WO2009099465A2

WO2009099465A2 - Methods of using mir-199a as a marker and sequences of mir-199a as a therapeutic for cancer

Info

Publication number: WO2009099465A2
Application number: PCT/US2008/073168
Authority: WO
Inventors: Guillermo G. Mor; Joanne Weidhaas
Original assignee: Yale University
Priority date: 2007-08-14
Filing date: 2008-08-14
Publication date: 2009-08-13
Also published as: WO2009099465A3

Abstract

The invention relates to methods of measuring the level of expression of differentially expressed microRNAs (miRNAs), such as for example hsa-mir-199a, in a cancer cell as an indicator of the level of chemoresistance of the cancer cell. The invention further relates to methods of administering a nucleic acid, having a sequence based upon the sequence of a differentially expressed miRNA, such as for example hsa-mir-199a, to a cancer cell to diminish the chemoresistance of the cancer cell.

Description

TITLE

Methods of Using mir-199a as a Marker and Sequences of mir-199a as a Therapeutic for Cancer

BACKGROUND

Epithelial ovarian cancer (EOC) is the fourth leading cause of cancer- related deaths in women in the US and the leading cause of gynecologic cancer deaths (Schwartz, 2002, Cancer Treat. Res. 107:99-1 18). Chemoresistance is a major obstacle in the treatment of EOC. One major limitation in treatment is the development of cross-resistance to a wide range of chemotherapeutic agents. Although some studies have shown that proinflammatory processes play an important role, the exact mechanism and characteristics of chemoresistant EOC have been incompletely characterized. Although 80%-90% of patients initially respond to first- line chemotherapy such as carboplatin and paclitaxel, less than 10-15% will remain in remission (Jemal et al., 2006, CA Cancer J. Clin. 56:106-130). Treatment advances have led to improved five-year survival, approaching 45%, but not in overall survival.

Currently, the typing and staging of ovarian cancer is based on histopathologic characteristics. The epithelial type is the most common form of ovarian cancer in the United States and Europe. Almost all patients with ovarian cancer receive the same first-line chemotherapy consisting of a platinum- and taxane- based regimen. However, 20-25% of patients do not respond to this treatment. Thus, despite the fact that histologically, all of these tumors represent the same type of cancer, there is an unknown underlying biology that results in the differential behavior and response to treatment. Understanding the molecular mechanisms facilitating the development of chemoresistance is paramount in the development of individualized therapeutic regimen to improve treatment success.

Recent studies have demonstrated a potential link between inflammation, cancer progression and chemoresistance (Balkwill and Coussens, 2004, Nature 431 :405-406; Chen et al, 2007, Am. J. Reprod. Immunol. 57:93-107; Karin et al, 2002, Nat. Rev. Cancer 2:301-310). NF-κB is one of the key transcription factors in pro-inflammatory response, and some studies have been reported that link NF-κB activation and cancer development (Chen et al, 2007, Am. J. Reprod. Immunol. 57:93-107). Cytokines and chemokines, such as IL-6, IL-8, TNF-α, MCP-I, GRO-α and MIF produced at the microenvironment by immune cells through NF-κB activation, are thought to drive the neoplastic process (Balkwill and Coussens, 2004, Nature 431 :405-406).

However, the contribution of cancer cells themselves (especially non- leukemic cancer cells) in the maintenance of a proinflammatory environment that promotes cancer growth is largely unstudied and is sometimes considered passive. This is despite the fact that some studies have shown that NF-κB, and its activator IKB Kinases (IKKs) are constitutively active in most cancer cells (Chen et al , 2007, Am. J. Reprod. Immunol. 57:93-107; Shishodia and Aggarwal, 2004, Biochem. Pharmacol. 68:1071-1080).

The IKK complex is the direct upstream activator of NF-κB. The canonical IKK complex consists of 3 major subunits, IKKα, IKKβ and IKKγ. By phosphorylating the 'Inhibitor of NF-κBα' (IκBα), activated IKKs promote the proteosome-mediated degradation of IκBα and nuclear translocation of NF-κB. While IKKα is more important in cell differentiation, lymphoid organogenesis and the regulation of adaptive immunity (Hacker and Karin, 2006, Sci STKE 2006, rel3; Liu et al, 2006, Proc. Natl. Acad. Sci. USA 103:17202-17207), IKKβ plays a role in the production of pro-inflammatory cytokines related to cell survival and cell proliferation (Greten et al, 2004, Cell 118:285-296; Hu et al, 2004, Cell 117:225- 237). IKKβ has been found to be highly active in certain cancers including breast cancer, pancreatic cancer, thyroidal C-cells carcinoma, melanoma and acute myeloid leukemia (Baumgartner et al, 2002, Leukemia 16:2062-2071 ; Li et al, 2004, Cancer 101 :2351-2362; Ludwig et al, 2001, Cancer Res. 61 :4526-4535; Romieu-Mourez et al, 2001, Cancer Res. 61 :3810-3818; Tamatani et al 2001 , Cancer Lett. 171 :165-172; Yang and Richmond, 2001 , Cancer Res. 61 :4901-4909). IKKβ deletion in mouse enterocytes decreased the incidence of colitis-associated tumor by 75% (Greten et al , 2004, Cell 118:285-296). In addition, Hu et al previously reported that the breast cancer cell line 453 stably expressing IKKβ has a higher proliferation rate than its IKKβ-negative counterpart (Hu et al, 2004, Cell 117:225-237). Tumors, like normal tissues, have the ability of compensatory proliferation in response to injury and tissue damage (including necrosis and apoptosis). This tissue repair process has been reported to depend on TLR4-MyD88 signaling (Fukata et al, 2005, Am. J. Physiol. Gastrointest. Liver Physiol. 288:G1055-1065). LPS, a ligand for TLR4, was shown to accelerate wound repair in vitro (Koff et al, 2006, J. Immunol. 177:8693-8700). TLR4-MyD88 signaling is important to maintain intestinal epithelial homeostasis in response to gut injury, and both TLR4 and MyD88 knockout mice displayed impaired compensatory proliferation and increased apoptosis (Fukata et al, 2005, Am. J. Physiol. Gastrointest. Liver Physiol. 288:G1055-1065; Pull et al, 2005, Proc. Natl. Acad. Sci. USA 102:99-104; Rakoff-Nahoum et al, 2004, Cell 118:229-241). Similarly, in a mouse model of acute lung injury, hyaluronan released from injured cells protected epithelial cells from apoptosis through the TLR2/4-MyD88-NF-κB pathway (Jiang et al, 2005, Nat. Med. 11 :1173-1179). However, these studies focused only on the contribution of the immune cells. Recently, the ubiquitous expression of Toll-like receptor (TLR)-4 in EOC cells was described and that the ligation of TLR-4 by LPS or paclitaxel induced cell proliferation and enhanced cytokine/chemokine production (Kelly et al, 2006, Cancer Res. 66:3859-3868). However, this effect was limited to a group of EOC cells expressing the TLR adaptor protein MyD88 (Kelly et al, 2006, Cancer Res. 66:3859-3868).

The ability to identify cancer cells having a greater level of chemoresistance, as well as the ability to diminish cancer cell chemoresistance, will aid in the characterization and treatment of chemoresistant cancer cells. The present invention fulfills these needs.

SUMMARY OF THE INVENTION

The invention relates to methods of measuring the level of expression of differentially expressed micro RNAs (miRNAs), such as for example mir-199a, in a cancer cell as an indicator of the level of chemoresistance of the cancer cell. The invention further relates to methods of administering a nucleic acid, having a sequence based upon the sequence of a differentially expressed miRNA, such as for example mir-199a, to a cancer cell to diminish the chemoresistance of the cancer cell. In one embodiment, the invention is a method of identifying a chemoresistant cancer cell by measuring the level of mir-199a miRNA in a cancer cell and comparing the level of mir-199a miRNA in that cancer cell to the level of mir- 199a miRNA in a Type I epithelial ovarian cancer cell; wherein when the level of mir-199a miRNA detected in the cancer cell is not more than about 1.2-fold the level of mir-199a miRNA in the Type I epithelial ovarian cancer cell, the cancer cell is identified as chemoresistant. In a further embodiment, the level of mir-199a miRNA in the cancer cell is also compared to the level of mir-199a miRNA in a Type II epithelial ovarian cancer cell; wherein when the level of mir-199a miRNA detected in the cancer cell is not more than about 0.6-fold the level of mir-199a miRNA in the Type II epithelial ovarian cancer cell, the cancer cell is identified as chemoresistant. In various embodiments of the invention, the cancer cell identified as chemoresistant is an epithelial ovarian cancer cell. In various embodiments, the sequence of the mir- 199a miRNA comprises at least one of the group consisting of consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO.8, SEQ ID NO:9, and SEQ ID NO: 10; as well as fragments, variants and modifications thereof. The level of mir-199a can be measured using methods known in the art for detecting and measuring nucleic acids, such as miRNA, including, but not limited to, PCR, northern blot and microarray.

In another embodiment, the invention is a method of diminishing the level of expression of IKKβ in a cancer cell by administering to the cancer cell a nucleic acid that binds to IKKβ mRNA in the cancer cell. In various embodiments, the cancer cell can be an epithelial ovarian cancer cell, a mucinous ovarian cancer cell, a clear cell carcinoma of the ovaries, a mucinous ovarian cancer cell or a granulose ovarian cancer cell. In various embodiments, the sequence of nucleic acid administered to the cancer cell is based on at least one of the sequences of the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10; as well as fragments, variants and modifications thereof. In some embodiments, the nucleic acid is expressed from a vector. In some embodiments, the nucleic acid binds to the 3' UTR of the IKKβ mRNA. In some embodiments, the diminution of the level of expression of IKKβ occurs through the diminution of the level of IKKβ mRNA. In some embodiments, the diminution of the level of expression of IKKβ occurs through the diminution of the level of translation of IKKβ mRNA. In some embodiments, the diminution of the level of expression of IKKβ in the cancer cell reduces the chemoresistance of the cancer cell. In various embodiments, the nucleic acid is at least one of the group selected from an antisense nucleic acid, a polynucleotide, a miRNA, an siRNA and a ribozyme.

In another embodiment, the invention is a method of diminishing the level of chemoresistance of a cancer cell by administering to the cancer cell a nucleic acid that binds to IKKβ mRNA in the cancer cell and thereby diminishes the level of expression of IKKβ in the cancer cell. In various embodiments, the cancer cell can be an epithelial ovarian cancer cell, a mucinous ovarian cancer cell, a clear cell carcinoma of the ovaries, a mucinous ovarian cancer cell or a granulose ovarian cancer cell. In various embodiments, the sequence of nucleic acid administered to the cancer cell is based on at least one of the sequences of the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10; as well as fragments, variants and modifications thereof. In some embodiments, the nucleic acid is expressed from a vector. In some embodiments, the nucleic acid binds to the 3' UTR of the IKKβ mRNA. In some embodiments, the diminution of the level of expression of IKKβ occurs through the diminution of the level of IKKβ mRNA. In some embodiments, the diminution of the level of expression of IKKβ occurs through the diminution of the level of translation of IKKβ mRNA. In various embodiments, the nucleic acid is at least one of the group selected from an antisense nucleic acid, a polynucleotide, a miRNA, an siRNA and a ribozyme.

In another embodiment, the invention is a method of treating a patient with cancer by administering to a cancer cell of the patient, a nucleic acid that binds to IKKβ mRNA in the cancer cell and thereby diminishes the level of expression of IKKβ in the cancer cell. In various embodiments, the cancer cell can be an epithelial ovarian cancer cell, a mucinous ovarian cancer cell, a clear cell carcinoma of the ovaries, a mucinous ovarian cancer cell or a granulose ovarian cancer cell. In various embodiments, the sequence of nucleic acid administered to the cancer cell is based on at least one of the sequences of the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10; as well as fragments, variants and modifications thereof. In some embodiments, the nucleic acid is expressed from a vector. In some embodiments, the nucleic acid binds to the 3' UTR of the IKKβ mRNA. In some embodiments, the diminution of the level of expression of IKKβ occurs through the diminution of the level of IKKβ mRNA. In some embodiments, the diminution of the level of expression of IKKβ occurs through the diminution of the level of translation of IKKβ mRNA. In some embodiments, the diminution of the level of expression of IKKβ in the cancer cell reduces the chemoresistance of the cancer cell. In various embodiments, the nucleic acid is at least one of the group selected from an antisense nucleic acid, a polynucleotide, a miRNA, an siRNA and a ribozyme. In various embodiments, the patient being treated is also being treated with a chemotherapeutic agent, such as for example, one or more of carboplatin, paclitaxel, and docetaxel, cisplatin, doxorubicin, and topotecan.

BRIEF DESCRIPTION OF THE DRAWINGS

For the purpose of illustrating the invention, there are depicted in the drawings certain embodiments of the invention. However, the invention is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawings.

Figure IA depicts the results of an example experiment demonstrating the differential response to paclitaxel treatment by Type I and Type II OC cells in a xenograft model. The two types of OC cells were injected subcutaneously into SCID mice. After tumors were observed, animals were treated with paclitaxel (10 mg/kg) or PBS, and tumor growth was monitored on a daily basis. Black arrows indicate injections. Panel A. Type II ovarian cancer cells. Panel B. Type I ovarian cancer cells. At least five animals were included per group. Each experiment was repeated twice.

Figure 1 B depicts the results of an example experiment demonstrating the correlation between MyD88 tumor expression and patient response and survival. Kaplan-Meier curves illustrate the duration of progression-free interval for patients with MyD 88 -positive and MyD88-negative primary tumors. The pathological diagnosis was papillary serous adenocarcinoma of the ovary for all patients. However, the clinical course and the response to combination chemotherapy with carboplatin and paclitaxel were markedly different and correlated with MyD88 expression in the analyzed tumors. Mean progression-free interval was zero for patients with MyD88- positive tumors (n = 7) and 35 months for patients with MyD 88 -negative tumors (n = 5) treated with carboplatin and paclitaxel. This difference was statistically significant (Log Rank Statistical Test p = 0.009).

Figure 1 C depicts the results of an example experiment demonstrating the correlation between MyD88 tumor expression and patient response and survival. Kaplan-Meier curves illustrate overall survival for patients with MyD88-positive and MyD88-negative primary tumors. The pathological diagnosis was papillary serous adenocarcinoma of the ovary for all patients. However, the clinical course and the response to combination chemotherapy with carboplatin and paclitaxel were markedly different and correlated with MyD 88 expression in the analyzed tumors. Overall survival according to the MyD88 status of the analyzed tumors shows divergent Kaplan-Meier curves and was statistically significant (-2 log Likelihood Ratio Test p = 0.022).

Figure 2A depicts the results of an example experiment demonstrating the differential response of Type I and Type II cells to paclitaxel, LPS and TNFβ as measured by cell viability determined by CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega). n = 3 per group. * = p<0.001. EOC cells were treated with LPS (10 μg/ml), paclitaxel (2 μM), or TNF-α (100 ng/ml) for 48 hours. Representative experiment often Type I and ten Type II EOC analyzed. Each experiment was repeated at least three times.

