WO2009085278A1 - Methods and compositions for producing olefins - Google Patents
Methods and compositions for producing olefins Download PDFInfo
- Publication number
- WO2009085278A1 WO2009085278A1 PCT/US2008/014029 US2008014029W WO2009085278A1 WO 2009085278 A1 WO2009085278 A1 WO 2009085278A1 US 2008014029 W US2008014029 W US 2008014029W WO 2009085278 A1 WO2009085278 A1 WO 2009085278A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- olefin
- fatty acid
- biofuel
- host cell
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
- C12P5/02—Preparation of hydrocarbons or halogenated hydrocarbons acyclic
- C12P5/026—Unsaturated compounds, i.e. alkenes, alkynes or allenes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C11/00—Aliphatic unsaturated hydrocarbons
- C07C11/02—Alkenes
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10G—CRACKING HYDROCARBON OILS; PRODUCTION OF LIQUID HYDROCARBON MIXTURES, e.g. BY DESTRUCTIVE HYDROGENATION, OLIGOMERISATION, POLYMERISATION; RECOVERY OF HYDROCARBON OILS FROM OIL-SHALE, OIL-SAND, OR GASES; REFINING MIXTURES MAINLY CONSISTING OF HYDROCARBONS; REFORMING OF NAPHTHA; MINERAL WAXES
- C10G3/00—Production of liquid hydrocarbon mixtures from oxygen-containing organic materials, e.g. fatty oils, fatty acids
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
- C10L1/00—Liquid carbonaceous fuels
- C10L1/04—Liquid carbonaceous fuels essentially based on blends of hydrocarbons
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
- C10L1/00—Liquid carbonaceous fuels
- C10L1/04—Liquid carbonaceous fuels essentially based on blends of hydrocarbons
- C10L1/06—Liquid carbonaceous fuels essentially based on blends of hydrocarbons for spark ignition
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
- C10L1/00—Liquid carbonaceous fuels
- C10L1/04—Liquid carbonaceous fuels essentially based on blends of hydrocarbons
- C10L1/08—Liquid carbonaceous fuels essentially based on blends of hydrocarbons for compression ignition
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10G—CRACKING HYDROCARBON OILS; PRODUCTION OF LIQUID HYDROCARBON MIXTURES, e.g. BY DESTRUCTIVE HYDROGENATION, OLIGOMERISATION, POLYMERISATION; RECOVERY OF HYDROCARBON OILS FROM OIL-SHALE, OIL-SAND, OR GASES; REFINING MIXTURES MAINLY CONSISTING OF HYDROCARBONS; REFORMING OF NAPHTHA; MINERAL WAXES
- C10G2300/00—Aspects relating to hydrocarbon processing covered by groups C10G1/00 - C10G99/00
- C10G2300/10—Feedstock materials
- C10G2300/1011—Biomass
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10G—CRACKING HYDROCARBON OILS; PRODUCTION OF LIQUID HYDROCARBON MIXTURES, e.g. BY DESTRUCTIVE HYDROGENATION, OLIGOMERISATION, POLYMERISATION; RECOVERY OF HYDROCARBON OILS FROM OIL-SHALE, OIL-SAND, OR GASES; REFINING MIXTURES MAINLY CONSISTING OF HYDROCARBONS; REFORMING OF NAPHTHA; MINERAL WAXES
- C10G2400/00—Products obtained by processes covered by groups C10G9/00 - C10G69/14
- C10G2400/02—Gasoline
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10G—CRACKING HYDROCARBON OILS; PRODUCTION OF LIQUID HYDROCARBON MIXTURES, e.g. BY DESTRUCTIVE HYDROGENATION, OLIGOMERISATION, POLYMERISATION; RECOVERY OF HYDROCARBON OILS FROM OIL-SHALE, OIL-SAND, OR GASES; REFINING MIXTURES MAINLY CONSISTING OF HYDROCARBONS; REFORMING OF NAPHTHA; MINERAL WAXES
- C10G2400/00—Products obtained by processes covered by groups C10G9/00 - C10G69/14
- C10G2400/04—Diesel oil
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10G—CRACKING HYDROCARBON OILS; PRODUCTION OF LIQUID HYDROCARBON MIXTURES, e.g. BY DESTRUCTIVE HYDROGENATION, OLIGOMERISATION, POLYMERISATION; RECOVERY OF HYDROCARBON OILS FROM OIL-SHALE, OIL-SAND, OR GASES; REFINING MIXTURES MAINLY CONSISTING OF HYDROCARBONS; REFORMING OF NAPHTHA; MINERAL WAXES
- C10G2400/00—Products obtained by processes covered by groups C10G9/00 - C10G69/14
- C10G2400/08—Jet fuel
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10G—CRACKING HYDROCARBON OILS; PRODUCTION OF LIQUID HYDROCARBON MIXTURES, e.g. BY DESTRUCTIVE HYDROGENATION, OLIGOMERISATION, POLYMERISATION; RECOVERY OF HYDROCARBON OILS FROM OIL-SHALE, OIL-SAND, OR GASES; REFINING MIXTURES MAINLY CONSISTING OF HYDROCARBONS; REFORMING OF NAPHTHA; MINERAL WAXES
- C10G2400/00—Products obtained by processes covered by groups C10G9/00 - C10G69/14
- C10G2400/20—C2-C4 olefins
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10G—CRACKING HYDROCARBON OILS; PRODUCTION OF LIQUID HYDROCARBON MIXTURES, e.g. BY DESTRUCTIVE HYDROGENATION, OLIGOMERISATION, POLYMERISATION; RECOVERY OF HYDROCARBON OILS FROM OIL-SHALE, OIL-SAND, OR GASES; REFINING MIXTURES MAINLY CONSISTING OF HYDROCARBONS; REFORMING OF NAPHTHA; MINERAL WAXES
- C10G2400/00—Products obtained by processes covered by groups C10G9/00 - C10G69/14
- C10G2400/22—Higher olefins
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
- C10L2290/00—Fuel preparation or upgrading, processes or apparatus therefore, comprising specific process steps or apparatus units
- C10L2290/26—Composting, fermenting or anaerobic digestion fuel components or materials from which fuels are prepared
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/30—Fuel from waste, e.g. synthetic alcohol or diesel
Definitions
- Petroleum is a limited, natural resource found in the Earth in liquid, gaseous, or solid forms. Petroleum is primarily composed of hydrocarbons, which are comprised mainly of carbon and hydrogen. It also contains significant amounts of other elements, such as, nitrogen, oxygen, or sulfur, in different forms.
- Petroleum is a valuable resource, but petroleum products are developed at considerable costs, both financial and environmental.
- sources of petroleum must be discovered. Petroleum exploration is an expensive and risky venture. The cost of exploring deep water wells can exceed $100 million. Moreover, there is no guarantee that these wells will contain petroleum. It is estimated that only 40% of drilled wells lead to productive wells generating commercial hydrocarbons.
- petroleum exploration carries a high environmental cost. For example, offshore exploration disturbs the surrounding marine environments.
- Petroleum extraction also carries an environmental cost.
- petroleum extraction can result in large seepages of petroleum rising to the surface.
- offshore drilling involves dredging the seabed which disrupts or destroys the surrounding marine environment. Since petroleum deposits are not found uniformly throughout the Earth, petroleum must be transported over great distances from petroleum producing regions to petroleum consuming regions. In addition to the shipping costs, there is also the environmental risk of devastating oil spills. [0004] In its natural form, crude petroleum extracted from the Earth has few commercial uses.
- hydrocarbons e.g., paraffins (or alkanes), olefins (or alkenes), alkynes, napthenes (or cylcoalkanes), aliphatic compounds, aromatic compounds, etc.
- hydrocarbons e.g., paraffins (or alkanes), olefins (or alkenes), alkynes, napthenes (or cylcoalkanes), aliphatic compounds, aromatic compounds, etc.
- crude petroleum contains other organic compounds (e.g., organic compounds containing nitrogen, oxygen, sulfur, etc.) and impurities (e.g., sulfur, salt, acid, metals, etc.).
- crude petroleum must be refined and purified before it can be used commercially. Due to its high energy density and its easy transportability, most petroleum is refined into fuels, such as transportation fuels (e.g., gasoline, diesel, aviation fuel, etc.), heating oil, liquefied petroleum gas, etc.
- transportation fuels e.g., gasoline, diesel, aviation fuel, etc.
- heating oil e.g., heating oil, liquefied petroleum gas, etc.
- Crude petroleum is also a primary source of raw materials for producing petrochemicals.
- the two main classes of raw materials derived from petroleum are short chain olefins (e.g., ethylene and propylene) and aromatics (e.g., benzene and xylene isomers). These raw materials are derived from longer chain hydrocarbons in crude petroleum by cracking it at considerable expense using a variety of methods, such as catalytic cracking, steam cracking, or catalytic reforming. These raw materials are used to make petrochemicals, which cannot be directly refined from crude petroleum, such as monomers, solvents, detergents, or adhesives.
- ethylene is used to produce petrochemicals such as, polyethylene, ethanol, ethylene oxide, ethylene glycol, polyester, glycol ether, ethoxylate, vinyl acetate, 1 ,2-dichloroethane, trichloroethylene, tetrachloroethylene, vinyl chloride, and polyvinyl chloride.
- An additional example of a raw material is propylene, which is used to produce isopropyl alcohol, acrylonitrile, polypropylene, propylene oxide, propylene glycol, glycol ethers, butylene, isobutylene, 1,3 -butadiene, synthetic elastomers, polyolefins, alpha-olefins, fatty alcohols, acrylic acid, acrylic polymers, allyl chloride, epichlorohydrin, and epoxy resins. [0008] These petrochemicals can then be used to make specialty chemicals, such as plastics, resins, fibers, elastomers, pharmaceuticals, lubricants, or gels.
- Particular specialty chemicals which can be produced from petrochemical raw materials are: fatty acids, hydrocarbons (e.g., long chain, branched chain, saturated, unsaturated, etc.), fatty alcohols, esters, fatty aldehydes, ketones, lubricants, etc.
- Specialty chemicals have many commercial uses.
- Hydrocarbons have many commercial uses.
- shorter chain alkanes are used as fuels.
- Methane and ethane are the main constituents of natural gas.
- Longer chain alkanes e.g., from five to sixteen carbons
- Alkanes having more than sixteen carbon atoms are important components of fuel oils and lubricating oils.
- alkanes which are solid at room temperature, can be used, for example, as a paraffin wax.
- Alkanes that contain approximately thirty-five carbons are found in bitumen, which is used for road surfacing.
- longer chain alkanes can be cracked to produce commercially useful shorter chain hydrocarbons.
- short chain olefins are used in transportation fuels.
- Longer chain olefins are used in plastics, lubricants, and synthetic lubricants.
- olefins are used as a feedstock to produce alcohols, esters, plasticizers, surfactants, tertiary amines, enhanced oil recovery agents, fatty acids, thiols, alkenylsuccinic anhydrides, polymers, textiles, solvents, adhesives epoxides, chlorinated alkanes, chlorinated olefins, waxes, fuel additives, and drag flow reducers.
- long chain olefins can be cracked to produce fuels.
- Olefins have traditionally been produced from petroleum sources through the process of steam or catalytic cracking. Because of the limited availability and high cost of petroleum sources, the cost of producing olefins from such petroleum sources has been steadily increasing.
- Olefins are the largest volume of chemical intermediates produced in the chemical industry, with global annual production previously estimated at over 300 billion lbs per year. Olefins are produced almost exclusively from ethane or other light alkanes (naphtha) in a process called cracking. This process involves heating the ethane or other light olefins to approximately 750-1000°C in a cracker. It has been estimated that 30% of all pollution from chemical plants comes from cracking owing to emissions and unburned hydrocarbons in the flame required to heat the cracker. Approximately 10% of petroleum is consumed in the production of olefins and related chemicals.
- Lubricants derived petroleum are typically composed of olefins, particularly polyolefins and terminal olefins. Lubricants can either be refined from crude petroleum or manufactured using raw materials refined from crude petroleum. [0014] Obtaining these specialty chemicals from crude petroleum requires a significant financial investment as well as a great deal of energy. It is also an inefficient process because frequently the long chain hydrocarbons in crude petroleum are cracked to produce smaller monomers. These monomer are then used as the raw material to manufacture the more complex specialty chemicals.
- One method of producing renewable petroleum is by engineering microorganisms to produce renewable petroleum products.
- Some microorganims have a natural ability to produce chemicals.
- yeast has been used for centuries to produce ethanol (e.g., beer, wine, etc.).
- biochemicals Chemicals derived from these cellular activities are known as biochemicals.
- Fuels produced these cellular activities are known as biofuels.
- Biofuels are a renewable alternative to petroleum based fuels. Biofuels can be substituted for any petroleum based fuel (e.g., gasoline, diesel, aviation fuel, heating oil, etc.).
- Biofuels can be derived from renewable sources, such as plant matter, animal matter, or even waste products. These renewable sources are collectively known as biomass.
- renewable sources such as plant matter, animal matter, or even waste products. These renewable sources are collectively known as biomass.
- One advantage of biofuels over petroleum based fuels is that they do not require expensive and risky exploration or extraction.
- biofuels can be locally produced. Hence, they do not require transportation over long distances.
- biofuels can be made directly without the need for expensive and energy intensive refining as is needed with refining crude petroleum. In other circumstances, the biofuel may require a limited and cost-effective level of refining.
- the use of biofuels improves the environment by reducing the amount of environmentally harmful emissions (e.g., green house gases, air pollution, etc.) released during combustion.
- biofuels maintain a balanced carbon cycle because biofuels are produced from biomass, a renewable, natural resource. While the burning of biofuels will release carbon (e.g., as carbon dioxide), this carbon will be recycled during the production of biomass (e.g., the cultivation of crops) thereby balancing the carbon cycle unlike petroleum based fuels.
- carbon e.g., as carbon dioxide
- biologically derived chemicals offer the same advantages as biofuels over petroleum based fuels.
- Biologically derived chemicals are a renewable alternative to petrochemicals.
- Biologically derived chemicals such as hydrocarbons (e.g., alkanes, alkenes, or alkynes), fatty alcohols, esters, fatty acids, fatty aldehydes, and ketones are superior to petrochemicals because they are produced directly without extensive refining.
- hydrocarbons e.g., alkanes, alkenes, or alkynes
- fatty alcohols e.g., esters, fatty acids, fatty aldehydes, and ketones
- biologically derived chemicals do not need to be refined like crude petroleum to recover raw materials which must then be further processed to make more complex petrochemicals.
- Biologically derived chemicals are directly converted from biomass to the desired chemical product.
- the invention is based, at least in part, on the discovery of a novel gene, or ⁇ 80, which encodes an olefin-producing enzyme. Accordingly, in one aspect, the invention features an isolated polynucleotide comprising a nucleotide sequence having at least 70% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
- the nucleotide sequence has at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
- the polynucleotide comprises the nucleotide sequence of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
- the polynucleotide consists of the nucleotide sequence of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
- the invention features an isolated polynucleotide comprising a nucleotide sequence that hybridizes to a complement of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13 or to a fragment thereof.
- the nucleotide sequence hybridizes to a complement of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13 or to a fragment thereof under low stringency, medium stringency, high stringency, or very high stringency conditions.
- the invention features an isolated polynucleotide comprising a sequence encoding a polypeptide comprising (i) the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 or (ii) the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more amino acid substitutions, additions, insertions, or deletions.
- the polypeptide comprises the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more conservative amino acid substitutions.
- the polypeptide comprises one or more of the following conservative amino acid substitutions: replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid; replacement of a serine with a threonine; replacement of a threonine with a serine; replacement of an acidic residue, such as aspartic acid and glutamic acid, with another acidic residue; replacement of a residue bearing an amide group, such as asparagine and glutamine, with another residue bearing an amide group; exchange of a basic residue, such as lysine and arginine, with another basic residue; and replacement of an aromatic residue, such as phenylalanine and tyrosine, with another aromatic residue.
- conservative amino acid substitutions replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid
- the polypeptide has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more amino acid substitutions, additions, insertions, or deletions. [0024] In some embodiments, the polypeptide has fatty acid decarboxylase activity.
- the invention features an isolated polynucleotide comprising a nucleotide sequence encoding a polypeptide having the same biological activity as a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14, wherein the polynucleotide comprises: (i) the nucleotide sequence of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13 or a fragment thereof, or (ii) a nucleotide sequence that hybridizes to a complement of SEQ ID NO: 1 , 4, 6, 8, 9, 11 , or 13 or to a fragment thereof.
- the biological activity is fatty acid decarboxylase activity.
- the nucleotide sequence hybridizes to a complement of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13 or to a fragment thereof under low stringency, medium stringency, high stringency, or very high stringency conditions.
- the polynucleotide comprises a sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14.
- a polynucleotide described herein is isolated from a bacterium, plant, insect, yeast, fungus, or mammal.
- the polynucleotide is isolated from a bacterium, for example, a Gram positive or Gram negative bacterium.
- the bacterium is a member of the genus Jeotgalicoccus, Corynebacterium, Kokuria, Methylobacterium, or Bacillus.
- the bacterium is selected from the group consisting of Jeotgalicoccus halotolerans, Jeotgalicoccus psychrophilus, Jeotgalicoccus sp. ATCC 8456, Jeotgalicoccus pinnipedalis, Corynebacterium efficiens, Kokuria rhizophila, Methylobacterium populi, and Bacillus subtilis.
- the isolated polynucleotide includes an operably linked promoter.
- the invention features an isolated polypeptide that includes the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14, or a biologically active fragment thereof.
- the polypeptide consists of the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 or a biologically active fragment thereof.
- the fragment is at least about 25 amino acids in length, for example, at least about 30, at least about 40, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, or at least about 250 amino acids in length.
- the fragment has fatty acid decarboxylase activity.
- the invention features an isolated polypeptide that includes the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more amino acid substitutions, additions, insertions, or deletions.
- the polypeptide includes the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more conservative amino acid substitutions.
- the polypeptide includes one or more of the following conservative amino acid substitutions: replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid; replacement of a serine with a threonine; replacement of a threonine with a serine; replacement of an acidic residue, such as aspartic acid and glutamic acid, with another acidic residue; replacement of a residue bearing an amide group, such as asparagine and glutamine, with another residue bearing an amide group; exchange of a basic residue, such as lysine and arginine, with another basic residue; and replacement of an aromatic residue, such as phenylalanine and tyrosine, with another aromatic residue.
- conservative amino acid substitutions replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid
- the polypeptide has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more amino acid substitutions, additions, insertions, or deletions.
- the isolated polypeptide has fatty acid decarboxylase activity.
- the invention features an isolated polypeptide that includes the amino acid sequence F-X-X-E-[VI]-[RK]-R-X- Y-P-F- ⁇ F ⁇ -P-X-[LIV], where X is any amino acid and ⁇ F ⁇ stands for any amino acid except Phe; and wherein the polypeptide has fatty acid decarboxylase activity.
- the invention features an isolated polypeptide that includes the amino acid sequence P-X(6)-[LI]-X(4)- ⁇ G ⁇ -[VI]-[HQM]-X- [MLV]-D-G-X(2)-H-X(2)-R-K, where X is any amino acid and ⁇ G ⁇ stands for any amino acid except GIy; and wherein the polypeptide has fatty acid decarboxylase activity.
- the invention features an isolated polypeptide that includes the amino acid sequence [AC]-[AG]-[IV]-[DE]-[IL]-X-N-X(2)-R-P-X-[VI]-A-X(3)-[FY]-X(2)-F-X(3)- A-[LMV]-X-[DE] where X is any amino acid; and wherein the polypeptide has fatty acid decarboxylase activity.
- the invention features an isolated polypeptide that includes the amino acid sequence ⁇ RK ⁇ -X(6)-[LMV]-X(4)-[AC]-[AG]-[IV]-[DE]-[IL]- X-N-X(2)-R-P-X-[VI]-A-X(3)-[FY]-X(2)-F-X(3)-A-[LMV]-X-[DE] where X is any amino acid and ⁇ RK ⁇ stands for any amino acid except Arg and Lys; and wherein the polypeptide has fatty acid decarboxylase activity.
- the invention features a recombinant vector that includes a polynucleotide described herein.
- the vector is a plasmid.
- the vector further includes a promoter operably linked to the polynucleotide, for example, a developmentally-regulated, an organelle-specific, a tissue-specific, an inducible, a constitutive, or a cell-specific promoter.
- the vector includes at least one sequence selected from the group consisting of: (a) a regulatory sequence operatively coupled to the polynucleotide; (b) a selection marker operatively coupled to the polynucleotide; (c) a marker sequence operatively coupled to the polynucleotide; (d) a purification moiety operatively coupled to the polynucleotide; (e) a secretion sequence operatively coupled to the polynucleotide; and (f) a targeting sequence operatively coupled to the polynucleotide.
- the invention features a host cell comprising a recombinant vector described herein, for example, a recombinant vector that includes a polynucleotide sequence described herein.
- the host cell expresses a polypeptide encoded by the recombinant vector, for example, encoded by a polynucleotide sequence included in the recombinant vector.
- the polynucleotide sequence is stably incorporated into the genomic DNA of the host cell.
- the expression of the polynucleotide sequence is under the control of a regulated promoter region.
- the host cell is a mammalian cell, plant cell, insect cell, yeast cell, fungus cell, a filamentous fungi cell, or bacterial cell.
- the host cell is a Gram positive bacterial cell. In other embodiments, the host cell is a Gram negative bacterial host cell.
- the host cell is from a member of the genus Escherichia
- Bacillus Lactobacillus, Rhodococcus, Pseudomonas, Aspergillus, Trichoderma, Neurospora,
- Stenotrophomonas Schizosaccharomyces, Yarrowia, or Streptomyces.
- the host cell is a Bacillus lentus cell, a Bacillus brevis cell, a Bacillus stearothermophilus cell, a Bacillus licheniformis cell, a Bacillus alkalophilus cell, a
- Bacillus coagulans cell a Bacillus circulans cell, a Bacillus pumilis cell, a Bacillus thuringiensis cell, a Bacillus clausii cell, a Bacillus megaterium cell, a Bacillus subtilis cell, or a Bacillus amyloliquefaciens cell.
- the host cell is a Trichoderma koningii cell, a Trichoderma viride cell, a Trichoderma reesei cell, a Trichoderma longibrachiatum cell, an Aspergillus awamori cell, an Aspergillus fumigates cell, an Aspergillus foetidus cell, an Aspergillus nidulans cell, an Aspergillus niger cell, an Aspergillus oryzae cell, a Humicola insolens cell, a Humicola lanuginose cell, a Rhodococcus opacus cell, a Rhizomucor miehei cell, or a Mucor michei cell.
- the host cell is a Streptomyces lividans cell or a Streptomyces murinus cell. In other embodiments, the host cell is an Actinomycetes cell. [0042] In some embodiments, the host cell is a CHO cell, a COS cell, a VERO cell, a BHK cell, a HeLa cell, a CvI cell, an MDCK cell, a 293 cell, a 3T3 cell, or a PC12 cell. [0043] In particular embodiments, the host cell is an E. coli cell, such as a strain B, a strain C, a strain K, or a strain W E. coli cell.
- the host cell produces an olefin, for example, a terminal olefin.
- the olefin is secreted by the host cell.
- the host cell expresses a reduced level of an acyl-CoA synthase relative to a corresponding wild type host cell.
- a gene encoding an acyl-CoA synthase is attenuated or deleted in the host cell.
- the gene is fadDJadK, BH3103, yhfL, Pfl-4354, EAVl 5023, fadDl,fadD2, RPC_4074,fadDD35, fadDD22,faalp,faa3p, lcfA, or the gene encoding the protein having the amino acid sequence Accession No. ZP O 1644857.
- the gene is fadD.
- the invention features a genetically engineered microorganism comprising an exogenous control sequence stably incorporated into the genomic DNA of the microorganism.
- the control sequence is integrated upstream of a polynucleotide comprising a nucleotide sequence having at least about 70% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
- the nucleotide sequence has at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
- the nucleotide sequence is SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
- the polynucleotide is endogenous to the microorganism.
- the microorganism expresses an increased level of a polypeptide encoded by the polynucleotide relative to a wild-type microorganism.
- the microorganism produces an increased level of an olefin relative to a wild-type microorganism.
- the microorganism is a bacterium, such as a Jeotgalicoccus bacterium.
- the microorganism expresses a reduced level of an acyl-CoA synthase relative to a corresponding wild type microorganism.
- a gene encoding an acyl-CoA synthase is attenuated or deleted in the microorganism.
- the gene is fadDJadK, BH3103,yhfL, Pfl-4354, EAV15023,fadDl,fadD2, RPC_4074,fadDD35,fadDD22,faalp,faa3p, lcfA, or the gene encoding the protein having the amino acid sequence Accession No. ZP O 1644857.
- the gene isfadD.
- the invention features a polypeptide produced by a host cell described herein.
- the invention features a method of producing an olefin.
- the method comprises culturing a host cell described herein, for example, a host cell comprising a nucleotide sequence described herein, under conditions sufficient to allow expression of a polypeptide encoded by the nucleotide sequence.
- the nucleotide sequence has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
- the nucleotide sequence is SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
- the nucleotide sequence hybridizes to a complement of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13 or to a fragment thereof, for example, under low stringency, medium stringency, high stringency, or very high stringency conditions.
- the nucleotide sequence encodes a polypeptide comprising: (i) the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14; or (ii) the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more amino acid substitutions, additions, insertions, or deletions.
- the polypeptide comprises the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more conservative amino acid substitutions.
- the polypeptide comprises one or more of the following conservative amino acid substitutions: replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid; replacement of a serine with a threonine; replacement of a threonine with a serine; replacement of an acidic residue, such as aspartic acid and glutamic acid, with another acidic residue; replacement of a residue bearing an amide group, such as asparagine and glutamine, with another residue bearing an amide group; exchange of a basic residue, such as lysine and arginine, with another basic residue; and replacement of an aromatic residue, such as phenylalanine and tyrosine, with another aromatic residue.
- the polypeptide has about 1,
- the polypeptide has fatty acid decarboxylase activity.
- the nucleotide sequence encodes a polypeptide having the same biological activity as a polypeptide comprising the amino acid sequence of SEQ ID NO: 1
- nucleotide sequence is SEQ ID NO:1, 4,
- the nucleotide sequence hybridizes to a complement of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13 or to a fragment thereof, for example, under low stringency, medium stringency, high stringency, or very high stringency conditions.
- the biological activity is fatty acid decarboxylase activity.
- the nucleotide sequence encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14.
- the host cell is selected from the group consisting of a mammalian cell, plant cell, insect cell, yeast cell, fungus cell, filamentous fungi cell, and bacterial cell.
- the host cell is a Gram positive bacterial cell. In other embodiments, the host cell is a Gram negative bacterial cell.
- the host cell is selected from the genus Escherichia, Bacillus,
- Lactobacillus Rhodococcus, Pseudomonas, Aspergillus, Trichoderma, Neurospora,
- the host cell is a Bacillus lentus cell, a Bacillus brevis cell, a Bacillus stearothermophilus cell, a Bacillus licheniformis cell, a Bacillus alkalophilus cell, a
- Bacillus coagulans cell a Bacillus circulans cell, a Bacillus pumilis cell, a Bacillus thuringiensis cell, a Bacillus clausii cell, a Bacillus megaterium cell, a Bacillus subtilis cell, or a Bacillus amyloliquefaciens cell.
- the host cell is a Trichoderma koningii cell, a Trichoderma viride cell, a Trichoderma reesei cell, a Trichoderma longibrachiatum cell, an Aspergillus awamori cell, an Aspergillus fumigates cell, an Aspergillus foetidus cell, an Aspergillus nidulans cell, an Aspergillus niger cell, an Aspergillus oryzae cell, a Humicola insolens cell, a
- Humicola lanuginose cell a Rhodococcus opacus cell, a Rhizomucor miehei cell, or a Mucor michei cell.
- the host cell is a Streptomyces lividans cell or a
- Streptomyces murinus cell In other embodiments, the host cell is an Actinomycetes cell.
- the host cell is a CHO cell, a COS cell, a VERO cell, a BHK cell, a HeLa cell, a CvI cell, an MDCK cell, a 293 cell, a 3T3 cell, or a PC12 cell.
- the host cell is an E. coli cell, such as a strain B, a strain C, a strain K, or a strain W E. coli cell.
- the olefin is a terminal olefin.
- the terminal olefin is a C 3 -C 25 terminal olefin.
- the terminal olefin is a C 3 , C 4 , C 5 ,
- the terminal olefin is nonadecene, methylnonadecene, heptadecene, methylheptadecene, or pentadecene.
- the terminal olefin is an unsaturated terminal olefin or a monounsaturated terminal olefin. In yet other embodiments, the terminal olefin is a straight chain terminal olefin, a branched chain terminal olefin, or a terminal olefin that includes a cyclic moiety.
- the host cell overexpresses a fatty acid substrate.
- the method further includes transforming the host cell with a nucleic acid that encodes a fatty acid enzyme (e.g., a fatty acid enzyme described herein) and the host cell overexpresses a fatty acid substrate.
- the method further includes culturing the host cell in the presence of at least one fatty acid substrate.
- the fatty acid substrate is a C 6 -C 26 fatty acid substrate.
- the fatty acid substrate is a C 6 , C 7 , C 8 , C 9 , Ci 0 , Cn, C 12 , C 13 , C 14 , Ci 5 , C 16 , Ci 7 , Ci 8 ,
- the fatty acid substrate is methyl eicosanoic acid, eicosanoic acid, methyl octadecanoic acid, stearic acid, or palmitic acid.
- the fatty acid substrate is an unsaturated fatty acid substrate, a monounsaturated fatty acid substrate, or a saturated fatty acid substrate.
- the fatty acid substrate is a straight chain fatty acid substrate, a branched chain fatty acid substrate, or a fatty acid substrate that includes a cyclic moiety.
- the host cell expresses a reduced level of an acyl-CoA synthase relative to a corresponding wild type host cell.
- a gene encoding an acyl-CoA synthase is attenuated or deleted in the host cell.
- the gene is fadDJadK, BH3103,yhfL, Pfl-4354, EAV15023,fadDl,fadD2, RPCJ074,fadDD35, fadDD22,faalp,faa3p, lcfA, or the gene encoding the protein having the amino acid sequence Accession No. ZP O 1644857.
- the gene is fadD.
- the method further includes isolating the olefin from the host cell or from the culture medium. In other embodiments, the method further includes cracking or refining the olefin.
- the invention features a method of making an olefin.
- the method includes contacting a biological substrate with an isolated polypeptide having the same biological activity as a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14.
- the olefin is a terminal olefin.
- the terminal olefin is a C 3 -C 25 terminal olefin.
- the terminal olefin is a C 3 , C 4 , C 5 , C 6 , C 7 , C 8 , C 9 , C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , Cj 8 , C 19 , C 20 , C 21 , C 22 , C 23 , C 24 , or C 25 terminal olefin.
- the terminal olefin is nonadecene, methylnonadecene, heptadecene, methylheptadecene, or pentadecene.
- the terminal olefin is an unsaturated terminal olefin or a monounsaturated terminal olefin. In yet other embodiments, the terminal olefin is a straight chain terminal olefin, a branched chain terminal olefin, or a terminal olefin that includes a cyclic moiety.
- the biological substrate is a fatty acid substrate.
- the fatty acid substrate is a C 6 -C 26 fatty acid substrate.
- the fatty acid substrate is a C 6 , C 7 , C 8 , C 9 , Ci 0 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , Ci 8 , Cj 9 , C 20 , C 2 i, C 22 , C 23 , C 24 , C 25 , or a C 26 fatty acid substrate.
- the fatty acid substrate is methyl eicosanoic acid, eicosanoic acid, methyl octadecanoic acid, stearic acid, or palmitic acid.
- the fatty acid substrate is an unsaturated fatty acid substrate, a monounsaturated fatty acid substrate, or a saturated fatty acid substrate.
- the fatty acid substrate is a straight chain fatty acid substrate, a branched chain fatty acid substrate, or a fatty acid substrate that includes a cyclic moiety.
- the invention features a method of making an olefin.
- the method includes contacting a biological substrate with an isolated polypeptide encoded by a nucleotide sequence described herein.
- the nucleotide sequence has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about
- nucleotide sequence is SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
- nucleotide sequence hybridizes to a complement of SEQ ID NO:
- the olefin is a terminal olefin.
- the terminal olefin is a C 3 -C 25 terminal olefin.
- the terminal olefin is a C 3 , C 4 , C 5 ,
- the terminal olefin is nonadecene, methylnonadecene, heptadecene, methylheptadecene, or pentadecene.
- the terminal olefin is an unsaturated terminal olefin or a monounsaturated terminal olefin. In yet other embodiments, the terminal olefin is a straight chain terminal olefin, a branched chain terminal olefin, or a terminal olefin that includes a cyclic moiety.
- the biological substrate is a fatty acid substrate.
- the fatty acid substrate is a C 6 -C 26 fatty acid substrate.
- the fatty acid substrate is a C 6 , C 7 , C 8 , C 9 , Ci 0 , C n , C 12 , C 13 , C 14 , C 15 , Cj 6 , Cn, C 18 , C 19 , C 20 , C21, C 22 ,
- the fatty acid substrate is methyl eicosanoic acid, eicosanoic acid, methyl octadecanoic acid, stearic acid, or palmitic acid.
- the fatty acid substrate is an unsaturated fatty acid substrate, a monounsaturated fatty acid substrate, or a saturated fatty acid substrate.
- the fatty acid substrate is a straight chain fatty acid substrate, a branched chain fatty acid substrate, or a fatty acid substrate that includes a cyclic moiety.
- the invention features a method of making an olefin. The method includes contacting a biological substrate with an isolated polypeptide described herein.
- the polypeptide includes the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 or a biologically active fragment thereof.
- the polypeptide consists of the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 or a biologically active fragment thereof.
- the fragment is at least about 25 amino acids in length, for example, at least about 30, at least about 40, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, or at least about 250 amino acids in length.
- the fragment has fatty acid decarboxylase activity.
- the polypeptide includes the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more amino acid substitutions, additions, insertions, or deletions. In some embodiments, the polypeptide includes the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more conservative amino acid substitutions.
- the polypeptide includes one or more of the following conservative amino acid substitutions: replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid; replacement of a serine with a threonine; replacement of a threonine with a serine; replacement of an acidic residue, such as aspartic acid and glutamic acid, with another acidic residue; replacement of a residue bearing an amide group, such as asparagine and glutamine, with another residue bearing an amide group; exchange of a basic residue, such as lysine and arginine, with another basic residue; and replacement of an aromatic residue, such as phenylalanine and tyrosine, with another aromatic residue.
- conservative amino acid substitutions replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid
- the polypeptide has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more amino acid substitutions, additions, insertions, or deletions.
- the isolated polypeptide has fatty acid decarboxylase activity.
- the polypeptide includes the amino acid sequence F-X-X-E- [VI]-[RK]-R-X-Y-P-F-(F)-P-X-[LIV]; and wherein the polypeptide has fatty acid decarboxylase activity.
- the polypeptide includes the amino acid sequence P-X(6)-[LI]-X(4)- ⁇ G ⁇ -[VI]-[HQM]-X-[MLV]-D-G-X(2)-H-X(2)-R-K; and wherein the polypeptide has fatty acid decarboxylase activity.
- the polypeptide includes the amino acid sequence [AC]-[AG]-[IV]-[DE]-[IL]-X-N-X(Z)-R-P-X-
- polypeptide includes the amino acid sequence ⁇ RK ⁇ -X(6)-[LMV]-X(4)-[AC]-[AG]-[IV]-[DE]-[IL]-X-N-X(2)-R-P-X-[VI]-A-
- X is any amino acid
- [AB] is A or
- ⁇ A ⁇ is any amino acid except A (e.g., ⁇ F ⁇ stands for any amino acid except Phe), X is any amino acid, and X(n) is X repeated n times (e.g., X(4) is X-
- the olefin is a terminal olefin.
- the terminal olefin is a C 3 -C 25 terminal olefin.
- the terminal olefin is a C 3 , C 4 , C 5 ,
- the terminal olefin is nonadecene, methylnonadecene, heptadecene, methylheptadecene, or pentadecene.
- the terminal olefin is an unsaturated terminal olefin or a monounsaturated terminal olefin. In yet other embodiments, the terminal olefin is a straight chain terminal olefin, a branched chain terminal olefin, or a terminal olefin that includes a cyclic
- the biological substrate is a fatty acid substrate.
- the fatty acid substrate is a C 6 -C 26 fatty acid substrate.
- the fatty acid substrate is a C 6 , C 7 , C 8 , C 9 , do, Cn, C 12 , C 13 , C 14 , Cj 5 , C 16 , C 17 , Cj 8 , Cj 9 , C 20 , C 2 i, C 22 ,
- the fatty acid substrate is methyl eicosanoic acid, eicosanoic acid, methyl octadecanoic acid, stearic acid, or palmitic acid.
- the fatty acid substrate is an unsaturated fatty acid substrate, a monounsaturated fatty acid substrate, or a saturated fatty acid substrate.
- the fatty acid substrate is a straight chain fatty acid substrate, a branched chain fatty acid substrate, or a fatty acid substrate that includes a cyclic moiety.
- the invention features an olefin produced by any of the methods described herein.
- the olefin has a ⁇ 1 C of about -15.4 or greater.
- the olefin has a 6 13 C of about -15.4 to about -10.9, for example, about -13.92 to about -13.84.
- the olefin has an f M 14 C of at least about 1.003.
- the olefin has an f M 14 C of at least about 1.01 or at least about 1.5.
- the olefin has an f M 14 C of about 1.111 to about 1.124.
- the invention features a biofuel that includes an olefin produced by any of the methods described herein.
- the olefin has a 6 13 C of about -15.4 or greater.
- the olefin has a 5 13 C of about -15.4 to about -10.9, for example, about -13.92 to about -13.84.
- the olefin has an f M 14 C of at least about 1.003.
- the olefin has an f M 14 C of at least about 1.01 or at least about 1.5.
- the olefin has an fvi ' 4 C of about 1.111 to about 1.124.
- the biofuel is a biodiesel, gasoline, or jet fuel.
- accession numbers referenced herein are derived from the NCBI database (National Center for Biotechnology Information) maintained by the National Institute of Health, U.S.A. The accession numbers are as provided in the database as of August 28, 2008.
- NC-IUBMB Nomenclature Committee of the International Union of Biochemistry and Molecular Biology
- the EC numbers referenced herein are derived from the KEGG Ligand database, maintained by the Kyoto Encyclopedia of Genes and Genomics, sponsored in part by the University of Tokyo. The EC numbers are as provided in the database as of March, 2008.
- a polypeptide can be attenuated by modifying the polypeptide to reduce its activity (e.g., by modifying a nucleotide sequence that encodes the polypeptide).
- biodiesel means a biofuel that can be a substitute of diesel, which is derived from petroleum. Biodiesel can be used in internal combustion diesel engines in either a pure form, which is referred to as "neat” biodiesel, or as a mixture in any concentration with petroleum-based diesel. Biodiesel can include esters or hydrocarbons, such as olefins (e.g., terminal olefins).
- biofuel refers to any fuel derived from biomass.
- Biofuels can be substituted for petroleum based fuels.
- biofuels are inclusive of transportation fuels (e.g., gasoline, diesel, jet fuel, etc.), heating fuels, and electricity- generating fuels.
- transportation fuels e.g., gasoline, diesel, jet fuel, etc.
- heating fuels e.g., heating fuels
- electricity- generating fuels e.g., electricity- generating fuels.
- Biofuels are a renewable energy source.
- biomass refers to a carbon source derived from biological material. Biomass can be converted into a biofuel.
- One exemplary source of biomass is plant matter. For example, corn, sugar cane, or switchgrass can be used as biomass.
- Another non- limiting example of biomass is animal matter, for example cow manure.
- Biomass also includes waste products from industry, agriculture, forestry, and households. Examples of such waste products that can be used as biomass are fermentation waste, straw, lumber, sewage, garbage, and food leftovers.
- Biomass also includes sources of carbon, such as carbohydrates (e.g., monosaccharides, disaccharides, or polysaccharides).
- carbon source refers to a substrate or compound suitable to be used as a source of carbon for prokaryotic or simple eukaryotic cell growth.
- Carbon sources can be in various forms, including, but not limited to polymers, carbohydrates, acids, alcohols, aldehydes, ketones, amino acids, peptides, and gases (e.g., CO and CO 2 ).
- the carbon source can also be a product of photosynthesis, including, but not limited to, glucose.
- a preferred carbon source is biomass.
- Another preferred carbon source is glucose.
- a “cloud point lowering additive” is an additive added to a composition to decrease or lower the cloud point of a solution.
- cloud point of a fluid means the temperature at which dissolved solids are no longer completely soluble. Below this temperature, solids begin precipitating as a second phase giving the fluid a cloudy appearance.
- cloud point refers to the temperature below which a solidified material or other heavy hydrocarbon crystallizes in a crude oil, refined oil, or fuel to form a cloudy appearance.
- the presence of solidified materials influences the flowing behavior of the fluid, the tendency of the fluid to clog fuel filters, injectors, etc., the accumulation of solidified materials on cold surfaces ⁇ e.g., a pipeline or heat exchanger fouling), and the emulsion characteristics of the fluid with water.
- a nucleotide sequence is "complementary" to another nucleotide sequence if each of the bases of the two sequences matches (i.e., is capable of forming Watson Crick base pairs).
- the term "complementary strand” is used herein interchangeably with the term “complement”.
- the complement of a nucleic acid strand can be the complement of a coding strand or the complement of a non-coding strand.
- condition sufficient to allow expression means any conditions that allow a host cell to produce a desired product, such as a polypeptide or olefin described herein. Suitable conditions include, for example, fermentation conditions. Fermentation conditions can comprise many parameters, such as temperature ranges, levels of aeration, and media composition. Each of these conditions, individually and in combination, allows the host cell to grow. Exemplary culture media include broths or gels. Generally, the medium includes a carbon source, such as glucose, fructose, cellulose, or the like, that can be metabolized by a host cell directly. In addition, enzymes can be used in the medium to facilitate the mobilization (e.g., the depolymerization of starch or cellulose to fermentable sugars) and subsequent metabolism of the carbon source.
- a carbon source such as glucose, fructose, cellulose, or the like
- enzymes can be used in the medium to facilitate the mobilization (e.g., the depolymerization of starch or cellulose to fermentable sugars) and subsequent metabolism
- a host cell can be cultured, for example, for about 4, 8, 12, 24, 36, or 48 hours. During and/or after culturing, samples can be obtained and analyzed to determine if the conditions allow expression. For example, the host cells in the sample or the medium in which the host cells were grown can be tested for the presence of a desired product. When testing for the presence of a product, assays, such as, but not limited to, TLC, HPLC, GC/FID, GC/MS, LC/MS, MS, can be used.
- polypeptides described herein may have additional conservative or non-essential amino acid substitutions, which do not have a substantial effect on the polypeptide functions. Whether or not a particular substitution will be tolerated (i.e., will not adversely affect desired biological properties, such as decarboxylase activity) can be determined as described in Bowie et al. Science (1990) 247:1306 1310.
- a "conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
- amino acids with basic side chains e.g., lysine, arginine, histidine
- acidic side chains e.g., aspartic acid, glutamic acid
- uncharged polar side chains e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine
- nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
- beta-branched side chains e.g., threonine, valine, isoleucine
- aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine
- control element means a transcriptional control element.
- Control elements include promoters and enhancers.
- promoter element refers to a DNA sequence that functions as a switch that activates the expression of a gene. If the gene is activated, it is said to be transcribed or participating in transcription. Transcription involves the synthesis of mRNA from the gene. A promoter, therefore, serves as a transcriptional regulatory element and also provides a site for initiation of transcription of the gene into mRNA. Control elements interact specifically with cellular proteins involved in transcription (Maniatis et al, Science 236:1237, 1987).
- fatty acid means a carboxylic acid having the formula RCOOH.
- R represents an aliphatic group, preferably an alkyl group.
- R can comprise between about 4 and about 22 carbon atoms.
- Fatty acids can be saturated, monounsaturated, or polyunsaturated.
- the fatty acid is made from a fatty acid biosynthetic pathway.
- fatty acid biosynthetic pathway means a biosynthetic pathway that produces fatty acids.
- the fatty acid biosynthetic pathway includes fatty acid enzymes that can be engineered, as described herein, to produce fatty acids, and in some embodiments can be expressed with additional enzymes to produce fatty acids having desired carbon chain characteristics.
