WO2009088991A2 - Flow cytometric gfp-based yeast two hybrid system - Google Patents

Flow cytometric gfp-based yeast two hybrid system Download PDF

Info

Publication number
WO2009088991A2
WO2009088991A2 PCT/US2009/000043 US2009000043W WO2009088991A2 WO 2009088991 A2 WO2009088991 A2 WO 2009088991A2 US 2009000043 W US2009000043 W US 2009000043W WO 2009088991 A2 WO2009088991 A2 WO 2009088991A2
Authority
WO
WIPO (PCT)
Prior art keywords
reporter
yeast
protein
yegfp
fluorescence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2009/000043
Other languages
French (fr)
Other versions
WO2009088991A3 (en
Inventor
Hong Cai
Jun Chen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Los Alamos National Security LLC
Original Assignee
Los Alamos National Security LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Los Alamos National Security LLC filed Critical Los Alamos National Security LLC
Publication of WO2009088991A2 publication Critical patent/WO2009088991A2/en
Publication of WO2009088991A3 publication Critical patent/WO2009088991A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1037Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display

Definitions

  • Protein-protein interactions are fundamental to virtually every aspect of cellular function. To understand the protein-protein interaction network on a large scale, the genome-wide protein linkage mapping or "interactome” analyses have therefore become a major objective in the field of proteomics (1). Although a number of promising technologies have been developed to analyze and monitor protein-protein interactions in vitro and in vivo, and the need for confirmation by independent methods is recognized (2), only the yeast two-hybrid (Y2H) and mass spectrometry- based affinity co-purification approaches have been proven robust and versatile enough for systematic large scale analysis (3-6).
  • yeast two-hybrid Y2H
  • mass spectrometry- based affinity co-purification approaches have been proven robust and versatile enough for systematic large scale analysis (3-6).
  • the Y2H system is a genetic screen wherein the interaction between two proteins of interest is detected via the functional reconstitution of the distinct DNA binding and activation domains of a transcription factor and the subsequent activation of reporter expression controlled by the transcription factor (7).
  • bait and prey protein pairs are fused to distinct DNA binding and activation domains of a transcription factor (e.g. GAL4).
  • GAL4 a transcription factor
  • the interaction of bait and prey protein pairs brings the DNA binding and activation domains into close proximity, forming an active transcription factor complex which binds the promoter and triggers the expression of reporter gene(s) under the control of that promoter.
  • the Y2H assay does not require specialized instrumentation and has been widely adopted.
  • Y2H protein interaction maps are now available from various species, including virus, bacterium, u i rv ⁇ iiuduun yeast, fly, worm and human (3, 4, 6).
  • the Y2H system does have limitations. False positive results (due to the non-specific triggering of reporter expression) and false negatives (e.g. due to incorrect protein folding or inactivation when fused with Y2H transcription binding or activation domain) are known issues.
  • a recent parallel Y2H screening in either yeast or fly showed little overlap in the data suggesting the reliability of such screening may be problematic (8, 9).
  • the false positive rate an intrinsic drawback of Y2H, can be reduced by performing screening with several selective reporters controlled by different promoters. For example, three inducible promoters Gall, Gal2, and MeH (corresponding to three expression regulation levels) controlling HIS3, ADE2, and LacZ/MEL1 reporter genes, were used in combination to reduce the false positives (10). In addition, the false positive rates could also be reduced with multiple rounds of screening. Similarly, false negatives could also be reduced from repeated Y2H screening rounds.
  • one fundamental limitation of the conventional Y2H system is the labor intensive, time consuming, and expensive reporter (selection) analysis process that typically involves the uses of agar plates and filter membranes for auxotrophic marker selection (e.g.
  • Yeast two-hybrid assays and systems are described in, for example, United States Patent Nos. 5,283,173, 5,468,614, and 5,667,973.
  • Y2H kits and systems are available from various commercial suppliers, including Invitrogen (www.invitrogen.com) and Clontech (www.clontech.com).
  • Flow cytometry is a versatile high speed cell analysis method that is playing key roles in proteomics and systems biology efforts (12). The ability to analyze and physically sort individual cells at high rates (thousands per second) in a manner compatible with popular microwell plate formats make it well-suited for large scale cell screening and selection applications.
  • Yeast (13, 14) and bacterial (15, 16) display screening of antibody and other libraries (17-19) are good examples.
  • Green fluorescent protein (GFP) and its variants are good candidates for reporters for a flow cytometric version of the Y2H screen, and plasmid-based reporter systems employing the enhanced green fluorescent protein (EGFP) and GFPuv have been reported (20, 21).
  • EGFP enhanced green fluorescent protein
  • GFPuv plasmid-based reporter systems employing the enhanced green fluorescent protein (EGFP) and GFPuv have been reported (20, 21).
  • EGFP enhanced green fluorescent protein
  • GFPuv GFPuv
  • the invention provides an improved yeast two-hybrid screening system that is optimal for high throughput screening of cDNA libraries for protein-protein interactions.
  • the invention is based, in part, upon the surprising and unexpected results generated with a yeast two-hybrid system in which at least one reporter is a yeast-optimized green fluorescent protein, yEGFP, that is encoded within the genome of the yeast reporter cell used in the assay, and fluorescence is quantified via flow cytometry.
  • the invention provides a yeast two-hybrid assay (or system) in which at least one reporter is yEGFP.
  • the fluorescence generated by the expression of yEGFP is measured by flow cytometry, and the yEGFP reporter is encoded within the genome of the yeast reporter cell used in the assay (preferably, stably integrated).
  • the yEGFP reporter may be under the transcriptional control of any promoter capable of being activated by a transcription factor suitable for use in such an assay.
  • the yeast two-hybrid assay is a GAL4-based assay, in which the yEGFP is under the transcriptional control of the GAL1 promoter.
  • the yeast reporter cell is a S.
  • the yeast reporter cell is a S. cervisiae AH109 cell in which the yEGFP reporter gene is stably- integrated.
  • bait and prey plasmids are introduced into the yeast reporter cell, typically by transformation, grown in liquid culture for a time sufficient to generate detectable fluorescence when yEGFP is expressed in the co-transformed cell (e.g., 48 hours; see Examples), and fluorescence is detected using flow cytometry.
  • Large cDNA libraries of test "prey" proteins may be cloned into prey vectors, introduced into a yeast reporter cell along with the coordinate bait vector, and rapidly screened for cells containing interacting pairs of prey: bait proteins using flow cytometry.
  • FIG. 1 Schematic of the flow cytometric Y2H system. Binding of fusion proteins bait and prey activates fluorescent reporter gene expression in yeast cells, which can be analyzed by flow cytometry.
  • BD DNA binding domain
  • AD transcriptional activation domain
  • Fluo-reporter fluorescent reporter gene.
  • FIG. 2. Measurement of EGFP reporter fluorescence in Y2H system using flow cytometry.
  • A GFP fluorescence analysis of plasmid-based GFP reporter in AH109 cells. AH 109 cells were cotransformed respectively with the negative control pair (pGBKT7-Gal1-EGFP and pGADT7, shown in red) and the positive control pair (pGBKT7-Gal1-EGFP and pCL1 , shown in green). The transformants that grew on SD-L-T plate were used for GFP fluorescence analysis by flow cytometry.
  • B GFP fluorescence analysis of the chromosomal integrated EGFP reporter in EGFP-AH109 cells.
  • EGFP-AH109 cells were cotransformed respectively with the negative control pair (pGBKT7-Lam and pGADT7-T, shown in red) and two positive control pairs (pGBKT7-P53 and pGADT7-T, shown in blue; pGBKT7 and pCL1 , shown in green).
  • the transformants growing on SD-L-T plates supplemented with G418 were used for GFP fluorescence analysis by flow cytometry.
  • FIG. 3 Flow cytometry analysis of chromosomal integrated yEGFP reporter fluorescence in Y2H system.
  • Various bait and prey pairs were cotransformed into yEGFP-AH109 cells.
  • the transformants growing on SD-L-T plates supplemented with G418 were used for GFP fluorescence analysis by flow cytometry.
  • the negative control pair pGBKT7-Lam1 pGADT7-T (A) was used to determine M1 region.
  • Two strong reporter triggers pGBKT7- P531pGADT7-T (B) and pGBKT71 pCL1 (C) as well as two weak reporter triggers pGBKT7-NS11 pGADT7 (D) and pGBKT7- NS1 C1 pGADT7 (E) were used for the evaluation of yEGFP reporter gene expression in Y2H system.
  • FIG. 4 Flow cytometry analysis of the yEGFP reporter fluorescence on yEGFP- AH109 cells growing in liquid media. yEGFPAH109 cells were cotransformed with the same sets of bait and prey pairs as described in Figure 3. After the transformation, the cells were grown in the SD-L-T liquid media supplemented with G418 instead of plating. The GFP fluorescence of the each sample was analyzed by flow cytometry 48 hours post transformation.
  • A pGBKT7-Lam1 pGADT7-T (negative control for setting M1 region),
  • B pGBKT7-P531 pGADT7-T,
  • C pGBKT71 pCL1 ,
  • D pGBKT7- NS11 pGADT7, and
  • E pGBKT7-NS1 C1 pGADT7.
  • FIG. 5 Fluorescence histograms of positive and negative controls used to determine the sorting region for P53 cDNA library screening.
  • the negative control pair pGBKT7-Lam1 pGADT7-T, left panel
  • the positive control pair pGBKT7- P531pGADT7-T, right panel
  • Two sorting gates weak GFP positive (P1) and strong GFP positive (P2) were established accordingly for isolating the GFP positive cells from the cDNA library screening.
  • a “yeast two-hybrid assay” or “yeast two-hybrid system” are used interchangeably herein and refer to an assay or system for the detection of interactions between protein pairs.
  • a transcription factor is split into two separate fragments, the binding domain (BD) and the activation domain (AD), each of which are provided on separate plasmids, and each of which is fused to a protein of interest.
  • the yeast two-hybrid assay/system comprises (i) a "bait" vector, comprising a bait protein and the BD of the transcription factor utilized in the system; (ii) a "prey” vector, comprising a prey protein (or a library of prey proteins to be screened for interaction with the bait protein) and the AD of the transcription factor; (iii) a suitable reporter yeast strain containing the activation sequence for the transcription factor used in the system, which drives the expression of one or more reporter proteins.