Figure 2B depicts the results of an example experiment demonstrating the differential response of Type I and Type II cells to paclitaxel, LPS and TNFβ as measured by apoptosis determined by evaluating Caspase 3/7 activity by Caspase-Glo 3/7 Assay (Promega). n = 3 per group. * = p<0.001. EOC cells were treated with LPS (10 μg/ml), paclitaxel (2 μM), or TNF-α (100 ng/ml) for 48 hours. Representative experiment of ten Type I and ten Type II EOC analyzed. Each experiment was repeated at least three times.

Figure 3 A depicts the results of an example experiment demonstrating endogenous cyclic NF-κB activity in Type I, but not Type II, ovarian cancer cells transfected with a luciferase reporter construct containing three NF -KB binding sites over a period of 12 hours.

Figure 3B depicts the results of an example experiment demonstrating LPS-induced NF-κB activity in Type I, but not Type II, ovarian cancer cells transfected with a luciferase reporter construct containing three NF-κB binding sites over a period of 12 hours.

Figure 3C depicts the results of an example experiment demonstrating paclitaxel-induced NF -KB activity in Type I, but not Type II, ovarian cancer cells transfected with a luciferase reporter construct containing three NF-κB binding sites over a period of 12 hours.

Figure 3D depicts the results of an example experiment demonstrating that treatment with TNFα increase NF-κB activity in both Type I and Type II ovarian cancer cells transfected with a luciferase reporter construct containing three NF-κB binding sites over a period of 12 hours.

Figure 3E depicts the results of an example experiment demonstrating nuclear translocation of p65 following TNFα (10 ng/ml) treatment in both Type I and Type II cells. Note the high levels of p65 in the nuclear fraction of Type I cells without treatment compared to the same conditions on Type II EOC cells. Topoisomerase was used to determine the purity of the nuclear preparation. p65 = ReIA; Topol, topoisomerase I. Representative experiment of two Type I and Type II ovarian cancer cells. Similar results were observed with other cells of the same type, n = 3 per sample per time point.

Figure 3 F depicts the results of an example experiment demonstrating that treatment with lipopolysaccharide (LPS) and paclitaxel induced NF-kB activity in Type I but not in Type II EOC cells, at 12 hour after treatment. *P<0.05.

Figure 4A depicts the results of an example experiment demonstrating differential cytokine production in the supernatant of EOC cells without and with treatment with LPS (10 μg/ml), paclitaxel (2 μM) or TNF-α (10 ng/ml) for 48 h. Type I EOC cells expresses significant levels of inflammatory cytokines and the levels increased in response to treatment. No inflammatory cytokines were detected in Type II EOC cells in any condition.

Figure 4B depicts the results of an example experiment demonstrating that treatment of Type I EOC cells with Eriocalyxin B (EB), a NF-κB inhibitor, blocks the constitutive cytokine production as well as TNF-α-induced cytokine production. NT = no treatment. Figure representative of three independent experiments.

Figure 4C depicts the results of an example Western blot analysis for IκBα expression in ovarian cancer cells. Note the lack of IκBα expression in Type I EOC cells compared to Type II. Low IκBα expression corresponds to high MyD88 expression levels.

Figure 4D depicts the results of an example experiment demonstrating the differential expression of IKKα and IKKβ in Type I and Type II EOC cells. Type I EOC cells are characterized by a high IKKβ:IKKα ratio.

Figure 4E depicts the results of an example experiment demonstrating that transient overexpression of a constitutively active form of IKKβ (IKKβ S177E Sl 81 E) in Type II EOC cells induced a significant decrease on IκBα expression and increase on MyD88 expression. No change on IKKα expression was observed.

Figure 4F depicts the results of an example experiment demonstrating the differential expression of cytokines between Type I and Type II EOC cells.

Cytokine production was determined in the supernatant from EOC cells. Type I EOC cells express significant levels of inflammatory cytokines. No inflammatory cytokines were detected in Type II EOC cells in any condition. Representative of 20 evaluated EOC cells.

Figure 5 A depicts the results of an example experiment demonstrating that ectopic overexpression of IKKβ S177E S181E on Type II EOC cells promotes cytokine production.

Figure 5 B depicts the results of an example experiment demonstrating that transient ectopic overexpression of the WT IKKβ in a MyD 88 stable transfectant Type II cell line restored the functionality of the TLR-4 pathway, as determined by LPS-induced cytokine production. * = p<0.05. pCMV2-IKKEE, plasmid expressing a constitutively active form of IKKβ (IKKβ S177E Sl 81 E). MOCK, mock transfection with the empty plasmid pCMV2. Representative figure of an experiment using A2780 cells. Similar results were obtained with two additional Type II EOC cells.

Figure 6A depicts the results of an example experiment demonstrating the panel of differentially expressed miRNA in Type I and Type II cells. Note the similarity of miRNA expression between the Type II cell lines and their similar differences in relation to Type I. Red indicates miRNA upregulated in Type II versus Type I; green indicates miRNA downregulated in Type II versus Type I.

Figure 6B depicts the results of an example experiment demonstrating quantification of hsa-mir-199a in ovarian cancer cells using rRT-PCR. Data are normalized to beta-2 macroglobulin. Note the high expression levels of hsa-mir-199a in Type II cells compared to Type I cells.

Figure 6C depicts the results of an example experiment demonstrating:

(a) transient transfection of Type I cells with pre-miR-199a inhibits IKKβ expression and (b) transient transfection of Type II cells with anti-miR-199a induced IKKβ expression.

Figure 6D depicts the results of an example experiment demonstrating that miR- 199a suppressed the IKKβ 3 ' -UTR Luciferase reporter activity compared to mock transfection, whereas the negative control miRNA (miR-NC no. 1) did not result in any changes. Diagram of the Luciferase reporter plasmid to study the function of the IKKβ 3'-UTR of IKKB mRNA. The reporter consists of a Luciferase gene with the IKKβ 3'-UTR driven by a cytomegalovirus promoter. *P<0.001.

Figure 7 depicts a model of Type I and Type II EOC cells. Type I EOC cells have high levels of IKKβ expression due to low hsa-mir-199a; therefore, when stimulated, NF-κB activation leads to cytokine production, cell proliferation and induction of anti-apoptotic proteins. In Type II cells, expression of IKKβ is low due to high hsa-mir-199a expression levels, therefore an incomplete TLR4-MyD88-NF-κB pathway cannot respond to ligands, resulting in no cytokine production and chemosensitivity. Figure 8 depicts the results of an example experiment demonstrating the cytokine profiles of Type I and Type II ovarian cancer tumors. Type I and Type II cells were injected subcutaneously into SCID mice, as described for experiments depicted in Figure IA. At the end of the treatment, tumor samples were homogenized and the tumor cytokine content was determined using Multiplex. Note the increase in cytokine levels of type I EOC cells following paclitaxel treatment, n = 5 animals per group.

Figure 9A depicts the results of an example experiment demonstrating the detection of MyD88 expression in ovarian cancer tumors. The expression of MyD88 was determined in ovarian cancer patients using Laser Capture Microdissection (LCMD) or immunocytochemistry. Frozen sections were immunostained with CD45 antibody and CD45 -negative EOC cells were microdissected-using LCMD. MyD88 expression was then determined by Western blot. Left panel, representative MyD88-negative tumor; right panel, representative MyD88-positive tumor.

Figure 9B depicts the results of an example experiment demonstrating the detection of MyD88 expression in ovarian cancer tumors. The expression of MyD88 was determined in ovarian cancer patients using immunocytochemistry. Paraffin-embedded sections were stained with rabbit anti-human MyD88 antibody by immunohistochemistry. A and B, representative MyD 88 -positive tumors; C and D, representative MyD88-positive tumors.

Figure 1 OA depicts the results of an example experiment demonstrating the differential response of Type I and Type II cells to high dose TNF- α. Type I cell lines (left) are resistant, while Type II cell lines (right) are sensitive to 100 ng/ml TNF-α-induced apoptosis.

Figure 1 OB depicts the results of an example experiment demonstrating the differential response of Type I and Type II cells to high dose TNF-α. TNF-α- induced apoptosis in Type II cells involved the activation of Caspase-3, Caspase-8 and Caspase-9. No caspase activation was detected in TNF-α-treated Type I cells, n = 3 per group. *<0.05. Figure 1 OC depicts the results of an example experiment demonstrating that TNF-α treatment induces the phosphorylation of IKKβ but no IKKα in Type I EOC cells.

Figure 11 depicts the results of an example experiment demonstrating the inhibition of NF-κB reverse TNFα-resistance in Type I EOC cells. Type I EOC cells were treated with the NF-κB inhibitor Eriocalyxin B followed by TNF-α treatment. Note the significant increase on caspase 3/7 activity observed in the combination Eriocalyxin B + TNFα while no activity was observed in the group treated with TNF-α alone, n = 3 per group. * = p<0.05.

Figure 12 depicts the results of an example experiment demonstrating the correlation of cellular IκBα level to endogenous NF-κB activity. Cellular IκBα levels in Type I EOC cells correlates with the autonomous cyclicity of NF-κB (Figure 4A), while Type II cells displayed a stably high level of IκBα expression. Figure is representative of 3 independent experiments.

Figure 13 A depicts the results of an example experiment demonstrating that Type I and Type II cells have similar levels of IKKβ mRNA, as determined by RT-PCR.

Figure 13B depicts the results of an example experiment demonstrating the miRNA profile of 1 Type I cell line and 2 Type II cell lines by Invitrogen NCODE miRNA microarray.

Figure 13C depicts 3 putative hsa-mir-199a binding sites within the 3'- untranslated region (UTR) of the IKKB mRNA, as predicted by Pictar (pictar.bio.nyu.edu).

DETAILED DESCRIPTION

In one embodiment of the invention, the level of expression in a cancer cell of a differentially expressed miRNA, such as mir-199a, is used to identify a chemoresistant cancer cell. In another embodiment, the level of expression in a cancer cell of a differentially expressed miRNA, such as mir-199a, is used to determine whether a cancer cell is chemoresistant. In another embodiment, a nucleic acid, having a sequence based upon the sequence of a differentially expressed miRNA, such as mir-199a, is administered to a cancer cell to diminish its chemoresistance.

Detailed herein are molecular and cellular characteristics of Type I

EOC cells (chemoresistant) and Type II EOC cells (chemosensitve). Type I EOC cells have developed mechanisms that enhance their tissue repair capability that allow them to respond to, and grow, after chemotherapy. They present a profile that promotes tumor growth, inhibits apoptosis and shows enhanced chemoresistance. Identification of markers in patient tumor samples can facilitate the optimum selection of treatment protocols, and open new venues for the development of effective therapy for chemoresistant ovarian cancers. Type I EOC cells have been identified as ovarian cancer stem cells.

Using EOC cells isolated from malignant ovarian cancer ascites, or from solid ovarian cancer tumors, intracellular molecules involved in the differential response of these cells to chemotherapy were identified. Type I and Type II EOC cells display remarkable differences in their responses to various stimuli and their expression of intracellular proteins. Specific markers of chemoresistance can be used to guide treatment selection for individual patients, as well as to guide the development of new therapies specific to each cell type. In an embodiment of the invention, the level of expression of mir-199a miRNA, disclosed herein to be differentially expressed between Type I and Type II EOC cells, can be used as a marker to identify chemoresistant cancer cells and to characterize the level of chemoresistance of cancer cells. In another embodiment, the differentially expressed mir-199a miRNA, as well as other nucleic acids sharing all or some portion of the sequence of mir-199a, can be administered to a cancer cell to diminish the level of chemoresistance of the cancer cell. The data disclosed herein describe characteristics of Type I and Type II EOC cells, including their levels of NF-κB activation, IKKβ expression, cytokine production and miRNA profiles, all of which correlate with tumor survival, progression and level of chemoresistance. Generally, Type I cells can be characterized by: i) constitutive cyclicity of NF-κB activity; ii) continued production of cytokines which further increases following LPS, paclitaxel or TNF-α stimulation; iii) high expression of MyD88, low IκBα, and a high IKKβ/IKKα ratio; iv) low levels of mir- 199a and v) chemoresistance. Moreover, Type I cells have been identified as ovarian cancer stem cells. The characteristics of Type II cells are the opposite: i) absence of NF-κB activity; ii) no cytokines production; iii) MyD88 negative, high IκBα expression, and a low IKKβ/IKKα ratio; iv) high levels of mir-199a and v) chemosensitivity.

The data disclosed herein also demonstrate that, in addition to cancer cell lines, the differential expression of miRNA, including mir-199a, is a feature of ovarian cancer cells isolated from patient tumor samples using laser capture microdissection to confirm the presence of higher levels of mir-199a, in tumors of chemosensitive patients, but not of chemoresistant patients. Cells used in experiments described herein include primary cells obtained from patients with ovarian cancer, permitting the establishment of a correlation between the molecular phenotype, chemoresistant propensity, and clinical outcome. In an embodiment of the invention, the level of expression of mir-199a miRNA in cells isolated from tumors of patients can be used as a marker to identify chemoresistant cancer cells and to characterize the level of chemoresistance of the patient's cancer cells. In another embodiment, the differentially expressed mir-199a miRNA, as well as other nucleic acids sharing all or some portion of the sequence of mir-199a, can be administered to the cancer cells of the patient to diminish the level of chemoresistance of the patient's cancer cells.

The data presented herein suggest that tumor cells, in addition to immune cells, may also actively contribute to the inflammatory process that may enhance the repair process, promote cell growth, and contribute to the chemoresistance of cancer cells that have a functional TLR4-MyD88-NF-κB signaling pathway. Although not wishing to be bound by any particular theory, it may be that the observed elevated repair capacity of Type I EOC cells following chemotherapeutic drug treatment contributes, at least in part, to chemoresistance and tumor recurrence. The presence of necrotic centers in tumors has been associated with poor prognosis due to the occurrence of strong immune infiltration and inflammation, suggesting that the damage induced by chemotherapeutic drugs could also initiate a compensatory repair process, which includes all the cellular and molecular characteristics associated with inflammation, including: immune infiltration, cytokine and chemokine production, resistance to apoptosis and high rate of proliferation. All these characteristics have been observed in Type I EOC cells isolated from tumors of chemoresistant ovarian cancer patients.

The data disclosed herein demonstrate for the first time a functional role for mir- 199a as a regulator of IKKβ expression. Type I and Type II EOC cells were shown to differ in their miRNA profile, mir- 199a was substantially overexpressed in Type II EOC cells compared with Type I EOC cells, and its expression was associated with the diminution of IKKβ expression. In an embodiment the invention, the differentially expressed mir- 199a miRNA, as well as other nucleic acids sharing all or some portion of the sequence of mir- 199a, can be administered to a cancer cell to diminish the level of IKKβ expression in the cancer cell.