- fatty acid enzyme means any enzyme involved in fatty acid biosynthesis. Fatty acid enzymes can be expressed or overexpressed in host cells to produce fatty acids. Non-limiting examples of fatty acid enzymes include fatty acid synthases and thioesterases.
- the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes).
- the length of a reference sequence that is aligned for comparison purposes is at least about 30%, preferably at least about 40%, more preferably at least about 50%, even more preferably at least about 60%, and even more preferably at least about 70%, at least about 80%, at least about 90%, or about 100% of the length of the reference sequence.
- amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared.
- a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein, amino acid or nucleic acid "identity” is equivalent to amino acid or nucleic acid "homology”).
- the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
- the comparison of sequences and determination of percent homology between two sequences can be accomplished using a mathematical algorithm.
- the percent homology between two amino acid sequences is determined using the Needleman and Wunsch (1970), J. MoI. Biol. 48:444 453, algorithm that has been incorporated into the GAP program in the GCG software package, using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
- the percent homology between two nucleotide sequences is determined using the GAP program in the GCG software package, using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6.
- a particularly preferred set of parameters are a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
- a "host cell” is a cell used to produce a product described herein (e.g., an olefin described herein).
- a host cell can be modified to express or overexpress selected genes or to have attenuated expression of selected genes.
- Non-limiting examples of host cells include plant, animal, human, bacteria, yeast, or filamentous fungi cells.
- hybridizes under low stringency, medium stringency, high stringency, or very high stringency conditions describes conditions for hybridization and washing.
- Guidance for performing hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N. Y. (1989), 6.3.1 - 6.3.6. Aqueous and nonaqueous methods are described in that reference and either method can be used.
- Specific hybridization conditions referred to herein are as follows: 1) low stringency hybridization conditions in 6X sodium chloride/sodium citrate (SSC) at about 45 0 C, followed by two washes in 0.2X SSC, 0.1% SDS at least at 5O 0 C (the temperature of the washes can be increased to 55 0 C for low stringency conditions); 2) medium stringency hybridization conditions in 6X SSC at about 45 0 C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 6O 0 C; 3) high stringency hybridization conditions in 6X SSC at about 45°C, followed by one or more washes in 0.2.X SSC, 0.1% SDS at 65 0 C; and preferably 4) very high stringency hybridization conditions are 0.5M sodium phosphate, 7% SDS at 65 0 C, followed by one or more washes at 0.2X SSC, 1% SDS at 65 0 C.
- isolated refers to molecules separated from other DNAs or RNAs, respectively, that are present in the natural source of the nucleic acid.
- isolated nucleic acid refers to include nucleic acid fragments, which are not naturally occurring as fragments and would not be found in the natural state.
- isolated is also used herein to refer to polypeptides, which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides.
- isolated as used herein also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques.
- isolated as used herein also refers to a nucleic acid or peptide that is substantially free of chemical precursors or other chemicals when chemically synthesized.
- the "level of expression of a gene in a cell” refers to the level of mRNA, pre-mRNA nascent transcript(s), transcript processing intermediates, mature mRNA(s), and degradation products encoded by the gene in the cell.
- microorganism means prokaryotic and eukaryotic microbial species from the domains Archaea, Bacteria and Eucarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista.
- microbial cells i.e., cells from microbes
- microbes are used interchangeably and refer to cells or small organisms that can only be seen with the aid of a microscope.
- nucleic acid refers to polynucleotides, such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA).
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- the term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides, ESTs, chromosomes, cDNAs, mRNAs, and rRNAs.
- operably linked means that selected nucleotide sequence (e.g., encoding a polypeptide described herein) is in proximity with a promoter to allow the promoter to regulate expression of the selected DNA.
- the promoter is located upstream of the selected nucleotide sequence in terms of the direction of transcription and translation.
- operably linked is meant that a nucleotide sequence and a regulatory sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence(s).
- overexpress means to express or cause to be expressed a nucleic acid, polypeptide, or hydrocarbon in a cell at a greater concentration than is normally expressed in a corresponding wild-type cell.
- a polypeptide can be "overexpressed” in a recombinant host cell when the polypeptide is present in a greater concentration in the recombinant host cell compared to its concentration in a non- recombinant host cell of the same species.
- partition coefficient is defined as the equilibrium concentration of a compound in an organic phase divided by the concentration at equilibrium in an aqueous phase (e.g. , fermentation broth).
- the organic phase is formed by the olefin during the production process.
- an organic phase can be provided, such as by providing a layer of octane, to facilitate product separation.
- the partition characteristics of a compound can be described as logP. For example, a compound with a logP of 1 would partition 10:1 to the organic phase. A compound with a logP of -1 would partition 1 : 10 to the organic phase.
- the term “purify,” “purified,” or “purification” means the removal or isolation of a molecule from its environment by, for example, isolation or separation.
- “Substantially purified” molecules are at least about 60% free, preferably at least about 75% free, and more preferably at least about 90% free from other components with which they are associated.
- these terms also refer to the removal of contaminants from a sample.
- the removal of contaminants can result in an increase in the percentage of olefins in a sample.
- the olefins can be purified by the removal of host cell proteins. After purification, the percentage of olefins in the sample is increased.
- a purified olefin when olefins are produced in host cells, a purified olefin is one that is substantially separated from other cellular components (e.g., nucleic acids, polypeptides, lipids, carbohydrates, or other hydrocarbons).
- a purified olefin preparation is one in which the olefin is substantially free from contaminants, such as those that might be present following fermentation.
- an olefin is purified when at least about 50% by weight of a sample is composed of the olefin.
- an olefin is purified when at least about 60%, 70%, 80%, 85%, 90%, 92%, 95%, 98%, or 99% or more by weight of a sample is composed of the olefin.
- recombinant polypeptide refers to a polypeptide that is produced by recombinant DNA techniques, wherein generally DNA encoding the expressed protein or RNA is inserted into a suitable expression vector and that is in turn used to transform a host cell to produce the polypeptide or RNA.
- the term “substantially identical” is used to refer to a first amino acid or nucleotide sequence that contains a sufficient number of identical or equivalent (e.g., with a similar side chain, e.g., conserved amino acid substitutions) amino acid residues or nucleotides to a second amino acid or nucleotide sequence such that the first and second amino acid or nucleotide sequences have similar activities.
- transfection means the introduction of a nucleic acid (e.g., via an expression vector) into a recipient cell by nucleic acid-mediated gene transfer.
- transformation refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA. This may result in the transformed cell expressing a recombinant form of an RNA or polypeptide. In the case of antisense expression from the transferred gene, the expression of a naturally-occurring form of the polypeptide is disrupted.
- a "transport protein” is a polypeptide that facilitates the movement of one or more compounds in and/or out of a cellular organelle and/or a cell.
- a "variant" of polypeptide X refers to a polypeptide having the amino acid sequence of peptide X in which one or more amino acid residues is altered. The variant may have conservative changes or nonconservative changes. Guidance in determining which amino acid residues may be substituted, inserted, or deleted without affecting biological activity may be found using computer programs well known in the art, for example, LASERGENE software (DNASTAR).
- variants when used in the context of a polynucleotide sequence, may encompass a polynucleotide sequence related to that of a gene or the coding sequence thereof. This definition may also include, for example, "allelic,” “splice,” “species,” or “polymorphic” variants.
- a splice variant may have significant identity to a reference polynucleotide, but will generally have a greater or lesser number of polynucleotides due to alternative splicing of exons during niRNA processing.
- the corresponding polypeptide may possess additional functional domains or an absence of domains.
- Species variants are polynucleotide sequences that vary from one species to another. The resulting polypeptides generally will have significant amino acid identity relative to each other.
- a polymorphic variant is a variation in the polynucleotide sequence of a particular gene between individuals of a given species.
- vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- One type of useful vector is an episome (i.e., a nucleic acid capable of extra-chromosomal replication).
- Useful vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked.
- Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors".
- expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids," which refer generally to circular double stranded DNA loops that, in their vector form, are not bound to the chromosome.
- plasmid and vector are used interchangeably, as the plasmid is the most commonly used form of vector.
- other forms of expression vectors that serve equivalent functions and that become known in the art subsequently hereto.
- FIGS. IA, IB, 1C and ID are GC/MS traces of olefins produced by Jeotgalicoccus sp. ATCC 8456 cells, Jeotgalicoccus halotolerans DSMZ 17274 cells, Jeotgalicoccus pinnipedalis DSMZ 17030 cells, and Jeotgalicoccus psychrophilus DSMZ 19085 cells, respectively.
- FIGS. 2 A and 2B are mass spectrometry fragmentation patterns of two ⁇ -olefins produced by Jeotgalicoccus ATCC 8456 cells.
- Compound A was identified as 1-nonadecene and compound B as 18-methyl- 1-nonadecene.
- FIG. 3 is a schematic of a phylogenetic analysis of 16s rRNA of Jeotgalicoccus ATCC 8456.
- FIGS. 4A and 4B are GC/MS traces of ⁇ -olefins produced by Jeotgalicoccus sp. ATCC 8456 cells upon feeding with eisosanoic acid (FIG. 4A) or stearic acid (FIG. 4B).
- FIG. 5 is a GC/MS trace of ⁇ -olefins produced by cell free lysates of Jeotgalicoccus sp ATCC 8456 cells.
- FIG. 6 is a digital representation of an SDS-PAGE gel of final purified ⁇ -olefins- producing protein fraction from Jeotgalicoccus sp. ATCC 8456 cells.
- FIGS. 7A, 7B, and 7D-7N are or ⁇ 80 and or ⁇ 80 homolog nucleotide and amino acid sequences.
- FIG. 7C is the partial 16s rRNA sequence of Jeotgalicoccus sp. ATCC8456.
- FIG. 8 is a GC/MS trace of ⁇ -olefins produced by E. coli upon expression of Jeotgalicoccus sp. 8456_or ⁇ 80 and feeding of stearic acid.
- FIG. 9 is a schematic of a bootstrap phylogenetic analysis of 8456_or ⁇ 80 homologs using ClustalW.
- FIG. 10 is a table identifying various genes that can be expressed, overexpressed or attenuated to increase production of particular fatty acid substrates.
- FIG. 11 is a representation of a gel of PCR products from MGl 655 wild type cells, ⁇ fadDr.Cm cells, and ⁇ fadD cells.
- FIG. 12A is a GC/MS trace of ⁇ -olefins produced by MGl 655 ⁇ fadD cells transformed with empty vector.
- FIG. 12B is a GC/MS trace of ⁇ -olefins produced by MGl 655 ⁇ fadD cells transformed with Jeotgalicoccus sp. 8456_or ⁇ 80.
- FIGS. 13A, 13B, and 13C are GC/MS traces of ⁇ -olefms produced by E. coli C41 ⁇ fadE cells transformed with empty vector (FIG. 13A), Corynebacterium efflciens YS- 134 orf_CE2459 without stearic acid feeding (FIG. 13B), or with Corynebacterium efficiens YS- 134 orf_CE2459 with stearic acid feeding (FIG. 13C).
- FIGS. 14A, 14B, 14C, and 14D are GC/MS traces of ⁇ -olefms produced by E. coli C41 ⁇ fadE cells transformed with empty vector (FIG. 14A), empty vector with stearic acid feeding (FIG. 14B), Kokuria rhizopila DC2201 orf_KRH21570 without stearic acid feeding (FIG. 14C), or with Kokuria rhizopila DC2201 orf_KRH21570 with stearic acid feeding (FIG. 14D).
- FIGS. 15 A, 15B, and 15C are GC/MS traces of ⁇ -olefms produced by B. subtilis cells transformed With Jeotgalicoccus sp. ATCC%456 _or ⁇ 80 (FIG. 15A), C. efficiens YS- 134 orf_CE2459 (FIG. 15B), or empty vector (FIG. 15C).
- FIG. 16 is a set of GC/MS traces of ⁇ -olefins produced in vitro by Corynebacterium efficiens ORF_CE2459.
- FIG. 17A, 17B, and 17C are GC/MS traces of ⁇ -olefins produced in vitro by purified Kokuria rhizophila orf_KRH21570 with hexadecanoic acid as substrate (FIG. 18A), by purified Kokuria rhizophila orf_KRH21579 with no substrate (FIG. 18B), and with no enzyme (FIG. 18C).
- FIG. 18 A, 18B, and 18C are GC/MS traces of ⁇ -olefms produced in vitro by purified Methylobacterium populi orf_Mpopl292 with hexadecanoic acid as substrate (FIG. 19A), by purified Methylobacterium populi orf_Mpopl292 with no substrate (FIG. 19B), and with no enzyme (FIG. 19C).
- FIG. 19 is a set of GC/MS traces of ⁇ -olefins produced by E. coli cells transformed with Bacillus subtilis P450 ⁇ s ⁇ or empty vector.
- FIG. 20 is a graph demonstrating the specific activity of 1-pentadecene and ⁇ (2)- and ⁇ (3)-hydroxy hexadecanoic acid production for ORF880, CYP152A1, and CYP152A1 Q85H using hexadecanoic acid as a substrate
- FIG. 21 is a graph demonstrating the ratio of decarboxylation to hydroxylation specific activities for ORF880, CYP152A1, and CYP152A1 Q85H.
- FIG. 22 is a table identifying various P450 peroxygenases that can be expressed or overexpressed to produce ⁇ -olefins.
- the invention provides compositions and methods of producing olefins from fatty acid substrates, in particular, terminal olefins.
- olefins are useful as a biofuel ⁇ e.g., substitutes for gasoline, diesel, jet fuel, etc.), specialty chemicals ⁇ e.g., lubricants, fuel additive, etc.), or feedstock for further chemical conversion ⁇ e.g., fuels, polymers, plastics, textiles, solvents, adhesives, etc.).
- the invention is based on the discovery of a novel gene, or/880, which encodes an olefm-producing enzyme.
- polynucleotide sequence oforf880 and homologs of or ⁇ 80 are presented as SEQ ID NO:1, 4, 6, 8, 9, 11, or 13 in Figure 7, and the corresponding amino acid sequences are presented as SEQ ID NO:2, 5, 7, 10, 12, or 14 in Figure 7.
- olefins can be prepared using or ⁇ 80, or ⁇ 80 homologs, or variants thereof utilizing host cells or cell-free methods.
- the methods and compositions described herein include the or ⁇ 80 polynucleotide sequence (SEQ ID NO: 1) as well as or ⁇ 80 homologs depicted in Figure 7 (SEQ ID NO: 4, 6, 8, 9, 11, or 13) and polynucleotide variants thereof.
- the variants can be naturally occurring or created in vitro.
- such variants can be created using genetic engineering techniques, such as site directed mutagenesis, random chemical mutagenesis, Exonuclease III deletion procedures, and standard cloning techniques.
- such variants, fragments, analogs, or derivatives can be created using chemical synthesis or modification procedures.
- Methods of making variants are well known in the art. These include procedures in which nucleic acid sequences obtained from natural isolates are modified to generate nucleic acids that encode polypeptides having characteristics that enhance their value in industrial or laboratory applications. In such procedures, a large number of variant sequences having one or more nucleotide differences with respect to the sequence obtained from the natural isolate are generated and characterized. Typically, these nucleotide differences result in amino acid changes with respect to the polypeptides encoded by the nucleic acids from the natural isolates.
- variants can be created using error prone PCR (see, e.g., Leung et al, Technique 1 :11-15, 1989; and Caldwell et al, PCR Methods Applic. 2:28-33, 1992).
- error prone PCR PCR is performed under conditions where the copying fidelity of the DNA polymerase is low, such that a high rate of point mutations is obtained along the entire length of the PCR product.
- nucleic acids to be mutagenized ⁇ e.g., an or/880 polynucleotide sequence
- PCR primers e.g., an or/880 polynucleotide sequence
- reaction buffer MgCl 2 , MnCl 2 , Taq polymerase, and an appropriate concentration of dNTPs for achieving a high rate of point mutation along the entire length of the PCR product.
- the reaction can be performed using 20 fmoles of nucleic acid to be mutagenized (e.g., an orf880 polynucleotide sequence), 30 pmole of each PCR primer, a reaction buffer comprising 50 mM KCl, 10 mM Tris HCl (pH 8.3), and 0.01% gelatin, 7 mM MgCl 2 , 0.5 mM MnCl 2 , 5 units of Taq polymerase, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, and 1 mM dTTP.
- a reaction buffer comprising 50 mM KCl, 10 mM Tris HCl (pH 8.3), and 0.01% gelatin, 7 mM MgCl 2 , 0.5 mM MnCl 2 , 5 units of Taq polymerase, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dC
- PCR can be performed for 30 cycles of 94 0 C for 1 min, 45 0 C for 1 min, and 72°C for 1 min. However, it will be appreciated that these parameters can be varied as appropriate.
- the mutagenized nucleic acids are then cloned into an appropriate vector and the activities of the polypeptides encoded by the mutagenized nucleic acids are evaluated.
- Variants can also be created using oligonucleotide directed mutagenesis to generate site-specific mutations in any cloned DNA of interest.
- Oligonucleotide mutagenesis is described in, for example, Reidhaar-Olson et al, Science 241 :53-57, 1988. Briefly, in such procedures a plurality of double stranded oligonucleotides bearing one or more mutations to be introduced into the cloned DNA are synthesized and inserted into the cloned DNA to be mutagenized (e.g., an or ⁇ 80 polynucleotide sequence). Clones containing the mutagenized DNA are recovered, and the activities of the polypeptides they encode are assessed.
- Assembly PCR involves the assembly of a PCR product from a mixture of small DNA fragments. A large number of different PCR reactions occur in parallel in the same vial, with the products of one reaction priming the products of another reaction. Assembly PCR is described in, for example, U.S. Pat. No. 5,965,408.
- Still another method of generating variants is sexual PCR mutagenesis.
- sexual PCR mutagenesis forced homologous recombination occurs between DNA molecules of different, but highly related, DNA sequence in vitro as a result of random fragmentation of the DNA molecule based on sequence homology. This is followed by fixation of the crossover by primer extension in a PCR reaction.
- Sexual PCR mutagenesis is described in, for example, Stemmer, PNAS, USA 91:10747- 10751 , 1994.
- Variants can also be created by in vivo mutagenesis.
- random mutations in a nucleic acid sequence are generated by propagating the sequence in a bacterial strain, such as an E. coli strain, which carries mutations in one or more of the DNA repair pathways.
- a bacterial strain such as an E. coli strain
- Such "mutator" strains have a higher random mutation rate than that of a wild- type strain. Propagating a DNA sequence (e.g., an or ⁇ 80 polynucleotide sequence) in one of these strains will eventually generate random mutations within the DNA.
- Mutator strains suitable for use for in vivo mutagenesis are described in, for example, PCT Publication No. WO 91/16427.
- cassette mutagenesis a small region of a double stranded DNA molecule is replaced with a synthetic oligonucleotide "cassette" that differs from the native sequence.
- the oligonucleotide often contains a completely and/or partially randomized native sequence.
- Recursive ensemble mutagenesis can also be used to generate variants.
- Recursive ensemble mutagenesis is an algorithm for protein engineering (i. e. , protein mutagenesis) developed to produce diverse populations of phenotypically related mutants whose members differ in amino acid sequence. This method uses a feedback mechanism to control successive rounds of combinatorial cassette mutagenesis. Recursive ensemble mutagenesis is described in, for example, Arkin et al, PNAS, USA 89:7811-7815, 1992.
- variants are created using exponential ensemble mutagenesis.
- Exponential ensemble mutagenesis is a process for generating combinatorial libraries with a high percentage of unique and functional mutants, wherein small groups of residues are randomized in parallel to identify, at each altered position, amino acids which lead to functional proteins.
- Exponential ensemble mutagenesis is described in, for example, Delegrave et al , Biotech. Res. 11 :1548-1552, 1993. Random and site-directed mutagenesis are described in, for example, Arnold, Curr. Opin. Biotech. 4:450-455, 1993.
- variants are created using shuffling procedures wherein portions of a plurality of nucleic acids that encode distinct polypeptides are fused together to create chimeric nucleic acid sequences that encode chimeric polypeptides as described in, for example, U.S. Pat. Nos. 5,965,408 and 5,939,250.
- Polynucleotide variants also include nucleic acid analogs.
- Nucleic acid analogs can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for example, stability, hybridization, or solubility of the nucleic acid.
- Modifications at the base moiety include deoxyuridine for deoxythymidine and 5-methyl-2'-deoxycytidine or 5-bromo- 2'-doxycytidine for deoxycytidine.
- Modifications of the sugar moiety include modification of the 2' hydroxyl of the ribose sugar to form 2'-O-methyl or 2'-O-allyl sugars.
- the deoxyribose phosphate backbone can be modified to produce morpholino nucleic acids, in which each base moiety is linked to a six-membered, morpholino ring, or peptide nucleic acids, in which the deoxyphosphate backbone is replaced by a pseudopeptide backbone and the four bases are retained.
- morpholino nucleic acids in which each base moiety is linked to a six-membered, morpholino ring, or peptide nucleic acids, in which the deoxyphosphate backbone is replaced by a pseudopeptide backbone and the four bases are retained.
- deoxyphosphate backbone can be replaced with, for example, a phosphorothioate or phosphorodithioate backbone, a phosphoroamidite, or an alkyl phosphotriester backbone.
- ORF880 amino acid sequence depicted in Figure 7, homologs of ORF880 (SEQ ID NO:5, 7, 10, 12, or 14) depicted in Figure 7, and variants thereof.
- ORF880 polypeptide variants can be variants in which one or more amino acid residues are substituted with a conserved or non- conserved amino acid residue (preferably a conserved amino acid residue). Such substituted amino acid residue may or may not be one encoded by the genetic code.
- Conservative substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of similar characteristics. Typical conservative substitutions are the following replacements: replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid; replacement of a serine with a threonine or vice versa; replacement of an acidic residue, such as aspartic acid and glutamic acid, with another acidic residue; replacement of a residue bearing an amide group, such as asparagine and glutamine, with another residue bearing an amide group; exchange of a basic residue, such as lysine and arginine, with another basic residue; and replacement of an aromatic residue, such as phenylalanine and tyrosine, with another aromatic residue.
- an aliphatic amino acid such as alanine, valine, leucine, and isoleucine
- polypeptide variants are those in which one or more amino acid residues include a substituent group. Still other polypeptide variants are those in which the polypeptide is associated with another compound, such as a compound to increase the half- life of the polypeptide (e.g., polyethylene glycol).
- a compound to increase the half- life of the polypeptide e.g., polyethylene glycol
- Additional polypeptide variants are those in which additional amino acids are fused to the polypeptide, such as a leader sequence, a secretory sequence, a proprotein sequence, or a sequence which facilitates purification, enrichment, or stabilization of the polypeptide.
- polypeptide variants retain the same biological function as ORF880 (e.g., retain decarboxylase activity) and have amino acid sequences substantially identical thereto.
- the polypeptide variants have at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more than about 95% homology to the amino acid sequence depicted in Figure 7 (SEQ ID NO:2, 5, 7, 10, 12, or 14).
- the polypeptide variants include a fragment comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof.
- polypeptide variants or fragments thereof can be obtained by isolating nucleic acids encoding them using techniques described herein or by expressing synthetic nucleic acids encoding them. Alternatively, polypeptide variants or fragments thereof can be obtained through biochemical enrichment or purification procedures. The sequence of polypeptide variants or fragments can be determined by proteolytic digestion, gel electrophoresis, and/or microsequencing. The sequence of the polypeptide variants or fragments can then be compared to the amino acid sequence depicted in Figure 7 (SEQ ID NO:2, 5, 7, 10, 12, or 14) using any of the programs described herein.
- polypeptide variants and fragments thereof can be assayed for olefin-producing activity using routine methods.
- the polypeptide variants or fragment can be contacted with a substrate (e.g., a fatty acid substrate) under conditions that allow the polypeptide variant to function.
- a decrease in the level of the substrate or an increase in the level of an olefin can be measured to determine olefin-producing activity.
- amino acid motifs can be designed by identifying conserved regions of the fatty acid decarboxylase (e.g., Jeotgalicoccus sp. 8456 or ⁇ 80). These amino acid motifs can be designed by methods well known in the art, such as bioinformatics, phylogenetic study, and/or protein alignments followed by visual inspection of the protein sequences. These amino acid motifs can then be used to identify proteins that have similar biological functions as the fatty acid decarboxylase. Several programs well known in the art can use the amino acid motifs to identify proteins that belong to the family of functional proteins. For example, one such publicly available program is http://motif.genome.jp/motif2.html.
- [AB] is A or B (e.g., [VI] is valine or isoleucine)
- ⁇ A ⁇ is any amino acid except A (e.g., ⁇ F ⁇ stands for any amino acid except Phe)
- X represents any amino acid (e.g., any naturally occurring amino acid)
- X(n) is X repeated n times (e.g.,
- X(4) is X-X-X-X).
- the invention is directed to an isolated nucleic acid encoding a polypeptide comprising a fatty acid decarboxylase amino acid motif sequence.
- the isolated nucleic acid can encode a polypeptide comprising an amino acid sequence selected from the motifs described herein.
- the isolated nucleic acid encodes a polypeptide of no more than about
- the Orf880 polypeptides described herein can also be used to produce antibodies directed against Orf880 polypeptides. Such antibodies can be used, for example, to detect the expression of an Orf880 polypeptide using methods known in the art.
- the antibody can be, e.g., a polyclonal antibody; a monoclonal antibody or antigen binding fragment thereof; a modified antibody such as a chimeric antibody, reshaped antibody, humanized antibody, or fragment thereof (e.g., Fab 1 , Fab, F(ab') 2 ); or a biosynthetic antibody, e.g., a single chain antibody, single domain antibody (DAB), Fv, single chain Fv (scFv), or the like.
- DAB single domain antibody
- scFv single chain Fv
- compositions and methods described herein can be used to produce olefins (e.g., terminal olefins) from fatty acid substrates. While not wishing to be bound by theory, it is believed that the polypeptides described herein produce olefins from fatty acid substrates via a decarboxylation mechanism. Thus, olefins having particular branching patterns, levels of saturation, and carbon chain length can be produced from fatty acid substrates having those particular characteristics. Accordingly, each step within a fatty acid biosynthetic pathway can be modified to produce or overproduce a fatty acid substrate of interest.
- olefins e.g., terminal olefins
- known genes involved in the fatty acid biosynthetic pathway can be expressed, overexpressed, or attenuated in host cells to produce a desired fatty acid substrate (see, e.g., PCT/US08/058788).
- Exemplary genes are provided in Figure 10. It is recognized, however, that the carbon chain of an olefin produced using the methods described herein will have one less carbon than the fatty acid substrate from which it was produced.
- Fatty acid synthase is a group of polypeptides that catalyze the initiation and elongation of acyl chains (Marrakchi et ah, Biochemical Society, 30:1050-1055, 2002).
- the acyl carrier protein (ACP) along with the enzymes in the FAS pathway control the length, degree of saturation, and branching of the fatty acids produced.
- the fatty acid biosynthetic pathway involves the precursors acetyl-CoA and malonyl-CoA.
- the steps in this pathway are catalyzed by enzymes of the fatty acid biosynthesis (fab) and acetyl-CoA carboxylase (ace) gene families (see, e.g., Heath et al, Prog. Lipid Res. 40(6):467-97 (2001)).
- fab fatty acid biosynthesis
- ace acetyl-CoA carboxylase
- Host cells can be engineered to express fatty acid substrates by recombinantly expressing or overexpressing acetyl-CoA and/or malonyl-CoA synthase genes.
- acetyl-CoA genes that can be expressed in a host cell: pdh, panK, aceEF (encoding the EIp dehydrogenase component and the E2p dihydrolipoamide acyltransferase component of the pyruvate and 2-oxoglutarate dehydrogenase complexes), fabH, fabD, fabG, acpP, and fabF.
- GenBank accession numbers for these genes are: pdh (BAB34380, AAC73227, AAC73226), panK (also known as coaA, AAC76952), aceEF (AAC73227, AAC73226),/ ⁇ H(AAC74175), fabD (AAC74 ⁇ 76),fabG (AAC74177), acpP ⁇ AAC74l7S),fabF (AAC74179).
- the expression levels oifadE, gpsA, idhA, pflb, adhE, pta, poxB, ackA, and/or ackB can be attenuated or knocked-out in an engineered host cell by transformation with conditionally replicative or non-replicative plasmids containing null or deletion mutations of the corresponding genes or by substituting promoter or enhancer sequences.
- GenBank accession numbers for these genes axe:fadE (AAC73325), gspA (AAC76632), IdhA ⁇ AAC7AA62), pflb (AAC73989), adhE (AAC74323 ⁇ pta (A AC7 '5357), poxB (AAC73958), ackA (AAC75356), and ackB (BAB81430).
- the resulting host cells will have increased acetyl-CoA production levels when grown in an appropriate environment.
- Malonyl-CoA overexpression can be effected by introducing accABCD ⁇ e.g., accession number AAC73296, EC 6.4.1.2) into a host cell.
- Fatty acids can be further overexpressed in host cells by introducing into the host cell a DNA sequence encoding a lipase ⁇ e.g., accession numbers CAA89087, CAA98876).
- inhibiting PIsB can lead to an increase in the levels of long chain acyl- ACP, which will inhibit early steps in the pathway ⁇ e.g., accABCD, fabH, and fabl).
- the plsB ⁇ e.g., accession number AAC77011) D31 IE mutation can be used to increase the amount of available acyl-CoA.
- a host cell can be engineered to overexpress a sfa gene (suppressor of fabA, e.g., accession number AAN79592) to increase production of monounsaturated fatty acids (Rock et al., J. Bacteriology 178:5382-5387, 1996).
- a sfa gene suppressor of fabA, e.g., accession number AAN79592
- host cells can be engineered to express, overexpress, or attenuate expression of a thioesterase to increase fatty acid substrate production.
- the chain length of a fatty acid substrate is controlled by thioesterase.
- a tes or fat gene can be overexpressed.
- Cj 0 fatty acids can be produced by attenuating thioesterase Cj 8 ⁇ e.g., accession numbers AAC73596 and POADAl), which uses C 18I i-ACP, and expressing thioesterase C 10 ⁇ e.g., accession number Q39513), which uses Qo-ACP.
- C 14 fatty acids can be produced by attenuating endogenous thioesterases that produce non-C 14 fatty acids and expressing the thioesterases, that use Cj 4 - ACP (for example, accession number Q39473).
- Cj 2 fatty acids can be produced by expressing thioesterases that use C 12 -ACP (for example, accession number Q41635) and attenuating thioesterases that produce non-C ⁇ fatty acids.
- Acetyl-CoA, malonyl-CoA, and fatty acid overproduction can be verified using methods known in the art, for example, by using radioactive precursors, HPLC, and GC-MS subsequent to cell lysis.
- radioactive precursors HPLC, and GC-MS subsequent to cell lysis.
- Non-limiting examples of thioesterases that can be used in the methods described herein are listed in Table 1.
- Olefins can be produced that contain branch points by using branched fatty acids as substrates.
- E. coli naturally produces straight chain fatty acids (sFAs)
- E. coli can be engineered to produce branched chain fatty acids (brFAs) by introducing and expressing or overexpressing genes that provide branched precursors in the E. coli (e.g., bkd, Uv, icm, and fab gene families).
- a host cell can be engineered to express or overexpress genes encoding proteins for the elongation of brFAs (e.g., ACP, FabF, etc.) and/or to delete or attenuate the corresponding host cell genes that normally lead to sFAs.
- the first step in forming brFAs is the production of the corresponding ⁇ -keto acids by a branched-chain amino acid aminotransferase.
- Host cells may endogenously include genes encoding such enzymes or such genes can be recombinantly introduced.
- E. coli for example, endogenously expresses such an enzyme, HvE (EC 2.6.1.42; GenBank accession YP_026247).
- HvE EC 2.6.1.42; GenBank accession YP_026247
- a heterologous branched-chain amino acid aminotransferase may not be expressed.
- HvE or any other branched-chain amino acid aminotransferase (e.g., HvE from Lactococcus lactis (GenBank accession AAF34406), HvE from Pseudomonas putida (GenBank accession NP_745648), or HvE from Streptomyces coelicolor (GenBank accession NP_629657)), if not endogenous, can be introduced.
- HvE from Lactococcus lactis GenBank accession AAF34406
- HvE from Pseudomonas putida GenBank accession NP_745648
- HvE from Streptomyces coelicolor GenBank accession NP_629657
- the second step is the oxidative decarboxylation of the ⁇ -ketoacids to the corresponding branched-chain acyl-CoA.
- This reaction can be catalyzed by a branched-chain ⁇ -keto acid dehydrogenase complex (bkd; EC 1.2.4.4.) (Denoya et al, J. Bacteriol. 177:3504, 1995), which consists of El ⁇ / ⁇ (decarboxylase), E2 (dihydrolipoyl transacylase), and E3 (dihydrolipoyl dehydrogenase) subunits.
- bkd branched-chain ⁇ -keto acid dehydrogenase complex
- branched-chain ⁇ -keto acid dehydrogenase complexes are similar to pyruvate and ⁇ -ketoglutarate dehydrogenase complexes.
- Any microorganism that possesses brFAs and/or grows on branched-chain amino acids can be used as a source to isolate bkd genes for expression in host cells, for example, E. coli.
- E. coli has the E3 component as part of its pyruvate dehydrogenase complex (Ipd, EC 1.8.1.4, GenBank accession NP_414658). Thus, it can be sufficient to express only the El a/ ⁇ and E2 bkd genes.
- Table 2 lists non-limiting examples of bkd genes from several microorganisms that can be recombinantly introduced and expressed in a host cell to provide branched-chain acyl-CoA precursors.
- Table 2 Bkd genes from selected microorganisms
- isobutyryl-CoA can be made in a host cell, for example in E. coli, through the coexpression of a crotonyl-CoA reductase (Ccr, EC 1.6.5.5, 1.1.1.1) and isobutyryl-CoA mutase (large subunit IcmA, EC 5.4.99.2; small subunit IcmB, EC 5.4.99.2 ) (Han and Reynolds, J Bacteriol. 179:5157, 1997).
- Crotonyl-CoA is an intermediate in fatty acid biosynthesis in E. coli and other microorganisms.
- Non-limiting examples of ccr and icm genes from selected microorganisms are listed in Table 3. Table 3: Ccr and icm genes from selected microorganisms
- FabH ⁇ -ketoacyl-acyl-carrier-protein synthase III
- FabH ⁇ -ketoacyl-acyl-carrier-protein synthase III
- Non-limiting examples of such FabH enzymes are listed in Table 4.
- fabH genes that are involved in fatty acid biosynthesis of any brFA-containing microorganism can be expressed in a host cell.
- the Bkd and FabH enzymes from host cells that do not naturally make brFA may not support brFA production. Therefore, bkd and fabH can be expressed recombinantly.
- Vectors containing the bkd and f ⁇ bH genes can be inserted into such a host cell.
- the endogenous level of Bkd and FabH production may not be sufficient to produce brFA. In this case, they can be overexpressed.
- other components of the fatty acid biosynthesis pathway can be expressed or overexpressed, such as acyl carrier proteins (ACPs) and ⁇ -ketoacyl-acyl-carrier- protein synthase II (f ⁇ bF, EC 2.3.1.41) (non-limiting examples of candidates are listed in Table 4).
- ACPs acyl carrier proteins
- f ⁇ bF ⁇ -ketoacyl-acyl-carrier- protein synthase II
- some genes in the endogenous fatty acid biosynthesis pathway can be attenuated in the host cell ⁇ e.g., the E.
- coli genes f ⁇ bH (GenBank accession # NP_415609) and/or f ⁇ bF (GenBank accession # NP_415613)).
- Table 4 FabH, ACP andfabF genes from selected microorganisms with brFAs
- Cyclic olefins can be produced by using cyclic fatty acids as substrates.
- genes that provide cyclic precursors e.g., the ans, chc, and plm gene families
- cyclic precursors e.g., the ans, chc, and plm gene families
- a host cell such as E. coli
- CHC-CoA cyclohexylcarbonyl-CoA
- ropp et al Nature Biotech. 18:980-983, 2000
- Non-limiting examples of genes that provide CHC-CoA in E. coli include: ansJ, ansK, ansL, chcA, and ansM from the ansatrienin gene cluster of Streptomyces collinus (Chen et al, Eur. J. Biochem. 261 : 98-107, 1999) or plmJ, plmK, plmL, chcA, and plmM from the phoslactomycin B gene cluster of Streptomyces sp. HK803 (Palaniappan et al., J. Biol. Chem. 278:35552-35557, 2003) together with the chcB gene (Patton et al, Biochem.
- S. collinus 39:7595-7604, 2000
- S. avermitilis 39:7595-7604, 2000
- S. coelicolor 39:7595-7604, 2000
- the genes listed in Table 4 can then be expressed to allow initiation and elongation of ⁇ -cyclic fatty acids.
- the homologous genes can be isolated from microorganisms that make cyFA and expressed in a host cell (e.g., E. coli).
- f ⁇ bH, ACP, and f ⁇ bF allow initiation and elongation of ⁇ -cyclic fatty acids because they have broad substrate specificity. If the coexpression of any of these genes with the genes listed in Table 5 does not yield cyFA, then f ⁇ bH, ACP, and/or f ⁇ bF homologs from microorganisms that make cyFAs ⁇ e.g., those listed in Table 6) can be isolated ⁇ e.g., by using degenerate PCR primers or heterologous DNA sequence probes) and coexpressed.
- Table 6 Non-limiting examples of microorganisms that contain ⁇ -cyclic fatty acids
- the degree of saturation in olefins can be controlled by regulating the degree of saturation of olefin intermediates, for example, fatty acids.
- the sfa, gns, and fab families of genes can be expressed or overexpressed to control the saturation of fatty acids.
- host cells can be engineered to produce unsaturated fatty acids by engineering the host cells to overexpress ⁇ aZ>5 or by growing the host cells at low temperatures (e.g., less than 37°C).
- FabB has preference for cis- ⁇ 3 decenoyl-ACP and results in unsaturated fatty acid production in E.
- fabB results in the production of a significant percentage of unsaturated fatty acids (de Mendoza et ah, J. Biol. Chem., 258:2098-101, ⁇ 983).
- fabB may be inserted into and expressed in host cells not naturally having the gene. These unsaturated fatty acids can then be used as substrates in host cells that are engineered to produce olefins.
- a repressor of fatty acid biosynthesis for example, fabR (GenBank accession NP_418398 ), can be deleted, which will result in increased unsaturated fatty acid production in E. coli (Zhang et a , J. Biol. Chem. 277: 15558, 2002). Similar deletions may be made in other host cells.
- a further increase in unsaturated fatty acids can be achieved, for example, by overexpressing_/aZ>M(trans-2, cis-3-decenoyl-ACP isomerase, GenBank accession DAA05501) and controlled expression of fabK (trans-2-enoyl-ACP reductase II, GenBank accession NP_357969) from Streptococcus pneumoniae (Marrakchi et ah, J. Biol. Chem. 277: 44809, 2002), while deleting E. colifabl (trans-2-enoyl-ACP reductase, GenBank accession NP_415804).
- the endogenous fabF gene can be attenuated. Thus, increasing the percentage of palmitoleate (C 16: i) produced.
- a host cell can be any prokaryotic or eukaryotic cell.
- a polypeptide described herein can be expressed in bacterial cells, such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) cells, COS cells, VERO cells, BHK cells, HeLa cells, CvI cells, MDCK cells, 293 cells, 3T3 cells, or PC12 cells).
- bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) cells, COS cells, VERO cells, BHK cells, HeLa cells, CvI cells, MDCK cells, 293 cells, 3T3 cells, or PC12 cells).
- exemplary host cells include cells from the members of the genus Escherichia, Bacillus, Lactobacillus, Rhodococcus, Pseudomonas, Aspergillus, Trichoderma, Neurospora, Fusarium, Humicola, Rhizomucor, Kluyveromyces, Pichia, Mucor, Myceliophtora, Penicillium, Phanerochaete, Pleurotus, Trametes, Chrysosporium, Saccharomyces, Schizosaccharomyces, Yarrowia, or Streptomyces.
- Yet other exemplary host cells can be a Bacillus lentus cell, a Bacillus brevis cell, a Bacillus stearothermophilus cell, a Bacillus licheniformis cell, a Bacillus alkalophilus cell, a Bacillus coagulans cell, a Bacillus circulans cell, a Bacillus pumilis cell, a Bacillus thuringiensis cell, a Bacillus clausii cell, a Bacillus megaterium cell, a Bacillus subtilis cell, a Bacillus amyloliquefaciens cell, a Trichoderma koningii cell, a Trichoderma viride cell, a Trichoderma reesei cell, a Trichoderma longibrachiatum cell, an Aspergillus awamori cell, an Aspergillus fumigates cell, an Aspergillus foetidus cell, an Aspergillus nidulans cell, an Asper
- vectors preferably expression vectors, containing a nucleic acid encoding an ORF880 polypeptide, polypeptide variant, or a fragment thereof.
- vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- vector a "plasmid,” which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated.
- viral vector Another type of vector, wherein additional DNA segments can be ligated into the viral genome.
- vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non- episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell and are thereby replicated along with the host genome. Moreover, certain vectors, such as expression vectors, are capable of directing the expression of genes to which they are operatively linked. In general, expression vectors used in recombinant DNA techniques are often in the form of plasmids. However, other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses, and adeno- associated viruses), can also be used.
- viral vectors e.g., replication defective retroviruses, adenoviruses, and adeno- associated viruses
- the recombinant expression vectors described herein include a nucleic acid described herein in a form suitable for expression of the nucleic acid in a host cell.
- the recombinant expression vectors can include one or more control sequences, selected on the basis of the host cell to be used for expression.
- the control sequence is operably linked to the nucleic acid sequence to be expressed.
- control sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990).
- Control sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g.
- tissue-specific regulatory sequences can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc.
- the expression vectors described herein can be introduced into host cells to produce polypeptides, including fusion polypeptides, encoded by the nucleic acids as described herein.
- Recombinant expression vectors can be designed for expression of an ORF880 polypeptide or variant in prokaryotic or eukaryotic cells (e.g., bacterial cells, such as E. coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells). Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example, by using T7 promoter regulatory sequences and T7 polymerase. [0206] Expression of polypeptides in prokaryotes, for example, E.
- Fusion vectors add a number of amino acids to a polypeptide encoded therein, usually to the amino terminus of the recombinant polypeptide.
- Such fusion vectors typically serve three purposes: (1) to increase expression of the recombinant polypeptide; (2) to increase the solubility of the recombinant polypeptide; and (3) to aid in the purification of the recombinant polypeptide by acting as a ligand in affinity purification.
- a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant polypeptide. This enables separation of the recombinant polypeptide from the fusion moiety after purification of the fusion polypeptide.
- enzymes include Factor Xa, thrombin, and enterokinase.
- Exemplary fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith et al, Gene (1988) 67:31-40), pMAL (New England Biolabs, Beverly, Mass.), and pRITS (Pharmacia, Piscataway, N.J.), which fuse glutathione S- transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant polypeptide.
- GST glutathione S- transferase
- maltose E binding protein or protein A, respectively
- Examples of inducible, non-fusion E. coli expression vectors include pTrc (Amann et al, Gene (1988) 69:301-315) and pET 1 Id (Studier et al, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 60-89).
- Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter.
- Target gene expression from the pET 1 Id vector relies on transcription from a T7 gnlO-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied by host strains BL21(DE3) or HMS174(DE3) from a resident ⁇ prophage harboring a T7 gnl gene under the transcriptional control of the lacUV 5 promoter.
- One strategy to maximize recombinant polypeptide expression is to express the polypeptide in a host cell with an impaired capacity to proteolytically cleave the recombinant polypeptide (see Gottesman, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 119-128).
- Another strategy is to alter the nucleic acid sequence to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in the host cell (Wada et al. , Nucleic Acids Res. ( 1992) 20:2111 -2118). Such alteration of nucleic acid sequences can be carried out by standard DNA synthesis techniques.
- the host cell is a yeast cell.
- the expression vector is a yeast expression vector.
- yeast expression vectors for expression in yeast S. cerevisiae include pYepSecl (Baldari et al, EMBO J. (1987) 6:229-234), pMFa (Kurjan et al, Cell (1982) 30:933-943), pJRY88 (Schultz et al, Gene (1987) 54:113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.), and picZ (Invitrogen Corp, San Diego, Calif).
- a polypeptide described herein can be expressed in insect cells using baculovirus expression vectors.
- Baculo virus vectors available for expression of proteins in cultured insect cells ⁇ e.g., Sf 9 cells include, for example, the pAc series (Smith et al, MoI. Cell Biol. (1983) 3:2156-2165) and the pVL series (Lucklow et ⁇ /. , Virology ⁇ 19 ⁇ 9) 170:31- 39).
