WO2009076775A1 - Immune response modulation and uses thereof - Google Patents

Immune response modulation and uses thereof Download PDF

Info

Publication number
WO2009076775A1
WO2009076775A1 PCT/CA2008/002259 CA2008002259W WO2009076775A1 WO 2009076775 A1 WO2009076775 A1 WO 2009076775A1 CA 2008002259 W CA2008002259 W CA 2008002259W WO 2009076775 A1 WO2009076775 A1 WO 2009076775A1
Authority
WO
WIPO (PCT)
Prior art keywords
expression
seq
nucleic acid
subject
activity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2008/002259
Other languages
French (fr)
Inventor
Nahum Sonenberg
Mauro Costa-Mattioli
Humberto Rodney Colina Munoz
Iouri V. Svitkin
Tommy Alain
Masad J. Damha
Glen Deleavey
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
McGill University
Royal Institution for the Advancement of Learning
Original Assignee
McGill University
Royal Institution for the Advancement of Learning
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by McGill University, Royal Institution for the Advancement of Learning filed Critical McGill University
Priority to CA2764456A priority Critical patent/CA2764456C/en
Priority to PCT/CA2009/000789 priority patent/WO2009146556A1/en
Priority to ES09757018.8T priority patent/ES2643576T3/en
Priority to JP2011511949A priority patent/JP5684116B2/en
Priority to US12/996,362 priority patent/US9090649B2/en
Priority to EP09757018.8A priority patent/EP2294195B1/en
Publication of WO2009076775A1 publication Critical patent/WO2009076775A1/en
Anticipated expiration legal-status Critical
Priority to US14/810,148 priority patent/US9719091B2/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983Viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16611Simplexvirus, e.g. human herpesvirus 1, 2
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/16011Orthomyxoviridae
    • C12N2760/16111Influenzavirus A, i.e. influenza A virus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/20011Rhabdoviridae
    • C12N2760/20211Vesiculovirus, e.g. vesicular stomatitis Indiana virus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/32011Picornaviridae
    • C12N2770/32311Enterovirus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/36011Togaviridae
    • C12N2770/36111Alphavirus, e.g. Sindbis virus, VEE, EEE, WEE, Semliki

Definitions

  • the present invention relates to the modulation of the immune response, and more particularly to the prevention, treatment and/or diagnosis of infectious diseases, such as viral infections and related diseases, based on such modulation.
  • Translational control of gene expression provides the cell with a rapid response to external and internal triggers or cues, without invoking the slower nuclear pathways for mRNA synthesis and transport.
  • translational control mostly occurs at the rate- limiting initiation step, during which the small 40S ribosomal subunit is recruited to the mRNA. Ribosome recruitment is facilitated by the 5'-cap structure (m 7 GpppN, where N is any nucleotide) present on all nuclear transcribed eukaryotic mRNAs.
  • the cap structure is recognized by eukaryotic initiation factor 4F (elF4F), which comprises of elF4E, the cap-binding subunit; elF4A, a bidirectional RNA helicase and elF4GI or elF4GII, scaffolding proteins that bind directly to elF4E and elF4A and bridge the mRNA to the ribosome through interactions with e1 F3.
  • elF4F complex assembly is inhibited by the elF4E binding proteins (4E-BPs). Mammals contain three highly related 4E-BPs that compete with elF4G for a shared binding site on the convex dorsal surface of elF4E.
  • 4E-BP1 the most characterized 4E-BP
  • 4E-BP1 stimulates translation by dissociating 4E-BPs from elF4E.
  • Hypophosphorylated 4E-BP1 binds to elF4E with high affinity (nanomolar range), whereas increased phosphorylation decreases its affinity for elF4E.
  • IFN ⁇ and IFN ⁇ Type-I interferons
  • IFN ⁇ and IFN ⁇ Type-I interferons
  • Transcriptional control of IFN- gene expression plays a role in the activation of the innate immune response.
  • the present invention provides a method for inducing or enhancing an immune response in a subject comprising administering an effective amount of an agent that inhibits the expression and/or activity of a elF4E-binding protein (4E-BP) to said subject.
  • an agent that inhibits the expression and/or activity of a elF4E-binding protein (4E-BP) to said subject.
  • the present invention provides a method for preventing or treating a viral infection in a subject comprising administering an effective amount of an agent that inhibits the expression and/or activity of a elF4E-binding protein (4E-BP) to said subject.
  • an agent that inhibits the expression and/or activity of a 4E-BP for inducing or enhancing an immune response in a subject.
  • the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for inducing or enhancing an immune response in a subject.
  • the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for preventing or treating a viral infection or disease in a subject.
  • the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for preventing or treating a viral infection or disease in a subject.
  • the present invention provides an agent that inhibits the expression or activity of 4E-BP for preventing or treating a viral infection or disease in a subject. In another aspect, the present invention provides an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for preventing or treating a viral infection or disease in a subject.
  • the present invention provides a composition for preventing or treating a viral infection or disease in a subject comprising an agent that inhibits the expression or activity of a 4E-BP, and a pharmaceutically acceptable carrier.
  • the present invention provides an agent that inhibits the expression or activity of 4E-BP for inducing or enhancing an immune response in a subject.
  • the present invention provides an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for inducing or enhancing an immune response in a subject.
  • the present invention provides a composition for inducing or enhancing an immune response in a subject comprising an agent that inhibits the expression or activity of a 4E-BP, and a pharmaceutically acceptable carrier.
  • the present invention provides a kit or package for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said kit or package comprising (a) an agent that inhibit the expression or activity of a elF4E-binding protein (4E-BP) and (b) a container.
  • a kit or package for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said kit or package comprising (a) an agent that inhibit the expression or activity of a elF4E-binding protein (4E-BP) and (b) a container.
  • 4E-BP elF4E-binding protein
  • the above-mentioned kit or package further comprises instructions for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii).
  • the above-mentioned agent inhibits the expression of a 4E- BP. In a further embodiment, the above-mentioned agent inhibits the expression of 4E-BP1 , 4E- BP2, or both.
  • the above-mentioned agent is a short-hairpin RNA (shRNA).
  • the above-mentioned shRNA is derived from a 4E-BP1 nucleic acid sequence, a 4E-BP2 nucleic acid sequence, or both.
  • the above- mentioned shRNA is encoded by a nucleic acid comprising the sequence of SEQ ID NOs: 11,
  • the above-mentioned shRNA is derived from a 4E-BP1 nucleic acid sequence.
  • the above-mentioned shRNA is encoded by a nucleic acid comprising the sequence of SEQ ID NO: 11.
  • the above-mentioned method comprises administering to said subject an effective amount of: (a) an shRNA derived from a 4E-BP1 nucleic acid sequence; (b) an shRNA derived from a 4E-BP2 nucleic acid sequence; or (c) both (a) and (b).
  • the above-mentioned method comprises administering to said subject an effective amount of: (a) an shRNA encoded by a nucleic acid comprising the sequence of SEQ ID NO: 11 ; (b) an shRNA encoded by a nucleic acid comprising the sequence of SEQ ID NO:12; or (c) both (a) and (b).
  • the above-mentioned use comprises a use of: (a) an shRNA derived from a 4E-BP1 nucleic acid sequence; (b) an shRNA derived from a 4E-BP2 nucleic acid sequence; or (c) both (a) and (b).
  • the above-mentioned use comprises a use of: (a) an shRNA encoded by a nucleic acid comprising the sequence of SEQ ID NO: 11 ; (b) an shRNA encoded by a nucleic acid comprising the sequence of SEQ ID NO: 12; or (c) both (a) and (b).
  • the above-mentioned agent is a small-interfering RNA (siRNA).
  • siRNA small-interfering RNA
  • the above-mentioned siRNA is derived from a 4E-BP1 nucleic acid sequence, a 4E-BP2 nucleic acid sequence, or both.
  • the above- mentioned siRNA comprises the sequence of (a) SEQ ID NOs: 13 and 14; (b) SEQ ID NOs: 21 and 22; (c) SEQ ID NOs: 27 and 28; (d) SEQ ID NOs: 15 and 16; (e) SEQ ID NOs: 23 and 24; (f) SEQ ID NOs: 29 and 30, or (g) any combination of (a) to (f).
  • the above-mentioned siRNA is derived from a 4E-BP1 nucleic acid sequence.
  • the above-mentioned siRNA comprises the sequence of (a) SEQ ID NOs: 13 and 14; (b) SEQ ID NOs: 21 and 22; (c) SEQ ID NOs: 27 and 28, or (d) any combination of (a) to (c).
  • the present invention provides a method of identifying a compound for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said method comprising determining whether: (a) a level of expression of a 4E-BP nucleic acid or encoded polypeptide; (b) a level of 4E-BP activity; or both (a) and (b), is decreased in the presence of a test compound relative to in the absence of said test compound, wherein said decrease is indicative that said test compound can be used for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection, or (iii) both (i) and (ii).
  • the present invention provides a method of identifying or characterizing a compound for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said method comprising: contacting a test compound with a cell comprising a first nucleic acid comprising a transcriptionally regulatory element normally associated with a 4E-BP gene, operably linked to a second nucleic acid comprising a reporter gene capable of encoding a reporter protein; and determining whether reporter gene expression or reporter protein activity is decreased in the presence of said test compound; wherein a decrease in said reporter gene expression or reporter protein activity is indicative that said test compound may be used for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection, or (iii) both (i) and (ii).
  • the present invention provides a method for diagnosing viral infection or disease or susceptibility thereto, in a subject, the method comprising: (a) determining in a biological sample from said subject: (i) a level of expression of a 4E-BP nucleic acid or encoded polypeptide; (ii) a level of 4E-BP activity; or (iii) both (i) and (ii); (b) comparing said level to a corresponding reference level; and (c) diagnosing said viral infection or disease or susceptibility thereto in accordance with said comparison.
  • the present invention provides a method for diagnosing viral infection or disease or susceptibility thereto, in a subject, the method comprising: (a) comparing: (i) a level of expression of a 4E-BP nucleic acid or encoded polypeptide; (ii) a level of 4E-BP activity; or (iii) both (i) and (ii); determined in a biological sample from said subject; with a corresponding reference level; and (b) diagnosing said viral infection or disease or susceptibility thereto in accordance with said comparison.
  • the present invention provides a kit or package for diagnosing viral infection or disease or susceptibility thereto in a subject, the kit comprising means for determining in a biological sample from said subject: (a) a level of expression of a 4E-BP nucleic acid or encoded polypeptide; (b) a level of 4E-BP activity; or (c) both (a) and (b); together with instructions for correlating said level with viral infection or disease or susceptibility thereto.
  • the above-mentioned corresponding reference level is the level measured in a corresponding biological sample from one or more healthy subject(s) who are not suffering from or are known not to be susceptible to viral infection or disease, and wherein an increase in said level relative to said corresponding reference level is indicative that the subject is suffering from or is susceptible to viral infection or disease; or a substantially similar level relative to said corresponding reference level is indicative that the subject is not suffering from or is not susceptible to viral infection or disease.
  • the above-mentioned corresponding reference level is the level measured in a corresponding biological sample from one or more subject(s) who are suffering from or are known to be susceptible to viral infection or disease, and wherein a substantially similar level relative to said corresponding reference level is indicative that the subject is suffering from or has a susceptibility to viral infection or disease; or an decrease in said level relative to said corresponding reference level is indicative that the subject is not suffering from or is not susceptible to viral infection or disease.
  • the above-mentioned 4E-BP is 4E-BP1.
  • the above-mentioned 4E-BP1 comprises the amino acid sequence of SEQ ID NO: 32.
  • the above-mentioned 4E-BP1 nucleic acid encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 32.
  • the above-mentioned 4E-BP1 nucleic acid comprises the coding sequence of the nucleotide sequence of SEQ ID NO: 31.
  • Figure 1 shows the effect of the lack of 4E-BPs on vesicular stomatitis virus (VSV) replication.
  • WT and 4E-BP1/2 double-knockout (DKO) Mouse Embryonic Fibroblasts (MEFs) were mock-infected or infected with VSV at an MOI of 0.5 PFU/cell.
  • DKO Mouse Embryonic Fibroblasts
  • FIG. 2 shows that VSV replication is impaired in 4E-BP1/2 DKO MEFs.
  • WT and 4E-BP1/2 DKO MEFs were mock-infected or infected with VSV at an MOI of 5 PFU/cell.
  • A MEFs were incubated with [ 35 S]methionine for 30 min at the indicated times post-infection (p.i). Proteins were subjected to 15% SDS-PAGE. An autoradiogram of the dried gel is shown. Viral proteins are indicated on the left.
  • Figure 3 shows the restoration of 4E-BP1/2 DKO MEFs with 4E-BP1 and 4E- BP2 expression vectors.
  • 4E-BP1/2 DKO MEFs were infected with two retroviruses carrying 4E- BP1 and 4E-BP2 or an empty vector. After 5 days of selection with puromycin, cells were infected with VSV at an MOI of 1 PFU/cell. Proteins were subjected to 15% SDS-PAGE. Western blot analysis was performed using antibodies against VSV proteins (A), 4E-BP1 and 4E-BP2 (B) and ⁇ -actin (C). (D) Virus yield was determined at 8h post-infection;
  • Figure 4 shows that Sindbis virus, encephalomyocarditis virus (EMCV) and influenza virus replication is reduced in 4E-BP1/2 DKO MEFs.
  • WT and 4E-BP1/2 DKO MEFs were infected with an MOI of 1 with (A) Sindbis virus, (B) EMCV and (C) Influenza virus A/HK/1/68-MA20 for the indicated times.
  • MEFs were pulse labeled with [ 35 S]methionine, lysed and subjected to 15% SDS-PAGE as described in Fig 1. Viral proteins are indicated on the left.
  • Virion production was determined by a plaque assay at 12h post-infection for Sindbis virus and EMCV, and at 24h post-infection for influenza virus. The limit of detection was 10 3 PFU/ml;
  • FIG. 5 shows that Myxoma virus and Herpes Simplex virus-1 (HSV-1 ) replication is reduced in 4E-BP1/2 DKO MEFs.
  • WT and 4E-BP1/2 DKO cells were infected with GFP-Myxoma virus at an 0.1, 1.0 and 10 MOI. GFP fluorescence and cytopathic effects were observed 24 hrs post-infection.