In addition to MyD88, high levels of IKKβ are also responsible for the phenotype of Type I EOC cells. IKKβ is one of the catalytic subunits of the IKK complex that has been shown to be crucial for the NF-κB -mediated production of proinflammatory cytokines that are related to cell survival and cell proliferation (Greten et al, 2004, Cell 1 18:285-296; Hu et al, 2004, Cell 117:225-237), and has been found highly active in many types of cancer (Baumgartner et al , 2002, Leukemia 16:2062-2071; Li et al, 2004, Cancer 101 :2351-2362; Ludwig et al, 2001, Cancer Res. 61 :4526-4535; Romieu-Mourez et α/. , 2001, Cancer Res. 61:3810-3818;

Tamatani et al 2001, Cancer Lett. 171 :165-172; Yang and Richmond, 2001, Cancer Res. 61:4901-4909). Consistent with these findings, it was observed that high IKKβ levels in Type I EOC cells correlated with high levels of cytokine production. These cytokines and chemokines had been shown to be related to cell proliferation and chemoresistance (Balkwill, 2004, Nat. Rev. Cancer 4:540-550; Duan et al. , 2002, Cytokine 17:234-242; Nakanishi et al., 2005, Nat. Rev. Cancer 5:297-309). As disclosed herein, the transient overexpression of IKKβ in Type II cells restored both cytokine production and MyD88 expression, confirming that IKKβ plays a very important role in the proinflammatory response in Type I cells that may lead to chemoresistance and tumor recurrence.

Although not wishing to be bound by any particular theory, distinct characteristics of Type I and Type II EOC cells may result, at least in part, from differential responses to stimulation signals from pro-inflammatory cell surface receptors. The data presented herein are consistent with the potential explanation that Type I cells, due to their high IKKβ levels and low mir-199a expression levels, can commence IKKβ-induced NF-κB activation upon stimulation, which leads to the production of cytokines, chemokines, anti-apoptotic proteins, and cell proliferation. Also, the data presented herein are consistent with the potential explanation that Type II cells, however, due to their low IKKβ levels and high levels of mir-199a, when stimulated either do not respond due to an incomplete pathway (e.g., the TLR-4 pathway), or possibly activate alternative pathways such as IKKα-dependent NF-κB pathway, or the RAS-RAF-ERK pathway. It has been observed that Type II cells have a much higher level of activated ERK compared to that of Type I cells.

Diagnostic Assays

The present invention has application in various diagnostic assays, including, determining whether a cancer cell is chemoresistant or chemosensitve. Based on the novel biological activities of differentially expressed miRNAs, such as mir-199a, an embodiment of the invention is a method for identifying chemoresistant cancer cells in a biological sample utilizing the differentially expressed miRNAs, such as for example mir-199a.

A biological sample can be any mammalian cell or tissue, or cell or tissue-containing composition or isolate. For example, one biological sample may be a cell scraping, exudate or tissue specimen from biopsy, e.g., cervical scraping, tumor tissue. Thus, the diagnostic method of the invention comprises isolating miRNA from the biological sample and measuring the amount or level of differentially expressed miRNAs, such as, for example, mir-hsa-199a. The amount or level of differentially expressed miRNA, such as, for example, mir-has-199a, present in the biological sample can then be compared to the amount or level in one or more standards or comparators. By way of non-limiting examples, standards and/or comparators can include, cells known to be Type I EOC cells and/or cells known to be Type II EOC cells. By way of further non-limiting examples, standards and/or comparators can include historical normal or average values of differentially expressed miRNA obtained from past measurements of the amount or level of miRNAs present in cells known to be Type I EOC cells and/or cells known to be Type II EOC cells.

In some embodiments, the level of mir-199a miRNA detected in a biological sample is compared to the level of mir-199a miRNA detected in a Type I EOC cell comparator. In various embodiments, when the level of mir-199a miRNA detected in the biological sample is not more than about 0.8-fold, 0.9-fold, 1.0-fold, 1.1 -fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold or 1.8-fold the level of mir-199a miRNA detected in the Type I EOC cell comparator, the biological sample is identified as chemoresistant.

In other embodiments, the level of mir-199a miRNA detected in a biological sample is compared to the level of mir-199a miRNA detected in a Type II EOC cell comparator. In various embodiments, when the level of mir-199a miRNA detected in the biological sample is not more than about 0.4-fold, 0.45-fold, 0.5-fold, 0.55-fold, 0.6-fold, 0.65-fold, 0.7-fold, 0.75-fold, 0.8-fold, 0.85-fold, or 0.9-fold the level of mir-199a miRNA detected in the Type II EOC cell comparator, the biological sample is identified as chemoresistant. In still further embodiments, whether a biological sample is chemoresistance or chemosensitive is determined by comparing the level of mir-199a miRNA in the biological sample to level of mir-199a miRNA in both Type I EOC cell and Type II EOC cell comparators.

In various embodiments, the cancer cell can be an epithelial ovarian cancer cell, a mucinous ovarian cancer cell, a clear cell carcinoma of the ovaries, a mucinous ovarian cancer cell or a granulose ovarian cancer cell. It should be understood that the type of cancer cells useful in the methods of the invention is not limited to the type of cancer cells named herein, but rather can be any type of cancer cell that displays a chemoresistant phenotype that correlates with the level of one or more differentially expressed miRNA, such as for example, mir-199a.

Methods of detecting and measuring the amount of RNA, such as miRNA, present in biological samples are well known in the art. The invention contemplates the identification of differentially expressed miRNA to identify miRNA differentially expressed between chemoresistant and chemosensitive cancer cells by, for example, nucleic acid microarray, northern blot, northern dot blot, quantitative PCR and/or quantitative real-time PCR.

Nucleic acid arrays that are useful in the present invention include arrays such as those commercially available from Invitrogen (Santa Clara, CA) (example arrays and methods are shown on the website at www.invitrogen.com). The practice of the present invention may employ, unless otherwise indicated, conventional techniques and descriptions of organic chemistry, polymer technology, molecular biology (including recombinant techniques), cell biology, biochemistry and immunology, which are within the skill of the art. Such conventional techniques include polymer array synthesis, hybridization, ligation, and detection of hybridization using a label. Specific illustrations of suitable techniques can be had by reference to the examples herein below. However, other equivalent conventional procedures can, of course, also be used. Such conventional techniques and descriptions can be found in standard laboratory manuals such as Genome Analysis: A Laboratory Manual Series (VoIs. I-IV), Using Antibodies: A Laboratory Manual, Cells: A Laboratory Manual, PCR Primer: A Laboratory Manual, and Molecular Cloning: A Laboratory Manual (all from Cold Spring Harbor Laboratory Press); Stryer, L., 1995, Biochemistry (4th Ed.) Freeman, New York; Gait, 1984, "Oligonucleotide Synthesis: A Practical Approach," IRL Press, London, Nelson and Cox; Lehninger, Principles of Biochemistry 3rd Ed., W.H. Freeman Pub., New York, N.Y.; Berg et al, 2002, Biochemistry, 5th Ed., W.H. Freeman Pub., New York, N. Y., Nolan et al, 2006, Nat. Protoc. 1 : 1559-1582, Higuchi et al, 1993, Biotechnology 11 : 1026-1030, and Mackay, 2007, Real-Time PCR in Microbiology, Norwich, U.K., all of which are herein incorporated in their entirety by reference for all purposes. The present invention also contemplates sample preparation and quantitation methods in certain embodiments. Prior to or concurrent with miRNA expression analysis, the biological sample may be amplified using a variety of mechanisms, some of which may employ PCR and/or RT-PCR. See, for example, PCR Technology: Principles and Applications for DNA Amplification (Ed. H.A. Erlich, Freeman Press, NY, NY, 1992); PCR Protocols: A Guide to Methods and

Applications (Eds. Innis, et al, Academic Press, San Diego, Calif., 1990); Mattila et al, Nucleic Acids Res. 19, 4967 (1991); Eckert et al, PCR Methods and Applications 1, 17 (1991); PCR (Eds. McPherson et al, IRL Press, Oxford); and US Pat Nos 4,683,202, 4,683,195, 4,800,159 4,965,188, and 5,333,675, each of which is incorporated herein by reference in their entireties for all purposes.

Other suitable amplification methods include the ligase chain reaction (LCR) (for example, Wu and Wallace, Genomics 4, 560 (1989), Landegren et al, Science 241, 1077 (1988) and Barringer et al Gene 89:117 (1990)), transcription amplification (Kwoh et al, Proc. Natl. Acad. Sci. USA 86, 1 173 (1989) and WO88/10315), self-sustained sequence replication (Guatelli et al, Proc. Nat. Acad. Sci. USA, 87, 1874 (1990) and WO90/06995), selective amplification of target polynucleotide sequences (US Pat No 6,410,276), consensus sequence primed PCR (CP-PCR) (US Pat No 4,437,975), arbitrarily primed PCR (AP-PCR) (US Pat Nos

5,413,909, 5,861,245), degenerate oligonucleotide primed PCR (DOP-PCR) (Wells et al, 1999, Nuc Acids Res 27:1214-1218) and nucleic acid based sequence amplification (NABSA). (See, US Pat Nos 5,409,818, 5,554,517, and 6,063,603, each of which is incorporated herein by reference). Other amplification methods that may be used are described in, US Pat Nos 5,242,794, 5,494,810, 4,988,617 and in US Ser No 09/854,317, each of which is incorporated herein by reference.

Additional methods of sample preparation and techniques for reducing the complexity of a nucleic sample are described in Dong et al, Genome Research 1 1, 1418 (2001), in US Pat Nos 6,361,947, 6,391,592 and US Ser Nos 09/916,135, 09/920,491 (US Patent Application Publication 20030096235), 09/910,292 (US Patent Application Publication 20030082543), and 10/013,598.

Methods for conducting nucleic acid hybridization assays, for example, but not limited to northern blots and microarrays, have been developed in the art. Hybridization assay procedures and conditions will vary depending on the application and are selected in accordance with the general binding methods known including those referred to in: Sambrook et al (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York); Berger and Kimmel Methods in Enzymology, Vol. 152, Guide to Molecular Cloning Techniques (Academic Press, Inc., San Diego, Calif, 1987); Young and Davism, P.N.A.S, 80: 1194 (1983). Methods and apparatus for carrying out repeated and controlled hybridization reactions have been described in US Pat Nos 5,871,928, 5,874,219, 6,045,996 and 6,386,749, 6,391,623 each of which are incorporated herein by reference.

It is also contemplated that the hybridized nucleic acids can be detected by detecting one or more labels attached to the sample nucleic acids. The labels may be incorporated by any of a number of means well known to those of skill in the art. In one embodiment, the label is simultaneously incorporated during the amplification step in the preparation of the sample nucleic acids. Thus, for example, PCR with labeled primers or labeled nucleotides will provide a labeled amplification product. In another embodiment, transcription amplification, as described above, using a labeled nucleotide (e.g. fluorescein-labeled UTP and/or CTP) incorporates a label into the transcribed nucleic acids. In another embodiment PCR amplification products are fragmented and labeled by terminal deoxytransferase and labeled dNTPs. Alternatively, a label may be added directly to the original nucleic acid sample (e.g., mRNA, polyA mRNA, cDNA, etc.) or to the amplification product after the amplification is completed. Means of attaching labels to nucleic acids are well known to those of skill in the art and include, for example, nick translation or end-labeling (e.g. with a labeled RNA) by kinasing the nucleic acid and subsequent attachment (ligation) of a nucleic acid linker joining the sample nucleic acid to a label (e.g., a fluorophore). In another embodiment label is added to the end of fragments using terminal deoxytransferase.

Detectable labels suitable for use in the present invention include any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Useful labels in the present invention include, but are not limited to: biotin for staining with labeled streptavidin conjugate; anti-biotin antibodies, magnetic beads (e.g., Dynabeads.TM.); fluorescent dyes (e.g., fluorescein, texas red, rhodamine, green fluorescent protein, and the like); radiolabels (e.g., .sup.3H, .sup.1251, .sup.35S, .sup.4C, or .sup.32P); phosphorescent labels; enzymes (e.g., horse radish peroxidase, alkaline phosphatase and others commonly used in an ELISA); and colorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads. Patents teaching the use of such labels include US Pat Nos 3,817,837, 3,850,752, 3,939,350, 3,996,345, 4,277,437, 4,275,149 and 4,366,241 , each of which is hereby incorporated by reference in its entirety for all purposes. Means of detecting such labels are well known to those of skill in the art. Thus, for example, radiolabels may be detected using photographic film or scintillation counters; fluorescent markers may be detected using a photodetector to detect emitted light. Enzymatic labels are typically detected by providing the enzyme with a substrate and detecting the reaction product produced by the action of the enzyme on the substrate, and calorimetric labels are detected by simply visualizing the colored label.

Nucleic Acids

Nucleic acids according to the present invention may include any polymer or oligomer of pyrimidine and purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively. (See Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982) which is herein incorporated in its entirety for all purposes). Indeed, the present invention contemplates any deoxyribonucleotide, ribonucleotide or peptide nucleic acid component, and any chemical modifications thereof, such as methylated, hydroxymethylated or glucosylated forms of these bases, and the like. The polymers or oligomers may be heterogeneous or homogeneous in composition, and may be isolated from naturally occurring sources or may be artificially or synthetically produced. In addition, the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single-stranded or double-stranded form, including homoduplex, heteroduplex and hybrid states. By way of non-limiting examples, nucleic acids useful in the invention include sense nucleic acids, antisense nucleic acids, polynucleotides, siRNA, miRNAs and ribozymes. In various embodiments of the invention, the differentially expressed mir-199a miRNA, as well as other nucleic acids sharing all or some portion of the sequence of mir-199a, can be administered to a cancer cell to diminish the level of IKKβ expression in the cancer cell. In other embodiments of the invention, the differentially expressed mir-199a miRNA, as well as other nucleic acids sharing all or some portion of the sequence of mir-199a, can be administered to a cancer cell to diminish the level of chemoresistance of the cancer cell. By way of non-limiting examples, mir-199a nucleic acid reference sequences, upon which the sequences of the nucleic acids of the invention can be based, include, but are not limited to:

hsa-mir-199a- l iGCCAACCCAGUGUUCAGACUACCUGUUCAGG AGGCUCUCAAUGUGUACAGUAGUCUGCACAUUGGUUAGGC (SEQ ID NO: 1); miRBase Accession MI0000242; Symbol HGNC:MIRN199A1. hsa-mir- 199a-2 : AGGAAGCUUCUGGAGAUCCUGCUCCGUCGC CCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGU CUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA (SEQ ID NO:2); miRBase Accession MI0000281; Symbol HGNC:MIRN 199A2.

hsa-mir-199a-3p: ACAGUAGUCUGCACAUUGGUUA (SEQ ID

NO:3); miRBase Accession MIMAT0000232.

hsa-mir-199a-5p: CCCAGUGUUCAGACUACCUGUUC (SEQ ID NO:4); miRBase Accession MIMAT0000231.

Binding site 1 (AS): CCCAGUGUUCAGACUACCUGUUC (SEQ ID NO:5).

Binding site l(S): UAGCAGGCCUUGUGCAGUGGGG (SEQ ID NO:6).

Binding site 2(AS): CCCAGUGUUCAGACUACCUGUUC (SEQ ID

NO:7).

Binding site 2(S): UGGGCACUGCCGGCGCCUUGUCUGCACAC

UGGA (SEQ ID NO:8).