- the nucleic acids described herein can be expressed in mammalian cells using a mammalian expression vector.
- mammalian expression vectors include pCDM8 (Seed, Nature (1987) 329:840) and pMT2PC (Kaufman et al, EMBOJ. (1987) 6:187-195).
- the expression vector's control functions can be provided by viral regulatory elements.
- commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40.
- Vectors can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques.
- transformation and “transfection” refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in, for example, Sambrook et al. (supra).
- a gene that encodes a selectable marker e.g., resistance to antibiotics
- selectable markers include those that confer resistance to drugs, such as ampacillin, kanamycin, chloramphenicol, or tetracycline.
- Nucleic acids encoding a selectable marker can be introduced into a host cell on the same vector as that encoding a polypeptide described herein or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
- a gene that encodes a selectable marker e.g., resistance to antibiotics
- Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin, and methotrexate.
- Nucleic acids encoding a selectable marker can be introduced into a host cell on the same vector as that encoding a polypeptide described herein or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
- an ORF880 polypeptide, polypeptide variant, or a fragment thereof is produced in a host cell that contains a naturally occurring mutation that results in an increased level of fatty acids in the host cells.
- the host cell is genetically engineered to increase the level of fatty acids in the host cell relative to a corresponding wild-type host cell.
- the host cell can be genetically engineered to express a reduced level of an acyl-CoA synthase relative to a corresponding wild-type host cell.
- the level of expression of one or more genes, e.g., an acyl-CoA synthase gene is reduced by genetically engineering a "knock out" host cell.
- Gene knockout refers to a procedure by which the gene encoding the target protein is modified or inactivated so to reduce or eliminate the function of the intact protein. Inactivation of the gene may be performed by general methods such as mutagenesis by UV irradiation or treatment with N-methyl-N'-nitro-N-nitrosoguanidine, site-directed mutagenesis, homologous recombination, insertion-deletion mutagenesis, or "Red-driven integration” (Datsenko et al., Proc. Natl. Acad. Sci. USA, 97:6640-45, 2000).
- a construct is introduced into a host cell, such that it is possible to select for homologous recombination events in the host cell.
- a knock-out construct including both positive and negative selection genes for efficiently selecting transfected cells that undergo a homologous recombination event with the construct.
- the alteration in the host cell may be obtained, e.g., by replacing through a single or double crossover recombination a wild type DNA sequence by a DNA sequence containing the alteration.
- the alteration may, e.g., be a DNA sequence encoding an antibiotic resistance marker or a gene complementing a possible auxotrophy of the host cell.
- Mutations include, but are not limited to, deletion-insertion mutations.
- An example of such an alteration includes a gene disruption, i.e., a perturbation of a gene such that the product that is normally produced from this gene is not produced in a functional form. This could be due to a complete deletion, a deletion and insertion of a selective marker, an insertion of a selective marker, a frameshift mutation, an in-frame deletion, or a point mutation that leads to premature termination.
- the entire mRNA for the gene is absent. In other situations, the amount of mRNA produced varies.
- acyl-CoA synthase gene can be reduced or knocked out in a host cell.
- Non-limiting examples of acyl-CoA synthase genes include fadD,fadK, BH3103, yitfL, Pfl- 4354, EAVl 5023, fadDl,fadD2, RPC_4074,fadDD35,fadDD22,faa3p or the gene encoding the protein ZP O 1644857.
- Specific examples of acyl-CoA synthase genes include fadDD35 from M. tuberculosis H37Rv [NP_21702 l],fadDD22 from M.
- tuberculosis H37Rv [NP_217464],/flJD from E. coli ⁇ N?_4 ⁇ 63 ⁇ 9],fadK fmm E. coli [ YP_416216], fadD from Acinetobacter sp.
- aeruginosa PAOl [NP_251989],/ ⁇ cfDi from Ralstonia solanacearum GMl 1000 [NP_520978],/ ⁇ dD2 from P. aeruginosa PAOl [NP_251990],, the gene encoding the protein ZP_01644857 from Stenotrophomonas maltophilia R.551-3, faa3p from Saccharomyces cerevisiae [NP_012257],7 ⁇ 7/> from Saccharomyces cerevisiae [NP_014962], lcfA from Bacillus subtilis [CAA99571], or those described in Shockey et al, Plant. Physiol.
- Transport proteins can export polypeptides and hydrocarbons (e.g., olefins) out of a host cell.
- hydrocarbons e.g., olefins
- Many transport and efflux proteins serve to excrete a wide variety of compounds and can be naturally modified to be selective for particular types of hydrocarbons.
- Non-limiting examples of suitable transport proteins are ATP-Binding Cassette (ABC) transport proteins, efflux proteins, and fatty acid transporter proteins (FATP). Additional non-limiting examples of suitable transport proteins include the ABC transport proteins from organisms such as Caenorhabditis elegans, Arabidopsis thalania, Alkaligenes eutrophus, and Rhodococcus erythropolis. Exemplary ABC transport proteins that can be used are listed in Figure 10 (e.g., CER5, AtMRP5, AmiS2, and AtPGPl). Host cells can also be chosen for their endogenous ability to secrete hydrocarbons.
- ABC ATP-Binding Cassette
- FATP fatty acid transporter proteins
- the efficiency of hydrocarbon production and secretion into the host cell environment can be expressed as a ratio of intracellular product to extracellular product.
- the ratio can be about 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, or 1:5.
- the production and isolation of olefins can be enhanced by employing beneficial fermentation techniques.
- One method for maximizing production while reducing costs is increasing the percentage of the carbon source that is converted to hydrocarbon products.
- UmuDC genes Genes that can be activated to stop cell replication and growth in E. coli include umuDC genes.
- the overexpression of umuDC genes stops the progression from stationary phase to exponential growth (Murli et al, J. ofBact. 182:1127, 2000).
- UmuC is a DNA polymerase that can carry out translesion synthesis over non-coding lesions - the mechanistic basis of most UV and chemical mutagenesis.
- the umuDC gene products are involved in the process of translesion synthesis and also serve as a DNA sequence damage checkpoint.
- the umuDC gene products include UmuC, UmuD, umuD', UmuD' 2 C, UmuD' 2 , and UmuD 2 .
- product-producing genes can be activated, thus minimizing the need for replication and maintenance pathways to be used while an olefin is being made.
- the percentage of input carbons converted to olefins can be a cost driver.
- the more efficient the process is i.e., the higher the percentage of input carbons converted to olefins), the less expensive the process will be.
- oxygen-containing carbon sources e.g., glucose and other carbohydrate based sources
- the oxygen must be released in the form of carbon dioxide.
- a carbon atom is also released leading to a maximal theoretical metabolic efficiency of approximately 34% (w/w) (for fatty acid derived products). This figure, however, changes for other hydrocarbon products and carbon sources. Typical efficiencies in the literature are approximately less than 5%.
- Host cells engineered to produce olefins can have greater than about 1, 3, 5, 10, 15, 20, 25, and 30% efficiency. In one example, host cells can exhibit an efficiency of about 10% to about 25%. In other examples, such host cells can exhibit an efficiency of about 25% to about 30%. In other examples, host cells can exhibit greater than 30% efficiency.
- the host cell can be additionally engineered to express recombinant cellulosomes, such as those described in PCT application number PCT/US2007/003736. These cellulosomes can allow the host cell to use cellulosic material as a carbon source.
- the host cell can be additionally engineered to express invertases (EC 3.2.1.26) so that sucrose can be used as a carbon source.
- the host cell can be engineered using the teachings described in U.S. Patent Nos. 5,000,000; 5,028,539; 5,424,202; 5,482,846; and 5,602,030; so that the host cell can assimilate carbon efficiently and use cellulosic materials as carbon sources.
- the fermentation chamber can enclose a fermentation that is undergoing a continuous reduction.
- a stable reductive environment can be created.
- the electron balance can be maintained by the release of carbon dioxide (in gaseous form).
- Efforts to augment the NAD/H and NADP/H balance can also facilitate in stabilizing the electron balance.
- the availability of intracellular NADPH can also be enhanced by engineering the host cell to express an NADH:NADPH transhydrogenase.
- the expression of one or more NADH :N ADPH transhydrogenases converts the NADH produced in glycolysis to NADPH, which can enhance the production of olefins.
- the engineered host cells can be grown in batches of, for example, around 100 mL, 500 mL, 1 L, 2 L, 5 L, or 10 L; fermented; and induced to express desired olefins based on the specific genes encoded in the appropriate plasmids.
- the engineered host cells can be grown in batches of, for example, around 100 mL, 500 mL, 1 L, 2 L, 5 L, or 10 L; fermented; and induced to express desired olefins based on the specific genes encoded in the appropriate plasmids.
- coli BL21(DE3) cells harboring pBAD24 (with ampicillin resistance and the olefin synthesis pathway) as well as pUMVCl (with kanamycin resistance and the acetyl CoA/malonyl CoA overexpression system) can be incubated overnight in 2 L flasks at 37 0 C shaken at > 200 rpm in 500 mL LB medium supplemented with 75 ⁇ g/mL ampicillin and 50 ⁇ g/mL kanamycin until cultures reach an OD 600 of > 0.8.
- the cells can be supplemented with 25 mM sodium proprionate (pH 8.0) to activate the engineered gene systems for production and to stop cellular proliferation by activating UmuC and UmuD proteins.
- Induction can be performed for 6 h at 30°C. After incubation, the media can be examined for olefins using GC-MS.
- the engineered host cells can be grown in batches of 10 L, 100 L, 1000 L ,or larger; fermented; and induced to express desired olefins based on the specific genes encoded in the appropriate plasmids.
- 10 L, 100 L, 1000 L or larger
- fermented or induced to express desired olefins based on the specific genes encoded in the appropriate plasmids.
- coli BL21(DE3) cells harboring pBAD24 (with ampicillin resistance and the olefin synthesis pathway) as well as pUMVCl (with kanamycin resistance and the acetyl-CoA/malonyl-CoA overexpression system) can be incubated from a 500 mL seed culture for 10 L fermentations (5 L for 100 L fermentations, etc.) in LB media (glycerol free) with 50 ⁇ g/mL kanamycin and 75 ⁇ g/mL ampicillin at 37°C, and shaken at > 200 rpm until cultures reach an OD 600 of > 0.8 (typically 16 h).
- Media can be continuously supplemented to maintain 25 mM sodium proprionate (pH 8.0) to activate the engineered gene systems for production and to stop cellular proliferation by activating umuC and umuD proteins.
- Media can be continuously supplemented with glucose to maintain a concentration 25 g/100 mL.
- aliquots of no more than 10% of the total cell volume can be removed each hour and allowed to sit without agitation to allow the olefins to rise to the surface and undergo a spontaneous phase separation. The olefin component can then be collected, and the aqueous phase returned to the reaction chamber.
- the reaction chamber can be operated continuously. When the OD 600 drops below 0.6, the cells can be replaced with a new batch grown from a seed culture.
- an olefin can be produced using a purified polypeptide described herein and a fatty acid substrate.
- a host cell can be engineered to express a polypeptide (e.g., an ORF880 polypeptide or variant) as described herein.
- the host cell can be cultured under conditions suitable to allow expression of the polypeptide.
- Cell free extracts can then be generated using known methods.
- the host cells can be lysed using detergents or by sonication.
- the expressed polypeptides can be purified using known methods.
- fatty acid substrates described herein can be added to the cell free extracts and maintained under conditions to allow conversion of the fatty acid substrates to olefins.
- the olefins can then be separated and purified using known techniques.
- the olefins produced during fermentation can be separated from the fermentation media. Any known technique for separating olefins from aqueous media can be used.
- One exemplary separation process is a two phase (bi-phasic) separation process. This process involves fermenting the genetically engineered host cells under conditions sufficient to produce an olefin, allowing the olefin to collect in an organic phase, and separating the organic phase from the aqueous fermentation broth. This method can be practiced in both a batch and continuous fermentation setting.
- Bi-phasic separation uses the relative immiscibility of olefins to facilitate separation. Immiscible refers to the relative inability of a compound to dissolve in water and is defined by the compound's partition coefficient.
- Immiscible refers to the relative inability of a compound to dissolve in water and is defined by the compound's partition coefficient.
- the olefins produced by the methods described herein can be relatively immiscible in the fermentation broth, as well as in the cytoplasm. Therefore, the olefin can collect in an organic phase either intracellularly or extracellularly. The collection of the products in the organic phase can lessen the impact of the olefin on cellular function and can allow the host cell to produce more product.
- the methods described herein can result in the production of homogeneous compounds wherein at least about 60%, 70%, 80%, 90%, or 95% of the olefins produced will have carbon chain lengths that vary by less than about 6 carbons, less than about 4 carbons, or less than about 2 carbons. These compounds can also be produced with a relatively uniform degree of saturation. For example, at least about 60%, 70%, 80%, 90%, or 95% of the olefins will be monounsaturated, diunsaturated, or triunsaturated.
- These compounds can be used directly as fuels, fuel additives, starting materials for production of other chemical compounds (e.g., polymers, surfactants, plastics, textiles, solvents, adhesives, etc.), or personal care additives. These compounds can also be used as feedstock for subsequent reactions, for example, hydrogenation, catalytic cracking (via hydrogenation, pyrolisis, or both), or epoxidation reactions to make other products.
- chemical compounds e.g., polymers, surfactants, plastics, textiles, solvents, adhesives, etc.
- personal care additives e.g., polymers, surfactants, plastics, textiles, solvents, adhesives, etc.
- These compounds can also be used as feedstock for subsequent reactions, for example, hydrogenation, catalytic cracking (via hydrogenation, pyrolisis, or both), or epoxidation reactions to make other products.
- the olefins produced using methods described herein can contain between about 50% and about 90% carbon; between about 5% and about 25% hydrogen; or between about 5% and about 25% oxygen. In other embodiments, the olefins produced using methods described herein can contain between about 65% and about 85% carbon; between about 10% and about 15% hydrogen; or between about 10% and about 20% oxygen.
- the olefins described herein can be used as or converted into a fuel.
- a fuel different olefins can be produced and used.
- a branched olefin may be desirable for automobile fuel that is intended to be used in cold climates.
- the characteristics of the olefin feedstock will affect the characteristics of the fuel produced.
- the characteristics of the fuel product can be selected for by producing particular olefins for use as a feedstock.
- biofuels having desired fuel qualities can be produced from olefins.
- Biologically produced olefins represent a new source of biofuels, which can be used as jet fuel, diesel, or gasoline.
- Some biofuels made using olefins have not been produced from renewable sources and are new compositions of matter.
- These new fuels can be distinguished from fuels derived from petrochemical carbon on the basis of dual carbon-isotopic fingerprinting.
- the specific source of biosourced carbon e.g., glucose vs. glycerol
- can be determined by dual carbon-isotopic fingerprinting see, e.g., U.S. Patent No. 7,169,588, in particular col. 4, line 31, to col. 6, line 8).
- Hydrocarbons comprising biologically produced hydrocarbons, particularly ⁇ -olefins biologically produced using the fatty acid biosynthetic pathway, have not been produced from renewable sources and, as such, are new compositions of matter. These new hydrocarbons can be distinguished from hydrocarbons derived from petrochemical carbon on the basis of dual carbon-isotopic fingerprinting or 14 C dating. Additionally, the specific source of biosourced carbon (e.g., glucose vs. glycerol) can be determined by dual carbon- isotopic fingerprinting (see U.S. Patent No. 7,169,588, which is herein incorporated by reference).
- biosourced carbon e.g., glucose vs. glycerol
- hydrocarbons or chemicals comprising both biologically based and petroleum based carbon isotope profiles may be distinguished from hydrocarbons and chemicals made only of petroleum based materials.
- the instant materials may be followed in commerce on the basis of their unique carbon isotope profile.
- Hydrocarbons can be distinguished from petroleum based fuels by comparing the stable carbon isotope ratio ( 13 C/ 12 C) in each fuel.
- the 13 C/ I2 C ratio in a given biologically based material is a consequence of the 13 C/ 12 C ratio in atmospheric carbon dioxide at the time the carbon dioxide is fixed. It also reflects the precise metabolic pathway. Regional variations also occur. Petroleum, C 3 plants (the broadleaf), C 4 plants (the grasses), and marine carbonates all show significant differences in 13 C/ 12 C and the corresponding 5 13 C values. Furthermore, lipid matter of C 3 and C 4 plants analyze differently than materials derived from the carbohydrate components of the same plants as a consequence of the metabolic pathway.
- 13 C shows large variations due to isotopic fractionation effects, the most significant of which for biologically produced hydrocarbons is the photosynthetic mechanism.
- the major cause of differences in the carbon isotope ratio in plants is closely associated with differences in the pathway of photosynthetic carbon metabolism in the plants, particularly the reaction occurring during the primary carboxylation (i.e., the initial fixation of atmospheric CO 2 ).
- Two large classes of vegetation are those that incorporate the "C 3 " (or Calvin-Benson) photosynthetic cycle and those that incorporate the "C 4 " (or Hatch-Slack) photosynthetic cycle.
- the primary CO 2 fixation or carboxylation reaction involves the enzyme ribulose-l,5-diphosphate carboxylase and the first stable product is a 3-carbon compound.
- C 3 plants such as hardwoods and conifers, are dominant in the temperate climate zones.
- an additional carboxylation reaction involving another enzyme, phosphoenol-pyruvate carboxylase, is the primary carboxylation reaction.
- the first stable carbon compound is a 4-carbon acid which is subsequently decarboxylated. The CO 2 thus released is refixed by the C 3 cycle.
- Examples of C 4 plants are tropical grasses, corn, and sugar cane.
- the invention provides a hydrocarbon or biofuel produced by any of the methods disclosed herein.
- the hydrocarbon or biofuel can have a 5 13 C of about -28 or greater, about -27 or greater, -20 or greater, -18 or greater, -15 or greater, -13 or greater, -10 or greater, and -8 or greater.
- the hydrocarbon can have a 5 13 C of about -30 to about -15, about -27 to about -19, about -25 to about -21, about -15 to about -5, about -13 to about -7, about -13 to about -10.
- a biofuel composition can be made that includes an olefin having 6 13 C of from about -10.9 to about -15.4, where the olefin accounts for at least about 85% of biosourced material (i.e., derived from a renewable resource, such as biomass, cellulosic materials, and sugars) in the composition.
- biosourced material i.e., derived from a renewable resource, such as biomass, cellulosic materials, and sugars
- the invention also provides for a hydrocarbon or biofule with a 5 13 C of about -10, -11, -12, or -12.3.
- Biologically produced hydrocarbons can also be distinguished from petroleum based hydrocarbons by comparing the amount of 14 C in each fuel.
- the fundamental definition relates to 0.95 times the 14 C / 12 C isotope ratio HOxI (referenced to AD 1950). This is roughly equivalent to decay-corrected pre- Industrial Revolution wood.
- f M is approximately 1.1.
- the invention provides a hydrocarbon or biofuel which can have an f M 14 C of at least about 1.
- the hydrocarbon or biofuel can have an f M 14 C of at least about 1.01, an f M 14 C of about 1 to about 1.5, an f M 14 C of about 1.04 to about 1.18, or an f M 14 C of about 1.111 to about 1.124.
- the olefin in the biofuel composition can have a fraction of modern carbon (f M 14 C) of, for example, at least about 1.003, 1.010, or 1.5.
- Another measurement of 14 C is known as the percent of modern carbon, pMC. For an archaeologist or geologist using 14 C dates, AD 1950 equals "zero years old".
- the measured pMC value for that material will reflect the proportions of the two component types. For example, a material derived 100% from present day soybeans would give a radiocarbon signature near 107.5 pMC. If that material was diluted 50% with petroleum based products, it would give a radiocarbon signature of approximately 54 pMC.
- a biologically based carbon content is derived by assigning 100% equal to 107.5 pMC and 0% equal to 0 pMC. For example, a sample measuring 99 pMC will give an equivalent biologically based carbon content of 93%.
- the invention provides a hydrocarbon or biofuel which can have a pMC of at least about 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100.
- the invention further provides for a hydrocarbon or fuel which has a pMC of between about 50 to about 100, about 60 to about 100, about 70 to about 100, about 80 to about 100, about 85 to about 100, and about 87 to about 98, about 90 to about 95.
- the invention further provides for a hydrocarbon or biofuel with a pMC of about 90, 91, 92, 93, 94, or 94.2.
- Fuel additives are used to enhance the performance of a fuel or engine.
- fuel additives can be used to alter the freezing/gelling point, cloud point, lubricity, viscosity, oxidative stability, ignition quality, octane level, and/or flash point.
- all fuel additives must be registered with Environmental Protection Agency.
- the names of fuel additives and the companies that sell the fuel additives are publicly available by contacting the EPA or by viewing the agency's website.
- the olefin-based biofuels described herein can be mixed with one or more fuel additives to impart a desired quality.
- the olefin-based biofuels described herein can be mixed with other fuels, such as various alcohols, such as ethanol and butanol, and petroleum-derived products, such as gasoline, diesel, or jet fuel.
- fuels such as various alcohols, such as ethanol and butanol
- petroleum-derived products such as gasoline, diesel, or jet fuel.
- the mixture can include at least about 10%, 15%, 20%, 30%, 40%, 50%, or 60% by weight of the olefin.
- a biofuel composition can be made that includes at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90% or 95% of an olefin that includes a carbon chain that is 8:1, 10:1, 12:1, 13:1, 14:1, 14:2, 15:1, 15:2, 16:1, 16:2, 17:1, 17:2, 18:1, 18:2, 18:3, 19:1, 19:2, 19:3, 20:1, 20:2, 20:3, 22:1, 22:2, or 22:3.
- Such biofuel compositions can additionally include at least one additive selected from a cloud point lowering additive that can lower the cloud point to less than about 5 0 C, or 0°C; a surfactant; a microemulsion; at least about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, or 95% diesel fuel from triglycerides; petroleum-derived gasoline; or diesel fuel from petroleum.
- a cloud point lowering additive that can lower the cloud point to less than about 5 0 C, or 0°C
- a surfactant a microemulsion
- a microemulsion at least about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, or 95% diesel fuel from triglycerides
- petroleum-derived gasoline or diesel fuel from petroleum.
- Example 1 Identification and Reclassification of a Microorganism Belonging to the Genus Jeotgalicoccus that is an ⁇ -olefin Producer
- Micrococcus candicans ATCC 8456 was previously reported to synthesize aliphatic hydrocarbons with carbon chain lengths ranging from Cj 8 to C 20 (Morrison et ah, J. Bacteriol. 108:353-358, 1971). To identify the hydrocarbons produced by this strain, ATCC 8456 cells were cultured in 15 mL TSBYE medium (3% Tryptic Soy Broth + 0.5% Yeast Extract), for 40-48 h at 3O 0 C. Cells from 5 mL of culture were pelleted, resuspended in 1 mL methanol, sonicated for 30 min and extracted with 4 mL hexane.
- TSBYE medium 3% Tryptic Soy Broth + 0.5% Yeast Extract
- ATCC 8456 was previously misidentified as belonging to the genus Micrococci.
- the phylogenetic classification of ATCC 8456 was reassessed by amplifying and sequencing the partial 16s rRNA gene using primers Eubac27 and 1492R (see DeLong et al, PNAS 89:5685, 1992).
- the 16s rRNA sequence of ATCC8456 (SEQ ID NO:3, depicted in Figure 7C) was analyzed using the classifier program of the Ribosomal Database Project II (http://rdp.cme.msu.edu/index.jsp). Based upon this analysis, the strain was identified as belonging to the genus Jeotgalicoccus.
- the genus Jeotgalicoccus has been previously described (see, e.g., Jung-Hoon et al, Int. J. Syst. Evol. Microbiol. 53:595-602, 2003).
- Jeotgalicoccus is a low G+C Gram-positive bacteria related to the genus Staphylococcus (see Figure 3). Micrococci are high G+C Gram-positive bacteria.
- the ends of several clones from a cosmid library of ATCC 8456 genomic DNA were sequenced. Based upon a DNA sequence of approximately 4,000 bp, the G+C content was determined to be approximately 36%.
- Nucleotide sequence searches against a non-redundant protein database revealed that all sequences with a match to a database entry were similar to proteins from low G+C Gram- positive bacteria, such as species belonging to the genus Staphylococcus or Bacillus, but not the genus Micrococcus.
- Jeotgalicoccus halotolerans DSMZ 17274 Jeotgalicoccus psychrophilus DSMZ 19085
- Jeotgalicoccus pinnipedalis DSMZ 17030 Each strain was cultured in 15 mL TSBYE medium (3% Tryptic Soy Broth + 0.5% Yeast Extract), and the hydrocarbons were isolated and analyzed by GC- MS as described above.
- the fatty acids eicosanoic acid (straight-chain C 20 fatty acid), 16-methyl octadecanoic acid, and 17-methyl octadecanoic acid (branched-chain Cj 9 fatty acids) were identified as components of ATCC 8456's lipids. These fatty acids were deduced to be the direct precursors, after decarboxylation, for 1 -nonadecene, 15 -methyl- 1-heptadecene, and 16- methyl-1-heptadecene biosynthesis, respectively.
- ATCC 8456 cells were grown in 15 rnL TSBYE medium (3% Tryptic Soy Broth + 0.5% Yeast Extract). Fatty acids were added to the culture medium at final concentrations of 0.5 g/1 (0.05%). After growth for 40-48 h at 3O 0 C, cells from 5 mL of culture were pelleted, resuspended in 1 mL methanol, sonicated for 30 min, and extracted with 4 mL hexane. After solvent evaporation, samples were resuspended in 0.1 mL hexane and analyzed by GC-MS.
- a cell free extract of ATCC 8456 was used to convert free fatty acids into ⁇ -olefins.
- the cell free extract was generated using the following procedure: ATCC 8456 cells were grown in TSBYE medium (3% Tryptic Soy Broth + 0.5% Yeast Extract) at 3O 0 C for 24 h with shaking. The cells were then pelleted from the culture by centrifuging at 3,700 rpm for 20 min. The cell pellet was then resuspended in 50 mM Tris buffer pH 7.5 with 0.1 M NaCl and 2.0 mM dithiothreitol to a concentration of 0.1 g/mL cells.
- lysostaphin Sigma
- the cell lysis reaction was allowed to proceed for 30 min.
- the cells were then sonicated at 12 W on ice for three cycles of 1.5 sec of sonication followed by 1.5 sec of rest. Sonication lasted for a total of 9 sec. This procedure was repeated 5 times with a 1 min interval between each sonication cycle.
- the lysed cells were then centrifuged at 12,000 rpm for 10 min to pellet the cell debris.
- the supernatant ⁇ i.e., cell free extract was then removed and used for the conversion of free fatty acids to ⁇ -olefins.
- the free fatty acids, stearic acid and eicosanoic acid were converted to ⁇ -olefins using the cell free extract as described below.
- Figure 5 shows the GC/MS trace for assaying stearic acid.
- sample 1 TICl; black line in Figure 5
- sample 2 TIC3; blue line in Figure 5
- sample 3 stearic acid was added to the cell free extract.
- the peak at 7.62 min had the same retention time and the same mass spectra as a 1-heptadecene standard (Sigma).
- eicosanoic acid was added under similar conditions, 1-nonadecene was formed.
- the ATCC 8456 cell free extract did not require any additional co-factors to produce ⁇ -olefins.
- the cell free extract was supplemented with several co-factors in 1 mM concentrations, no increase in ⁇ -olefin synthesis was observed.
- the co-factors examined were NAD+, NADP+, NADH, NADPH, FADH 2 , SAM, ATP, and CoA.
- Mg 2+ was examined at a 10 mM concentration.
- the co-factor requirement was also tested by dialyzing the cell free extract with a 10 kDa cut-off membrane for 1.5 h in a volume 200-fold greater than the cell extract volume using a dialysis buffer: 50 mM Tris, pH 7.5 with 0.1 M sodium chloride. No decrease in ⁇ -olefin synthesis was observed after dialysis. Additionally, no decrease in ⁇ -olefin synthesis was observed when 10 mM EDTA pH 7.5 was added to the reaction mixture.
- the ATCC 8456 cell free extract was further enriched by carrying out an ammonium sulfate precipitation.
- the mixture was stirred gently on ice for 60 min and then centrifuged at 13,000 rpm for 30 min. The supernatant was recovered and additional ammonium sulfate was added to bring the ammonium sulfate concentration to 65% (wt/vol).
- the mixture was allowed to mix on ice for 60 min and was centrifuged again for 30 min. The supernatant was discarded.
- the pellet was then resuspended in 50 mM Tris buffer pH 7.5 with 0.1 M sodium chloride. This mixture was then dialyzed in the aforementioned buffer to remove the ammonium sulfate.
- the cell free extract treated with ammonium sulfate had the same ⁇ -olefin synthesizing activity as the cell free extract.
- the cell slurry was sonicated as described in Example 3 to shear the DNA.
- the cell free extract was next centrifuged at 10,000 rpm for 60 min at 4 0 C.
- the supernatant was then removed and ammonium sulfate was added to a final concentration of 50% (wt/vol) ammonium sulfate saturation.
- the mixture was gently stirred at 4 0 C for 60 min and then centrifuged at 10,000 rpm for 30 min.
- the supernatant was then removed and additional ammonium sulfate was added to 65% (wt/vol) saturation.
- the mixture was stirred again for 60 min at 4 0 C and centrifuged at 10,000 rpm for 30 min.
- the supernatant was discarded.
- the remaining pellet was resuspended in 50 mL of 50 mM Tris pH 8.0 and 2.0 mM DTT.
- the mixture was passed through a 5 mL HiTrap SP column (GE Healthcare) at 3 mL/min and 4°C.
- the following buffers were used as an elution gradient: buffer A contained 50 mM Tris pH 8.0 and 2.0 mM DTT and buffer B contained 50 mM Tris pH 8.0, 1.0 M NaCl, and 2.0 mM DTT.
- buffer A contained 50 mM Tris pH 8.0 and 2.0 mM DTT
- buffer B contained 50 mM Tris pH 8.0, 1.0 M NaCl, and 2.0 mM DTT.
- the dialyzed protein fraction was then loaded onto a 1 mL ResourceQ (GE Healthcare) column at 4 mL/min at 4°C.
- Buffer B used with the HiTrap SP column was used for the ResourceQ column.
- a 7-min elution gradient between 0% buffer B and 25% buffer B was run at 4 mL/min. 1.5 mL fractions were collected and assayed for activity.
- Active fractions eluted between 150 and 200 mM NaCl concentrations.
- Fractions containing activity were then pooled and concentrated with a Millipore Amicon protein concentrator (4 mL and 10 kDa exclusion size) to about 50 ⁇ L.
- the approximate protein concentration was determined with a Bradford assay (Biorad).
- Protein concentrations ranged from about 5 mg/mL to about 10 mg/mL.
- 30 ⁇ L of protein was then loaded onto a SDS PAGE gel (Invitrogen) along with an appropriate protein molecular weight marker. The gel was stained with Simple Safe Coomassie stain (Invitrogen).
- Figure 6 depicts a representative gel. Two intense protein bands at 50 kDa and 20 kDa were observed.
- Jeotgalicoccus ATCC 8456 ORF880 was identified as one of the two major proteins in a highly purified enzyme fraction that catalyzed the conversion of free fatty acids to ⁇ - olefins.
- the genomic DNA encoding ATCC $456_or ⁇ 80 was cloned into pCDF-Duetl under the control of the T7 promoter, and E. coli was transformed with various vectors, as described below.
- the E. coli cells were grown, and the hydrocarbons produced by the cells were analyzed as described in Example 2. When 0.05% stearic acid was fed to cultures of E.
- Example 6 Production of ⁇ -Olefins from Glucose by Heterologous Expression of Jeotsalicoccus ATCC 8456 orf880 in E. coli MGl 655 ⁇ fadD Construction offadD deletion strain
- the fadD gene of E. coli MG1655 was deleted using the lambda red system (Datsenko et al, 2000, Proc. Natl. Acad. Sci. USA. 97: 6640-6645) as described below.
- This PCR product was electroporated into E. coli MGl 655 (pKD46). The cells were plated on L-chloramphenicol (30 ⁇ g/mL)(L-Cm) and grown overnight at 37 0 C. Individual colonies were picked on to another L-Cm plate and grown at 42 0 C. These colonies were then patched to L-Cm and L-carbenicillin (100 mg/mL) (L-Cb) plates and grown at 37 0 C overnight. Colonies that were Cm and Cb were evaluated further by PCR to ensure the PCR product inserted at the correct site.
- PCR verification was performed on colony Iy sates of these bacteria using the primers fadF (5 ⁇ - CGTCCGTGGTAATCATTTGG-3') and fadR (5 ⁇ -TCGCAACCTTTTCGTTGG-3 ⁇ ).
- the expected size of the ⁇ fadDy.Cm deletion was about 1200 bp ( Figure 11).
- the chloramphenicol resistance gene was eliminated using a FLP helper plasmid as described in Datsenko et al. (2000) Proc. Natl. Acad. Sci. USA. 97: 6640- 6645.
- PCR verification of the deletion was performed with primers fadF and fadR ( Figure 11).
- the MG1655 AfadD strain was unable to grow on M9 + oleate agar plates (oleate as carbon source). It was also unable to grow in M9 + oleate liquid media.
- IPTG 1 mM
- delta-aminolaevulinic acid heme biosynthesis precursor
- Example 7 Production of ⁇ -Olefins in E. coli by Heterologous Expression of Coryneb ⁇ cterium efficiens YS- 134 orfCE2459
- coli C41 AfadE was constructed using primers YafV NotI and Ivry_Ol to amplify about 830 bp upstream of fadE and primers Lpcaf_ol and LpcaR_Bam to amplify about 960 bp downstream of fadE.
- Overlap PCR was used to create a construct for in frame deletion of the complete fadE gene.
- the fadE deletion construct was cloned into the temperature-sensitive plasmid pKOV3, which contained a sacB gene for counterselection, and a chromosomal deletion of fadE was made according to the method of Link et al., J. Bact. 179:6228-6237, 1997.
- This strain has the acyl-CoA dehydrogenase gene (fadE) deleted, therefore it can not degrade activated fatty acids.
- the cells were grown at 37 0 C in M9 minimal media supplemented with 20 ⁇ g/mL uracil, 1% glucose (w/v), and 100 ⁇ g/mL spectinomycin.
- M9 minimal media supplemented with 20 ⁇ g/mL uracil, 1% glucose (w/v), and 100 ⁇ g/mL spectinomycin.
- OD 60 O 0.8 to 1.0
- E. coli cells transformed with an orfCE2459-bearing vector produced 1 -heptadecadiene without stearic acid feeding and produced 1-heptadecene with stearic acid feeding.
- This result indicates that expression of orfCE2459 confers on E. coli the ability to biosynthesize ⁇ -olef ⁇ ns ⁇ e.g., 1- heptadecadiene) when grown on glucose ( Figure 13B) and that orfCE2459 can convert fed fatty acids, such as stearic acid, into ⁇ -olef ⁇ ns, such as 1-heptadecene ( Figure 13C).
- Example 8 Production of ⁇ -Olefins in E. coli by Heterologous Expression of Kokuria rhizo ⁇ hila orfKRH21570
- Example 9 Production of ⁇ -Olefms in Bacillus subtilis by Heterologous Expression of Jeotsalicoccus sp. ATCC8456 orf880
- Genomic DNA encoding Jeotgalicoccus ATCC 8456_or ⁇ 80 was cloned into the BamHl and Xbal sites of vector pHTOl under the control of the P grac promoter.
- B. subtilis IHAOl lacA::spec leuB8 metB5 r(-)m(+) Sp, obtained from Bacillus Genetic Stock Center, Columbus, OH, strain number BGSC 1 A785) was transformed with the resulting vector.
- the B. subtilis cells were grown at 37 0 C in minimal medium supplemented with 2% glucose, 0.3 mM leucine, 0.3 mM methionine, and 10 mg/L chloramphenicol.
- B. subtilis cells transformed with Jeotgalicoccus sp. ATCC8456 ⁇ r/SSO-bearing vector produced 1- heptadecene from stearic acid (see Figure 15B).
- B. subtilis fatty acids such as stearic acid
- Jeotgalicoccus ATCC 8456_or ⁇ 80 in Bacillus subtilis.
- Example 10 Production of ⁇ -Olefins in Bacillus subtilis by Heterologous Expression of Corynebacterium efficiens YS- 134 orfCE2459
- Genomic DNA encoding Corynebacterium efficiens YS-134 orfCE2459 was cloned into the BamHI and Xbal sites of vector pHTOl under the control of the P grac promoter and transformed into B. subtilis IHAOl cells. The resulting cells were grown, extracted, and analyzed as described in Example 9.
- B. subtilis cells transformed with Corynebacterium efficiens YS-134 orf_CE2459-bea ⁇ ng vector produced 1-heptadecene from stearic acid (see Figure 15). This demonstrates that in B. subtilis fatty acids, such as stearic acid, can be converted to ⁇ -olefins by heterologous expression of C. efficiens orf_CE2459.
- Example 11 Production of ⁇ -Olefins in S ⁇ cch ⁇ romyces cerevisi ⁇ e by Heterologous Expression of Jeotg ⁇ licoccus sp. ATCC8456 orf880
- Genomic DNA encoding Jeotg ⁇ licoccus sp. ATCC 8456_or ⁇ 80 is cloned into the Ap ⁇ l and Xhol sites of the yeast expression vector pESC-His.
- S. cerevisi ⁇ e (BY4741) yeast cells are then transformed with either a plasmid containing or ⁇ 80 or a plasmid not containing orf880.
- the transformed yeast cells are cultured under suitable conditions to allow expression of ORF880.
- the cells are pelleted and then lysed using YeastBusterTM (Novagen, Madison, WI).
- the ⁇ -olef ⁇ ns are extracted and analyzed as described in Examples 6 and 7.
- Jeotg ⁇ licoccus sp. ATCC8456_or/SS0 expressed in S. cerevisi ⁇ e produces ⁇ -olefins. Similar methods are used to express Jeotg ⁇ licoccus sp. ATCC 8456j)r ⁇ 80 in any cell of interest, after which cell lysates are prepared and the production of ⁇ -olefins analyzed.
- E. coli BL21 strain (DE3) (Invitrogen) was transformed with pETl5b-or ⁇ 80 using routine chemical transformation techniques. Protein expression was carried out by first inoculating a colony of the E. coli strain in 5 mL of LB media supplemented with 100 mg/L of carbenecillin and shaken overnight at 37°C to produce a starter culture. This starter culture was used to inoculate 1 L of LB media supplemented with 100 mg/L of carbenecillin. The culture was shaken at 37°C until an OD 6O0 value of 0.6 was reached. The culture was placed on ice for 10 min before IPTG was added to a final concentration of 250 ⁇ M.
- the culture was then shaken at 18°C for approximately 18 h.
- the culture was then centrifuged at 3,700 rpm for 20 min at 4 0 C.
- the pellet was then resuspended in 30 mL of buffer containing 100 mM sodium phosphate buffer at pH 7.2 supplemented with Bacterial ProteaseArrest (GBiosciences).
- the cells were then sonicated at 12 W on ice for 9 sec with 1.5 sec of sonication followed by 1.5 sec of rest. This procedure was repeated 5 times with one min intervals between each sonication cycle.
- the cell free extract was centrifuged at 10,000 rpm for 30 min at 4°C.
- Ni-NTA Ni-NTA
- the slurry was passed over a column removing the resin from the lysate.
- the resin was then washed with 30 mL of buffer containing 100 mM sodium phosphate buffer at pH 7.2 plus 30 mM imidazole.
- the protein was eluted with 15 mL of 100 mM sodium phosphate buffer at pH 7.2 plus 250 mM imidazole.
- the protein solution was dialyzed with 200 volumes of 100 mM sodium phosphate buffer at pH 7.2. Protein concentration was determined using the Bradford assay (Biorad). 125 ⁇ g/mL of protein was obtained.
- potassium salts of the following fatty acids were prepared: tetradecanoic acid, hexadecanoic acid, octadecanoic acid, eicosanoic acid, and behenic acid (Sigma).
- the fatty acid solutions were made with 2% ethanol and 2% Tergitol solution (Sigma, St. Louis, MO) to a final concentration of 20 mM.
- the kinetics of the decarboxylation reaction was determined using potassium octadecanoate.
- a 200 ⁇ L reaction was prepared with the following reactant concentrations: 1.25 ⁇ M of ORF880, 200 ⁇ M of potassium octadecanoate, 200 ⁇ L dithiothreitol , and 100 mM sodium phosphate buffer at pH 7.2.
- the reactions were incubated at room temperature and time points were taken in duplicate between 5 min and 120 min. Reactions were quenched and extracted by adding 100 ⁇ L of ethyl acetate containing 1-octadecene at 5 mg/L as an internal reference.
- Samples were analyzed using GC/MS using the alkane-1 splitless method, which is performed using the following parameters: run time: 20 min; column: HP- 5-MS Part No. 19091S-433E (length of 30 meters; I.D.: 0.25 mm narrowbore; film: 0.25 ⁇ M); sample: standard ethyl acetate extraction; inject: 1 ⁇ L Agilent 6850 inlet; inlet: 300 0 C splitless; carrier gas: helium; flow: 1.3 niL/min; oven temp: 100°C hold 5 min, 320 at 20°C/min, 320 hold 5 min; det: Agilent 5975B VL MSD; det. temp: 300°C; scan: 50-500 M/Z. Calibration curves were generated using 1-heptadecene dissolved in ethyl acetate. Based upon this analysis, the product production was determined to be linear from 5 min to 60 min.
- E. coli BL21 strain (DE3) (Invitrogen) was transformed with pETl5-orfCE2459 using routine transformation techniques. Protein expression was carried out by first inoculating a colony of the E. coli strain in 5 mL of LB media supplemented with 100 mg/L of carbenecillin and then shaking overnight at 37°C to produce a starter culture. This starter culture was used to inoculate 0.5 L of LB media supplemented with 100 mg/L of carbenecillin. The culture was shaken at 37°C until an OD 600 value of 0.6 was reached. The culture was placed on ice for 10 min before IPTG was added to a final concentration of 250 ⁇ M.
- ⁇ - Aminolevulinic acid was also added to a final concentration of 0.5 mM.
- the culture was then shaken at 25 °C for approximately 18 h.
- the culture was then centrifuged at 3,700 rpm for 20 min at 4 0 C.
- the pellet was then resuspended in 7 mL of buffer containing 100 mM sodium phosphate buffer at pH 7.2 supplemented with Bacterial ProteaseArrest (GBiosciences).
- the cells were then sonicated at 12 W on ice for 9 sec with 1.5 sec of sonication followed by 1.5 sec of rest. This procedure was repeated 4 times with one min intervals between each sonication cycle.
- the cell free extract was centrifuged at 10,000 rpm for 30 min at 4°C.
- Samples were analyzed using GC/MS using the alkane-1 splitless method which was performed using the following parameters: run time: 20 min; column: HP-5-MS Part No. 19091S-433E (length of 30 meters; LD. : 0.25 mm narrowbore; film: 0.25 ⁇ M); sample: standard ethyl acetate extraction; inject: 1 ⁇ L Agilent 6850 inlet; inlet: 300°C splitless; carrier gas: helium; flow: 1.3 mL/min; oven temp: 100°C hold 5 min, 320 at 2O 0 C /min, 320 hold 5 min; det: Agilent 5975B VL MSD; det. temp: 300°C; scan: 50-500 M/Z.
- an E. coli lysate expressing orfCE2459 was capable of converting octadecanoic acid into 1-heptadecene.
- the peak at 5.20 min corresponds to 1-heptadecene and the peak at 8.76 is the internal standard 1-octadecene. Peak identification was determined by comparing the retention time and the MS fragmentation pattern with authentic references from Sigma. This result demonstrates that ORF CE2459 exhibits similar in vitro fatty acid decarboxylase activity as ORF880.
- Example 14 In Vitro Synthesis of ⁇ -Olefms by Kokuria rhizophila orf KRH21570 Heterologously Expressed in and Purified from E. coli
- E. coli C41 DE3 (AfadE) cells were transformed with pETl5b-orfKRH21570 using routine transformation techniques. Protein expression was carried out by first inoculating 5 mL of LB broth supplemented with 100 mg/L carbenicillin with a colony of the E. coli strain which was followed by shaking the cells overnight at 37 0 C to produce a starter culture. This starter culture was used to inoculate 0.5 L of LB media supplemented with 100 mg/L of carbenicillin. The culture was shaken at 37 0 C until an OD 60O value of 0.6 was reached, after which it was induced with 1 niM IPTG and 0.5 mM delta-aminolaevulinic acid. The culture was then shaken at 25 0 C for approximately 18 h. The protein was purified as described in Example 12.