  • B WT and 4E-BP1/2 DKO cells were infected with HSV-1 at an MOI of 1. An immunoblot for HSV-1 viral glycoproteins at indicated times post-infection is shown. Bottom panel, plaque titration to measure viral progeny at 24hrs post-infection;
  • Figure 6 shows the effect of single 4E-BP1 or 4E-BP2 knockout in mouse embryonic fibroblasts on resistance to VSV infection.
  • A WT, 4E-BP1 KO, 4E-BP2 KO, and 4E-
  • Figure 7 shows the enhanced production of type-l IFN in 4E-BP1/2 DKO MEFs.
  • A Diagram of experimental protocol. WT (filled squares) and DKO MEFs (open squares) were treated with polyinosine-polycytidylic acid (poly(l:C)) (0.1 ⁇ g/ml) for 6h and cultured medium was collected. WT MEFs were incubated overnight with the cultured medium from WT and 4E- BP1/2 DKO MEFs and then infected with VSV (0.1 MOI).
  • B CPE and virus titers in the culture supernatant were determined by microscopy and plaque assay, respectively.
  • (A) 4E-BP1/2 DKO MEFs were mock-treated or treated with a neutralizing antibody against IFN ⁇ and infected with VSV (MOI of 1 PFU/cell). CPE and virus titers were determined 1Oh post-infection.
  • (B) WT and 4E-BP1/2 DKO MEFs were mock treated or treated with poly(l:C) (1 ⁇ g/ml) for 6h and total RNA was isolated.
  • C WT and 4E-BP1/2 DKO MEFs were mock-infected or infected with VSV (MOI of 1 PFU/cell). The induction of IFN ⁇ and IFN ⁇ mRNAs was determined by RT-PCR.
  • h.p.i hours post-infection;
  • Figure 10 shows that type-l IFN production is increased in 4E-BP1/2 DKO MEFs.
  • WT and 4EBP1/2 DKO MEFs were treated with poly(l:C) (0.1 ⁇ g/ml and 1 ⁇ g/ml) for 6h (A) and 3h (B) and the production of IFN ⁇ was determined by ELISA.
  • C 3h post-treatment, I FNa was only produced in 4E-BP1/2 DKO MEFs, as determined by ELISA;
  • Figure 11 shows the genes whose expression is up-regulated in 4E-BP1/2 DKO
  • RNA from both the total extract and polysomes was isolated and used for gene-expression microarray analysis.
  • A All genes that showed a >1.5 up-regulation were searched for functions related to interferon or inflammation. Shown is the normalized expression in DKO and WT MEFs, on a Iog2 scale. The genes are ranked according to their expression level in WT MEFs.
  • B All genes that showed increased translational activity (>4-fold) in DKO MEFs, when the polysomal RNA level had been corrected for transcript abundance and did not differ at the total level ( ⁇ 1.5-fold), were considered translationally up-regulated.
  • Figure 12 shows that 4E-BPs inhibit translation of Irf7 mRNA.
  • A Polysome profiles of wild-type (left) and 4E-BP1/2 DKO (right) MEFs.
  • B, C RT-PCR of Irf7 (B) and ⁇ - actin (C) mRNAs.
  • C mRNAs.
  • D Western blot of IRF-7 and ⁇ -actin.
  • E Translation of 5' UTR-/rf7-Fluc mRNA(Fluc, top) relative to Flue mRNA.
  • a Renilla luciferase (Rluc) reporter vector was co- transfected with both reporters as a transfection control. Flue was normalized against Rluc.
  • Flue reporter Values for the Flue reporter were about 7 X 10 4 RLU (relative light units) and 3 X 10 3 RLU for the 5' UTR-//f7-Fluc reporter. Rluc values were about 1 X 10 6 RLU.
  • F Ratio of expression of 5' UTR-lrf7-Fluc/Rluc. The 5' UTR-//f7-Fluc and Rluc reporters were co-transfected. Flue activity was normalized against Rluc activity.
  • the Flue value for wild-type MEFs was set as 1. For wild- type MEFs, Flue ranged between 1 X 10 3 and 6 X 10 3 RLU and Rluc between 1.2 X 10 6 and 3.4 X 10 6 . For 4E-BP1/2 DKO MEFs, Flue ranged between 3.5 X 10 3 and 2.4 X 10 4 RLU and Rluc between 9 X 10 5 and 1.5 X 10 6 RLU;
  • Figure 13 shows that expression of 4E-BP1/2 is lower in plasmacytoid dendritic cells (pDCs) as compared to MEFs. Protein levels were determined by Western blot analysis using antibodies against 4E-BP1 , 4E-BP2 and ⁇ -actin;
  • Figure 14 shows that retinoic acid inducible gene I (RIG-I) and melanoma- differentiation-associated gene 5 (MDA5) expression is increased in 4E-BP1/2 DKO MEFs.
  • RIG-I retinoic acid inducible gene I
  • MDA5 melanoma- differentiation-associated gene 5
  • FIG. 15 shows that a reduction of IRF-7 in 4E-BP1/2 DKO MEFs renders the cells susceptible to VSV infection and blocks type-l IFN production.
  • A 4EBP1/2 DKO MEFs were first transfected with a control (Ctrl) shRNA or an shRNA against Irf7 and then infected with VSV (MOI of 1 PFU per cell) and incubated with [ 35 S]methionine. Proteins were analysed by SDS-PAGE (15%). Viral proteins are indicated on the left.
  • Figure 16 shows the knockdown of 4E-BP1/2 in human cell lines using lentivirus shRNA vectors and the effects on viral replication.
  • Lentivirus shRNA vectors against 4E-BP1/2 were used to infect HEK293T, Jurkat, THP1 and U937 cell lines. Infected cells were selected in puromycin and stable clones kept in culture.
  • A Western blotting against 4E-BP1 , 4E-BP2 and ⁇ -actin to demonstrate the knockdown of respective target.
  • B VSV-GFP infection of HEK293T cells with knockdown of 4E-BP1 or 4E-BP2 1Oh post-infection at an MOI of 1 , GFP and CPE are shown.
  • FIG 17 shows the effect of small-interfering RNA (siRNA) transfections on 4E- BP1 or 4E-BP2 expression.
  • siRNA transfections were performed in HEK293T cells using Lipofectamine PlusTM reagent on cells plated at 70-80% confluence in a 24-well plate. For each well, either 2.5 ⁇ l (1) or 5 ⁇ l of siRNA duplex (20 ⁇ M annealed duplex) was mixed with 50 ⁇ l of OPTI-MEMTM and 1 ⁇ l of PlusTM reagent and incubated for 5 min. at room temperature (RT).
  • RT room temperature
  • Figure 18 shows the effect of siRNA transfections on IFN production by HEK293T cells following stimulation with poly(l:C).
  • siRNA transfections were performed in HEK293T cells using Lipofectamine PlusTM reagent on cells plated at 70-80% confluence in a 24-well plate.
  • 5 ⁇ l of both 4E-BP1 and 4E-BP2 siRNA duplexes (modified H-611 or unmodified) (20 ⁇ M annealed duplex) (20 ⁇ M annealed duplex) were mixed with 75 ⁇ l of OPTI-MEMTM and 1 ⁇ l of PlusTM reagent and incubated for 5 min. at room temperature (RT).
  • Figure 19 shows the nucleotide sequences of human and murine 4E-BP transcripts.
  • shRNA short-hairpin RNA
  • siRNA small interfering RNA
  • Mammals contain three highly related 4E-BPs (4E-BP1 , 4E-BP2 and 4E-BP3) that compete with elF4G for a shared binding site on the convex dorsal surface of elF4E.
  • mTOR-mediated phosphorylation of 4E-BP1 (the best characterized 4E-BP) stimulates translation by dissociating 4E-BPs from elF4E.
  • Hypophosphorylated 4E-BP1 binds to elF4E with high affinity, whereas increased phosphorylation decreases its affinity for elF4E.
  • the nucleotide sequences of human and mouse 4E-BPs are provided at Fig. 19.
  • the present invention provides a method for inducing or enhancing an immune response in a subject comprising administering an effective amount of an agent that inhibits the expression or activity of a elF4E-binding protein (4E-BP) to said subject.
  • an agent that inhibits the expression or activity of a elF4E-binding protein (4E-BP) to said subject.
  • the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for inducing or enhancing an immune response in a subject.
  • the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for inducing or enhancing an immune response in a subject.
  • the present invention provides a method for preventing or treating a viral infection in a subject comprising administering an effective amount of an agent that inhibits the expression or activity of a elF4E-binding protein (4E-BP) to said subject.
  • the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for preventing or treating a viral infection or disease in a subject.
  • the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for preventing or treating a viral infection or disease in a subject.
  • the present invention provides an agent that inhibits the expression or activity of a 4E-BP for inducing or enhancing an immune response in a subject.
  • the present invention provides an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for inducing or enhancing an immune response in a subject.
  • the present invention provides an agent that inhibits the expression or activity of a 4E-BP for preventing or treating a viral infection or disease in a subject. In another aspect, the present invention provides an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for preventing or treating a viral infection or disease in a subject.
  • the present invention provides an shRNA or siRNA molecule described herein. In another aspect, the present invention provides a composition comprising an shRNA or siRNA molecule described herein and a pharmaceutically acceptable carrier.
  • the present invention provides a use of an shRNA or siRNA molecule described herein for the preparation of a medicament.
  • the above-mentioned method or use comprises inhibiting the expression and/or activity of at least one 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3). In another embodiment, the above-mentioned method or use comprises inhibiting the expression and/or activity of 4E-BP1. In another embodiment, the above-mentioned method or use comprises inhibiting the expression and/or activity of all 4E-BPs (4E-BP1 , 4E-BP2 and 4E-BP3).
  • any agent that inhibits the activity and/or expression of a 4E-BP may be used in the methods/uses of the present invention.
  • the regulation of 4E-BP expression or activity could be achieved by various mechanisms, which among others could act at the level of: (i) its transcription (ii) mRNA levels (e.g., RNA interference), (iii) its translation, which may be controlled by specific factors, (iv) its post-translational modifications that may affect its activity, including glycosylation, phosphorylation (e.g., hypophosphorylated 4E-BP1 binds to elF4E with high affinity, whereas increased phosphorylation decreases its affinity for elF4E and therefore its repressor activity), or possibly by processing events resulting in its degradation, (v) its cellular localization, (vi) its interaction with other biomolecules (e.g., other proteins), for example using small compounds, protein fragments or antibodies.
  • mRNA levels e.g., RNA interference
  • the agent capable of inhibiting or reducing expression of 4E- BP is an oligonucleotide-based molecule (e.g., antisense, ribozyme, siRNA, shRNA, aptamer).
  • an oligonucleotide-based molecule e.g., antisense, ribozyme, siRNA, shRNA, aptamer.
  • RNAi RNA interference
  • RNAi is a form of oligonucleotide-mediated gene silencing involving the introduction of duplex or double stranded RNA (dsRNA; typically of less than 30 nucleotides in length, and generally about 19 to 24 nucleotides in length) leading to the sequence-specific reduction of targeted endogenous mRNA levels, here the RNA transcript of a 4E-BP gene.
  • dsRNA duplex or double stranded RNA
  • Such dsRNA are generally substantially complementary to at least part of an RNA transcript of a 4E-BP gene.
  • Such dsRNA e.g., siRNA
  • shRNA generally refers to a sequence of RNA that makes a hairpin turn that can be used to silence gene expression via RNA interference.
  • shRNA generally uses a vector comprising a DNA sequence encoding the shRNA and which is introduced into cells. This vector may be passed on to daughter cells, allowing the gene silencing to be inherited.
  • siRNA generally refers to a duplex of short (e.g., about 20-25 nucleotides, typically about 21 nucleotides) nucleic acids, e.g., a double strand of RNA (dsRNA), generally having a short overhang (e.g., 2-3 nucleotides) on either end.
  • short e.g., about 20-25 nucleotides, typically about 21 nucleotides
  • dsRNA double strand of RNA
  • short overhang e.g., 2-3 nucleotides
  • Antisense compounds directed against 4E-BP1 and 4E-BP2 are disclosed, for example, in U.S. Patent Application Nos. 2005/0181400 and 2005/0196787, respectively.
  • Chemically modified nucleotides are routinely used for incorporation into oligonucleotide compounds to enhance one or more properties, such as nuclease resistance, stability, pharmacokinetics or affinity for a target RNA.
  • modified nucleotides are described in Dowler, et al. (Nucl. Acids Res. 2006, 34: 1669-1675), Watts et al., (Nucl. Acids Res. 2007, 35: 1441 -1451), Layzer, et al. (RNA, 2004, 10: 766-771), Allerson, et al. (J. Med. Chem. 2005, 48: 901-904), Koller, et al. (Nucl. Acids Res.
  • the modified nucleotide is a 2'-fluoro modified nucleotide.
  • the modified nucleotide is 2'-fluoro RNA (2'F-RNA) or a 2'-deoxy-2'-fluoro- arabinonucleotide (2'F-ANA).
  • the agent capable of inhibiting or reducing expression of 4E- BP is a shRNA or a siRNA.
  • the agent capable of inhibiting or reducing expression of 4E-BP is a shRNA.
  • the above-mentioned shRNA inhibits or reduces the expression of 4E-BP1 and is encoded by a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 11.
  • the above-mentioned siRNA inhibits or reduces the expression of 4E-BP2 and is encoded by a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 12.
  • 4E-BP is a siRNA.
  • the above-mentioned siRNA inhibits or reduces the expression of 4E-BP1 and comprises the nucleotide sequence of SEQ ID NOs: 13 and 14, SEQ ID NOs: 21 and 22, or SEQ ID NOs: 27 and 28.
  • the above-mentioned siRNA inhibits or reduces the expression of 4E-BP2 and comprises the nucleotide sequence of SEQ ID NOs: 15 and 16, SEQ ID NOs: 23 and 24, or SEQ ID NOs: 29 and 30.
  • hybridization means hydrogen bonding between complementary nucleoside or nucleotide bases.
  • Terms “specifically hybridizable” and “complementary” are the terms, which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
  • An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.
  • Such conditions may comprise, for example, 400 mM NaCI, 40 mM PIPES pH 6.4, 1 mM EDTA, at 50 0 C to 70 0 C for 12 to 16 hours, followed by washing.
  • oligonucleotide-based molecules of the invention may be synthesized in vitro (e.g., using the method described at example 1 below) or in vivo.