Binding site 3(AS): CCCAGUGUUCAGACUACCUGUUC (SEQ ID NO:9).

Binding site 3(S): UUGCUUUGUGGAGAUUCACACUAUGCACU GGG (SEQ ID NO: 10).

It will be readily understood by one skilled in the art that nucleic acid sequences useful in the methods of the invention, include not only the hsa-mir- 199a nucleic acid reference sequences provided herein as examples (i.e., hsa-mir- 199a- 1, hsa-mir- 199a-2, hsa-mir- 199a-3p and hsa-mir- 199a-5p), but also include fragments, modifications and variants, as elsewhere defined herein, of the example nucleic acid reference sequences provided herein.

Anti-sense Nucleic Acids In one embodiment of the invention, an antisense nucleic acid sequence, which may be expressed by a vector, is used to diminish IKKβ expression and to reduce chemoresistance. The antisense expressing vector is used to transfect or infect a cancer cell or the mammal itself, thereby causing reduced endogenous expression of IKKβ and reduced chemoresistance.

Antisense molecules and their use for inhibiting gene expression are well known in the art {see, e.g., Cohen, 1989, In: Oligodeoxyribonucleotides, Antisense Inhibitors of Gene Expression, CRC Press). Antisense nucleic acids are DNA or RNA molecules that are complementary, as that term is defined elsewhere herein, to at least a portion of a specific mRNA molecule (Weintraub, 1990, Scientific American 262:40). In the cell, antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule and thereby inhibiting expression of the mRNA.

The use of antisense methods to inhibit the translation of genes is known in the art, and is described, for example, in Marcus-Sakura (1988, Anal.

Biochem. 172:289). Such antisense molecules may be provided to the cell via genetic expression using DNA encoding the antisense molecule as taught by Inoue, 1993, U.S. Patent No. 5,190,931.

Alternatively, antisense molecules of the invention may be made synthetically and then provided to the cell. Antisense oligomers of between about 10 to about 50, and more preferably about 20 nucleotides, are preferred, since they are easily synthesized and introduced into a target cell. Synthetic antisense molecules contemplated by the invention include oligonucleotide derivatives known in the art which have improved biological activity compared to unmodified oligonucleotides {see U.S. Patent No. 5,023,243).

In various embodiments of the invention, antisense nucleic acids with sequences corresponding to all or some portion of the sequence of mir-199a, can be administered to a cancer cell to diminish the level of IKKβ expression in the cancer cell. In other embodiments of the invention, antisense nucleic acids with sequences corresponding to all or some portion of the sequence of mir-199a, can be administered to a cancer cell to diminish the level of chemoresistance of the cancer cell.

Ribozymes Ribozymes and their use for inhibiting gene expression are also well known in the art (see, e.g., Cech et al, 1992, J. Biol. Chem. 267: 17479-17482; Hampel et al, 1989, Biochemistry 28:4929-4933; Eckstein et al, International Publication No. WO 92/07065; Altman et al, U.S. Patent No. 5,168,053). Ribozymes are RNA molecules possessing the ability to specifically cleave other single-stranded RNA in a manner analogous to DNA restriction endonucleases. Through the modification of nucleotide sequences encoding these RNAs, molecules can be engineered to recognize specific nucleotide sequences in an RNA molecule and cleave it (Cech, 1988, J. Amer. Med. Assn. 260:3030). A major advantage of this approach is the fact that ribozymes are sequence-specific.

There are two basic types of ribozymes, namely, tetrahymena-type (Hasselhoff, 1988, Nature 334:585) and hammerhead-type. Tetrahymena-type ribozymes recognize sequences which are four bases in length, while hammerhead- type ribozymes recognize base sequences 11-18 bases in length. The longer the sequence, the greater the likelihood that the sequence will occur exclusively in the target mRNA species. Consequently, hammerhead-type ribozymes are preferable to tetrahymena-type ribozymes for inactivating specific mRNA species, and 18-base recognition sequences are preferable to shorter recognition sequences which may occur randomly within various unrelated mRNA molecules. In various embodiments of the invention, ribozymes that specifically cleave IKKβ mRNA can be administered to a cancer cell to diminish the level of IKKβ expression in the cancer cell. In other embodiments of the invention, ribozymes that specifically cleave IKKβ mRNA can be administered to a cancer cell to diminish the level of chemoresistance of the cancer cell.

siRNA

In one embodiment, siRNA is used to decrease the level of IKKβ expression and to reduce chemoresistance. RNA interference (RNAi) is a phenomenon in which the introduction of double-stranded RNA (dsRNA) into a diverse range of organisms and cell types, such as for example EOC cancer cells, causes degradation of the complementary mRNA. Generally, in the cell, long dsRNAs are cleaved into shorter 21-25 nucleotide small interfering RNAs, or siRNAs, by a ribonuclease (e.g., Dicer). The siRNAs subsequently assemble with protein components into an RNA-induced silencing complex (RISC), unwinding in the process. Activated RISC then binds to complementary transcript by base pairing interactions between the siRNA antisense strand and the mRNA. The bound mRNA is cleaved and sequence specific degradation of mRNA results in gene silencing. See, for example, U.S. Patent No. 6,506,559; Fire et al, 1998, Nature 391(19):306-311 ; Timmons et al, 1998, Nature 395:854; Montgomery et al, 1998, TIG 14 (7):255-258; David R. Engelke, Ed., RNA Interference (RNAi) Nuts & Bolts of RNAi Technology, DNA Press, Eagleville, PA (2003); and Gregory J. Harmon, Ed., RNAi A Guide to Gene Silencing, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2003). Soutschek et al (2004, Nature 432:173-178) describe a chemical modification to siRNAs that aids in intravenous systemic delivery. Optimizing siRNAs involves consideration of overall G/C content, C/T content at the termini, Tm and the nucleotide content of the 3' overhang. See, for instance, Schwartz et al, 2003, Cell, 115:199-208 and Khvorova et al, 2003, Cell 115:209-216. Therefore, the present invention also includes methods of decreasing levels of IKKβ protein using RNAi technology.

Modification of RNA

Following the generation of the RNA of the present invention, a skilled artisan will understand that the RNA will have certain characteristics that can be modified to improve the RNA as a therapeutic compound. Therefore, the RNA may be further designed to resist degradation by modifying it to include phosphorothioate, or other linkages, methylphosphonate, sulfone, sulfate, ketyl, phosphorodithioate, phosphoramidate, phosphate esters, and the like (see, e.g., Agrwal et al, 1987 Tetrahedron Lett. 28:3539-3542; Stec et al, 1985 Tetrahedron Lett. 26:2191-2194; Moody et al. , 1989 Nucleic Acids Res. 12:4769-4782; Eckstein, 1989 Trends Biol. Sci. 14:97-100; Stein, In: Oligodeoxynucleotides. Antisense Inhibitors of Gene Expression, Cohen, ed., Macmillan Press, London, pp. 97-117 (1989)).

Any nucleic acid of the invention may be further modified to increase its stability in vivo. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends; the use of phosphorothioate or 2' O- methyl rather than phosphodiester linkages in the backbone; and/or the inclusion of nontraditional bases such as inosine, queosine, and wybutosine and the like, as well as acetyl- methyl-, thio- and other modified forms of adenine, cytidine, guanine, thymine, and uridine. Vectors

In other related aspects, the invention includes an isolated nucleic acid encoding an nucleic acid inhibitor of IKKβ expression, such as, for example, an antisense nucleic acid, a polynucleotide, a ribozymes, or an miRNA or an siRNA, wherein the isolated nucleic acid encoding the nucleic acid inhibitor is operably linked to a nucleic acid comprising a promoter/regulatory sequence. Thus, the invention encompasses expression vectors and methods for the introduction of exogenous DNA into cells with concomitant expression of the exogenous DNA in the cells such as those described, for example, in Sambrook et al. (2001, Molecular

Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in Ausubel et al. (1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York).

In another aspect, the invention includes a vector comprising an siRNA polynucleotide. Preferably, the siRNA polynucleotide is capable of inhibiting the expression of a target mRNA, such as IKKβ. The incorporation of a desired nucleic acid into a vector and the choice of vectors is well-known in the art as described in, for example, Sambrook et al. , supra, and Ausubel et al. , supra.

The nucleic acid inhibitor of IKKβ can be cloned into a number of types of vectors. However, the present invention should not be construed to be limited to any particular vector. Instead, the present invention should be construed to encompass a wide plethora of vectors which are readily available and/or well-known in the art. For example, nucleic acid inhibitor of the invention can be cloned into a vector including, but not limited to a plasmid, a phagemid, a phage derivative, an animal virus and a cosmid. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors and sequencing vectors.

In specific embodiments, the expression vector is selected from the group consisting of a viral vector, a bacterial vector and a mammalian cell vector. Numerous expression vector systems exist that comprise at least a part or all of the compositions discussed above. Prokaryote- and/or eukaryote-vector based systems can be employed for use with the present invention to produce polynucleotides. Many such systems are commercially and widely available.

Further, the expression vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2001), and in Ausubel et al. (1997), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers. (See, e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193.

For expression of the nucleic acid inhibitor of the invention, at least one module in each promoter functions to position the start site for RNA synthesis. The best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 genes, a discrete element overlying the start site itself helps to fix the place of initiation.

Additional promoter elements, i.e., enhancers, regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription.

A promoter may be one naturally associated with a gene or polynucleotide sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon. Such a promoter can be referred to as "endogenous." Similarly, an enhancer may be one naturally associated with a polynucleotide sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages will be gained by positioning the coding polynucleotide segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a polynucleotide sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a polynucleotide sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers not "naturally occurring," i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression. In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCR™, in connection with the compositions disclosed herein (U.S. Patent 4,683,202, U.S. Patent 5,928,906). Furthermore, it is contemplated that control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.

Naturally, it will be important to employ a promoter and/or enhancer that effectively directs the expression of the DNA segment in the cell type, organelle and organism chosen for expression. Those of skill in the art of molecular biology generally know how to use promoters, enhancers and cell type combinations for protein expression, for example, see Sambrook et al. (2001). The promoters employed may be constitutive, tissue-specific, inducible and/or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides. The promoter may be heterologous or endogenous.

A promoter sequence exemplified in the experimental examples presented herein is the cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. However, other constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, Moloney virus promoter, the avian leukemia virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the muscle creatine promoter. Further, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter in the invention provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired, or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter. Further, the invention includes the use of a tissue specific promoter, which promoter is active only in a desired tissue. Tissue specific promoters are well known in the art and include, but are not limited to, the HER-2 promoter and the PSA associated promoter sequences.

In order to assess the expression of the nucleic acid inhibitor of the invention, the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors. In other embodiments, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers are known in the art and include, for example, antibiotic-resistance genes, such as neo and the like.

Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. Reporter genes that encode for easily assayable proteins are well known in the art. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a protein whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells.

Suitable reporter genes may include genes encoding luciferase, beta- galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (see, e.g., Ui-Tei et al, 2000 FEBS Lett. 479:79- 82). Suitable expression systems are well known and may be prepared using well known techniques or obtained commercially. Internal deletion constructs may be generated using unique internal restriction sites or by partial digestion of non-unique restriction sites. Constructs may then be transfected into cells. In general, the construct with the minimal 5' flanking region showing the highest level of expression of reporter gene is identified as the promoter. Such promoter regions may be linked to a reporter gene and used to evaluate agents for the ability to modulate promoter- driven transcription.

Methods of Administration

The methods of the invention comprise administering a therapeutically effective amount of at least one nucleic acid, having a sequence based upon mir-199a, to a cancer cell, or to an individual with cancer, or to an individual identified as having a chemoresistant cancer, where the nucleic acid reduces, diminishes or decreases the level of expression of IKKβ. The methods of the invention also comprise administering a therapeutically effective amount of a nucleic acid, having a sequence based upon mir- 199a, to a cancer cell, or to an individual with cancer, or to an individual identified as having a chemoresistant cancer, where the nucleic acid reduces, diminishes or decreases the level of chemoresistance. The methods of the present invention may be practiced on any cell identified as a cancer cell, or any individual diagnosed with cancer. The cell may be a chemoresistant EOC cell. The individual may have chemoresistant EOC. In a preferred embodiment the individual is a mammal. In a more preferred embodiment the individual is a human. In various embodiments, the cancer cell can be an epithelial ovarian cancer cell, a mucinous ovarian cancer cell, a clear cell carcinoma of the ovaries, a mucinous ovarian cancer cell or a granulose ovarian cancer cell. It should be understood that the type of cancer cells useful in the methods of the invention is not limited to the type of cancer cells named herein, but rather can be any type of cancer cell that displays a chemoresistant phenotype that correlates with the level of one or more differentially expressed miRNA, such as for example, mir-199a.

Decreasing expression of endogenous IKKβ includes decreasing the half-life or stability IKKβ mRNA or decreasing translation of IKKβ mRNA. Methods of decreasing expression of IKKβ include, but are not limited to, methods that use an siRNA, a miRNA, an antisense nucleic acid, a ribozyme, a polynucleotide or other specific inhibitors of IKKβ mRNA, as well as combinations thereof.

The present invention should in no way be construed to be limited to the inhibitors described herein, but rather should be construed to encompass any inhibitor of IKKβ, both known and unknown, that diminishes and reduces IKKβ expression and/or that diminishes and reduces cancer chemoresistance.

The methods of the invention comprise administering a therapeutically effective amount of at least one IKKβ inhibitor nucleic acid to a mammal wherein a IKKβ inhibitor nucleic acid, or combination thereof prevents, attenuates, reduces or diminishes IKKβ expression and/or that prevents, attenuates, reduces or diminishes cancer chemoresistance.

The method of the invention comprises administering a therapeutically effective amount of at least one IKKβ inhibitor nucleic acid to a mammal wherein a composition of the present invention comprising an IKKβ inhibitor nucleic acid, or a combination thereof is used either alone or in combination with other therapeutic agents. The invention can be used in combination with other treatment modalities, such as chemotherapy, radiation therapy, and the like. Examples of chemotherapeutic agents that can be used in combination with the methods of the invention include, for example, carboplatin, paclitaxel, and docetaxel, cisplatin, doxorubicin, and topotecan, as well as others chemotherapeutic agents useful as a combination therapy that may discovered in the future.

Isolated nucleic acid-based IKKβ inhibitors can be delivered to a cell in vitro or in vivo using vectors comprising one or more isolated IKKβ inhibitor nucleic acid sequences. In some embodiments, the nucleic acid sequence has been incorporated into the genome of the vector. The vector comprising an isolated IKKβ inhibitor nucleic acid described herein can be contacted with a cell in vitro or in vivo and infection or transfection can occur. The cell can then be used experimentally to study, for example, the effect of an isolated IKKβ inhibitor nucleic acid in vitro. The cell can be migratory or non-migratory. The cell can be present in a biological sample obtained from the subject (e.g., blood, bone marrow, tissue, fluids, organs, etc.) and used in the treatment of disease, or can be obtained from cell culture.