  • the bait and prey vectors are introduced into the reporter yeast strain, wherein if the expressed bait and prey proteins may interact. Interacting bait and prey protein pairs result in the reconstitution and activation of the transcription factor, which then binds to its compatible activation domain provided in the reporter yeast strain, which in turn triggers the expression of the reporter gene, which may then be detected.
  • fluorescent protein as used herein is a protein that has intrinsic fluorescence. Typically, a fluorescent protein has a structure that includes an 11 -stranded beta- barrel.
  • yEGFP refers to a yeast codon-optimized variant of Enhanced Green Fluorescent Protein(EGFP), as described in Cormack et al., 1997, Microbiol. 143: 303-311.
  • Physical linkage refers to any method known in the art for functionally connecting two or more molecules or domains (which are termed “physically linked”), including without limitation, recombinant fusion with or without intervening domains, intein-mediated fusion, non-covalent association, covalent bonding (e.g., disulfide bonding and other covalent bonding), hydrogen bonding; electrostatic bonding; and conformational bonding, e.g., antibody-antigen, and biotin- avidin associations.
  • physical linkage refers to any method known in the art for functionally connecting two or more molecules or domains (which are termed “physically linked”), including without limitation, recombinant fusion with or without intervening domains, intein-mediated fusion, non-covalent association, covalent bonding (e.g., disulfide bonding and other covalent bonding), hydrogen bonding; electrostatic bonding; and conformational bonding, e.g., antibody-antigen, and biotin- avidin associations.
  • a “fusion protein” refers to a chimeric molecule formed by the joining of two or more polypeptides through a bond formed one polypeptide and another polypeptide. Fusion proteins may also contain a linker polypeptide in between the constituent polypeptides of the fusion protein.
  • the term “fusion construct” or “fusion protein construct” is generally meant to refer to a polynucleotide encoding a fusion protein.
  • heterologous when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature.
  • a nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a nucleic acid encoding a fluorescent protein from one source and a nucleic acid encoding a peptide sequence from another source.
  • a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
  • a "reporter molecule” has a detectable phenotype.
  • the reporter molecule is a polypeptide, such as an enzyme, or a fluorescent polypeptide.
  • a reporter polypeptide may have intrinsic activity.
  • a reporter molecule has a detectable phenotype associated with correct folding or solubility of the reporter molecule.
  • the reporter could be an enzyme or a fluorescent polypeptide.
  • the detectable phenotype would then be the ability to turn over a substrate giving a detectable product or change in substrate concentration or physical state.
  • the activity would be the emission of fluorescence upon excitation by the appropriate wavelength(s) of light.
  • nucleic acid or protein when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It is preferably in a homogeneous state although it can be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein which is the predominant species present in a preparation is substantially purified. In particular, an isolated gene is separated from open reading frames which flank the gene and encode a protein other than the gene of interest. The term "purified" denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel.
  • nucleic acid or protein is at least 85% pure, more preferably at least 95% pure, and most preferably at least 99% pure.
  • Nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form.
  • the term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).
  • PNAs peptide-nucleic acids
  • nucleic acid is used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide.
  • polypeptide peptide
  • protein protein
  • amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
  • amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
  • Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, ⁇ -carboxyglutamate, and O-phosphoserine.
  • Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an ⁇ carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
  • Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
  • Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes. r ⁇ _> ⁇ /-i ⁇ ocuiu ⁇
  • amino acid sequences one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid.
  • Conservative substitution tables providing functionally similar amino acids are well known in the art. For example, substitutions may be made wherein an aliphatic amino acid (G, A, I, L, or V) is substituted with another member of the group.
  • an aliphatic polar-uncharged group such as C, S, T, M, N, or Q
  • basic residues e.g., K, R, or H
  • an amino acid with an acidic side chain, E or D may be substituted with its uncharged counterpart, Q or N, respectively; or vice versa.
  • Each of the following eight groups contains other exemplary amino acids that are conservative substitutions for one another: 1 ) Alanine (A), Glycine (G);
  • Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.
  • recombinant when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified.
  • recombinant cells express genes that are not found within the native (nonrecombinant) form of the cell or express native genes that are otherwise abnormally expressed, under-expressed or not expressed at all. _ «
  • an "expression vector” is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a host cell.
  • the expression vector can be part of a plasmid, virus, or nucleic acid fragment.
  • the expression vector includes a nucleic acid to be transcribed operably linked to a promoter.
  • the invention provides an improved yeast two-hybrid screening system that is optimal for high throughput screening of cDNA libraries for protein-protein interactions.
  • the invention utilizes a combination of stably-integrated yEGFP as a reporter in the reporter yeast strain, combined with flow cytometric detection of fluorescence resulting from transcriptional activation of the reporter protein following interaction of protein-protein pairs.
  • the system of the invention maybe conducted using liquid culture, rather than the agar plating required in conventional Y2H systems, thereby saving substantial time and resources.
  • the invention is adaptable to high-throughput format and can be used for large-scale cDNA screening for interacting proteins with high sensitivity and low signal:noise ratios.
  • the invention's Y2H assay/system offers convenient, quantitative and faster reporter analysis compatible with existing liquid handling robots, and also reduces labor requirements in screening cDNA libraries.
  • the yeast two-hybrid system of the invention uses yEGFP, stably-integrated into the reporter yeast strain S. cervisiae AH109, in combination with the "Matchmaker” Y2H bait and prey plasmids available from Clontech Laboratories (Mountain View, California).
  • This is a GAL4-based Y2H system, and it has been thoroughly characterized in the Examples, infra.
  • the "MatchmakerTM GAL4 Two-Hybrid System 3 & Libraries User Manual" from Clontech may be obtained from Clontech and is hereby specifically incorporated by reference herein in its entirety.
  • yeast Saccharomyces cerevisiae is recognized as a model eukaryote capable of rapid growth and with a versatile DNA transformation system. Background information and exemplary methods and media for growing, testing and preserving yeast in general and S.
  • an existing system may be modified by integrating yEGFP as at least one of the reporters whose expression is driven by the transcription factor that is activated upon protein-protein interacting pairs.
  • yEGFP as at least one of the reporters whose expression is driven by the transcription factor that is activated upon protein-protein interacting pairs.
  • many other Y2H systems may be similarly improved by introducing yEGFP into the yeast reporter strain genome, as will be appreciated by those skilled in the art.
  • fluorescent proteins are known and are suitable for use as a fluorescent protein marker for enabling cell sorting.
  • Fluorescent proteins such as the prototypic the Green Fluorescent Protein isolated from Aequorea victoria (GFP), generally rv_/ 1 rt ⁇ nocaiiui i share a common tertiary structure comprising an 1 1 -stranded beta-barrel structure surrounding a centrally-located self-activating chromophore.
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • Additional/multiple reporters may also be incorporated into the reporter strains, as is common in existing Y2H systems today.
  • a positive selection reporter such various nutrient selection reporters, including but not limited to the HIS3 gene, encoding a protein required for histidine synthesis; the LEU2 gene, encoding a protein required for leucine synthesis; and the URA3 gene, encoding a protein required for uracil synthesis. Only yeast cells transformed with bait and prey vectors that result in a positive interaction between the bait and prey fusion proteins will survive selection on media requiring the expression of the nutrient selector.
  • EXAMPLE 1 FLOW CYTOMETRIC yEGFP YEAST TWO-HYBRID ASSAY/SYSTEM
  • Bacterial strains, plasmids and molecular cloning Plasmid construction and molecular cloning were performed in the cloning host cell E.coli DH5 ⁇ (Invitrogen) following standard protocols.
  • the Y2H kit "Matchmaker system" was obtained from Clontech.
  • the kit includes the bait vector of pGBKT7 (containing GAL4 transcription factor DNA binding domain, BD) and prey vector of pGADT7 (containing GAL4 transcription activation domain, AD) along with the negative interaction control of pGBKT7-l_am/pGADT7-T (Lam/T) pair, and positive interaction control pGBKT7-P53/pGADT7-T (P53/T) pair.
  • a strong trigger of reporter gene expression PCL1 plasmid encoding the full length GAL4 transcription factor was also included in the kit.
  • the weak reporter expression trigger, influenza NS1 (suggested to have weak transcription activation activity when fused to DNA binding domain without the requirement of a separate transcription activator domain (22)) was constructed as follows: NS1 fragment amplified through a directed RT-PCR amplification process from influenza strain A (A/PR/8/34) was cloned into EcoRI/Sall sites of pGBKT7 vector in frame with GaWBD domain (pGBKT7-NS1).
  • pGBKT7-NS1 C (a N-terminal truncated NS1 gene fusing to the GAL4 binding domain) was made by removing a N-terminal segment of pGBKT7-NS1 gene by Ncol restriction digestion and ligation.
  • pGBKT7-Gal1 pr-EGFP plasmid was made by inserting the Gal1 pr-EGFP fragment from pYM-N22-EGFP (which was made by insertion of the EGFP gene from pYM-27 into pYM-N22 vector) into Avrll and BstBI sites of pGBKT7 vector.
  • the Y2H recipient strain of the Matchmaker system, S. cerevisiae AH 109 has the genotypes of (MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4 ⁇ , gal ⁇ O ⁇ , L YS::GAL 1 ⁇ AS -GAL 1 TATA-HIS3, GAL2 UAS -GAL2 TAT A-ADE2, URA3::MEL 1 UAS - r ⁇ i ⁇ A ⁇ uciiiui i
  • the yeast GFP two hybrid reporter strains, yEGFP-AH109 and EGFP-AH109 strains were constructed by replacing the chromosomal ADE2 coding region in AH 109 with yEGFP or EGFP coding region respectively using a well established PCR-based direct gene replacement method (23). Briefly, the yEGFP gene and Kan resistance gene replacement cassette was amplified with the following two primers,
