WO2009090004A1 - Phosphodiesterase 10 catalytic domain crystals - Google Patents
Phosphodiesterase 10 catalytic domain crystals Download PDFInfo
- Publication number
- WO2009090004A1 WO2009090004A1 PCT/EP2009/000036 EP2009000036W WO2009090004A1 WO 2009090004 A1 WO2009090004 A1 WO 2009090004A1 EP 2009000036 W EP2009000036 W EP 2009000036W WO 2009090004 A1 WO2009090004 A1 WO 2009090004A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- crystal
- cat
- polypeptide
- pdelo
- pde10
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B15/00—ICT specially adapted for analysing two-dimensional [2D] or three-dimensional [3D] molecular structures, e.g. structural or functional relations or structure alignment
- G16B15/30—Drug targeting using structural data; Docking or binding prediction
-
- C—CHEMISTRY; METALLURGY
- C30—CRYSTAL GROWTH
- C30B—SINGLE-CRYSTAL GROWTH; UNIDIRECTIONAL SOLIDIFICATION OF EUTECTIC MATERIAL OR UNIDIRECTIONAL DEMIXING OF EUTECTOID MATERIAL; REFINING BY ZONE-MELTING OF MATERIAL; PRODUCTION OF A HOMOGENEOUS POLYCRYSTALLINE MATERIAL WITH DEFINED STRUCTURE; SINGLE CRYSTALS OR HOMOGENEOUS POLYCRYSTALLINE MATERIAL WITH DEFINED STRUCTURE; AFTER-TREATMENT OF SINGLE CRYSTALS OR A HOMOGENEOUS POLYCRYSTALLINE MATERIAL WITH DEFINED STRUCTURE; APPARATUS THEREFOR
- C30B29/00—Single crystals or homogeneous polycrystalline material with defined structure characterised by the material or by their shape
- C30B29/54—Organic compounds
- C30B29/58—Macromolecular compounds
-
- C—CHEMISTRY; METALLURGY
- C30—CRYSTAL GROWTH
- C30B—SINGLE-CRYSTAL GROWTH; UNIDIRECTIONAL SOLIDIFICATION OF EUTECTIC MATERIAL OR UNIDIRECTIONAL DEMIXING OF EUTECTOID MATERIAL; REFINING BY ZONE-MELTING OF MATERIAL; PRODUCTION OF A HOMOGENEOUS POLYCRYSTALLINE MATERIAL WITH DEFINED STRUCTURE; SINGLE CRYSTALS OR HOMOGENEOUS POLYCRYSTALLINE MATERIAL WITH DEFINED STRUCTURE; AFTER-TREATMENT OF SINGLE CRYSTALS OR A HOMOGENEOUS POLYCRYSTALLINE MATERIAL WITH DEFINED STRUCTURE; APPARATUS THEREFOR
- C30B7/00—Single-crystal growth from solutions using solvents which are liquid at normal temperature, e.g. aqueous solutions
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16C—COMPUTATIONAL CHEMISTRY; CHEMOINFORMATICS; COMPUTATIONAL MATERIALS SCIENCE
- G16C20/00—Chemoinformatics, i.e. ICT specially adapted for the handling of physicochemical or structural data of chemical particles, elements, compounds or mixtures
- G16C20/50—Molecular design, e.g. of drugs
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2299/00—Coordinates from 3D structures of peptides, e.g. proteins or enzymes
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B15/00—ICT specially adapted for analysing two-dimensional [2D] or three-dimensional [3D] molecular structures, e.g. structural or functional relations or structure alignment
Definitions
- the present invention relates to crystals and co-crystals of the phosphodiesterase 10 catalytic domain (PDElO-cat) and their use in drug design.
- cyclic nucleotides cAMP and cGMP are second messengers that transmit a large body of hormone-, neurotransmitter-, and light-induced signals to regulate synaptic function, muscle contraction, immune response, vision, lipid metabolism, and gene expression.
- cAMP and cGMP levels are tightly regulated via their synthesis (adenylyl and guanylyl cyclases) and degradation
- PDEs are multi domain proteins grouped into 11 families encoded by 21 genes. Alternative splicing generates more than 60 functionally unique enzymes. Differences in substrate specificity allow for classification of PDEs in cAMP-specific (PDE4, 7, and 8), cGMP-specific (PDE5, 6, and 9), and dual specificity (PDEl, 2, 3, 10, and 1 1). For the catalytic domain, sequence conservation is high among PDEs, with >75% sequence homology within a family and 20-45% sequence homology across families. Despite the high sequence and also structural homology, PDEs exhibit diversity in their functional properties.
- PDEs are regulated by various mechanisms including cGMP binding to GAF domains (PDE5), phosphorylation (PDE4), association with other proteins such as kinase-A anchoring protein and PKA (PDE4), and oligomeri- zation (PDE4D3).
- PDElO is a dual specificity enzyme that was originally identified from mouse (Soderling et al., PNAS 96, 7071-7076 (1999)), and subsequently shown to play a major role in the progressive- sion of the neurodegenerative Huntington's disease (HD).
- HD neurodegenerative Huntington's disease
- PDElO mRNA levels decrease in HD mice prior to onset of motor symptoms (Hebb et al., Neuroscience 123, 967-981 (2004)).
- PDElO is highly expressed in testes, thyroid, and brain with a predominant distribution in the putamen and caudate nucleus. This expression pattern is conserved across species.
- Four splice isoforms of PDElO have been cloned from humans, two of which (PDElOAl and PDE10A2) have been par- tially characterized and may be regulated differently via phosphorylation.
- PDE inhibitors have recently been suggested as antipsychotic agents (Becker & Grecksch, Behav. Brain Res. (2008) 186(2): 155-60).
- the weak PDElO inhibitor papaverine was shown to potentiate haloperidol-induced catalepsy in rats, suggesting that inhibition of PDElOA might improve executive function deficits associated with schizophrenia or, more general, other models predictive of antipsychotic activity.
- papaverine and other broadband PDE inhibitors typically induce extrapyramidal side-effects, resulting in moderate compliance of prescribed therapies.