Various vectors can be used to introduce an isolated IKKβ inhibitor nucleic acid into mammalian cells. Examples of viral vectors have been discussed elsewhere herein and include retrovirus, adenovirus, parvovirus (e.g., adeno- associated viruses), coronavirus, negative-strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g. measles and Sendai), positive-strand RNA viruses such as picornavirus and alphavirus, and double stranded DNA viruses including adenovirus, herpesvirus (e.g., herpes simplex virus types 1 and 2, Epstein- Barr virus, cytomegalovirus), and poxvirus (e.g. vaccinia, fowlpox and canarypox). Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus and hepatitis virus, for example. Examples of retroviruses include: avian leukosis-sarcoma, mammalian C-type, B-type viruses, D-type viruses, HTLV-BLV group, lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields et al, Eds., Lippincott-Raven Publishers, Philadelphia, 1996). Other examples include murine leukemia viruses, murine sarcoma viruses, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, Gibbon ape leukemia virus, Mason Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus, lentiviruses and baculoviruses.

In addition, an engineered viral vector can be used to deliver an isolated IKKβ inhibitor nucleic acid of the present invention. These vectors provide a means to introduce nucleic acids into cycling and quiescent cells, and have been modified to reduce cytotoxicity and to improve genetic stability. The preparation and use of engineered Herpes simplex virus type 1 (Krisky et al. , 1997, Gene Therapy 4:1120-1125), adenoviral (Amalfitanl et al, 1998, Journal of Virology 72:926-933) attenuated lentiviral (Zufferey et al, 1997, Nature Biotechnology 15:871-875) and adenoviral/retroviral chimeric (Feng et al , 1997, Nature Biotechnology 15:866-870) vectors are known to the skilled artisan. In addition to delivery through the use of vectors, an isolated IKKβ inhibitor nucleic acid can be delivered to cells without vectors, e.g. as "naked" nucleic acid delivery using methods known to those of skill in the art. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.

Physical methods for introducing a nucleic acid into a host cell include transfection, calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation and the like. Methods for producing cells comprising vectors and/or exogenous nucleic acids are well-known in the art. See, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in Ausubel et al (2001, Current Protocols in Molecular Biology, John Wiley & Sons, New York).

Chemical means for introducing a nucleic acid into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles and liposomes. A preferred colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (i.e., an artificial membrane vesicle). The preparation and use of such systems is well known in the art. Various forms of an isolated IKKβ inhibitor nucleic acid, as described herein, can be administered or delivered to a mammalian cell (e.g., by virus, direct injection, or liposomes, or by any other suitable methods known in the art or later developed). The methods of delivery can be modified to target certain cells, and in particular, cell surface receptor molecules. As an example, the use of cationic lipids as a carrier for nucleic acid constructs provides an efficient means of delivering the isolated IKKβ inhibitor nucleic acid of the present invention.

Various formulations of cationic lipids have been used to deliver nucleic acids to cells (WO 91/17424; WO 91/16024; U.S. Pat. Nos. 4,897,355; 4,946,787; 5,049,386; and 5,208,036). Cationic lipids have also been used to introduce foreign nucleic acids into frog and rat cells in vivo (Holt et al. , Neuron 4:203-214 (1990); Hazinski et al, Am. J. Respr. Cell. MoI. Biol. 4:206-209 (1991)). Therefore, cationic lipids may be used, generally, as pharmaceutical carriers to provide biologically active substances (for example, see WO 91/17424; WO 91/16024; and WO 93/03709). Thus, cationic liposomes can provide an efficient carrier for the introduction of nucleic acids into a cell.

Further, liposomes can be used as carriers to deliver a nucleic acid to a cell, tissue or organ. Liposomes comprising neutral or anionic lipids do not generally fuse with the target cell surface, but are taken up phagocytically, and the nucleic acids are subsequently subjected to the degradative enzymes of the lysosomal compartment (Straubinger et α/., 1983, Methods Enzymol. 101 :512-527; Mannino et al, 1988,

Biotechniques 6:682-690). However, as demonstrated by the data disclosed herein, an isolated siRNA of the present invention is a stable nucleic acid, and thus, may not be susceptible to degradative enzymes. Further, despite the fact that the aqueous space of typical liposomes may be too small to accommodate large macromolecules, the isolated IKKβ inhibitor nucleic acid of the present invention is relatively small, and therefore, liposomes are a suitable delivery vehicle for the present invention. Methods of delivering a nucleic acid to a cell, tissue or organism, including liposome-mediated delivery, are known in the art and are described in, for example, Feigner {Gene Transfer and Expression Protocols Vol. 7, Murray, E. J. Ed., Humana Press, New Jersey, (1991)).

In other related aspects, the invention includes an isolated IKKβ inhibitor nucleic acid operably linked to a nucleic acid comprising a promoter/regulatory sequence such that the nucleic acid is preferably capable of delivering an isolated IKKβ inhibitor nucleic acid. Thus, the invention encompasses expression vectors and methods for the introduction of an isolated IKKβ inhibitor nucleic acid into or to cells.

Such delivery can be accomplished by generating a plasmid, viral, or other type of vector comprising an isolated IKKβ inhibitor nucleic acid operably linked to a promoter/regulatory sequence which serves to introduce the IKKβ inhibitor nucleic acid into cells in which the vector is introduced. Many promoter/regulatory sequences useful for the methods of the present invention are available in the art and include, but are not limited to, for example, the cytomegalovirus immediate early promoter enhancer sequence, the SV40 early promoter, as well as the Rous sarcoma virus promoter, and the like. Moreover, inducible and tissue specific expression of an isolated IKKβ inhibitor nucleic acid may be accomplished by placing an isolated IKKβ inhibitor nucleic acid, with or without a tag, under the control of an inducible or tissue specific promoter/regulatory sequence. Examples of tissue specific or inducible promoter/regulatory sequences which are useful for his purpose include, but are not limited to the MMTV LTR inducible promoter, and the SV40 late enhancer/promoter. In addition, promoters which are well known in the art which are induced in response to inducing agents such as metals, glucocorticoids, and the like, are also contemplated in the invention. Thus, it will be appreciated that the invention includes the use of any promoter/regulatory sequence, which is either known or unknown, and which is capable of driving expression of the desired protein operably linked thereto.

Selection of any particular plasmid vector or other vector is not a limiting factor in the invention and a wide plethora of vectors are well-known in the art. Further, it is well within the skill of the artisan to choose particular promoter/regulatory sequences and operably link those promoter/regulatory sequences to a DNA sequence encoding a desired polypeptide. Such technology is well known in the art and is described, for example, in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in Ausubel et al. (2001, Current Protocols in Molecular Biology, John Wiley & Sons, New York) and elsewhere herein.

Pharmaceutical Compositions and Therapies

Administration of an IKKβ inhibitor nucleic acid comprising one or more nucleic acids, antisense nucleic acids, polynucleotides, ribozymes, miRNAs or siRNAs of the invention in a method of treatment can be achieved in a number of different ways, using methods known in the art. Such methods include, but are not limited to, providing exogenous nucleic acids, antisense nucleic acids, polynucleotides, ribozymes, miRNAs or siRNAs to a subject or expressing a recombinant nucleic acid, antisense nucleic acid, polynucleotide, ribozyme, miRNA or siRNA expression cassette.

The therapeutic and prophylactic methods of the invention thus encompass the use of pharmaceutical compositions comprising IKKβ inhibitor nucleic acid, antisense nucleic acid, polynucleotide, ribozyme, miRNA or siRNA of the invention. The pharmaceutical compositions useful for practicing the invention may be administered to deliver a dose of between 1 ng/kg/day and 100 mg/kg/day. In one embodiment, the invention envisions administration of a dose which results in a concentration of the compound of the present invention between 1 μM and 10 μM in a mammal. In another embodiment, the invention envisions administration of a dose which results in a concentration of the compound of the present invention between 1 μM and 10 μM in a cell of a mammal.

Typically, dosages which may be administered in a method of the invention to an animal, preferably a human, range in amount from 0.5 μg to about 50 mg per kilogram of body weight of the animal. While the precise dosage administered will vary depending upon any number of factors, including but not limited to, the type of animal and type of disease state being treated, the age of the animal and the route of administration. Preferably, the dosage of the compound will vary from about 1 μg to about 10 mg per kilogram of body weight of the animal. More preferably, the dosage will vary from about 3 μg to about 1 mg per kilogram of body weight of the animal.

The compound may be administered to an animal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month or even less frequently, such as once every several months or even once a year or less. The frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the animal, etc. The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.

Although the description of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as non-human primates, cattle, pigs, horses, sheep, cats, and dogs.

Pharmaceutical compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for ophthalmic, oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, or another route of administration. Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically-based formulations.

A pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. A unit dose is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w/w) active ingredient.

In addition to the active ingredient, a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents.

Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology.

Parenteral administration of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, intraocular, intravitreal, subcutaneous, intraperitoneal, intramuscular, intrasternal injection, and intratumoral.

Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e. powder or granular) form for reconstitution with a suitable vehicle (e.g. sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.

The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1,3 -butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides. Other parentally-administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer systems. Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.

A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for pulmonary administration via the buccal cavity. Such a formulation may comprise dry particles which comprise the active ingredient and which have a diameter in the range from about 0.5 to about 7 nanometers, and preferably from about 1 to about 6 nanometers. Such compositions are conveniently in the form of dry powders for administration using a device comprising a dry powder reservoir to which a stream of propellant may be directed to disperse the powder or using a self-propelling solvent/powder-dispensing container such as a device comprising the active ingredient dissolved or suspended in a low- boiling propellant in a sealed container. Preferably, such powders comprise particles wherein at least 98% of the particles by weight have a diameter greater than 0.5 nanometers and at least 95% of the particles by number have a diameter less than 7 nanometers. More preferably, at least 95% of the particles by weight have a diameter greater than 1 nanometer and at least 90% of the particles by number have a diameter less than 6 nanometers. Dry powder compositions preferably include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form. Low boiling propellants generally include liquid propellants having a boiling point of below 65°F at atmospheric pressure. Generally the propellant may constitute 50 to 99.9% (w/w) of the composition, and the active ingredient may constitute 0.1 to 20% (w/w) of the composition. The propellant may further comprise additional ingredients such as a liquid non-ionic or solid anionic surfactant or a solid diluent (preferably having a particle size of the same order as particles comprising the active ingredient).

Pharmaceutical compositions of the invention formulated for pulmonary delivery may also provide the active ingredient in the form of droplets of a solution or suspension. Such formulations may be prepared, packaged, or sold as aqueous or dilute alcoholic solutions or suspensions, optionally sterile, comprising the active ingredient, and may conveniently be administered using any nebulization or atomization device. Such formulations may further comprise one or more additional ingredients including, but not limited to, a flavoring agent such as saccharin sodium, a volatile oil, a buffering agent, a surface active agent, or a preservative such as methylhydroxybenzoate. The droplets provided by this route of administration preferably have an average diameter in the range from about 0.1 to about 200 nanometers.

The formulations described herein as being useful for pulmonary delivery are also useful for intranasal delivery of a pharmaceutical composition of the invention.

Another formulation suitable for intranasal administration is a coarse powder comprising the active ingredient and having an average particle from about 0.2 to 500 micrometers. Such a formulation is administered in the manner in which snuff is taken i.e. by rapid inhalation through the nasal passage from a container of the powder held close to the nares.

Formulations suitable for nasal administration may, for example, comprise from about as little as 0.1% (w/w) and as much as 100% (w/w) of the active ingredient, and may further comprise one or more of the additional ingredients described herein.

A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for buccal administration. Such formulations may, for example, be in the form of tablets or lozenges made using conventional methods, and may, for example, 0.1 to 20% (w/w) active ingredient, the balance comprising an orally dissolvable or degradable composition and, optionally, one or more of the additional ingredients described herein. Alternately, formulations suitable for buccal administration may comprise a powder or an aerosolized or atomized solution or suspension comprising the active ingredient. Such powdered, aerosolized, or aerosolized formulations, when dispersed, preferably have an average particle or droplet size in the range from about 0.1 to about 200 nanometers, and may further comprise one or more of the additional ingredients described herein.

As used herein, "additional ingredients" include, but are not limited to, one or more of the following: excipients; surface active agents; dispersing agents; inert diluents; granulating and disintegrating agents; binding agents; lubricating agents; sweetening agents; flavoring agents; coloring agents; preservatives; physiologically degradable compositions such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents, demulcents; buffers; salts; thickening agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials. Other "additional ingredients" which may be included in the pharmaceutical compositions of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (1985, Genaro, ed., Mack Publishing Co., Easton, PA), which is incorporated herein by reference.

Kits

The invention also includes a kit comprising an IKKβ inhibitor nucleic acid, or combinations thereof, of the invention and an instructional material which describes, for instance, administering the IKKβ inhibitor nucleic acid, or a combinations thereof, to a subject as a therapeutic treatment or a non-treatment use as described elsewhere herein. In an embodiment, this kit further comprises a (preferably sterile) pharmaceutically acceptable carrier suitable for dissolving or suspending the therapeutic composition, comprising a IKKβ inhibitor nucleic acid, or combinations thereof, of the invention, for instance, prior to administering the molecule to a subject. Optionally, the kit comprises an applicator for administering the inhibitor. A kit providing a nucleic acid, antisense nucleic acid, polynucleotide, ribozyme, miRNA or siRNA of the invention and an instructional material is also provided. Definitions:

The definitions used in this application are for illustrative purposes and do not limit the scope of the invention.

The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

"Antisense nucleic acid" as used herein means a non-enzymatic nucleic acid molecule that binds to target RNA by means of RNA-RNA or RNA- DNA or RNA-PNA (protein nucleic acid; Egholm et al, 1993 Nature 365, 566) interactions and alters the activity of the target RNA (for a review, see Stein and

Cheng, 1993 Science 261, 1004 and Woolf et al, U.S. Pat. No. 5,849,902). Typically, antisense molecules are complementary to a target sequence along a single contiguous sequence of the antisense molecule. However, an antisense molecule can also bind to substrate such that the substrate molecule forms a loop, and/or an antisense molecule can bind such that the antisense molecule forms a loop. Thus, the antisense molecule can be complementary to two (or even more) non-contiguous substrate sequences or two (or even more) non-contiguous sequence portions of an antisense molecule can be complementary to a target sequence or both. In addition, antisense DNA can be used to target RNA by means of DNA-RNA interactions, thereby activating RNaseH, which digests the target RNA in the duplex. The antisense oligonucleotides can comprise one or more RNAseH activating region, which is capable of activating RNAseH cleavage of a target RNA. Antisense DNA can be synthesized chemically or expressed via the use of a single stranded DNA expression vector or equivalent thereof. An "array" or "microarray" comprises a support, preferably solid, with nucleic acid probes attached to the support. Preferred arrays typically comprise a plurality of different nucleic acid probes that are coupled to a surface of a substrate in different, known locations. These arrays, also described as "microarrays" or colloquially "chips" have been generally described in the art, for example, US Pat Nos 5,143,854, 5,445,934, 5,744,305, 5,677,195, 5,800,992, 6,040,193, 5,424,186 and Fodor et al, 1991, Science, 251 -.161-111. Arrays may generally be produced using a variety of techniques, such as mechanical synthesis methods or light directed synthesis methods that incorporate a combination of photolithographic methods and solid phase synthesis methods. Techniques for the synthesis of these arrays using mechanical synthesis methods are described in, e.g., US Pat Nos 5,384,261, and 6,040,193. Although the array of the invention can have a planar array surface, the array can be fabricated on a surface of virtually any shape or even a multiplicity of surfaces. Arrays may be nucleic acids on beads, gels, polymeric surfaces, fibers such as fiber optics, glass or any other appropriate substrate (see US Pat Nos 5,770,358, 5,789,162, 5,708,153, 6,040,193 and 5,800,992.)