  • the oligonucleotide-based molecules may be expressed from recombinant viral vectors, such as vectors derived from adenoviruses, adeno-associated viruses, retroviruses, herpesviruses, and the like.
  • viral vectors typically comprises a sequence encoding an antisense molecule of interest (e.g., a dsRNA specific for 4E-BP) and a suitable promoter operatively linked to the antisense molecule for expressing the antisense molecule.
  • the vector may also comprise other sequences, such as regulatory sequences, to allow, for example, expression in a specific cell/tissue/organ, or in a particular intracellular environment/compartment. Methods for generating, selecting and using viral vectors are well known in the art.
  • the agent capable of inhibiting or reducing 4E-BP activity is a fragment of a 4E-BP polypeptide that lacks 4E-BP activity, e.g., a fragment of a polypeptide of SEQ ID NOs: 32, 34, 36, 38 or 40.
  • Such fragment may act, for example, as a competitive inhibitor to prevent binding of native 4E-BP to one or more of its binding partner (e.g., elF4E), thus inhibiting its activity.
  • the agent capable of inhibiting or reducing 4E-BP activity is an anti-4E-BP antibody.
  • anti-4E-BP antibody refers to an antibody that specifically binds to (interacts with) a 4E-BP protein and displays no substantial binding to other naturally occurring proteins other than the ones sharing the same antigenic determinants as the 4E-BP protein.
  • the term antibody or immunoglobulin is used in the broadest sense, and covers monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, multispecific antibodies, and antibody fragments so long as they exhibit the desired biological activity.
  • Antibody fragments comprise a portion of a full length antibody, generally an antigen binding or variable region thereof.
  • antibody fragments include Fab, Fab', F(ab')2, and Fv fragments, diabodies, linear antibodies, single-chain antibody molecules, single domain antibodies (e.g., from camelids), shark NAR single domain antibodies, and multispecific antibodies formed from antibody fragments.
  • Antibody fragments can also refer to binding moieties comprising CDRs or antigen binding domains including, but not limited to, VH regions (VH, VH-VH), anticalins, PepBodies, antibody-T-cell epitope fusions (Troybodies) or Peptibodies. Additionally, any secondary antibodies, either monoclonal or polyclonal, directed to the first antibodies would also be included within the scope of this invention.
  • antibody encompasses herein polyclonal, monoclonal antibodies and antibody variants such as single- chain antibodies, humanized antibodies, chimeric antibodies and immunologically active fragments of antibodies (e.g., Fab and Fab' fragments) which inhibit or neutralize their respective interaction domains in Hyphen and/or are specific thereto.
  • a protein that is immunogenic in the species to be immunized e.g., keyhole limpet hemocyanin,
  • Animals may be immunized against the antigen, immunogenic conjugates, or derivatives by combining the antigen or conjugate (e.g., 100 ⁇ g for rabbits or 5 ⁇ g for mice) with 3 volumes of Freund's complete adjuvant and injecting the solution intradermal ⁇ at multiple sites.
  • the antigen or conjugate e.g., 100 ⁇ g for rabbits or 5 ⁇ g for mice
  • 3 volumes of Freund's complete adjuvant e.g., 100 ⁇ g for rabbits or 5 ⁇ g for mice
  • the antigen or conjugate e.g., 100 ⁇ g for rabbits or 5 ⁇ g for mice
  • the antigen or conjugate e.g., 100 ⁇ g for rabbits or 5 ⁇ g for mice
  • the antigen or conjugate e.g., with 1/5 to 1/10 of the original amount used to immunize
  • the serum is assayed for antibody titer. Animals are boosted until the titer plateaus.
  • the animal is boosted with the conjugate of the same antigen, but conjugated to a different protein and/or through a different cross-linking reagent.
  • Conjugates also can be made in recombinant cell culture as protein fusions.
  • aggregating agents such as alum are suitably used to enhance the immune response.
  • Monoclonal antibodies may be made using the hybridoma method first described by Kohler ef al., Nature, 256: 495 (1975), or may be made by recombinant DNA methods (e.g., U.S. Patent No. 6,204,023). Monoclonal antibodies may also be made using the techniques described in U.S. Patent Nos.
  • a mouse or other appropriate host animal such as a rat, hamster or monkey
  • lymphocytes that produce or are capable of producing antibodies that will specifically bind to the antigen used for immunization.
  • lymphocytes may be immunized in vitro. Lymphocytes then are fused with myeloma cells using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (see, e.g., Goding 1986).
  • the hybridoma cells thus prepared are seeded and grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells.
  • a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells.
  • the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT medium), which substances prevent the growth of HGPRT-deficient cells.
  • the agent that inhibits the activity of 4E-BP may also be in the form of non- antibody-based scaffolds, such as avimers (Avidia); DARPins (Molecular Partners); Adnectins (Adnexus), Anticalins (Pieris) and Affibodies (Affibody).
  • avimers Alvidia
  • DARPins Molecular Partners
  • Adnectins Adnexus
  • Anticalins Pieris
  • Affibodies Affibody
  • 4E-BP activity refers to detectable enzymatic, biochemical or cellular activity attributable to 4E-BP, including its translational repressor activity.
  • the above-mentioned treatment comprises the use/administration of more than one (i.e., a combination of) active/therapeutic agent (e.g., an agent capable of inhibiting expression of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3), an agent capable of inhibiting the activity of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3)).
  • active/therapeutic agent e.g., an agent capable of inhibiting expression of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3
  • an agent capable of inhibiting the activity of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3 an agent capable of inhibiting the activity of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3
  • the combination of prophylactic/therapeutic agents and/or compositions of the present invention may be administered or
  • Co-administration in the context of the present invention refers to the administration of more than one therapeutic in the course of a coordinated treatment to achieve an improved clinical outcome. Such co-administration may also be coextensive, that is, occurring during overlapping periods of time.
  • a first agent may be administered to a patient before, concomitantly, before and after, or after a second active agent is administered.
  • the agents may in an embodiment be combined/formulated in a single composition and thus administered at the same time.
  • the one or more active agent(s) of the present invention is used/administered in combination with one or more agent(s) currently used to prevent or treat the disorder in question (e.g., a vaccine, an antiviral drug, an agent that stimulates the immune response).
  • the methods of the invention comprise administering pharmaceutical compositions (medicaments) that comprise one or more active agent(s) of the present invention (e.g., an agent capable of inhibiting expression of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3), an agent capable of inhibiting the activity of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3)).
  • the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier or excipient.
  • pharmaceutically acceptable carrier or “excipient” includes any and all solvents, buffers, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • the carrier can be suitable, for example, for intravenous, parenteral, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intrathecal, epidural, intracisternal, intraperitoneal, intranasal or pulmonary (e.g., aerosol) administration.
  • parenteral subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intrathecal, epidural, intracisternal, intraperitoneal, intranasal or pulmonary (e.g., aerosol) administration.
  • Therapeutic formulations may be in the form of liquid solutions or suspension; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols.
  • Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of active agent(s)/composition(s) suspended in diluents, such as water, saline or PEG 400; (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin; (c) suspensions in an appropriate liquid; and (d) suitable emulsions.
  • liquid solutions such as an effective amount of active agent(s)/composition(s) suspended in diluents, such as water, saline or PEG 400
  • capsules, sachets or tablets each containing a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin
  • suspensions in an appropriate liquid such as water, saline or PEG 400
  • Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn starch, potato starch, microcrystalline cellulose, gelatin, colloidal silicon dioxide, talc, magnesium stearate, stearic acid, and other excipients, colorants, fillers, binders, diluents, buffering agents, moistening agents, preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically compatible carriers.
  • Lozenge forms can comprise the active ingredient in a flavor, e.g., sucrose, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art.
  • Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes.
  • Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds.
  • Other potentially useful parenteral delivery systems for compounds/compositions of the invention include ethylenevinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes.
  • Formulations for inhalation may contain excipients, (e.g., lactose) or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.
  • pharmaceutically acceptable carriers are either solid or liquid.
  • Solid form preparations include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules.
  • a solid carrier can be one or more substance, which may also act as diluents, flavoring agents, binders, preservatives, tablet disintegrating agents, or an encapsulating material.
  • the carrier is a finely divided solid, which is in a mixture with the finely divided active component.
  • the active component is mixed with the carrier having the necessary binding properties in suitable proportions and compacted in the shape and size desired.
  • the powders and tablets may typically contain from 5% or 10% to 70% of the active compound/composition.
  • Suitable carriers are magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, cocoa butter, and the like.
  • preparation is intended to include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it.
  • carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it.
  • cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be used as solid dosage forms suitable for oral administration.
  • Liquid form preparations include solutions, suspensions, and emulsions, for example, water or water/propylene glycol solutions.
  • liquid preparations can be formulated in solution in aqueous polyethylene glycol solution.
  • Aqueous solutions suitable for oral use are prepared by dissolving the active compound(s)/composition(s) in water and adding suitable colorants, flavors, stabilizers, and thickening agents as desired.
  • Aqueous suspensions suitable for oral use can be made by dispersing the finely divided active component in water with viscous material, such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, and other well-known suspending agents.
  • Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • the composition may also contain more than one active compound for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. It may be desirable to use the above-mentioned composition in addition to one or more agents currently used to prevent or treat the disorder in question (e.g., an antiviral agent, a vaccine, an immunostimulating agent).
  • agents currently used to prevent or treat the disorder in question e.g., an antiviral agent, a vaccine, an immunostimulating agent.
  • the above-mentioned agents may be formulated in a single composition or in several individual compositions which may be coadministered in the course of the treatment.
  • Formulations to be used for in vivo administration are preferably sterile. This is readily accomplished, for example, by filtration through sterile filtration membranes.
  • the amount of the pharmaceutical composition e.g., an agent capable of inhibiting expression of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3), an agent capable of inhibiting the activity of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3)
  • a particular disease, disorder or condition e.g., viral infection and/or viral-related disease
  • the chosen prophylactic/therapeutic regimen i.e., compound, DNA construct, protein, cells
  • the target site of action i.e., the patient's weight, special diets being followed by the patient, concurrent medications being used, the administration route and other factors that will be recognized by those skilled in the art.
  • the dosage will be adapted by the clinician in accordance with conventional factors such as the extent of the disease and different parameters from the patient. Typically, 0.001 to 1000 mg/kg of body weight/day will be administered to the subject. In an embodiment, a daily dose range of about 0.01 mg/kg to about 500 mg/kg, in a further embodiment of about 0.1 mg/kg to about 200 mg/kg, in a further embodiment of about 1 mg/kg to about 100 mg/kg, in a further embodiment of about 10 mg/kg to about 50 mg/kg, may be used.
  • the dose administered to a patient, in the context of the present invention should be sufficient to effect a beneficial prophylactic and/or therapeutic response in the patient over time.
  • the size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration.
  • Effective doses may be extrapolated from dose response curves derived from in vitro or animal model test systems. For example, in order to obtain an effective mg/kg dose for humans based on data generated from rat studies, the effective mg/kg dosage in rat may be divided by six.
  • the terms “treat/treating/treatment” and “prevent/preventing/prevention” as used herein, refers to eliciting the desired biological response, i.e., a therapeutic and prophylactic effect, respectively.
  • the therapeutic effect comprises one or more of a decrease/reduction in viral load (viremia), a control or stabilization of the viral load, an amelioration of symptoms and viral-related effects, and increased survival time of the affected host animal, following administration of an agent that inhibit 4E-BP expression and/or activity.
  • the decrease in viral load or viremia may be, for example, a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or 100% (i.e., complete elimination of the virus) decrease in viremia.
  • a prophylactic effect may comprise a decrease in the onset of or of the severity of one or more of viral load or viremia, symptoms and parasite-related effects, and increased survival time of the affected host animal, following administration of an agent that inhibit 4E-BP expression and/or activity.
  • a "therapeutically effective" or “prophylactically effective" amount of an agent that inhibit 4E-BP expression and/or activity, or any combinations thereof may be administered to an animal, in the context of the methods of treatment and prevention, respectively, described herein.
  • the herein-mentioned immune response is an innate immune response.
  • innate immune response or “innate immunity” generally refers to the early immune response induced in a host by a foreign organism (e.g., viruses, bacteria, parasites) and which precedes (or do not involve) the clonal expansion of antigen-specific lymphocytes (T and B lymphocytes).
  • T and B lymphocytes antigen-specific lymphocytes
  • “Inducing or enhancing an innate immune response” thus refers to the induction or activation of one or more of the biological mechanisms involved in the innate immune response, such as phagocytosis, expression of chemokines, expression of cytokines, etc.
  • the above-mentioned innate immune response involves the activation of a Toll-like receptor (TLR) pathway, such as a TLR3 pathway, in a cell.
  • TLR Toll-like receptor
  • the above-mentioned innate immune response is the innate immune response to a viral infection, such as the innate immune response triggered by double-stranded RNA (dsRNA).
  • dsRNA double-stranded RNA
  • the above-mentioned biological mechanism is the expression of interferons (IFNs), such as type-l IFNs (IFN ⁇ and/or IFN ⁇ ).
  • the present invention also provides a kit or package comprising the above-mentioned agent or pharmaceutical compositions.
  • kit may further comprises, for example, instructions (e.g., for the prevention and/or treatment of viral infection, and/or for inducing/increasing an immune response), containers, devices for administering the agent/composition, etc.
  • the present invention further provides a method (e.g., an in vivo or in vitro method) of identifying a compound for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said method comprising determining whether:
  • test compound both (a) and (b), is decreased in the presence of a test compound relative to in the absence of said test compound, wherein said decrease is indicative that said test compound can be used for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection, or (iii) both (i) and (ii).
  • the present invention also provides a method (e.g., an in vivo or in vitro method) of identifying or characterizing a compound for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said method comprising:
  • test compound (b) determining whether reporter gene expression or reporter protein activity is decreased in the presence of said test compound; wherein a decrease in said reporter gene expression or reporter protein activity is indicative that said test compound may be used for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection, or (iii) both (i) and (ii).
  • the level of 4E-BP activity may be measured, for example, by measuring the level expression of a gene whose expression is modulated or controlled by 4E-BP activity, such as the genes listed in Fig. 11 (i.e., genes which are up-regulated in 4E-BP1/2 DKO cells).
  • a decreased 4E-BP activity may be detected by an increase in the expression of one or more gene(s) whose expression is/are directly or indirectly controlled through 4E-BP activity, such as IRF-7, RIG-1 and MDA5.