- compounds that specifically modulate PDElO activity without side-effects may show superior therapeutic efficacy on psychotic indications than current therapies that address PDE activity in a more unspecific manner.
- Ligands bound to the active site include the substrates cAMP and cGMP and the products AMP and GMP (PNAS, 104, 5782-5787 (2007)).
- the rat structures were determined in complex with two 6,7-dimethoxy-4- pyrrolidylquinazolines, demonstrating the principal drugability of PDElO (J.Med. Chem. 50, 182- 185 (2007)).
- the present invention relates to a crystal of a PDElO-cat polypeptide, wherein the crystal belongs to space group H3.
- the present invention relates to a co-crystal of a PDElO-cat polypeptide and a ligand bound to the PDElO-cat, wherein the crystal belongs to space group H3.
- the ligand is l-(3,4-Dimethoxy-benzyl)-6,7-dimethoxy- isoquinoline (papaverin).
- the PDElO-cat polypeptide is a polypeptide comprising a sequence having a similarity to the catalytic domain of a polypeptide of Seq. Id. No. 1 of at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, most preferably 100%.
- the PDE10-cat polypeptide comprises amino acids
- the present invention relates to a method for crystallizing a PDE10-cat polypeptide comprising the steps of: providing an aqueous solution of the PDE10-cat polypep- tide, mixing with a precipitant, and growing crystals by sitting drop vapor diffusion or micro- batch using a buffered precipitant solution of 5 % to 30 % (w/v) PEG, wherein the PEG has an average molecular weight of 200Da to 20 kDa.
- the buffered precipitant solution comprises 0 M to 1 M Bis-tris pH 6.5, 0 M to 0.1 M zinc chloride, 0 M to 0.5 M magnesium chloride, and 0 M to 1 M sodium chloride.
- the present invention relates to a method for generating a co-crystal of a
- PDE10-cat polypeptide with a ligand that binds to the active site of PDE10-cat a) providing a crystal of the PDE10-cat polypeptide of the present invention, b) adding a molar excess of the ligand to the crystal of the polypeptide, and c) generating a co-crystal.
- Crystals of the present invention can be grown by a number of techniques including batch crystallization, vapour diffusion (either by sitting drop or hanging drop) and by microdialysis. Seeding of the crystals in some instances is required to obtain X-ray quality crystals. Standard micro- and/or macroseeding of crystals may therefore be used.
- (co-)crystals are grown by vapor diffusion.
- the polypeptide solution is allowed to equilibrate in a closed container with a larger aqueous reservoir having a precipitant concentration optimal for producing crystals.
- a precipitant concentration optimal for producing crystals.
- less than about 10 ⁇ L of substantially pure polypeptide solution is mixed with an equal or similar volume of reservoir solution, giving a precipitant concentration about half that required for crystallization.
- This solution is placed as a droplet on a plastic post surrounded by reservoir, which is sealed.
- the sealed container is allowed to stand, from one day to one year, usually for about 2-6 weeks, until crystals grow.
- the crystals or co-crystals of the present invention can be obtained by a method which comprises: providing a buffered, aqueous solution of 3.75 to 50 mg/ml of a PDElO-cat polypeptide, optionally adding a molar excess of the ligand to the aqueous polypeptide solution, and growing crystals by vapor diffusion or microbatch using a buffered reservoir solution of 0 % to 30 % (w/v) PEG, wherein the PEG has an average molecular weight of 200 Da to 20000 Da.
- the PEG may be added as monomethyl ether.
- a preferred PEG has an average molecular weight of 500 Da to 5,000 Da.
- a preferred buffered reservoir solution further comprises 0 M to 1 M Bis- tris pH 6.5, 0 M to 0.1 M zinc chloride, 0 M to 0.5 M magnesium chloride, and 0 M to 1 M sodium chloride. Said microbatch may be modified.
- the method is performed in presence of a 10 - 15 molar excess of the ligand.
- crystals of the invention and particularly the atomic structure coordinates obtained therefrom, have a wide variety of uses.
- the crystals and structure coordinates described herein are particularly useful for identifying compounds that bind to PDElO as an approach towards developing new therapeutic agents.
- the structure coordinates described herein can be used as phasing models in determining the crystal structures of additional native or mutated, as well as the structures of co-crystals of PDElO with bound ligand.
- the structure coordinates, as well as models of the three-dimensional structures obtained therefrom, can also be used to aid the elucidation of solution-based structures of native or mutated PDEs, such as those obtained via NMR.
- the crystals and atomic structure coordinates of the invention provide a convenient means for elucidating the structures and functions of a PDElO.
- the present invention also provides a method of identifying compounds that can bind to
- PDElO comprising the steps of: applying a 3-dimensional molecular modeling algorithm to the atomic coordinates of a protein shown in Fig. 1 or 2 to determine the spatial coordinates of the binding site of PDE10-cat; and electronically screening the stored spatial coordinates of a set of candidate compounds against the spatial coordinates of the PDElO catalytic domain to identify a compound that can bind to PDElO.
- the method comprises the steps of: generating a three dimensional model of a binding pocket of PDElO-cat using the relative structural data coordinates of Figure 1 or 2 of Leu635, Phe639, Asp674, Leu675, Ser677, Val678, Thr685, Ala689, Ile692, Tyr693, Phe696, Met713, Gly725, Gln726, Phe729, Tyr730, Val733, and Trp762 ⁇ a root mean square deviation from the backbone atoms of said amino acids of not more than 2 A; and performing computer fitting analysis to identify a compound that can bind to a PDElO-cat binding site.
- root mean square deviation means the square root of the arithmetic mean of the squares of the deviations. It is a way to express the deviation or variation from a trend or object.
- the "root mean square deviation” defines the variation in the backbone of a protein from the backbone of PDElO-cat or an active binding site thereof, as defined by the structure coordinates of PDElO-cat described herein.
- 3-dimensional structure is now a common approach in the identification of new lead compounds.
- This "virtual screening” approach relies on fast and accurate estimation of the ligand binding mode and an estimate of ligand affinity.