"Complementary" as used herein refers to the broad concept of subunit sequence complementarity between two nucleic acids. When a nucleotide position in both of the molecules is occupied by nucleotides normally capable of base pairing with each other, then the nucleic acids are considered to be complementary to each other at this position. Thus, two nucleic acids are substantially complementary to each other when at least about 50%, preferably at least about 60% and more preferably at least about 80% of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g., A:T and G:C nucleotide pairs).

The terms "diminish" and "diminution," as used herein, means to reduce, suppress, inhibit or block an activity or function by at least about 10% relative to a control value. Preferably, the activity is suppressed or blocked by 50% compared to a control value, more preferably by 75%, and even more preferably by 95%.

The term "downstream" when used in reference to a direction along a nucleotide sequence means the 5'— »3' direction. Similarly, the term "upstream" means the 3'→5' direction.

The terms "effective amount" and "pharmaceutically effective amount" refer to a nontoxic but sufficient amount of an agent to provide the desired biological result. That result can be reduction and/or alleviation of the signs, symptoms, or causes of a disease or disorder, or any other desired alteration of a biological system. An appropriate effective amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation. As used herein "endogenous" refers to any material from or produced inside an organism, cell, tissue or system.

As used herein, the term "exogenous" refers to any material introduced from or produced outside an organism, cell, tissue or system. The term "expression" as used herein is defined as the transcription and/or translation of a particular nucleotide sequence driven by its promoter.

By "expression cassette" is meant a nucleic acid molecule comprising a coding sequence operably linked to promoter/regulatory sequences necessary for transcription and, optionally, translation of the coding sequence.

The term "expression vector" as used herein refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules, miRNA, siRNA, ribozymes, and the like. Expression vectors can contain a variety of control sequences, which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operatively linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well.

"Fragment" as the term is used herein, is a nucleic acid sequence that differs in length (i.e., in the number of nucleotides) from the length of a reference nucleic acid sequence, but retains essential properties of the reference molecule. One example of a retained essential property would be the ability of the fragment nucleic acid to hybridize to a particular target mRNA, much like the reference nucleic acid sequence, and thereby diminish expression. A fragment of a nucleic acid can be a naturally occurring or can be a fragment that is not known to occur naturally. Non- naturally occurring fragments of nucleic acids may be made by mutagenesis techniques or by direct synthesis. Preferably, the fragment is at least about 25% of the length of the reference nucleic acid sequence. More preferably, the fragment is at least about 35% of the length of the reference nucleic acid sequence. Even more preferably, the fragment is at least about 45% of the length of the reference nucleic acid sequence.

As used herein, "homologous" refers to the subunit sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules, e.g., two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions, e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two compound sequences are homologous then the two sequences are 50% homologous, if 90% of the positions, e.g., 9 of 10, are matched or homologous, the two sequences share 90% homology. By way of example, the DNA sequences 3ΑTTGCC5¹ and 3¹TATGGC share 50% homology.

As used herein, "homology" is used synonymously with "identity." In addition, when the term "homology" is used herein to refer to the nucleic acids and proteins, it should be construed to be applied to homology at both the nucleic acid and the amino acid levels. The determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm. For example, a mathematical algorithm useful for comparing two sequences is the algorithm of Karlin and Altschul (1990, Proc. Natl. Acad. Sci. USA 87:2264-2268), modified as in Karlin and Altschul (1993, Proc. Natl. Acad. Sci. USA 90:5873-5877). This algorithm is incorporated into the NBLAST and XBLAST programs of Altschul, et al. (1990, J. MoI. Biol. 215:403-410), and can be accessed, for example, at the National Center for Biotechnology Information (NCBI) world wide web site having the universal resource locator www<dot>ncbi<dot>nlm<dot>nih<dot>gov/BLAST/. BLAST nucleotide searches can be performed with the NBLAST program (designated "blastn" at the NCBI web site), using the following parameters: gap penalty = 5; gap extension penalty = 2; mismatch penalty = 3; match reward = 1; expectation value 10.0; and word size = 11 to obtain nucleotide sequences homologous to a nucleic acid described herein. BLAST protein searches can be performed with the XBLAST program (designated "blastn" at the NCBI web site) or the NCBI "blastp" program, using the following parameters: expectation value 10.0, BLOSUM62 scoring matrix to obtain amino acid sequences homologous to a protein molecule described herein. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997, Nucleic Acids Res. 25:3389-3402). Alternatively, PSI-Blast or PHI-Blast can be used to perform an iterated search which detects distant relationships between molecules (id.) and relationships between molecules which share a common pattern. When utilizing BLAST, Gapped BLAST, PSI-Blast, and PHI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See www<dot>ncbi<dot>nlm<dot>nih<dot>gov. The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically exact matches are counted.

As used herein, "hybridization," "hybridize(s)" or "capable of hybridizing" is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature. Complementary sequences in the nucleic acids pair with each other to form a double helix. The resulting double-stranded nucleic acid is a "hybrid." Hybridization may be between, for example two complementary or partially complementary sequences. The hybrid may have double-stranded regions and single stranded regions. The hybrid may be, for example, DNA:DNA, RNA:DNA or DNA:RNA. Hybrids may also be formed between modified nucleic acids. One or both of the nucleic acids may be immobilized on a solid support. Hybridization techniques may be used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. The stability of a hybrid depends on a variety of factors including the length of complementarity, the presence of mismatches within the complementary region, the temperature and the concentration of salt in the reaction. Hybridizations are usually performed under stringent conditions, for example, at a salt concentration of no more than 1 M and a temperature of at least 25. degree. C. For example, conditions of 5.times.SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) or 100 mM MES, 1 M Na, 20 mM EDTA, 0.01% Tween-20 and a temperature of 25- 50. degree. C. are suitable for allele-specific probe hybridizations. In a particularly preferred embodiment, hybridizations are performed at 40-50. degree. C. Acetylated BSA and herring sperm DNA may be added to hybridization reactions. Hybridization conditions suitable for microarrays are described in the Gene Expression Technical Manual and the GeneChip Mapping Assay Manual available from Affymetrix (Santa Clara, CA).

"Hybridization probes" are oligonucleotides capable of binding in a base-specific manner to a complementary strand of nucleic acid. Such probes include peptide nucleic acids, as described in Nielsen et al, 1991, Science 254, 1497-1500, and other nucleic acid analogs and nucleic acid mimetics. See US Pat No 6,156,501.

An "inducible" promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced substantially only when an inducer which corresponds to the promoter is present.

"Instructional material," as that term is used herein, includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the composition and/or compound of the invention in a kit. The instructional material of the kit may, for example, be affixed to a container that contains the compound and/or composition of the invention or be shipped together with a container which contains the compound and/or composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the recipient uses the instructional material and the compound cooperatively. Delivery of the instructional material may be, for example, by physical delivery of the publication or other medium of expression communicating the usefulness of the kit, or may alternatively be achieved by electronic transmission, for example by means of a computer, such as by electronic mail, or download from a website.

"Isolated" means altered or removed from the natural state through the actions of a human being. For example, a nucleic acid or a peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.

The term "label" as used herein refers to a luminescent label, a light scattering label or a radioactive label. Fluorescent labels include, but are not limited to, the commercially available fluorescein phosphoramidites such as Fluoreprime (Pharmacia), Fluoredite (Millipore) and FAM (ABI). See US Pat No 6,287,778.

As used herein, "miRNA" describes small non-coding RNA molecules, generally about 15 to about 50 nucleotides in length, which can play a role in regulating gene expression through a process termed RNA interference (RNAi). RNAi describes a phenomenon whereby the presence of an RNA sequence that is identical or highly similar to a sequence in a target gene messenger RNA (mRNA) results in inhibition of expression of the target gene. Often, miRNAs are processed from hairpin precursors of about 70 or more nucleotides (pre-miRNA) which are derived from primary transcripts (pri-miRNA) through sequential cleavage by RNAse III enzymes. By "modification" is meant any alteration of any nucleic acid of the invention to increase its stability in vivo. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends; the removal of terminal sequences at the 5' and/or 3' ends; the use of phosphorothioate or 2' O-methyl rather than phosphodiester linkages in the backbone; and/or the inclusion of nontraditional bases such as inosine, queosine, and wybutosine and the like, as well as acetyl- methyl-, thio- and other modified forms of adenine, cytidine, guanine, thymine, and uridine. Other modifications known in the art will be readily understood by the skilled artisan to be included herein. By "nucleic acid" is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

An "oligonucleotide" or "polynucleotide" is a nucleic acid ranging from at least 2, preferably at least 8, 15 or 25 nucleotides in length, but may be up to 50, 100, 1000, or 5000 nucleotides long or a compound that specifically hybridizes to a polynucleotide. Polynucleotides of the present invention include sequences of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) or mimetics thereof which may be isolated from natural sources, recombinantly produced or artificially synthesized. A further example of a polynucleotide of the present invention may be a peptide nucleic acid (PNA). (See US Pat No 6,156,501 which is hereby incorporated by reference in its entirety.) The invention also encompasses situations in which there is a nontraditional base pairing such as Hoogsteen base pairing which has been identified in certain tRNA molecules and postulated to exist in a triple helix. "Polynucleotide" and "oligonucleotide" are used interchangeably in this disclosure.

As used herein a "probe" is defined as a nucleic acid capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. As used herein, a probe may include natural (i.e. A, G, U, C, or T) or modified bases (7-deazaguanosine, inosine, etc.). In addition, a linkage other than a phosphodiester bond may join the bases in probes, so long as it does not interfere with hybridization. Thus, probes may be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages.

A "probe target pair" is formed when two macromolecules have combined through molecular recognition to form a complex.

As used herein, the term "promoter/regulatory sequence" means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulator sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter/regulatory sequence may, for example, be one which expresses the gene product in an inducible manner. Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range. The term "solid support," "support," and "substrate" as used herein are used interchangeably and refer to a material or group of materials having a rigid or semi-rigid surface or surfaces. In one embodiment, at least one surface of the solid support will be substantially flat, although in some embodiments it may be desirable to physically separate synthesis regions for different compounds with, for example, wells, raised regions, pins, etched trenches, or the like. According to other embodiments, the solid support(s) will take the form of beads, resins, gels, microspheres, or other geometric configurations. See US Pat No 5,744,305 for exemplary substrates. The term "target" as used herein refers to a molecule that has an affinity for a given probe. Targets may be naturally-occurring or man-made molecules. Also, they can be employed in their unaltered state or as aggregates with other species. Targets may be attached, covalently or noncovalently, to a binding member, either directly or via a specific binding substance. Examples of targets which can be employed by the invention include, but are not restricted to, oligonucleotides, nucleic acids, antibodies, cell membrane receptors, monoclonal antibodies and antisera reactive with specific antigenic determinants (such as on viruses, cells or other materials), drugs, peptides, cofactors, lectins, sugars, polysaccharides, cells, cellular membranes, and organelles. Targets are sometimes referred to in the art as anti-probes. As the term targets is used herein, no difference in meaning is intended.

"Variant" as the term is used herein, is a nucleic acid sequence that differs in sequence from a reference nucleic acid sequence, but retains essential properties of the reference molecule. One example of a retained essential property would be the ability of the variant nucleic acid to hybridize to a particular target mRNA, much like the reference nucleic acid sequence, and thereby diminish expression. A variant of a nucleic acid can be a naturally occurring such as an allelic variant, or can be a variant that is not known to occur naturally. Non-naturally occurring variants of nucleic acids may be made by mutagenesis techniques or by direct synthesis. Preferably, the variant shares at least about 80% homology with the reference nucleic acid sequence. More preferably, the variant shares at least about 90% homology with the reference nucleic acid sequence. Even more preferably, the variant shares at least about 95% homology with the reference nucleic acid sequence. A "vector" is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non- viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, poly-1-lysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like. EXPERIMENTAL EXAMPLES

The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

The materials and methods used in the experimental examples are now described.

Patients and samples

Malignant ovarian ascites samples were collected from stage III/IV ovarian cancer patients. Tumor samples were collected from surgery under sterile conditions, one aliquot was processed for cell preparation and a second aliquot was snap frozen in liquid nitrogen for later use.

Cell lines and culture conditions

Human EOC cell lines A2780 and CP70 were grown in RPMI plus 10% fetal bovine serum (Gemini Bio-Products, Woodland, CA) at 37°C in a 5% CO₂ atmosphere. Primary EOC cells were isolated from malignant ovarian ascites and cultured as previously described (Kamsteeg et al, 2003, Oncogene 22:2611-2620).

EOC cells were isolated from tumors as previously described (Flick et al. , 2004, J.

Soc. Gynecol. Investig. 1 1 :252-259; Kamsteeg et al., 2003, Oncogene 22:2611-2620). Purity of the EOC cells was 100% as determined by immunostaining for cytokeratin antigen.

Reagents

LPS isolated from Escherichia coli (0111 :B4), paclitaxel and rabbit anti-human β-actin antibody were purchased from Sigma Chemical Co. (St. Louis, MO). TNF-α was purchased from PeproTech Inc. (Rocky Hill, NJ). Rabbit anti- human MyD88 antibody was purchased from eBioscience (San Diego, CA). Mouse anti-human IκBα antibody and rabbit anti-human IKKα, IKKβ, or phospho-IKKα (Serl80)IKKβ (Serl81) antibodies were purchased from Cell Signaling Technology (Danvers, MA). Mouse anti-human p65 and mouse anti-human DNA topoisomerase I were purchased from Santa Cruz Biotechnology (Santa Cruz, CA) and BD Biosciences (San Jose, CA), respectively.

Establishment of mice xenograft model

SCID mice were injected subcutaneously with either IxIO⁷ Type I or 1 xlO⁷ Type II ovarian cancer cells (n = 5 per type per treatment). Paclitaxel (10 mg/kg body weight) or phosphate-buffered saline (PBS) control injection intraperitoneal (i.p.) started at Day 0 when the xenograft tumors were palpable (-0.3x0.3x0.3 cm³). Mice were then injected i.p. with 3 additional doses of paclitaxel (10 mg/kg body weight) or PBS on Day 3, 6, and 9. Tumor size and animal weight were monitored daily. Animals were sacrificed after the experiment, the xenografted tumors were isolated, and cytokine levels in the protein lysates from each tumor mass were measured by Luminex (see below).

Cell viability assay

Non-treated and treated Type I and Type II cells were subjected to cell viability assay using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega, Madison, WI) according to the manufacturer's instructions. The values from treated cells were reported as percentage change compared with those of untreated cells. Each experiment was repeated at least 3 times.