- Trimethylanilinium hydroxide was added to the ethyl acetate layer at a 1 : 1 ratio and the extracts analyzed by GC/MS using the MAR_splitless_short method.
- the parameters used were as follows: 9.50 min; column: DB5-ht Part No. J&W 122-5711 (length of 15 meters; LD.
- sample standard ethyl acetate extraction; inject: 1 ⁇ L Agilent 6850 inlet; inlet: 300 C splitless; carrier gas: helium; flow: 1.3 mL/min; oven temp: 80 0 C hold 1.0 min, 320 at 30°C/min, 320 hold 0.5 min; det: Agilent 5975B VL MSD; EI mode; det. temp: 230 0 C; scan: 50-330 M/Z.
- Kokuria rhizophila ORF KRH21570 was capable of converting hexadecanoic acid to 1-pentadecene in vitro.
- Example 15 In Vitro Synthesis of ⁇ -Olefins by Methylobacterium populi orf Mpopl292 Heterologously Expressed in and Purified from E. coli
- E. coli C41 DE3 (AfadE) cells were transformed with pET ⁇ 5b-orf_Mpopl292 using routine transformation techniques. Protein expression was carried out by first inoculating 5 mL of LB broth supplemented with 100 mg/L carbenicillin with a colony of the E. coli strain, and then shaking the cells overnight at 37 0 C to produce a starter culture. This starter culture was used to inoculate 0.5 L of LB media supplemented with 100 mg/L of carbenicillin. The culture was shaken at 37 0 C until an OD 60O value of 0.6 was reached, after which it was induced with 1 mM IPTG and 0.5 mM delta-aminolaevulinic acid. The culture was then shaken at 25°C for about 18 h. The protein was purified as described in Example 12 and assayed as described in Example 14.
- Methylobacterium populi ORF_Mpopl292 was capable of converting hexadecanoic acid to 1 -pentadecene in vitro.
- Example 16 Production of ⁇ -Olefins in E. coli Through Heterologous Expression of Bacillus subtilis fatty acid hydroxylase, P450gs ⁇
- the cells were grown at 37°C in M9 minimal media supplemented with 20 ⁇ g/mL uracil, 1% glucose (w/v), and 100 ⁇ g/mL carbenicillin.
- OD 60O 0.8-1.0
- it was induced with ImM IPTG; supplemented with 0.5mM delta-aminolaevulinic acid (heme biosynthesis precursor) and 0.05% stearic acid (as a substrate for Bs b ).
- the temperature was shifted down to 25°C and cells were allowed to grow for an additional 18-20 h.
- Bacillus subtilis P450 ⁇ S ⁇ can convert fed fatty acids, such as stearic acid, into ⁇ -olefms, such as 1-heptadecene ( Figure 20). Both the wildtype protein and the Gln85-His-mutant protein were capable of carrying out this reaction.
- Example 17 Specific activity of ⁇ -olefin production and ⁇ and ⁇ hydroxy fatty acid production using ORF880, CYP152A1 (P450g ⁇ and CYP152A1 Q85H [0311] The specific activity of ⁇ -olefin formation as well as ⁇ -(2) and ⁇ -(3)hydroxy fatty acid formation were determined for ORF880, CYP 152Al, and CYP 152Al Q85H (see Examples 12 and 16). An E.
- coli BL21 strain (DE3) (Invitrogen) was transformed with either pETl5b-orf880, pETl5b-cypl52Al, and pETl5b-cypl52Al Q85H using routine chemical transformation techniques.
- Protein expression was carried out by first inoculating a colony of the E. coli strain in 5 mL of LB media supplemented with 100 mg/L of carbenicillin and shaken overnight at 37 0 C to produce a starter culture. This starter culture was used to inoculate 0.5 L of LB media supplemented with 100 mg/L of carbenicillin. The culture was shaken at 37°C until an OD 600 value of 0.6 was reached.
- the culture was placed on ice for 10 min before IPTG was added to a final concentration of 250 ⁇ M.
- the culture was shaken at 25°C for approximately 18 h, and then centrifuged at 3,700 rpm for 20 min at 4°C.
- the pellet was then resuspended in 10 mL of buffer containing 100 mM sodium phosphate buffer at pH 7.2 supplemented with Bacterial ProteaseArrest (GBiosciences).
- the cells were then sonicated at 12 W on ice for 9 sec with 1.5 sec of sonication followed by 1.5 sec of rest. This procedure was repeated 5 times with one min intervals between each sonication cycle.
- the cell free extract was centrifuged at 10,000 rpm for 30 min at 4°C.
- each time point consisted of 500 ⁇ L.
- Each reaction contained of 500 ⁇ M H 2 O 2 , 200 ⁇ M of potassium hexadecanoate, 100 mM sodium phosphate buffer at pH 7.2, and protein at the following concentrations: ORF880 - 0.23 or 0.46 ⁇ M; CYP 152Al - 8.65, 17.3, or 34.6 ⁇ M; CYP152A1 Q85H - 6.53, 13.06, or 26.12 ⁇ M.
- the reactions were carried out at room temperature and time points were taken at 0, 1, 3, 5, 7, 10, 14, and 20 minutes.
- 19091S-433E (length of 30 meters; I.D.: 0.25 mm narrowbore; film: 0.25 ⁇ M); inject: 1 ⁇ L Agilent 6850 inlet; inlet: 300°C splitless; carrier gas: helium; flow: 1.3 mL/min; oven temp: 100°C hold 5 min, 32O 0 C at 20°C/min, 320°C hold 5 min; det: Agilent 5975B VL MSD; det. temp: 300°C; scan: 50-500 M/Z.
- Calibration curves were generated using 1- pentadecene, ⁇ (2)-hydroxyhexadecanoic acid, and ⁇ (3)-hydroxyhexadecanoic acid dissolved in ethyl acetate and derivatized as described herein.
- This mutation also increased the rate of ⁇ -hydroxyhexadecanoic acid formation and lowered the rate of ⁇ -hydroxyhexadecanoic acid formation as compared with the wild-type version of CYP 152Al.
- the rate of hydroxyhexadecanoic acid production by ORF880 was about l/50 th of the rates exhibited by the two CYP 152Al enzymes.
- the ratio of 1-pentadecene formation (i.e. decarboxylation) to hydroxyhexadeconic acid formation (i.e., hydroxylation) activities for each enzyme is given in Figure 22.
- P450 enzymes were able to convert fatty acids into ⁇ -olefins in-vivo and in-vitro, and three of these P450 enzymes were also able to convert fatty acids into ⁇ -hydroxy fatty acids (see Table 8).
- two P450 enzymes Bacillus claussii orf_ABC3040 and Sphingomonas paucimobilis P450s p ⁇ , were not able to make ⁇ -olefins or ⁇ -hydroxy fatty acids. These P450 enzymes converted fatty acids only to the corresponding ⁇ -hydroxy fatty acids (see Table 8).
- Table 8 also demonstrates that when a His or Met is at position 85, the enzyme has the ability to produce ⁇ -olefins. Table 8 also shows the percent identity of each enzyme tested relative to Jeotgalicoccus sp. 8456 ORF880.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Compositions and methods for producing olefins are described herein. The olefins can be used to produced biofuels.
Description
METHODS AND COMPOSITIONS FOR PRODUCING OLEFINS
BACKGROUND OF THE INVENTION
[0001] Petroleum is a limited, natural resource found in the Earth in liquid, gaseous, or solid forms. Petroleum is primarily composed of hydrocarbons, which are comprised mainly of carbon and hydrogen. It also contains significant amounts of other elements, such as, nitrogen, oxygen, or sulfur, in different forms.
[0002] Petroleum is a valuable resource, but petroleum products are developed at considerable costs, both financial and environmental. First, sources of petroleum must be discovered. Petroleum exploration is an expensive and risky venture. The cost of exploring deep water wells can exceed $100 million. Moreover, there is no guarantee that these wells will contain petroleum. It is estimated that only 40% of drilled wells lead to productive wells generating commercial hydrocarbons. In addition to the economic cost, petroleum exploration carries a high environmental cost. For example, offshore exploration disturbs the surrounding marine environments.
[0003] After a productive well is discovered, the petroleum must be extracted from the Earth at great expense. During primary recovery, the natural pressure underground is sufficient to extract about 20% of the petroleum in the well. As this natural pressure falls, secondary recovery methods are employed, if economical. Generally, secondary recovery involves increasing the well's pressure by, for example, water injection, natural gas injection, or gas lift. Using secondary recovery methods, an additional 5% to 15% of petroleum is recovered. Once secondary recovery methods are exhausted, tertiary recovery methods can be used, if economical. Tertiary methods involve reducing the viscosity of the petroleum to make it easier to extract. Using tertiary recovery methods, an additional 5% to 15% of petroleum is recovered. Hence, even under the best circumstances, only 50% of the petroleum in a well can be extracted. Petroleum extraction also carries an environmental cost. For example, petroleum extraction can result in large seepages of petroleum rising to the surface. Moreover, offshore drilling involves dredging the seabed which disrupts or destroys the surrounding marine environment. Since petroleum deposits are not found uniformly throughout the Earth, petroleum must be transported over great distances from petroleum producing regions to petroleum consuming regions. In addition to the shipping costs, there is also the environmental risk of devastating oil spills.
[0004] In its natural form, crude petroleum extracted from the Earth has few commercial uses. It is a mixture of hydrocarbons (e.g., paraffins (or alkanes), olefins (or alkenes), alkynes, napthenes (or cylcoalkanes), aliphatic compounds, aromatic compounds, etc.) of varying length and complexity. In addition, crude petroleum contains other organic compounds (e.g., organic compounds containing nitrogen, oxygen, sulfur, etc.) and impurities (e.g., sulfur, salt, acid, metals, etc.).
[0005] Hence, crude petroleum must be refined and purified before it can be used commercially. Due to its high energy density and its easy transportability, most petroleum is refined into fuels, such as transportation fuels (e.g., gasoline, diesel, aviation fuel, etc.), heating oil, liquefied petroleum gas, etc.
[0006] Crude petroleum is also a primary source of raw materials for producing petrochemicals. The two main classes of raw materials derived from petroleum are short chain olefins (e.g., ethylene and propylene) and aromatics (e.g., benzene and xylene isomers). These raw materials are derived from longer chain hydrocarbons in crude petroleum by cracking it at considerable expense using a variety of methods, such as catalytic cracking, steam cracking, or catalytic reforming. These raw materials are used to make petrochemicals, which cannot be directly refined from crude petroleum, such as monomers, solvents, detergents, or adhesives.
[0007] One example of a raw material derived from crude petroleum is ethylene. Ethylene is used to produce petrochemicals such as, polyethylene, ethanol, ethylene oxide, ethylene glycol, polyester, glycol ether, ethoxylate, vinyl acetate, 1 ,2-dichloroethane, trichloroethylene, tetrachloroethylene, vinyl chloride, and polyvinyl chloride. An additional example of a raw material is propylene, which is used to produce isopropyl alcohol, acrylonitrile, polypropylene, propylene oxide, propylene glycol, glycol ethers, butylene, isobutylene, 1,3 -butadiene, synthetic elastomers, polyolefins, alpha-olefins, fatty alcohols, acrylic acid, acrylic polymers, allyl chloride, epichlorohydrin, and epoxy resins. [0008] These petrochemicals can then be used to make specialty chemicals, such as plastics, resins, fibers, elastomers, pharmaceuticals, lubricants, or gels. Particular specialty chemicals which can be produced from petrochemical raw materials are: fatty acids, hydrocarbons (e.g., long chain, branched chain, saturated, unsaturated, etc.), fatty alcohols, esters, fatty aldehydes, ketones, lubricants, etc.
[0009] Specialty chemicals have many commercial uses. Hydrocarbons have many commercial uses. For example, shorter chain alkanes are used as fuels. Methane and ethane are the main constituents of natural gas. Longer chain alkanes (e.g., from five to sixteen carbons) are used as transportation fuels (e.g., gasoline, diesel, or aviation fuel). Alkanes having more than sixteen carbon atoms are important components of fuel oils and lubricating oils. Even longer alkanes, which are solid at room temperature, can be used, for example, as a paraffin wax. Alkanes that contain approximately thirty-five carbons are found in bitumen, which is used for road surfacing. In addition, longer chain alkanes can be cracked to produce commercially useful shorter chain hydrocarbons.
[0010] Like short chain alkanes, short chain olefins, or alkenes, are used in transportation fuels. Longer chain olefins are used in plastics, lubricants, and synthetic lubricants. In addition, olefins are used as a feedstock to produce alcohols, esters, plasticizers, surfactants, tertiary amines, enhanced oil recovery agents, fatty acids, thiols, alkenylsuccinic anhydrides, polymers, textiles, solvents, adhesives epoxides, chlorinated alkanes, chlorinated olefins, waxes, fuel additives, and drag flow reducers. In addition, long chain olefins can be cracked to produce fuels.
[0011] Olefins have traditionally been produced from petroleum sources through the process of steam or catalytic cracking. Because of the limited availability and high cost of petroleum sources, the cost of producing olefins from such petroleum sources has been steadily increasing.
[0012] Olefins are the largest volume of chemical intermediates produced in the chemical industry, with global annual production previously estimated at over 300 billion lbs per year. Olefins are produced almost exclusively from ethane or other light alkanes (naphtha) in a process called cracking. This process involves heating the ethane or other light olefins to approximately 750-1000°C in a cracker. It has been estimated that 30% of all pollution from chemical plants comes from cracking owing to emissions and unburned hydrocarbons in the flame required to heat the cracker. Approximately 10% of petroleum is consumed in the production of olefins and related chemicals.
[0013] In addition, crude petroleum is a source of lubricants. Lubricants derived petroleum are typically composed of olefins, particularly polyolefins and terminal olefins. Lubricants can either be refined from crude petroleum or manufactured using raw materials refined from crude petroleum.
[0014] Obtaining these specialty chemicals from crude petroleum requires a significant financial investment as well as a great deal of energy. It is also an inefficient process because frequently the long chain hydrocarbons in crude petroleum are cracked to produce smaller monomers. These monomer are then used as the raw material to manufacture the more complex specialty chemicals.
[0015] In addition to the problems with exploring, extracting, transporting, and refining petroleum, petroleum is a limited and dwindling resource. One estimate of world petroleum consumption is 30 billion barrels per year. By some estimates, it is predicted that at current production levels, the world's petroleum reserves could be depleted before the year 2050. [0016] Finally, the burning of petroleum based fuels releases greenhouse gases (e.g., carbon dioxide) and other forms of air pollution (e.g., carbon monoxide, sulfur dioxide, etc.). As the world's demand for fuel increases, the emission of greenhouse gases and other forms of air pollution also increases. The accumulation of greenhouse gases in the atmosphere leads to an increase global warming. Hence, in addition to damaging the environment locally (e.g., oil spills, dredging of marine environments, etc.), burning petroleum also damages the environment globally.
[0017] Due to the inherent challenges posed by petroleum, there is a need for a renewable petroleum source which does not need to be explored, extracted, transported over long distances, or substantially refined like petroleum. There is also a need for a renewable petroleum source which can be produced economically without creating the type of environmental damage produced by the petroleum industry and the burning of petroleum based fuels. For similar reasons, there is also a need for a renewable source of chemicals which are typically derived from petroleum.
[0018] One method of producing renewable petroleum is by engineering microorganisms to produce renewable petroleum products. Some microorganims have a natural ability to produce chemicals. For example, yeast has been used for centuries to produce ethanol (e.g., beer, wine, etc.). In recent years, through the development of advanced biotechnologies, it is possible to metabolically engineer an organism to produce biochemicals that were never previously produced. Chemicals derived from these cellular activities are known as biochemicals. Fuels produced these cellular activities are known as biofuels. Biofuels are a renewable alternative to petroleum based fuels. Biofuels can be substituted for any petroleum based fuel (e.g., gasoline, diesel, aviation fuel, heating oil, etc.). Biofuels can be derived from
renewable sources, such as plant matter, animal matter, or even waste products. These renewable sources are collectively known as biomass. One advantage of biofuels over petroleum based fuels is that they do not require expensive and risky exploration or extraction. In addition, biofuels can be locally produced. Hence, they do not require transportation over long distances. Moreover, biofuels can be made directly without the need for expensive and energy intensive refining as is needed with refining crude petroleum. In other circumstances, the biofuel may require a limited and cost-effective level of refining. Furthermore, the use of biofuels improves the environment by reducing the amount of environmentally harmful emissions (e.g., green house gases, air pollution, etc.) released during combustion. Finally, biofuels maintain a balanced carbon cycle because biofuels are produced from biomass, a renewable, natural resource. While the burning of biofuels will release carbon (e.g., as carbon dioxide), this carbon will be recycled during the production of biomass (e.g., the cultivation of crops) thereby balancing the carbon cycle unlike petroleum based fuels.
[0019] For similar reasons, biologically derived chemicals offer the same advantages as biofuels over petroleum based fuels. Biologically derived chemicals are a renewable alternative to petrochemicals. Biologically derived chemicals, such as hydrocarbons (e.g., alkanes, alkenes, or alkynes), fatty alcohols, esters, fatty acids, fatty aldehydes, and ketones are superior to petrochemicals because they are produced directly without extensive refining. Unlike petrochemicals, biologically derived chemicals do not need to be refined like crude petroleum to recover raw materials which must then be further processed to make more complex petrochemicals. Biologically derived chemicals are directly converted from biomass to the desired chemical product.
[0020] To reduce our reliance on petroleum based fuels, it would be desirable to produce olefins from other sources.
SUMMARY OF THE INVENTION
[0021] The invention is based, at least in part, on the discovery of a novel gene, orβ80, which encodes an olefin-producing enzyme. Accordingly, in one aspect, the invention features an isolated polynucleotide comprising a nucleotide sequence having at least 70% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13. In some embodiments, the nucleotide sequence has at least about 75%, at least about 80%, at least about 85%, at least
about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13. In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13. In other embodiments, the polynucleotide consists of the nucleotide sequence of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
[0022] In another aspect, the invention features an isolated polynucleotide comprising a nucleotide sequence that hybridizes to a complement of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13 or to a fragment thereof. In some embodiments, the nucleotide sequence hybridizes to a complement of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13 or to a fragment thereof under low stringency, medium stringency, high stringency, or very high stringency conditions. [0023] In another aspect, the invention features an isolated polynucleotide comprising a sequence encoding a polypeptide comprising (i) the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 or (ii) the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more amino acid substitutions, additions, insertions, or deletions. In some embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more conservative amino acid substitutions. For example, the polypeptide comprises one or more of the following conservative amino acid substitutions: replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid; replacement of a serine with a threonine; replacement of a threonine with a serine; replacement of an acidic residue, such as aspartic acid and glutamic acid, with another acidic residue; replacement of a residue bearing an amide group, such as asparagine and glutamine, with another residue bearing an amide group; exchange of a basic residue, such as lysine and arginine, with another basic residue; and replacement of an aromatic residue, such as phenylalanine and tyrosine, with another aromatic residue. In some embodiments, the polypeptide has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more amino acid substitutions, additions, insertions, or deletions. [0024] In some embodiments, the polypeptide has fatty acid decarboxylase activity. [0025] In another aspect, the invention features an isolated polynucleotide comprising a nucleotide sequence encoding a polypeptide having the same biological activity as a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14, wherein the polynucleotide comprises: (i) the nucleotide sequence of SEQ ID NO:1, 4, 6, 8,
9, 11, or 13 or a fragment thereof, or (ii) a nucleotide sequence that hybridizes to a complement of SEQ ID NO: 1 , 4, 6, 8, 9, 11 , or 13 or to a fragment thereof. In some embodiments, the biological activity is fatty acid decarboxylase activity. In some embodiments, the nucleotide sequence hybridizes to a complement of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13 or to a fragment thereof under low stringency, medium stringency, high stringency, or very high stringency conditions.
[0026] In some embodiments, the polynucleotide comprises a sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14. [0027] In other embodiments, a polynucleotide described herein is isolated from a bacterium, plant, insect, yeast, fungus, or mammal. In some embodiments, the polynucleotide is isolated from a bacterium, for example, a Gram positive or Gram negative bacterium. In specific embodiments, the bacterium is a member of the genus Jeotgalicoccus, Corynebacterium, Kokuria, Methylobacterium, or Bacillus. For example, the bacterium is selected from the group consisting of Jeotgalicoccus halotolerans, Jeotgalicoccus psychrophilus, Jeotgalicoccus sp. ATCC 8456, Jeotgalicoccus pinnipedalis, Corynebacterium efficiens, Kokuria rhizophila, Methylobacterium populi, and Bacillus subtilis. [0028] In other embodiments, the isolated polynucleotide includes an operably linked promoter.
[0029] In another aspect, the invention features an isolated polypeptide that includes the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14, or a biologically active fragment thereof. In some embodiments, the polypeptide consists of the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 or a biologically active fragment thereof. In some embodiments, the fragment is at least about 25 amino acids in length, for example, at least about 30, at least about 40, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, or at least about 250 amino acids in length. In certain embodiments, the fragment has fatty acid decarboxylase activity.
[0030] In yet another aspect, the invention features an isolated polypeptide that includes the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more amino acid substitutions, additions, insertions, or deletions. In some embodiments, the polypeptide includes the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more conservative amino acid substitutions. For example, the polypeptide includes one or more of the following conservative amino acid substitutions: replacement of an aliphatic amino acid,
such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid; replacement of a serine with a threonine; replacement of a threonine with a serine; replacement of an acidic residue, such as aspartic acid and glutamic acid, with another acidic residue; replacement of a residue bearing an amide group, such as asparagine and glutamine, with another residue bearing an amide group; exchange of a basic residue, such as lysine and arginine, with another basic residue; and replacement of an aromatic residue, such as phenylalanine and tyrosine, with another aromatic residue.
[0031] In some embodiments, the polypeptide has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more amino acid substitutions, additions, insertions, or deletions. In some embodiments, the isolated polypeptide has fatty acid decarboxylase activity.
[0032] In another aspect, the invention features an isolated polypeptide that includes the amino acid sequence F-X-X-E-[VI]-[RK]-R-X- Y-P-F-{F}-P-X-[LIV], where X is any amino acid and {F} stands for any amino acid except Phe; and wherein the polypeptide has fatty acid decarboxylase activity. In an alternate embodiment, the invention features an isolated polypeptide that includes the amino acid sequence P-X(6)-[LI]-X(4)-{G}-[VI]-[HQM]-X- [MLV]-D-G-X(2)-H-X(2)-R-K, where X is any amino acid and{G} stands for any amino acid except GIy; and wherein the polypeptide has fatty acid decarboxylase activity. In another embodiment, the invention features an isolated polypeptide that includes the amino acid sequence [AC]-[AG]-[IV]-[DE]-[IL]-X-N-X(2)-R-P-X-[VI]-A-X(3)-[FY]-X(2)-F-X(3)- A-[LMV]-X-[DE] where X is any amino acid; and wherein the polypeptide has fatty acid decarboxylase activity. In another embodiment, the invention features an isolated polypeptide that includes the amino acid sequence {RK}-X(6)-[LMV]-X(4)-[AC]-[AG]-[IV]-[DE]-[IL]- X-N-X(2)-R-P-X-[VI]-A-X(3)-[FY]-X(2)-F-X(3)-A-[LMV]-X-[DE] where X is any amino acid and{RK} stands for any amino acid except Arg and Lys; and wherein the polypeptide has fatty acid decarboxylase activity.
[0033] In another aspect, the invention features a recombinant vector that includes a polynucleotide described herein. In some embodiments, the vector is a plasmid. In other embodiments, the vector further includes a promoter operably linked to the polynucleotide, for example, a developmentally-regulated, an organelle-specific, a tissue-specific, an inducible, a constitutive, or a cell-specific promoter.
[0034] In some embodiments, the vector includes at least one sequence selected from the group consisting of: (a) a regulatory sequence operatively coupled to the polynucleotide; (b) a selection marker operatively coupled to the polynucleotide; (c) a marker sequence operatively coupled to the polynucleotide; (d) a purification moiety operatively coupled to the polynucleotide; (e) a secretion sequence operatively coupled to the polynucleotide; and (f) a targeting sequence operatively coupled to the polynucleotide.
[0035] In another aspect, the invention features a host cell comprising a recombinant vector described herein, for example, a recombinant vector that includes a polynucleotide sequence described herein. In some embodiments, the host cell expresses a polypeptide encoded by the recombinant vector, for example, encoded by a polynucleotide sequence included in the recombinant vector. In some embodiments, the polynucleotide sequence is stably incorporated into the genomic DNA of the host cell. In particular embodiments, the expression of the polynucleotide sequence is under the control of a regulated promoter region.
[0036] In some embodiments, the host cell is a mammalian cell, plant cell, insect cell, yeast cell, fungus cell, a filamentous fungi cell, or bacterial cell.
[0037] In some embodiments, the host cell is a Gram positive bacterial cell. In other embodiments, the host cell is a Gram negative bacterial host cell.
[0038] In some embodiments, the host cell is from a member of the genus Escherichia,
Bacillus, Lactobacillus, Rhodococcus, Pseudomonas, Aspergillus, Trichoderma, Neurospora,
Fusarium, Humicola, Rhizomucor, Kluyveromyces, Pichia, Mucor, Myceliophtora,
Penicillium, Phanerochaete, Pleurotus, Trametes, Chrysosporium, Saccharomyces,
Stenotrophomonas, Schizosaccharomyces, Yarrowia, or Streptomyces.
[0039] In particular embodiments, the host cell is a Bacillus lentus cell, a Bacillus brevis cell, a Bacillus stearothermophilus cell, a Bacillus licheniformis cell, a Bacillus alkalophilus cell, a
Bacillus coagulans cell, a Bacillus circulans cell, a Bacillus pumilis cell, a Bacillus thuringiensis cell, a Bacillus clausii cell, a Bacillus megaterium cell, a Bacillus subtilis cell, or a Bacillus amyloliquefaciens cell.
[0040] In other embodiments, the host cell is a Trichoderma koningii cell, a Trichoderma viride cell, a Trichoderma reesei cell, a Trichoderma longibrachiatum cell, an Aspergillus awamori cell, an Aspergillus fumigates cell, an Aspergillus foetidus cell, an Aspergillus nidulans cell, an Aspergillus niger cell, an Aspergillus oryzae cell, a Humicola insolens cell, a
Humicola lanuginose cell, a Rhodococcus opacus cell, a Rhizomucor miehei cell, or a Mucor michei cell.
[0041] In yet other embodiments, the host cell is a Streptomyces lividans cell or a Streptomyces murinus cell. In other embodiments, the host cell is an Actinomycetes cell. [0042] In some embodiments, the host cell is a CHO cell, a COS cell, a VERO cell, a BHK cell, a HeLa cell, a CvI cell, an MDCK cell, a 293 cell, a 3T3 cell, or a PC12 cell. [0043] In particular embodiments, the host cell is an E. coli cell, such as a strain B, a strain C, a strain K, or a strain W E. coli cell.
[0044] In certain embodiments, the host cell produces an olefin, for example, a terminal olefin. In some embodiments, the olefin is secreted by the host cell.
[0045] In other embodiments, the host cell expresses a reduced level of an acyl-CoA synthase relative to a corresponding wild type host cell. In some embodiments, a gene encoding an acyl-CoA synthase is attenuated or deleted in the host cell. In certain embodiments, the gene is fadDJadK, BH3103, yhfL, Pfl-4354, EAVl 5023, fadDl,fadD2, RPC_4074,fadDD35, fadDD22,faalp,faa3p, lcfA, or the gene encoding the protein having the amino acid sequence Accession No. ZP O 1644857. In particular embodiments, the gene is fadD. [0046] In another aspect, the invention features a genetically engineered microorganism comprising an exogenous control sequence stably incorporated into the genomic DNA of the microorganism. In one embodiment, the control sequence is integrated upstream of a polynucleotide comprising a nucleotide sequence having at least about 70% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13. In some embodiments, the nucleotide sequence has at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13. In some embodiments, the nucleotide sequence is SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
[0047] In some embodiments, the polynucleotide is endogenous to the microorganism. In some embodiments, the microorganism expresses an increased level of a polypeptide encoded by the polynucleotide relative to a wild-type microorganism. In other embodiments, the microorganism produces an increased level of an olefin relative to a wild-type microorganism. In some embodiments, the microorganism is a bacterium, such as a Jeotgalicoccus bacterium.
[0048] In other embodiments, the microorganism expresses a reduced level of an acyl-CoA synthase relative to a corresponding wild type microorganism. In some embodiments, a gene encoding an acyl-CoA synthase is attenuated or deleted in the microorganism. In certain embodiments, the gene is fadDJadK, BH3103,yhfL, Pfl-4354, EAV15023,fadDl,fadD2, RPC_4074,fadDD35,fadDD22,faalp,faa3p, lcfA, or the gene encoding the protein having the amino acid sequence Accession No. ZP O 1644857. In particular embodiments, the gene isfadD.
[0049] In another aspect, the invention features a polypeptide produced by a host cell described herein.
[0050] In yet another aspect, the invention features a method of producing an olefin. The method comprises culturing a host cell described herein, for example, a host cell comprising a nucleotide sequence described herein, under conditions sufficient to allow expression of a polypeptide encoded by the nucleotide sequence.
[0051] In some embodiments, the nucleotide sequence has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13. In some embodiments, the nucleotide sequence is SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
[0052] In other embodiments, the nucleotide sequence hybridizes to a complement of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13 or to a fragment thereof, for example, under low stringency, medium stringency, high stringency, or very high stringency conditions. [0053] In other embodiments, the nucleotide sequence encodes a polypeptide comprising: (i) the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14; or (ii) the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more amino acid substitutions, additions, insertions, or deletions. In some embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more conservative amino acid substitutions. For example, the polypeptide comprises one or more of the following conservative amino acid substitutions: replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid; replacement of a serine with a threonine; replacement of a threonine with a serine; replacement of an acidic residue, such as aspartic acid and glutamic acid, with another acidic residue; replacement of a
residue bearing an amide group, such as asparagine and glutamine, with another residue bearing an amide group; exchange of a basic residue, such as lysine and arginine, with another basic residue; and replacement of an aromatic residue, such as phenylalanine and tyrosine, with another aromatic residue. In some embodiments, the polypeptide has about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more amino acid substitutions, additions, insertions, or deletions. In some embodiments, the polypeptide has fatty acid decarboxylase activity.
[0054] In other embodiments, the nucleotide sequence encodes a polypeptide having the same biological activity as a polypeptide comprising the amino acid sequence of SEQ ID
NO:2, 5, 7, 10, 12, or 14. In some embodiments, the nucleotide sequence is SEQ ID NO:1, 4,
6, 8, 9, 11, or 13 or a fragment thereof. In other embodiments, the nucleotide sequence hybridizes to a complement of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13 or to a fragment thereof, for example, under low stringency, medium stringency, high stringency, or very high stringency conditions. In some embodiments, the biological activity is fatty acid decarboxylase activity.
[0055] In some embodiments, the nucleotide sequence encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14.
[0056] In some embodiments, the host cell is selected from the group consisting of a mammalian cell, plant cell, insect cell, yeast cell, fungus cell, filamentous fungi cell, and bacterial cell.
[0057] In some embodiments, the host cell is a Gram positive bacterial cell. In other embodiments, the host cell is a Gram negative bacterial cell.
[0058] In some embodiments, the host cell is selected from the genus Escherichia, Bacillus,
Lactobacillus, Rhodococcus, Pseudomonas, Aspergillus, Trichoderma, Neurospora,
Fusarium, Humicola, Rhizomucor, Kluyveromyces, Pichia, Mucor, Myceliophtora,
Penicillium, Phanerochaete, Pleurotus, Trametes, Chrysosporium, Saccharomyces,
Stenotrophamonas,
[0059] In particular embodiments, the host cell is a Bacillus lentus cell, a Bacillus brevis cell, a Bacillus stearothermophilus cell, a Bacillus licheniformis cell, a Bacillus alkalophilus cell, a
Bacillus coagulans cell, a Bacillus circulans cell, a Bacillus pumilis cell, a Bacillus thuringiensis cell, a Bacillus clausii cell, a Bacillus megaterium cell, a Bacillus subtilis cell, or a Bacillus amyloliquefaciens cell.
[0060] In other embodiments, the host cell is a Trichoderma koningii cell, a Trichoderma viride cell, a Trichoderma reesei cell, a Trichoderma longibrachiatum cell, an Aspergillus awamori cell, an Aspergillus fumigates cell, an Aspergillus foetidus cell, an Aspergillus nidulans cell, an Aspergillus niger cell, an Aspergillus oryzae cell, a Humicola insolens cell, a
Humicola lanuginose cell, a Rhodococcus opacus cell, a Rhizomucor miehei cell, or a Mucor michei cell.
[0061] In yet other embodiments, the host cell is a Streptomyces lividans cell or a
Streptomyces murinus cell. In other embodiments, the host cell is an Actinomycetes cell.
[0062] In some embodiments, the host cell is a CHO cell, a COS cell, a VERO cell, a BHK cell, a HeLa cell, a CvI cell, an MDCK cell, a 293 cell, a 3T3 cell, or a PC12 cell.
[0063] In particular embodiments, the host cell is an E. coli cell, such as a strain B, a strain C, a strain K, or a strain W E. coli cell.
[0064] In some embodiments, the olefin is a terminal olefin. In some embodiments, the terminal olefin is a C3-C25 terminal olefin. For example, the terminal olefin is a C3, C4, C5,
C6, C7, C8, C9, C10, C11, On, C13, C14, C15, C16, C17, C18, Cj9, C20, C21, C22, C23, C24, or C25 terminal olefin. In some embodiments, the terminal olefin is nonadecene, methylnonadecene, heptadecene, methylheptadecene, or pentadecene.
[0065] In some embodiments, the terminal olefin is an unsaturated terminal olefin or a monounsaturated terminal olefin. In yet other embodiments, the terminal olefin is a straight chain terminal olefin, a branched chain terminal olefin, or a terminal olefin that includes a cyclic moiety.
[0066] In certain embodiments, the host cell overexpresses a fatty acid substrate. In some embodiments, the method further includes transforming the host cell with a nucleic acid that encodes a fatty acid enzyme (e.g., a fatty acid enzyme described herein) and the host cell overexpresses a fatty acid substrate. In other embodiments, the method further includes culturing the host cell in the presence of at least one fatty acid substrate.
[0067] In certain embodiments, the fatty acid substrate is a C6-C26 fatty acid substrate. For example, the fatty acid substrate is a C6, C7, C8, C9, Ci0, Cn, C12, C13, C14, Ci5, C16, Ci7, Ci8,
Ci9, C2O, C21, C22, C23, C24, C25, or a C26 fatty acid substrate. In particular embodiments, the fatty acid substrate is methyl eicosanoic acid, eicosanoic acid, methyl octadecanoic acid, stearic acid, or palmitic acid.
[0068] In some embodiments, the fatty acid substrate is an unsaturated fatty acid substrate, a monounsaturated fatty acid substrate, or a saturated fatty acid substrate. In other embodiments, the fatty acid substrate is a straight chain fatty acid substrate, a branched chain fatty acid substrate, or a fatty acid substrate that includes a cyclic moiety. [0069] In other embodiments, the host cell expresses a reduced level of an acyl-CoA synthase relative to a corresponding wild type host cell. In some embodiments, a gene encoding an acyl-CoA synthase is attenuated or deleted in the host cell. In certain embodiments, the gene is fadDJadK, BH3103,yhfL, Pfl-4354, EAV15023,fadDl,fadD2, RPCJ074,fadDD35, fadDD22,faalp,faa3p, lcfA, or the gene encoding the protein having the amino acid sequence Accession No. ZP O 1644857. In particular embodiments, the gene is fadD. [0070] In some embodiments, the method further includes isolating the olefin from the host cell or from the culture medium. In other embodiments, the method further includes cracking or refining the olefin.
[0071] In another aspect, the invention features a method of making an olefin. The method includes contacting a biological substrate with an isolated polypeptide having the same biological activity as a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14.
[0072] In some embodiments, the olefin is a terminal olefin. In some embodiments, the terminal olefin is a C3-C25 terminal olefin. For example, the terminal olefin is a C3, C4, C5, C6, C7, C8, C9, C10, C11, C12, C13, C14, C15, C16, C17, Cj8, C19, C20, C21, C22, C23, C24, or C25 terminal olefin. In some embodiments, the terminal olefin is nonadecene, methylnonadecene, heptadecene, methylheptadecene, or pentadecene.
[0073] In some embodiments, the terminal olefin is an unsaturated terminal olefin or a monounsaturated terminal olefin. In yet other embodiments, the terminal olefin is a straight chain terminal olefin, a branched chain terminal olefin, or a terminal olefin that includes a cyclic moiety.
[0074] In some embodiments, the biological substrate is a fatty acid substrate. In certain embodiments, the fatty acid substrate is a C6-C26 fatty acid substrate. For example, the fatty acid substrate is a C6, C7, C8, C9, Ci0, C11, C12, C13, C14, C15, C16, C17, Ci8, Cj9, C20, C2i, C22, C23, C24, C25, or a C26 fatty acid substrate. In particular embodiments, the fatty acid substrate is methyl eicosanoic acid, eicosanoic acid, methyl octadecanoic acid, stearic acid, or palmitic acid.
[0075] In some embodiments, the fatty acid substrate is an unsaturated fatty acid substrate, a monounsaturated fatty acid substrate, or a saturated fatty acid substrate. In other embodiments, the fatty acid substrate is a straight chain fatty acid substrate, a branched chain fatty acid substrate, or a fatty acid substrate that includes a cyclic moiety.
[0076] In another aspect, the invention features a method of making an olefin. The method includes contacting a biological substrate with an isolated polypeptide encoded by a nucleotide sequence described herein. In some embodiments, the nucleotide sequence has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about
90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13. In some embodiments, the nucleotide sequence is SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
[0077] In other embodiments, the nucleotide sequence hybridizes to a complement of SEQ
ID NO:1, 4, 6, 8, 9, 11, or 13 or to a fragment thereof, for example, under low stringency, medium stringency, high stringency, or very high stringency conditions.
[0078] In some embodiments, the olefin is a terminal olefin. In some embodiments, the terminal olefin is a C3-C25 terminal olefin. For example, the terminal olefin is a C3, C4, C5,
C6, C7, C8, C9, C10, Cn, C12, Ci3, C14, C15, Cj6, C17, C18, C19, C20, C21, C22, C23, C24, or C25 terminal olefin. In some embodiments, the terminal olefin is nonadecene, methylnonadecene, heptadecene, methylheptadecene, or pentadecene.
[0079] In some embodiments, the terminal olefin is an unsaturated terminal olefin or a monounsaturated terminal olefin. In yet other embodiments, the terminal olefin is a straight chain terminal olefin, a branched chain terminal olefin, or a terminal olefin that includes a cyclic moiety.
[0080] In some embodiments, the biological substrate is a fatty acid substrate. In certain embodiments, the fatty acid substrate is a C6-C26 fatty acid substrate. For example, the fatty acid substrate is a C6, C7, C8, C9, Ci0, Cn, C12, C13, C14, C15, Cj6, Cn, C18, C19, C20, C21, C22,
C23, C24, C25, or a C26 fatty acid substrate. In particular embodiments, the fatty acid substrate is methyl eicosanoic acid, eicosanoic acid, methyl octadecanoic acid, stearic acid, or palmitic acid.
[0081] In some embodiments, the fatty acid substrate is an unsaturated fatty acid substrate, a monounsaturated fatty acid substrate, or a saturated fatty acid substrate. In other
embodiments, the fatty acid substrate is a straight chain fatty acid substrate, a branched chain fatty acid substrate, or a fatty acid substrate that includes a cyclic moiety. [0082] In another aspect, the invention features a method of making an olefin. The method includes contacting a biological substrate with an isolated polypeptide described herein. In some embodiments, the polypeptide includes the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 or a biologically active fragment thereof. In some embodiments, the polypeptide consists of the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 or a biologically active fragment thereof. In some embodiments, the fragment is at least about 25 amino acids in length, for example, at least about 30, at least about 40, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, or at least about 250 amino acids in length. In certain embodiments, the fragment has fatty acid decarboxylase activity.
[0083] In other embodiments, the polypeptide includes the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more amino acid substitutions, additions, insertions, or deletions. In some embodiments, the polypeptide includes the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more conservative amino acid substitutions. For example, the polypeptide includes one or more of the following conservative amino acid substitutions: replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid; replacement of a serine with a threonine; replacement of a threonine with a serine; replacement of an acidic residue, such as aspartic acid and glutamic acid, with another acidic residue; replacement of a residue bearing an amide group, such as asparagine and glutamine, with another residue bearing an amide group; exchange of a basic residue, such as lysine and arginine, with another basic residue; and replacement of an aromatic residue, such as phenylalanine and tyrosine, with another aromatic residue. In some embodiments, the polypeptide has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more amino acid substitutions, additions, insertions, or deletions. In some embodiments, the isolated polypeptide has fatty acid decarboxylase activity.
[0084] In other embodiments, the polypeptide includes the amino acid sequence F-X-X-E- [VI]-[RK]-R-X-Y-P-F-(F)-P-X-[LIV]; and wherein the polypeptide has fatty acid decarboxylase activity. In an alternate embodiment, the polypeptide includes the amino acid sequence P-X(6)-[LI]-X(4)-{G}-[VI]-[HQM]-X-[MLV]-D-G-X(2)-H-X(2)-R-K; and
wherein the polypeptide has fatty acid decarboxylase activity. In another embodiment, the polypeptide includes the amino acid sequence [AC]-[AG]-[IV]-[DE]-[IL]-X-N-X(Z)-R-P-X-
[VI]-A-X(S)-[FY]-X(I)-F-X(S)-A-[LMV]-X-[DE]; and wherein the polypeptide has fatty acid decarboxylase activity. In another embodiment, the polypeptide includes the amino acid sequence {RK}-X(6)-[LMV]-X(4)-[AC]-[AG]-[IV]-[DE]-[IL]-X-N-X(2)-R-P-X-[VI]-A-
X(3)-[FY]-X(2)-F-X(3)-A-[LMV]-X-[DE]; and wherein the polypeptide has fatty acid decarboxylase activity. In the sequences described herein, X is any amino acid, [AB] is A or
B (e.g., [VI] is valine or isoleucine), {A} is any amino acid except A (e.g., {F} stands for any amino acid except Phe), X is any amino acid, and X(n) is X repeated n times (e.g., X(4) is X-
X-X-X).
[0085] In some embodiments, the olefin is a terminal olefin. In some embodiments, the terminal olefin is a C3-C25 terminal olefin. For example, the terminal olefin is a C3, C4, C5,
C6, C7, C8, C9, C1O, Cn, Cj2, Co, Cj4, C15, C16, C17, Cj8, C19, C20, C21, C22, C23, C24, or C25 terminal olefin. In some embodiments, the terminal olefin is nonadecene, methylnonadecene, heptadecene, methylheptadecene, or pentadecene.
[0086] In some embodiments, the terminal olefin is an unsaturated terminal olefin or a monounsaturated terminal olefin. In yet other embodiments, the terminal olefin is a straight chain terminal olefin, a branched chain terminal olefin, or a terminal olefin that includes a cyclic
[0087] In some embodiments, the biological substrate is a fatty acid substrate. In certain embodiments, the fatty acid substrate is a C6-C26 fatty acid substrate. For example, the fatty acid substrate is a C6, C7, C8, C9, do, Cn, C12, C13, C14, Cj5, C16, C17, Cj8, Cj9, C20, C2i, C22,
C23, C24, C25, or a C26 fatty acid substrate. In particular embodiments, the fatty acid substrate is methyl eicosanoic acid, eicosanoic acid, methyl octadecanoic acid, stearic acid, or palmitic acid.
[0088] In some embodiments, the fatty acid substrate is an unsaturated fatty acid substrate, a monounsaturated fatty acid substrate, or a saturated fatty acid substrate. In other embodiments, the fatty acid substrate is a straight chain fatty acid substrate, a branched chain fatty acid substrate, or a fatty acid substrate that includes a cyclic moiety.
[0089] In another aspect, the invention features an olefin produced by any of the methods described herein. In particular embodiments, the olefin has a δ1 C of about -15.4 or greater.
For example, the olefin has a 613C of about -15.4 to about -10.9, for example, about -13.92 to
about -13.84. In other embodiments, the olefin has an fM 14C of at least about 1.003. For example, the olefin has an fM 14C of at least about 1.01 or at least about 1.5. In some embodiments, the olefin has an fM 14C of about 1.111 to about 1.124.