  • the criteria of selecting a reporter strain was to choose the candidate strain that would give rise to the brightest fluorescence for the stronger trigger plasmid sets (P53/T and PCL1/pGBKT7), and lowest fluorescence background for the negative trigger set (Lam/T) using SD-L-T+G418 selective media (SD medium lacking Leucine and Tryptophan) in combination with flow cytometric GFP analysis.
  • the resulting yEGFP and EGFP reporter strains were named yEGFP-AH109 and EGFP-AH109 respectively.
  • the chromosomal integration of the yEGFP and EGFP gene was confirmed by PCR and sequencing.
  • the protein-protein interaction assays were performed according to the instruction manual provided by Clontech.
  • the GFP reporter yeast host cells carrying various bait and prey pairs were grown on SD-L-T+G418 selective medium to ensure all the yeast cells were under the same growth conditions and selection pressures.
  • colonies were picked directly into 300 ⁇ l PBS solution for flow cytometry analysis.
  • 50 ⁇ l liquid sample were transferred into 300 ⁇ l PBS solution for flow cytometry analysis.
  • GFP signal analysis was performed using a FACSCalibur flow cytometer from Becton Dickson (San Jose, CA, USA). The instrument settings are as following: Log forward scatter (FSC) E00; Log side scatter 2 (SSC) at 299V and Log FL1 fluorescence at 600 V.
  • the GFP fluorescence was excited at 488nm and collected through 530/30nm bandpass filter on the FL1 channel.
  • the yeast single cell population was gated on FSC and SSC.
  • the typical sampling rate was low (12 ⁇ l/min, ⁇ 200 events/second) and the typical sample size was 10,000 cells per measurement unless otherwise stated.
  • the data were analyzed with WinMDI 2.8 software.
  • An artificial human cDNA library was prepared by spiking 2ng pGADT7-T into 20 ⁇ g human leukocyte cDNA library (Clontech) to achieve 1 : 10,000 target/non-target r ⁇ s I r-vpy ⁇ t- * ⁇ uv ⁇ i ratios.
  • the P53 gene carried by the pGBKT7-P53 vector was used as a bait to investigate if its interaction partner, T antigen (carried by pGADT7-T), could be isolated from this spiked human cDNA library screening.
  • the bait plasmid, pGBKT7- P53 was first transformed into yEGFP-AH109 cells and selected against SD- T+G418 media.
  • the resulting cells ( ⁇ 2x10 9 cells) were then transformed with 20 ⁇ g of the prepared cDNA library plasmid using LiAc/PEG method following the manufacturer's protocol. After transformation, the cells were washed with sterile water and then resuspended into 200ml SD-L-T-H selection medium ( ⁇ 1x10 7 cells/ml). An aliquot of 200 ⁇ l was taken out, serially diluted and spread onto SD-L-T plates for determining the transformation efficiency from colony formation. The rest of cells were grown for 48 hours before 2ml samples were collected, washed twice with PBS, passed through a 45um mesh filter and sorted (FACSAria, Becton Dickson, San Jose, CA).
  • GFP reporter analysis was performed by picking colonies, directly resuspending them into 300 ⁇ l PBS solution and analyzing the cells by FACS as described above at analysis rate of ⁇ 200 cell/second.
  • HIS/3AT and MEL1 reporter analysis the colonies were replicated onto SD-L-T-H+10mM 3AT and SD-L- T+ ⁇ -x-gal plates to observe the growth and color of individual colonies respectively.
  • the plasmids were isolated from each yeast colony and were transformed into E. coli for amplification and sequencing. Results
  • the EGFP-based reporter under the control of the G AU promoter was cloned into the bait plasmid of pGBKT7 (called pGBKT7-Gal1pr-EGFP).
  • the EGFP expression was turned on upon transformation of a positive trigger plasmid PCL1 (encoding the full length GAL4 transcriptional factor that contains both BD and AD domains) and the EGFP signal was detected by flow cytometry.
  • a single copy of the EGFP reporter was integrated into the AH109 host genome.
  • the coding region of the ADE2 reporter gene in the AH109 host strain was replaced with the EGFP gene by the standard PCR based gene replacement method, resulting the strain EGFP-AH109.
  • yEGFP reporter could distinguish all the positive and negative control triggers in the Matchmaker system and that yEGFP is a more robust flow cytometric Y2H reporter than EGFP. It is also interesting to note that the yEGFP fluorescence distributions of cells from single colonies were bimodal, while positive control cells expressing the covalently linked activation domain-binding domain fusion (pCL1) gives a unimodal distribution. Such phenomena could be explained by a cell cycle- dependence of yEGFP expression and/or a threshold effect for reporter gene activation that reflects the efficiencies of bait and target gene transcription, translation, proper folding, transport to the nucleus, interaction, and promoter binding and activation.
  • pCL1 covalently linked activation domain-binding domain fusion
  • influenza NS1 protein was utilized as a weak reporter trigger for a sensitivity test.
  • Flow cytometric measurements of the yEGFP-based reporter correlate well with conventional Y2H system using nutrient and colorimetric reporters: Since the nutrient and colorimetric markers were used as gold standard reporters in the conventionalY2H system, it was desirable to validate the invention's new flow cytometric Y2H system by establishing convincing correlation between the two approaches.
  • triggers with different strengths were used to transform yEGFP-AH109 cell, and the reporter signals were measured.
  • the HIS, HIS/3AT and MEL1 were detected using agar plating method, and the yEGFP fluorescence reporter was measured by flow cytometry.
  • the relatively strong triggers P53/T pair and PCL1 generate stronger GFP signals as well as being positive for all three HIS, HIS/3AT and MEL1 reporters.
  • the weak triggers, NS1 and NS1C generated weaker GFP signal, scored positive on SD-L-T-H, SD-L-T-H+5mM 3AT, and MEL1 selection plates, but negative on the more stringent SD-L-T-H supplemented with 1 OmM, 15mM and 3OmM 3AT selection plates.
  • the negative control trigger, Lam/T had extremely low GFP fluorescence signal and also scored negative for all the conventional reporter genes. Based on these comparison data, the invention's yEGFP-based reporter assay is in accordance with the gold standard conventional reporter assay. o i /Application
  • the labor intensive reporter analysis using agar plates and filter membranes ultimately limit their application in a high throughput manner as is desired for large scale interaction analysis.
  • the yeast reporter cells are transformed with bait and prey plasmids, and plated on nutrient marker agar plates (e.g. SD-L-T) to select the co-transformed colonies. Then the co-transformed cells are subjected to two subsequent reporter analyses: (1) A nutrient reporter to indicate the positive interaction between bait and prey using agar plates, e.g.
  • HIS reporter analysis that involves the transfer of the co- transformed colonies to SD-L-T-H plate for growth test
  • a LacZ reporter analysis that involves the transfer of colonies onto a filter membrane, letting the colonies undergo a freeze and thaw cell disruption process, adding a ⁇ -X-Gal substrate and waiting for several hours before the colorimetric signal is developed and visualized. Since flow cytometry is capable of analyzing rare target cells in a larger heterogeneous cell population, it would be useful to determine if all the plating steps could be eliminated, and the target cells (co-transformant bearing both bait and prey plasmids) could be directly analyzed by flow cytometry for GFP reporter fluorescence.
  • the co-transformed (target) population in the total cell mixtures was quantified.
  • the efficiency of the transformation assay was calculated by plating a transformation mixture aliquot (AH109-yEFGP transformed with bait and prey plasmids) onto co-transformation selective media plate (SD-L-T) and counted the surviving colonies.
  • the numbers of positive colonies ranged from 124-1000 co-transformants per ⁇ 10 8 starting competent cells, in good agreement with the standard transformation efficiencies.
  • a time course study on the GFP reporter expression as a function of growth time was conducted.
  • the optimal GFP expression was observed at 48 hours post- transformation, the time point that allowed ⁇ 10 5 fold of target cell amplification and resulted >10% co-transformed cell population. Given that >10% of the cells would be the target cells bearing both bait and prey, a rapid flow GFP expression analysis v ⁇ i ⁇ nudii ⁇ on 10,000 cells should be statistically sufficient to detect positive GFP expression.
  • yEGFP-AH109 cells were transformed with control bait and prey plasmids, cultured the cells in the selective liquid media (SD-L-T) for 48 hours and then measured GFP expression by flow cytometry. As shown in Fig.
  • Table 2 and Supp Fig 1 are the percent positive values and fluorescence intensities of the positive cells, as well as the results of the plate-based HIS/3AT and MEL1 reporter analysis for each of the 50 colonies analyzed. As observed previously, all of the positive samples exhibited bimodal fluorescence distributions. Thirty-seven of the 50 selected clones expressed the T antigen prey (Supp Fig.1 C-E, showing strong-, medium-, and weak- positive clones, respectively), and also were positive in the HIS/3AT and MEL1 analyses (Table 2). Among the 13 non-T candidates, 1 1 showed good correlation between plate and flow reporter analysis.
  • the HIS3 reporter gene was scored by replicating the transformants onto SD-L-T-H plate as well as SD-L-T-H plates supplemented with 5, 10, 15 and 3OmM 3AT respectively.
  • the MEL1 Reporter was scored by replicating the colonies onto SD-L-T supplemented with appropriate concentration of ⁇ -X-gal. ++: strong positive; +: positive; -: negative. NA: not applicable.
  • Boulware KT Daugherty PS. Protease specificity determination by using cellular libraries of peptide substrates (CLiPS). Proc Natl Acad Sci USA 2006; 103:7583-
  • Boder ET Bill JR, Nields AW, Marrack PC, Kappler JW. Yeast surface display of a noncovalent MHC class Il heterodimer complexed with antigenic peptide.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides an improved yeast two-hybrid screening system that is optimal for high throughput screening of cDNA libraries for protein-protein interactions. The invention utilizes a combination of stably-integrated yEGFP as a reporter in the reporter yeast strain, combined with flow cytometric detection of fluorescence resulting from transcriptional activation of the reporter protein following interaction of protein-protein pairs. The system of the invention maybe conducted using liquid culture, rather than the agar plating required in conventional Y2H systems, thereby saving substantial time and resources. Moreover, by virtue of the system's liquid culture approach the invention is adaptable to high-throughput format and can be used for large-scale cDNA screening for interacting proteins with high sensitivity and low signal:noise ratios. The invention's Y2H assay/system offers convenient, quantitative and faster reporter analysis compatible with existing liquid handling robots, and also reduces labor requirements in screening cDNA libraries.