Protein preparation

Protein extraction was done as previously described (Kamsteeg et al. , 2003, Oncogene 22:2611-2620). Briefly, cell pellets were lysed on ice in IX PBS with 1 % NP40, 0.1 % SDS, and freshly added 20 μl/ml protease inhibitor cocktail (Sigma Chemical) and 2 mM phenylmethylsulfonyl fluoride (Sigma Chemical). Cytoplasmic and nuclear fractionation, when necessary, was performed using the NEPER Nuclear and Cytoplasmic Extraction kit (Pierce Biotechnology, Rockford, IL) according to the manufacturer's manual. Protein concentration was determined by BCA Protein Assay (Pierce Biotechnology, Rockford, IL), and proteins were stored at -40°C until further use.

SDS-PAGE and Western blots

20 μg of each protein sample was denatured in sample buffer [2.5% SDS, 10% glycerol, 5% β-mercaptoethanol, 0.15 M Tris (pH6.8), and 0.01% bromophenol blue] and subjected to 12% SDS-PAGE as previously described (Kamsteeg et α/., 2003, Oncogene 22:2611-2620). Antibodies used: rabbit anti-human MyD88 (1 : 1,000), mouse anti-human IκBα (1 : 1,000), rabbit anti-human IKKα (1 :1 ,000), rabbit anti-human IKKβ (1 :2,000), rabbit anti-human phospho-IKKα (Serl 80)/IKKβ (Serl 81) (1 :250), mouse anti-human p65 (1 : 1 ,000), mouse anti-human DNA topoisomerase 1 (1 : 10,000), and rabbit anti-human β-actin (1 : 10,000). Specific protein bands were visualized using the enhanced chemiluminescence assay (Pierce Biotechnology, Rockford, IL).

Caspase-Glo assay

10 μg of each protein sample was diluted with ddH₂O in a total volume of 50 μl. The samples were then mixed with 50 μl of Caspase-Glo 3/7, 8 or 9 reagents (Promega, Madison, WI). After 1-hour incubation at room temperature, luminescence was measured using TD 20/20 Luminometer (Turner Designs, Sunnyvale, CA). After subtracting blank values, relative caspase activity was calculated based on readings measured from untreated cells. Each sample was done in triplicates.

NF-κB activity

NF-κB activity was measured by means of a luciferase reporter construct, pBII-LUC containing two KB sites before a Fos essential promoter. Cells were transiently transfected with pBII-LUC using the FuGENE 6 Transfection Reagent (Roche Applied Science, Indianapolis, IN) following the manufacturer's instructions. Luciferase activity was measured using the Luciferase Assay System (Promega, Madison, WI) according to the manufacturer's protocol. Briefly, 10 μg of each protein sample in a total volume of 20 μl was mixed with 100 μl of the Luciferase Assay Reagent, and luminescence was measured using TD 20/20 Luminometer (Turner Designs, Sunnyvale, CA). Relative activity was calculated based on readings measured from untreated cells after subtracting blank values. Each sample was done in triplicates.

Cytokine Profiling

Cytokine profiling was performed from protein extracts or culture supernatants using the Luminex 200 system (Luminex Co., Austin, TX) according to the manufacturer's instructions. In summary, 50 μl of standard or sample was added to the wells of 96-well plates, and 25 μl of microparticle mixture was added to each well. The plates were incubated at room temperature on an orbital shaker (500 rpm) for 2 hours. The plates were then washed 3 times with Beadle Cell Signaling Assay Buffer (Upstate, Charlottesville, VA) and the microparticles were resuspended in 75 μl of the Assay Buffer. 25 μl of biotinylated detection Ab was added to each well, and after 1.5 hours of incubation at RT (500 rpm), the plates were washed 3 times again with Assay Buffer, and the microparticles were resuspended in 75 μl of Assay Buffer. 1 :20 Streptavadin-PE: Assay buffer mixture was prepare and 25 μl were added per well. After 0.5 hour of incubation at RT (500 rpm), the plates were washed again 3 times with Assay Buffer and resuspended in 125 μl of Assay Buffer. The plates were then read by the Luminex 200 Multiplex Analyzer.

IKKB transfection

The plasmid construct overexpressing a constitutively active form of IKKβ (pCMV-IKK2 S 177E S 181 E) was obtained from www.addgene.com (Plasmid #11105). Transient transfection of Type II cells with pCMV-IKK2 S177E S181E, or the empty vector pCMV was carried out using the FuGENE 6 Transfection Reagent (Roche Applied Science, Indianapolis, IN) following the manufacturer's instructions.

mJRNA microarray

Analysis with miRNA microarrays each containing 316 analytes were carried out using the NCode™ Multi-Species miRNA Microarray Kit (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. In summary miRNA were isolated from total RNA and Poly(A)-tailed followed by ligation of a specific capture sequence through an Oligo(dT) bridge. The tagged miRNA were purified and hybridized to the microarray slides overnight. The slides were then washed and hybridized with Alexa Fluor® 3 / Alexa Fluor® 5 Capture Reagents. The microarray slides were scanned and quantitated using a GenePix 4000B microarray scanner (Molecular Devices, Sunnyvale, CA).

mJRNA qRT-PCR

qRT-PCR was performed to detect the levels of hsa-mir- 199a (i.e., human mir-199) in three Type I and three Type II OC cell lines by NCode™ SYBR® GreenER™ miRNA qRT-PCR Analysis (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol as summarized below. The sequence of hsa-mir- 199a- 1 has been reported to be: GCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUC UCAAUGUGUACAGUAGUCUGCACAUUGGUUAGGC (SEQ ID NO: 1); miRBase Accession MI0000242; Symbol HGNC:MIRN 199Al . A qRT-PCR forward primer for hsa-mir- 199a (5'-CCCAGTGTTCAGACTACCTGTTC-S ' (SEQ ID NO:11)) was designed and synthesized by Invitrogen. A polyadenylation reaction was performed on 500ng of each total RNA sample using the NCode™ miRNA First- Strand cDNA Synthesis Kit (Invitrogen). Quadruplicate qPCR reactions for each cDNA were performed for hsa-mir- 199a as well as for the housekeeping control genes beta-2-microglobulin (B2M, RefSeq NM_004048.2, forward primer 5'-CCGTGGCC TTAGCTGTGCTC-3' (SEQ ID NO: 12), reverse primer 5'-TCCATTCTCTGCTG GATGACG-3' (SEQ ID NO: 13)) and glyceraldehyde-3 -phosphate dehydrogenase (GAPDH, RefSeq NM 002046.3, forward primer 5'-CGCTGAGTACGTCGTGGA GTC-3' (SEQ ID NO:14), reverse primer 5'-GCAGGAGGCATTGCTGATGA-S ' (SEQ ID NO: 15)) using the NCode™ SYBR® GreenER™ miRNA qRT-PCR Kit (Invitrogen) and a 7900HT qPCR machine (Applied Biosystems, Foster City, CA). The data are shown as fold change compared to sample A2780 after normalization to either housekeeping gene.

Immunohistochemistry

Twenty samples of ovarian cancer tissues were evaluated for immunohistochemistry. To detect expression of MyD88 by EOC cells, sections of tumor samples (8 μm) were blocked with either 3% BSA or 10% goat serum in PBS for 1 hour at room temperature. Following 3 washes with PBS, samples were incubated at room temperature for 1 hour with the anti-CD45 antibody (DAKO A/SO, 1 :150) or overnight at 4°C with the anti-MyD88 antibody. Mouse IgGl or rabbit serum served as negative controls. After 3 washes with PBS, specific staining was detected by incubating with a biotinylated horse anti-mouse antibody (Vector Laboratories, 1 :200) or a peroxidase-conjugated goat anti-rabbit antibody (Vector Laboratories, 1 : 1 ,000), respectively, for 1 hour followed by a 5-minute incubation with either DAB substrate (Vector Laboratories) or 3,3V-diaminobenzidine substrate (Vector Laboratories, Burlingame, CA), respectively. Tissue sections were then counterstained with hematoxylin (Sigma Chemical) before dehydration with ethanol and Histosolve (Shandon, Inc., Pittsburgh, PA). Slides were then mounted with Permount (Fisher Scientific, Pittsburgh, PA) and visualized by light microscopy.

Laser Capture Microdissection

6,000 ovarian cancer cells were microdissected using a Leica Laser Capture Microdissection System (Leica Microsystems MA), from 20 patient samples and collected in PCR Eppendorf tubes containing sample buffer. Then, samples underwent 3 freeze-thaw cycles and were heated for 10 minutes at 95°C. The samples were then stored at -20 °C until Western Blot analysis.

RNA isolation and reverse transcription-PCR

Total RNA was isolated using the RNeasy Mini kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. Reverse transcription was performed using 2 μg of total RNA using the First Strand cDNA Synthesis kit (Amersham Biosciences, Buckinghamshire, United Kingdom) according to the manufacturer's instructions. The primers used for amplification of human IKKB were as follows: forward primer, 5'-ACTTGGCGCCCAATGACCT-S ' (SEQ ID NO: 16); reverse primer, 5 '-CTCTGTTCTCCTTGCTGCA-S' (SEQ ID NO: 17). The primers used for human ACTB control were as below: forward primer, 5'-

TGACGGGGTCACCCACACTGTGCCCATCTA-3' (SEQ ID NO: 18); reverse primer, 5'-CTAGAAGCATTTGCGGTGGACGATGGAGGG-S' (SEQ ID NO:19). Thirty cycles of PCR were done at 95⁰C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds. The size of PCR products was 223 bp (IKKB) and 661 bp (ACTB), respectively.

Statistical Analysis Data were presented as mean ± SD (O'Dwyer et al, 1994, Cancer Res.

54:724-729). Statistical significance (P < 0.05) was determined using one-way

ANOVA with the Bonferonni correction. Survival curve of the patients were done by the method of Kaplan-Meier (Kaplan et al, 1958, J. Am. Stat. Assoc. 53:457-481), and the significance of the difference was estimated by log-rank test.

The results of the experiments performed are now described.

TLR-4-MyP88 pathway confers paclitaxel resistance in an EOC xenograft model.

The differential expression of MyD88 in EOC cells and its correlation with paclitaxel resistance was previously reported (Kelly et al, 2006, Cancer Res. 66:3859-3868). Herein, the differential response of MyD88 -positive (Type I EOC cells) and MyD88-negative cells (Type II EOC cells) to paclitaxel using a xenograft mice model was examined. As shown in Figure IA, paclitaxel treatment inhibited Type II EOC cells, but enhanced Type I EOC tumor growth, compared to vehicle control. Evaluation of the cytokine content of these tumors showed high levels of IL- 6, GM-CSF and MIP-Ia in tumors bearing Type I EOC cells but not Type II EOC cells (Figure 8).

MyD88 expression correlates with chemoresistance in patients with EOC.

To determine whether MyD88 expression in patients' tumor tissues correlates with patient survival, a retrospective study was performed using twenty randomly selected tumors from EOC patients collected from 2004 through 2006. MyD88 expression was determined by Western blot in ovarian cancer cells microdissected from tissue samples and by immunohistochemistry in paraffin sections. Eleven out of 20 tumors were classified as Type I and nine tumors were classified as Type II (Figures 9A and 9B).

A statistically significant correlation between assay prediction of response and progression-free interval (PFI) was observed in all these cases (Figure IB). Furthermore, as shown by the Kaplan-Meier curve, patients with Type II tumors responded better to treatment and had significantly longer overall survival when compared to patients with Type I tumors (Figure 1C). Differential response of EOC cells to LPS, Paclitaxel, and TNF-α stimulation.

The potential molecular differences between these two types of EOC cells were further characterized. TNF-α is a pro-inflammatory cytokine involved in cancer, which originally was thought to induce tumor cell death (Aggarwal, 2003, Nat. Rev. Immunol 3:745-756). However, there is ample evidence that TNF-α may act as tumor promoter instead through the activation of NF-κB (Aggarwal, 2003, Nat.

Rev. Immunol 3:745-756; Barnhart and Peter, 2003, Cell 114:148-150; Chen et al,

2007, Am. J. Reprod. Immunol. 57:93-107). Two subtypes of EOC cells were examined to determine whether, in addition to their differential response to LPS and paclitaxel (Kelly et al, 2006, Cancer Res. 66:3859-3868), they would also respond differently to TNF-α stimulation.

Type I cells were resistant to TNF-α-induced cell death and proliferate in the presence of paclitaxel and LPS. In contrast, Type II EOC cells did not proliferate upon LPS stimulation and showed a significant decrease in cell viability following treatment with paclitaxel and TNF-α (Figure 2A). The decrease in cell viability was due to induction of apoptosis as demonstrated by increased levels of caspase-3/7 activity (Figures 2B & 10A). In addition, TNF-α-induced apoptosis followed the classical pathway characterized by increased levels of caspase-3, caspase-8 and caspase-9 activity (Figure 10B). These results suggested that in addition to MyD88 expression, and their differential response to paclitaxel and LPS, the two sub-types of EOC cells also showed differential response to TNF-α. Furthermore, low-dose (10 ng/ml) TNF-α treatment was demonstrated to induce the time-dependent increase in phosphorylation of IKKβ in Type I EOC cells, but not in Type II EOC cells. No change in phosphorylation of IKKα in either type of cells was observed.

Differential patterns of NF-κB activity in EOC cells.

Although stimulation of TLRs and TNFR leads to activation of many important signaling pathways, it is well accepted that NF-κB has a central role in the resulting inflammatory response (Karin et al, 2002, Nat. Rev. Cancer 2:301-310). Therefore, the expression and function of the transcription factor NF-κB was evaluated. Using a luciferase reporter system (Leung et al, 2006, MoI. Pharmacol. 70:1946-1955), the level of NF-κB activity in these cells was monitored. As shown in Figure 3A, Type I EOC cells have constitutive NF-κB activity characterized by cyclic changes during a 12-hour time course. In contrast, in Type II EOC cells, NF-κB activity remained constant during the same time period (Figure 3A). Further differences in NF-κB activity were observed when EOC cells were stimulated with either LPS or paclitaxel (both of which activate NF-κB in a MyD 88 -dependent pathway), or low dose of TNF-α (10ng/ml), which activates NF-κB in a MyD88- independent pathway). LPS and Paclitaxel enhanced NF -KB activity in Type I but not Type II EOC cells, confirming that MyD88 expression is necessary for the effects of these two compounds (Figure 3 B and 3C). However, TNF-α treatment enhanced NF- KB activity in both Type I and II EOC cells suggestive of functional NF -KB in the two cell types (Figure 3D). These results were further confirmed the nuclear level of p65 in EOC cells was evaluated. TNF-α treatment induced nuclear translocation of p65 within 30 minutes in both cell types; however, this effect was transient in Type II EOC cells, showing decreased levels after 1 hour of treatment, while in Type I EOC cells p65 nuclear expression remained high even after 6 hours post-treatment (Figure 3E).

Type I EOC cells constitutively secrete pro-tumor cytokines, which is enhanced by LPS, paclitaxel, and TNF-α.