- a large database of compounds either real or virtual is docked to a target structure and a list of the best potential ligands is produced. This ranking should be highly enriched for active compounds which may then be subject to further experimental validation.
- the calculation of the ligand binding mode may be carried out by molecular docking programs which are able to dock the ligands in a flexible manner to a protein structure.
- the estimation of ligand affinity is typically carried out by the use of a separate scoring function.
- scoring functions include energy-based approaches which calculate the molecular mechanics force field and rule-based approaches which use empirical rules derived from the analysis of a suitable database of structural information. Consensus scoring involves rescoring each ligand with multiple scoring functions and then using a combination of these rankings to generate a hit list.
- Figure 1 shows the coordinates of an apo crystal of human PDElO-cat (amino acids 449 -
- Figure 2 shows the coordinates of a co-crystal of human PDElO-cat (amino acids 449 - 759 of Seq. Id. No. 1) with ligand l-(3,4-Dimethoxy-benzyl)-6,7-dimethoxy-isoquinoline (papa verin).
- GTACTTC AGAAG-3' (AttBl recombination site in bold, thrombin protease cleavage site in italics; Seq. Id. No. 2) and 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCAAT CTTCAGATGCAGCTG-3' ( ⁇ //B2 recombination site in bold; Seq. Id. No. 3), which conferred Gateway recombination sites (Invitrogen).
- the PCR product was used in a BP recombination reaction with pDONR221 (Invitrogen) to generate pENTR Thm-PDE10A2 (449-779).
- the DNA sequence was verified and used in an LR recombination reaction with a Gateway-modified version of pETl Ia (Novagen).
- Recombinant protein was produced at 22 0 C by induction to a final IPTG concentration of O.lmM at an optical density of 1.0 at 600nm for 2Oh. About 30% of the protein was in the soluble fraction of the cell homogenate.
- the protein was purified using sequential chromatography on Ni-NTA and HiTrapQ/HiTrapS.
- Protein used for crystallization of PDElO-cat has been purified as described above.
- the crystallization droplet was set up at 22 °C by mixing 0.3 ⁇ l of protein solution at a concentration of lOmg/mL with 0.3 ⁇ l reservoir in vapor diffusion sitting drop experiments. Crystals appeared out of 0.1 M bis-TRIS/NaOH pH 6.5, 25% PEG 3350 or 0.1 M HEPES/NaOH pH 7.5, 0.2 M MgCl 2 , 25% PEG 3350 after 1 day and grew to a maximum final size of 0.1x0.1x0. lmm 3 within 7 days.
- Crystals were harvested with paraffin oil as cryoprotectant and then flash cooled in liquid N 2 .
- Diffraction images were collected at a temperature of IOOK at the beamline XlOSA of the Swiss Light Source and processed with the programs DENZO and SCALEPACK (HKL Research) yielding data to 2.1 A resolution.
- Standard crystallographic programs from the CCP4 software suite were used to determine the structure by molecular replacement (CCP4 (Collaborative Computational Project, N. The CCP4 suite: programs for protein crystallography. Acta Crys- tallogr. D50, 760-763 (1994)).
- the structure 2OUN (Structural insight into substrate specificity of phosphodiesterase 10, PNAS, 104, 5782-5787 (2007)) was used as search model. Refinement and model building cycles were performed with REFMAC and COOT, respectively (Table 1).
- the structure is not isomor- phous to the orthorhombic crystals of human PDElO-cat in the PDB entries 20UN, 2OUP, 2OUQ, 2OUR, 2OUS, 2OUU, 20UV, and 20UY (Structural insight into substrate specificity of phosphodiesterase 10, PNAS, 104, 5782-5787 (2007)).
- the active site harbors a hydrated two metal ion cluster, which were assigned as Mg + and Zn + .
- the Zn 2+ ion was assigned based on an electron density map using anomalous differences and model phases.
- Example 2 Crystal structure of human PDElO-cat with inhibitor l-(3,4-Dimethoxy- benzyl)-6,7-dimethoxy-isoquinoline
- Protein used for crystallization of PDE10-cat together with l-(3,4-Dimethoxy-benzyl)-6,7- dimethoxy-isoquinoline has been purified as described above.
- the protein crystals were incubated with ligand in a 10 fold molar excess for 2 hours at room temperature.
- Crystals were harvested with reservoir as cryoprotectant and then flash cooled in liquid N 2 .
- the ligand was clearly defined in the initial Fo-Fc electron density map in all four monomers.
- the ligand is bound to the protein by one hydrogen bond to Gln726 and mainly hydrophobic interactions via residues Leu635, Leu675, Val678, Tyr693, Phe696, and Phe729.
- the structure is isomorphous to the structure in example 1 but not isomorphous to the orthorhombic crystals of human PDE10-cat in the PDB entries 2OUN, 2OUP, 2OUQ, 2OUR, 2OUS, 2OUU, 2OUV, and 2OUY (Structural insight into substrate specificity of phosphodiesterase 10, PNAS, 104, 5782-5787 (2007)).
- Table 2 Data collection and structure refinement statistics for l-(3,4-Dimethoxy-benzvD- 6,7-dimethoxy-isoquinoline co-crystal
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Crystallography & Structural Chemistry (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Theoretical Computer Science (AREA)
- Biotechnology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Materials Engineering (AREA)
- Metallurgy (AREA)
- Evolutionary Biology (AREA)
- Zoology (AREA)
- Medical Informatics (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Computing Systems (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention provides a crystal or co-crystal of PDE10 catalytic domain, which crystallizes in the rhombohedral space group H3 and their uses in drug design.
Description
PHOSPHODIESTERASE 10 CATALYTIC DOMAIN CRYSTALS
The present invention relates to crystals and co-crystals of the phosphodiesterase 10 catalytic domain (PDElO-cat) and their use in drug design.
The cyclic nucleotides cAMP and cGMP are second messengers that transmit a large body of hormone-, neurotransmitter-, and light-induced signals to regulate synaptic function, muscle contraction, immune response, vision, lipid metabolism, and gene expression. cAMP and cGMP levels are tightly regulated via their synthesis (adenylyl and guanylyl cyclases) and degradation
(PDEs).