Description

FLOW CYTOMETRIC GFP-BASED YEAST TWO HYBRID SYSTEM
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT .
This invention was made with government support under Contract No. DE-AC52-06 NA 25396 awarded by the U.S. Department of Energy. The government has certain rights in the invention.
BACKGROUND OF THE INVENTION
Protein-protein interactions are fundamental to virtually every aspect of cellular function. To understand the protein-protein interaction network on a large scale, the genome-wide protein linkage mapping or "interactome" analyses have therefore become a major objective in the field of proteomics (1). Although a number of promising technologies have been developed to analyze and monitor protein-protein interactions in vitro and in vivo, and the need for confirmation by independent methods is recognized (2), only the yeast two-hybrid (Y2H) and mass spectrometry- based affinity co-purification approaches have been proven robust and versatile enough for systematic large scale analysis (3-6).
The Y2H system is a genetic screen wherein the interaction between two proteins of interest is detected via the functional reconstitution of the distinct DNA binding and activation domains of a transcription factor and the subsequent activation of reporter expression controlled by the transcription factor (7). Briefly, bait and prey protein pairs are fused to distinct DNA binding and activation domains of a transcription factor (e.g. GAL4). The interaction of bait and prey protein pairs brings the DNA binding and activation domains into close proximity, forming an active transcription factor complex which binds the promoter and triggers the expression of reporter gene(s) under the control of that promoter. The Y2H assay does not require specialized instrumentation and has been widely adopted. Large scale Y2H protein interaction maps are now available from various species, including virus, bacterium, u i rvμμiiuduun yeast, fly, worm and human (3, 4, 6). The Y2H system, however, does have limitations. False positive results (due to the non-specific triggering of reporter expression) and false negatives (e.g. due to incorrect protein folding or inactivation when fused with Y2H transcription binding or activation domain) are known issues. A recent parallel Y2H screening in either yeast or fly showed little overlap in the data suggesting the reliability of such screening may be problematic (8, 9).
The false positive rate, an intrinsic drawback of Y2H, can be reduced by performing screening with several selective reporters controlled by different promoters. For example, three inducible promoters Gall, Gal2, and MeH (corresponding to three expression regulation levels) controlling HIS3, ADE2, and LacZ/MEL1 reporter genes, were used in combination to reduce the false positives (10). In addition, the false positive rates could also be reduced with multiple rounds of screening. Similarly, false negatives could also be reduced from repeated Y2H screening rounds. However, one fundamental limitation of the conventional Y2H system is the labor intensive, time consuming, and expensive reporter (selection) analysis process that typically involves the uses of agar plates and filter membranes for auxotrophic marker selection (e.g. ADE2, HIS3/3AT) and the colorimetric LacZ quantification (via beta-galactosidase turnover of β-X-Gal). Such a process is not very compatible with conventional lab automation systems for high throughput analysis. Moreover, it has been reported some false positives resulted from the abnormal activity of LacZ reporter due to the altered growth and cell permeability in yeast (11). For these reasons, it would be extremely useful to develop a quantitative, cost-effective and high throughput Y2H system in which all the reporter genes could be easily scored quantitatively, simultaneously at low cost and without any bias by alterations in permeability.
Yeast two-hybrid assays and systems are described in, for example, United States Patent Nos. 5,283,173, 5,468,614, and 5,667,973. Y2H kits and systems are available from various commercial suppliers, including Invitrogen (www.invitrogen.com) and Clontech (www.clontech.com). Flow cytometry is a versatile high speed cell analysis method that is playing key roles in proteomics and systems biology efforts (12). The ability to analyze and physically sort individual cells at high rates (thousands per second) in a manner compatible with popular microwell plate formats make it well-suited for large scale cell screening and selection applications. Yeast (13, 14) and bacterial (15, 16) display screening of antibody and other libraries (17-19) are good examples. Green fluorescent protein (GFP) and its variants are good candidates for reporters for a flow cytometric version of the Y2H screen, and plasmid-based reporter systems employing the enhanced green fluorescent protein (EGFP) and GFPuv have been reported (20, 21). However, such plasmid-based systems produced highly heterogeneous fluorescence signals due to different numbers of plasmids transformed in host cells, resulting in large variations in detection sensitivity.
SUMMARY OF THE INVENTION
The invention provides an improved yeast two-hybrid screening system that is optimal for high throughput screening of cDNA libraries for protein-protein interactions. The invention is based, in part, upon the surprising and unexpected results generated with a yeast two-hybrid system in which at least one reporter is a yeast-optimized green fluorescent protein, yEGFP, that is encoded within the genome of the yeast reporter cell used in the assay, and fluorescence is quantified via flow cytometry.
In one embodiment, the invention provides a yeast two-hybrid assay (or system) in which at least one reporter is yEGFP. Preferably, the fluorescence generated by the expression of yEGFP is measured by flow cytometry, and the yEGFP reporter is encoded within the genome of the yeast reporter cell used in the assay (preferably, stably integrated). The yEGFP reporter may be under the transcriptional control of any promoter capable of being activated by a transcription factor suitable for use in such an assay. In one embodiment, the yeast two-hybrid assay is a GAL4-based assay, in which the yEGFP is under the transcriptional control of the GAL1 promoter. Typically, the yeast reporter cell is a S. cervisiae cell, and in preferred embodiments utilizing the GAL4-based assay/system described herein (see Examples), the yeast reporter cell is a S. cervisiae AH109 cell in which the yEGFP reporter gene is stably- integrated.
In the practice of the assay of the invention, bait and prey plasmids are introduced into the yeast reporter cell, typically by transformation, grown in liquid culture for a time sufficient to generate detectable fluorescence when yEGFP is expressed in the co-transformed cell (e.g., 48 hours; see Examples), and fluorescence is detected using flow cytometry. Large cDNA libraries of test "prey" proteins may be cloned into prey vectors, introduced into a yeast reporter cell along with the coordinate bait vector, and rapidly screened for cells containing interacting pairs of prey: bait proteins using flow cytometry.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1. Schematic of the flow cytometric Y2H system. Binding of fusion proteins bait and prey activates fluorescent reporter gene expression in yeast cells, which can be analyzed by flow cytometry. BD, DNA binding domain; AD, transcriptional activation domain; Fluo-reporter, fluorescent reporter gene.
FIG. 2. Measurement of EGFP reporter fluorescence in Y2H system using flow cytometry. A: GFP fluorescence analysis of plasmid-based GFP reporter in AH109 cells. AH 109 cells were cotransformed respectively with the negative control pair (pGBKT7-Gal1-EGFP and pGADT7, shown in red) and the positive control pair (pGBKT7-Gal1-EGFP and pCL1 , shown in green). The transformants that grew on SD-L-T plate were used for GFP fluorescence analysis by flow cytometry. B: GFP fluorescence analysis of the chromosomal integrated EGFP reporter in EGFP-AH109 cells. EGFP-AH109 cells were cotransformed respectively with the negative control pair (pGBKT7-Lam and pGADT7-T, shown in red) and two positive control pairs (pGBKT7-P53 and pGADT7-T, shown in blue; pGBKT7 and pCL1 , shown in green). The transformants growing on SD-L-T plates supplemented with G418 were used for GFP fluorescence analysis by flow cytometry. i i
FIG. 3. Flow cytometry analysis of chromosomal integrated yEGFP reporter fluorescence in Y2H system. Various bait and prey pairs were cotransformed into yEGFP-AH109 cells. The transformants growing on SD-L-T plates supplemented with G418 were used for GFP fluorescence analysis by flow cytometry. The negative control pair pGBKT7-Lam1 pGADT7-T (A) was used to determine M1 region. Two strong reporter triggers, pGBKT7- P531pGADT7-T (B) and pGBKT71 pCL1 (C) as well as two weak reporter triggers pGBKT7-NS11 pGADT7 (D) and pGBKT7- NS1 C1 pGADT7 (E) were used for the evaluation of yEGFP reporter gene expression in Y2H system.
FIG. 4. Flow cytometry analysis of the yEGFP reporter fluorescence on yEGFP- AH109 cells growing in liquid media. yEGFPAH109 cells were cotransformed with the same sets of bait and prey pairs as described in Figure 3. After the transformation, the cells were grown in the SD-L-T liquid media supplemented with G418 instead of plating. The GFP fluorescence of the each sample was analyzed by flow cytometry 48 hours post transformation. (A) pGBKT7-Lam1 pGADT7-T (negative control for setting M1 region), (B) pGBKT7-P531 pGADT7-T, (C) pGBKT71 pCL1 , (D) pGBKT7- NS11 pGADT7, and (E) pGBKT7-NS1 C1 pGADT7.
FIG. 5. Fluorescence histograms of positive and negative controls used to determine the sorting region for P53 cDNA library screening. The negative control pair (pGBKT7-Lam1 pGADT7-T, left panel) and the positive control pair (pGBKT7- P531pGADT7-T, right panel) were cotransformed into yEGFP-AH109 cells and grown for 48 h before GFP fluorescence measurement by FACSAria. Two sorting gates: weak GFP positive (P1) and strong GFP positive (P2) were established accordingly for isolating the GFP positive cells from the cDNA library screening.
DETAILED DESCRIPTION OF THE INVENTION Definitions
Unless otherwise defined, all terms of art, notations and other scientific terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms with commonly I Application understood meanings are defined herein for clarity and/or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. The techniques and procedures described or referenced herein are generally well understood and commonly employed using conventional methodology by those skilled in the art, such as, for example, the widely utilized molecular cloning methodologies described in Sambrook et al., Molecular Cloning: A Laboratory Manual 3rd. edition (2001) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and Current Protocols in Molecular Biology (Ausbel et al., eds., John Wiley & Sons, Inc. 2001. As appropriate, procedures involving the use of commercially available kits and reagents are generally carried out in accordance with manufacturer defined protocols and/or parameters unless otherwise noted.
A "yeast two-hybrid assay" or "yeast two-hybrid system" are used interchangeably herein and refer to an assay or system for the detection of interactions between protein pairs. In a two-hybrid screening assay/system, a transcription factor is split into two separate fragments, the binding domain (BD) and the activation domain (AD), each of which are provided on separate plasmids, and each of which is fused to a protein of interest. The yeast two-hybrid assay/system comprises (i) a "bait" vector, comprising a bait protein and the BD of the transcription factor utilized in the system; (ii) a "prey" vector, comprising a prey protein (or a library of prey proteins to be screened for interaction with the bait protein) and the AD of the transcription factor; (iii) a suitable reporter yeast strain containing the activation sequence for the transcription factor used in the system, which drives the expression of one or more reporter proteins. The bait and prey vectors are introduced into the reporter yeast strain, wherein if the expressed bait and prey proteins may interact. Interacting bait and prey protein pairs result in the reconstitution and activation of the transcription factor, which then binds to its compatible activation domain provided in the reporter yeast strain, which in turn triggers the expression of the reporter gene, which may then be detected.
A "fluorescent protein" as used herein is a protein that has intrinsic fluorescence. Typically, a fluorescent protein has a structure that includes an 11 -stranded beta- barrel. As used herein, "yEGFP" refers to a yeast codon-optimized variant of Enhanced Green Fluorescent Protein(EGFP), as described in Cormack et al., 1997, Microbiol. 143: 303-311.
"Physical linkage", "link" and "join" refer to any method known in the art for functionally connecting two or more molecules or domains (which are termed "physically linked"), including without limitation, recombinant fusion with or without intervening domains, intein-mediated fusion, non-covalent association, covalent bonding (e.g., disulfide bonding and other covalent bonding), hydrogen bonding; electrostatic bonding; and conformational bonding, e.g., antibody-antigen, and biotin- avidin associations.
"Fused" refers to linkage by covalent bonding.
A "fusion protein" refers to a chimeric molecule formed by the joining of two or more polypeptides through a bond formed one polypeptide and another polypeptide. Fusion proteins may also contain a linker polypeptide in between the constituent polypeptides of the fusion protein. The term "fusion construct" or "fusion protein construct" is generally meant to refer to a polynucleotide encoding a fusion protein.