The production of pro-inflammatory cytokines is known to be one of the main consequences of NF-κB activation. Therefore, the cytokine profile of Type I and Type II EOC cells in the presence or absence of LPS, paclitaxel and TNF-α, was examined. Previously, the differential expression of MyD88 in EOC cells, which correlated with their in vitro response to LPS and paclitaxel, was identified (Kelly et al. , 2006). Furthermore, it was shown that ligation of TLR4 by LPS or paclitaxel in MyD88-positive (Type I EOC cells) but not MyD88-negative cells (Type II EOC cells) enhanced cytokine/chemokine production (Kelly et al. , 2006). As the tumor microenvironment is determined, in great part, by the factors produced by the tumor cells, the first objective was to characterize the cytokine profile for each of these two cell types. Type I EOC cells (MyD88-positive) are characterized by constitutive secretion of proinflammatory cytokines and chemokines including IL-6, IL-8, MCP-I, MIP-Ia, Regulated on Activation, Normal T-cell Expressed and Secreted (RANTES), GRO-a, granulocyte monocyte-colony- stimulating factor (GM-CSF) and MIF (Figure 4F). Conversely, none of these cytokines, with the exception of MIF, were detected in Type II EOC cells (Figure 4F).

Type I cells are characterized by the continuous secretion of pro- inflammatory cytokines and chemokines including IL-6, IL-8, MCP-I, and GRO-α, and the levels of these cytokines were enhanced upon LPS, paclitaxel or TNF-α stimulation (Figure 4A). Conversely, none of these cytokines were detected in Type II EOC cells in the presence or absence of these agents (Figure 4A). Surprisingly, the NF-κB activation observed in Type II EOC cells upon TNF-a stimulation did not translate into cytokine production. These data suggest that constitutive NF-κB activity in Type I EOC cells may be responsible for the constitutive production of proinflammatory cytokines. Indeed, NF-κB activity inhibited in Type I EOC cells was inhibited with a specific NF-κB inhibitor Eriocalyxin B (Leung et al, 2006, MoI. Pharmacol. 70:1946-1955), both constitutive and TNF-α-induced cytokine production was inhibited (Figure 4B). In addition, the cells became sensitive to TNF-α-induced apoptosis (Figure 11).

Differential expression and regulation of the Inhibitor of NF-κB α (IKBOQ in EOC cells.

The data disclosed herein suggest that the constitutive NF-κB cyclic activity observed in Type I EOC cells may be the result of specific regulatory elements upstream of the pathway. Thus, the expression and activation of IκBα, in both cell types was examined by Western Blot analysis. Type I EOC cells have low levels of IκBα while high levels of expression was observed in Type II EOC cells. This pattern of expression was inversely correlated with MyD88 expression (Figure 4C). Furthermore, evaluation of IκBα levels over a period of 12 hours showed a similar cyclic pattern as observed for NF-κB in Type I but not Type II EOC cells (Figure 12). These data demonstrate a correlation between the levels of IκBα and NF- KB activity, suggesting that the differential regulation of NF-κB activity and function in Type I and II EOC cells may be through the regulation of cellular IκBα levels by upstream regulators. The degradation of IκBα depends on the phosphorylation of the IKB kinase (IKK) (Greten and Karin, Cancer Lett. 206:193-199; Rothwarf and Karin, 1999, Sci STKE 1999, REl). The IKK complex has two catalytic subunits, IKKα and IKKβ and an essential regulatory subunit IKKγ/NEMO (Mer curio et al., 1999, MoI. Cell. Biol. 19:1526-1538). Differential expression of IKK subunits has been associated with cytokine production and resistance/sensitivity to TNF-α treatment (Luo et al, 2004, Cancer Cell 6:297-305; Maeda et al, 2003, Immunity 19:725-737), suggesting that the difference observed between in Type I and II EOC cells may be related to the expression of IKK subunits. Thus, levels of IKKα and IKKβ were determined by western blot analysis. The ratio of IKKβ/IKKα was found to be significantly higher in Type I than Type II cells (Figure 4D), suggesting that this differential expression of IKKα and IKKβ may explain the observed difference in NF- KB and IκBα activity.

Ectopic expression of IKKβ induces cytokine production in Type II EOC cells.

Deletion of the IKKβ subunit has been shown to inhibit inflammatory response and IKKβ deficient cells have been shown to be sensitive to TNF-α-induced apoptosis (Li et al, 1999, Science 284:321-325; Li and Verma, 2002, Nat. Rev. Immunol. 2:725-734). That Type II EOC cells express low levels of IKKβ suggests that the ectopic expression of IKKβ in these cells will increase the ratio of IKKβ/IKKα and may induce Type II EOC cells to produce proinflammatory cytokines. Indeed, the ectopic overexpression of a constitutively active form of IKKβ (pCMV2-IKK2 S177E S 181 E) (Mercurio et al, 1999, MoI. Cell. Biol. 19:1526- 1538) in Type II EOC cells resulted in a significant decrease in the expression of IκBα (Figure 4E), and the production of high levels of pro-inflammatory cytokines (Figure 5A). Interestingly, increased MyD88 expression in these transfected cells was observed (Figure 4E), which may be the result of NF-κB activation since MyD88 is also a target of NF-κB (Harroch et al, 1995, Nucleic Acids Res 23:3539-3546).

IKKβ restores TLR-4 response in Type Il EOC cells.

Whether the expression of IKKβ could restore in Type II EOC cells the TLR-4 response seen in Type I cells was evaluated. Thus, Type II A2780 cells stably transfected with MyD88 were transiently transfected with a plasmid expressing the wild-type IKKβ gene. 24 hours after transfection, cells were treated with LPS and cytokine production was determined in both supernatant and lysate. As shown in Figure 5B, only cells transfected with IKKβ have increased levels of cytokine secretion following LPS treatment. These results confirm the important role of IKKβ in cytokine production following TLR-4 ligation.

miR-199a regulates IKKβ expression in EOC cells.

Although protein levels are different, evaluation of IKKβ mRNA showed similar levels in both cell types (Figure 13A), suggesting post-transcriptional regulation mechanism. MiRNAs are non-coding forms of RNAs involved in posttranscriptional gene regulation. Therefore, whether differential expression of IKKβ protein was due to miRNA regulation was investigated. To examine the potential involvement of miRNAs on the regulation of EOC cell phenotype, the expression of 316 miRNAs in Type I and II EOC cells was analyzed using miRNA microarray chips (Invitrogen) (Figure 13B). Eighteen miRNAs were identified to be differentially expressed between the two cell types (Figure 6A). Three miRNAs are highly expressed in Type II while 15 are down-regulated, compared to Type I. Using PicTar (pictar.bio.nyu.edu), an algorithm for the identification of miRNA targets, it was found that the 3 '-untranslated region (UTR) of IKKβ mRNA contains 3 putative target sequences for hsa-mir-199a, which is one of the three miRNAs up-regulated in Type II cells (Figure 13C). In order to validate the results from the miRNA microarray, NCode™ SYBR® GreenER™ miRNA qRT-PCR analysis was performed for hsa-mir-199a. Using total RNA from 6 samples in a blinded manner (Figure 13D), high levels of hsa-mir-199a expression was detected only in Type II EOC cells (Figure 6B).

To confirm the role of hsa-mir- 199a in the regulation of IKKβ, loss-of- function and gain-of-function studies were performed. Transient transfection of the pre-miRNA of hsa-mir- 199a into Type I cells led to a significant decrease on IKKβ expression, while the transient transfection of the anti-miRNA of hsa-miR199a into Type II cells resulted in the expression of IKKβ (Figure 6C). The sequence of pre- hsa-mir- 199a (i.e., hsa-mir- 199a-2) has been reported to be: AGGAAGCUUCUGG AGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAA UGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGA GAGCA (SEQ ID NO:2); miRBase Accession MI0000281 ; Symbol HGNC:MIRN199A2.

The downregulation of IKKβ expression by hsa-mir-199a was demonstrated to depend directly on the 3'-UTR of IKKβ mRNA with a luciferase reporter system (Figure 6D). Using a construct that highly expresses luciferase, the IKKβ 3'-UTR was added after the luciferase gene (pmir-RIKK2-3u-l) (Figure 6D). Then, the construct was transfected into Type I EOC cells (having endogenous low levels of hsa-mir-199a), and divided in three groups. Group 1 was transfected with hsa-mir-199a; group 2 received a nonspecific negative control miRNA (miR-NC-no. 1) and group 3 received mock transfection control (only transfection reagent), hsa- mir- 199a transfection resulted in significant suppression of luciferase activity compared to mock transfection, whereas negative control miRNA (miRNC-no. 1) led to no change in the luciferase activity (Figure 6D). Mutation of the hsa-mir-199a- binding sites in the IKKβ 3'-UTR completely abolished the inhibitory effect of hsa- mir-199a on luciferase activity (data not shown). These results further confirm a direct inhibition of hsa-mir-199a on IKKβ mRNA translation through its 3'-UTR.

OTHER EMBODIMENTS

While the invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of the invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.

The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety.

Claims

1. A method of identifying a chemoresistant cancer cell, the method comprising: measuring the level of mir-199a miRNA in a first cancer cell; and comparing the level of mir-199a miRNA in the first cancer cell to the level of mir-199a miRNA in a second cancer cell; wherein the second cancer cell is a Type I epithelial ovarian cancer cell; and wherein when the level of mir-199a miRNA detected in the first cancer cell is not more than about 1.8-fold the level of mir-199a miRNA in the second cancer cell, the first cancer cell is identified as chemoresistant.

2. The method of claim 1 , wherein the level of mir- 199a miRNA in the first cancer cell is also compared to the level of mir- 199a miRNA in a third cancer cell; wherein the third cancer cell is a Type II epithelial ovarian cancer cell; and wherein when the level of mir- 199a miRNA detected in the first cancer cell is not more than about 0.9-fold the level of mir- 199a miRNA in the third cancer cell, the first cancer cell is identified as chemoresistant.

3. The method of claim 1 , wherein the first cancer cell is a cancer cell selected from the group consisting of: an epithelial ovarian cancer cell, a mucinous ovarian cancer cell, a clear cell carcinoma of the ovaries, a mucinous ovarian cancer cell and a granulose ovarian cancer cell.

4. The method of claim 1 , wherein the first cancer cell is an epithelial ovarian cancer cell.

5. The method of claim 1 , wherein the sequence of the mir- 199a miRNA comprises at least one of the group consisting of consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10; and fragments, variants and modifications thereof.

6. The method of claim 1 , wherein the level of mir- 199a is measured using one of the group consisting of PCR, northern blot and microarray.

7. A method of diminishing the level of expression of IKKβ in a cancer cell, the method comprising: administering to the cancer cell a nucleic acid; wherein the nucleic acid binds to IKKβ mRNA in the cancer cell.

8. The method of claim 7, wherein the first cancer cell is a cancer cell selected from the group consisting of: an epithelial ovarian cancer cell, a mucinous ovarian cancer cell, a clear cell carcinoma of the ovaries, a mucinous ovarian cancer cell and a granulose ovarian cancer cell.

9. The method of claim 7, wherein the cancer cell is an epithelial ovarian cancer cell.

10. The method of claim 7, wherein the nucleic acid comprises at least one of the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10; and fragments, variants and modifications thereof.

1 1. The method of claim 7, wherein the nucleic acid is expressed from a vector.

12. The method of claim 7, wherein the nucleic acid binds to the 3' UTR of the IKKβ mRNA.

13. The method of claim 7, wherein the diminution of the level of expression of IKKβ occurs through the diminution of the level of IKKβ mRNA.

14. The method of claim 7, wherein the diminution of the level of expression of IKKβ occurs through the diminution of the level of translation of IKKβ mRNA.

15. The method of claim 7, wherein the nucleic acid is at least one of the group selected from an antisense nucleic acid, a polynucleotide, a miRNA, an siRNA and a ribozyme.

16. A method of diminishing the level of chemoresistance of a cancer cell, the method comprising: administering to the cancer cell a nucleic acid; wherein the nucleic acid binds to IKKβ mRNA in the cancer cell; and wherein the binding of the nucleic acid to IKKβ mRNA in the cancer cell diminishes the level of expression of IKKβ in the cancer cell.

17. The method of claim 16, wherein the cancer cell is a cancer cell selected from the group consisting of: an epithelial ovarian cancer cell, a mucinous ovarian cancer cell, a clear cell carcinoma of the ovaries, a mucinous ovarian cancer cell and a granulose ovarian cancer cell.

18. The method of claim 16, wherein the cancer cell is an epithelial ovarian cancer cell.

19. The method of claim 16, wherein the nucleic acid comprises at least one of the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3,

SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10; and fragments, variants and modifications thereof.

20. The method of claim 16, wherein the nucleic acid is expressed from a vector.

21. The method of claim 16, wherein the nucleic acid binds to the

3' UTR of the IKKβ mRNA.

22. The method of claim 16, wherein the diminution of the level of expression of IKKβ occurs through the diminution of the level of IKKβ mRNA.

23. The method of claim 16, wherein the diminution of the level of expression of IKKβ occurs through the diminution of the level of translation of IKKβ mRNA.

24. The method of claim 16, wherein the nucleic acid is at least one of the group selected from an antisense nucleic acid, a polynucleotide, a miRNA, an siRNA and a ribozyme.

25. A method of treating a patient with cancer, the method comprising: administering to a cancer cell of the patient, a nucleic acid; wherein the nucleic acid binds to IKKβ mRNA in the cancer cell; and wherein the binding of the nucleic acid to IKKβ mRNA in the cancer cell diminishes the level of expression of IKKβ in the cancer cell.

26. The method of claim 25, wherein the cancer cell is a cancer cell selected from the group consisting of: an epithelial ovarian cancer cell, a mucinous ovarian cancer cell, a clear cell carcinoma of the ovaries, a mucinous ovarian cancer cell and a granulose ovarian cancer cell.

27. The method of claim 25, wherein the cancer is epithelial ovarian cancer.

28. The method of claim 25, wherein the nucleic acid comprises at least one of the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10; and fragments, variants and modifications thereof.

29. The method of claim 25, wherein the nucleic acid is expressed from a vector.

30. The method of claim 25, wherein the diminution of the level of expression of IKKβ in the cancer cell reduces the chemoresistance of the cancer cell.

31. The method of claim 25, wherein the nucleic acid binds IKKβ mRNA.

32. The method of claim 25, wherein the nucleic acid comprising binds to the 3' UTR of the IKKβ mRNA.

33. The method of claim 25, wherein the diminution of the level of expression of IKKβ occurs through the diminution of the level of IKKβ mRNA.

34. The method of claim 25, wherein the diminution of the level of expression of IKKβ occurs through the diminution of the level of translation of IKKβ mRNA.

35. The method of claim 25, wherein the patient is treated concomitantly with a chemotherapeutic agent.

36. The method of claim 35, wherein the chemotherapeutic agent is at least one selected from the group consisting of carboplatin, paclitaxel, and docetaxel, cisplatin, doxorubicin, and topotecan.

37. The method of claim 25, wherein the nucleic acid is at least one of the group selected from an antisense nucleic acid, a polynucleotide, a miRNA, an siRNA and a ribozyme.