[0090] In another aspect, the invention features a biofuel that includes an olefin produced by any of the methods described herein. In particular embodiments, the olefin has a 613C of about -15.4 or greater. For example, the olefin has a 513C of about -15.4 to about -10.9, for example, about -13.92 to about -13.84. In other embodiments, the olefin has an fM 14C of at least about 1.003. For example, the olefin has an fM 14C of at least about 1.01 or at least about 1.5. In some embodiments, the olefin has an fvi ' 4C of about 1.111 to about 1.124. In some embodiments, the biofuel is a biodiesel, gasoline, or jet fuel.
Definitions
[0091] Throughout the specification, a reference may be made using an abbreviated gene name or polypeptide name, but it is understood that such an abbreviated gene or polypeptide name represents the genus of genes or polypeptides. Such gene names include all genes encoding the same polypeptide and homologous polypeptides having the same physiological function. Polypeptide names include all polypeptides that have the same activity (e.g., that catalyze the same fundamental chemical reaction).
[0092] The accession numbers referenced herein are derived from the NCBI database (National Center for Biotechnology Information) maintained by the National Institute of Health, U.S.A. The accession numbers are as provided in the database as of August 28, 2008. [0093] EC numbers are established by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB) (available at http://www.chem.qmul.ac.uk/iubmb/enzyme/). The EC numbers referenced herein are derived from the KEGG Ligand database, maintained by the Kyoto Encyclopedia of Genes and Genomics, sponsored in part by the University of Tokyo. The EC numbers are as provided in the database as of March, 2008.
[0094] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
[0095] The term "about" is used herein to mean a value ± 20% of a given numerical value. Thus, "about 60%" means a value of between 60 ± (20% of 60) (i.e., between 48 and 70). [0096] As used herein, the term "attenuate" means to weaken, reduce or diminish. For example, a polypeptide can be attenuated by modifying the polypeptide to reduce its activity (e.g., by modifying a nucleotide sequence that encodes the polypeptide). [0097] As used herein, the term "biodiesel" means a biofuel that can be a substitute of diesel, which is derived from petroleum. Biodiesel can be used in internal combustion diesel engines in either a pure form, which is referred to as "neat" biodiesel, or as a mixture in any concentration with petroleum-based diesel. Biodiesel can include esters or hydrocarbons, such as olefins (e.g., terminal olefins).
[0098] As used therein, the term "biofuel" refers to any fuel derived from biomass. Biofuels can be substituted for petroleum based fuels. For example, biofuels are inclusive of transportation fuels (e.g., gasoline, diesel, jet fuel, etc.), heating fuels, and electricity- generating fuels. Biofuels are a renewable energy source.
[0099] As used herein, the term "biomass" refers to a carbon source derived from biological material. Biomass can be converted into a biofuel. One exemplary source of biomass is plant matter. For example, corn, sugar cane, or switchgrass can be used as biomass. Another non- limiting example of biomass is animal matter, for example cow manure. Biomass also includes waste products from industry, agriculture, forestry, and households. Examples of such waste products that can be used as biomass are fermentation waste, straw, lumber, sewage, garbage, and food leftovers. Biomass also includes sources of carbon, such as carbohydrates (e.g., monosaccharides, disaccharides, or polysaccharides). [0100] As used herein, the phrase "carbon source" refers to a substrate or compound suitable to be used as a source of carbon for prokaryotic or simple eukaryotic cell growth. Carbon sources can be in various forms, including, but not limited to polymers, carbohydrates, acids, alcohols, aldehydes, ketones, amino acids, peptides, and gases (e.g., CO and CO2). These include, for example, various monosaccharides, such as glucose, fructose, mannose, and galactose; oligosaccharides, such as fructo-oligosaccharide and galacto-oligosaccharide; polysaccharides such as xylose and arabinose; disaccharides, such as sucrose, maltose, and turanose; cellulosic material, such as methyl cellulose and sodium carboxymethyl cellulose; saturated or unsaturated fatty acid esters, such as succinate, lactate, and acetate; alcohols, such as ethanol or mixtures thereof. The carbon source can also be a product of
photosynthesis, including, but not limited to, glucose. A preferred carbon source is biomass. Another preferred carbon source is glucose.
[0101] As used herein, a "cloud point lowering additive" is an additive added to a composition to decrease or lower the cloud point of a solution.
[0102] As used herein, the phrase "cloud point of a fluid" means the temperature at which dissolved solids are no longer completely soluble. Below this temperature, solids begin precipitating as a second phase giving the fluid a cloudy appearance. In the petroleum industry, cloud point refers to the temperature below which a solidified material or other heavy hydrocarbon crystallizes in a crude oil, refined oil, or fuel to form a cloudy appearance. The presence of solidified materials influences the flowing behavior of the fluid, the tendency of the fluid to clog fuel filters, injectors, etc., the accumulation of solidified materials on cold surfaces {e.g., a pipeline or heat exchanger fouling), and the emulsion characteristics of the fluid with water.
[0103] A nucleotide sequence is "complementary" to another nucleotide sequence if each of the bases of the two sequences matches (i.e., is capable of forming Watson Crick base pairs). The term "complementary strand" is used herein interchangeably with the term "complement". The complement of a nucleic acid strand can be the complement of a coding strand or the complement of a non-coding strand.
[0104] As used herein, the term "conditions sufficient to allow expression" means any conditions that allow a host cell to produce a desired product, such as a polypeptide or olefin described herein. Suitable conditions include, for example, fermentation conditions. Fermentation conditions can comprise many parameters, such as temperature ranges, levels of aeration, and media composition. Each of these conditions, individually and in combination, allows the host cell to grow. Exemplary culture media include broths or gels. Generally, the medium includes a carbon source, such as glucose, fructose, cellulose, or the like, that can be metabolized by a host cell directly. In addition, enzymes can be used in the medium to facilitate the mobilization (e.g., the depolymerization of starch or cellulose to fermentable sugars) and subsequent metabolism of the carbon source.
[0105] To determine if conditions are sufficient to allow expression, a host cell can be cultured, for example, for about 4, 8, 12, 24, 36, or 48 hours. During and/or after culturing, samples can be obtained and analyzed to determine if the conditions allow expression. For
example, the host cells in the sample or the medium in which the host cells were grown can be tested for the presence of a desired product. When testing for the presence of a product, assays, such as, but not limited to, TLC, HPLC, GC/FID, GC/MS, LC/MS, MS, can be used.
[0106] It is understood that the polypeptides described herein may have additional conservative or non-essential amino acid substitutions, which do not have a substantial effect on the polypeptide functions. Whether or not a particular substitution will be tolerated (i.e., will not adversely affect desired biological properties, such as decarboxylase activity) can be determined as described in Bowie et al. Science (1990) 247:1306 1310. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0107] As used herein, "control element" means a transcriptional control element. Control elements include promoters and enhancers. The term "promoter element," "promoter," or "promoter sequence" refers to a DNA sequence that functions as a switch that activates the expression of a gene. If the gene is activated, it is said to be transcribed or participating in transcription. Transcription involves the synthesis of mRNA from the gene. A promoter, therefore, serves as a transcriptional regulatory element and also provides a site for initiation of transcription of the gene into mRNA. Control elements interact specifically with cellular proteins involved in transcription (Maniatis et al, Science 236:1237, 1987).
[0108] As used herein, the term "fatty acid" means a carboxylic acid having the formula RCOOH. R represents an aliphatic group, preferably an alkyl group. R can comprise between about 4 and about 22 carbon atoms. Fatty acids can be saturated, monounsaturated, or polyunsaturated. In a preferred embodiment, the fatty acid is made from a fatty acid biosynthetic pathway.
[0109] As used herein, the term "fatty acid biosynthetic pathway" means a biosynthetic pathway that produces fatty acids. The fatty acid biosynthetic pathway includes fatty acid
enzymes that can be engineered, as described herein, to produce fatty acids, and in some embodiments can be expressed with additional enzymes to produce fatty acids having desired carbon chain characteristics.
[0110] As used herein, "fatty acid enzyme" means any enzyme involved in fatty acid biosynthesis. Fatty acid enzymes can be expressed or overexpressed in host cells to produce fatty acids. Non-limiting examples of fatty acid enzymes include fatty acid synthases and thioesterases.
[0111] As used herein, "fraction of modern carbon" or 'TM" has the same meaning as defined by National Institute of Standards and Technology (NIST) Standard Reference Materials (SRJVIs) 4990B and 4990C, known as oxalic acids standards HOxI and HOxII, respectively. The fundamental definition relates to 0.95 times the 14C /12C isotope ratio HOxI (referenced to AD 1950). This is roughly equivalent to decay-corrected pre-Industrial Revolution wood. For the current living biosphere (plant material), fu is approximately 1.1.
[0112] Calculations of "homology" between two sequences can be performed as follows. The sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence that is aligned for comparison purposes is at least about 30%, preferably at least about 40%, more preferably at least about 50%, even more preferably at least about 60%, and even more preferably at least about 70%, at least about 80%, at least about 90%, or about 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein, amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid "homology"). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
[0113] The comparison of sequences and determination of percent homology between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment,
the percent homology between two amino acid sequences is determined using the Needleman and Wunsch (1970), J. MoI. Biol. 48:444 453, algorithm that has been incorporated into the GAP program in the GCG software package, using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent homology between two nucleotide sequences is determined using the GAP program in the GCG software package, using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and the one that should be used if the practitioner is uncertain about which parameters should be applied to determine if a molecule is within a homology limitation of the claims) are a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
[0114] As used herein, a "host cell" is a cell used to produce a product described herein (e.g., an olefin described herein). A host cell can be modified to express or overexpress selected genes or to have attenuated expression of selected genes. Non-limiting examples of host cells include plant, animal, human, bacteria, yeast, or filamentous fungi cells.
[0115] As used herein, the term "hybridizes under low stringency, medium stringency, high stringency, or very high stringency conditions" describes conditions for hybridization and washing. Guidance for performing hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N. Y. (1989), 6.3.1 - 6.3.6. Aqueous and nonaqueous methods are described in that reference and either method can be used. Specific hybridization conditions referred to herein are as follows: 1) low stringency hybridization conditions in 6X sodium chloride/sodium citrate (SSC) at about 450C, followed by two washes in 0.2X SSC, 0.1% SDS at least at 5O0C (the temperature of the washes can be increased to 550C for low stringency conditions); 2) medium stringency hybridization conditions in 6X SSC at about 450C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 6O0C; 3) high stringency hybridization conditions in 6X SSC at about 45°C, followed by one or more washes in 0.2.X SSC, 0.1% SDS at 650C; and preferably 4) very high stringency hybridization conditions are 0.5M sodium phosphate, 7% SDS at 650C, followed by one or more washes at 0.2X SSC, 1% SDS at 650C. Very high stringency conditions (4) are the preferred conditions unless otherwise specified.
[0116] The term "isolated" as used herein with respect to nucleic acids, such as DNA or RNA, refers to molecules separated from other DNAs or RNAs, respectively, that are present in the natural source of the nucleic acid. Moreover, by an "isolated nucleic acid" is meant to include nucleic acid fragments, which are not naturally occurring as fragments and would not be found in the natural state. The term "isolated" is also used herein to refer to polypeptides, which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides. The term "isolated" as used herein also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques. The term "isolated" as used herein also refers to a nucleic acid or peptide that is substantially free of chemical precursors or other chemicals when chemically synthesized.
[0117] As used herein, the "level of expression of a gene in a cell" refers to the level of mRNA, pre-mRNA nascent transcript(s), transcript processing intermediates, mature mRNA(s), and degradation products encoded by the gene in the cell.
[0118] As used herein, the term "microorganism" means prokaryotic and eukaryotic microbial species from the domains Archaea, Bacteria and Eucarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista. The terms "microbial cells" (i.e., cells from microbes) and "microbes" are used interchangeably and refer to cells or small organisms that can only be seen with the aid of a microscope.
[0119] As used herein, the term "nucleic acid" refers to polynucleotides, such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides, ESTs, chromosomes, cDNAs, mRNAs, and rRNAs.
[0120] "Olefin" and "alkene" are used interchangeably herein, and "terminal olefin," "α-olefin," and "terminal alkene" are used interchangeably herein.
[0121] As used herein, the term "operably linked" means that selected nucleotide sequence (e.g., encoding a polypeptide described herein) is in proximity with a promoter to allow the promoter to regulate expression of the selected DNA. In addition, the promoter is located upstream of the selected nucleotide sequence in terms of the direction of transcription and
translation. By "operably linked" is meant that a nucleotide sequence and a regulatory sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence(s).
[0122] The term "or" is used herein to mean, and is used interchangeably with, the term "and/or," unless context clearly indicates otherwise.
[0123] As used herein, "overexpress" means to express or cause to be expressed a nucleic acid, polypeptide, or hydrocarbon in a cell at a greater concentration than is normally expressed in a corresponding wild-type cell. For example, a polypeptide can be "overexpressed" in a recombinant host cell when the polypeptide is present in a greater concentration in the recombinant host cell compared to its concentration in a non- recombinant host cell of the same species.
[0124] As used herein, "partition coefficient" or "P," is defined as the equilibrium concentration of a compound in an organic phase divided by the concentration at equilibrium in an aqueous phase (e.g. , fermentation broth). In one embodiment of a bi-phasic system described herein, the organic phase is formed by the olefin during the production process. However, in some examples, an organic phase can be provided, such as by providing a layer of octane, to facilitate product separation. When describing a two phase system, the partition characteristics of a compound can be described as logP. For example, a compound with a logP of 1 would partition 10:1 to the organic phase. A compound with a logP of -1 would partition 1 : 10 to the organic phase. By choosing an appropriate fermentation broth and organic phase, an olefin with a high logP value can separate into the organic phase even at very low concentrations in the fermentation vessel.
[0125] As used herein, the term "purify," "purified," or "purification" means the removal or isolation of a molecule from its environment by, for example, isolation or separation. "Substantially purified" molecules are at least about 60% free, preferably at least about 75% free, and more preferably at least about 90% free from other components with which they are associated. As used herein, these terms also refer to the removal of contaminants from a sample. For example, the removal of contaminants can result in an increase in the percentage of olefins in a sample. For example, when olefins are produced in a host cell, the olefins can be purified by the removal of host cell proteins. After purification, the percentage of olefins in the sample is increased.
[0126] The terms "purify," "purified," and "purification" do not require absolute purity. They are relative terms. Thus, for example, when olefins are produced in host cells, a purified olefin is one that is substantially separated from other cellular components (e.g., nucleic acids, polypeptides, lipids, carbohydrates, or other hydrocarbons). In another example, a purified olefin preparation is one in which the olefin is substantially free from contaminants, such as those that might be present following fermentation. In some embodiments, an olefin is purified when at least about 50% by weight of a sample is composed of the olefin. In other embodiments, an olefin is purified when at least about 60%, 70%, 80%, 85%, 90%, 92%, 95%, 98%, or 99% or more by weight of a sample is composed of the olefin.
[0127] As used herein, the term "recombinant polypeptide" refers to a polypeptide that is produced by recombinant DNA techniques, wherein generally DNA encoding the expressed protein or RNA is inserted into a suitable expression vector and that is in turn used to transform a host cell to produce the polypeptide or RNA.
[0128] As used herein, the term "substantially identical" (or "substantially homologous") is used to refer to a first amino acid or nucleotide sequence that contains a sufficient number of identical or equivalent (e.g., with a similar side chain, e.g., conserved amino acid substitutions) amino acid residues or nucleotides to a second amino acid or nucleotide sequence such that the first and second amino acid or nucleotide sequences have similar activities.
[0129] As used herein, the term "transfection" means the introduction of a nucleic acid (e.g., via an expression vector) into a recipient cell by nucleic acid-mediated gene transfer.
[0130] As used herein, "transformation" refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA. This may result in the transformed cell expressing a recombinant form of an RNA or polypeptide. In the case of antisense expression from the transferred gene, the expression of a naturally-occurring form of the polypeptide is disrupted.
[0131] As used herein, a "transport protein" is a polypeptide that facilitates the movement of one or more compounds in and/or out of a cellular organelle and/or a cell.
[0132] As used herein, a "variant" of polypeptide X refers to a polypeptide having the amino acid sequence of peptide X in which one or more amino acid residues is altered. The variant may have conservative changes or nonconservative changes. Guidance in determining which amino acid residues may be substituted, inserted, or deleted without affecting biological activity may be found using computer programs well known in the art, for example, LASERGENE software (DNASTAR).
[0133] The term "variant," when used in the context of a polynucleotide sequence, may encompass a polynucleotide sequence related to that of a gene or the coding sequence thereof. This definition may also include, for example, "allelic," "splice," "species," or "polymorphic" variants. A splice variant may have significant identity to a reference polynucleotide, but will generally have a greater or lesser number of polynucleotides due to alternative splicing of exons during niRNA processing. The corresponding polypeptide may possess additional functional domains or an absence of domains. Species variants are polynucleotide sequences that vary from one species to another. The resulting polypeptides generally will have significant amino acid identity relative to each other. A polymorphic variant is a variation in the polynucleotide sequence of a particular gene between individuals of a given species.
[0134] As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of useful vector is an episome (i.e., a nucleic acid capable of extra-chromosomal replication). Useful vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids," which refer generally to circular double stranded DNA loops that, in their vector form, are not bound to the chromosome. In the present specification, "plasmid" and "vector" are used interchangeably, as the plasmid is the most commonly used form of vector. However, also included are such other forms of expression vectors that serve equivalent functions and that become known in the art subsequently hereto.
[0135] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention
belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
[0136] Other features and advantages of the invention will be apparent from the following detailed description and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0137] FIGS. IA, IB, 1C and ID are GC/MS traces of olefins produced by Jeotgalicoccus sp. ATCC 8456 cells, Jeotgalicoccus halotolerans DSMZ 17274 cells, Jeotgalicoccus pinnipedalis DSMZ 17030 cells, and Jeotgalicoccus psychrophilus DSMZ 19085 cells, respectively.
[0138] FIGS. 2 A and 2B are mass spectrometry fragmentation patterns of two α-olefins produced by Jeotgalicoccus ATCC 8456 cells. Compound A was identified as 1-nonadecene and compound B as 18-methyl- 1-nonadecene.
[0139] FIG. 3 is a schematic of a phylogenetic analysis of 16s rRNA of Jeotgalicoccus ATCC 8456.
[0140] FIGS. 4A and 4B are GC/MS traces of α-olefins produced by Jeotgalicoccus sp. ATCC 8456 cells upon feeding with eisosanoic acid (FIG. 4A) or stearic acid (FIG. 4B).
[0141] FIG. 5 is a GC/MS trace of α-olefins produced by cell free lysates of Jeotgalicoccus sp ATCC 8456 cells.
[0142] FIG. 6 is a digital representation of an SDS-PAGE gel of final purified α-olefins- producing protein fraction from Jeotgalicoccus sp. ATCC 8456 cells.
[0143] FIGS. 7A, 7B, and 7D-7N are orβ80 and orβ80 homolog nucleotide and amino acid sequences.
[0144] FIG. 7C is the partial 16s rRNA sequence of Jeotgalicoccus sp. ATCC8456.
[0145] FIG. 8 is a GC/MS trace of α-olefins produced by E. coli upon expression of Jeotgalicoccus sp. 8456_orβ80 and feeding of stearic acid.
[0146] FIG. 9 is a schematic of a bootstrap phylogenetic analysis of 8456_orβ80 homologs using ClustalW.
[0147] FIG. 10 is a table identifying various genes that can be expressed, overexpressed or attenuated to increase production of particular fatty acid substrates.
[0148] FIG. 11 is a representation of a gel of PCR products from MGl 655 wild type cells, ΔfadDr.Cm cells, and ΔfadD cells.
[0149] FIG. 12A is a GC/MS trace of α-olefins produced by MGl 655 ΔfadD cells transformed with empty vector. FIG. 12B is a GC/MS trace of α-olefins produced by MGl 655 ΔfadD cells transformed with Jeotgalicoccus sp. 8456_orβ80.
[0150] FIGS. 13A, 13B, and 13C are GC/MS traces of α-olefms produced by E. coli C41 ΔfadE cells transformed with empty vector (FIG. 13A), Corynebacterium efflciens YS- 134 orf_CE2459 without stearic acid feeding (FIG. 13B), or with Corynebacterium efficiens YS- 134 orf_CE2459 with stearic acid feeding (FIG. 13C).
[0151] FIGS. 14A, 14B, 14C, and 14D are GC/MS traces of α-olefms produced by E. coli C41 ΔfadE cells transformed with empty vector (FIG. 14A), empty vector with stearic acid feeding (FIG. 14B), Kokuria rhizopila DC2201 orf_KRH21570 without stearic acid feeding (FIG. 14C), or with Kokuria rhizopila DC2201 orf_KRH21570 with stearic acid feeding (FIG. 14D).
[0152] FIGS. 15 A, 15B, and 15C are GC/MS traces of α-olefms produced by B. subtilis cells transformed With Jeotgalicoccus sp. ATCC%456 _orβ80 (FIG. 15A), C. efficiens YS- 134 orf_CE2459 (FIG. 15B), or empty vector (FIG. 15C).
[0153] FIG. 16 is a set of GC/MS traces of α-olefins produced in vitro by Corynebacterium efficiens ORF_CE2459.
[0154] FIG. 17A, 17B, and 17C are GC/MS traces of α-olefins produced in vitro by purified Kokuria rhizophila orf_KRH21570 with hexadecanoic acid as substrate (FIG. 18A), by purified Kokuria rhizophila orf_KRH21579 with no substrate (FIG. 18B), and with no enzyme (FIG. 18C).
[0155] FIG. 18 A, 18B, and 18C are GC/MS traces of α-olefms produced in vitro by purified Methylobacterium populi orf_Mpopl292 with hexadecanoic acid as substrate (FIG. 19A), by purified Methylobacterium populi orf_Mpopl292 with no substrate (FIG. 19B), and with no enzyme (FIG. 19C).
[0156] FIG. 19 is a set of GC/MS traces of α-olefins produced by E. coli cells transformed with Bacillus subtilis P450βsβ or empty vector.
[0157] FIG. 20 is a graph demonstrating the specific activity of 1-pentadecene and α(2)- and β(3)-hydroxy hexadecanoic acid production for ORF880, CYP152A1, and CYP152A1 Q85H using hexadecanoic acid as a substrate
FIG. 21 is a graph demonstrating the ratio of decarboxylation to hydroxylation specific activities for ORF880, CYP152A1, and CYP152A1 Q85H. [0158] FIG. 22 is a table identifying various P450 peroxygenases that can be expressed or overexpressed to produce α-olefins.
DETAILED DESCRIPTION
[0159] The invention provides compositions and methods of producing olefins from fatty acid substrates, in particular, terminal olefins. Such olefins are useful as a biofuel {e.g., substitutes for gasoline, diesel, jet fuel, etc.), specialty chemicals {e.g., lubricants, fuel additive, etc.), or feedstock for further chemical conversion {e.g., fuels, polymers, plastics, textiles, solvents, adhesives, etc.). The invention is based on the discovery of a novel gene, or/880, which encodes an olefm-producing enzyme. The polynucleotide sequence oforf880 and homologs of orβ80 are presented as SEQ ID NO:1, 4, 6, 8, 9, 11, or 13 in Figure 7, and the corresponding amino acid sequences are presented as SEQ ID NO:2, 5, 7, 10, 12, or 14 in Figure 7. Using the methods described herein, olefins can be prepared using orβ80, orβ80 homologs, or variants thereof utilizing host cells or cell-free methods.
ORF880 Polynucleotide Variants
[0160] The methods and compositions described herein include the orβ80 polynucleotide sequence (SEQ ID NO: 1) as well as orβ80 homologs depicted in Figure 7 (SEQ ID NO: 4, 6, 8, 9, 11, or 13) and polynucleotide variants thereof. The variants can be naturally occurring or created in vitro. In particular, such variants can be created using genetic engineering
techniques, such as site directed mutagenesis, random chemical mutagenesis, Exonuclease III deletion procedures, and standard cloning techniques. Alternatively, such variants, fragments, analogs, or derivatives can be created using chemical synthesis or modification procedures.
[0161] Methods of making variants are well known in the art. These include procedures in which nucleic acid sequences obtained from natural isolates are modified to generate nucleic acids that encode polypeptides having characteristics that enhance their value in industrial or laboratory applications. In such procedures, a large number of variant sequences having one or more nucleotide differences with respect to the sequence obtained from the natural isolate are generated and characterized. Typically, these nucleotide differences result in amino acid changes with respect to the polypeptides encoded by the nucleic acids from the natural isolates.
[0162] For example, variants can be created using error prone PCR (see, e.g., Leung et al, Technique 1 :11-15, 1989; and Caldwell et al, PCR Methods Applic. 2:28-33, 1992). In error prone PCR, PCR is performed under conditions where the copying fidelity of the DNA polymerase is low, such that a high rate of point mutations is obtained along the entire length of the PCR product. Briefly, in such procedures, nucleic acids to be mutagenized {e.g., an or/880 polynucleotide sequence), are mixed with PCR primers, reaction buffer, MgCl2, MnCl2, Taq polymerase, and an appropriate concentration of dNTPs for achieving a high rate of point mutation along the entire length of the PCR product. For example, the reaction can be performed using 20 fmoles of nucleic acid to be mutagenized (e.g., an orf880 polynucleotide sequence), 30 pmole of each PCR primer, a reaction buffer comprising 50 mM KCl, 10 mM Tris HCl (pH 8.3), and 0.01% gelatin, 7 mM MgCl2, 0.5 mM MnCl2, 5 units of Taq polymerase, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, and 1 mM dTTP. PCR can be performed for 30 cycles of 940C for 1 min, 450C for 1 min, and 72°C for 1 min. However, it will be appreciated that these parameters can be varied as appropriate. The mutagenized nucleic acids are then cloned into an appropriate vector and the activities of the polypeptides encoded by the mutagenized nucleic acids are evaluated.
[0163] Variants can also be created using oligonucleotide directed mutagenesis to generate site-specific mutations in any cloned DNA of interest. Oligonucleotide mutagenesis is described in, for example, Reidhaar-Olson et al, Science 241 :53-57, 1988. Briefly, in such
procedures a plurality of double stranded oligonucleotides bearing one or more mutations to be introduced into the cloned DNA are synthesized and inserted into the cloned DNA to be mutagenized (e.g., an orβ80 polynucleotide sequence). Clones containing the mutagenized DNA are recovered, and the activities of the polypeptides they encode are assessed.
[0164] Another method for generating variants is assembly PCR. Assembly PCR involves the assembly of a PCR product from a mixture of small DNA fragments. A large number of different PCR reactions occur in parallel in the same vial, with the products of one reaction priming the products of another reaction. Assembly PCR is described in, for example, U.S. Pat. No. 5,965,408.
[0165] Still another method of generating variants is sexual PCR mutagenesis. In sexual PCR mutagenesis, forced homologous recombination occurs between DNA molecules of different, but highly related, DNA sequence in vitro as a result of random fragmentation of the DNA molecule based on sequence homology. This is followed by fixation of the crossover by primer extension in a PCR reaction. Sexual PCR mutagenesis is described in, for example, Stemmer, PNAS, USA 91:10747- 10751 , 1994.
[0166] Variants can also be created by in vivo mutagenesis. In some embodiments, random mutations in a nucleic acid sequence are generated by propagating the sequence in a bacterial strain, such as an E. coli strain, which carries mutations in one or more of the DNA repair pathways. Such "mutator" strains have a higher random mutation rate than that of a wild- type strain. Propagating a DNA sequence (e.g., an orβ80 polynucleotide sequence) in one of these strains will eventually generate random mutations within the DNA. Mutator strains suitable for use for in vivo mutagenesis are described in, for example, PCT Publication No. WO 91/16427.
[0167] Variants can also be generated using cassette mutagenesis. In cassette mutagenesis, a small region of a double stranded DNA molecule is replaced with a synthetic oligonucleotide "cassette" that differs from the native sequence. The oligonucleotide often contains a completely and/or partially randomized native sequence.
[0168] Recursive ensemble mutagenesis can also be used to generate variants. Recursive ensemble mutagenesis is an algorithm for protein engineering (i. e. , protein mutagenesis) developed to produce diverse populations of phenotypically related mutants whose members differ in amino acid sequence. This method uses a feedback mechanism to control successive
rounds of combinatorial cassette mutagenesis. Recursive ensemble mutagenesis is described in, for example, Arkin et al, PNAS, USA 89:7811-7815, 1992.
[0169] In some embodiments, variants are created using exponential ensemble mutagenesis. Exponential ensemble mutagenesis is a process for generating combinatorial libraries with a high percentage of unique and functional mutants, wherein small groups of residues are randomized in parallel to identify, at each altered position, amino acids which lead to functional proteins. Exponential ensemble mutagenesis is described in, for example, Delegrave et al , Biotech. Res. 11 :1548-1552, 1993. Random and site-directed mutagenesis are described in, for example, Arnold, Curr. Opin. Biotech. 4:450-455, 1993.
[0170] In some embodiments, variants are created using shuffling procedures wherein portions of a plurality of nucleic acids that encode distinct polypeptides are fused together to create chimeric nucleic acid sequences that encode chimeric polypeptides as described in, for example, U.S. Pat. Nos. 5,965,408 and 5,939,250.
[0171] Polynucleotide variants also include nucleic acid analogs. Nucleic acid analogs can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for example, stability, hybridization, or solubility of the nucleic acid. Modifications at the base moiety include deoxyuridine for deoxythymidine and 5-methyl-2'-deoxycytidine or 5-bromo- 2'-doxycytidine for deoxycytidine. Modifications of the sugar moiety include modification of the 2' hydroxyl of the ribose sugar to form 2'-O-methyl or 2'-O-allyl sugars. The deoxyribose phosphate backbone can be modified to produce morpholino nucleic acids, in which each base moiety is linked to a six-membered, morpholino ring, or peptide nucleic acids, in which the deoxyphosphate backbone is replaced by a pseudopeptide backbone and the four bases are retained. (See, e.g. , Summerton et al. , Antisense Nucleic Acid Drug Dev. (1997) 7:187- 195; and Hyrup et al, Bioorgan. Med. Chem. (1996) 4:5-23.) In addition, the deoxyphosphate backbone can be replaced with, for example, a phosphorothioate or phosphorodithioate backbone, a phosphoroamidite, or an alkyl phosphotriester backbone.
ORF880 Polypeptide Variants
[0172] The methods and compositions described herein also include the ORF880 amino acid sequence (SEQ ID NO:2) depicted in Figure 7, homologs of ORF880 (SEQ ID NO:5, 7, 10, 12, or 14) depicted in Figure 7, and variants thereof. ORF880 polypeptide variants can be
variants in which one or more amino acid residues are substituted with a conserved or non- conserved amino acid residue (preferably a conserved amino acid residue). Such substituted amino acid residue may or may not be one encoded by the genetic code.
[0173] Conservative substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of similar characteristics. Typical conservative substitutions are the following replacements: replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid; replacement of a serine with a threonine or vice versa; replacement of an acidic residue, such as aspartic acid and glutamic acid, with another acidic residue; replacement of a residue bearing an amide group, such as asparagine and glutamine, with another residue bearing an amide group; exchange of a basic residue, such as lysine and arginine, with another basic residue; and replacement of an aromatic residue, such as phenylalanine and tyrosine, with another aromatic residue.
[0174] Other polypeptide variants are those in which one or more amino acid residues include a substituent group. Still other polypeptide variants are those in which the polypeptide is associated with another compound, such as a compound to increase the half- life of the polypeptide (e.g., polyethylene glycol).
[0175] Additional polypeptide variants are those in which additional amino acids are fused to the polypeptide, such as a leader sequence, a secretory sequence, a proprotein sequence, or a sequence which facilitates purification, enrichment, or stabilization of the polypeptide.
[0176] In some instances, the polypeptide variants retain the same biological function as ORF880 (e.g., retain decarboxylase activity) and have amino acid sequences substantially identical thereto.
[0177] In other instances, the polypeptide variants have at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more than about 95% homology to the amino acid sequence depicted in Figure 7 (SEQ ID NO:2, 5, 7, 10, 12, or 14). In another embodiment, the polypeptide variants include a fragment comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof.
[0178] The polypeptide variants or fragments thereof can be obtained by isolating nucleic acids encoding them using techniques described herein or by expressing synthetic nucleic acids encoding them. Alternatively, polypeptide variants or fragments thereof can be obtained through biochemical enrichment or purification procedures. The sequence of polypeptide variants or fragments can be determined by proteolytic digestion, gel electrophoresis, and/or microsequencing. The sequence of the polypeptide variants or fragments can then be compared to the amino acid sequence depicted in Figure 7 (SEQ ID NO:2, 5, 7, 10, 12, or 14) using any of the programs described herein.
[0179] The polypeptide variants and fragments thereof can be assayed for olefin-producing activity using routine methods. For example, the polypeptide variants or fragment can be contacted with a substrate (e.g., a fatty acid substrate) under conditions that allow the polypeptide variant to function. A decrease in the level of the substrate or an increase in the level of an olefin can be measured to determine olefin-producing activity.
ORF880 Motifs
[0180] By using bioinformatics, amino acid motifs can be designed by identifying conserved regions of the fatty acid decarboxylase (e.g., Jeotgalicoccus sp. 8456 orβ80). These amino acid motifs can be designed by methods well known in the art, such as bioinformatics, phylogenetic study, and/or protein alignments followed by visual inspection of the protein sequences. These amino acid motifs can then be used to identify proteins that have similar biological functions as the fatty acid decarboxylase. Several programs well known in the art can use the amino acid motifs to identify proteins that belong to the family of functional proteins. For example, one such publicly available program is http://motif.genome.jp/motif2.html.
[0181] Based on the experimental data, it was predicted that organisms that contain polypeptide sequences containing these amino acid motifs may be functional fatty acid decarboxylases
(1) F-X-X-E-[VI]-[RK]-R-X-Y-P-F-(F)-P-X-[LIV];
(2) P-X(6)-[LI]-X(4)-{G}-[VI]-[HQM]-X-[MLV]-D-G-X(2)-H-X(2)-R-K;
(3) [AC]-[AG]-[IV]-[DE]-[IL]-X-N-X(2)-R-P-X-[VI]-A-X(3)-[FY]-X(2)-F-X(3)-A- [LMV]-X-[DE];
(4) {RK}-X(6)-[LMV]-X(4)-[AC]-[AG]-[IV]-[DE]-[IL]-X-N-X(2)-R-P-X-[VI]-A-X(3)- [FY]-X(2)-F-X(3)-A-[LMV]-X-[DE].
In the sequences described herein, [AB] is A or B (e.g., [VI] is valine or isoleucine), {A} is any amino acid except A (e.g., {F} stands for any amino acid except Phe), X represents any amino acid (e.g., any naturally occurring amino acid), and X(n) is X repeated n times (e.g.,
X(4) is X-X-X-X).
[0182] The invention is directed to an isolated nucleic acid encoding a polypeptide comprising a fatty acid decarboxylase amino acid motif sequence. For example, the isolated nucleic acid can encode a polypeptide comprising an amino acid sequence selected from the motifs described herein.
[0183] Preferably, the isolated nucleic acid encodes a polypeptide of no more than about
700, 650, 600, 550, 500, or 450 amino acid residues comprising a fatty acid decarboxylase amino acid motif sequence.
Anti-Orf880 Antibodies
[0184] The Orf880 polypeptides described herein can also be used to produce antibodies directed against Orf880 polypeptides. Such antibodies can be used, for example, to detect the expression of an Orf880 polypeptide using methods known in the art. The antibody can be, e.g., a polyclonal antibody; a monoclonal antibody or antigen binding fragment thereof; a modified antibody such as a chimeric antibody, reshaped antibody, humanized antibody, or fragment thereof (e.g., Fab1, Fab, F(ab')2); or a biosynthetic antibody, e.g., a single chain antibody, single domain antibody (DAB), Fv, single chain Fv (scFv), or the like.
[0185] Methods of making and using polyclonal and monoclonal antibodies are described, e.g. , in Harlow et αl. , Using Antibodies: A Laboratory Manual: Portable Protocol I. Cold Spring Harbor Laboratory (December 1, 1998). Methods for making modified antibodies and antibody fragments {e.g., chimeric antibodies, reshaped antibodies, humanized antibodies, or fragments thereof, e.g., Fab1, Fab, F(ab')2 fragments); or biosynthetic antibodies {e.g., single chain antibodies, single domain antibodies (DABs), Fv, single chain Fv (scFv), and the like),
are known in the art and can be found, e.g. , in Zola, Monoclonal Antibodies: Preparation and Use of Monoclonal Antibodies and Engineered Antibody Derivatives, Springer Verlag (December 15, 2000; 1st edition).
Fatty Acid Substrates
[0186] The compositions and methods described herein can be used to produce olefins (e.g., terminal olefins) from fatty acid substrates. While not wishing to be bound by theory, it is believed that the polypeptides described herein produce olefins from fatty acid substrates via a decarboxylation mechanism. Thus, olefins having particular branching patterns, levels of saturation, and carbon chain length can be produced from fatty acid substrates having those particular characteristics. Accordingly, each step within a fatty acid biosynthetic pathway can be modified to produce or overproduce a fatty acid substrate of interest. For example, known genes involved in the fatty acid biosynthetic pathway can be expressed, overexpressed, or attenuated in host cells to produce a desired fatty acid substrate (see, e.g., PCT/US08/058788). Exemplary genes are provided in Figure 10. It is recognized, however, that the carbon chain of an olefin produced using the methods described herein will have one less carbon than the fatty acid substrate from which it was produced.
Synthesis of Fatty Acid Substrates
[0187] Fatty acid synthase (FAS) is a group of polypeptides that catalyze the initiation and elongation of acyl chains (Marrakchi et ah, Biochemical Society, 30:1050-1055, 2002). The acyl carrier protein (ACP) along with the enzymes in the FAS pathway control the length, degree of saturation, and branching of the fatty acids produced. The fatty acid biosynthetic pathway involves the precursors acetyl-CoA and malonyl-CoA. The steps in this pathway are catalyzed by enzymes of the fatty acid biosynthesis (fab) and acetyl-CoA carboxylase (ace) gene families (see, e.g., Heath et al, Prog. Lipid Res. 40(6):467-97 (2001)).
[0188] Host cells can be engineered to express fatty acid substrates by recombinantly expressing or overexpressing acetyl-CoA and/or malonyl-CoA synthase genes. For example, to increase acetyl-CoA production, one or more of the following genes can be expressed in a host cell: pdh, panK, aceEF (encoding the EIp dehydrogenase component and the E2p
dihydrolipoamide acyltransferase component of the pyruvate and 2-oxoglutarate dehydrogenase complexes), fabH, fabD, fabG, acpP, and fabF. Exemplary GenBank accession numbers for these genes are: pdh (BAB34380, AAC73227, AAC73226), panK (also known as coaA, AAC76952), aceEF (AAC73227, AAC73226),/αδH(AAC74175), fabD (AAC74\76),fabG (AAC74177), acpP {AAC74l7S),fabF (AAC74179). Additionally, the expression levels oifadE, gpsA, idhA, pflb, adhE, pta, poxB, ackA, and/or ackB can be attenuated or knocked-out in an engineered host cell by transformation with conditionally replicative or non-replicative plasmids containing null or deletion mutations of the corresponding genes or by substituting promoter or enhancer sequences. Exemplary GenBank accession numbers for these genes axe:fadE (AAC73325), gspA (AAC76632), IdhA {AAC7AA62), pflb (AAC73989), adhE (AAC74323λ pta (A AC7 '5357), poxB (AAC73958), ackA (AAC75356), and ackB (BAB81430). The resulting host cells will have increased acetyl-CoA production levels when grown in an appropriate environment.
[0189] Malonyl-CoA overexpression can be effected by introducing accABCD {e.g., accession number AAC73296, EC 6.4.1.2) into a host cell. Fatty acids can be further overexpressed in host cells by introducing into the host cell a DNA sequence encoding a lipase {e.g., accession numbers CAA89087, CAA98876).
[0190] In addition, inhibiting PIsB can lead to an increase in the levels of long chain acyl- ACP, which will inhibit early steps in the pathway {e.g., accABCD, fabH, and fabl). The plsB {e.g., accession number AAC77011) D31 IE mutation can be used to increase the amount of available acyl-CoA.
[0191] In addition, a host cell can be engineered to overexpress a sfa gene (suppressor of fabA, e.g., accession number AAN79592) to increase production of monounsaturated fatty acids (Rock et al., J. Bacteriology 178:5382-5387, 1996).
[0192] In some instances, host cells can be engineered to express, overexpress, or attenuate expression of a thioesterase to increase fatty acid substrate production. The chain length of a fatty acid substrate is controlled by thioesterase. In some instances, a tes or fat gene can be overexpressed. In other instances, Cj0 fatty acids can be produced by attenuating thioesterase Cj8 {e.g., accession numbers AAC73596 and POADAl), which uses C18Ii-ACP, and expressing thioesterase C10 {e.g., accession number Q39513), which uses Qo-ACP. This results in a relatively homogeneous population of fatty acids that have a carbon chain length
of 10. In yet other instances, C14 fatty acids can be produced by attenuating endogenous thioesterases that produce non-C14 fatty acids and expressing the thioesterases, that use Cj4- ACP (for example, accession number Q39473). In some situations, Cj2 fatty acids can be produced by expressing thioesterases that use C12-ACP (for example, accession number Q41635) and attenuating thioesterases that produce non-Cπ fatty acids. Acetyl-CoA, malonyl-CoA, and fatty acid overproduction can be verified using methods known in the art, for example, by using radioactive precursors, HPLC, and GC-MS subsequent to cell lysis. Non-limiting examples of thioesterases that can be used in the methods described herein are listed in Table 1.
Table 1 : Thioesterases
* Mayer et al. , BMC Plant Biology 7:1-11, 2007
Formation of Branched Olefins
[0193] Olefins can be produced that contain branch points by using branched fatty acids as substrates. For example, although E. coli naturally produces straight chain fatty acids (sFAs), E. coli can be engineered to produce branched chain fatty acids (brFAs) by introducing and expressing or overexpressing genes that provide branched precursors in the E. coli (e.g., bkd, Uv, icm, and fab gene families). Additionally, a host cell can be engineered to express or overexpress genes encoding proteins for the elongation of brFAs (e.g., ACP, FabF, etc.) and/or to delete or attenuate the corresponding host cell genes that normally lead to sFAs.
[0194] The first step in forming brFAs is the production of the corresponding α-keto acids by a branched-chain amino acid aminotransferase. Host cells may endogenously include genes encoding such enzymes or such genes can be recombinantly introduced. E. coli, for example, endogenously expresses such an enzyme, HvE (EC 2.6.1.42; GenBank accession YP_026247). In some host cells, a heterologous branched-chain amino acid aminotransferase may not be expressed. However, E. coli HvE or any other branched-chain amino acid aminotransferase (e.g., HvE from Lactococcus lactis (GenBank accession AAF34406), HvE from Pseudomonas putida (GenBank accession NP_745648), or HvE from Streptomyces coelicolor (GenBank accession NP_629657)), if not endogenous, can be introduced.
[0195] The second step is the oxidative decarboxylation of the α-ketoacids to the corresponding branched-chain acyl-CoA. This reaction can be catalyzed by a branched-chain α-keto acid dehydrogenase complex (bkd; EC 1.2.4.4.) (Denoya et al, J. Bacteriol. 177:3504, 1995), which consists of Elα/β (decarboxylase), E2 (dihydrolipoyl transacylase), and E3 (dihydrolipoyl dehydrogenase) subunits. These branched-chain α-keto acid dehydrogenase complexes are similar to pyruvate and α-ketoglutarate dehydrogenase complexes. Any microorganism that possesses brFAs and/or grows on branched-chain amino acids can be used as a source to isolate bkd genes for expression in host cells, for example, E. coli. Furthermore, E. coli has the E3 component as part of its pyruvate dehydrogenase complex (Ipd, EC 1.8.1.4, GenBank accession NP_414658). Thus, it can be sufficient to express only the El a/β and E2 bkd genes. Table 2 lists non-limiting examples of bkd genes from several microorganisms that can be recombinantly introduced and expressed in a host cell to provide branched-chain acyl-CoA precursors.
Table 2: Bkd genes from selected microorganisms
[0196] In another example, isobutyryl-CoA can be made in a host cell, for example in E. coli, through the coexpression of a crotonyl-CoA reductase (Ccr, EC 1.6.5.5, 1.1.1.1) and isobutyryl-CoA mutase (large subunit IcmA, EC 5.4.99.2; small subunit IcmB, EC 5.4.99.2 ) (Han and Reynolds, J Bacteriol. 179:5157, 1997). Crotonyl-CoA is an intermediate in fatty acid biosynthesis in E. coli and other microorganisms. Non-limiting examples of ccr and icm genes from selected microorganisms are listed in Table 3.