The term "heterologous" when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature. For instance, a nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a nucleic acid encoding a fluorescent protein from one source and a nucleic acid encoding a peptide sequence from another source. Similarly, a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
A "reporter molecule" has a detectable phenotype. Often, the reporter molecule is a polypeptide, such as an enzyme, or a fluorescent polypeptide. A reporter polypeptide may have intrinsic activity. In the context of the methods of the rv^ i /-iμμuocuiuπ invention, a reporter molecule has a detectable phenotype associated with correct folding or solubility of the reporter molecule. For example, the reporter could be an enzyme or a fluorescent polypeptide. For an enzyme, the detectable phenotype would then be the ability to turn over a substrate giving a detectable product or change in substrate concentration or physical state. For a fluorescent protein, the activity would be the emission of fluorescence upon excitation by the appropriate wavelength(s) of light.
The term "isolated," when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It is preferably in a homogeneous state although it can be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein which is the predominant species present in a preparation is substantially purified. In particular, an isolated gene is separated from open reading frames which flank the gene and encode a protein other than the gene of interest. The term "purified" denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel.
Particularly, it means that the nucleic acid or protein is at least 85% pure, more preferably at least 95% pure, and most preferably at least 99% pure.
"Nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).
Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly o i Mppiicauυπ indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991 ); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); Rossolini et al., MoI. Cell. Probes 8:91-98 (1994)). The term nucleic acid is used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide.
The terms "polypeptide," "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an α carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes. r<_> ι /-iμμπocuiuπ
As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. For example, substitutions may be made wherein an aliphatic amino acid (G, A, I, L, or V) is substituted with another member of the group. Similarly, an aliphatic polar-uncharged group such as C, S, T, M, N, or Q, may be substituted with another member of the group; and basic residues, e.g., K, R, or H, may be substituted for one another. In some embodiments, an amino acid with an acidic side chain, E or D, may be substituted with its uncharged counterpart, Q or N, respectively; or vice versa. Each of the following eight groups contains other exemplary amino acids that are conservative substitutions for one another: 1 ) Alanine (A), Glycine (G);
2) Aspartic acid (D), Glutamic acid (E);
3) Asparagine (N), Glutamine (Q);
4) Arginine (R), Lysine (K);
5) lsoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W);
7) Serine (S), Threonine (T); and
8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.
The term "recombinant" when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (nonrecombinant) form of the cell or express native genes that are otherwise abnormally expressed, under-expressed or not expressed at all. _«
An "expression vector" is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a host cell. The expression vector can be part of a plasmid, virus, or nucleic acid fragment. Typically, the expression vector includes a nucleic acid to be transcribed operably linked to a promoter.
The invention provides an improved yeast two-hybrid screening system that is optimal for high throughput screening of cDNA libraries for protein-protein interactions. The invention utilizes a combination of stably-integrated yEGFP as a reporter in the reporter yeast strain, combined with flow cytometric detection of fluorescence resulting from transcriptional activation of the reporter protein following interaction of protein-protein pairs. The system of the invention maybe conducted using liquid culture, rather than the agar plating required in conventional Y2H systems, thereby saving substantial time and resources. Moreover, by virtue of the system's liquid culture approach the invention is adaptable to high-throughput format and can be used for large-scale cDNA screening for interacting proteins with high sensitivity and low signal:noise ratios. The invention's Y2H assay/system offers convenient, quantitative and faster reporter analysis compatible with existing liquid handling robots, and also reduces labor requirements in screening cDNA libraries.
In a preferred embodiment, the yeast two-hybrid system of the invention uses yEGFP, stably-integrated into the reporter yeast strain S. cervisiae AH109, in combination with the "Matchmaker" Y2H bait and prey plasmids available from Clontech Laboratories (Mountain View, California). This is a GAL4-based Y2H system, and it has been thoroughly characterized in the Examples, infra. The "Matchmaker™ GAL4 Two-Hybrid System 3 & Libraries User Manual" from Clontech may be obtained from Clontech and is hereby specifically incorporated by reference herein in its entirety.
However, many other embodiments involving other types of Y2H systems are envisioned, as the nature of the transcription factor, yeast reporter strain, particular bait/prey plasmids, and the like used in the assay is not likely to be critical. For example, a variety of yeast strains maybe used in the practice of the invention. Strains of the yeast Saccharomyces cerevisiae are particularly suitable in embodiments of the invention, in part because their genome has been extensively studied, and because they enjoy GRAS ("Generally Regarded As Safe") status with the Food and Drug Administration. Saccharomyces cerevisiae is recognized as a model eukaryote capable of rapid growth and with a versatile DNA transformation system. Background information and exemplary methods and media for growing, testing and preserving yeast in general and S. cerevisiae in particular may be found, for example, in Sherman, F., "Getting Started with Yeast," Dept. of Biochem. and Biophysics, Univ. of Rochester Med. Sch. (August 2003) (adapted from Sherman, F., "Getting Started with Yeast," Methods Enzymol., 350:3-41 (2002) (hereinafter "Sherman (I)"); and in Sherman, F., "An Introduction to the Genetics and Molecular Biology of the Yeast Saccharomyces cerevisiae," Dept. of Biochem. and Biophysics, Univ. of Rochester Med. Sch. (1998) (modified from Sherman, F., "Yeast Genetics," The Encyclopedia of Molecular Biology and Molecular Medicine," 6:302-325 (edited by R. A. Meyers, Weinheim, Germany, 1997); and Burke, D., et al., "Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual" (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 2000); Colby, et al. "Engineering Antibody Affinity by Yeast Surface Display" Methods Enzymol. 388:348-58 (2004). Additionally, many Y2H systems are known and commercially available. While some, like the exemplary system described herein, are GAL4 based systems, other systems based on other transcription factors such as LexA are known and available. In each case, an existing system may be modified by integrating yEGFP as at least one of the reporters whose expression is driven by the transcription factor that is activated upon protein-protein interacting pairs. Thus, many other Y2H systems may be similarly improved by introducing yEGFP into the yeast reporter strain genome, as will be appreciated by those skilled in the art.
In addition, it is possible that other fluorescent proteins maybe engineered to be yeast codon-optimized, and similarly used to improve reporter functionality. The parameters for evaluating such other yeast codon-optimized fluorescent protein variants are detailed in the Examples which follow.
A variety of fluorescent proteins are known and are suitable for use as a fluorescent protein marker for enabling cell sorting. Fluorescent proteins, such as the prototypic the Green Fluorescent Protein isolated from Aequorea victoria (GFP), generally rv_/ 1 rtμμnocaiiui i share a common tertiary structure comprising an 1 1 -stranded beta-barrel structure surrounding a centrally-located self-activating chromophore. One group of fluorescent proteins Aequorea victoria GFP1 as well as a number of GFP variants, such as cyan fluorescent protein, blue fluorescent protein, yellow fluorescent protein, etc. A number of color shift mutants of GFP have been developed and may be employed in the directed evolution methods of the present invention. These color- shift GFP mutants have emission colors blue to yellow-green, increased brightness, and photostability (Tsien et al., 1998, Annual Review of Biochemistry 67: 509-544). Additional GPF-based variants having modified excitation and emission spectra (Tsien et al., U.S. Patent Appn. 20020123113A1), enhanced fluorescence intensity and thermal tolerance (Thastrup et al., U.S. Patent Appn. 20020107362A1 ; Bjorn et al., U.S. Patent Appn. 20020177189A1), and chromophore formation under reduced oxygen levels (Fisher, U.S. Patent No. 6,414,119) have also been described. Most recently, GFPs from the anthozoans Renilla reniformis and Renilla kollikeri were described (Ward et al., U.S. Patent Appn. 20030013849).
Additional/multiple reporters may also be incorporated into the reporter strains, as is common in existing Y2H systems today. In particular, it is desirable to include a positive selection reporter, such various nutrient selection reporters, including but not limited to the HIS3 gene, encoding a protein required for histidine synthesis; the LEU2 gene, encoding a protein required for leucine synthesis; and the URA3 gene, encoding a protein required for uracil synthesis. Only yeast cells transformed with bait and prey vectors that result in a positive interaction between the bait and prey fusion proteins will survive selection on media requiring the expression of the nutrient selector.
The invention is further described and illustrated by way of the examples which follow, none of which are intended to limit the scope of the invention. o i Mppiicaiioπ
EXAMPLES
EXAMPLE 1 : FLOW CYTOMETRIC yEGFP YEAST TWO-HYBRID ASSAY/SYSTEM
Materials and Methods
Bacterial strains, plasmids and molecular cloning: Plasmid construction and molecular cloning were performed in the cloning host cell E.coli DH5α (Invitrogen) following standard protocols. The Y2H kit "Matchmaker system" was obtained from Clontech. The kit includes the bait vector of pGBKT7 (containing GAL4 transcription factor DNA binding domain, BD) and prey vector of pGADT7 (containing GAL4 transcription activation domain, AD) along with the negative interaction control of pGBKT7-l_am/pGADT7-T (Lam/T) pair, and positive interaction control pGBKT7-P53/pGADT7-T (P53/T) pair. A strong trigger of reporter gene expression, PCL1 plasmid encoding the full length GAL4 transcription factor was also included in the kit. The weak reporter expression trigger, influenza NS1 (suggested to have weak transcription activation activity when fused to DNA binding domain without the requirement of a separate transcription activator domain (22)) was constructed as follows: NS1 fragment amplified through a directed RT-PCR amplification process from influenza strain A (A/PR/8/34) was cloned into EcoRI/Sall sites of pGBKT7 vector in frame with GaWBD domain (pGBKT7-NS1). Another weak reporter expression trigger, pGBKT7-NS1 C (a N-terminal truncated NS1 gene fusing to the GAL4 binding domain) was made by removing a N-terminal segment of pGBKT7-NS1 gene by Ncol restriction digestion and ligation. pGBKT7-Gal1 pr-EGFP plasmid was made by inserting the Gal1 pr-EGFP fragment from pYM-N22-EGFP (which was made by insertion of the EGFP gene from pYM-27 into pYM-N22 vector) into Avrll and BstBI sites of pGBKT7 vector.
Yeast strains, culture conditions, and transformation:
The Y2H recipient strain of the Matchmaker system, S. cerevisiae AH 109 has the genotypes of (MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4Δ, galβOΔ, L YS::GAL 1 υAS-GAL 1 TATA-HIS3, GAL2UAS-GAL2TATA-ADE2, URA3::MEL 1 UAS- rυ i ΛAμμπuciiiui i
MEL1TATA-lacZ). The culturing of AH 109 was performed in YPD media using the standard protocol suggested by the manufacturer. Nutrient marker selective plates were made with minimum synthetic medium SD (Clontech) supplemented with the amino acids of the appropriate Dropout Mixture (Clontech). Synthetic medium lacking Leucine, Tryptophan and Histidine (SD-L-T-H) was used for the selection of positive interaction. Three-amino triazole (3AT) (Sigma) was used to counteract background expression of the HIS3 reporter. The GFP cassettes and the toolbox for PCR based tagging were purchased from EUROSCARF (EUROpean Saccharomyces cerevisiae ARchive for Functional analysis).
The yeast GFP two hybrid reporter strains, yEGFP-AH109 and EGFP-AH109 strains were constructed by replacing the chromosomal ADE2 coding region in AH 109 with yEGFP or EGFP coding region respectively using a well established PCR-based direct gene replacement method (23). Briefly, the yEGFP gene and Kan resistance gene replacement cassette was amplified with the following two primers,
yEGFP-F: 5'-
TAAGTAAACACAAGATTAACATAATAAAAAAATAATTCTTTCATATTAACATGTCT AAAGGTGAAG-3' [SEQ ID NO: 1]
yEGFP-R:
5'-TTTATATTATTTGCTGTGCAAGTATATCAATAAACTTATATATTA TTAGAAAAACTCATCGAGCA-S1 [SEQ ID NO: 2]
using PKT-127 plasmid as the PCR template (EUROSCARF). The EGFP gene and Kan resistance gene replacement cassette was amplified with primer, EGFP-F,
5'- TAAGTAAACACAAGATTAACATAATAAAAAAATAATTCTTTCATAGGAGCAATGA GCAAGGGCGA-31 [SEQ ID NO: 3]
and primer yEGFP-R [SEQ ID NO: 2], using the pYM-27 (EUROSCARF) as the PCR template. The resulting PCR products bearing EGFP and yEGFP genes were u i Application purified and transformed into yeast AH109 respectively by the standard LiAC/PEG method. The selection of G418 resistant transformants was performed on YPD media supplemented with 400μg/ml G418. After three days, several colonies were picked from YPD/G418 selection plates and used as the reporter strains to evaluate GFP fluorescence generated upon the transformation of different expression trigger sets. The criteria of selecting a reporter strain was to choose the candidate strain that would give rise to the brightest fluorescence for the stronger trigger plasmid sets (P53/T and PCL1/pGBKT7), and lowest fluorescence background for the negative trigger set (Lam/T) using SD-L-T+G418 selective media (SD medium lacking Leucine and Tryptophan) in combination with flow cytometric GFP analysis. The resulting yEGFP and EGFP reporter strains were named yEGFP-AH109 and EGFP-AH109 respectively. The chromosomal integration of the yEGFP and EGFP gene was confirmed by PCR and sequencing. The protein-protein interaction assays were performed according to the instruction manual provided by Clontech.
Flow cytometric analysis of yeast yEGFP fluorescence:
The GFP reporter yeast host cells carrying various bait and prey pairs were grown on SD-L-T+G418 selective medium to ensure all the yeast cells were under the same growth conditions and selection pressures. For the cells growing on the agar plates, colonies were picked directly into 300μl PBS solution for flow cytometry analysis. For the cells growing in the liquid medium, 50μl liquid sample were transferred into 300μl PBS solution for flow cytometry analysis. GFP signal analysis was performed using a FACSCalibur flow cytometer from Becton Dickson (San Jose, CA, USA). The instrument settings are as following: Log forward scatter (FSC) E00; Log side scatter 2 (SSC) at 299V and Log FL1 fluorescence at 600 V. The GFP fluorescence was excited at 488nm and collected through 530/30nm bandpass filter on the FL1 channel. The yeast single cell population was gated on FSC and SSC. The typical sampling rate was low (12 μl/min, ~200 events/second) and the typical sample size was 10,000 cells per measurement unless otherwise stated. The data were analyzed with WinMDI 2.8 software.
Preparation and screening of a spiked cDNA library:
An artificial human cDNA library was prepared by spiking 2ng pGADT7-T into 20μg human leukocyte cDNA library (Clontech) to achieve 1 : 10,000 target/non-target r \s I r-vpyιιt-*αuvι i ratios. The P53 gene carried by the pGBKT7-P53 vector was used as a bait to investigate if its interaction partner, T antigen (carried by pGADT7-T), could be isolated from this spiked human cDNA library screening. The bait plasmid, pGBKT7- P53, was first transformed into yEGFP-AH109 cells and selected against SD- T+G418 media. The resulting cells (~2x109 cells) were then transformed with 20μg of the prepared cDNA library plasmid using LiAc/PEG method following the manufacturer's protocol. After transformation, the cells were washed with sterile water and then resuspended into 200ml SD-L-T-H selection medium (~1x107 cells/ml). An aliquot of 200 μl was taken out, serially diluted and spread onto SD-L-T plates for determining the transformation efficiency from colony formation. The rest of cells were grown for 48 hours before 2ml samples were collected, washed twice with PBS, passed through a 45um mesh filter and sorted (FACSAria, Becton Dickson, San Jose, CA). In parallel with library screening experiment, negative (Lam/T) and positive (P53/T) control plasmid pairs were also transformed into the same yeast host and grown for 48 hours. The resulting control cells were then used to set up two cell sorting gates: P1 (weak interaction region defined as fluorescence signal from 200-600) and P2 (strong interaction region defined as fluorescence signal >600), The sorting of a 2ml library sample . (~48 million cells) yielded 1691 GFP positive cells from P2 region and 9700 GFP positive cells from P1 region respectively, that were subsequently plated onto a SD-L-T-H selection plate and allowed to grow for 3 days for further confirmation. Approximately 500 colonies grew up from the sorted cells in P1 and P2 regions respectively. 50 colonies from P2 region were randomly picked for GFP, HIS/3AT and MEL reporter gene expression analysis respectively. The GFP reporter analysis was performed by picking colonies, directly resuspending them into 300μl PBS solution and analyzing the cells by FACS as described above at analysis rate of ~200 cell/second. For the HIS/3AT and MEL1 reporter analysis, the colonies were replicated onto SD-L-T-H+10mM 3AT and SD-L- T+α-x-gal plates to observe the growth and color of individual colonies respectively. The plasmids were isolated from each yeast colony and were transformed into E. coli for amplification and sequencing. Results
Evaluation of an EGFP-based Y2H reporter system for flow cytometric analysis: The first step to adapt a conventional Y2H system for flow cytometric analysis was to develop a fluorescence-based reporter system so that the fluorescence signal could be quantified by flow cytometry (Fig.l). Because EGFP (an optimized variant of GFP gene in eukaryotic cells) was previously suggested for fluorescence-based Y2H system, when engineered in a plasmid based reporter format (20), the EGFP gene was evaluated as the reporter for a flow cytometric system. The EGFP-based reporter under the control of the G AU promoter was cloned into the bait plasmid of pGBKT7 (called pGBKT7-Gal1pr-EGFP). The EGFP expression was turned on upon transformation of a positive trigger plasmid PCL1 (encoding the full length GAL4 transcriptional factor that contains both BD and AD domains) and the EGFP signal was detected by flow cytometry. As shown in Fig 2A, the PCL1 did trigger plasmid-based EGFP fluorescence but resulted in a heterogeneous population distribution of fluorescence (Signal/Noise, S/N=200, coefficient of variation, CV= 25) in the yeast cells. This large variation in fluorescence signal was probably due to the variations of different EGFP plasmid copies within individual cells after the transformation. The more EGFP plasmid copies are in a single cell, the higher possibility of reporter expression is triggered, and consequently, the higher the fluorescence signal the cell produces. Such heterogeneity posed a significant problem for quantifying bait-prey interaction in the Y2H assay. In fact, the problem became even worse in an attempt to perform a large scale cDNA library screening due to the difficulties of setting up a clear sorting gate for rare target sorting (data not shown).
To minimize the fluorescence variations attributed to heterogeneous copies of the EGFP plasmid reporters, a single copy of the EGFP reporter was integrated into the AH109 host genome. The coding region of the ADE2 reporter gene in the AH109 host strain was replaced with the EGFP gene by the standard PCR based gene replacement method, resulting the strain EGFP-AH109. The EGFP-AH109 strain produced a fluorescence signal (S/N=3.0, CV= 12) with much narrower CV when transformed with the positive trigger PCL1 plasmid, indicating that chromosomal EGFP reporter did reduce the problem of heterogeneous fluorescence intensities (Fig 2B, green line). However, the EGFP-AH109 strain was not able to produce strong fluorescence signal (S/N=1.8, CV=9) when triggered by the strong interaction pairs, P53/T (Fig 2B, blue line). These results suggested that the single copy of EGFP reporter did not have adequate signaling strength and underscored the importance of developing a more sensitive fluorescence Y2H reporter system.
Development of a yEGFP-based Y2H reporter system with improved sensitivity: To evaluate yEGFP as an Y2H reporter for flow cytometric analysis, the chromosomal ADE2 coding region in yeast strain AH 109 was replaced with the yEGFP gene, resulting in the strain yEGFP-AH109.
When testing with the positive trigger pCL1 , almost 100% of yEGFP-AH109 cells carrying pCL1 produced fluorescence signal ~200 times higher than the negative control cells carrying Lam/T (S/N=200, CV=9; Fig 3A and 3C). Furthermore, 52% yEGPF-AH109 cells carrying the positive interaction trigger (P53/T) produced GFP fluorescence signal ~20 times higher than the negative control (S/N=20, CV=14; Fig 3A and 3B). Compared with the EGFP reporter (S/N=1.8), yEGFP reporter has a much better signal to noise ratio. The quantification of GFP fluorescence signal of positive and negative triggers is presented in Table 1. These results demonstrated that yEGFP reporter could distinguish all the positive and negative control triggers in the Matchmaker system and that yEGFP is a more robust flow cytometric Y2H reporter than EGFP. It is also interesting to note that the yEGFP fluorescence distributions of cells from single colonies were bimodal, while positive control cells expressing the covalently linked activation domain-binding domain fusion (pCL1) gives a unimodal distribution. Such phenomena could be explained by a cell cycle- dependence of yEGFP expression and/or a threshold effect for reporter gene activation that reflects the efficiencies of bait and target gene transcription, translation, proper folding, transport to the nucleus, interaction, and promoter binding and activation.
To further evaluate the sensitivity of yEGFP reporter gene for detecting weak protein-protein interaction, the influenza NS1 protein was utilized as a weak reporter trigger for a sensitivity test. The NS1/GAL4BD fusion construct, pGBKT7-NS1 , was co-transformed into the yEGFP-AH109 strain with pGADT7, and the GFP expression ., was measured by flow cytometry. 35.9% the yEGFP-AH109 cells carrying pGBKT7- NS1 showed clear GFP signal with S/N of ~7 (CV=8), three times less than the strong reporter triggers P53/T pair, indicating adequate detection sensitivity for the weak reporter trigger (Fig.3D). A similar result was obtained with pGBKT7-NS1 C construct (N-terminal truncated NS1) (Fig.3E). This data supports the observation that pGBKT7-NS1 is a weak reporter trigger, a conclusion also drawn by scoring the conventional HIS3/3AT reporter gene in the Matchmaker system. The yEGFP- AH109 cells carrying pGBKT7-NS1/pGADT7 constructs could not grow on SD-L-T-H supplemented with 1OmM 3AT plates, on which yEGFP-AH109 cells carrying P53/T pair showed strong growth (Table 1). These data showed that yEGFP reporter could detect the weak reporter trigger, indicating that it was able to detect weak protein- protein interactions, which also trigger weak reporter gene expression. To conclude, yEGFP reporter is a sensitive Y2H reporter for detection of both strong and relative weak protein-protein interactions.
Flow cytometric measurements of the yEGFP-based reporter correlate well with conventional Y2H system using nutrient and colorimetric reporters: Since the nutrient and colorimetric markers were used as gold standard reporters in the conventionalY2H system, it was desirable to validate the invention's new flow cytometric Y2H system by establishing convincing correlation between the two approaches. To carry out the side-by-side comparison of the flow and plating analysis, triggers with different strengths were used to transform yEGFP-AH109 cell, and the reporter signals were measured. The HIS, HIS/3AT and MEL1 were detected using agar plating method, and the yEGFP fluorescence reporter was measured by flow cytometry. As show in Table 1 , the relatively strong triggers P53/T pair and PCL1 generate stronger GFP signals as well as being positive for all three HIS, HIS/3AT and MEL1 reporters. On the other hand, the weak triggers, NS1 and NS1C generated weaker GFP signal, scored positive on SD-L-T-H, SD-L-T-H+5mM 3AT, and MEL1 selection plates, but negative on the more stringent SD-L-T-H supplemented with 1 OmM, 15mM and 3OmM 3AT selection plates. Finally, the negative control trigger, Lam/T had extremely low GFP fluorescence signal and also scored negative for all the conventional reporter genes. Based on these comparison data, the invention's yEGFP-based reporter assay is in accordance with the gold standard conventional reporter assay. o i /Application
Evaluation of the flow cytometric yEGFP-based Y2H system for high throughput protein-protein interaction analysis: elimination of agar plating:
Despite the wide utilization of the Y2H systems, the labor intensive reporter analysis using agar plates and filter membranes ultimately limit their application in a high throughput manner as is desired for large scale interaction analysis. In a typical Y2H procedure, the yeast reporter cells are transformed with bait and prey plasmids, and plated on nutrient marker agar plates (e.g. SD-L-T) to select the co-transformed colonies. Then the co-transformed cells are subjected to two subsequent reporter analyses: (1) A nutrient reporter to indicate the positive interaction between bait and prey using agar plates, e.g. HIS reporter analysis that involves the transfer of the co- transformed colonies to SD-L-T-H plate for growth test, and (2) A LacZ reporter analysis that involves the transfer of colonies onto a filter membrane, letting the colonies undergo a freeze and thaw cell disruption process, adding a β-X-Gal substrate and waiting for several hours before the colorimetric signal is developed and visualized. Since flow cytometry is capable of analyzing rare target cells in a larger heterogeneous cell population, it would be useful to determine if all the plating steps could be eliminated, and the target cells (co-transformant bearing both bait and prey plasmids) could be directly analyzed by flow cytometry for GFP reporter fluorescence.