PDEs are multi domain proteins grouped into 11 families encoded by 21 genes. Alternative splicing generates more than 60 functionally unique enzymes. Differences in substrate specificity allow for classification of PDEs in cAMP-specific (PDE4, 7, and 8), cGMP-specific (PDE5, 6, and 9), and dual specificity (PDEl, 2, 3, 10, and 1 1). For the catalytic domain, sequence conservation is high among PDEs, with >75% sequence homology within a family and 20-45% sequence homology across families. Despite the high sequence and also structural homology, PDEs exhibit diversity in their functional properties. In addition, PDEs are regulated by various mechanisms including cGMP binding to GAF domains (PDE5), phosphorylation (PDE4), association with other proteins such as kinase-A anchoring protein and PKA (PDE4), and oligomeri- zation (PDE4D3).
PDElO is a dual specificity enzyme that was originally identified from mouse (Soderling et al., PNAS 96, 7071-7076 (1999)), and subsequently shown to play a major role in the progres- sion of the neurodegenerative Huntington's disease (HD). PDElO mRNA levels decrease in HD mice prior to onset of motor symptoms (Hebb et al., Neuroscience 123, 967-981 (2004)). PDElO is highly expressed in testes, thyroid, and brain with a predominant distribution in the putamen and caudate nucleus. This expression pattern is conserved across species. Four splice isoforms of PDElO have been cloned from humans, two of which (PDElOAl and PDE10A2) have been par- tially characterized and may be regulated differently via phosphorylation.
PDE inhibitors have recently been suggested as antipsychotic agents (Becker & Grecksch, Behav. Brain Res. (2008) 186(2): 155-60). The weak PDElO inhibitor papaverine was shown to potentiate haloperidol-induced catalepsy in rats, suggesting that inhibition of PDElOA might improve executive function deficits associated with schizophrenia or, more general, other models predictive of antipsychotic activity. However, papaverine and other broadband PDE inhibitors
typically induce extrapyramidal side-effects, resulting in moderate compliance of prescribed therapies. Thus, there is need for compounds that specifically modulate PDElO activity without side-effects. Such compounds may show superior therapeutic efficacy on psychotic indications than current therapies that address PDE activity in a more unspecific manner.
In 2007 the crystal structures of wildtype human and rat PDElO-cat were published. The
PDElO-cat domains recapitulate the fold known from previous PDE iso forms, consisting of 15 α-helices and no β-sheets. Key residues in the active site include Val678, Thr685, Ala689, Ile692, Tyr693, Met713, Gly725, Gln726, Phe729, Tyr730, and Trp762. All human PDElO crystal structures share the same orthorhombic space group Y2{1{1\ with cell axes a=48.7-51.4 A, b=81.9-82.3 A, c=153.2-156.7 A. For human PDElO both the wildtype and the catalytically inactive Asp674Ala mutant structure were determined. Ligands bound to the active site include the substrates cAMP and cGMP and the products AMP and GMP (PNAS, 104, 5782-5787 (2007)). The rat structures were determined in complex with two 6,7-dimethoxy-4- pyrrolidylquinazolines, demonstrating the principal drugability of PDElO (J.Med. Chem. 50, 182- 185 (2007)).
Reproducible generation of well-diffracting crystals of the PDElO-cat proved to be difficult. Therefore, there is a need for PDElO-cat crystal forms allowing more reproducible crystallization for subsequent X-ray crystallographic analysis and structure-based drug design.
In a first aspect, the present invention relates to a crystal of a PDElO-cat polypeptide, wherein the crystal belongs to space group H3.
In a preferred embodiment, the crystal has unit cell dimensions of a = b = 135 ± 4 A, c = 235 ± 4 A, α = β = 90°, γ = 120°. In a preferred embodiment, the crystal has unit cell dimensions of a = b = 135 ± 3 A, c = 235 ± 3 A, α = β = 90°, γ = 120°.
In another preferred embodiment, the crystal has unit cell dimensions of a = b = 135 ± 2 A, c = 235 ± 2 A, α = β = 90°, γ = 120°. In a further preferred embodiment, the crystal has unit cell dimensions of a = b = 135 ± 1 A, c = 235 ± 1 A, α = β = 90°, γ = 120°. In yet another preferred embodiment, the crystal has unit cell dimensions of a = b = 135 A, c = 235 A, α = β = 90°, γ =
120°.
In a second aspect, the present invention relates to a co-crystal of a PDElO-cat polypeptide and a ligand bound to the PDElO-cat, wherein the crystal belongs to space group H3.
In a preferred embodiment, the co-crystal has unit cell dimensions of a = b = 135 ± 3 A, c = 235 ± 3 A, α = β = 90°, γ = 120°. In another preferred embodiment, the co-crystal has unit cell dimensions of a = b = 135 ± 2 A, c = 235 ± 2 A, α = β = 90°, γ = 120°. In a further preferred em-
bodiment, the crystal has unit cell dimensions ofa = b = 135 ± 1 A, c = 235 ± 1 A, α = β = 90°, γ = 120°. In yet another preferred embodiment, the crystal has unit cell dimensions of a = b = 135.0 A, c = 235 A, α = β = 90°, γ - 120°.
In a further preferred embodiment, the ligand is l-(3,4-Dimethoxy-benzyl)-6,7-dimethoxy- isoquinoline (papaverin).
In a preferred embodiment of the crystal and co-crystal of the present invention, the PDElO-cat polypeptide is a polypeptide comprising a sequence having a similarity to the catalytic domain of a polypeptide of Seq. Id. No. 1 of at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, most preferably 100%.
In a further preferred embodiment, the PDE10-cat polypeptide comprises amino acids
449-779 of Seq. Id. No.l (human PDE10A2 polypeptide, Gene bank accession No. CAG38804.1).