  • Expression levels of 4E-BP may be detected by either detecting nucleic acids (e.g., mRNA) from the cells and/or detecting expression products, such as polypeptides and proteins. Expression of the transcripts and/or proteins encoded by the nucleic acids described herein may be measured by any of a variety of known methods in the art. In general, the nucleic acid sequence of a nucleic acid molecule ⁇ e.g., DNA or RNA) in a patient sample can be detected by any suitable method or technique of measuring or detecting gene sequence or expression.
  • Such methods include, but are not limited to, polymerase chain reaction (PCR), reverse transcriptase- PC R (RT-PCR), in situ PCR, quantitative PCR (q-PCR), in situ hybridization, Southern blot, Northern blot, sequence analysis, microarray analysis, detection of a reporter gene, or other DNA/RNA hybridization platforms.
  • PCR polymerase chain reaction
  • RT-PCR reverse transcriptase- PC R
  • q-PCR quantitative PCR
  • in situ hybridization Southern blot
  • Northern blot sequence analysis
  • microarray analysis detection of a reporter gene, or other DNA/RNA hybridization platforms.
  • RNA expression preferred methods include, but are not limited to: extraction of cellular mRNA and Northern blotting using labeled probes that hybridize to transcripts encoding all or part of a 4E-BP gene; amplification of mRNA expressed from a 4E-BP gene using gene-specific primers, polymerase chain reaction (PCR), quantitative PCR (q-PCR), and reverse transcriptase-polymerase chain reaction (RT- PCR), followed by quantitative detection of the product by any of a variety of means; extraction of total RNA from the cells, which is then labeled and used to probe cDNAs or oligonucleotides encoding all or part of a 4E-BP gene, arrayed on any of a variety of surfaces; in situ hybridization; and detection of a reporter gene.
  • PCR polymerase chain reaction
  • q-PCR quantitative PCR
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • quantifying or “quantitating” when used in the context of quantifying transcription levels of a gene can refer to absolute or to relative quantification.
  • Absolute quantification may be accomplished by inclusion of known concentration(s) of one or more target nucleic acids and referencing the hybridization intensity of unknowns with the known target nucleic acids (e.g., through generation of a standard curve).
  • relative quantification can be accomplished by comparison of hybridization signals between two or more genes, or between two or more treatments to quantify the changes in hybridization intensity and, by implication, transcription level.
  • Methods that may be used to measure 4E-BP protein expression levels include, but are not limited to: Western blot, immunoblot, enzyme-linked immunosorbant assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, surface plasmon resonance, chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical analysis, matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, microcytometry, microarray, microscopy, fluorescence activated cell sorting (FACS), flow cytometry, and assays based on a property of the protein including but not limited to DNA binding, ligand binding, or interaction with other protein partners.
  • ELISA enzyme-linked immunosorbant assay
  • RIA radioimmunoassay
  • MALDI-TOF matrix-assisted laser desorption/ionization time-of-flight
  • the expression level of a gene of the present invention can be normalized on the basis of the relative ratio of the mRNA level of this gene to the mRNA level of a housekeeping gene or the relative ratio of the protein level of the protein encoded by this gene to the protein level of the housekeeping protein, so that variations in the sample extraction efficiency among cells or tissues are reduced in the evaluation of the gene expression level.
  • a "housekeeping gene” is a gene the expression of which is substantially the same from sample to sample or from tissue to tissue, or one that is relatively refractory to change in response to external stimuli.
  • a housekeeping gene can be any RNA molecule other than that encoded by the gene of interest that will allow normalization of sample RNA or any other marker that can be used to normalize for the amount of total RNA added to each reaction.
  • the GAPDH gene, the G6PD gene, the ACTIN gene, ribosomal RNA, 36B4 RNA, PGK1 , RPLPO, or the like may be used as a housekeeping gene.
  • Methods for calibrating the level of expression of a gene are well known in the art.
  • the expression of a gene can be calibrated using reference samples, which are commercially available.
  • reference samples include, but are not limited to: Stratagene® QPCR Human Reference Total RNA, ClontechTM Universal Reference Total RNA, and XpressRefTM Universal Reference Total RNA.
  • the above-mentioned methods may be employed either with a single test compound or a plurality or library [e.g., a combinatorial library) of test compounds. In the latter case, synergistic effects provided by combinations of compounds may also be identified and characterized.
  • the above-mentioned compounds may be used for enhancing an immune response and/or for the prevention and/or treatment of a viral infection, or may be used as lead compounds for the development and testing of additional compounds having improved specificity, efficacy and/or pharmacological (e.g., pharmacokinetic) properties.
  • the compound may be a prodrug which is altered into its active form at the appropriate site of action, (e.g., a cell, tissue or organ affected by a viral infection).
  • one or a plurality of the steps of the screening/testing methods of the invention may be automated.
  • Such assay systems may comprise a variety of means to enable and optimize useful assay conditions.
  • Such means may include but are not limited to: suitable buffer solutions, for example, for the control of pH and ionic strength and to provide any necessary components for optimal 4E-BP activity and stability (e.g. protease inhibitors), temperature control means for 4E-BP activity and or stability, and detection means to enable the detection of a 4E-BP activity reaction product.
  • a variety of such detection means may be used, including but not limited to one or a combination of the following: radiolabelling (e.g., 32 P, 14 C, 3 H), antibody- based detection, fluorescence, chemiluminescence, spectroscopic methods (e.g., generation of a product with altered spectroscopic properties), various reporter enzymes or proteins (e.g., horseradish peroxidase, green fluorescent protein), specific binding reagents (e.g. biotin/(strept)avidin), and others.
  • radiolabelling e.g., 32 P, 14 C, 3 H
  • antibody- based detection e.g., fluorescence, chemiluminescence
  • spectroscopic methods e.g., generation of a product with altered spectroscopic properties
  • reporter enzymes or proteins e.g., horseradish peroxidase, green fluorescent protein
  • specific binding reagents e.g. biotin/(strept)avidin
  • the assay may be carried out in vitro utilizing a source of 4E-BP which may comprise naturally isolated or recombinantly produced 4E-BP, in preparations ranging from crude to pure.
  • Recombinant 4E-BP may be produced in a number of prokaryotic or eukaryotic expression systems, which are well known in the art. Such assays may be performed in an array format.
  • the invention further relates to methods for the identification and characterization of compounds capable of decreasing 4E-BP gene expression.
  • a method may comprise assaying 4E-BP gene expression in the presence versus the absence of a test compound.
  • gene expression may be measured by detection of the corresponding RNA or protein, or via the use of a suitable reporter construct comprising one or more transcriptional regulatory element(s) normally associated with a 4E-BP gene, operably-linked to a reporter gene (e.g., a gene whose level of expression may be measured, for example a gene encoding a fluorescent protein (such as GFP) or encoding a protein having an enzymatic activity (e.g., using a detectable substrate) such as alkaline phosphatase or ⁇ -galactosidase.
  • a reporter gene e.g., a gene whose level of expression may be measured, for example a gene encoding a fluorescent protein (such as GFP) or encoding a protein having an enzymatic
  • a first nucleic acid sequence is "operably-linked" with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
  • a promoter is operably-linked to a coding sequence if the promoter affects the transcription or expression of the coding sequences.
  • operably-linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in reading frame.
  • enhancers generally function when separated from the promoters by several kilobases and intronic sequences may be of variable lengths, some polynucleotide elements may be operably-linked but not contiguous.
  • Transcriptional regulatory element is a generic term that refers to DNA sequences, such as initiation and termination signals, enhancers, and promoters, splicing signals, polyadenylation signals which induce or control transcription of protein coding sequences with which they are operably-linked.
  • the expression of such a reporter gene may be measured on the transcriptional or translational level, e.g., by the amount of RNA or protein produced.
  • RNA may be detected by for example Northern analysis or by the reverse transcriptase-polymerase chain reaction (RT-PCR) method (see for example Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2 nd edition), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA).
  • the present invention further provides a method (e.g., an in vivo or in vitro method) for diagnosing viral infection or disease or susceptibility thereto, in a subject, the method comprising (a) determining in a biological sample from said subject:
  • a “reference” or “control” level may be determined, for example, by measuring the level of expression of a 4E-BP nucleic acid or encoded polypeptide, or the level of 4E-BP activity, in a corresponding biological sample obtained from one or more healthy subject(s) (i.e., not suffering from viral infection or disease) known not to be susceptible to (or to be resistant to) viral infection or disease.
  • a control level a higher or increased level measured in a biological sample from a subject (i.e., test sample) is indicative that said subject is suffering from or is susceptible to viral infection or disease, whereas a substantially similar level is indicative that said subject is not suffering from or is not susceptible to parasite infection or disease.
  • a "reference" level may be determined, for example, by measuring the level of expression of a 4E-BP nucleic acid or encoded polypeptide, or the level of 4E-BP activity, in a biological sample obtained from one or more subject(s) known to be suffering from or susceptible to viral infection or disease.
  • a substantially similar level measured in a biological sample from a subject i.e., test sample
  • a lower or decreased level is indicative that said subject is not suffering from or is not susceptible to parasite infection or disease.
  • a substantially similar level refers to a difference in the level of expression or activity between the level determined in a biological sample of a given subject (i.e., test sample) and the reference level which is 20% or less; in a further embodiment, 15% or less; in a further embodiment, 10% or less; in a further embodiment, 5% or less.
  • a “higher” or “increased” level refers to a level of expression or activity in a biological sample of a given subject (i.e., test sample) which is at least 20% higher, in an embodiment at least 30% higher, in a further embodiment at least 40% higher; in a further embodiment at least 50% higher, in a further embodiment at least 100% higher (i.e., 2-fold), in a further embodiment at least 200% higher (i.e., 3-fold), in a further embodiment at least 300% higher (i.e., 4-fold), relative to the reference level.
  • a "lower” or “decreased” level refers to a level of expression or activity in a biological sample of a given subject (i.e. test sample) which is at least 20% lower, in an embodiment at least 30% lower, in a further embodiment at least 40% lower; in a further embodiment at least 50% lower, in a further embodiment at least 100% lower (i.e., 2-fold), in a further embodiment at least 200% lower (i.e., 3-fold), in a further embodiment at least 300% lower (i.e., 4-fold), relative to the reference level.
  • kits or packages for diagnosing viral infection or disease or susceptibility thereto in a subject comprising means for determining in a biological sample from said subject:
  • Kits for evaluating expression of nucleic acids can include, for example, probes or primers that specifically bind a nucleic acid of interest (e.g., a 4E-BP nucleic acid).
  • the kits for evaluating nucleic acid expression can provide substances useful as standard (e.g., a sample containing a known quantity of a nucleic acid which may be used as a reference level and to which test results can be compared, with which one can assess factors that may alter the readout of a diagnostic test, such as variations in an enzyme activity or binding conditions).
  • Kits for assessing nucleic acid expression can further include other reagents useful in assessing levels of expression of a nucleic acid (e.g., buffers and other reagents for performing PCR reactions, or for detecting binding of a probe to a nucleic acid).
  • other reagents useful in assessing levels of expression of a nucleic acid e.g., buffers and other reagents for performing PCR reactions, or for detecting binding of a probe to a nucleic acid.
  • kits can include reagents for detecting polypeptides/proteins (e.g., antibodies) and, for example, a standard (e.g., a sample containing a known quantity of a polypeptide, which may be used as a reference level to which test results can be compared).
  • the kits can provide instructions for performing the assay used to evaluate gene expression instructions for determining susceptibility to viral infection or disease based on the results of the assay.
  • the instructions can indicate that levels of expression of a gene of interest ⁇ e.g., a 4E-BP gene), relative to a standard or a control, correlate with increased or decreased susceptibility to viral infection or disease.
  • Kits can also provide instructions, containers, computer readable media (comprising, for example, a data analysis program, a reference standard, etc.), control samples, and other reagents for obtaining and processing samples for analysis.
  • typical biological samples include, but are not limited to, sputum, serum, lymphatic fluid, blood, plasma, tissue or fine needle biopsy samples, urine, peritoneal fluid, colostrums, breast milk, fetal fluid, tears, and pleural fluid, or cells therefrom ⁇ e.g., blood cells, such as peripheral blood mononuclear cells).
  • the above-mentioned subject is a mammal.
  • a mammal including for purposes of treatment, prevention or diagnosis, refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports or pet animals such as dogs, horses, cats, cows etc.
  • the mammal is human.
  • the invention relates to nucleic acid(s) which is substantially identical or substantially complementary (e.g., for hybridization under suitable conditions) to a nucleic acid sequence selected from nucleic acid sequences among SEQ ID NOs: 1-40, a complement thereof, or a portion thereof, in the methods, products, uses, kits and agents described herein.
  • the invention relates to a polypeptide which is substantially identical to a polypeptide comprising an amino acid sequence selected from amino acid sequences among SEQ ID NOs: 1-40, or a fragment thereof, in the methods, products, uses, kits and agents described herein.
  • a polypeptide which is substantially identical to a 4E-BP polypeptide and retains 4E-BP function, or a fragment thereof which retains 4E-BP function may be used in the methods of the invention.
  • a nucleic acid which encodes a polypeptide which is substantially identical to a 4E-BP polypeptide and retains 4E-BP function, or a fragment thereof which retains 4E-BP function may be used in the methods of the invention.
  • Homology and “homologous” refers to sequence similarity between two polypeptides or two nucleic acid molecules. Homology can be determined by comparing each position in the aligned sequences. A degree of homology between nucleic acid or between amino acid sequences is a function of the number of identical or matching nucleotides or amino acids at positions shared by the sequences. As the term is used herein, a nucleic acid or polypeptide sequence is "homologous" to another sequence if the two sequences are substantially identical and the functional activity of the sequences is conserved (as used herein, the term 'homologous' does not infer evolutionary relatedness).
  • sequence similarity in optimally aligned substantially identical sequences may be at least 60%, 70%, 75%, 80%, 85%, 90% or 95%.
  • a given percentage of homology between sequences denotes the degree of sequence identity in optimally aligned sequences.
  • nucleic acid sequence or polypeptide amino acid sequence described herein e.g., any of SEQ ID NOs: 1-33.
  • substantially complementary nucleic acids are nucleic acids in which the complement of one molecule is substantially identical to the other molecule.
  • Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms, such as the local homology algorithm of Smith and Waterman, 1981 , Adv. Appl. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J. MoI. Biol. 48:443, the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85: 2444, and the computerised implementations of these algorithms (such as GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Madison, Wl, U.S.A.). Sequence identity may also be determined using the BLAST algorithm, described in Altschul et al., 1990, J. MoI. Biol.
  • HSPs high scoring sequence pairs
  • T some positive-valued threshold score
  • Initial neighbourhood word hits act as seeds for initiating searches to find longer HSPs.
  • the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased.
  • Extension of the word hits in each direction is halted when the following parameters are met: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment.
  • the BLAST program may use as defaults a word length (W) of 11 , the BLOSUM62 scoring matrix (Henikoff and Henikoff, 1992, Proc. Natl. Acad. Sci.
  • nucleotide or amino acid sequences are considered substantially identical if the smallest sum probability in a comparison of the test sequences is less than about 1 , preferably less than about 0.1 , more preferably less than about 0.01 , and most preferably less than about 0.001.
  • hybridisation to filter-bound sequences under moderately stringent conditions may, for example, be performed in 0.5 M NaHPO 4 , 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and washing in 0.2 x SSC/0.1% SDS at 42 0 C (see Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1 , Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3).
  • hybridization to filter-bound sequences under high stringency conditions may, for example, be performed in 0.5 M NaHPO 4 , 7% SDS, 1 mM EDTA at 65 C C, and washing in 0.1 x SSC/0.1% SDS at 68°C (see Ausubel, et al. (eds), 1989, supra).
  • Hybridization conditions may be modified in accordance with known methods depending on the sequence of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York).
  • stringent conditions are selected to be about 5°C lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
  • Example 1 Materials and Methods Mice and Cell Culture. 4E-BP1 and 4E-BP2 KO mice were previously described (Banko JL et al., J Neurosci. 2005, 25(42): 9581-90; Tsukiyama-Kohara K et al., Nat Med. 2001, 10: 1128-32). Single knockout mice were backcrossed for 10 generations to inbred Balb/c mice (Charles River Laboratories). To generate 4E-BP1 and 4E-BP2 DKO mice, heterozygous mice were intercrossed. MEFs derived from WT and 4E-BP1/2 DKO mice were immortalized by sequential passaging.
  • MEFs were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and antibiotics. All experiments were performed at least three times and repeated with independently derived MEFs.
  • Splenic pDCs were isolated using anti-mPDCA1 (murine plasmacytoid dendritic cell antigen-1) magnetic beads according to the manufacturer's instructions (Miltenyi Biotech).
  • the IFN neutralization experiment was performed using a monoclonal antibody against mouse IFN ⁇ according to the manufacturer's procedure (PBL Biomedical Laboratories).
  • viruses The Indiana serotype of VSV was previously described (Stojdl DF et al., Nat Med. 2000, 7: 821-5).
  • Other viruses used in the studies described herein include: Influenza virus A/HK/1/68-MA20 (Brown et al., Proc. Natl. Acad. Sci. USA 98(12): 6883-6888), EMCV K-2 (Svitkin, Y. V. et al. (1974) Intervirology 4: 214-220), Sindbis virus (Berlanga et al. (2006) EMBO Journal, 25(8): 1730-1740), Myxoma virus (Lun X et al., Cancer Res.
  • mice were infected intranasally (i.n.) with VSV and sacrificed 5 days post-infection. Lungs were aseptically removed and snap-frozen in liquid nitrogen. Specimens were homogenized in 3 ml of PBS on ice, and titers were determined in BHK21 cells.
  • RNA extractions Total RNA was extracted using TrizolTM reagent (Invitrogen) according to the manufacturer's instructions. Total RNA (1 microgram) was reverse transcribed (RT) with SuperscriptTM III reverse transcriptase (Invitrogen) for 1 h at 50 0 C using oligodT. One microliter ( ⁇ l) of RT template was incubated with specific primers (described below) and with Taq Polymerase (Fermentas) according to the manufacturer's instructions. The number of PCR cycles ranged from 23 to 34 depending on the linearity of the reaction.
  • the PCR primers used were the following (5' to 3'): IFN ⁇ -sense (CCTTCCACAGGATCACTGTGTACCT; SEQ ID NO: 1), IFN ⁇ -antisense (TTCTGCTCTGACCACCTCCC; SEQ ID NO: 2), IFN ⁇ -sense (CACAG CCCTCTCCATCAACT; SEQ ID NO: 3), IFN ⁇ -antisense (TCCCACGTCAATCTTTCCTC; SEQ ID NO: 4), IRF7-sense (ATGATGGTCACATCCAGGAACCC; SEQ ID NO: 5), IRF7 antisense (TCAGGTCTGCAGTACAGCCACAT; SEQ ID NO: 6); ⁇ -actin-sense (GGACTCCTATGTGGGTGACGAGG; SEQ ID NO: 7); ⁇ -actin-antisense (GGGAGAGCATAGCCCTCGTAGAT; SEQ ID NO: 8).
  • MEFs were washed twice with cold PBS containing 100 ⁇ g/ml cycloheximide, suspended in lysis buffer (5 mM Tris-HCI, pH 7.5, 2.5 mM MgCb, 1.5 mM KCI, 100 ⁇ g/ml cycloheximide, 2 mM DTT, 0.5% TritonTM X-100, and 0.5% sodium deoxycholate), and centrifuged for 2 mi ⁇ at 14,00Og (EppendorfTM centrifuge).
  • lysis buffer 5 mM Tris-HCI, pH 7.5, 2.5 mM MgCb, 1.5 mM KCI, 100 ⁇ g/ml cycloheximide, 2 mM DTT, 0.5% TritonTM X-100, and 0.5% sodium deoxycholate
  • RNA or polysomal RNA was isolated from WT and 4E- BP1/2 DKO MEFs using TrizolTM.
  • RNA samples were purified using the Qiagen RNeasyTM kit (according to the manufacturer's instructions, Qiagen, Mississauga, Ontario, Canada) followed by sodium acetate/ethanol precipitation. Twenty micrograms of each RNA sample were processed according to manufacturer's protocol (Affymetrix, Santa Clara, CA) and hybridized to an AffymetrixTM Mouse430_2 chip. Primary image analysis of the arrays was performed using the GenechipTM 3.2 software package (Affymetrix, Santa Clara, CA).
  • RMA Robust Multichip Averaging
  • MEFs were homogenizated in Buffer A (50 mM Tris-HCI, pH 7.4,100 mM NaCI, 1% TritonTM X-100, 1 mM EDTA, 1 mM DTT, protease inhibitors cocktail (Roche), 20 mM ⁇ -glycerophosphate, 0.25 mM Na 3 VO 4 , 10 mM NaF, 10 nM okadaic acid, 1 mM PMSF), and incubated for 30 min at 4 0 C. Cell debris was removed by centrifugation at 10,000g (Eppendorf centrifuge) for 10 min at 4°C and total protein content was determined using a Bio- RadTM assay.
  • Buffer A 50 mM Tris-HCI, pH 7.4,100 mM NaCI, 1% TritonTM X-100, 1 mM EDTA, 1 mM DTT, protease inhibitors cocktail (Roche), 20 mM ⁇ -glycerophosphate,
  • MEFs were transfected with poly(hC) using FuGENETM 6 transfection reagent (Roche) according to the manufacturer's protocol. Cultured medium was recovered at 3h and 6h post-transfection. Murine IFN ⁇ and IFN ⁇ production was detected in the cultured medium by ELISA according to the manufacturer's procedure (PBL Biomedical Laboratories).
  • Plasmid Construction, Transfection and Luciferase Assay A 411 bp DNA corresponding to the 5'UTR of mouse IRF-7 mRNA was amplified by PCR from MEF genomic DNA. Hin ⁇ W and ⁇ /col restriction sites were added to the 5' and 3' ends, respectively. Using the same restriction sites, the IRF-7 5'UTR was cloned into the pGL3TM firefly luciferase (Flue) reporter vector (Promega). MEFs were co-transfected with 500 ng of 5'UTR-IRF-7-FLuc and 100 ng of Renilla luciferase (Rluc; Promega) in 24-well plates using LipofectamineTM 2000 as described.
  • pBABE-4E-BP1 , PBABE-4E-BP2 and empty vector constructs were transfected into phoenix-293-T packaging cells. After 48h, virus-containing medium was filtered, collected and used to infect 4E-BP1/2 DKO MEFs in the presence of 5 mg/ml of polybrene (Sigma-Aldrich). Cells were re-infected the next day and supplemented with puromycin (2 ⁇ g/ml, Sigma-Aldrich) for selection for five days. shRNA against IRF-7.
  • 4E-BP1/2 DKO MEFs were transfected with PLKO.1-puro- Ctrl-shRNA (Origene; CAACAAGATGAAGAGCACCAA; SEQ ID NO: 9) or PLKO.1-puro- /f?F7- shRNA (Origene; GTCACCACACTACACCATCTA; SEQ ID NO: 10) as described. Next, transfected-MEFs were selected with puromycin for 1 week and colonies were picked up.
  • Sequence-verified shRNA lentiviral plasimids for 4E-BP1 and 4E-BP2 gene silencing in mammalian cells were obtained from Sigma's MISSIONTM shRNA.
  • the plasmid pLKO.1 ⁇ -puro 4E-BP1 shRNA CCGGGCCAGGCCTTATGAAAGTGATCTCGAGATCACTTTCAT AAGGCCTGGCTTTTTG;
  • SEQ ID NO: 11 [product number: SHDNAC-TRCN0000030203] and 4E-BP2 (CCGGGCTGTATTTCTGTAGAGCTAACTCGAGTTAGCTCTACAGAAATACAGC I I I I G; SEQ ID NO: 12) [product number SHDNAC-TRCN00001 17812] were used to generate lentiviral transduction particles in packaging cells (HEK293T) by co-transfection with compatible packaging plasmids. Lentiviral containing mediums were filtered and used directly to transduce the different cell lines. Transduction was performed in 6-well plates by addition of 1 ml of medium containing lentiviruses carrying shRNA sequences against 4E-BP1 , 4E-BP2, or both, twice at 24h interval.
  • siRNA synthesis Standard conditions for solid-phase oligonucleotide synthesis were used for the synthesis of all oligonucleotides, 1.0 ⁇ mol scale. 5-ethylthiotetrazole (0.25 M in acetonitrile) was used as an activator, and 0.10 M iodine in 1 :2:10 pyridine:water:THF was used as oxidant (wait time during the oxidation step was 24 seconds). Phosphoramidites were prepared as 0.15 M solutions (RNA amidites) or 0.08-0.15 M solutions (DNA, 2'-fluoro amidites).
  • 5'-phosphorylation of oligonucleotides was generally accomplished on the CPG solid support, by treating the newly-synthesized oligonucleotide with bis(2-cyanoethyl)- diisopropylaminophosphoramidite and ethylthiotetrazole, followed by normal deprotection conditions. In all cases, ESI-MS was used to confirm the success of the phosphorylation reaction.
  • the sequences of the siRNAs used herein are provided in Table I.
  • IFN production using the HEK-BlueTM IFN detection assay 48 hours after siRNA transfection, cells were left untreated or treated with 1 ug/ml of poly(l:C) for 24 hours. The amount of IFN in the supernatant was measured according to the manufacturer's instructions (InvivoGen). Briefly, supernatants were mixed with HEK-BlueTM cells that carry a reporter gene expressing a secreted alkaline phosphatase under the control of the interferon stimulated response element 9 (ISRE9) promoter. In response to IFN exposure, the HEK-BlueTM cells release soluble alkaline phosphatase that is quantified by mixing the supernatant with Quanti BlueTM (InvivoGen) reagent and measuring the absorbance at 650 nm.
  • ISRE9 interferon stimulated response element 9
  • Example 2 Virus infection is suppressed in 4E-BP1/2 DKO MEFs.
  • MEFs derived from 4E-BP1 and 4E-BP2 double knockout (DKO) and wild-type (WT) mice were used.
  • the 4E-BP1/2 DKO MEFs lack all three 4E-BPs, since 4E-BP3 is not expressed in MEFs.
  • MEFs were first infected with VSV (rhabdovirus, negative strand RNA virus) at a multiplicity of infection (MOI) of 0.5 plaque forming units (PFU)/cell and viral protein synthesis was analyzed by pulse labeling with [ 35 S]methionine at various times post-infection (p.i).
  • FIG. 1A In WT MEFs, synthesis of VSV proteins was first detected at 4h p.i. (Fig. 1A). Strikingly, in 4E-BP1/2 DKO MEFs, no viral proteins were detected at this, or even later time points (Fig. 1A). Western blot analysis over the time-course of infection demonstrated a robust expression of VSV proteins in WT MEFs, but not in 4E-BP1/2 DKO MEFs (Fig. 1B). VSV-induced cytopathic effect (ePE) evaluated at 1 Oh p.i. was observed only in WT MEFs (Fig. 1C). The lack of 4E-BPs resulted in reduced ( ⁇ 700-fold) virus titers, as assayed on BHK21 cell monolayers (Fig. 1 D). These data demonstrate that removing 4E-BPs inhibits VSV propagation.
  • ePE VSV-induced cytopathic effect
  • 4E-BP1/2 DKO MEFs were infected with different viruses and viral replication was determined. As shown in Figs. 4 and 5, 4E-BP1/2 DKO MEFs are less susceptible to infection by Sindbis (alphavirus, positive strand RNA virus), EMCV (picornavirus, positive strand RNA virus), Influenza (orthomyxovirus, negative strand RNA virus), Myxoma (Poxviridae, double-stranded DNA virus) and HSV-1 (Herpesviridae, double-stranded DNA virus).
  • Fig. 6A shows that cells deficient in 4E-BP1 or 4E-BP2 are less susceptible to Sindbis (alphavirus, positive strand RNA virus), EMCV (picornavirus, positive strand RNA virus), Influenza (orthomyxovirus, negative strand RNA virus), Myxoma (Poxviridae, double-stranded DNA virus) and HSV-1 (Herpesviridae, double
  • FIG. 6B shows the expression of 4E-BP1 and/or 4E-BP2 in 4E-BP1 KO, 4E-BP2 KO and 4E-BP1/2 DKO cells, demonstrating the lack of expression of the knockout gene(s).
  • Example 3 The IFN response is up-regulated in 4E-BP1/2 DKO MEFs.