To evaluate the feasibility of such an approach, the co-transformed (target) population in the total cell mixtures was quantified. First, the efficiency of the transformation assay was calculated by plating a transformation mixture aliquot (AH109-yEFGP transformed with bait and prey plasmids) onto co-transformation selective media plate (SD-L-T) and counted the surviving colonies. The numbers of positive colonies ranged from 124-1000 co-transformants per ~108 starting competent cells, in good agreement with the standard transformation efficiencies. Then, a time course study on the GFP reporter expression as a function of growth time was conducted. The optimal GFP expression was observed at 48 hours post- transformation, the time point that allowed~105 fold of target cell amplification and resulted >10% co-transformed cell population. Given that >10% of the cells would be the target cells bearing both bait and prey, a rapid flow GFP expression analysis v^ i Λψμnudiiυπ on 10,000 cells should be statistically sufficient to detect positive GFP expression. To test this approach, yEGFP-AH109 cells were transformed with control bait and prey plasmids, cultured the cells in the selective liquid media (SD-L-T) for 48 hours and then measured GFP expression by flow cytometry. As shown in Fig. 4, the cells carrying the positive triggers (P53/T, PCL1 and Influenza NS1 ) all produced clear GFP expression signal detected by flow cytometry. This result demonstrated that protein-protein interaction analysis may be performed using the new yEGFP-based flow cytometric Y2H approach without the conventional colony selection process on agar, thus greatly simplifying the experimental procedures and shortening the Y2H analysis time.
Evaluation of the flow cytometric yEGFP-based Y2H system for cDNA library screening: To investigate if a flow cytometric yEGFP Y2H system could be useful for cDNA library screening, an "artificial" cDNA library was prepared by spiking (at a ratio of 1 :10,000) prey T antigens into a human leukocyte cDNA library (known not to contain any viral T antigen) and used it to screen p53/T interaction (pGBKT7-P53 as bait). The spiked library of plasmids was transformed into yEGFP-AH109 cells bearing pGBKT7-P53 plasmid, and grew in SD-L-T-H liquid selection medium for 48hrs. An aliquot of the culture that contained approximately 107 cells was sorted by flow cytometry. Weak (P1) and a strong (P2) signal sorting regions were established using cells that bear negative (Lam/T) and positive control pairs (P53/T) (Fig. 5). Sorted cells from region P1 as well as P2 were plated onto selective media plates respectively. The 50 positive colonies from P2 were randomly picked, resuspended into PBS buffer and validated by GFP fluorescence analysis (via flow cytometry), MEL1 indication plate assay, SD-L-T-H and SD-L-T-H+10mM 3AT plate assays before sequencing to determine prey identity. Presented in Table 2 and Supp Fig 1 , are the percent positive values and fluorescence intensities of the positive cells, as well as the results of the plate-based HIS/3AT and MEL1 reporter analysis for each of the 50 colonies analyzed. As observed previously, all of the positive samples exhibited bimodal fluorescence distributions. Thirty-seven of the 50 selected clones expressed the T antigen prey (Supp Fig.1 C-E, showing strong-, medium-, and weak- positive clones, respectively), and also were positive in the HIS/3AT and MEL1 analyses (Table 2). Among the 13 non-T candidates, 1 1 showed good correlation between plate and flow reporter analysis. For instance, four of these candidates including two clones encoding CAPG (Supp Fig 1.F and G), and the other two clones encoding hypothetical proteins of unknown function (Supp Fig. 1 H and I) scored positive both in the plate-based and flow cytometry assays. Seven non-T candidates that were negative on the plate based analyses, were also giving very low fluorescence values. Among these, the most frequent candidate was identified as IRF7 (Supp Fig. U)1 which was suspected as a false positive here because it a showed weak reporter signal when expressed alone (data not shown). Finally, the two clones, expressing the genes ZNF302 and RanBMP (Supp Fig. 1 K and L)1 gave discordant results in the plate-based analysis, and both of these gave low fluorescence signals. RanBMP tested alone also resulted in low levels of fluorescence, indicating nonspecific reporter activation (data not shown). These results showed that the discrepancy among the different reporter assays could occur when the reporter signal was weak. In summary, the analysis on the 50 positive clones showed the successful identification of positive T antigens from cDNA library screening and good correlation between flow and plat reporter assays in general.
Table 1 :
Comparison of Y2H reporter gene expression level using different triggers
Bait and Prey Pairs yyEEGGFFPP SSDD--LL-- SSDD--LL--TT--HH++33AATT MEL1
% MFl positive T-H 5 10 15 30 pGBKT7-lam+pGADT7-T NNAA NNAA - pGBKT7-P53+pGADT7-T 555222...111 111000111...555 ++++++ ++++ ++++ ++++ ++++ ++
PCL1 +pGBKT7 999999...999 111222000888... ++++++ ++++ ++++ ++++ ++++ ++ 66 pGBKT7-NS1 +pGADT7 3355..99 4444..99 ++++ + PGBKT7-NS1 C+PGADT7 3300..77 4422..22 ++++ + Various bait and prey pairs were transformed into yEGFP-AH109 cells and the transformants were selected on SD-L-T plates and scored for four reporter gene expression. GFP fluorescence was measured by analyzing colonies resuspended in PBS using flow cytometry. The yEGFP signal was represented by the % positive events and the MFI (median fluorescence intensity) in the M1 region shown in Fig.3. The HIS3 reporter gene was scored by replicating the transformants onto SD-L-T-H plate as well as SD-L-T-H plates supplemented with 5, 10, 15 and 3OmM 3AT respectively. The MEL1 Reporter was scored by replicating the colonies onto SD-L-T supplemented with appropriate concentration of α-X-gal. ++: strong positive; +: positive; -: negative. NA: not applicable.
Table 2:
Characterization of the GFP positive candidates isolated from the P53 cDNA library screening yEGFP SD-L-T-H
Sample MFI %positive SD-L-T-H +1OmM 3AT MEL1 prey pGADT7 NA NA - NA
4 51 10 + + ZNF302
17 52 17 + unknown
31 55 20 + S20
41 56 22 + IRF7
37 57 21 + IRF7
16 58 22 + IRF7
48 60 23 + IRF7
33 63 35 + IRF7
24 64 30 + + + T
35 67 30 + + + T
23 69 26 + + - RanBMP
3, 6, 13, 26 70 33 + + + T
28, 25, 47, 27 76-77 33-37 + + + T
11 77 40 + + + unknown
12, 7, 30 78-79 33-38 + + + T
49 80 21 + + + CAPG
+ + +
34, 36, 15 81-82 34-36 T
2 85 37 + + + T
5, 29, 46, 43 91-94 36-44 + + + T
+ + +
14, 39 95 28-39 T
38 96 40 + + + T
44 97 19 + + + CAPG
18, 50, 20, 19 97-99 42-44 + + + T
1, 40 100 38-43 + + + T
42, 8, 32 126-130 45-47 + + + T pGADT7-T 148 42 + + + T
10 151 53 + + + T
45 153 40 + + + T
21 159 TI + + + unknown
9 166 49 + + + T
22 180 56 + + + T
50 GFP positive colonies obtained from P2 gate as well as the colonies containing negative control (pGBKT7-P53+pGADT7) and the positive control (pGBKT7-P53+pGADT7-T) were analyzed for the yEGFP, HIS, MEL1 reporter gene expression as described in Table 1. The candidates were sorted by descending yEGFP signal. The candidates with similar yEGFP median fluorescence intensity were shown in the same row. "+" and "-" represent the positive and negative reporter gene expression respectively. The plasmid isolated from each colony was sequenced and the identity is shown in the right column. "Unknown" represents the prey sequence that does not correspond to any known sequence. LITERATURE CITED BY REFERENCE NUMBERS
ICusick ME, Klitgord N1 Vidal M, Hill DE. Interactome: gateway into systems biology. Hum. MoI Genet. 2005; 14 Spec No. 2:R171-R181. 2. Figeys D. Combining different Omics1 technologies to map and validate protein- protein interactions in humans. Brief Funct Genomic Proteomic 2004, 2:357-365.
3. Piehler J. New methodologies for measuring protein interactions in vivo and in vitro. Curr Opin in Struct Biol 2005; 15: 4-14.
4. Parrish JR, Gulyas KD1 Finley RL. Yeast two-hybrid contributions to interactome mapping. Curr Opin in Biotech 2006; 17: 387-393.
5. Downard KM. Ions of the interactome: the role of MS in the study of protein interactions in proteomics and structural biology. Proteomics 2006; 6:5374-5384.
6. Stanley F. High-throughput two-hybrid analysis -the promise and the peril. FEBS J 2005; 272: 5391-5399. 7. Fields S, Song O. A novel genetic system to detect protein-protein interactions. Nature 1989; 340: 245-246.
8. lto T, Chiba T, OZava R, Yoshida M1 Hattori M, Sakaki Y. A comprehensive two- hybrid analysis to explore the yeast protein interactome. Proc Natl Acad Sci USA 2001 ; 98: 4569-4574 9. Utez P, Giot L, Cagney G, Mansfield TA, Judson RS, Knight JR, Lockshon D, Narayan V, Srinivasan M, Pochart P, Quershi-emili A, Li Y, Godwin B, Conover D, Kalbfleisch T, Vijayadamodar G.Yang M, Johnston M, Fields S, Rothberg JM. A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae Nature 2000; 403: 623-627 10. James P, Halladay J, Craig EA. Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 1996; 144: 1425-1436.
11. Serebriiskii I1 Estojak J, Berman M, Golemis EA. Approaches to detecting false positives in yeast two-hybrid systems. Biotechniques 2000; 28: 328-330, 332-336.
12. Nolan JP, Yang L. The flow of cytometry into systems biology. Brief Funct Genomic Proteomic 2007; 0: elm01 1v1-10.
13. Feldhaus MJ1 Siegel RW, Opresko LK. Coleman JR, Feldhaus JM, Yeung YA1 Cochran JR, Heinzelman P, Colby D1 Swers J1 Graff C, Wiley HS1 Wittrup KD. Flow- cytometric isolation of human antibodies from a nonimmune Saccharomyces cerevisiae surface display library. Nat Biotechnol 2003; 21 :163-170. 14. Shusta EV, Kieke MC, Parke E, Kranz DM, Wittrup KD. Yeast polypeptide fusion surface display levels predict thermal stability and soluble secretion efficiency. Journal of Molecular Biology 1999; 292:949-956.
15. Fuchs P, Weichel W, Dubel S, Breitling F, Little M. Separation of E. coli expressing functional cell-wall bound antibody fragments by FACS. lmmunotechnology 1996; 2:97-102.
16. Wernerus H, Stahl S. Biotechnological applications for surface-engineered bacteria. Biotechnol Appl Biochem 2004; 40:209-228.
17. Boulware KT, Daugherty PS. Protease specificity determination by using cellular libraries of peptide substrates (CLiPS). Proc Natl Acad Sci USA 2006; 103:7583-
7588.
18. Shusta EV1 Holler PD, Kieke MC, Kranz DM, and Wittrup KD. Directed evolution of a stable scaffold for T-cell receptor engineering. Nat Biotechnol 2006; 18:754-759.
19. Varadarajan NJ, Gam J, Olsen MJ, Georgiou G, Iverson NL. Engineering of protease variants exhibiting high catalytic activity and exquisite substrate selectivity. Proc Natl Acad Sci USA 2005; 102:6855-6860.
20. Starling AL, Ortega JM, Gollob KJ, Vicente EJ, Andrade-Nobrega GM, Rodriguez MB. Evaluation of alternative reporter genes for the yeast two-hybrid system. Genet MoI Res 2003; 2: 124-135. 21. Cormack RS, Hahlbrock K, Somssich IE. Isolation of putative plant transcriptional coactivatiors using a modified two-hybrid sytem incorporating a GFP reporter gene. The Plant J 1998; 14: 685-692.
22. Marion RM, Fortes P, Beloso A, Dotti C, Ortin J. A human sequence homologue of Staufen is an RNA-binding protein that is associated with polysomes and localizes to the rough endoplasmic reticulum. MoI Cell Biol 1999; 19: 2212-2219
23. Janke C, Magiera MM1 RAthfelder N, Taxis C1 Reber S , Maekawa H1 Moreno- Borchart A, Doenges G, Schwob E, Schiebel E, Knop M. A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast 2004; 21 : 947-962. 24. Cormack BP1 Bertram G, Egerton M, Gow NAR1 Falkow S1 Brown AJP. Yeast - enhanced green fluorescent protein (yEGFP): a reporter of gene expression in Candida albicans. Microbiology 1997; 143: 303-31 1.
25. Mayer G. Launhardt H. Munder T. Application of the green fluorescent protein as a reporter for Ace1 -based, two-hybrid studies. Biotechniques 1999; 27: 86-8, 92-4 26. Mazor Y, Blarcom TV1 Mabry R, Iverson BL, Georgiou G. Isolation of engineered, full-length antibodies from libraries expressed in Escherichia coli. Nat Biotechnol 2007; 25:563-565
27. Boder ET, Bill JR, Nields AW, Marrack PC, Kappler JW. Yeast surface display of a noncovalent MHC class Il heterodimer complexed with antigenic peptide.
Biotechnol Bioeng 2005; 92:485-491.
28. Kieke MC, Sundberg E, Shusta EV, Mariuzza RA1 Wittrup KD, Kranz DM. High affinity T cell receptors from yeast display libraries block T cell activation by superantigens. J MoI Biol 2001 ; 307:1305-1315. 29. Kim YS1 Bhandari R, Cochran JR, Kuriyan J, Wittrup KD. Directed evolution of the epidermal growth factor receptor extracellular domain for expression in yeast. Proteins 2006; 62:1026-1035.
30. Cochran JR, Kim YS, Lippow SM1 Rao B, Wittrup KD. Improved mutants from directed evolution are biased to orthologous substitutions. Protein Eng Des SeI 2006; 19:245-253.
31. Olsen MJ1 .Gam J1 Iverson BL, Georgiou G. High-throughput FACS method for directed evolution of substrate specificity. Methods MoI Biol 2003; 230:329-342.
32. Clark DD, Peterson BR. Fluorescence-based cloning of a protein tyrosine kinase with a yeast tribrid system. Chembiochem 2005; 6:1442-1448. 33. Nguyen AW, Daugherty PS. Evolutionary optimization of fluorescent proteins for intracellular FRET. Nat Biotechnol 2005; 23:355-360.