In a third aspect, the present invention relates to a method for crystallizing a PDE10-cat polypeptide comprising the steps of: providing an aqueous solution of the PDE10-cat polypep- tide, mixing with a precipitant, and growing crystals by sitting drop vapor diffusion or micro- batch using a buffered precipitant solution of 5 % to 30 % (w/v) PEG, wherein the PEG has an average molecular weight of 200Da to 20 kDa. In a preferred embodiment, the buffered precipitant solution comprises 0 M to 1 M Bis-tris pH 6.5, 0 M to 0.1 M zinc chloride, 0 M to 0.5 M magnesium chloride, and 0 M to 1 M sodium chloride.
In a fourth aspect, the present invention relates to a method for generating a co-crystal of a
PDE10-cat polypeptide with a ligand that binds to the active site of PDE10-cat, a) providing a crystal of the PDE10-cat polypeptide of the present invention, b) adding a molar excess of the ligand to the crystal of the polypeptide, and c) generating a co-crystal.
Crystals of the present invention can be grown by a number of techniques including batch crystallization, vapour diffusion (either by sitting drop or hanging drop) and by microdialysis. Seeding of the crystals in some instances is required to obtain X-ray quality crystals. Standard micro- and/or macroseeding of crystals may therefore be used.
In a preferred embodiment of the invention, (co-)crystals are grown by vapor diffusion. In this method, the polypeptide solution is allowed to equilibrate in a closed container with a larger aqueous reservoir having a precipitant concentration optimal for producing crystals. Generally, less than about 10 μL of substantially pure polypeptide solution is mixed with an equal or similar volume of reservoir solution, giving a precipitant concentration about half that required
for crystallization. This solution is placed as a droplet on a plastic post surrounded by reservoir, which is sealed. The sealed container is allowed to stand, from one day to one year, usually for about 2-6 weeks, until crystals grow.
The crystals or co-crystals of the present invention can be obtained by a method which comprises: providing a buffered, aqueous solution of 3.75 to 50 mg/ml of a PDElO-cat polypeptide, optionally adding a molar excess of the ligand to the aqueous polypeptide solution, and growing crystals by vapor diffusion or microbatch using a buffered reservoir solution of 0 % to 30 % (w/v) PEG, wherein the PEG has an average molecular weight of 200 Da to 20000 Da. The PEG may be added as monomethyl ether. A preferred PEG has an average molecular weight of 500 Da to 5,000 Da. A preferred buffered reservoir solution further comprises 0 M to 1 M Bis- tris pH 6.5, 0 M to 0.1 M zinc chloride, 0 M to 0.5 M magnesium chloride, and 0 M to 1 M sodium chloride. Said microbatch may be modified.
In a preferred embodiment of the method for generating a co-crystal of the PDE10-cat polypeptide, the method is performed in presence of a 10 - 15 molar excess of the ligand.
Methods for obtaining the three-dimensional structure of the crystals described herein, as well as the atomic structure coordinates, are well-known in the art (see, e.g., D. E. McRee, Practical Protein Crystallography, published by Academic Press, San Diego (1993), and references cited therein).
The crystals of the invention, and particularly the atomic structure coordinates obtained therefrom, have a wide variety of uses. For example, the crystals and structure coordinates described herein are particularly useful for identifying compounds that bind to PDElO as an approach towards developing new therapeutic agents.
The structure coordinates described herein can be used as phasing models in determining the crystal structures of additional native or mutated, as well as the structures of co-crystals of PDElO with bound ligand. The structure coordinates, as well as models of the three-dimensional structures obtained therefrom, can also be used to aid the elucidation of solution-based structures of native or mutated PDEs, such as those obtained via NMR. Thus, the crystals and atomic structure coordinates of the invention provide a convenient means for elucidating the structures and functions of a PDElO.
The present invention also provides a method of identifying compounds that can bind to
PDElO, comprising the steps of: applying a 3-dimensional molecular modeling algorithm to the atomic coordinates of a protein shown in Fig. 1 or 2 to determine the spatial coordinates of the binding site of PDE10-cat; and electronically screening the stored spatial coordinates of a set of
candidate compounds against the spatial coordinates of the PDElO catalytic domain to identify a compound that can bind to PDElO.
In a preferred embodiment, the method comprises the steps of: generating a three dimensional model of a binding pocket of PDElO-cat using the relative structural data coordinates of Figure 1 or 2 of Leu635, Phe639, Asp674, Leu675, Ser677, Val678, Thr685, Ala689, Ile692, Tyr693, Phe696, Met713, Gly725, Gln726, Phe729, Tyr730, Val733, and Trp762 ± a root mean square deviation from the backbone atoms of said amino acids of not more than 2 A; and performing computer fitting analysis to identify a compound that can bind to a PDElO-cat binding site.
The term "root mean square deviation" means the square root of the arithmetic mean of the squares of the deviations. It is a way to express the deviation or variation from a trend or object. For purposes of this invention, the "root mean square deviation" defines the variation in the backbone of a protein from the backbone of PDElO-cat or an active binding site thereof, as defined by the structure coordinates of PDElO-cat described herein.
Molecular docking of large compound databases to target proteins of known or modelled
3-dimensional structure is now a common approach in the identification of new lead compounds. This "virtual screening" approach relies on fast and accurate estimation of the ligand binding mode and an estimate of ligand affinity. Typically a large database of compounds, either real or virtual is docked to a target structure and a list of the best potential ligands is produced. This ranking should be highly enriched for active compounds which may then be subject to further experimental validation.
The calculation of the ligand binding mode may be carried out by molecular docking programs which are able to dock the ligands in a flexible manner to a protein structure. The estimation of ligand affinity is typically carried out by the use of a separate scoring function. These scoring functions include energy-based approaches which calculate the molecular mechanics force field and rule-based approaches which use empirical rules derived from the analysis of a suitable database of structural information. Consensus scoring involves rescoring each ligand with multiple scoring functions and then using a combination of these rankings to generate a hit list.
Short description of the figures
Figure 1 shows the coordinates of an apo crystal of human PDElO-cat (amino acids 449 -
Figure 2 shows the coordinates of a co-crystal of human PDElO-cat (amino acids 449 - 759 of Seq. Id. No. 1) with ligand l-(3,4-Dimethoxy-benzyl)-6,7-dimethoxy-isoquinoline (papa verin).