  • WT and 4E-BP1/2 DKO MEFs were treated with polyinosine-polycytidylic acid (poly(l:C)), a synthetic double-stranded RNA (dsRNA) analogue, which is a potent inducer of type-l IFN.
  • poly(l:C) polyinosine-polycytidylic acid
  • dsRNA synthetic double-stranded RNA
  • IFN type-l IFN.
  • CPE VSV-induced cytopathic effect
  • Example 4 4E-BP1/2 DKO mice are protected against VSV infection.
  • VSV replication is known to be sensitive to inhibition by IFN.
  • mice In lungs from 4E-BP1/2 DKO mice, virus load was reduced ( ⁇ 100-fold; Fig. 8B) and the expression of both IFN ⁇ and IFN ⁇ mRNAs, as assayed by RT-PCR analysis, was significantly increased ( ⁇ 3-fold) already by 2 days post-infection (d.p.L), as compared to WT mice (Fig. 8C).
  • the serum of VSV-infected 4E-BP1/2 DKO mice contained increased IFN ⁇ levels, as compared to the serum of VSV-infected WT mice (Fig. 8F).
  • mice lacking 4E-BP1/2 are more resistant to VSV infection and produce more type-l IFN, as compared to their WT counterparts.
  • Plasmacytoid dendritic cells pDCs are the main producers of systemic type-l
  • pDCs from 4E-BP1/2 DKO mice were isolated and incubated with VSV (MOI of 1 and 10 PFU/cell) for 6h.
  • VSV MOI of 1 and 10 PFU/cell
  • pDCs from 4E-BP1/2 DKO mice generated significantly more (>7-fold) IFN ⁇ , as compared to pDCs from WT littermates (Fig. 8D).
  • pDCs from 4E- BP1/2 DKO mice which were co-cultured with synthetic CpG oligodeoxynucleotides (CpG- ODN), elicited higher IFN ⁇ levels (>4-fold) than pDCs from WT littermates (Fig. 8E).
  • CpG- ODN synthetic CpG oligodeoxynucleotides
  • chemokine (C-X-C) ligand 5 e.g., chemokine (C-X-C) ligand 5, complement component 4 binding protein, and a variety of cytokines] were also up-regulated (Fig. 1OA; for a complete list of genes up-regulated in 4E- BP1/2 DKO MEFs, see Fig. 11C).
  • mRNAs encoding for proteins involved in the production of IFN polysomal RNA from WT and DKO MEFs was analyzed by gene-expression microarrays. mRNAs with low or no induction at the mRNA level ( ⁇ 1.5-fold) but a robust induction of translation (> 4-fold) were identified (Fig. 11 B and Table III). The microarray analysis revealed that IRF-7 mRNA, which encodes a regulator of the type-l IFN response, was the highest ranked gene in this analysis as its expression was increased ⁇ 12-fold in 4E-BP1/2 DKO MEFs as compared to WT MEFs (Fig. 11 B).
  • Table III Genes showing increased translational activity (>4-fold) in DKO MEFs as compared to WT MEFs
  • IRF-7 mRNA was mainly associated with light polysomes in WT MEFs (Fig. 12B, left panel), consistent with its inefficient translation initiation, ⁇ -actin mRNA, by contrast, was distributed mainly in heavy polysomes (Fig. 12C).
  • the IRF-7 mRNA has a highly structured 5 1 UTR which is evolutionarily conserved.
  • a construct in which the SV40 promoter drives the expression of the 5' UTR of IRF- 7 mRNA fused to a firefly luciferase (Flue) reporter (5'UTR-IRF-7-Fluc; Fig. 12E) was generated.
  • the expression of the 5'UTR-I RF-7-Fluc in WT MEFs was reduced relative to the control (lacking the 5'UTR) Flue reporter and a Renilla Luciferase (Rluc) reporter plasmid, which is under the control of the CMV promoter and used as a transfection control (Fig. 12E).
  • IRF-7-mediated type-l IFN response induces the expression of RIG-I and MDA5, which triggers the induction of NF- ⁇ B, IRF-3 and IRF-7 that cooperate in the production of the antiviral type-l IFN response.
  • RIG-I retinoic acid inducible gene I
  • MDA5 melanoma-differentiation- associated gene 5
  • IRF-7 levels were reduced the in 4E-BP1/2 DKO MEFs using a specific shRNA against IRF-7 mRNA. Expressing the shRNA against IRF-7 mRNA, but not a control shRNA, not only restored the sensitivity to VSV infection but also blocked type-l IFN production in these cells (Fig. 15). These data provide genetic evidence that the enhanced IFN response in 4E-BP1/2 DKO MEFs is caused by up-regulation of IRF-7 expression.
  • Example 7 Knockdown of 4E-BP1/2 in different human cell lines using lentivirus shRNA vectors and effects on viral replication.
  • Fig. 16A transfection of various human cell lines (HEK293T, Jurkat, THP-1 and U937 cells) using lentivirus shRNA vectors against 4E-BP1 and/or 4E-BP2 results in the knockdown of the respective target(s). Knockdown is almost complete for both 4E-BPs for all four cell lines.
  • Fig. 16B shows that single knockdown of 4E-BP1 or 4E-BP2 in HEK293T cells results in a restriction of VSV replication 1Oh post-infection, an effect which is more pronounced with 4E-BP1 knockdown.
  • Fig. 16A transfection of various human cell lines (HEK293T, Jurkat, THP-1 and U937 cells) using lentivirus shRNA vectors against 4E-BP1 and/or 4E-BP2 results in the knockdown of the respective target(s). Knockdown is almost complete for both 4E-BPs for all four cell lines.
  • Fig. 16B shows that single knockdown of 4E-BP1
  • FIG. 16C shows that VSV proteins 6h post-infection are expressed at lower levels in Jurkat cells in which both 4E-BP1/2 has been knockdown as compared to control Jurkat cells. Also, knockdown of both 4E-BP1/2 in HEK293T cells results in an inhibition of HIV- 1 release from infected cells as compared to controls (Fig. 16D).
  • Example 8 Knockdown of 4E-BP1/2 using specific siRNA and effects on IFN production.
  • Fig. 17A The results presented at Fig. 17A indicate that unmodified siRNAs targeting human 4E-BP1 and 4E-BP2 are eliciting potent gene silencing (far right lanes in the two gels).
  • siRNAs As well, none of the scrambled (non-targeting) siRNAs affect expression levels of 4E-BP1 or 4E-BP2. Because Scrambled modified control 1 and 2 are chemically modified with 2'F-ANA and 2'F-RNA, these data indicate that the chemical modifications alone are not responsible for changes in expression of 4E-BP1 or 2. Looking at the knockdown of 4E-BP1 and 2 with the H_14 modification architecture (fully 2'F-ANA sense strand, fully 2'F-RNA antisense strand), it is shown that siRNAs comprising this modification are capable of silencing both 4E-BP1 and 2, although not as potently as the unmodified control after 24 hours, especially in the case of 4E- BP1.
  • H_611 modification architecture (alternating 2'F-ANA/2'F-RNA sense strand, fully 2'F- RNA antisense strand) appears to be more potent than H_14 in both cases, possibly even exceeding the potency of the unmodified control for 4E-BP2.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Compounds, methods, uses, compositions, kits and packages for inducing an immune response and for the diagnosis, prevention and/or treatment of viral infection and/or disease based on 4E-BP modulation are described. Related methods for diagnosing susceptibility to viral infection, and for identifying or characterizing compounds for the induction of an immune response and for the prevention and/or treatment of viral infection are also described.

Description

IMMUNE RESPONSE MODULATION AND USES THEREOF
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit, under 35 U. S. C. 119(e), of United States Provisional Patent Application serial No. 61/015,033 filed on December 19, 2007, which is incorporated herein by reference in its entirety.
TECHNICAL FIELD
The present invention relates to the modulation of the immune response, and more particularly to the prevention, treatment and/or diagnosis of infectious diseases, such as viral infections and related diseases, based on such modulation.
BACKGROUND ART
Translational control of gene expression provides the cell with a rapid response to external and internal triggers or cues, without invoking the slower nuclear pathways for mRNA synthesis and transport. In eukaryotes, translational control mostly occurs at the rate- limiting initiation step, during which the small 40S ribosomal subunit is recruited to the mRNA. Ribosome recruitment is facilitated by the 5'-cap structure (m7GpppN, where N is any nucleotide) present on all nuclear transcribed eukaryotic mRNAs. The cap structure is recognized by eukaryotic initiation factor 4F (elF4F), which comprises of elF4E, the cap-binding subunit; elF4A, a bidirectional RNA helicase and elF4GI or elF4GII, scaffolding proteins that bind directly to elF4E and elF4A and bridge the mRNA to the ribosome through interactions with e1 F3. elF4F complex assembly is inhibited by the elF4E binding proteins (4E-BPs). Mammals contain three highly related 4E-BPs that compete with elF4G for a shared binding site on the convex dorsal surface of elF4E. mTOR-mediated phosphorylation of 4E-BP1 (the most characterized 4E-BP), stimulates translation by dissociating 4E-BPs from elF4E. Hypophosphorylated 4E-BP1 binds to elF4E with high affinity (nanomolar range), whereas increased phosphorylation decreases its affinity for elF4E.
Infections such as viral infections activate a subset of genes encoding cytokines and other antiviral proteins that trigger first the innate immune response, and subsequently the adaptive immune response. Type-I interferons (IFNα and IFNβ) are widely expressed cytokines which constitute the first line of defence against viral infections. Transcriptional control of IFN- gene expression plays a role in the activation of the innate immune response. There is a need to develop new approaches for immune response modulation. There is also a need to develop new strategies for the prevention, treatment and/or diagnosis of viral infections and related diseases.
The present description refers to a number of documents, the content of which is herein incorporated by reference in their entirety.
SUMMARY OF THE INVENTION
In a first aspect, the present invention provides a method for inducing or enhancing an immune response in a subject comprising administering an effective amount of an agent that inhibits the expression and/or activity of a elF4E-binding protein (4E-BP) to said subject.
In another aspect, the present invention provides a method for preventing or treating a viral infection in a subject comprising administering an effective amount of an agent that inhibits the expression and/or activity of a elF4E-binding protein (4E-BP) to said subject. In another aspect, the present invention provides a use of an agent that inhibits the expression and/or activity of a 4E-BP for inducing or enhancing an immune response in a subject.
In another aspect, the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for inducing or enhancing an immune response in a subject.
In another aspect, the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for preventing or treating a viral infection or disease in a subject.
In another aspect, the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for preventing or treating a viral infection or disease in a subject.
In another aspect, the present invention provides an agent that inhibits the expression or activity of 4E-BP for preventing or treating a viral infection or disease in a subject. In another aspect, the present invention provides an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for preventing or treating a viral infection or disease in a subject.
In another aspect, the present invention provides a composition for preventing or treating a viral infection or disease in a subject comprising an agent that inhibits the expression or activity of a 4E-BP, and a pharmaceutically acceptable carrier. In another aspect, the present invention provides an agent that inhibits the expression or activity of 4E-BP for inducing or enhancing an immune response in a subject. In another aspect, the present invention provides an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for inducing or enhancing an immune response in a subject.
In another aspect, the present invention provides a composition for inducing or enhancing an immune response in a subject comprising an agent that inhibits the expression or activity of a 4E-BP, and a pharmaceutically acceptable carrier.
In another aspect, the present invention provides a kit or package for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said kit or package comprising (a) an agent that inhibit the expression or activity of a elF4E-binding protein (4E-BP) and (b) a container.
In an embodiment, the above-mentioned kit or package further comprises instructions for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii).
In an embodiment, the above-mentioned agent inhibits the expression of a 4E- BP. In a further embodiment, the above-mentioned agent inhibits the expression of 4E-BP1 , 4E- BP2, or both.
In an embodiment, the above-mentioned agent is a short-hairpin RNA (shRNA).
In a further embodiment, the above-mentioned shRNA is derived from a 4E-BP1 nucleic acid sequence, a 4E-BP2 nucleic acid sequence, or both. In a further embodiment, the above- mentioned shRNA is encoded by a nucleic acid comprising the sequence of SEQ ID NOs: 11,
SEQ ID NO: 12, or both.
In an embodiment, the above-mentioned shRNA is derived from a 4E-BP1 nucleic acid sequence. In a further embodiment, the above-mentioned shRNA is encoded by a nucleic acid comprising the sequence of SEQ ID NO: 11. In an embodiment, the above-mentioned method comprises administering to said subject an effective amount of: (a) an shRNA derived from a 4E-BP1 nucleic acid sequence; (b) an shRNA derived from a 4E-BP2 nucleic acid sequence; or (c) both (a) and (b).
In an embodiment, the above-mentioned method comprises administering to said subject an effective amount of: (a) an shRNA encoded by a nucleic acid comprising the sequence of SEQ ID NO: 11 ; (b) an shRNA encoded by a nucleic acid comprising the sequence of SEQ ID NO:12; or (c) both (a) and (b).
In an embodiment, the above-mentioned use comprises a use of: (a) an shRNA derived from a 4E-BP1 nucleic acid sequence; (b) an shRNA derived from a 4E-BP2 nucleic acid sequence; or (c) both (a) and (b). In an embodiment, the above-mentioned use comprises a use of: (a) an shRNA encoded by a nucleic acid comprising the sequence of SEQ ID NO: 11 ; (b) an shRNA encoded by a nucleic acid comprising the sequence of SEQ ID NO: 12; or (c) both (a) and (b).
In another embodiment, the above-mentioned agent is a small-interfering RNA (siRNA). In a further embodiment, the above-mentioned siRNA is derived from a 4E-BP1 nucleic acid sequence, a 4E-BP2 nucleic acid sequence, or both. In a further embodiment, the above- mentioned siRNA comprises the sequence of (a) SEQ ID NOs: 13 and 14; (b) SEQ ID NOs: 21 and 22; (c) SEQ ID NOs: 27 and 28; (d) SEQ ID NOs: 15 and 16; (e) SEQ ID NOs: 23 and 24; (f) SEQ ID NOs: 29 and 30, or (g) any combination of (a) to (f). In an embodiment, the above-mentioned siRNA is derived from a 4E-BP1 nucleic acid sequence.