Claims

WHAT IS CLAIMED IS:
1. A yeast two-hybrid assay or system in which at least one reporter is yEGFP.
2. The yeast two-hybrid assay or system of claim 1 , wherein yEGFP fluorescence is measured using flow cytometry.
3. The yeast two-hybrid assay or system of claim 1 or 2 wherein the yEGFP reporter is encoded within the genome of a yeast reporter cell.
4. The yeast two-hybrid assay or system of claims 1-3, wherein the yEGFP reporter is under the transcriptional control of the GAL1 promoter.
5. The yeast two-hybrid assay or system of claim 4, wherein the yeast reporter cell is a S. cervisiae cell.
6. The yeast two-hybrid assay or system of claim 5, wherein the S. cervisiae cell is a S. cervisiae strain AH109 cell.
7. The yeast two-hybrid assay or system of claim 3, wherein the yeast reporter cell is co-transformed with bait and prey plasmids, grown in liquid culture for a time sufficient to generate detectable fluorescence when yEGFP is expressed in the co- transformed cell, and fluorescence is detected using flow cytometry.
PCT/US2009/000043 2008-01-03 2009-01-05 Flow cytometric gfp-based yeast two hybrid system Ceased WO2009088991A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US1008508P 2008-01-03 2008-01-03
US61/010,085 2008-01-03

Publications (2)

Publication Number Publication Date
WO2009088991A2 true WO2009088991A2 (en) 2009-07-16
WO2009088991A3 WO2009088991A3 (en) 2009-12-30

Family

ID=40853400

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2009/000046 Ceased WO2009088994A1 (en) 2008-01-03 2009-01-05 Surface display-based yeast two hybrid screening system
PCT/US2009/000043 Ceased WO2009088991A2 (en) 2008-01-03 2009-01-05 Flow cytometric gfp-based yeast two hybrid system

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US2009/000046 Ceased WO2009088994A1 (en) 2008-01-03 2009-01-05 Surface display-based yeast two hybrid screening system

Country Status (1)

Country Link
WO (2) WO2009088994A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102590528A (en) * 2012-01-18 2012-07-18 厦门大学 Method for detecting interaction of proteins

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5491068A (en) * 1991-02-14 1996-02-13 Vicam, L.P. Assay method for detecting the presence of bacteria
US6562576B2 (en) * 2001-01-04 2003-05-13 Myriad Genetics, Inc. Yeast two-hybrid system and use thereof
FR2867783B1 (en) * 2004-03-16 2008-02-01 Cytomics Systems METHOD OF SCREENING AGENT MODULATING THE UBIQUITINATION OF THE IKBALPHA PROTEIN AND MEANS FOR CARRYING OUT SAID METHOD
ES2381384T3 (en) * 2004-08-31 2012-05-25 Fox Chase Cancer Center Yeast / bacteria bihybrid system and procedures for its use

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102590528A (en) * 2012-01-18 2012-07-18 厦门大学 Method for detecting interaction of proteins

Also Published As

Publication number Publication date
WO2009088994A1 (en) 2009-07-16
WO2009088991A3 (en) 2009-12-30

Similar Documents

Publication Publication Date Title
US12275760B2 (en) Amino acid-specific binder and selectively identifying an amino acid
US7393318B2 (en) Methods and compositions for interaction trap assays
Toby et al. Using the yeast interaction trap and other two-hybrid-based approaches to study protein-protein interactions
US6562576B2 (en) Yeast two-hybrid system and use thereof
AU781478B2 (en) Methods and compositions for the construction and use of fusion libraries
US5695941A (en) Interaction trap systems for analysis of protein networks
US20030049647A1 (en) Use of nucleic acid libraries to create toxicological profiles
JP2021505675A (en) Yeast display of proteins in the periplasmic space
US7297491B2 (en) Methods and compositions for interaction trap assays
WO1999028746A1 (en) A bacterial multi-hybrid system and applications
Zhang et al. [5] Yeast three-hybrid system to detect and analyze interactions between RNA and protein
US6074829A (en) Relating to assay systems
CA2304367C (en) An improved yeast interaction trap assay
Chen et al. A yEGFP‐based reporter system for high‐throughput yeast two‐hybrid assay by flow cytometry
EP2190989B1 (en) Method for manufacturing a modified peptide
Chen et al. A surface display yeast two-hybrid screening system for high-throughput protein interactome mapping
WO2009088991A2 (en) Flow cytometric gfp-based yeast two hybrid system
Clarke et al. Novel mobilizable prokaryotic two-hybrid system vectors for high-throughput protein interaction mapping in Escherichia coli by bacterial conjugation
Zhang et al. [27] Yeast three-hybrid system to detect and analyze RNA-protein interactions
US20090305286A1 (en) Method for the Identification of Suitable Fragmentation Sites in a Reporter Protein
CN111778270A (en) A method to reflect in vitro cell-free protein expression levels by integrating a luminescent reporter gene
US20090105089A1 (en) Method for detecting intracytoplasmic protein/protein interactions
HK40043087A (en) Yeast display of proteins in the periplasmic space
ETH Development of split-ubiquitin based
Oberoi et al. 9 Molecular Matchmaking

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09701142

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09701142

Country of ref document: EP

Kind code of ref document: A2