Examples
Example 0: Production of human PDE10-cat
DNA manipulation and sequence analysis
Preparation of DNA probes, digestion with restriction endonucleases, DNA ligation and transformation of E.coli strains were performed as described (Sambrook, J., Fritsch, E.F. & Ma- niatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY.). Mutagenesis was performed by using the QuikChange Multi Kit from Stratagene. For DNA sequencing, the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit and ABI PRISM 310 Genetic analyzer were used. PCR were performed in the T3 Thermocycler (Whatman Biometra), using the Expand polymerase (Roche).
Production and Purification of recombinant human PDElO-cat in E.coli
The catalytic domain of human PDE 10A2, residues 449-779 of Seq. Id. No. 1 (PDE 10-cat), was amplified by PCR using cDNA (Origene) and the oligonucleotides 5'-
GGGGACAAGTTTGTACAAAAAAGCAGGCΓΓΛGΓΛCCΓΛGΛGGΛΓCΛAGCATTT
GTACTTC AGAAG-3' (AttBl recombination site in bold, thrombin protease cleavage site in italics; Seq. Id. No. 2) and 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCAAT CTTCAGATGCAGCTG-3' (Λ//B2 recombination site in bold; Seq. Id. No. 3), which conferred Gateway recombination sites (Invitrogen). The PCR product was used in a BP recombination reaction with pDONR221 (Invitrogen) to generate pENTR Thm-PDE10A2 (449-779). The DNA sequence was verified and used in an LR recombination reaction with a Gateway-modified version of pETl Ia (Novagen). The sequence of the resulting expression vector, placT7.2 H6-(gwl)- Thm-PDE10A2 (449-779), was confirmed and transformed into E.coli strain BL21(DE3) pLysS (Invitrogen). Recombinant protein was produced at 220C by induction to a final IPTG concentration of O.lmM at an optical density of 1.0 at 600nm for 2Oh. About 30% of the protein was in the soluble fraction of the cell homogenate. The protein was purified using sequential chromatography on Ni-NTA and HiTrapQ/HiTrapS. After thrombin digest overnight at room temperature, impurities, uncleaved protein and thrombin were removed by HiTrapChelating / HiTrap ben- zamindine chromatography. The last step in purification ofPDEl 0-cat was Superdex 75 size exclusion chromatography equilibrated with 25mM HEPES/NaOH pH8.4, 0.1M NaCl. The protein was >95% pure, monomeric and monodisperse as shown by SDS-PAGE, HPLC, and analytical ultracentrifugation, respectively.
Example 1: Crystal structure of human PDElO-cat
Protein used for crystallization of PDElO-cat has been purified as described above. The crystallization droplet was set up at 22 °C by mixing 0.3 μl of protein solution at a concentration of lOmg/mL with 0.3 μl reservoir in vapor diffusion sitting drop experiments. Crystals appeared out of 0.1 M bis-TRIS/NaOH pH 6.5, 25% PEG 3350 or 0.1 M HEPES/NaOH pH 7.5, 0.2 M MgCl2, 25% PEG 3350 after 1 day and grew to a maximum final size of 0.1x0.1x0. lmm3 within 7 days.
Crystals were harvested with paraffin oil as cryoprotectant and then flash cooled in liquid N2. Diffraction images were collected at a temperature of IOOK at the beamline XlOSA of the Swiss Light Source and processed with the programs DENZO and SCALEPACK (HKL Research) yielding data to 2.1 A resolution. Standard crystallographic programs from the CCP4 software suite were used to determine the structure by molecular replacement (CCP4 (Collaborative Computational Project, N. The CCP4 suite: programs for protein crystallography. Acta Crys- tallogr. D50, 760-763 (1994)). The structure 2OUN (Structural insight into substrate specificity of phosphodiesterase 10, PNAS, 104, 5782-5787 (2007)) was used as search model. Refinement and model building cycles were performed with REFMAC and COOT, respectively (Table 1).
Crystals belong to space group H3 with cell axes a=b=136.3lA, c=235.95A, α = β=90°, γ=120° and contain a tetramer of PDElO-cat in the asymmetric unit. The structure is not isomor- phous to the orthorhombic crystals of human PDElO-cat in the PDB entries 20UN, 2OUP, 2OUQ, 2OUR, 2OUS, 2OUU, 20UV, and 20UY (Structural insight into substrate specificity of phosphodiesterase 10, PNAS, 104, 5782-5787 (2007)). The active site harbors a hydrated two metal ion cluster, which were assigned as Mg + and Zn +. The Zn2+ ion was assigned based on an electron density map using anomalous differences and model phases.
Table 1; Data collection and structure refinement statistics for PDElO-cat
Data Collection No ligand
Wavelength (A) 0.9999
Resolution1 (A) 41.7-2.1 (2.359-2.3)
Unique reflections1 27273
Completeness (%)' 99.3 (99.3)
Rmerge (%)1'2 7.5 (26.4)
<I/σ>' 5.2 (2.5)
Unit Cell (Space group H3) a=b=136.3lA, c=235.95A, α=β=90°, γ=120° Refinement
Resolution (A) 41.1-2.1 (2.23-2.10)
Rcrys,1'3 17.8 (21.7)
Rfree M 21.7 (23.4)
R.m.s. deviations from ideality 0.006 / 0.920 Bond lengths (A) / angles (°)
Main chain dihedral angles (%) 93.4 / 6.6 / 0.0 / 0.0 Most favored / allowed / generous / disallowed 5
1 Values in parentheses refer to the highest resolution bins.
2 I I-<I> I /∑I where I is the reflection intensity.
3 Rcryst =∑ I FO-<FC> I /EF0 where F0 is the observed and Fc is the calculated structure factor amplitude. 4 Rfree was calculated based on 5% of the total data omitted during refinement.
5 Calculated with PROCHECK [Laskowski, R.A., MacArthur, M.W., Moss, D.S. & Thornton, J.M. PROCHECK: a program to check the stereochemical quality of protein structure. J. Appl. Crystallogr. 26, 283-291 (1993)].