In a further embodiment, the above-mentioned siRNA comprises the sequence of (a) SEQ ID NOs: 13 and 14; (b) SEQ ID NOs: 21 and 22; (c) SEQ ID NOs: 27 and 28, or (d) any combination of (a) to (c). In another aspect, the present invention provides a method of identifying a compound for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said method comprising determining whether: (a) a level of expression of a 4E-BP nucleic acid or encoded polypeptide; (b) a level of 4E-BP activity; or both (a) and (b), is decreased in the presence of a test compound relative to in the absence of said test compound, wherein said decrease is indicative that said test compound can be used for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection, or (iii) both (i) and (ii).
In another aspect, the present invention provides a method of identifying or characterizing a compound for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said method comprising: contacting a test compound with a cell comprising a first nucleic acid comprising a transcriptionally regulatory element normally associated with a 4E-BP gene, operably linked to a second nucleic acid comprising a reporter gene capable of encoding a reporter protein; and determining whether reporter gene expression or reporter protein activity is decreased in the presence of said test compound; wherein a decrease in said reporter gene expression or reporter protein activity is indicative that said test compound may be used for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection, or (iii) both (i) and (ii).
In another aspect, the present invention provides a method for diagnosing viral infection or disease or susceptibility thereto, in a subject, the method comprising: (a) determining in a biological sample from said subject: (i) a level of expression of a 4E-BP nucleic acid or encoded polypeptide; (ii) a level of 4E-BP activity; or (iii) both (i) and (ii); (b) comparing said level to a corresponding reference level; and (c) diagnosing said viral infection or disease or susceptibility thereto in accordance with said comparison.
In another aspect, the present invention provides a method for diagnosing viral infection or disease or susceptibility thereto, in a subject, the method comprising: (a) comparing: (i) a level of expression of a 4E-BP nucleic acid or encoded polypeptide; (ii) a level of 4E-BP activity; or (iii) both (i) and (ii); determined in a biological sample from said subject; with a corresponding reference level; and (b) diagnosing said viral infection or disease or susceptibility thereto in accordance with said comparison.
In another aspect, the present invention provides a kit or package for diagnosing viral infection or disease or susceptibility thereto in a subject, the kit comprising means for determining in a biological sample from said subject: (a) a level of expression of a 4E-BP nucleic acid or encoded polypeptide; (b) a level of 4E-BP activity; or (c) both (a) and (b); together with instructions for correlating said level with viral infection or disease or susceptibility thereto. In an embodiment, the above-mentioned corresponding reference level is the level measured in a corresponding biological sample from one or more healthy subject(s) who are not suffering from or are known not to be susceptible to viral infection or disease, and wherein an increase in said level relative to said corresponding reference level is indicative that the subject is suffering from or is susceptible to viral infection or disease; or a substantially similar level relative to said corresponding reference level is indicative that the subject is not suffering from or is not susceptible to viral infection or disease.
In another embodiment, the above-mentioned corresponding reference level is the level measured in a corresponding biological sample from one or more subject(s) who are suffering from or are known to be susceptible to viral infection or disease, and wherein a substantially similar level relative to said corresponding reference level is indicative that the subject is suffering from or has a susceptibility to viral infection or disease; or an decrease in said level relative to said corresponding reference level is indicative that the subject is not suffering from or is not susceptible to viral infection or disease.
In an embodiment, the above-mentioned 4E-BP is 4E-BP1. In a further embodiment, the above-mentioned 4E-BP1 comprises the amino acid sequence of SEQ ID NO: 32.
In another embodiment, the above-mentioned 4E-BP1 nucleic acid encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 32. In a further embodiment, the above-mentioned 4E-BP1 nucleic acid comprises the coding sequence of the nucleotide sequence of SEQ ID NO: 31. Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings.
BRIEF DESCRIPTION OF DRAWINGS
In the appended drawings:
Figure 1 shows the effect of the lack of 4E-BPs on vesicular stomatitis virus (VSV) replication. WT and 4E-BP1/2 double-knockout (DKO) Mouse Embryonic Fibroblasts (MEFs) were mock-infected or infected with VSV at an MOI of 0.5 PFU/cell. (A) MEFs were incubated with [35S]methionine for 30 min at the indicated times post-infection. Proteins were subjected to 15% SDS-PAGE. An autoradiogram of the dried gel is shown. Viral proteins are indicated on the left: G = glycoprotein; M = matrix protein; N/P = nucleocapsid protein/phosphoprotein. (B) Western blotting analysis using antibodies against VSV structural proteins, 4E-BP1, 4E-BP2 and β-actin. Cytopathic effect (CPE) (C) and virus yield (D) were determined at 1Oh post-infection in WT and 4E-BP1/2 DKO MEFs;
Figure 2 shows that VSV replication is impaired in 4E-BP1/2 DKO MEFs. WT and 4E-BP1/2 DKO MEFs were mock-infected or infected with VSV at an MOI of 5 PFU/cell. (A) MEFs were incubated with [35S]methionine for 30 min at the indicated times post-infection (p.i). Proteins were subjected to 15% SDS-PAGE. An autoradiogram of the dried gel is shown. Viral proteins are indicated on the left. (B) Virus yield was determined at 6h post-infection;
Figure 3 shows the restoration of 4E-BP1/2 DKO MEFs with 4E-BP1 and 4E- BP2 expression vectors. 4E-BP1/2 DKO MEFs were infected with two retroviruses carrying 4E- BP1 and 4E-BP2 or an empty vector. After 5 days of selection with puromycin, cells were infected with VSV at an MOI of 1 PFU/cell. Proteins were subjected to 15% SDS-PAGE. Western blot analysis was performed using antibodies against VSV proteins (A), 4E-BP1 and 4E-BP2 (B) and β-actin (C). (D) Virus yield was determined at 8h post-infection;
Figure 4 shows that Sindbis virus, encephalomyocarditis virus (EMCV) and influenza virus replication is reduced in 4E-BP1/2 DKO MEFs. WT and 4E-BP1/2 DKO MEFs were infected with an MOI of 1 with (A) Sindbis virus, (B) EMCV and (C) Influenza virus A/HK/1/68-MA20 for the indicated times. MEFs were pulse labeled with [35S]methionine, lysed and subjected to 15% SDS-PAGE as described in Fig 1. Viral proteins are indicated on the left.
(D) Virion production was determined by a plaque assay at 12h post-infection for Sindbis virus and EMCV, and at 24h post-infection for influenza virus. The limit of detection was 103 PFU/ml;
Figure 5 shows that Myxoma virus and Herpes Simplex virus-1 (HSV-1 ) replication is reduced in 4E-BP1/2 DKO MEFs. (A) WT and 4E-BP1/2 DKO cells were infected with GFP-Myxoma virus at an 0.1, 1.0 and 10 MOI. GFP fluorescence and cytopathic effects were observed 24 hrs post-infection. (B) WT and 4E-BP1/2 DKO cells were infected with HSV-1 at an MOI of 1. An immunoblot for HSV-1 viral glycoproteins at indicated times post-infection is shown. Bottom panel, plaque titration to measure viral progeny at 24hrs post-infection;
Figure 6 shows the effect of single 4E-BP1 or 4E-BP2 knockout in mouse embryonic fibroblasts on resistance to VSV infection. (A) WT, 4E-BP1 KO, 4E-BP2 KO, and 4E-
BP1/2 DKO mouse embryonic fibroblasts were infected with VSV-wt-GFP at an MOI of 10 GFP fluorescence and cytopathic effects were observed 1Oh post-infection. (B) Immunoblot for 4E-
BP1 and 2, as well as β-actin.
Figure 7 shows the enhanced production of type-l IFN in 4E-BP1/2 DKO MEFs. (A) Diagram of experimental protocol. WT (filled squares) and DKO MEFs (open squares) were treated with polyinosine-polycytidylic acid (poly(l:C)) (0.1 μg/ml) for 6h and cultured medium was collected. WT MEFs were incubated overnight with the cultured medium from WT and 4E- BP1/2 DKO MEFs and then infected with VSV (0.1 MOI). (B) CPE and virus titers in the culture supernatant were determined by microscopy and plaque assay, respectively. (C) WT and 4E- BP1/2 DKO MEFs were mock treated or treated with poly(l:C) (0.1 μg/ml) for 6h and total RNA was isolated. Induction of IFNα {Ifna) and IFNβ (Ifnb) was determined by RT-PCR. RT-PCRs against 4E-BP1 and β-actin mRNAs were performed as controls. (D) WT and 4E-BP1/2 DKO MEFs were treated with poly(l:C) (0.1 μg/ml and 1 μg/ml) for 6h and the production of IFNα was determined by ELISA; Figure 8 shows that 4E-BP1/2 DKO mice are resistant to VSV infection. (A) Mice
(n=10) were intranasally infected with VSV (5 X 107 PFU) and their survival was plotted as a Kaplan-Meier curve. (B) Lungs from VSV-infected (105 PFU) mice (n=3) were dissected 5 days after infection and virus yield was determined by plaque assay (mean ± s.d.). (C) Expression of IFNα {Ifna) and IFNβ (Ifnb) genes was determined by RT-PCR in lungs (n=3). (D, E) Splenic plasmacytoid dendritic cells (pDCs) were isolated and cultured for 6 h with VSV (D) or incubated overnight in the presence of CpG-ODN (E). Secreted IFN-α was measured by ELISA. ND = not detected; (F) 4E-BPs inhibit type-I IFN production in mice. Wild-type and 4E-BP1/2 DKO mice (n=3 per group) were infected with VSV (105 PFU) and serum was collected at 12h postinfection. IFNα levels were measured by ELISA. Figure 9 shows that neutralizing antibodies against IFNβ restore the susceptibility to VSV infection in DKO MEFs, and that poly(l:C) and virus-induced type-l IFN production is enhanced in 4E-BP1/2 DKO MEFs. (A) 4E-BP1/2 DKO MEFs were mock-treated or treated with a neutralizing antibody against IFNβ and infected with VSV (MOI of 1 PFU/cell). CPE and virus titers were determined 1Oh post-infection. (B) WT and 4E-BP1/2 DKO MEFs were mock treated or treated with poly(l:C) (1 μg/ml) for 6h and total RNA was isolated. (C) WT and 4E-BP1/2 DKO MEFs were mock-infected or infected with VSV (MOI of 1 PFU/cell). The induction of IFNα and IFNβ mRNAs was determined by RT-PCR. h.p.i = hours post-infection; Figure 10 shows that type-l IFN production is increased in 4E-BP1/2 DKO MEFs. WT and 4EBP1/2 DKO MEFs were treated with poly(l:C) (0.1 μg/ml and 1 μg/ml) for 6h (A) and 3h (B) and the production of IFNβ was determined by ELISA. (C) 3h post-treatment, I FNa was only produced in 4E-BP1/2 DKO MEFs, as determined by ELISA; Figure 11 shows the genes whose expression is up-regulated in 4E-BP1/2 DKO
MEFs as compared to wild-type (WT) MEFs. RNA from both the total extract and polysomes was isolated and used for gene-expression microarray analysis. (A) All genes that showed a >1.5 up-regulation were searched for functions related to interferon or inflammation. Shown is the normalized expression in DKO and WT MEFs, on a Iog2 scale. The genes are ranked according to their expression level in WT MEFs. (B) All genes that showed increased translational activity (>4-fold) in DKO MEFs, when the polysomal RNA level had been corrected for transcript abundance and did not differ at the total level (<1.5-fold), were considered translationally up-regulated. Shown is the corrected translational activity in 4E-BP1/2 DKO and WT MEFs on a Iog2 scale. The genes were ranked in decreasing order according to the ratio between 4E-BP1/2 DKO and WT, with IRF-7 showing the largest translational activation. (C) List of all genes that showed a >1.5 up-regulation in DKO as compared to WT;
Figure 12 shows that 4E-BPs inhibit translation of Irf7 mRNA. (A) Polysome profiles of wild-type (left) and 4E-BP1/2 DKO (right) MEFs. (B, C) RT-PCR of Irf7 (B) and β- actin (C) mRNAs. (D) Western blot of IRF-7 and β-actin. (E) Translation of 5' UTR-/rf7-Fluc mRNA(Fluc, top) relative to Flue mRNA. A Renilla luciferase (Rluc) reporter vector was co- transfected with both reporters as a transfection control. Flue was normalized against Rluc. Values for the Flue reporter were about 7 X 104 RLU (relative light units) and 3 X 103 RLU for the 5' UTR-//f7-Fluc reporter. Rluc values were about 1 X 106 RLU. (F) Ratio of expression of 5' UTR-lrf7-Fluc/Rluc. The 5' UTR-//f7-Fluc and Rluc reporters were co-transfected. Flue activity was normalized against Rluc activity. The Flue value for wild-type MEFs was set as 1. For wild- type MEFs, Flue ranged between 1 X 103 and 6 X 103 RLU and Rluc between 1.2 X 106 and 3.4 X 106. For 4E-BP1/2 DKO MEFs, Flue ranged between 3.5 X 103 and 2.4 X 104 RLU and Rluc between 9 X 105 and 1.5 X 106 RLU;
Figure 13 shows that expression of 4E-BP1/2 is lower in plasmacytoid dendritic cells (pDCs) as compared to MEFs. Protein levels were determined by Western blot analysis using antibodies against 4E-BP1 , 4E-BP2 and β-actin;
Figure 14 shows that retinoic acid inducible gene I (RIG-I) and melanoma- differentiation-associated gene 5 (MDA5) expression is increased in 4E-BP1/2 DKO MEFs. (A) WT and 4E-BP1/2 DKO MEFs were either mock-treated or treated with poly(l:C) (1 μg/ml) and Western blotting was performed using a RIG-I specific antibody. (B) WT and 4E-BP1/2 DKO MEFs were mock-infected or infected with VSV (MOI of 1 PFU/cell) and Western blotting was performed using a MDA5 specific antibody; Figure 15 shows that a reduction of IRF-7 in 4E-BP1/2 DKO MEFs renders the cells susceptible to VSV infection and blocks type-l IFN production. (A) 4EBP1/2 DKO MEFs were first transfected with a control (Ctrl) shRNA or an shRNA against Irf7 and then infected with VSV (MOI of 1 PFU per cell) and incubated with [35S]methionine. Proteins were analysed by SDS-PAGE (15%). Viral proteins are indicated on the left. (B) Cytopathic effect was visualized at 9h after infection. (C) Western blot analysis using antibodies against IRF-7 and β- actin. (D) Virus yield was determined 9h post-infection. (E) IFN-α levels were determined 9h post-infection by ELISA (mean ± s.d. of three experiments);
Figure 16 shows the knockdown of 4E-BP1/2 in human cell lines using lentivirus shRNA vectors and the effects on viral replication. Lentivirus shRNA vectors against 4E-BP1/2 were used to infect HEK293T, Jurkat, THP1 and U937 cell lines. Infected cells were selected in puromycin and stable clones kept in culture. (A) Western blotting against 4E-BP1 , 4E-BP2 and β-actin to demonstrate the knockdown of respective target. (B) VSV-GFP infection of HEK293T cells with knockdown of 4E-BP1 or 4E-BP2 1Oh post-infection at an MOI of 1 , GFP and CPE are shown. (C) Western blot to detect VSV proteins 6h post-infection at an MOI of 1 of Jurkat control or Jurkat 4E-BP1/2 knockdown cells. (D) HIV-1 release relative to mature p24 inside the cell, and HIV-1 release relative to total gag was measure using HEK293T control and HEK293T 4E-BP1/2 knockdown cells;
Figure 17 shows the effect of small-interfering RNA (siRNA) transfections on 4E- BP1 or 4E-BP2 expression. siRNA transfections were performed in HEK293T cells using Lipofectamine Plus™ reagent on cells plated at 70-80% confluence in a 24-well plate. For each well, either 2.5 μl (1) or 5 μl of siRNA duplex (20 μM annealed duplex) was mixed with 50 μl of OPTI-MEM™ and 1 μl of Plus™ reagent and incubated for 5 min. at room temperature (RT). A mixture of 4 μl of Lipofectamine™ reagent and 50 μl of OPTI-MEM™ was then added to the precomplexed RNA mix and incubated for 20 min. at RT before adding to cells. Five hours later, the transfection medium was replaced by complete medium. Cells were harvested 48 hours after transfection and proteins were extracted for analysis by Western blotting using antibodies against 4E-BP1 , 4E-BP2 or β-actin (A). (B) Sequences of the siRNAs used in (A);
Figure 18 shows the effect of siRNA transfections on IFN production by HEK293T cells following stimulation with poly(l:C). siRNA transfections were performed in HEK293T cells using Lipofectamine Plus™ reagent on cells plated at 70-80% confluence in a 24-well plate. For each well, 5 μl of both 4E-BP1 and 4E-BP2 siRNA duplexes (modified H-611 or unmodified) (20 μM annealed duplex) were mixed with 75 μl of OPTI-MEM™ and 1 μl of Plus™ reagent and incubated for 5 min. at room temperature (RT). A mixture of 5 μl of Lipofectamine™ reagent and 75 μl of OPTI-MEM™ was then added to the precomplexed RNA mix and incubated for 20 min. at RT before adding to cells. Five hours later, the transfection medium was replaced by complete medium. 48 hours after transfection, cells were either left untreated or treated with 1 μg/ml of poly(l:C) for 24 hours. Supernatants from untreated and treated cells were collected and the amount of IFN was quantified using the HEK-Blue™ IFN- α/β Cells (InvivoGen, San Diego, USA) according to the manufacturer's protocol; and
Figure 19 shows the nucleotide sequences of human and murine 4E-BP transcripts. (A) Human 4E-BP1 (SEQ ID NO: 31); (B) mouse 4E-BP1 (SEQ ID NO: 33); (C)
Human 4E-BP2 (SEQ ID NO: 35); (D) mouse 4E-BP2 (SEQ ID NO: 37); (E) Human 4E-BP3
(SEQ ID NO: 39). The coding sequences are indicated in bold, and the portion of 4E-BP1 and
4E-BP2 targeted by the siRNA in the studies described herein is underlined.