Table 3: Ccr and icm genes from selected microorganisms
[0197] In addition to expression of the bkd genes, the initiation of brFA biosynthesis utilizes β-ketoacyl-acyl-carrier-protein synthase III (FabH, EC 2.3.1.41) with specificity for branched chain acyl-CoAs (Li et al, J. Bacteriol 187:3795-3799, 2005). Non-limiting examples of such FabH enzymes are listed in Table 4. fabH genes that are involved in fatty acid biosynthesis of any brFA-containing microorganism can be expressed in a host cell. The Bkd and FabH enzymes from host cells that do not naturally make brFA may not support brFA production. Therefore, bkd and fabH can be expressed recombinantly. Vectors containing the bkd and fαbH genes can be inserted into such a host cell. Similarly, the endogenous level of Bkd and FabH production may not be sufficient to produce brFA. In this case, they can be overexpressed. Additionally, other components of the fatty acid biosynthesis pathway can be expressed or overexpressed, such as acyl carrier proteins (ACPs) and β-ketoacyl-acyl-carrier- protein synthase II (fαbF, EC 2.3.1.41) (non-limiting examples of candidates are listed in Table 4). In addition to expressing these genes, some genes in the endogenous fatty acid biosynthesis pathway can be attenuated in the host cell {e.g., the E. coli genes fαbH (GenBank accession # NP_415609) and/or fαbF (GenBank accession # NP_415613)).
Table 4: FabH, ACP andfabF genes from selected microorganisms with brFAs
Formation of Cyclic Olefins
[0198] Cyclic olefins can be produced by using cyclic fatty acids as substrates. To produce cyclic fatty acid substrates, genes that provide cyclic precursors (e.g., the ans, chc, and plm gene families) can be introduced into the host cell and expressed to allow initiation of fatty acid biosynthesis from cyclic precursors. For example, to convert a host cell, such as E. coli, into one capable of synthesizing ω-cyclic fatty acids (cyFA), a gene that provides the cyclic precursor cyclohexylcarbonyl-CoA (CHC-CoA) (Cropp et al, Nature Biotech. 18:980-983, 2000) can be introduced and expressed in the host cell. Non-limiting examples of genes that provide CHC-CoA in E. coli include: ansJ, ansK, ansL, chcA, and ansM from the ansatrienin gene cluster of Streptomyces collinus (Chen et al, Eur. J. Biochem. 261 : 98-107, 1999) or plmJ, plmK, plmL, chcA, and plmM from the phoslactomycin B gene cluster of Streptomyces sp. HK803 (Palaniappan et al., J. Biol. Chem. 278:35552-35557, 2003) together with the chcB gene (Patton et al, Biochem. 39:7595-7604, 2000) from S. collinus, S. avermitilis, or S. coelicolor (see Table 5). The genes listed in Table 4 can then be expressed to allow initiation and elongation of ω-cyclic fatty acids. Alternatively, the homologous genes can be isolated from microorganisms that make cyFA and expressed in a host cell (e.g., E. coli).
Table 5: Genes for the synthesis of CHC-CoA
*Only chcA is annotated in GenBank entry U72144, ans JKLM are according to Chen et αl. {Eur. J. Biochem. 261 :98-107, 1999).
[0199] The genes listed in Table 4 (fαbH, ACP, and fαbF) allow initiation and elongation of ω-cyclic fatty acids because they have broad substrate specificity. If the coexpression of any of these genes with the genes listed in Table 5 does not yield cyFA, then fαbH, ACP, and/or fαbF homologs from microorganisms that make cyFAs {e.g., those listed in Table 6) can be isolated {e.g., by using degenerate PCR primers or heterologous DNA sequence probes) and coexpressed.
Table 6: Non-limiting examples of microorganisms that contain ω-cyclic fatty acids
*Uses cycloheptylcarbonyl-CoA and not cyclohexylcarbonyl-CoA as precursor for cyFA biosynthesis.
Controlling Degree of Saturation in Olefins
[0200] The degree of saturation in olefins can be controlled by regulating the degree of saturation of olefin intermediates, for example, fatty acids. The sfa, gns, and fab families of genes can be expressed or overexpressed to control the saturation of fatty acids. For example, host cells can be engineered to produce unsaturated fatty acids by engineering the host cells to overexpress^aZ>5 or by growing the host cells at low temperatures (e.g., less than 37°C). FabB has preference for cis-δ3decenoyl-ACP and results in unsaturated fatty acid production in E. coll Overexpression of fabB results in the production of a significant percentage of unsaturated fatty acids (de Mendoza et ah, J. Biol. Chem., 258:2098-101, \983). fabB may be inserted into and expressed in host cells not naturally having the gene. These unsaturated fatty acids can then be used as substrates in host cells that are engineered to produce olefins.
[0201] Alternatively, a repressor of fatty acid biosynthesis, for example, fabR (GenBank accession NP_418398 ), can be deleted, which will result in increased unsaturated fatty acid production in E. coli (Zhang et a , J. Biol. Chem. 277: 15558, 2002). Similar deletions may be made in other host cells. A further increase in unsaturated fatty acids can be achieved, for example, by overexpressing_/aZ>M(trans-2, cis-3-decenoyl-ACP isomerase, GenBank accession DAA05501) and controlled expression of fabK (trans-2-enoyl-ACP reductase II, GenBank accession NP_357969) from Streptococcus pneumoniae (Marrakchi et ah, J. Biol. Chem. 277: 44809, 2002), while deleting E. colifabl (trans-2-enoyl-ACP reductase, GenBank
accession NP_415804). In some examples, the endogenous fabF gene can be attenuated. Thus, increasing the percentage of palmitoleate (C16:i) produced.
Genetic Engineering of Host Cells to Express Olefins
[0202] Various host cells can be used to produce olefins, as described herein. A host cell can be any prokaryotic or eukaryotic cell. For example, a polypeptide described herein can be expressed in bacterial cells, such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) cells, COS cells, VERO cells, BHK cells, HeLa cells, CvI cells, MDCK cells, 293 cells, 3T3 cells, or PC12 cells). Other exemplary host cells include cells from the members of the genus Escherichia, Bacillus, Lactobacillus, Rhodococcus, Pseudomonas, Aspergillus, Trichoderma, Neurospora, Fusarium, Humicola, Rhizomucor, Kluyveromyces, Pichia, Mucor, Myceliophtora, Penicillium, Phanerochaete, Pleurotus, Trametes, Chrysosporium, Saccharomyces, Schizosaccharomyces, Yarrowia, or Streptomyces. Yet other exemplary host cells can be a Bacillus lentus cell, a Bacillus brevis cell, a Bacillus stearothermophilus cell, a Bacillus licheniformis cell, a Bacillus alkalophilus cell, a Bacillus coagulans cell, a Bacillus circulans cell, a Bacillus pumilis cell, a Bacillus thuringiensis cell, a Bacillus clausii cell, a Bacillus megaterium cell, a Bacillus subtilis cell, a Bacillus amyloliquefaciens cell, a Trichoderma koningii cell, a Trichoderma viride cell, a Trichoderma reesei cell, a Trichoderma longibrachiatum cell, an Aspergillus awamori cell, an Aspergillus fumigates cell, an Aspergillus foetidus cell, an Aspergillus nidulans cell, an Aspergillus niger cell, an Aspergillus oryzae cell, a Humicola insolens cell, a Humicola lanuginose cell, a Rhizomucor miehei cell, a Mucor michei cell, a Streptomyces lividans cell, a Streptomyces murinus cell, or an Actinomycetes cell. In a preferred embodiment, the host cell is an E. coli cell. In a more preferred embodiment, the host cell is from E. coli strains B, C, K, or W. Other suitable host cells are known to those skilled in the art.
[0203] Various methods well known in the art can be used to genetically engineer host cells to produce olefins. The methods include the use of vectors, preferably expression vectors, containing a nucleic acid encoding an ORF880 polypeptide, polypeptide variant, or a fragment thereof. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid," which refers to a circular double stranded DNA loop into which additional DNA
segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non- episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell and are thereby replicated along with the host genome. Moreover, certain vectors, such as expression vectors, are capable of directing the expression of genes to which they are operatively linked. In general, expression vectors used in recombinant DNA techniques are often in the form of plasmids. However, other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses, and adeno- associated viruses), can also be used.
[0204] The recombinant expression vectors described herein include a nucleic acid described herein in a form suitable for expression of the nucleic acid in a host cell. The recombinant expression vectors can include one or more control sequences, selected on the basis of the host cell to be used for expression. The control sequence is operably linked to the nucleic acid sequence to be expressed. Such control sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Control sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g. , tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors described herein can be introduced into host cells to produce polypeptides, including fusion polypeptides, encoded by the nucleic acids as described herein.
[0205] Recombinant expression vectors can be designed for expression of an ORF880 polypeptide or variant in prokaryotic or eukaryotic cells (e.g., bacterial cells, such as E. coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells). Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example, by using T7 promoter regulatory sequences and T7 polymerase.
[0206] Expression of polypeptides in prokaryotes, for example, E. coli, is most often carried out with vectors containing constitutive or inducible promoters directing the expression of either fusion or non- fusion polypeptides. Fusion vectors add a number of amino acids to a polypeptide encoded therein, usually to the amino terminus of the recombinant polypeptide. Such fusion vectors typically serve three purposes: (1) to increase expression of the recombinant polypeptide; (2) to increase the solubility of the recombinant polypeptide; and (3) to aid in the purification of the recombinant polypeptide by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant polypeptide. This enables separation of the recombinant polypeptide from the fusion moiety after purification of the fusion polypeptide. Examples of such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin, and enterokinase. Exemplary fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith et al, Gene (1988) 67:31-40), pMAL (New England Biolabs, Beverly, Mass.), and pRITS (Pharmacia, Piscataway, N.J.), which fuse glutathione S- transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant polypeptide.
[0207] Examples of inducible, non-fusion E. coli expression vectors include pTrc (Amann et al, Gene (1988) 69:301-315) and pET 1 Id (Studier et al, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 60-89). Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter. Target gene expression from the pET 1 Id vector relies on transcription from a T7 gnlO-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied by host strains BL21(DE3) or HMS174(DE3) from a resident λ prophage harboring a T7 gnl gene under the transcriptional control of the lacUV 5 promoter.
[0208] One strategy to maximize recombinant polypeptide expression is to express the polypeptide in a host cell with an impaired capacity to proteolytically cleave the recombinant polypeptide (see Gottesman, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 119-128). Another strategy is to alter the nucleic acid sequence to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in the host cell (Wada et al. , Nucleic Acids Res.
( 1992) 20:2111 -2118). Such alteration of nucleic acid sequences can be carried out by standard DNA synthesis techniques.
[0209] In another embodiment, the host cell is a yeast cell. In this embodiment, the expression vector is a yeast expression vector. Examples of vectors for expression in yeast S. cerevisiae include pYepSecl (Baldari et al, EMBO J. (1987) 6:229-234), pMFa (Kurjan et al, Cell (1982) 30:933-943), pJRY88 (Schultz et al, Gene (1987) 54:113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.), and picZ (Invitrogen Corp, San Diego, Calif).
[0210] Alternatively, a polypeptide described herein can be expressed in insect cells using baculovirus expression vectors. Baculo virus vectors available for expression of proteins in cultured insect cells {e.g., Sf 9 cells) include, for example, the pAc series (Smith et al, MoI. Cell Biol. (1983) 3:2156-2165) and the pVL series (Lucklow et α/. , Virology {19^9) 170:31- 39).
[0211] In yet another embodiment, the nucleic acids described herein can be expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, Nature (1987) 329:840) and pMT2PC (Kaufman et al, EMBOJ. (1987) 6:187-195). When used in mammalian cells, the expression vector's control functions can be provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. Other suitable expression systems for both prokaryotic and eukaryotic cells are described in chapters 16 and 17 of Sambrook et al, eds., Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989.
[0212] Vectors can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in, for example, Sambrook et al. (supra).
[0213] For stable transformation of bacterial cells, it is known that, depending upon the expression vector and transformation technique used, only a small fraction of cells will take-
up and replicate the expression vector. In order to identify and select these transformants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) can be introduced into the host cells along with the gene of interest. Selectable markers include those that confer resistance to drugs, such as ampacillin, kanamycin, chloramphenicol, or tetracycline. Nucleic acids encoding a selectable marker can be introduced into a host cell on the same vector as that encoding a polypeptide described herein or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
[0214] For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) can be introduced into the host cells along with the gene of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin, and methotrexate. Nucleic acids encoding a selectable marker can be introduced into a host cell on the same vector as that encoding a polypeptide described herein or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
[0215] In certain instances, an ORF880 polypeptide, polypeptide variant, or a fragment thereof, is produced in a host cell that contains a naturally occurring mutation that results in an increased level of fatty acids in the host cells. In other instances, the host cell is genetically engineered to increase the level of fatty acids in the host cell relative to a corresponding wild-type host cell. For example, the host cell can be genetically engineered to express a reduced level of an acyl-CoA synthase relative to a corresponding wild-type host cell. In one embodiment, the level of expression of one or more genes, e.g., an acyl-CoA synthase gene, is reduced by genetically engineering a "knock out" host cell.
[0216] "Gene knockout" refers to a procedure by which the gene encoding the target protein is modified or inactivated so to reduce or eliminate the function of the intact protein. Inactivation of the gene may be performed by general methods such as mutagenesis by UV irradiation or treatment with N-methyl-N'-nitro-N-nitrosoguanidine, site-directed mutagenesis, homologous recombination, insertion-deletion mutagenesis, or "Red-driven
integration" (Datsenko et al., Proc. Natl. Acad. Sci. USA, 97:6640-45, 2000). For example, in one embodiment, a construct is introduced into a host cell, such that it is possible to select for homologous recombination events in the host cell. One of skill in the art can readily design a knock-out construct including both positive and negative selection genes for efficiently selecting transfected cells that undergo a homologous recombination event with the construct. The alteration in the host cell may be obtained, e.g., by replacing through a single or double crossover recombination a wild type DNA sequence by a DNA sequence containing the alteration. For convenient selection of transformants, the alteration may, e.g., be a DNA sequence encoding an antibiotic resistance marker or a gene complementing a possible auxotrophy of the host cell. Mutations include, but are not limited to, deletion-insertion mutations. An example of such an alteration includes a gene disruption, i.e., a perturbation of a gene such that the product that is normally produced from this gene is not produced in a functional form. This could be due to a complete deletion, a deletion and insertion of a selective marker, an insertion of a selective marker, a frameshift mutation, an in-frame deletion, or a point mutation that leads to premature termination. In some instances, the entire mRNA for the gene is absent. In other situations, the amount of mRNA produced varies.
[0217] Any known acyl-CoA synthase gene can be reduced or knocked out in a host cell. Non-limiting examples of acyl-CoA synthase genes include fadD,fadK, BH3103, yitfL, Pfl- 4354, EAVl 5023, fadDl,fadD2, RPC_4074,fadDD35,fadDD22,faa3p or the gene encoding the protein ZP O 1644857. Specific examples of acyl-CoA synthase genes include fadDD35 from M. tuberculosis H37Rv [NP_21702 l],fadDD22 from M. tuberculosis H37Rv [NP_217464],/flJD from E. coli \N?_4\63\9],fadK fmm E. coli [ YP_416216], fadD from Acinetobacter sp. ADPl [YP_045024],/αJD from Haemophilus influenza RdkW20 [NP_438551],/αdD from Rhodopseudomonas palustris Bis B18 [YP_533919], BH3101 from Bacillus halodurans C-125 [NP_243969], Pfl-4354 from Pseudomonas fluorescens Pfo-1 [YP_350082], EAV15023 from Comamonas testosterone KF-I [ZP_01520072], j//z/L from B. subtilis [NP_388908],/ΩJ£>7 from P. aeruginosa PAOl [NP_251989],/αcfDi from Ralstonia solanacearum GMl 1000 [NP_520978],/αdD2 from P. aeruginosa PAOl [NP_251990],, the gene encoding the protein ZP_01644857 from Stenotrophomonas maltophilia R.551-3, faa3p from Saccharomyces cerevisiae [NP_012257],7αα7/> from Saccharomyces cerevisiae [NP_014962], lcfA from Bacillus subtilis [CAA99571], or those described in Shockey et al,
Plant. Physiol. 129:1710-1722, 2002; Caviglia et α/., J Biol. Chem. 279:1163-1169, 2004; Knoll et α/., J Biol. Chem. 269(23): 16348-56, 1994; Johnson et al, J. Biol. Chem. 269: 18037-18046, 1994; and Black et al , J. Biol Chem. 267: 25513-25520, 1992.
Transport Proteins
[0218] Transport proteins can export polypeptides and hydrocarbons (e.g., olefins) out of a host cell. Many transport and efflux proteins serve to excrete a wide variety of compounds and can be naturally modified to be selective for particular types of hydrocarbons.
[0219] Non-limiting examples of suitable transport proteins are ATP-Binding Cassette (ABC) transport proteins, efflux proteins, and fatty acid transporter proteins (FATP). Additional non-limiting examples of suitable transport proteins include the ABC transport proteins from organisms such as Caenorhabditis elegans, Arabidopsis thalania, Alkaligenes eutrophus, and Rhodococcus erythropolis. Exemplary ABC transport proteins that can be used are listed in Figure 10 (e.g., CER5, AtMRP5, AmiS2, and AtPGPl). Host cells can also be chosen for their endogenous ability to secrete hydrocarbons. The efficiency of hydrocarbon production and secretion into the host cell environment (e.g., culture medium, fermentation broth) can be expressed as a ratio of intracellular product to extracellular product. In some examples, the ratio can be about 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, or 1:5.
Fermentation
[0220] The production and isolation of olefins can be enhanced by employing beneficial fermentation techniques. One method for maximizing production while reducing costs is increasing the percentage of the carbon source that is converted to hydrocarbon products.
[0221] During normal cellular lifecycles, carbon is used in cellular functions, such as producing lipids, saccharides, proteins, organic acids, and nucleic acids. Reducing the amount of carbon necessary for growth-related activities can increase the efficiency of carbon source conversion to product. This can be achieved by, for example, first growing host cells to a desired density (for example, a density achieved at the peak of the log phase of growth). At such a point, replication checkpoint genes can be harnessed to stop the growth of cells. Specifically, quorum sensing mechanisms (reviewed in Camilli et al. , Science 311 :1113, 2006; Venturi FEMS Microbio. Rev. 30:274-291, 2006; and Reading etal, FEMS Microbiol.
Lett. 254:1-11, 2006) can be used to activate checkpoint genes, such as p53,p21, or other checkpoint genes.
[0222] Genes that can be activated to stop cell replication and growth in E. coli include umuDC genes. The overexpression of umuDC genes stops the progression from stationary phase to exponential growth (Murli et al, J. ofBact. 182:1127, 2000). UmuC is a DNA polymerase that can carry out translesion synthesis over non-coding lesions - the mechanistic basis of most UV and chemical mutagenesis. The umuDC gene products are involved in the process of translesion synthesis and also serve as a DNA sequence damage checkpoint. The umuDC gene products include UmuC, UmuD, umuD', UmuD'2C, UmuD'2, and UmuD2. Simultaneously, product-producing genes can be activated, thus minimizing the need for replication and maintenance pathways to be used while an olefin is being made.
[0223] The percentage of input carbons converted to olefins can be a cost driver. The more efficient the process is (i.e., the higher the percentage of input carbons converted to olefins), the less expensive the process will be. For oxygen-containing carbon sources (e.g., glucose and other carbohydrate based sources), the oxygen must be released in the form of carbon dioxide. For every 2 oxygen atoms released, a carbon atom is also released leading to a maximal theoretical metabolic efficiency of approximately 34% (w/w) (for fatty acid derived products). This figure, however, changes for other hydrocarbon products and carbon sources. Typical efficiencies in the literature are approximately less than 5%. Host cells engineered to produce olefins can have greater than about 1, 3, 5, 10, 15, 20, 25, and 30% efficiency. In one example, host cells can exhibit an efficiency of about 10% to about 25%. In other examples, such host cells can exhibit an efficiency of about 25% to about 30%. In other examples, host cells can exhibit greater than 30% efficiency.
[0224] The host cell can be additionally engineered to express recombinant cellulosomes, such as those described in PCT application number PCT/US2007/003736. These cellulosomes can allow the host cell to use cellulosic material as a carbon source. For example, the host cell can be additionally engineered to express invertases (EC 3.2.1.26) so that sucrose can be used as a carbon source. Similarly, the host cell can be engineered using the teachings described in U.S. Patent Nos. 5,000,000; 5,028,539; 5,424,202; 5,482,846; and 5,602,030; so that the host cell can assimilate carbon efficiently and use cellulosic materials as carbon sources.
[0225] In one example, the fermentation chamber can enclose a fermentation that is undergoing a continuous reduction. In this instance, a stable reductive environment can be created. The electron balance can be maintained by the release of carbon dioxide (in gaseous form). Efforts to augment the NAD/H and NADP/H balance can also facilitate in stabilizing the electron balance. The availability of intracellular NADPH can also be enhanced by engineering the host cell to express an NADH:NADPH transhydrogenase. The expression of one or more NADH :N ADPH transhydrogenases converts the NADH produced in glycolysis to NADPH, which can enhance the production of olefins.
[0226] For small scale production, the engineered host cells can be grown in batches of, for example, around 100 mL, 500 mL, 1 L, 2 L, 5 L, or 10 L; fermented; and induced to express desired olefins based on the specific genes encoded in the appropriate plasmids. For example, E. coli BL21(DE3) cells harboring pBAD24 (with ampicillin resistance and the olefin synthesis pathway) as well as pUMVCl (with kanamycin resistance and the acetyl CoA/malonyl CoA overexpression system) can be incubated overnight in 2 L flasks at 370C shaken at > 200 rpm in 500 mL LB medium supplemented with 75 μg/mL ampicillin and 50 μg/mL kanamycin until cultures reach an OD600 of > 0.8. Upon achieving an OD600 of > 0.8, the cells can be supplemented with 25 mM sodium proprionate (pH 8.0) to activate the engineered gene systems for production and to stop cellular proliferation by activating UmuC and UmuD proteins. Induction can be performed for 6 h at 30°C. After incubation, the media can be examined for olefins using GC-MS.
[0227] For large scale production, the engineered host cells can be grown in batches of 10 L, 100 L, 1000 L ,or larger; fermented; and induced to express desired olefins based on the specific genes encoded in the appropriate plasmids. For example, E. coli BL21(DE3) cells harboring pBAD24 (with ampicillin resistance and the olefin synthesis pathway) as well as pUMVCl (with kanamycin resistance and the acetyl-CoA/malonyl-CoA overexpression system) can be incubated from a 500 mL seed culture for 10 L fermentations (5 L for 100 L fermentations, etc.) in LB media (glycerol free) with 50 μg/mL kanamycin and 75 μg/mL ampicillin at 37°C, and shaken at > 200 rpm until cultures reach an OD600 of > 0.8 (typically 16 h). Media can be continuously supplemented to maintain 25 mM sodium proprionate (pH 8.0) to activate the engineered gene systems for production and to stop cellular proliferation by activating umuC and umuD proteins. Media can be continuously supplemented with glucose to maintain a concentration 25 g/100 mL.
[0228] After the first hour of induction, aliquots of no more than 10% of the total cell volume can be removed each hour and allowed to sit without agitation to allow the olefins to rise to the surface and undergo a spontaneous phase separation. The olefin component can then be collected, and the aqueous phase returned to the reaction chamber. The reaction chamber can be operated continuously. When the OD600 drops below 0.6, the cells can be replaced with a new batch grown from a seed culture.
Producing Olefins using Cell-free Methods
[0229] Some methods described herein, an olefin can be produced using a purified polypeptide described herein and a fatty acid substrate. For example, a host cell can be engineered to express a polypeptide (e.g., an ORF880 polypeptide or variant) as described herein. The host cell can be cultured under conditions suitable to allow expression of the polypeptide. Cell free extracts can then be generated using known methods. For example, the host cells can be lysed using detergents or by sonication. The expressed polypeptides can be purified using known methods. After obtaining the cell free extracts, fatty acid substrates described herein can be added to the cell free extracts and maintained under conditions to allow conversion of the fatty acid substrates to olefins. The olefins can then be separated and purified using known techniques.
Post-Production Processing
[0230] The olefins produced during fermentation can be separated from the fermentation media. Any known technique for separating olefins from aqueous media can be used. One exemplary separation process is a two phase (bi-phasic) separation process. This process involves fermenting the genetically engineered host cells under conditions sufficient to produce an olefin, allowing the olefin to collect in an organic phase, and separating the organic phase from the aqueous fermentation broth. This method can be practiced in both a batch and continuous fermentation setting.
[0231] Bi-phasic separation uses the relative immiscibility of olefins to facilitate separation. Immiscible refers to the relative inability of a compound to dissolve in water and is defined by the compound's partition coefficient. One of ordinary skill in the art will appreciate that by choosing a fermentation broth and organic phase, such that the olefin being produced has a
high logP value, the olefin can separate into the organic phase, even at very low concentrations, in the fermentation vessel.
[0232] The olefins produced by the methods described herein can be relatively immiscible in the fermentation broth, as well as in the cytoplasm. Therefore, the olefin can collect in an organic phase either intracellularly or extracellularly. The collection of the products in the organic phase can lessen the impact of the olefin on cellular function and can allow the host cell to produce more product.
[0233] The methods described herein can result in the production of homogeneous compounds wherein at least about 60%, 70%, 80%, 90%, or 95% of the olefins produced will have carbon chain lengths that vary by less than about 6 carbons, less than about 4 carbons, or less than about 2 carbons. These compounds can also be produced with a relatively uniform degree of saturation. For example, at least about 60%, 70%, 80%, 90%, or 95% of the olefins will be monounsaturated, diunsaturated, or triunsaturated. These compounds can be used directly as fuels, fuel additives, starting materials for production of other chemical compounds (e.g., polymers, surfactants, plastics, textiles, solvents, adhesives, etc.), or personal care additives. These compounds can also be used as feedstock for subsequent reactions, for example, hydrogenation, catalytic cracking (via hydrogenation, pyrolisis, or both), or epoxidation reactions to make other products.
[0234] In some embodiments, the olefins produced using methods described herein can contain between about 50% and about 90% carbon; between about 5% and about 25% hydrogen; or between about 5% and about 25% oxygen. In other embodiments, the olefins produced using methods described herein can contain between about 65% and about 85% carbon; between about 10% and about 15% hydrogen; or between about 10% and about 20% oxygen.
Fuel Compositions
[0235] The olefins described herein can be used as or converted into a fuel. One of ordinary skill in the art will appreciate that, depending upon the intended purpose of the fuel, different olefins can be produced and used. For example, a branched olefin may be desirable for automobile fuel that is intended to be used in cold climates. In addition, when the olefins described herein are used as a feedstock for fuel production, one of ordinary skill in the art
will appreciate that the characteristics of the olefin feedstock will affect the characteristics of the fuel produced. Hence, the characteristics of the fuel product can be selected for by producing particular olefins for use as a feedstock.
[0236] Using the methods described herein, biofuels having desired fuel qualities can be produced from olefins. Biologically produced olefins represent a new source of biofuels, which can be used as jet fuel, diesel, or gasoline. Some biofuels made using olefins have not been produced from renewable sources and are new compositions of matter. These new fuels can be distinguished from fuels derived from petrochemical carbon on the basis of dual carbon-isotopic fingerprinting. Additionally, the specific source of biosourced carbon (e.g., glucose vs. glycerol) can be determined by dual carbon-isotopic fingerprinting (see, e.g., U.S. Patent No. 7,169,588, in particular col. 4, line 31, to col. 6, line 8).
[0237] Hydrocarbons comprising biologically produced hydrocarbons, particularly α-olefins biologically produced using the fatty acid biosynthetic pathway, have not been produced from renewable sources and, as such, are new compositions of matter. These new hydrocarbons can be distinguished from hydrocarbons derived from petrochemical carbon on the basis of dual carbon-isotopic fingerprinting or 14C dating. Additionally, the specific source of biosourced carbon (e.g., glucose vs. glycerol) can be determined by dual carbon- isotopic fingerprinting (see U.S. Patent No. 7,169,588, which is herein incorporated by reference).
[0238] The ability to distinguish biologically produced hydrocarbons from petroleum based hydrocarbons is beneficial in tracking these materials in commerce. For example, hydrocarbons or chemicals comprising both biologically based and petroleum based carbon isotope profiles may be distinguished from hydrocarbons and chemicals made only of petroleum based materials. Hence, the instant materials may be followed in commerce on the basis of their unique carbon isotope profile.
[0239] Hydrocarbons can be distinguished from petroleum based fuels by comparing the stable carbon isotope ratio (13C/12C) in each fuel. The 13C/I2C ratio in a given biologically based material is a consequence of the 13C/12C ratio in atmospheric carbon dioxide at the time the carbon dioxide is fixed. It also reflects the precise metabolic pathway. Regional variations also occur. Petroleum, C3 plants (the broadleaf), C4 plants (the grasses), and marine carbonates all show significant differences in 13C/12C and the corresponding 513C values. Furthermore, lipid matter of C3 and C4 plants analyze differently than materials
derived from the carbohydrate components of the same plants as a consequence of the metabolic pathway.
[0240] Within the precision of measurement, 13C shows large variations due to isotopic fractionation effects, the most significant of which for biologically produced hydrocarbons is the photosynthetic mechanism. The major cause of differences in the carbon isotope ratio in plants is closely associated with differences in the pathway of photosynthetic carbon metabolism in the plants, particularly the reaction occurring during the primary carboxylation (i.e., the initial fixation of atmospheric CO2). Two large classes of vegetation are those that incorporate the "C3" (or Calvin-Benson) photosynthetic cycle and those that incorporate the "C4" (or Hatch-Slack) photosynthetic cycle.
[0241] In C3 plants, the primary CO2 fixation or carboxylation reaction involves the enzyme ribulose-l,5-diphosphate carboxylase and the first stable product is a 3-carbon compound. C3 plants, such as hardwoods and conifers, are dominant in the temperate climate zones. [0242] In C4 plants, an additional carboxylation reaction involving another enzyme, phosphoenol-pyruvate carboxylase, is the primary carboxylation reaction. The first stable carbon compound is a 4-carbon acid which is subsequently decarboxylated. The CO2 thus released is refixed by the C3 cycle. Examples of C4 plants are tropical grasses, corn, and sugar cane.
[0243] Both C4 and C3 plants exhibit a range of 13C/12C isotopic ratios, but typical values are about -7 to about -13 per mil for C4 plants and about -19 to about -27 per mil for C3 plants (see, e.g., Stuiver et al., Radiocarbon, 19: 355 (1977)). Coal and petroleum fall generally in this latter range. The 13C measurement scale was originally defined by a zero set by Pee Dee Belemnite (PDB) limestone, where values are given in parts per thousand deviations from this material. The "613C", values are in parts per thousand (per mil), abbreviated, %o, and are calculated as follows:
613C (96o) = [(13C/12C) sample- (13C/12C) standard]/ (13C/12C) standard x 1000
[0244] Since the PDB reference material (RM) has been exhausted, a series of alternative RMs have been developed in cooperation with the IAEA, USGS, NIST, and other selected international isotope laboratories. Notations for the per mil deviations from PDB is 513C.
Measurements are made on CO2 by high precision stable ratio mass spectrometry (IRMS) on molecular ions of masses 44, 45, and 46.
[0245] The invention provides a hydrocarbon or biofuel produced by any of the methods disclosed herein. Specifically, the hydrocarbon or biofuel can have a 513C of about -28 or greater, about -27 or greater, -20 or greater, -18 or greater, -15 or greater, -13 or greater, -10 or greater, and -8 or greater. For example, the hydrocarbon can have a 513C of about -30 to about -15, about -27 to about -19, about -25 to about -21, about -15 to about -5, about -13 to about -7, about -13 to about -10. In some examples, a biofuel composition can be made that includes an olefin having 613C of from about -10.9 to about -15.4, where the olefin accounts for at least about 85% of biosourced material (i.e., derived from a renewable resource, such as biomass, cellulosic materials, and sugars) in the composition. The invention also provides for a hydrocarbon or biofule with a 513C of about -10, -11, -12, or -12.3. [0246] Biologically produced hydrocarbons can also be distinguished from petroleum based hydrocarbons by comparing the amount of 14C in each fuel. Because 14C has a nuclear half life of 5730 years, petroleum based fuels containing "older" carbon can be distinguished from biofuels which contain "newer" carbon (see, e.g., Currie, "Source Apportionment of Atmospheric Particles," Characterization of Environmental Particles, J. Buffle and H. P. van Leeuwen, Eds., 1 of Vol. I of the IUPAC Environmental Analytical Chemistry Series (Lewis Publishers, Inc) (1992) 3-74).
[0247] The basic assumption in radiocarbon dating is that the constancy of 14C concentration in the atmosphere leads to the constancy of 14C in living organisms. However, because of atmospheric nuclear testing since 1950 and the burning of fossil fuel since 1850, 14C has acquired a second, geochemical time characteristic. Its concentration in atmospheric CO2, and hence in the living biosphere, approximately doubled at the peak of nuclear testing, in the mid-1960s. It has since been gradually returning to the steady-state cosmogenic (atmospheric) baseline isotope rate (14C /12C) of about 1.2 x 10"12, with an approximate relaxation "half-life" of 7-10 years. (This latter half-life must not be taken literally; rather, one must use the detailed atmospheric nuclear input/decay function to trace the variation of atmospheric and biospheric 14C since the onset of the nuclear age.)
[0248] It is this latter biospheric l C time characteristic that holds out the promise of annual dating of recent biospheric carbon. 14C can be measured by accelerator mass spectrometry (AMS), with results given in units of "fraction of modern carbon" (fu)- fM is defined by
National Institute of Standards and Technology (NIST) Standard Reference Materials (SRMs) 4990B and 4990C. As used herein, "fraction of modern carbon" or "fM" has the same meaning as defined by National Institute of Standards and Technology (NIST) Standard Reference Materials (SRMs) 4990B and 4990C, known as oxalic acids standards HOxI and HOxII, respectively. The fundamental definition relates to 0.95 times the 14C /12C isotope ratio HOxI (referenced to AD 1950). This is roughly equivalent to decay-corrected pre- Industrial Revolution wood. For the current living biosphere (plant material), fM is approximately 1.1.
[0249] The invention provides a hydrocarbon or biofuel which can have an fM 14C of at least about 1. For example, the hydrocarbon or biofuel can have an fM 14C of at least about 1.01, an fM 14C of about 1 to about 1.5, an fM 14C of about 1.04 to about 1.18, or an fM 14C of about 1.111 to about 1.124. In some examples, the olefin in the biofuel composition can have a fraction of modern carbon (fM 14C) of, for example, at least about 1.003, 1.010, or 1.5. [0250] Another measurement of 14C is known as the percent of modern carbon, pMC. For an archaeologist or geologist using 14C dates, AD 1950 equals "zero years old". This also represents 100 pMC. "Bomb carbon" in the atmosphere reached almost twice the normal level in 1963 at the peak of thermo-nuclear weapons. Its distribution within the atmosphere has been approximated since its appearance, showing values that are greater than 100 pMC for plants and animals living since AD 1950. It has gradually decreased over time with today's value being near 107.5 pMC. This means that a fresh biomass material, such as corn, would give a 14C signature near 107.5 pMC. Petroleum based compounds will have a pMC value of zero. Combining fossil carbon with present day carbon will result in a dilution of the present day pMC content. By presuming 107.5 pMC represents the 14C content of present day biomass materials and 0 pMC represents the 14C content of petroleum based products, the measured pMC value for that material will reflect the proportions of the two component types. For example, a material derived 100% from present day soybeans would give a radiocarbon signature near 107.5 pMC. If that material was diluted 50% with petroleum based products, it would give a radiocarbon signature of approximately 54 pMC. [0251] A biologically based carbon content is derived by assigning 100% equal to 107.5 pMC and 0% equal to 0 pMC. For example, a sample measuring 99 pMC will give an equivalent biologically based carbon content of 93%. This value is referred to as the mean
biologically based carbon result and assumes all the components within the analyzed material originated either from present day biological material or petroleum based material. [0252] The invention provides a hydrocarbon or biofuel which can have a pMC of at least about 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100. The invention further provides for a hydrocarbon or fuel which has a pMC of between about 50 to about 100, about 60 to about 100, about 70 to about 100, about 80 to about 100, about 85 to about 100, and about 87 to about 98, about 90 to about 95. The invention further provides for a hydrocarbon or biofuel with a pMC of about 90, 91, 92, 93, 94, or 94.2.
[0253] Fuel additives are used to enhance the performance of a fuel or engine. For example, fuel additives can be used to alter the freezing/gelling point, cloud point, lubricity, viscosity, oxidative stability, ignition quality, octane level, and/or flash point. In the United States, all fuel additives must be registered with Environmental Protection Agency. The names of fuel additives and the companies that sell the fuel additives are publicly available by contacting the EPA or by viewing the agency's website. One of ordinary skill in the art will appreciate that the olefin-based biofuels described herein can be mixed with one or more fuel additives to impart a desired quality.
[0254] The olefin-based biofuels described herein can be mixed with other fuels, such as various alcohols, such as ethanol and butanol, and petroleum-derived products, such as gasoline, diesel, or jet fuel.
[0255] In some examples, the mixture can include at least about 10%, 15%, 20%, 30%, 40%, 50%, or 60% by weight of the olefin. In other examples, a biofuel composition can be made that includes at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90% or 95% of an olefin that includes a carbon chain that is 8:1, 10:1, 12:1, 13:1, 14:1, 14:2, 15:1, 15:2, 16:1, 16:2, 17:1, 17:2, 18:1, 18:2, 18:3, 19:1, 19:2, 19:3, 20:1, 20:2, 20:3, 22:1, 22:2, or 22:3. Such biofuel compositions can additionally include at least one additive selected from a cloud point lowering additive that can lower the cloud point to less than about 50C, or 0°C; a surfactant; a microemulsion; at least about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, or 95% diesel fuel from triglycerides; petroleum-derived gasoline; or diesel fuel from petroleum.
EXAMPLES
[0256] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
Example 1. Identification and Reclassification of a Microorganism Belonging to the Genus Jeotgalicoccus that is an α-olefin Producer
[0257] Micrococcus candicans ATCC 8456 was previously reported to synthesize aliphatic hydrocarbons with carbon chain lengths ranging from Cj8 to C20 (Morrison et ah, J. Bacteriol. 108:353-358, 1971). To identify the hydrocarbons produced by this strain, ATCC 8456 cells were cultured in 15 mL TSBYE medium (3% Tryptic Soy Broth + 0.5% Yeast Extract), for 40-48 h at 3O0C. Cells from 5 mL of culture were pelleted, resuspended in 1 mL methanol, sonicated for 30 min and extracted with 4 mL hexane. After solvent evaporation, samples were resuspended in 0.1 mL hexane and analyzed by GC-MS. The hydrocarbons were identified as the following α-olefins: 15 -methyl- 1-heptadecene (a-C18), 16-methyl-l- heptadecene (i-Cj8), 1-nonadecene (n-C^), 17-methyl-l-nonadecene (a-C20) and 18-methyl- 1-nonadecene (i-C20) (i=iso, a=anteiso, n=straight chain) (see, e.g., Figure 1 and Figure 2).
[0258] Based upon the following analyses, it was determined that ATCC 8456 was previously misidentified as belonging to the genus Micrococci. The phylogenetic classification of ATCC 8456 was reassessed by amplifying and sequencing the partial 16s rRNA gene using primers Eubac27 and 1492R (see DeLong et al, PNAS 89:5685, 1992). The 16s rRNA sequence of ATCC8456 (SEQ ID NO:3, depicted in Figure 7C) was analyzed using the classifier program of the Ribosomal Database Project II (http://rdp.cme.msu.edu/index.jsp). Based upon this analysis, the strain was identified as belonging to the genus Jeotgalicoccus. The genus Jeotgalicoccus has been previously described (see, e.g., Jung-Hoon et al, Int. J. Syst. Evol. Microbiol. 53:595-602, 2003).
[0259] Additional analysis using the G+C content of ATCC 8456 was conducted. Jeotgalicoccus is a low G+C Gram-positive bacteria related to the genus Staphylococcus (see Figure 3). Micrococci are high G+C Gram-positive bacteria. The ends of several clones from a cosmid library of ATCC 8456 genomic DNA were sequenced. Based upon a DNA sequence of approximately 4,000 bp, the G+C content was determined to be approximately
36%. Nucleotide sequence searches against a non-redundant protein database revealed that all sequences with a match to a database entry were similar to proteins from low G+C Gram- positive bacteria, such as species belonging to the genus Staphylococcus or Bacillus, but not the genus Micrococcus.
[0260] Next, an analysis of the entire genome of ATCC 8456 was conducted. Based on a DNA sequence of approximately 2.1 MB, the G+C content of the entire genome was determined to be about 36.7%. In contrast, bacteria of the genus Micrococcus are known to have high G+C genomes. For example, the genome of Micrococcus luteus NCTC 2665 has a G+G content of 72.9% (GenBank Accession ABLQO 1000001-68). Based upon the G+C content analysis, it was determined that the ATCC 8456 microorganism does not belong to the genus Micrococcus.
[0261] Additional Jeotgalicoccus strains were also examined to determine if they produced α-olefϊns. The following strains of Jeotgalicoccus were examined: Jeotgalicoccus halotolerans DSMZ 17274, Jeotgalicoccus psychrophilus DSMZ 19085, and Jeotgalicoccus pinnipedalis DSMZ 17030. Each strain was cultured in 15 mL TSBYE medium (3% Tryptic Soy Broth + 0.5% Yeast Extract), and the hydrocarbons were isolated and analyzed by GC- MS as described above. All three strains produced α-olefins similar to the ones produced by ATCC 8456 (Figures IB, 1C, and ID depict GC-MS traces for the hydrocarbons produced by Jeotgalicoccus halotolerans DSMZ 17274 cells, Jeotgalicoccus pinnipedalis DSMZ 17030 cells, and Jeotgalicoccus psychrophilus DSMZ 19085 cells, respectively). These data indicate that the ability to produce α-olefins is widespread among the genus Jeotgalicoccus.
Example 2. Production of Increased Levels of Olefins and α-olefins Not Normally Produced by ATCC 8456 Cells Using Fatty Acid Feeding
[0262] The fatty acids eicosanoic acid (straight-chain C20 fatty acid), 16-methyl octadecanoic acid, and 17-methyl octadecanoic acid (branched-chain Cj9 fatty acids) were identified as components of ATCC 8456's lipids. These fatty acids were deduced to be the direct precursors, after decarboxylation, for 1 -nonadecene, 15 -methyl- 1-heptadecene, and 16- methyl-1-heptadecene biosynthesis, respectively. In order to improve α-olefin production and to produce olefins not normally produced by ATCC 8456 cells, fatty acid feeding experiments were carried out as described below.
[0263] ATCC 8456 cells were grown in 15 rnL TSBYE medium (3% Tryptic Soy Broth + 0.5% Yeast Extract). Fatty acids were added to the culture medium at final concentrations of 0.5 g/1 (0.05%). After growth for 40-48 h at 3O0C, cells from 5 mL of culture were pelleted, resuspended in 1 mL methanol, sonicated for 30 min, and extracted with 4 mL hexane. After solvent evaporation, samples were resuspended in 0.1 mL hexane and analyzed by GC-MS.
[0264] When cultures were fed eicosanoic acid, an increase in 1-nonodecene production of approximately 18-fold was observed (see Figure 4A; black traces depict production without fatty acid feeding and gray traces depict production with fatty acid feeding). When cultures were fed stearic acid or palmitic acid, an increase in the production of the α-olefins 1-pentadecene and 1-heptadecene, respectively, was observed (see Figure 4B). These olefins are not normally produced by ATCC 8456 cells. This indicated that fatty acids were the direct precursors for α-olefins and that Jeotgalicoccus bacteria could be used to enzymatically convert fatty acids into α-olefins in vivo.
[0265] In alternative methods, when resting Jeotgalicoccus cells are fed various fatty acids and the production of α-olefins is analyzed, similar results are observed.