Example 2: Crystal structure of human PDElO-cat with inhibitor l-(3,4-Dimethoxy- benzyl)-6,7-dimethoxy-isoquinoline
Protein used for crystallization of PDE10-cat together with l-(3,4-Dimethoxy-benzyl)-6,7- dimethoxy-isoquinoline has been purified as described above. The protein crystals were incubated with ligand in a 10 fold molar excess for 2 hours at room temperature.
Crystals were harvested with reservoir as cryoprotectant and then flash cooled in liquid N2.
Diffraction images were collected at a temperature of IOOK at the beamline XlOSA of the Swiss Light Source and processed with the programs DENZO and SCALEPACK (HKL Research) yielding data to a resolution of 2.1 A. Standard crystallographic programs from the CCP4 software suite were used to determine the structure by molecular replacement using an in-house PDE10-cat structure as search model (CCP4 (Collaborative Computational Project, N. The CCP4 suite: programs for protein crystallography. Acta Crystallogr. D 50, 760-763 (1994)). Refinement and model building cycles were performed with REFMAC, autoBUSTER (Acta Crystallogr., D56, 1313-1323 (2000)) and COOT, respectively (Table 2).
Crystals belong to space group H3 with cell axes a=b=136.96A, c=237.36A, α = β=90°, γ=120° and diffracted to 2.1 A resolution. The ligand was clearly defined in the initial Fo-Fc electron density map in all four monomers. The ligand is bound to the protein by one hydrogen bond to Gln726 and mainly hydrophobic interactions via residues Leu635, Leu675, Val678, Tyr693, Phe696, and Phe729. The structure is isomorphous to the structure in example 1 but not isomorphous to the orthorhombic crystals of human PDE10-cat in the PDB entries 2OUN,
2OUP, 2OUQ, 2OUR, 2OUS, 2OUU, 2OUV, and 2OUY (Structural insight into substrate specificity of phosphodiesterase 10, PNAS, 104, 5782-5787 (2007)).
Table 2: Data collection and structure refinement statistics for l-(3,4-Dimethoxy-benzvD- 6,7-dimethoxy-isoquinoline co-crystal
Data Collection l-(3,4-Dimethoxy-benzyl)-6,7-dimethoxy-isoquinoline
Wavelength (A) 0.9910
Resolution1 (A) 44.1-2.1 (2.15-2.10)
Unique reflections1 95401
Completeness (%)' 98.4 (97.8)
K-merge V. /o) 18.6 (86.0)
<I/σ>' 6.3 (1.0)
Unit Cell (Space group H3) a=b=136.96 A, c= 237.36 A, α=β=90 °, γ=120°
Refinement
Resolution (A) 44.1-2.1 (2.23-2.10)
R 1,3
*V;ryst 25.8 (34.2)
Rfree1 '4 29.5 (36.2)
R.m.s. deviations from 0.011 / 1.22 ideality Bond lengths (A) / angles (°)
Main chain dihedral angles 90.7/ 9.2 / 0.1 / 0.0 (%) Most favored/allowed/generous/ disallowed 5
1 Values in parentheses refer to the highest resolution bins.
2 I I-<I> I /∑I where I is the reflection intensity.
3 Rcryst=∑ I FO-<FC> I /ΣF0 where F0 is the observed and Fc is the calculated structure factor amplitude.
4 Rfree was calculated based on 5% of the total data omitted during refinement.
5 Calculated with PROCHECK [Laskowski, R.A., MacArthur, M.W., Moss, D.S. & Thornton, J.M. PROCHECK: a program to check the stereochemical quality of protein structure. J. Appl. Crystallogr. 26, 283-291 (1993)].
While there are shown and described presently preferred embodiments of the invention, it is to be distinctly understood that the invention is not limited thereto but may be otherwise variously embodied and practiced within the scope of the following claims.
Claims
1. A crystal of a PDElO-cat polypeptide, wherein the crystal belongs to space group H3.
2. The crystal of claim 1, wherein the crystal has unit cell dimensions of a = b = 135 ± 4 A, c = 235 ± 4 A, α = β = 90°, γ = 120°.
3. A co-crystal of a PDE10-cat polypeptide and a ligand bound to the PDE10-cat, wherein the crystal belongs to space group H3.
4. The co-crystal of claim 3, wherein the crystal has unit cell dimensions of a = b = 135 ±
3 A, c = 235 ± 3 A, α = β = 90°, γ = 120°.
5. The co-crystal of claim 3 or 4, wherein the ligand is l-(3,4-Dimethoxy-benzyl)-6,7- dimethoxy-isoquinoline (papaverin).
6. The crystal of claim 1 or 2 or the co-crystal of claims 3 to 5, wherein the PDE10-cat polypeptide is a polypeptide comprising a sequence having a similarity to the catalytic domain of a polypeptide of Seq. Id. No. 1 of at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, most preferably 100%.
7. The crystal or co-crystal of claim 6, wherein the PDE10-cat polypeptide comprises amino acids 449-779 of Seq. Id. No.l .
8. A method for crystallizing a PDE10-cat polypeptide, the method comprising: a) providing an aqueous solution of the polypeptide and b) growing crystals.
9. A method for co-crystallizing a PDE10-cat polypeptide with a compound that binds to the binding site of said polypeptide, the method comprising: a) providing an aqueous solution of the polypeptide, b) adding a molar excess of the ligand to the aqueous solution of the polypeptide, and c) growing crystals.
10. The method of claim 8 or 9, wherein the aqueous solution comprise 5 % to 30 % (w/v)
PEG, wherein the PEG has an average molecular weight of 200Da to 20 kDa.
1 1. The method of claims 8-10, wherein the aqueous solution comprises 0 M to 1 M Bis- tris pH 6.5, 0 M to 0.1 M zinc chloride, 0 M to 0.5 M magnesium chloride, and 0 M to 1 M sodium chloride.
12. A method for generating a co-crystal of a PDE10-cat polypeptide with a ligand that binds to the active site of PDE10-cat, the method comprising: a) providing a crystal of claim 1 or 2, b) adding a molar excess of the ligand to the crystal of the polypeptide, and c) generating a co-crystal.
