ ID NO: 11.
50. The diagnostic kit of claim 42, wherein said primers are designed to amplify a portion of SEQ ID NO: 12.
51. The diagnostic kit of claim 41 or 42, further comprising: a. one or more methylation-specific restriction enzyme; and/or b. one or more methylation-specific antibody.
52. The diagnostic kit of any of claims 41-51, further comprising primer pairs useful for detecting levels of mRNA expressed from at least one gene selected from the group consisting of KPNB J, ID4, PTGER4, SETD7, RASAl, GRINl, NHLH2, EFTUDl, BMPR2, SOX6, and E2F3.
116103όvl - 45 -
PCT/US2009/033119 2008-02-04 2009-02-04 Epigenetic silencing of mir-342 in colorectal cancer Ceased WO2009100161A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US2611208P 2008-02-04 2008-02-04
US61/026,112 2008-02-04
US2779808P 2008-02-11 2008-02-11
US61/027,798 2008-02-11

Publications (2)

Publication Number Publication Date
WO2009100161A2 true WO2009100161A2 (en) 2009-08-13
WO2009100161A3 WO2009100161A3 (en) 2009-10-01

Family

ID=40888144

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/033119 Ceased WO2009100161A2 (en) 2008-02-04 2009-02-04 Epigenetic silencing of mir-342 in colorectal cancer

Country Status (1)

Country Link
WO (1) WO2009100161A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2208499A4 (en) * 2007-10-03 2011-12-28 Kyowa Hakko Kirin Co Ltd Nucleic acid capable of regulating the proliferation of cell
WO2013097868A1 (en) * 2011-12-27 2013-07-04 Region Syddanmark Detection of adenomas of the colon or rectum
WO2019246499A1 (en) * 2018-06-21 2019-12-26 Arizona Board Of Regents On Behalf Of The University Of Arizona Systems and methods for determining a treatment course of action
WO2023273257A1 (en) * 2021-06-30 2023-01-05 武汉艾米森生命科技有限公司 Diagnostic or auxiliary diagnostic reagent for colorectal cancer or precancerous lesions and use thereof, nucleic acid combination, and kit

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6818404B2 (en) * 1997-10-23 2004-11-16 Exact Sciences Corporation Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2208499A4 (en) * 2007-10-03 2011-12-28 Kyowa Hakko Kirin Co Ltd Nucleic acid capable of regulating the proliferation of cell
WO2013097868A1 (en) * 2011-12-27 2013-07-04 Region Syddanmark Detection of adenomas of the colon or rectum
WO2019246499A1 (en) * 2018-06-21 2019-12-26 Arizona Board Of Regents On Behalf Of The University Of Arizona Systems and methods for determining a treatment course of action
US12351877B2 (en) 2018-06-21 2025-07-08 Arizona Board Of Regents On Behalf Of The University Of Arizona Systems and methods for determining a treatment course of action
WO2023273257A1 (en) * 2021-06-30 2023-01-05 武汉艾米森生命科技有限公司 Diagnostic or auxiliary diagnostic reagent for colorectal cancer or precancerous lesions and use thereof, nucleic acid combination, and kit

Also Published As

Publication number Publication date
WO2009100161A3 (en) 2009-10-01

Similar Documents

Publication Publication Date Title
Grady et al. Epigenetic silencing of the intronic microRNA hsa-miR-342 and its host gene EVL in colorectal cancer
Sandoval et al. Validation of a DNA methylation microarray for 450,000 CpG sites in the human genome
Oshima et al. DNA methylation controls metastasis-suppressive 14q32-encoded miRNAs
JP5778708B2 (en) MicroRNA-based methods and compositions for the diagnosis and treatment of colon cancer-related diseases
Mees et al. EP300—A miRNA‐regulated metastasis suppressor gene in ductal adenocarcinomas of the pancreas
Pallasch et al. miRNA deregulation by epigenetic silencing disrupts suppression of the oncogene PLAG1 in chronic lymphocytic leukemia
EP2800820B1 (en) Methods and kits for detecting subjects having pancreatic cancer
US20150126374A1 (en) Hypermethylated gene markers for head and neck cancer
CN103080334B (en) For diagnosing microRNA biomarker and the method for early stage colorectal cancer and senior adenoma
JP2010535782A (en) Method for reversing methylation by targeting DNMT3A and DNMT3B
Guz et al. Elevated miRNA inversely correlates with E-cadherin gene expression in tissue biopsies from Crohn disease patients in contrast to ulcerative colitis patients
EP3122905B1 (en) Circulating micrornas as biomarkers for endometriosis
Hutchison et al. How microRNAs influence both hereditary and inflammatory-mediated colon cancers
CN104673883B (en) For predicting the microRNA biomarker and detection method of early stage non-metastatic colorectal cancer prognosis
CN102933719B (en) Compositions and methods for microrna expession profiling in plasma of colorectal cancer
KR20230003560A (en) Methods for early detection of colorectal cancer, prediction of treatment response and prognosis
WO2011045349A2 (en) Methods for diagnosing and treating a pathology associated with a synonymous mutation occuring within a gene of interest
WO2011154008A1 (en) Microrna classification of thyroid follicular neoplasia
WO2009100161A2 (en) Epigenetic silencing of mir-342 in colorectal cancer
US10190174B2 (en) Ulcerative colitis (UC)-associated colorectal neoplasia markers
Masson et al. Copy number variants associated with 18p11. 32, DCC and the promoter 1B region of APC in colorectal polyposis patients
EP3775212A1 (en) Identification of muscular mirnas as molecular biomarkers and co-adjuvant for the treatment of spinal muscular atrophy
EP3168310A1 (en) Methylation markers for colorectal cancer
KR101789384B1 (en) Epigenetic markers for diagnosing inflammatory bowel disease, composition, and diagnosing method by using thereof
WO2009071920A2 (en) Methods for identifying epigenetically silenced genes and novel tumour suppressor genes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09708416

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09708416

Country of ref document: EP

Kind code of ref document: A2