Example 3. In Vitro Synthesis of α-olefins Using Cell Extracts and Partially Purified Proteins
[0266] A cell free extract of ATCC 8456 was used to convert free fatty acids into α-olefins. The cell free extract was generated using the following procedure: ATCC 8456 cells were grown in TSBYE medium (3% Tryptic Soy Broth + 0.5% Yeast Extract) at 3O0C for 24 h with shaking. The cells were then pelleted from the culture by centrifuging at 3,700 rpm for 20 min. The cell pellet was then resuspended in 50 mM Tris buffer pH 7.5 with 0.1 M NaCl and 2.0 mM dithiothreitol to a concentration of 0.1 g/mL cells. To this cell slurry, 200 units/mL of lysostaphin (Sigma) were added on ice. The cell lysis reaction was allowed to proceed for 30 min. The cells were then sonicated at 12 W on ice for three cycles of 1.5 sec of sonication followed by 1.5 sec of rest. Sonication lasted for a total of 9 sec. This procedure was repeated 5 times with a 1 min interval between each sonication cycle. The lysed cells were then centrifuged at 12,000 rpm for 10 min to pellet the cell debris. The supernatant {i.e., cell free extract) was then removed and used for the conversion of free fatty acids to α-olefins.
[0267] After obtaining the cell free extract, the free fatty acids, stearic acid and eicosanoic acid, were converted to α-olefins using the cell free extract as described below.
[0268] First, a 5% stock solution of sodium or potassium stearate was made in 1% Tergitol solution (Sigma, St. Louis, MO). Next, 6 μL of the stock solution was added to 1 mL of the cell free extract at room temperature to obtain a final concentration of 1 mM free fatty acid salt. The reaction was conducted at room temperature for 3 h. The α-olefins were recovered by adding 200 μL of ethyl acetate to the mixture, vortexing briefly, centrifuging briefly, and then removing the organic phase. The α-olefins were detected using GC/MS.
[0269] Figure 5 shows the GC/MS trace for assaying stearic acid. In sample 1 (TICl; black line in Figure 5), no stearic acid was added to the cell free extract. In sample 2 (TIC3; blue line in Figure 5), the cell free extract was replaced with 50 mM Tris pH 7.5 buffer with 0.1 M sodium chloride to which stearic acid was added. In sample 3 (TIC5; red line in Figure 5), stearic acid was added to the cell free extract. The peak at 7.62 min had the same retention time and the same mass spectra as a 1-heptadecene standard (Sigma). When eicosanoic acid was added under similar conditions, 1-nonadecene was formed.
[0270] Boiling the cell free extract eliminated the production of α-olefins upon the addition of free fatty acids. This data strongly suggested that the ATCC 8456 catalyst was protein based.
[0271] The ATCC 8456 cell free extract did not require any additional co-factors to produce α-olefins. When the cell free extract was supplemented with several co-factors in 1 mM concentrations, no increase in α-olefin synthesis was observed. The co-factors examined were NAD+, NADP+, NADH, NADPH, FADH2, SAM, ATP, and CoA. In addition, Mg2+ was examined at a 10 mM concentration. The co-factor requirement was also tested by dialyzing the cell free extract with a 10 kDa cut-off membrane for 1.5 h in a volume 200-fold greater than the cell extract volume using a dialysis buffer: 50 mM Tris, pH 7.5 with 0.1 M sodium chloride. No decrease in α-olefin synthesis was observed after dialysis. Additionally, no decrease in α-olefin synthesis was observed when 10 mM EDTA pH 7.5 was added to the reaction mixture.
[0272] The ATCC 8456 cell free extract was further enriched by carrying out an ammonium sulfate precipitation. First, enough ammonium sulfate was added to the cell free extract to bring the concentration of ammonium sulfate to 50% (wt/vol) saturation. The mixture was
stirred gently on ice for 60 min and then centrifuged at 13,000 rpm for 30 min. The supernatant was recovered and additional ammonium sulfate was added to bring the ammonium sulfate concentration to 65% (wt/vol). The mixture was allowed to mix on ice for 60 min and was centrifuged again for 30 min. The supernatant was discarded. The pellet was then resuspended in 50 mM Tris buffer pH 7.5 with 0.1 M sodium chloride. This mixture was then dialyzed in the aforementioned buffer to remove the ammonium sulfate. The cell free extract treated with ammonium sulfate had the same α-olefin synthesizing activity as the cell free extract.
Example 4. Purification and Identification of a Protein That Converts Fatty Acids into α- olefins
[0273] To isolate the protein necessary for α-olefin production from ATCC 8456 cells, the following protein purification procedure was carried out. First, 6 L of ATCC 8456 cells were cultured in TSBYE medium at 30°C for 24 h with shaking. The cells were pelleted at 3,700 rpm for 20 min at 40C, and the supernatant was discarded. The cell pellet was resuspended in a solution of 100 mL of 50 mM Tris pH 8.0, 0.1 M NaCl, 2.0 mM DTT, and bacterial protease inhibitors. The cell slurry was then passed through a french press one time at a pressure of 30,000 psi. Next, the cell slurry was sonicated as described in Example 3 to shear the DNA. The cell free extract was next centrifuged at 10,000 rpm for 60 min at 40C. The supernatant was then removed and ammonium sulfate was added to a final concentration of 50% (wt/vol) ammonium sulfate saturation. The mixture was gently stirred at 40C for 60 min and then centrifuged at 10,000 rpm for 30 min. The supernatant was then removed and additional ammonium sulfate was added to 65% (wt/vol) saturation. The mixture was stirred again for 60 min at 40C and centrifuged at 10,000 rpm for 30 min. The supernatant was discarded. The remaining pellet was resuspended in 50 mL of 50 mM Tris pH 8.0 and 2.0 mM DTT.
[0274] The mixture was passed through a 5 mL HiTrap SP column (GE Healthcare) at 3 mL/min and 4°C. The following buffers were used as an elution gradient: buffer A contained 50 mM Tris pH 8.0 and 2.0 mM DTT and buffer B contained 50 mM Tris pH 8.0, 1.0 M NaCl, and 2.0 mM DTT. After the column was loaded with the mixture, the column was washed with 40% buffer B. Next a 20 min gradient of 40% buffer B to 100% buffer B at 3.0 mL/min was carried out. 5 mL fractions were collected during the elution gradient. Each
fraction was tested for activity as described in Example 3. Fractions containing α-olefin production activity typically eluted between 600 and 750 mM NaCl concentration. Fractions containing activity were then pooled and dialyzed into buffer A.
[0275] The dialyzed protein fraction was then loaded onto a 1 mL ResourceQ (GE Healthcare) column at 4 mL/min at 4°C. Buffer B used with the HiTrap SP column was used for the ResourceQ column. A 7-min elution gradient between 0% buffer B and 25% buffer B was run at 4 mL/min. 1.5 mL fractions were collected and assayed for activity. Active fractions eluted between 150 and 200 mM NaCl concentrations. Fractions containing activity were then pooled and concentrated with a Millipore Amicon protein concentrator (4 mL and 10 kDa exclusion size) to about 50 μL. The approximate protein concentration was determined with a Bradford assay (Biorad). Final protein concentrations ranged from about 5 mg/mL to about 10 mg/mL. 30 μL of protein was then loaded onto a SDS PAGE gel (Invitrogen) along with an appropriate protein molecular weight marker. The gel was stained with Simple Safe Coomassie stain (Invitrogen). Figure 6 depicts a representative gel. Two intense protein bands at 50 kDa and 20 kDa were observed.
[0276] To determine the identity of the protein bands, the bands were excised from the gel, digested with trypsin, and analyzed using LC/MS/MS. The LC/MS/MS data was analyzed using the program Mascot (Mann et al., Anal. Chem. 66:4390-4399, 1994). The ATCC 8456 genome was sequenced. The genomic data was used to interpret the LC/MS/MS data and to determine the identity of the protein bands. The 50 kDa band had a strong match with ORF880. The Mascot score assigned to this match was 919, a high score. Furthermore, ORF880 has a predicted molecular weight of 48,367 Da. The nucleotide and amino acid sequences of orβ80 are presented in Figures 7A (SEQ ID NO:1) and 7B (SEQ ID NO:2), respectively.
Example 5. Heterologous Expression of Jeotgalicoccus ATCC 8456 orfS80 in E. coli
[0277] Jeotgalicoccus ATCC 8456 ORF880 was identified as one of the two major proteins in a highly purified enzyme fraction that catalyzed the conversion of free fatty acids to α- olefins. The genomic DNA encoding ATCC $456_orβ80 was cloned into pCDF-Duetl under the control of the T7 promoter, and E. coli was transformed with various vectors, as described below. The E. coli cells were grown, and the hydrocarbons produced by the cells
were analyzed as described in Example 2. When 0.05% stearic acid was fed to cultures of E. coli transformed with the 8456_ør/850-containing vector, the expression of S456_orβ80 led to the formation of 1-heptadecene in E. coli (see Figure 8, depicting GC/MS traces of α- olefins from E. coli either without (black) or with (gray) expression of S456_orβ80). In contrast, adding 0.05% stearic acid to cultures of E. coli transformed with a vector control (not containing ATCC_orβ80) did not result in the production of 1-heptadecene. This demonstrated that 8456 ORF880 synthesized α-olefϊns from free fatty acids in an E. coli heterologous host. This result indicates that α-olefin biosynthesis can be performed in heterologous organisms. Additionally, when E. coli cells expressing $456_orβ80 protein were fed with 0.05% palmitic acid or 0.05% eicosanoic acid, the production of 1-pentadecene or 1-nonadecene, respectively, was observed.
Example 6. Production of α-Olefins from Glucose by Heterologous Expression of Jeotsalicoccus ATCC 8456 orf880 in E. coli MGl 655 ΔfadD Construction offadD deletion strain
[0278] The fadD gene of E. coli MG1655 was deleted using the lambda red system (Datsenko et al, 2000, Proc. Natl. Acad. Sci. USA. 97: 6640-6645) as described below.
[0279] The chloramphenicol acety transferase gene from pKD3 was amplified with the primers fad 1:
(5 ' -TAACCGGCGTCTGACGACTGACTTAACGCTCAGGCTTTATTGTCCACTTTGTG TAGGCTGGAGCTGCTTCG-3 '), and fad2:
(5 ' -CATTTGGGGTTGCGATGACGACGAACACGCATTTTAGAGGTGAAGAATTGCA TATGAATATCCTCCTTTAGTTCC-3 ').
[0280] This PCR product was electroporated into E. coli MGl 655 (pKD46). The cells were plated on L-chloramphenicol (30 μg/mL)(L-Cm) and grown overnight at 370C. Individual colonies were picked on to another L-Cm plate and grown at 420C. These colonies were then patched to L-Cm and L-carbenicillin (100 mg/mL) (L-Cb) plates and grown at 370C overnight. Colonies that were Cm and Cb were evaluated further by PCR to ensure the PCR product inserted at the correct site. PCR verification was performed on colony Iy sates of these bacteria using the primers fadF (5λ- CGTCCGTGGTAATCATTTGG-3') and fadR
(5λ-TCGCAACCTTTTCGTTGG-3λ). The expected size of the ΔfadDy.Cm deletion was about 1200 bp (Figure 11). The chloramphenicol resistance gene was eliminated using a FLP helper plasmid as described in Datsenko et al. (2000) Proc. Natl. Acad. Sci. USA. 97: 6640- 6645. PCR verification of the deletion was performed with primers fadF and fadR (Figure 11). The MG1655 AfadD strain was unable to grow on M9 + oleate agar plates (oleate as carbon source). It was also unable to grow in M9 + oleate liquid media.
Expression of Jeotgalicoccus ATCC 8456_orβ80 in E. coli MG 1655 ΔfadD
[0281] The genomic DNA encoding ATCC 8456_orf880, which was codon-optimized for expression in E. coli (SEQ ID NO:4), was cloned into vector OP80 (pCL1920 derivative) under the control of the Ptrc promoter, and E. coli MGl 655 AfadD was transformed with the resulting vector. The E, coli cells were grown at 370C in M9 mineral medium supplemented with 20 μg/mL uracil and 100 μg/mL spectinomycin. Glucose (1%, w/v) was the only source of carbon and energy. When the culture reached an OD600 of 0.8 to 1.0, IPTG (1 mM) and 0.5 mM delta-aminolaevulinic acid (heme biosynthesis precursor) were added. The temperature was shifted to 250C. After growth for an additional 18 to 24 h at 250C, the cells from 10 niL of culture were pelleted, resuspended in 1 mL methanol, sonicated for 30 min, and extracted with 4 mL hexane. After solvent evaporation, the samples were resuspended in 0.1 mL hexane and analyzed by GC-MS. In contrast to the vector-only control, E. coli cells transformed with the orfS80-beaήng vector produced the α-olefins: 1-pentadecene and heptadecadiene (see Figure 12). This result indicates that expression of orf880confers on E. coli the ability to biosynthesize α-olefms when grown on glucose and that the direct precursors are the most abundant fatty acids in E. coli, namely hexadecanoic acid and vaccenic acid (11-m-octadecenoic acid).
Example 7: Production of α-Olefins in E. coli by Heterologous Expression of Corynebαcterium efficiens YS- 134 orfCE2459
[0282] Genomic DNA encoding C. efficiens YS- 134 (DSMZ44549) orfCE2459 (SEO ID NO: 6) was cloned into the iVcøl and EcoRl sites of vector OP-80 (pCL1920 derivative) under the control of the Ptrc promoter. The resulting construct was then transformed into E. coli C41 AfαdE.
[0283] The E. coli C41 AfadE was constructed using primers YafV NotI and Ivry_Ol to amplify about 830 bp upstream of fadE and primers Lpcaf_ol and LpcaR_Bam to amplify about 960 bp downstream of fadE. Overlap PCR was used to create a construct for in frame deletion of the complete fadE gene. The fadE deletion construct was cloned into the temperature-sensitive plasmid pKOV3, which contained a sacB gene for counterselection, and a chromosomal deletion of fadE was made according to the method of Link et al., J. Bact. 179:6228-6237, 1997. This strain has the acyl-CoA dehydrogenase gene (fadE) deleted, therefore it can not degrade activated fatty acids.
[0284] The cells were grown at 370C in M9 minimal media supplemented with 20 μg/mL uracil, 1% glucose (w/v), and 100 μg/mL spectinomycin. When the culture reached an OD60O of 0.8 to 1.0, it was induced with 1 mM IPTG supplemented with 0.5 mM delta- aminolaevulinic acid (heme biosynthesis precursor), and 0.05% stearic acid (as a substrate for orfCE2459). The temperature was shifted to 250C and cells were allowed to grow for an additional 18-20 h Cells from 1 mL of culture were resuspended with 100 μL of methanol, sonicated for 30 min, and extracted with 300 μL of ethyl acetate. After vortexing for 15 min, 300 μL of water was added, and the mixture was vortexed for another 15 min before centrifugation at 15,000 rpm for 10 min. The solvent layer was analyzed by GC-MS.
[0285] As shown in Figure 13, E. coli cells transformed with an orfCE2459-bearing vector produced 1 -heptadecadiene without stearic acid feeding and produced 1-heptadecene with stearic acid feeding. This result indicates that expression of orfCE2459 confers on E. coli the ability to biosynthesize α-olefϊns {e.g., 1- heptadecadiene) when grown on glucose (Figure 13B) and that orfCE2459 can convert fed fatty acids, such as stearic acid, into α-olefϊns, such as 1-heptadecene (Figure 13C).
Example 8: Production of α-Olefins in E. coli by Heterologous Expression of Kokuria rhizoϋhila orfKRH21570
[0286] Genomic DNA encoding Kokuria rhizophila DC2201 orfKRH21570 (SEQ ID NO:8), which was codon optimized (SEQ ID NO: 9) for expression in E .coli, was cloned into the NJeI and^TzoI sites of vector OP- 183 (pACYC177 derivative) under the control of the Ptrc promoter. The resulting construct was then transformed into E. coli C41 AfadE. The cells were grown, extracted, and analyzed as in described in Example 7.
[0287] As shown in Figure 14, E. coli cells transformed with codon optimized orfKRH21570-bearing vector produced 1-heptadecadiene without stearic acid feeding and produced 1-heptadecene with stearic acid feeding. This result indicates that expression of orfKRH21570 confers on E. coli the ability to biosynthesize α-olefins {e.g., 1- heptadecadiene) when grown on glucose (Figure 14C) and that orfKRH21570 can convert fed fatty acids, such as stearic acid, into α-olefins, such as 1-heptadecene (Figure 14D).
Example 9: Production of α-Olefms in Bacillus subtilis by Heterologous Expression of Jeotsalicoccus sp. ATCC8456 orf880
[0288] Genomic DNA encoding Jeotgalicoccus ATCC 8456_orβ80 was cloned into the BamHl and Xbal sites of vector pHTOl under the control of the Pgrac promoter. B. subtilis IHAOl (lacA::spec leuB8 metB5 r(-)m(+) Sp, obtained from Bacillus Genetic Stock Center, Columbus, OH, strain number BGSC 1 A785) was transformed with the resulting vector. The B. subtilis cells were grown at 370C in minimal medium supplemented with 2% glucose, 0.3 mM leucine, 0.3 mM methionine, and 10 mg/L chloramphenicol. When the cultures reached an OD6Oo of 0.8 to 1.0, 1 mM IPTG was added (to induce expression of orβ80) along with 0.5 mM 5-amino laevulinic acid (as a precursor for heme biosynthesis) and 0.05 % stearic acid (as a substrate for ORF880). The temperature was shifted to 25°C and after growth for additional 18-24 h at 25°C, cells from a 1 mL culture were pelleted, resuspended in 100 μL methanol, sonicated for 1 h, and extracted with 300 μL ethyl acetate. 300 μL of water was added before separating the organic layer by centrifugation at 15,000 rpm for 5 min. The solvent layer was analyzed by GC-MS.
[0289] In contrast to cells transformed with the vector only control, B. subtilis cells transformed with Jeotgalicoccus sp. ATCC8456 ør/SSO-bearing vector produced 1- heptadecene from stearic acid (see Figure 15B). This example demonstrates that in B. subtilis fatty acids, such as stearic acid, can be converted to α-olefins by heterologous expression of Jeotgalicoccus ATCC 8456_orβ80 in Bacillus subtilis.
Example 10: Production of α-Olefins in Bacillus subtilis by Heterologous Expression of Corynebacterium efficiens YS- 134 orfCE2459
[0290] Genomic DNA encoding Corynebacterium efficiens YS-134 orfCE2459 was cloned into the BamHI and Xbal sites of vector pHTOl under the control of the Pgrac promoter and transformed into B. subtilis IHAOl cells. The resulting cells were grown, extracted, and analyzed as described in Example 9.
[0291] In contrast to cells transformed with the vector only control, B. subtilis cells transformed with Corynebacterium efficiens YS-134 orf_CE2459-beaήng vector produced 1-heptadecene from stearic acid (see Figure 15). This demonstrates that in B. subtilis fatty acids, such as stearic acid, can be converted to α-olefins by heterologous expression of C. efficiens orf_CE2459.
Example 11 : Production of α-Olefins in Sαcchαromyces cerevisiαe by Heterologous Expression of Jeotgαlicoccus sp. ATCC8456 orf880
[0292] Genomic DNA encoding Jeotgαlicoccus sp. ATCC 8456_orβ80 is cloned into the Apαl and Xhol sites of the yeast expression vector pESC-His. S. cerevisiαe (BY4741) yeast cells are then transformed with either a plasmid containing orβ80 or a plasmid not containing orf880. The transformed yeast cells are cultured under suitable conditions to allow expression of ORF880. The cells are pelleted and then lysed using YeastBuster™ (Novagen, Madison, WI). The α-olefϊns are extracted and analyzed as described in Examples 6 and 7.
[0293] Jeotgαlicoccus sp. ATCC8456_or/SS0 expressed in S. cerevisiαe produces α-olefins. Similar methods are used to express Jeotgαlicoccus sp. ATCC 8456j)rβ80 in any cell of interest, after which cell lysates are prepared and the production of α-olefins analyzed.
Example 12. In Vitro Synthesis of α-Olefins by Jeoteαlicoccus sp. ATCC8456 _orβ80 Heterologously Expressed in and Purified from E. coli
Expression and Purification of Jeotgalicoccus sp. ATCC8456_orβ80
[0294] The genomic DNA encoding Jeotgalicoccus sp._ATCC8456_orβ80 was cloned into the Ndel and Xhol sites of vector pET15b (Novagen) under the control of the T7 promoter
for expression in and purification from E. coli. This plasmid expressed an N-terminal His- tagged version of 8456_orβ80.
[0295] An E. coli BL21 strain (DE3) (Invitrogen) was transformed with pETl5b-orβ80 using routine chemical transformation techniques. Protein expression was carried out by first inoculating a colony of the E. coli strain in 5 mL of LB media supplemented with 100 mg/L of carbenecillin and shaken overnight at 37°C to produce a starter culture. This starter culture was used to inoculate 1 L of LB media supplemented with 100 mg/L of carbenecillin. The culture was shaken at 37°C until an OD6O0 value of 0.6 was reached. The culture was placed on ice for 10 min before IPTG was added to a final concentration of 250 μM. The culture was then shaken at 18°C for approximately 18 h. The culture was then centrifuged at 3,700 rpm for 20 min at 40C. The pellet was then resuspended in 30 mL of buffer containing 100 mM sodium phosphate buffer at pH 7.2 supplemented with Bacterial ProteaseArrest (GBiosciences). The cells were then sonicated at 12 W on ice for 9 sec with 1.5 sec of sonication followed by 1.5 sec of rest. This procedure was repeated 5 times with one min intervals between each sonication cycle. The cell free extract was centrifuged at 10,000 rpm for 30 min at 4°C. 5 mL of Ni-NTA (Qiagen) was added to the supernatant and the mixture was gently stirred at 4°C. The slurry was passed over a column removing the resin from the lysate. The resin was then washed with 30 mL of buffer containing 100 mM sodium phosphate buffer at pH 7.2 plus 30 mM imidazole. Finally, the protein was eluted with 15 mL of 100 mM sodium phosphate buffer at pH 7.2 plus 250 mM imidazole. The protein solution was dialyzed with 200 volumes of 100 mM sodium phosphate buffer at pH 7.2. Protein concentration was determined using the Bradford assay (Biorad). 125 μg/mL of protein was obtained.
In Vitro Synthesis of a-Olefins from Fatty Acid Substrates
[0296] In order to assay the in vitro fatty acid substrate specificity of ORF880, potassium salts of the following fatty acids were prepared: tetradecanoic acid, hexadecanoic acid, octadecanoic acid, eicosanoic acid, and behenic acid (Sigma). The fatty acid solutions were made with 2% ethanol and 2% Tergitol solution (Sigma, St. Louis, MO) to a final concentration of 20 mM.
[0297] The kinetics of the decarboxylation reaction was determined using potassium octadecanoate. A 200 μL reaction was prepared with the following reactant concentrations:
1.25 μM of ORF880, 200 μM of potassium octadecanoate, 200 μL dithiothreitol , and 100 mM sodium phosphate buffer at pH 7.2. The reactions were incubated at room temperature and time points were taken in duplicate between 5 min and 120 min. Reactions were quenched and extracted by adding 100 μL of ethyl acetate containing 1-octadecene at 5 mg/L as an internal reference. Samples were analyzed using GC/MS using the alkane-1 splitless method, which is performed using the following parameters: run time: 20 min; column: HP- 5-MS Part No. 19091S-433E (length of 30 meters; I.D.: 0.25 mm narrowbore; film: 0.25μM); sample: standard ethyl acetate extraction; inject: 1 μL Agilent 6850 inlet; inlet: 3000C splitless; carrier gas: helium; flow: 1.3 niL/min; oven temp: 100°C hold 5 min, 320 at 20°C/min, 320 hold 5 min; det: Agilent 5975B VL MSD; det. temp: 300°C; scan: 50-500 M/Z. Calibration curves were generated using 1-heptadecene dissolved in ethyl acetate. Based upon this analysis, the product production was determined to be linear from 5 min to 60 min.
[0298] To assay the reaction rates of different fatty acid substrates, the following reactions were prepared at 200 μL scales: 1.0 μM ORF880 enzyme, 200 μM of a test fatty acid salt, 200 μL dithiothreitol, and 100 mM sodium phosphate buffer at pH 7.2. The reactions were carried out at room temperature and time points were taken in triplicate at 20 min and 47 min using the extraction and analysis procedure described above. Reference curves were generated using available chemical standards. In some instances, the chemical standards were not available (for example, cis-9-heneicosene was used as a reference for 1-heneicosene and 9-tricosene was used as a reference for 1-tricosene). Activities were calculated by taking the difference between the average α-olefm concentrations for each substrate at 47 min and 20 min and then dividing the difference by 27 min. The results are summarized in Table 7.]
Table 7: Activity of ORF880 with different fatty acid substrates
These results demonstrate that heterologously expressed ORF880 was able to convert various fatty acid substrates to α-olefins in vitro. The data also show that ORF880 had highest activity when hexadecanoic acid was the fatty acid substrate.
Example 13. In Vitro Synthesis of α-Olefins by Corynebacterium efficiens YS- 134 orfCE2459 Heterologously Expressed in E. coli
[0299] An E. coli BL21 strain (DE3) (Invitrogen) was transformed with pETl5-orfCE2459 using routine transformation techniques. Protein expression was carried out by first inoculating a colony of the E. coli strain in 5 mL of LB media supplemented with 100 mg/L of carbenecillin and then shaking overnight at 37°C to produce a starter culture. This starter culture was used to inoculate 0.5 L of LB media supplemented with 100 mg/L of carbenecillin. The culture was shaken at 37°C until an OD600 value of 0.6 was reached. The culture was placed on ice for 10 min before IPTG was added to a final concentration of 250 μM. δ- Aminolevulinic acid was also added to a final concentration of 0.5 mM. The culture was then shaken at 25 °C for approximately 18 h. The culture was then centrifuged at 3,700 rpm for 20 min at 40C. The pellet was then resuspended in 7 mL of buffer containing 100 mM sodium phosphate buffer at pH 7.2 supplemented with Bacterial ProteaseArrest (GBiosciences). The cells were then sonicated at 12 W on ice for 9 sec with 1.5 sec of sonication followed by 1.5 sec of rest. This procedure was repeated 4 times with one min
intervals between each sonication cycle. The cell free extract was centrifuged at 10,000 rpm for 30 min at 4°C.
[0300] To assay the activity of ORF CE2459, 200 μL of lysate was incubated with 200 μM of hydrogen peroxide and 200 μM of potassium octadecanoate. As a negative control, the same reaction was set up, but without the addition of either cell lysate (100 mM sodium phosphate pH 7.2 was used in its place) or free fatty acid. The reactions were incubated at room temperature overnight. The reactions were then extracted with 100 μL of ethyl acetate with 1-octadecene added at 5 mg/L as an internal standard. Samples were analyzed using GC/MS using the alkane-1 splitless method which was performed using the following parameters: run time: 20 min; column: HP-5-MS Part No. 19091S-433E (length of 30 meters; LD. : 0.25 mm narrowbore; film: 0.25 μM); sample: standard ethyl acetate extraction; inject: 1 μL Agilent 6850 inlet; inlet: 300°C splitless; carrier gas: helium; flow: 1.3 mL/min; oven temp: 100°C hold 5 min, 320 at 2O0C /min, 320 hold 5 min; det: Agilent 5975B VL MSD; det. temp: 300°C; scan: 50-500 M/Z.
[0301] As shown in Figure 17, an E. coli lysate expressing orfCE2459 was capable of converting octadecanoic acid into 1-heptadecene. The peak at 5.20 min corresponds to 1-heptadecene and the peak at 8.76 is the internal standard 1-octadecene. Peak identification was determined by comparing the retention time and the MS fragmentation pattern with authentic references from Sigma. This result demonstrates that ORF CE2459 exhibits similar in vitro fatty acid decarboxylase activity as ORF880.
Example 14. In Vitro Synthesis of α-Olefms by Kokuria rhizophila orf KRH21570 Heterologously Expressed in and Purified from E. coli
[0302] The genomic DNA encoding Kokuria rhizophila orf_KRH21570 was cloned into the Ndel and Xhol sites of vector pET15b (Novagen) under the control of the T7 promoter for expression in and purification from E. coli. This plasmid expressed an N-terminal His-tagged
[0303] E. coli C41 DE3 (AfadE) cells were transformed with pETl5b-orfKRH21570 using routine transformation techniques. Protein expression was carried out by first inoculating 5 mL of LB broth supplemented with 100 mg/L carbenicillin with a colony of the E. coli strain which was followed by shaking the cells overnight at 370C to produce a starter culture. This starter culture was used to inoculate 0.5 L of LB media supplemented with 100 mg/L of
carbenicillin. The culture was shaken at 370C until an OD60O value of 0.6 was reached, after which it was induced with 1 niM IPTG and 0.5 mM delta-aminolaevulinic acid. The culture was then shaken at 250C for approximately 18 h. The protein was purified as described in Example 12.
[0304] To assay the activity of ORF_KRH21570, 200 μL of purified protein was incubated with 200 μM of hydrogen peroxide and 200 μM of potassium hexadecanoate. As a negative control, the same reaction was conducted, but without the addition of either purified protein (100 mM sodium phosphate pH 7.2 was used in its place) or free fatty acid. The reactions were performed in duplicates and incubated at room temperature overnight. The reactions were then extracted with 100 μL of ethyl acetate with 1-octadecene added at 5 mg/L as an internal standard. Trimethylanilinium hydroxide was added to the ethyl acetate layer at a 1 : 1 ratio and the extracts analyzed by GC/MS using the MAR_splitless_short method. The parameters used were as follows: 9.50 min; column: DB5-ht Part No. J&W 122-5711 (length of 15 meters; LD. : 0.25 mm narrowbore; film: 0.1 OμM); sample: standard ethyl acetate extraction; inject: 1 μL Agilent 6850 inlet; inlet: 300 C splitless; carrier gas: helium; flow: 1.3 mL/min; oven temp: 800C hold 1.0 min, 320 at 30°C/min, 320 hold 0.5 min; det: Agilent 5975B VL MSD; EI mode; det. temp: 2300C; scan: 50-330 M/Z.
[0305] As shown in Figure 18, Kokuria rhizophila ORF KRH21570 was capable of converting hexadecanoic acid to 1-pentadecene in vitro.
Example 15. In Vitro Synthesis of α-Olefins by Methylobacterium populi orf Mpopl292 Heterologously Expressed in and Purified from E. coli
[0306] The genomic DNA encoding Methylobacterium populi orf_Mpopl292 (SEQ ID NO:11) was cloned into the Ndel and Xhol sites of vector pET15b (Novagen) under the control of the T7 promoter for expression in and purification from E. coli. This plasmid expressed an N-terminal His-tagged version of orf_KRH21570.
[0307] E. coli C41 DE3 (AfadE) cells were transformed with pET\5b-orf_Mpopl292 using routine transformation techniques. Protein expression was carried out by first inoculating 5 mL of LB broth supplemented with 100 mg/L carbenicillin with a colony of the E. coli strain, and then shaking the cells overnight at 370C to produce a starter culture. This starter culture was used to inoculate 0.5 L of LB media supplemented with 100 mg/L of carbenicillin. The
culture was shaken at 370C until an OD60O value of 0.6 was reached, after which it was induced with 1 mM IPTG and 0.5 mM delta-aminolaevulinic acid. The culture was then shaken at 25°C for about 18 h. The protein was purified as described in Example 12 and assayed as described in Example 14.
[0308] As shown in Figure 19, Methylobacterium populi ORF_Mpopl292 was capable of converting hexadecanoic acid to 1 -pentadecene in vitro.
Example 16: Production of α-Olefins in E. coli Through Heterologous Expression of Bacillus subtilis fatty acid hydroxylase, P450gsβ
[0309] The genomic DNA encoding Bacillus subtilis fatty acid hydroxylase, Cypl52Al (SEQ ID NO:13) or P450Bsβ, was cloned into the Ndel and Xhol sites of vector OP-183 (pACYC177 derivative) under the control of the Ptrc promoter. The construct was used as a template to introduce a mutation at position 85 changing the GIu to His using the following primer: GTTAATGCGATTCAcGGAATGGATGGC. The resulting constructs were then transformed into E. coli C41 (AfadE). The cells were grown at 37°C in M9 minimal media supplemented with 20 μg/mL uracil, 1% glucose (w/v), and 100 μg/mL carbenicillin. When the culture reached OD60O of 0.8-1.0, it was induced with ImM IPTG; supplemented with 0.5mM delta-aminolaevulinic acid (heme biosynthesis precursor) and 0.05% stearic acid (as a substrate for Bsb). The temperature was shifted down to 25°C and cells were allowed to grow for an additional 18-20 h. Cells from 1 mL of culture was resuspended with 100 μL of methanol, sonicated for 30 min, and extracted with 300 μL of ethyl acetate. After vortexing the extract for 15 min, 300 μL of water was added, vortexed for another 15 minutes before centrifugation at 15,000 rpm for 10 minutes. The solvent layer was analyzed by GC-MS. [0310] As shown in Figure 20, E. coli cells transformed with Bacillus subtilis P450βSβ- bearing vectors produced 1-heptadecene with stearic acid feeding. This result indicates that Bacillus subtilis P450βSβ can convert fed fatty acids, such as stearic acid, into α-olefms, such as 1-heptadecene (Figure 20). Both the wildtype protein and the Gln85-His-mutant protein were capable of carrying out this reaction.
Example 17: Specific activity of α-olefin production and α and β hydroxy fatty acid production using ORF880, CYP152A1 (P450g^\ and CYP152A1 Q85H [0311] The specific activity of α-olefin formation as well as α-(2) and β-(3)hydroxy fatty acid formation were determined for ORF880, CYP 152Al, and CYP 152Al Q85H (see Examples 12 and 16). An E. coli BL21 strain (DE3) (Invitrogen) was transformed with either pETl5b-orf880, pETl5b-cypl52Al, and pETl5b-cypl52Al Q85H using routine chemical transformation techniques. Protein expression was carried out by first inoculating a colony of the E. coli strain in 5 mL of LB media supplemented with 100 mg/L of carbenicillin and shaken overnight at 370C to produce a starter culture. This starter culture was used to inoculate 0.5 L of LB media supplemented with 100 mg/L of carbenicillin. The culture was shaken at 37°C until an OD600 value of 0.6 was reached. The culture was placed on ice for 10 min before IPTG was added to a final concentration of 250 μM. The culture was shaken at 25°C for approximately 18 h, and then centrifuged at 3,700 rpm for 20 min at 4°C. The pellet was then resuspended in 10 mL of buffer containing 100 mM sodium phosphate buffer at pH 7.2 supplemented with Bacterial ProteaseArrest (GBiosciences). The cells were then sonicated at 12 W on ice for 9 sec with 1.5 sec of sonication followed by 1.5 sec of rest. This procedure was repeated 5 times with one min intervals between each sonication cycle. The cell free extract was centrifuged at 10,000 rpm for 30 min at 4°C. 5 mL of Ni-NTA (Qiagen) was added to the supernatant, and the mixture was gently stirred at 4°C. The slurry was passed over a column removing the resin from the lysate. The resin was then washed with 30 mL of buffer containing 100 mM sodium phosphate buffer at pH 7.2 plus 30 mM imidazole. Finally, the protein was eluted with 15 mL of 100 mM sodium phosphate buffer at pH 7.2 plus 250 mM imidazole. The protein solution was dialyzed with 200 volumes of 100 mM sodium phosphate buffer at pH 7.2 with 20% glycerol. Protein concentration was determined using the Bradford assay (Biorad). 578 μg/mL of ORF880, 865 μg/mL of CYP 152Al, and 653 μg/mL of CYP152A1 Q85H protein was obtained.
[0312] To determine the specific activity with potassium hexadecanoate, the following reactions were set-up where each time point consisted of 500μL. Each reaction contained of 500 μM H2O2, 200 μM of potassium hexadecanoate, 100 mM sodium phosphate buffer at pH 7.2, and protein at the following concentrations: ORF880 - 0.23 or 0.46 μM; CYP 152Al - 8.65, 17.3, or 34.6 μM; CYP152A1 Q85H - 6.53, 13.06, or 26.12 μM. The reactions were carried out at room temperature and time points were taken at 0, 1, 3, 5, 7, 10, 14, and 20
minutes. Reactions were quenched with 50 μL of 12 M HCl and then extracted with 200 μL of ethyl acetate. 50 μL of this extract was then reacted with 50 μL TV, O- Bis(trimethylsilyl)trifluoroacetamide with trimethyl-chlorosilane (Aldrich). Samples were analyzed using GC/MS using the following parameters: run time: 20 min; column: HP-5-MS Part No. 19091S-433E (length of 30 meters; I.D.: 0.25 mm narrowbore; film: 0.25μM); inject: 1 μL Agilent 6850 inlet; inlet: 300°C splitless; carrier gas: helium; flow: 1.3 mL/min; oven temp: 100°C hold 5 min, 32O0C at 20°C/min, 320°C hold 5 min; det: Agilent 5975B VL MSD; det. temp: 300°C; scan: 50-500 M/Z. Calibration curves were generated using 1- pentadecene, α(2)-hydroxyhexadecanoic acid, and β(3)-hydroxyhexadecanoic acid dissolved in ethyl acetate and derivatized as described herein.
[0313] Based upon this analysis, product formation was determined to be linear within the first three minutes. The specific activities for each enzyme concentration in the linear range were averaged for a given reaction {e.g., decarboxylation, α-hydroxylation, or β- hydroxylation). Figure 21 summarizes the results. The specific activity for 1-pentadecene formation was similar for ORF880 and CYP 152Al . Mutating the glutamine 85 residue to a histidine increased the specific activity of 1 -pentadecene formation (i.e., increased fatty acid decarboxylase activity). This mutation also increased the rate of β-hydroxyhexadecanoic acid formation and lowered the rate of α-hydroxyhexadecanoic acid formation as compared with the wild-type version of CYP 152Al. The rate of hydroxyhexadecanoic acid production by ORF880 was about l/50th of the rates exhibited by the two CYP 152Al enzymes. The ratio of 1-pentadecene formation (i.e. decarboxylation) to hydroxyhexadeconic acid formation (i.e., hydroxylation) activities for each enzyme is given in Figure 22.
Example 18. Analysis of ORF880 Homolog Activity
[0314] As described in Examples 7 through 17, five P450 enzymes were able to convert fatty acids into α-olefins in-vivo and in-vitro, and three of these P450 enzymes were also able to convert fatty acids into β-hydroxy fatty acids (see Table 8). In contrast, two P450 enzymes, Bacillus claussii orf_ABC3040 and Sphingomonas paucimobilis P450spα, were not able to make α-olefins or β-hydroxy fatty acids. These P450 enzymes converted fatty acids only to the corresponding α-hydroxy fatty acids (see Table 8). Consequently, there appears to be a correlation between the ability of a P450 enzyme to hydroxylate fatty acids in the β-position and to decarboxylate fatty acids to the α-olefm, and the inability of a P450 enzyme to
decarboxylate fatty acids to α-olefms if the enzyme can only hydroxy late fatty acids in the α- position. In other words, P450 enzymes that hydroxylate fatty acids in the β-position also have the potential to decarboxylate these fatty acids to α-olefms.
[0315] Table 8 also demonstrates that when a His or Met is at position 85, the enzyme has the ability to produce α-olefins. Table 8 also shows the percent identity of each enzyme tested relative to Jeotgalicoccus sp. 8456 ORF880.
Table 8: ORF880 Homologs Tested
1 : in-vitro experiments with lysate, not with purified protein, difficult to detect hydroxyl fatty acids
2: poorly expressed in E. coli, activity was only detected in-vitro
3: Relative to the position in ORF880
4: with hexadecanoic acid as substrate {in-vitro and in-vivo) hyFA = hydroxy fatty acid
OTHER EMBODIMENTS
[0316] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. An isolated polynucleotide comprising a nucleotide sequence having at least about 70% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
2. The isolated polynucleotide of claim 1, wherein the nucleotide sequence has at least about 80% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
3. The isolated polynucleotide of claim 1, wherein the nucleotide sequence has at least about 90% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
4. The isolated polynucleotide of claim 1, wherein the nucleotide sequence has at least about 95% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13..
5. An isolated polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, 4, 6, 8, 9, 11, or 13.
6. The polynucleotide of claim 5, wherein the polynucleotide consists of the nucleotide sequence of SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
7. An isolated polynucleotide comprising a sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14.
8. An isolated polynucleotide comprising a sequence encoding a polypeptide having the same biological activity as a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14, wherein the polynucleotide comprises (i) the nucleotide sequence of SEQ ID NO: 1 or a fragment thereof, or (ii) a nucleotide sequence that hybridizes to a complement of SEQ ID NO: 1 or to a fragment thereof.
9. The isolated polynucleotide of claim 8, wherein the biological activity is fatty acid decarboxylase activity.
10. The isolated polynucleotide of claim 8, wherein the polynucleotide comprises a sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14.
11. The isolated polynucleotide of claim 8, wherein the polynucleotide is isolated from a bacterium, plant, insect, yeast, fungus, or mammal.
12. The isolated polynucleotide of claim 8, wherein the polynucleotide is isolated from a bacterium.
13. The isolated polynucleotide of claim 12, wherein the bacterium is a Gram positive or Gram negative bacterium.
14. The isolated polynucleotide of claim 12, wherein the bacterium is from the genus Jeotgalicoccus.
15. The isolated polynucleotide of claim 14, wherein the bacterium is selected from the group consisting of Jeotgalicoccus halotolerans, Jeotgalicoccus psychrophilus, Jeotgalicoccus sp. ATCC 8456, Jeotgalicoccus pinnipedalis, Corynebacterium efficiens, Kokuria rhizophila, Methylobacterium populi, and Bacillus subtilis.
16. The isolated polynucleotide of claim 8, further comprising an operably linked promoter.
17. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14.
18. The polypeptide of claim 17, wherein the polypeptide consists of the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14.
19. A fragment of the polypeptide of claim 18, wherein the fragment has fatty acid decarboxylase activity, and wherein the fragment is at least 50 amino acids in length.
20. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more amino acid substitutions, additions, insertions, or deletions, wherein the polypeptide has fatty acid decarboxylase activity.
21. The isolated polypeptide of claim 20, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14 with one or more conservative amino acid substitutions.
22. An isolated polypeptide comprising the amino acid sequence F-X-X-E-[VI]- [RK]-R-X-Y-P-F-(F)-P-X-[LIV], wherein X is any amino acid; [AB] is A or B; {F} stands for any amino acid except Phe; and wherein the polypeptide has fatty acid decarboxylase activity.
23. An isolated polypeptide comprising the amino acid sequence P-X(6)-[LI]- X(4)-{G}-[VI]-[HQM]-X-[MLV]-D-G-X(2)-H-X(2)-R-K, wherein X is any amino acid; X(n) is X repeated n times; [AB] is A or B; {G} stands for any amino acid except GIy; and wherein the polypeptide has fatty acid decarboxylase activity.
24. An isolated polypeptide comprising the amino acid sequence [AC]-[AG]-[IV]- [DE]-[IL]-X-N-X(2)-R-P-X-[VI]-A-X(3)-[FY]-X(2)-F-X(3)-A-[LMV]-X-[DE], wherein X is any amino acid; X(n) is X repeated n times; [AB] is A or B; and wherein the polypeptide has fatty acid decarboxylase activity.
25. An isolated polypeptide comprising the amino acid sequence {RK}-X(6)- [LMV]-X(4)-[AC]-[AG]-[IV]-[DE]-[IL]-X-N-X(2)-R-P-X-[VI]-A-X(3)-[FY]-X(2)-F-X(3)- A-[LMV]-X-[DE], wherein X is any amino acid; X(n) is X repeated n times; [AB] is A or B; {RK} stands for any amino acid except Arg and Lys; and wherein the polypeptide has fatty acid decarboxylase activity.
26. A recombinant vector comprising the polynucleotide of claim 8.
27. The recombinant vector of claim 26, wherein the recombinant vector is a plasmid.
28. A host cell comprising the recombinant vector of claim 26.
29. The host cell of claim 28, wherein the host cell is selected from the group consisting of a mammalian cell, plant cell, insect cell, yeast cell, fungus cell, filamentous fungi cell, and bacterial cell.
30. The host cell of claim 28, wherein the host cell is selected from the genus Escherichia, Bacillus, Lactobacillus, Rhodococcus, Pseudomonas, Aspergillus, Trichoderma, Neurospora, Fusarium, Humicola, Rhizomucor, Kluyveromyces, Pichia, Mucor, Myceliophtora, Penicillium, Phanerochaete, Pleurotus, Trametes, Chrysosporium, Saccharomyces, Stenotrophamonas, Schizosaccharomyces, Yarrowia, or Streptomyces.