13. The method of claims 9-12, wherein the ligand is added in a 10 - 15 molar excess.
14. A method for identifying a compound that can bind to the binding site of PDElO-cat comprising the steps: a) determining an active site of PDElO-cat from a three dimensional model of PDE10-cat using the atomic coordinates of Fig. 1 or Fig. 2, ± a root mean square deviation from the backbone atoms of said amino acids of not more than 2 A; and b) performing computer fitting analysis to identify a compound that can bind to the
PDElO-cat active site.
15. The method of claim 13 comprising the steps: a) generating a three dimensional model of an active site of PDElO-cat using the relative structural data coordinates of Figure 1 or 2 of residues, Leu635, Phe639, Asp674, Leu675, Ser677, Val678, Thr685, Ala689, Ile692, Tyr693, Phe696, Met713, GIy 725, Gln726, Phe729, Tyr730, Val733, and Trp762 ± a root mean square deviation from the backbone atoms of said amino acids of not more than 2 A; and b) performing computer fitting analysis to identify a compound that can bind to the PDElO-cat active site.
16. A crystal or co-crystal of PDElO-cat containing PDElO-cat in a conformation defined by the coordinates of Fig.1 or Fig. 2, optionally varied by an rmsd of less than 3.0A.
17. The crystals and methods substantially as hereinbefore described, especially with reference to the foregoing examples.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP08150227.0 | 2008-01-14 | ||
| EP08150227 | 2008-01-14 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2009090004A1 true WO2009090004A1 (en) | 2009-07-23 |
Family
ID=40383572
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2009/000036 Ceased WO2009090004A1 (en) | 2008-01-14 | 2009-01-07 | Phosphodiesterase 10 catalytic domain crystals |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2009090004A1 (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005087919A1 (en) * | 2004-03-12 | 2005-09-22 | Pfizer Products Inc. | Crystal structure of 3',5'-cyclic nucleotide phosphodiesterase (pde10a) and uses thereof |
-
2009
- 2009-01-07 WO PCT/EP2009/000036 patent/WO2009090004A1/en not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005087919A1 (en) * | 2004-03-12 | 2005-09-22 | Pfizer Products Inc. | Crystal structure of 3',5'-cyclic nucleotide phosphodiesterase (pde10a) and uses thereof |
Non-Patent Citations (2)
| Title |
|---|
| CHAPPIE THOMAS A ET AL: "Discovery of a series of 6,7-dimethoxy-4-pyrrolidylquinazoline PDE10A inhibitors.", JOURNAL OF MEDICINAL CHEMISTRY 25 JAN 2007, vol. 50, no. 2, 25 January 2007 (2007-01-25), pages 182 - 185, XP002518026, ISSN: 0022-2623 * |
| WANG HUANCHEN ET AL: "Structural insight into substrate specificity of phosphodiesterase 10.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA 3 APR 2007, vol. 104, no. 14, 3 April 2007 (2007-04-03), pages 5782 - 5787, XP002518027, ISSN: 0027-8424 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tang et al. | A novel ATP-dependent conformation in p97 N–D1 fragment revealed by crystal structures of disease-related mutants | |
| Serre et al. | Crystal structure of the phosphatidylethanolamine-binding protein from bovine brain: a novel structural class of phospholipid-binding proteins | |
| Löwe et al. | Crystal structure of the SMC head domain: an ABC ATPase with 900 residues antiparallel coiled-coil inserted | |
| Albert et al. | X-ray structure of yeast Hal2p, a major target of lithium and sodium toxicity, and identification of framework interactions determining cation sensitivity | |
| Zou et al. | Crystal structure of triple-BRCT-domain of ECT2 and insights into the binding characteristics to CYK-4 | |
| Wang et al. | Crystal structures of NAC domains of human nascent polypeptide-associated complex (NAC) and its αNAC subunit | |
| Kumaran et al. | Structure and mechanism of ADP‐ribose‐1 ″‐monophosphatase (Appr‐1 ″‐pase), a ubiquitous cellular processing enzyme | |
| US20050202550A1 (en) | Crystal structure of 3', 5'-cyclic nucleotide phosphodiesterase (PDE10A) and uses thereof | |
| Hiyama et al. | Crystal structure of the α subunit of human translation initiation factor 2B | |
| WO2009090004A1 (en) | Phosphodiesterase 10 catalytic domain crystals | |
| Rajakannan et al. | Observation of additional calcium ion in the crystal structure of the triple mutant K56, 120,121 M of bovine pancreatic phospholipase A2 | |
| US8309340B2 (en) | Insulin degrading enzyme crystals | |
| US20090275047A1 (en) | Crystal structure of human soluble adenylate cyclase | |
| WO2005083069A1 (en) | Pde2 crystal structures for structure based drug design | |
| US20040226502A1 (en) | Crystal structure of 2c-methyl-d-erythritol 2,4-cyclodiphosphate synthase | |
| US6689595B1 (en) | Crystallization and structure determination of Staphylococcus aureus thymidylate kinase | |
| Tadwal et al. | Relevance of the conserved histidine and asparagine residues in the phosphate-binding loop of the nucleotide binding subunit B of A1AO ATP synthases | |
| US20060234293A1 (en) | Polypeptide methods and means | |
| US20070015270A1 (en) | Crystalline PDE4D2 catalytic domain complex, and methods for making and employing same | |
| JP2003517818A (en) | Crystallization and structure determination of Staphylococcus aureus thymidylate kinase | |
| US20030073219A1 (en) | Crystal structure | |
| KR20170010635A (en) | Ubiquitin specific protease 47, three-dimensional structure thereof and method of developing a ubiquitin specific protease inhibitor | |
| KR100963315B1 (en) | Three-Dimensional Crystal Structure of FAF Protein and Method for Developing FAF Inhibitor Using the FAD Protein | |
| WO2002061063A1 (en) | Crystal structure of peroxiredoxin 5 and its use for design of structural homologues | |
| Lovelace | New approaches to the inhibition of human thymidylate synthase (hTS), and, Crystallographic studies of human complement protein C8γ |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09702486 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 09702486 Country of ref document: EP Kind code of ref document: A1 |