31. The host cell of claim 30, wherein the host cell is a Bacillus lentus cell, a Bacillus brevis cell, a Bacillus stearothermophilus cell, a Bacillus licheniformis cell, a Bacillus alkalophilus cell, a Bacillus coagulans cell, a Bacillus circulans cell, a Bacillus pumilis cell, a Bacillus thuringiensis cell, a Bacillus clausii cell, a Bacillus megaterium cell, a Bacillus subtilis cell, or a Bacillus amyloliquefaciens cell.
32. The host cell of claim 30, wherein the host cell is a Trichoderma koningii cell, a Trichoderma viride cell, a Trichoderma reesei cell, a Trichoderma longibrachiatum cell, an Aspergillus awamori cell, an Aspergillus fumigates cell, an Aspergillus foetidus cell, an Aspergillus nidulans cell, an Aspergillus niger cell, an Aspergillus oryzae cell, a Humicola insolens cell, a Humicola lanuginose cell, a Rhodococcus opacus cell, a Rhizomucor miehei cell, or a Mucor miehei cell.
33. The host cell of claim 30, wherein the host cell is a Streptomyces lividans cell or a Streptomyces murinus cell.
34. The host cell of claim 28, wherein the host cell is an Actinomycetes cell.
35. The host cell of claim 28, wherein the host cell is a CHO cell, a COS cell, a VERO cell, a BHK cell, a HeLa cell, a CvI cell, an MDCK cell, a 293 cell, a 3T3 cell, or a PC 12 cell.
36. The host cell of claim 28, wherein the host cell is an E. coli cell.
37. The host cell of claim 36, wherein the E. coli cell is a strain B, a strain C, a strain K, or a strain W E. coli cell.
38. The host cell of claim 28, wherein the host cell expresses a polypeptide encoded by the recombinant vector.
39. The host cell of claim 28, wherein the polynucleotide sequence is stably incorporated into the genomic DNA of the host cell, and wherein the expression of the polynucleotide sequence is under the control of a regulated promoter region.
40. The host cell of claim 38, wherein the host cell produces an olefin.
41. The host cell of claim 40, wherein the olefin is a terminal olefin.
42. The host cell of claim 40, wherein the olefin is secreted by the host cell.
43. A genetically engineered microorganism comprising an exogenous control sequence stably incorporated into the genomic DNA of the microorganism upstream of a polynucleotide comprising a nucleotide sequence having at least about 70% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
44. The microorganism of claim 43, wherein the nucleotide sequence has at least about 80% sequence identity to SEQ ID NO: 1, 4, 6, 8, 9, 11, or 13.
45. The microorganism of claim 43, wherein the nucleotide sequence has at least about 90% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
46. The microorganism of claim 43, wherein the nucleotide sequence has at least about 95% sequence identity to SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
47. The microorganism of claim 43, wherein the nucleotide sequence comprises SEQ ID NO:1, 4, 6, 8, 9, 11, or 13.
48. The microorganism of claim 43, wherein the microorganism is a Jeotgalicoccus, Corynebacterium, Kokuria, Methylobacterium, or Bacillus bacterium.
49. The microorganism of claim 43, wherein the polynucleotide is endogenous to the microorganism.
50. The microorganism of claim 43, wherein the microorganism expresses an increased level of a polypeptide encoded by the polynucleotide relative to a wild-type microorganism.
51. The microorganism of claim 43 , wherein the microorganism produces an increased level of an olefin relative to a wild-type microorganism.
52. A polypeptide produced by the host cell of claim 28.
53. A method of producing an olefin comprising culturing the host cell of claim 28 under conditions sufficient to allow expression of the polypeptide.
54. The method of claim 53, further comprising culturing the host cell in the presence of at least one biological substrate for the polypeptide.
55. The method of claim 53, wherein the host cell is selected from the group consisting of a mammalian cell, plant cell, insect cell, yeast cell, fungus cell, filamentous fungi cell, and bacterial cell.
56. The method of claim 55, wherein the host cell is selected from the genus Escherichia, Bacillus, Lactobacillus, Rhodococcus, Pseudomonas, Aspergillus, Trichoderma, Neurospora, Fusarium, Humicola, Rhizomucor, Kluyveromyces, Pichia, Mucor, Myceliophtora, Penicillium, Phanerochaete, Pleurotus, Trametes, Chrysosporium, Saccharomyces, Stenotrophamonas, Schizosaccharomyces, Yarrowia, or Streptomyces.
57. The method of claim 55, wherein the host cell is a Bacillus lentus cell, a Bacillus brevis cell, a Bacillus stearothermophilus cell, a Bacillus licheniformis cell, a Bacillus alkalophilus cell, a Bacillus coagulans cell, a Bacillus circulans cell, a Bacillus pumilis cell, a Bacillus thuringiensis cell, a Bacillus clausii cell, a Bacillus megaterium cell, « Bacillus subtilis cell, or a Bacillus amyloliquefaciens cell.
58. The method of claim 55, wherein the host cell is a Trichoderma koningii cell, a Trichoderma viride cell, a Trichoderma reesei cell, a Trichoderma longibrachiatum cell, an Aspergillus awamori cell, an Aspergillus fumigates cell, an Aspergillus foetidus cell, an Aspergillus nidulans cell, an Aspergillus niger cell, an Aspergillus oryzae cell, a Humicola insolens cell, a Humicola lanugiήose cell, a Rhodococcus opacus cell, a Rhizomucor miehei cell, or a Mucor miehei cell.
59. The method of claim 55, wherein the host cell is a Streptomyces lividans cell or a Streptomyces murinus cell.
60. The method of claim 55, wherein the host cell is an Actinomycetes cell.
61. The method of claim 55, wherein the host cell is a CHO cell, a COS cell, a VERO cell, a BHK cell, a HeLa cell, a CvI cell, an MDCK cell, a 293 cell, a 3T3 cell, or a PC 12 cell.
62. The method of claim 55, wherein the host cell is an E. coli cell.
63. The method of claim 62, wherein the E. coli cell is a strain B, a strain C, a strain K, or a strain W E. coli cell.
64. The method of claim 53, wherein the olefin is a terminal olefin.
65. The method of claim 64, wherein the terminal olefin comprises a C5-C25 terminal olefin.
66. The method of claim 64, wherein the terminal olefin comprises a C13-C2I terminal olefin.
67. The method of claim 66, wherein the terminal olefin is selected from the group consisting of nonadecene, methylnonadecene, heptadecene, methylheptadecene, and pentadecene.
68. The method of claim 64, wherein the terminal olefin comprises an unsaturated terminal olefin.
69. The method of claim 64, wherein the terminal olefin comprises a monounsaturated terminal olefin.
70. The method of claim 64, wherein the terminal olefin comprises a straight chain terminal olefin.
71. The method of claim 64, wherein the terminal olefin comprises a branched chain terminal olefin.
72. The method of claim 64, wherein the terminal olefin comprises a cyclic moiety.
73. The method of claim 54, wherein the substrate is a fatty acid.
74. The method of claim 73, wherein the fatty acid comprises a C6-C26 fatty acid.
75. The method of claim 73, wherein the fatty acid comprises a C14-C22 fatty acid.
76. The method of claim 75, wherein the fatty acid is selected from the group consisting of tetradecanoic acid, hexadecanoic acid, octadecanoic acid, behenic acid, methyl eicosanoic acid, eicosanoic acid, methyl octadecanoic acid, stearic acid, and palmitic acid.
77. The method of claim 73, wherein the fatty acid comprises an unsaturated fatty acid.
78. The method of claim 73, wherein the fatty acid comprises a monounsaturated fatty acid.
79. The method of claim 73, wherein the fatty acid comprises a saturated fatty acid.
80. The method of claim 73, wherein the fatty acid comprises a straight chain fatty acid.
81. The method of claim 73, wherein the fatty acid comprises a branched chain fatty acid.
82. The method of claim 73, wherein the fatty acid comprises a cyclic moiety.
83. The method of claim 54, further comprising isolating the olefin from the host cell or from the culture medium.
84. The method of claim 83, further comprising cracking or refining the olefin.
85. An olefin produced by any one of the methods of claims 53-84.
86. A biofuel comprising the olefin of claim 85.
87. The biofuel of claim 86, wherein the biofuel is a biodiesel, gasoline, or jet fuel.
88. The biofuel of claim 86, wherein the olefin has a 613C of about -15.4 or greater.
89. The biofuel of claim 88, wherein the olefin has a 613C of about -15.4 to about -10.9.
90. The biofuel of claim 88, wherein the olefin has a 613C of about -13.92 to about -13.84.
91. The biofuel of claim 86, wherein the olefin has a fM 14C of at least about 1.003.
92. The biofuel of claim 91, wherein the olefin has a f" M 14C of at least about 1.01.
93. . The biofuel of claim 91, wherein the olefin has a fM MC of at least about 1.5.
94. The biofuel of claim 91 , wherein the olefin has a f~M 14C of about 1.111 to about 1.124.
95. A method of making an olefin, comprising contacting a substrate with an isolated polypeptide having the same biological activity as a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 7, 10, 12, or 14.
96. The method of claim 95, wherein the olefin is a terminal olefin.
97. The method of claim 96, wherein the terminal olefin comprises a C5-C25 terminal olefin.
98. The method of claim 96, wherein the terminal olefin comprises a C13-C2I terminal olefin.
99. The method of claim 98, wherein the terminal olefin is selected from the group consisting of nonadecene, methylnonadecene, heptadecene, methylheptadecene, and pentadecene.
100. The method of claim 96, wherein the terminal olefin comprises an unsaturated terminal olefin.
101. The method of claim 96, wherein the terminal olefin comprises a monounsaturated terminal olefin.
102. The method of claim 96, wherein the terminal olefin comprises a straight chain terminal olefin.
103. The method of claim 96, wherein the terminal olefin comprises a branched chain terminal olefin.
104. The method of claim 96, wherein the terminal olefin comprises a cyclic moiety.
105. The method of claim 95, wherein the substrate is a fatty acid.
106. The method of claim 105, wherein the fatty acid comprises a C6-C26 fatty acid.
107. The method of claim 105, wherein the fatty acid comprises a Cj4-C22 fatty acid.
108. The method of claim 107, wherein the fatty acid is selected from the group consisting of tetradecanoic acid, hexadecanoic acid, octadecanoic acid, behenic acid, methyl eicosanoic acid, eicosanoic acid, methyl octadecanoic acid, stearic acid, and palmitic acid.
109. The method of claim 105, wherein the fatty acid comprises an unsaturated fatty acid.
110. The method of claim 105, wherein the fatty acid comprises a monounsaturated fatty acid.
111. The method of claim 105, wherein the fatty acid comprises a saturated fatty acid.
112. The method of claim 105, wherein the fatty acid comprises a straight chain fatty acid.
113. The method of claim 105, wherein the fatty acid comprises a branched chain fatty acid.
114. The method of claim 105, wherein the fatty acid comprises a cyclic moiety.
115. The method of any one of claims 95-114, further comprising cracking or refining the olefin.
116. An olefin produced by the method of claim 115.
117. A biofuel comprising the olefin of claim 116.
118. The biofuel of claim 117, wherein the biofuel is a biodiesel, gasoline, or jet fuel.
119. The biofuel of claim 117, wherein the olefin has a 613C of about -15.4 or greater.
120. The biofuel of claim 119, wherein the olefin has a 513C of about -15.4 to about -10.9.
121. The biofuel of claim 119, wherein the olefin has a 513C of about - 13.92 to about -13.84.
122. The biofuel of claim 117, wherein the olefin has a fjv/4C of at least about 1.003.
123. The biofuel of claim 122, wherein the olefin has a fM 14C of at least about 1.01.
124. The biofuel of claim 122, wherein the olefin has a fjvi14C of at least about 1.5.
125. The biofuel of claim 122, wherein the olefin has a fM 14C of about 1.111 to about 1.124.
126. A method of making an olefin, comprising contacting a substrate with an isolated polypeptide encoded by the polynucleotide of any of claims 1-15.
127. The method of claim 126, wherein the olefin is a terminal olefin.
128. The method of claim 127, wherein the terminal olefin comprises a C5-C25 terminal olefin.
129. The method of claim 127, wherein the terminal olefin comprises a C)3-C2I terminal olefin.
130. The method of claim 129, wherein the terminal olefin is selected from the group consisting of nonadecene, methylnonadecene, heptadecene, methylheptadecene, and pentadecene.
131. The method of claim 127, wherein the terminal olefin comprises an unsaturated terminal olefin.
132. The method of claim 127, wherein the terminal olefin comprises a monounsaturated terminal olefin.
133. The method of claim 127, wherein the terminal olefin comprises a straight chain terminal olefin.
134. The method of claim 127, wherein the terminal olefin comprises a branched chain terminal olefin.
135. The method of claim 127, wherein the terminal olefin comprises a cyclic moiety.
136. The method of claim 127, wherein the substrate is a fatty acid.
137. The method of claim 136, wherein the fatty acid comprises a C6-C26 fatty acid.
138. The method of claim 136, wherein the fatty acid comprises a C14-C22 fatty acid.
139. The method of claim 138, wherein the fatty acid is selected from the group consisting of tetradecanoic acid, hexadecanoic acid, octadecanoic acid, behenic acid, methyl eicosanoic acid, eicosanoic acid, methyl octadecanoic acid, stearic acid, and palmitic acid.
140. The method of claim 136, wherein the fatty acid comprises an unsaturated fatty acid.
141. The method of claim 136, wherein the fatty acid comprises a monounsaturated fatty acid.
142. The method of claim 136, wherein the fatty acid comprises a saturated fatty acid.
143. The method of claim 136, wherein the fatty acid comprises a straight chain fatty acid.
144. The method of claim 136, wherein the fatty acid comprises a branched chain fatty acid.
145. The method of claim 136, wherein the fatty acid comprises a cyclic moiety.
146. The method of claim 126, further comprising cracking or refining the olefin.
147. An olefin produced by the method of claim 146.
148. A biofuel comprising the olefin of claim 147.
149. The biofuel of claim 148, wherein the biofuel is a biodiesel, gasoline, or jet fuel.
150. The biofuel of claim 148, wherein the olefin has a 613C of about -15.4 or greater.
151. The biofuel of claim 150, wherein the olefin has a δ13C of about -15.4 to about -10.9.
152. The biofuel of claim 150, wherein the olefin has a 613C of about -13.92 to about -13.84.
153. The biofuel of claim 148, wherein the olefin has a fM 14C of at least about 1.003.
154. The biofuel of claim 153, wherein the olefin has a f* M 14C of at least about 1.01.
155. The biofuel of claim 153, wherein the olefin has a fM 14C of at least about 1.5.
156. The biofuel of claim 153, wherein the olefin has a fM 14C of about 1.111 to about 1.124.
157. A method of making an olefin, comprising contacting a substrate with the isolated polypeptide of any of claims 17-21.
158. The method of claim 157, wherein the olefin is a terminal olefin.
159. The method of claim 158, wherein the terminal olefin comprises a C5-C25 terminal olefin.
160. The method of claim 158, wherein the terminal olefin comprises a Ci3-C2I terminal olefin.
161. The method of claim 160, wherein the terminal olefin is selected from the group consisting of nonadecene, methylnonadecene, heptadecene, methylheptadecene, and pentadecene.
162. The method of claim 158, wherein the terminal olefin comprises an unsaturated terminal olefin.
163. The method of claim 158, wherein the terminal olefin comprises a monounsaturated terminal olefin.
164. The method of claim 158, wherein the terminal olefin comprises a straight chain terminal olefin.
165. The method of claim 158, wherein the terminal olefin comprises a branched chain terminal olefin.
166. The method of claim 158, wherein the terminal olefin comprises a cyclic moiety.
167. The method of claim 158, wherein the substrate is a fatty acid.
168. The method of claim 167, wherein the fatty acid comprises a C6-C26 fatty acid.
169. The method of claim 167, wherein the fatty acid comprises a Cj4-C22 fatty acid.
170. The method of claim 169, wherein the fatty acid is selected from the group consisting of tetradecanoic acid, hexadecanoic acid, octadecanoic acid, behenic acid, methyl eicosanoic acid, eicosanoic acid, methyl octadecanoic acid, stearic acid, and palmitic acid.
171. The method of claim 167, wherein the fatty acid comprises an unsaturated fatty acid.
172. The method of claim 167, wherein the fatty acid comprises a monounsaturated fatty acid.
173. The method of claim 167, wherein the fatty acid comprises a saturated fatty acid.
174. The method of claim 167, wherein the fatty acid comprises a straight chain fatty acid.
175. The method of claim 167, wherein the fatty acid comprises a branched chain fatty acid.
176. The method of claim 167, wherein the fatty acid comprises a cyclic moiety.
177. The method of claim 157, further comprising cracking or refining the olefin.
178. An olefin produced by the method of claim 177.
179. A biofuel comprising the olefin of claim 178.
180. The biofuel of claim 179, wherein the biofuel is a biodiesel, gasoline, or jet fuel.
181. The biofuel of claim 179, wherein the olefin has a δ13C of about -15.4 or greater.
182. The biofuel of claim 181, wherein the olefin has a δ ' 3C of about - 15.4 to about -10.9.
183. The biofuel of claim 181, wherein the olefin has a 513C of about - 13.92 to about -13.84.
184. The biofuel of claim 179, wherein the olefin has a fM 14C of at least about 1.003.
185. The biofuel of claim 184 wherein the olefin has a fM 14C of at least about 1.01.
186. The biofuel of claim 184, wherein the olefin has a fM 14C of at least about 1.5.
187. The biofuel of claim 184, wherein the olefin has a f* M 14C of about 1.111 to about 1.124.
188. The host cell of claim 28, wherein the host cell expresses a reduced level of an acyl-CoA synthase relative to a corresponding wild type host cell.
189. The host cell of claim 188, wherein a gene encoding an acyl-CoA synthase is attenuated or deleted in the host cell.
190. The host cell of claim 189, wherein the gene is fadDJadK, BH3103,yhflL, PjI- 4354, EAVl 5023, fadDl,fadD2, RPC_4074,fadDD35,fadDD22, ,faalp,faa3p, lcfA, or the gene encoding the protein having the amino acid sequence Accession No. ZP O 1644857.
191. The host cell of claim 190, wherein the gene is fadD.
192. The microorganism of claim 43 , wherein the microorganism expresses a reduced level of an acyl-CoA synthase relative to a corresponding wild type microorganism.
193. The microorganism of claim 192, wherein a gene encoding an acyl-Co A synthase is attenuated or deleted in the microorganism.
194. The microorganism of claim 193, wherein the gene is fadD, fadK, BH3103, yhfL, Pβ-4354, EAVl 5023, fadDl,fadD2, RPC_4074,fadDD35,fadDD22, Jaalp,faa3p, lcfA, or the gene encoding the protein having the amino acid sequence Accession No. ZPJ) 1644857.
195. The microorganism of claim 194, wherein the gene is fadD.
196. The method of claim 53, wherein the host cell expresses a reduced level of an acyl-CoA synthase relative to a corresponding wild type host cell.
197. The method of claim 196, wherein a gene encoding an acyl-CoA synthase is attenuated or deleted in the host cell.
198. The method of claim 197, wherein the gene is fadD, fadK, BH3103, yhfL, PfI- 4354, EAVl 5023, fadDl,fadD2, RPC_4074,fadDD35,fadDD22, ,faalp,faa3p, lcfA, or the gene encoding the protein having the amino acid sequence Accession No. ZP O 1644857.
199. The method of claim 198, wherein the gene is fadD.
200. An olefin produced by any one of the methods of claims 196-199.
201. A biofuel comprising the olefin of claim 200.
202. The biofuel of claim 201 , wherein the biofuel is a biodiesel, gasoline, or jet fuel.
203. The biofuel of claim 201, wherein the olefin has a 513C of about -15.4 or greater.
204. The biofuel of claim 203 , wherein the olefin has a 613C of about - 15.4 to about -10.9.
205. The biofuel of claim 203, wherein the olefin has a 813C of about -13.92 to about -13.84.
206. The biofuel of claim 201 , wherein the olefin has a I7 M 14C of at least about 1.003.
207. The biofuel of claim 206, wherein the olefin has a fM 14C of at least about 1.01.
208. The biofuel of claim 206, wherein the olefin has a fM 14C of at least about 1.5.
209. The biofuel of claim 206, wherein the olefin has a fM 14C of about 1.111 to about 1.124.
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US12/673,752 US8183028B2 (en) | 2007-12-21 | 2008-12-22 | Methods and compositions for producing olefins |
US13/452,449 US8597922B2 (en) | 2007-12-21 | 2012-04-20 | Methods and compositions for producing olefins |
US14/068,542 US20160340694A1 (en) | 2007-12-21 | 2013-10-31 | Methods and compositions for producing olefins |
Applications Claiming Priority (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US1618307P | 2007-12-21 | 2007-12-21 | |
US61/016,183 | 2007-12-21 | ||
US5188608P | 2008-05-09 | 2008-05-09 | |
US61/051,886 | 2008-05-09 | ||
US9237808P | 2008-08-27 | 2008-08-27 | |
US61/092,278 | 2008-08-27 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/673,752 A-371-Of-International US8183028B2 (en) | 2007-12-21 | 2008-12-22 | Methods and compositions for producing olefins |
US13/452,449 Division US8597922B2 (en) | 2007-12-21 | 2012-04-20 | Methods and compositions for producing olefins |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2009085278A1 true WO2009085278A1 (en) | 2009-07-09 |
Family
ID=40568165
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2008/014029 WO2009085278A1 (en) | 2007-12-21 | 2008-12-22 | Methods and compositions for producing olefins |
Country Status (2)
Country | Link |
---|---|
US (3) | US8183028B2 (en) |
WO (1) | WO2009085278A1 (en) |
Cited By (19)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20120157717A1 (en) * | 2010-09-15 | 2012-06-21 | Ls9, Inc. | Methods and compositions for producing linear alkyl benzenes |
US20120184003A1 (en) * | 2010-12-23 | 2012-07-19 | Exxonmobil Research And Engineering Company | Production of fatty acids and fatty acid derivatives by recombinant microorganisms expressing polypeptides having lipolytic activity |
WO2012096686A1 (en) | 2011-01-14 | 2012-07-19 | Ls9, Inc. | Production of branched chain fatty acids and derivatives thereof in recombinant microbial cells |
WO2012112828A1 (en) | 2011-02-17 | 2012-08-23 | The Procter & Gamble Company | Bio-based linear alkylphenyl sulfonates |
WO2012138423A1 (en) | 2011-02-17 | 2012-10-11 | The Procter & Gamble Company | Compositions comprising mixtures of c10-c13 alkylphenyl sulfonates |
DE102011110945A1 (en) | 2011-08-15 | 2013-02-21 | Evonik Degussa Gmbh | Biotechnological synthesis of organic compounds with alkIL gene product |
WO2013024114A2 (en) | 2011-08-15 | 2013-02-21 | Evonik Degussa Gmbh | Biotechnological synthesis process of omega-functionalized carbon acids and carbon acid esters from simple carbon sources |
WO2013039563A1 (en) | 2010-09-15 | 2013-03-21 | Ls9, Inc. | Production of odd chain fatty acid derivatives in recombinant microbial cells |
US8530221B2 (en) | 2010-01-14 | 2013-09-10 | Ls9, Inc. | Production of branched chain fatty acids and derivatives thereof in recombinant microbial cells |
WO2013152051A2 (en) | 2012-04-02 | 2013-10-10 | Ls9, Inc. | Improved production of fatty acid derivatives |
WO2014093505A2 (en) | 2012-12-12 | 2014-06-19 | Ls9, Inc. | Acp-mediated production of fatty acid derivatives |
US20140206057A1 (en) * | 2012-12-31 | 2014-07-24 | Shell Oil Company | Novel yeast strains |
WO2015095240A3 (en) * | 2013-12-20 | 2015-08-27 | The Regents Of The University Of California | Biosynthesis of 1-undecence and related terminal olefins |
EP3061827A1 (en) * | 2015-02-26 | 2016-08-31 | Evonik Degussa GmbH | Alkene production |
WO2017001606A1 (en) | 2015-06-30 | 2017-01-05 | Total Marketing Services | PRODUCTION OF α-OLEFINS |
WO2017191195A1 (en) * | 2016-05-04 | 2017-11-09 | Evonik Degussa Gmbh | Unsaturated amino acids |
US10301603B2 (en) | 2012-04-02 | 2019-05-28 | REG Life Sciences, LLC | Car enzymes and improved production of fatty alcohols |
EP3564345A1 (en) | 2008-12-23 | 2019-11-06 | REG Life Sciences, LLC | Methods and compositions related to thioesterase enzymes |
US10844410B2 (en) | 2018-03-19 | 2020-11-24 | Wisconsin Alumni Research Foundation | Mutant thioesterases |
Families Citing this family (41)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008091627A2 (en) * | 2007-01-22 | 2008-07-31 | Genomatica, Inc. | Methods and organisms for growth-coupled production of 3-hydroxypropionic acid |
US8183028B2 (en) * | 2007-12-21 | 2012-05-22 | Ls9, Inc. | Methods and compositions for producing olefins |
BRPI0907385A2 (en) * | 2008-01-22 | 2015-07-21 | Genomatica Inc | Methods and organisms for use of synthesis gas and other gaseous carbon sources and methanol |
EP2262901B1 (en) | 2008-03-05 | 2018-11-21 | Genomatica, Inc. | Primary alcohol producing organisms |
CA2719679C (en) * | 2008-03-27 | 2018-05-01 | Genomatica, Inc. | Microorganisms for the production of adipic acid and other compounds |
AU2009242615A1 (en) * | 2008-05-01 | 2009-11-05 | Genomatica, Inc. | Microorganisms for the production of methacrylic acid |
KR101735549B1 (en) | 2008-05-16 | 2017-05-16 | 알이지 라이프 사이언시스, 엘엘씨 | Methods and compositions for producing hydrocarbons |
JP2012506715A (en) | 2008-10-28 | 2012-03-22 | エルエス9・インコーポレイテッド | Methods and compositions for producing fatty alcohols |
KR20110097951A (en) * | 2008-12-16 | 2011-08-31 | 게노마티카 인코포레이티드 | Microorganisms and methods for conversion of syngas and other carbon sources to useful products |
WO2011038364A1 (en) | 2009-09-27 | 2011-03-31 | Opx Biotechnologies, Inc. | Method for producing 3-hydroxypropionic acid and other products |
RU2012128843A (en) * | 2009-12-10 | 2014-01-20 | Дженоматика, Инк. | METHODS AND ORGANISMS FOR THE TRANSFORMATION OF SYNTHESIS GAS OR OTHER GAS-SHAPED SOURCES OF CARBON AND METHANOL IN 1,3-BUTANDIOL |
AU2011209862A1 (en) | 2010-01-29 | 2012-07-26 | Genomatica, Inc. | Microorganisms and methods for the biosynthesis of p-toluate and terephthalate |
US8637286B2 (en) | 2010-02-23 | 2014-01-28 | Genomatica, Inc. | Methods for increasing product yields |
US9023636B2 (en) | 2010-04-30 | 2015-05-05 | Genomatica, Inc. | Microorganisms and methods for the biosynthesis of propylene |
KR20190006103A (en) | 2010-05-05 | 2019-01-16 | 게노마티카 인코포레이티드 | Microorganisms and methods for the biosynthsis of butadiene |
WO2012018624A2 (en) | 2010-07-26 | 2012-02-09 | Genomatica, Inc. | Microorganisms and methods for the biosynthesis of aromatics, 2,4-pentadienoate and 1,3-butadiene |
CN103998616A (en) * | 2011-10-17 | 2014-08-20 | 威廉马什莱斯大学 | Bacteria and method for synthesizing fatty acids |
CN109182238A (en) | 2012-08-10 | 2019-01-11 | 嘉吉有限公司 | For producing microorganism and the method for fatty acid and fatty acid derivative products |
EP3385375B1 (en) | 2013-01-16 | 2021-06-16 | Genomatica, Inc. | Acyl-acp reductase with improved properties |
WO2014152434A2 (en) | 2013-03-15 | 2014-09-25 | Genomatica, Inc. | Microorganisms and methods for producing butadiene and related compounds by formate assimilation |
US10047383B2 (en) | 2013-03-15 | 2018-08-14 | Cargill, Incorporated | Bioproduction of chemicals |
KR20220053681A (en) | 2013-06-14 | 2022-04-29 | 게노마티카 인코포레이티드 | Methods of producing omega-hydroxylated fatty acid derivatives |
US10337038B2 (en) | 2013-07-19 | 2019-07-02 | Cargill, Incorporated | Microorganisms and methods for the production of fatty acids and fatty acid derived products |
US11408013B2 (en) | 2013-07-19 | 2022-08-09 | Cargill, Incorporated | Microorganisms and methods for the production of fatty acids and fatty acid derived products |
US9469586B2 (en) | 2013-08-19 | 2016-10-18 | REG Life Sciences, LLC | Production of partially refined waste glycerol |
JP2016529259A (en) | 2013-08-19 | 2016-09-23 | アールイージー ライフ サイエンシズ リミテッド ライアビリティ カンパニー | Production of partially purified waste glycerol |
US10604750B2 (en) | 2013-09-13 | 2020-03-31 | Genomatica, Inc. | Acetyl-CoA carboxylase variants |
US10808262B2 (en) | 2013-12-03 | 2020-10-20 | Genomatica, Inc. | Microorganisms and methods for improving product yields on methanol using acetyl-CoA synthesis |
KR102321813B1 (en) | 2013-12-05 | 2021-11-04 | 게노마티카 인코포레이티드 | Microbial production of fatty amines |
EP3739057A1 (en) | 2014-04-10 | 2020-11-18 | Genomatica, Inc. | Semisynthetic routes to organic compounds |
PL3087179T3 (en) | 2014-06-16 | 2020-09-21 | Genomatica, Inc. | Omega-hydroxylase-related fusion polypeptides with improved properties |
KR20240023194A (en) | 2014-07-18 | 2024-02-20 | 게노마티카 인코포레이티드 | Microbial production of fatty diols |
EP2993228B1 (en) | 2014-09-02 | 2019-10-09 | Cargill, Incorporated | Production of fatty acid esters |
DK3194604T3 (en) | 2014-09-18 | 2020-05-25 | Genomatica Inc | NON-NATURAL MICROBIAL ORGANISMS WITH IMPROVED ENERGY EFFICIENCY |
WO2017101987A1 (en) | 2015-12-15 | 2017-06-22 | REG Life Sciences, LLC | Omega-hydroxylase-related fusion polypeptide variants with improved properties |
US20190112620A1 (en) * | 2016-03-22 | 2019-04-18 | Global Bioenergies | Method for producing isobutene from 3-methylcrotonyl-coa |
EP3246401A1 (en) | 2016-05-20 | 2017-11-22 | Commissariat À L'Énergie Atomique Et Aux Énergies Alternatives | New fatty acid decarboxylase and its uses |
KR102608769B1 (en) | 2016-09-14 | 2023-12-04 | 게노마티카 인코포레이티드 | 1,3-fatty diol compounds and derivatives thereof |
CN110494566A (en) | 2017-02-02 | 2019-11-22 | 嘉吉公司 | Generate the genetically modified cell of C6-C10 derivative of fatty acid |
JP2020515293A (en) | 2017-04-03 | 2020-05-28 | ジェノマティカ, インコーポレイテッド | Thioesterase variants with improved activity for the production of medium chain fatty acid derivatives |
US20210079334A1 (en) | 2018-01-30 | 2021-03-18 | Genomatica, Inc. | Fermentation systems and methods with substantially uniform volumetric uptake rate of a reactive gaseous component |
Family Cites Families (31)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB2237815B (en) | 1989-11-06 | 1994-01-05 | Univ Singapore | Production of synthetic crude petroleum |
US7053267B2 (en) | 1990-03-16 | 2006-05-30 | Calgene Llc | Plant seed oils |
US20080178519A1 (en) | 1996-11-18 | 2008-07-31 | Bp Oil International Limited | Fuel composition |
US6982155B1 (en) | 1999-11-26 | 2006-01-03 | Kansai Chemical Engineering Co., Ltd. | Process for producing fatty acid lower alcohol ester |
WO2002033061A2 (en) | 2000-10-20 | 2002-04-25 | Millennium Pharmaceuticals, Inc. | 32229, a human acyl-coa dehydrogenase family member and uses thereof |
CA2438279A1 (en) | 2001-02-22 | 2002-09-26 | Institut Pasteur | Comparative mycobacterial geneomics as a tool for identifying targets for the diagnosis, prophylaxis or treatment of mycobacterioses |
ATE448315T1 (en) | 2002-03-01 | 2009-11-15 | Monsanto Technology Llc | WAX ESTER SYNTHASE DNA SEQUENCE, PROTEIN AND USES THEREOF |
JP4491678B2 (en) | 2002-10-15 | 2010-06-30 | 公立大学法人大阪府立大学 | Process for producing fatty acid alcohol ester |
US20070251141A1 (en) | 2004-02-26 | 2007-11-01 | Purdue Research Foundation | Method for Preparation, Use and Separation of Fatty Acid Esters |
US7608700B2 (en) | 2004-03-08 | 2009-10-27 | North Carolina State University | Lactobacillus acidophilus nucleic acid sequences encoding stress-related proteins and uses therefor |
US7652167B2 (en) | 2004-07-19 | 2010-01-26 | Board Of Trustees Of Michigan State University | Process for production of organic acid esters |
GB0421937D0 (en) | 2004-10-02 | 2004-11-03 | Univ York | Acyl CoA synthetases |
DE102004052115A1 (en) | 2004-10-26 | 2006-04-27 | Westfälische Wilhelms-Universität Münster | Recombinant microorganism able to produce lower alkyl esters of long-chain fatty acids, useful as fuel, emollient or pharmaceuticals, includes three specified genes |
DE602006020837D1 (en) | 2005-01-10 | 2011-05-05 | Novozymes As | PROCESS FOR THE PREPARATION OF FATTY ACID ALKYL REPARTS FROM TRIGLYCERIDES AND ALCOHOLS USING A COMBINATION OF TWO LIPOLYTIC ENZYMES |
EP1885823A2 (en) | 2005-05-26 | 2008-02-13 | Ben Gurion University of the Negev Research and Development Authority Ltd. | Production of biodiesel from balanites aegyptiaca |
DE102006022718B4 (en) | 2006-05-16 | 2008-10-02 | Clariant International Limited | Composition of fuel oils |
ES2529176T3 (en) | 2006-05-19 | 2015-02-17 | Ls9, Inc. | Production of fatty acids and derivatives thereof |
US8110670B2 (en) | 2006-05-19 | 2012-02-07 | Ls9, Inc. | Enhanced production of fatty acid derivatives |
US20100242345A1 (en) | 2006-05-19 | 2010-09-30 | LS9, Inc | Production of fatty acids & derivatives thereof |
TWI330178B (en) | 2006-12-29 | 2010-09-11 | Univ Nat Taiwan | Process for transesterification of methyl acetate |
ES2536405T5 (en) | 2007-03-28 | 2022-04-06 | Genomatica Inc | Enhanced production of fatty acid derivatives |
WO2009009391A2 (en) | 2007-07-06 | 2009-01-15 | Ls9, Inc. | Systems and methods for the production of fatty esters |
CA2617614C (en) | 2007-08-10 | 2012-03-27 | Indian Oil Corporation Limited | Novel synthetic fuel and method of preparation thereof |
US8313934B2 (en) | 2007-09-27 | 2012-11-20 | Ls9, Inc. | Reduction of the toxic effect of impurities from raw materials by extractive fermentation |
US8183028B2 (en) * | 2007-12-21 | 2012-05-22 | Ls9, Inc. | Methods and compositions for producing olefins |
WO2010021711A1 (en) | 2008-08-18 | 2010-02-25 | Ls9, Inc. | Systems and methods for the production of mixed fatty esters |
MX2011006785A (en) | 2008-12-23 | 2011-09-27 | Ls9 Inc | Methods and compositions related to thioesterase enzymes. |
WO2010118410A1 (en) | 2009-04-10 | 2010-10-14 | Ls9, Inc. | Production of fatty acid derivatives |
CN102459569B (en) | 2009-04-10 | 2018-02-23 | Reg生命科学有限责任公司 | The generation of derivative of fatty acid |
CA2759273C (en) | 2009-04-27 | 2018-01-09 | Ls9, Inc. | Production of fatty acid esters |
MX2012003472A (en) | 2009-09-25 | 2012-05-22 | Ls9 Inc | Production of fatty acid derivatives. |
-
2008
- 2008-12-22 US US12/673,752 patent/US8183028B2/en not_active Expired - Fee Related
- 2008-12-22 WO PCT/US2008/014029 patent/WO2009085278A1/en active Application Filing
-
2012
- 2012-04-20 US US13/452,449 patent/US8597922B2/en not_active Expired - Fee Related
-
2013
- 2013-10-31 US US14/068,542 patent/US20160340694A1/en not_active Abandoned
Non-Patent Citations (4)
Title |
---|
"04/02388 Diesel-like fuel obtained by pyrolysis of vegetable oils - Lima, D. G. et al. Journal of Analytical and Applied Pyrolysis, 2004, 71,(2), 987-996", FUEL AND ENERGY ABSTRACTS, ELSEVIER, vol. 45, no. 5, 1 September 2004 (2004-09-01), pages 336, XP004659316, ISSN: 0140-6701 * |
MATSUNAGA I ET AL: "Characterization of the ybdT gene product of Bacillus subtilis: novel fatty acid beta-hydroxylating cytochrome P450.", LIPIDS AUG 1999, vol. 34, no. 8, August 1999 (1999-08-01), pages 841 - 846, XP002527230, ISSN: 0024-4201 * |
MILLER J A ET AL: "A HIGHLY CATALYTIC AND SELECTIVE CONVERSION OF CARBOXYLIC ACIDS TO 1-ALKENES OF ONE LESS CARBON ATOM", JOURNAL OF ORGANIC CHEMISTRY, AMERICAN CHEMICAL SOCIETY, EASTON.; US, vol. 58, no. 1, 1 January 1993 (1993-01-01), pages 18 - 20, XP000325380, ISSN: 0022-3263 * |
STEELE C L ET AL: "Sesquiterpene synthases from grand fir (Abies grandis). Comparison of constitutive and wound-induced activities, and cDNA isolation, characterization, and bacterial expression of delta-selinene synthase and gamma-humulene synthase", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOCHEMICAL BIOLOGISTS, BIRMINGHAM, US, vol. 273, no. 4, 23 January 1998 (1998-01-23), pages 2078 - 2089, XP002279809, ISSN: 0021-9258 * |
Cited By (32)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3564345A1 (en) | 2008-12-23 | 2019-11-06 | REG Life Sciences, LLC | Methods and compositions related to thioesterase enzymes |
US8530221B2 (en) | 2010-01-14 | 2013-09-10 | Ls9, Inc. | Production of branched chain fatty acids and derivatives thereof in recombinant microbial cells |
WO2013039563A1 (en) | 2010-09-15 | 2013-03-21 | Ls9, Inc. | Production of odd chain fatty acid derivatives in recombinant microbial cells |
EP3957736A1 (en) | 2010-09-15 | 2022-02-23 | Genomatica, Inc. | Production of odd chain fatty acid derivatives in recombinant microbial cells |
US20120157717A1 (en) * | 2010-09-15 | 2012-06-21 | Ls9, Inc. | Methods and compositions for producing linear alkyl benzenes |
EP2655625A4 (en) * | 2010-12-23 | 2014-04-23 | Exxonmobil Res & Eng Co | Production of fatty acids and fatty acid derivatives by recombinant microorganisms expressing polypeptides having lipolytic activity |
US9175256B2 (en) | 2010-12-23 | 2015-11-03 | Exxonmobil Research And Engineering Company | Production of fatty acids and fatty acid derivatives by recombinant microorganisms expressing polypeptides having lipolytic activity |
US20120184003A1 (en) * | 2010-12-23 | 2012-07-19 | Exxonmobil Research And Engineering Company | Production of fatty acids and fatty acid derivatives by recombinant microorganisms expressing polypeptides having lipolytic activity |
EP2655625A2 (en) * | 2010-12-23 | 2013-10-30 | ExxonMobil Research and Engineering Company | Production of fatty acids and fatty acid derivatives by recombinant microorganisms expressing polypeptides having lipolytic activity |
EP3456814A2 (en) | 2011-01-14 | 2019-03-20 | REG Life Sciences, LLC | Production of branched chain fatty acids and derivatives thereof in recombinant microbial cells |
WO2012096686A1 (en) | 2011-01-14 | 2012-07-19 | Ls9, Inc. | Production of branched chain fatty acids and derivatives thereof in recombinant microbial cells |
EP4282972A2 (en) | 2011-01-14 | 2023-11-29 | Genomatica, Inc. | Production of branched chain fatty acids and derivatives thereof in recombinant microbial cells |
WO2012138423A1 (en) | 2011-02-17 | 2012-10-11 | The Procter & Gamble Company | Compositions comprising mixtures of c10-c13 alkylphenyl sulfonates |
WO2012112828A1 (en) | 2011-02-17 | 2012-08-23 | The Procter & Gamble Company | Bio-based linear alkylphenyl sulfonates |
WO2013024114A2 (en) | 2011-08-15 | 2013-02-21 | Evonik Degussa Gmbh | Biotechnological synthesis process of omega-functionalized carbon acids and carbon acid esters from simple carbon sources |
DE102011110946A1 (en) | 2011-08-15 | 2016-01-21 | Evonik Degussa Gmbh | Biotechnological synthesis of omega-functionalized carboxylic acids and carboxylic acid esters from simple carbon sources |
DE102011110945A1 (en) | 2011-08-15 | 2013-02-21 | Evonik Degussa Gmbh | Biotechnological synthesis of organic compounds with alkIL gene product |
WO2013024111A1 (en) | 2011-08-15 | 2013-02-21 | Evonik Degussa Gmbh | Biotechnological synthesis process of organic compounds with the aid of an alkl gene product |
EP3674400A1 (en) | 2012-04-02 | 2020-07-01 | Genomatica, Inc. | Improved production of fatty acid derivatives |
US10301603B2 (en) | 2012-04-02 | 2019-05-28 | REG Life Sciences, LLC | Car enzymes and improved production of fatty alcohols |
US11060099B2 (en) | 2012-04-02 | 2021-07-13 | Genomatica, Inc. | Production of fatty acid derivatives |
US11034937B2 (en) | 2012-04-02 | 2021-06-15 | Genomatica, Inc. | Car enzymes and improved production of fatty alcohols |
WO2013152051A2 (en) | 2012-04-02 | 2013-10-10 | Ls9, Inc. | Improved production of fatty acid derivatives |
WO2014093505A2 (en) | 2012-12-12 | 2014-06-19 | Ls9, Inc. | Acp-mediated production of fatty acid derivatives |
US20140206057A1 (en) * | 2012-12-31 | 2014-07-24 | Shell Oil Company | Novel yeast strains |
WO2015095240A3 (en) * | 2013-12-20 | 2015-08-27 | The Regents Of The University Of California | Biosynthesis of 1-undecence and related terminal olefins |
EP3061827A1 (en) * | 2015-02-26 | 2016-08-31 | Evonik Degussa GmbH | Alkene production |
US9885060B2 (en) | 2015-02-26 | 2018-02-06 | Evonik Degussa Gmbh | Alkene production |
WO2017001606A1 (en) | 2015-06-30 | 2017-01-05 | Total Marketing Services | PRODUCTION OF α-OLEFINS |
WO2017191195A1 (en) * | 2016-05-04 | 2017-11-09 | Evonik Degussa Gmbh | Unsaturated amino acids |
US10844410B2 (en) | 2018-03-19 | 2020-11-24 | Wisconsin Alumni Research Foundation | Mutant thioesterases |
US11408014B2 (en) | 2018-03-19 | 2022-08-09 | Wisconsin Alumni Research Foundation | Mutant thioesterases |
Also Published As
Publication number | Publication date |
---|---|
US8597922B2 (en) | 2013-12-03 |
US20120253088A1 (en) | 2012-10-04 |
US20160340694A1 (en) | 2016-11-24 |
US8183028B2 (en) | 2012-05-22 |
US20110196180A1 (en) | 2011-08-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US8597922B2 (en) | Methods and compositions for producing olefins | |
US20210324430A1 (en) | Methods And Compositions For Producing Fatty Alcohols | |
EP2975122B1 (en) | Method and compositions for producing fatty aldehydes | |
EP2288694B1 (en) | Methods and compositions for producing hydrocarbons | |
WO2011062987A2 (en) | Methods and compositions for producing hydrocarbons |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08867536 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 08867536 Country of ref document: EP Kind code of ref document: A1 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 12673752 Country of ref document: US |