DISCLOSURE OF INVENTION
Described herein are studies which show that viral replication is inhibited in cells which are defective in one or more of the 4E-BPs. This inhibition is associated with an enhanced innate immune response, as determined by increased expression of type-l IFN. Also, mice deficient in 4E-BP are more resistant to viral infection. It has also been found that treatment of normal cells with agents that inhibit the expression of 4E-BP such as short-hairpin RNA (shRNA) and small interfering RNA (siRNA), results in increased type-l interferon expression and inhibition of viral replication.
Mammals contain three highly related 4E-BPs (4E-BP1 , 4E-BP2 and 4E-BP3) that compete with elF4G for a shared binding site on the convex dorsal surface of elF4E. mTOR-mediated phosphorylation of 4E-BP1 (the best characterized 4E-BP) stimulates translation by dissociating 4E-BPs from elF4E. Hypophosphorylated 4E-BP1 binds to elF4E with high affinity, whereas increased phosphorylation decreases its affinity for elF4E. The nucleotide sequences of human and mouse 4E-BPs are provided at Fig. 19.
Accordingly, in a first aspect, the present invention provides a method for inducing or enhancing an immune response in a subject comprising administering an effective amount of an agent that inhibits the expression or activity of a elF4E-binding protein (4E-BP) to said subject.
In another aspect, the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for inducing or enhancing an immune response in a subject.
In another aspect, the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for inducing or enhancing an immune response in a subject.
In another aspect, the present invention provides a method for preventing or treating a viral infection in a subject comprising administering an effective amount of an agent that inhibits the expression or activity of a elF4E-binding protein (4E-BP) to said subject. In another aspect, the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for preventing or treating a viral infection or disease in a subject.
In another aspect, the present invention provides a use of an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for preventing or treating a viral infection or disease in a subject.
In another aspect, the present invention provides an agent that inhibits the expression or activity of a 4E-BP for inducing or enhancing an immune response in a subject.
In another aspect, the present invention provides an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for inducing or enhancing an immune response in a subject.
In another aspect, the present invention provides an agent that inhibits the expression or activity of a 4E-BP for preventing or treating a viral infection or disease in a subject. In another aspect, the present invention provides an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for preventing or treating a viral infection or disease in a subject.
In another aspect, the present invention provides an shRNA or siRNA molecule described herein. In another aspect, the present invention provides a composition comprising an shRNA or siRNA molecule described herein and a pharmaceutically acceptable carrier.
In another aspect, the present invention provides a use of an shRNA or siRNA molecule described herein for the preparation of a medicament.
In an embodiment, the above-mentioned method or use comprises inhibiting the expression and/or activity of at least one 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3). In another embodiment, the above-mentioned method or use comprises inhibiting the expression and/or activity of 4E-BP1. In another embodiment, the above-mentioned method or use comprises inhibiting the expression and/or activity of all 4E-BPs (4E-BP1 , 4E-BP2 and 4E-BP3).
Any agent that inhibits the activity and/or expression of a 4E-BP may be used in the methods/uses of the present invention. The regulation of 4E-BP expression or activity could be achieved by various mechanisms, which among others could act at the level of: (i) its transcription (ii) mRNA levels (e.g., RNA interference), (iii) its translation, which may be controlled by specific factors, (iv) its post-translational modifications that may affect its activity, including glycosylation, phosphorylation (e.g., hypophosphorylated 4E-BP1 binds to elF4E with high affinity, whereas increased phosphorylation decreases its affinity for elF4E and therefore its repressor activity), or possibly by processing events resulting in its degradation, (v) its cellular localization, (vi) its interaction with other biomolecules (e.g., other proteins), for example using small compounds, protein fragments or antibodies. These regulatory processes occurred through different molecular interactions that could be modulated by a variety of compounds or modulators.
In an embodiment, the agent capable of inhibiting or reducing expression of 4E- BP is an oligonucleotide-based molecule (e.g., antisense, ribozyme, siRNA, shRNA, aptamer).
Generally, the principle behind antisense technology is that a single stranded antisense molecule hybridizes to a target nucleic acid and effects modulation of gene expression such as transcription, splicing, translocation of the RNA to the site of protein translation, translation of protein from the RNA. The modulation of gene expression can be achieved by, for example, target degradation or occupancy-based inhibition. An example of modulation of RNA target function by degradation is RNase H-based degradation of the target RNA upon hybridization with a DNA-like antisense compound. Another example of modulation of gene expression by RNA target degradation is RNA interference (RNAi). RNAi is a form of oligonucleotide-mediated gene silencing involving the introduction of duplex or double stranded RNA (dsRNA; typically of less than 30 nucleotides in length, and generally about 19 to 24 nucleotides in length) leading to the sequence-specific reduction of targeted endogenous mRNA levels, here the RNA transcript of a 4E-BP gene. Such dsRNA are generally substantially complementary to at least part of an RNA transcript of a 4E-BP gene. Such dsRNA (e.g., siRNA) may also comprises a overhang (e.g., a 2-3 nucleotide overhang) at one or both ends. Example of double stranded nucleic acid molecules short interfering nucleic acid (siNA), short- hairpin RNA (shRNA), short interfering RNA (siRNA), agRNA (antigene RNA) and micro-RNA (miRNA). The use of single stranded antisense oligonucleotides (ASO) is also encompassed by the methods of the present invention. shRNA generally refers to a sequence of RNA that makes a hairpin turn that can be used to silence gene expression via RNA interference. shRNA generally uses a vector comprising a DNA sequence encoding the shRNA and which is introduced into cells. This vector may be passed on to daughter cells, allowing the gene silencing to be inherited. The shRNA hairpin structure is cleaved by the cellular machinery, which is then bound to the RNA-induced silencing complex (RISC). siRNA generally refers to a duplex of short (e.g., about 20-25 nucleotides, typically about 21 nucleotides) nucleic acids, e.g., a double strand of RNA (dsRNA), generally having a short overhang (e.g., 2-3 nucleotides) on either end.
Antisense compounds directed against 4E-BP1 and 4E-BP2 are disclosed, for example, in U.S. Patent Application Nos. 2005/0181400 and 2005/0196787, respectively.
Chemically modified nucleotides are routinely used for incorporation into oligonucleotide compounds to enhance one or more properties, such as nuclease resistance, stability, pharmacokinetics or affinity for a target RNA. Examples of such modified nucleotides are described in Dowler, et al. (Nucl. Acids Res. 2006, 34: 1669-1675), Watts et al., (Nucl. Acids Res. 2007, 35: 1441 -1451), Layzer, et al. (RNA, 2004, 10: 766-771), Allerson, et al. (J. Med. Chem. 2005, 48: 901-904), Koller, et al. (Nucl. Acids Res. 2006 34: 4467-4476), Noronha, et al. (Biochemistry 2000, 39: 7050-7062), PCT/CA2006/002035, and Canadian Patent Application No. 2,635,187. In an embodiment, the modified nucleotide is a 2'-fluoro modified nucleotide. In a further embodiment, the modified nucleotide is 2'-fluoro RNA (2'F-RNA) or a 2'-deoxy-2'-fluoro- arabinonucleotide (2'F-ANA).
In an embodiment, the agent capable of inhibiting or reducing expression of 4E- BP is a shRNA or a siRNA. In a further embodiment, the agent capable of inhibiting or reducing expression of 4E-BP is a shRNA. In a further embodiment, the above-mentioned shRNA inhibits or reduces the expression of 4E-BP1 and is encoded by a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 11. In another embodiment, the above-mentioned siRNA inhibits or reduces the expression of 4E-BP2 and is encoded by a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 12. In another embodiment, the agent capable of inhibiting or reducing expression of
4E-BP is a siRNA. In another embodiment, the above-mentioned siRNA inhibits or reduces the expression of 4E-BP1 and comprises the nucleotide sequence of SEQ ID NOs: 13 and 14, SEQ ID NOs: 21 and 22, or SEQ ID NOs: 27 and 28. In another embodiment, the above-mentioned siRNA inhibits or reduces the expression of 4E-BP2 and comprises the nucleotide sequence of SEQ ID NOs: 15 and 16, SEQ ID NOs: 23 and 24, or SEQ ID NOs: 29 and 30.
In the context of this invention, "hybridization" means hydrogen bonding between complementary nucleoside or nucleotide bases. Terms "specifically hybridizable" and "complementary" are the terms, which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed. Such conditions may comprise, for example, 400 mM NaCI, 40 mM PIPES pH 6.4, 1 mM EDTA, at 500C to 700C for 12 to 16 hours, followed by washing. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance- with the ultimate application of the hybridized nucleotides. Methods to produce antisense and siRNA molecules directed against a nucleic acid are well known in the art. The oligonucleotide-based molecules of the invention may be synthesized in vitro (e.g., using the method described at example 1 below) or in vivo.
The oligonucleotide-based molecules may be expressed from recombinant viral vectors, such as vectors derived from adenoviruses, adeno-associated viruses, retroviruses, herpesviruses, and the like. Such vectors typically comprises a sequence encoding an antisense molecule of interest (e.g., a dsRNA specific for 4E-BP) and a suitable promoter operatively linked to the antisense molecule for expressing the antisense molecule. The vector may also comprise other sequences, such as regulatory sequences, to allow, for example, expression in a specific cell/tissue/organ, or in a particular intracellular environment/compartment. Methods for generating, selecting and using viral vectors are well known in the art.
In another embodiment, the agent capable of inhibiting or reducing 4E-BP activity is a fragment of a 4E-BP polypeptide that lacks 4E-BP activity, e.g., a fragment of a polypeptide of SEQ ID NOs: 32, 34, 36, 38 or 40. Such fragment may act, for example, as a competitive inhibitor to prevent binding of native 4E-BP to one or more of its binding partner (e.g., elF4E), thus inhibiting its activity.
In another embodiment, the agent capable of inhibiting or reducing 4E-BP activity is an anti-4E-BP antibody. As used herein, the term "anti-4E-BP antibody" refers to an antibody that specifically binds to (interacts with) a 4E-BP protein and displays no substantial binding to other naturally occurring proteins other than the ones sharing the same antigenic determinants as the 4E-BP protein. The term antibody or immunoglobulin is used in the broadest sense, and covers monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, multispecific antibodies, and antibody fragments so long as they exhibit the desired biological activity. Antibody fragments comprise a portion of a full length antibody, generally an antigen binding or variable region thereof. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments, diabodies, linear antibodies, single-chain antibody molecules, single domain antibodies (e.g., from camelids), shark NAR single domain antibodies, and multispecific antibodies formed from antibody fragments. Antibody fragments can also refer to binding moieties comprising CDRs or antigen binding domains including, but not limited to, VH regions (VH, VH-VH), anticalins, PepBodies, antibody-T-cell epitope fusions (Troybodies) or Peptibodies. Additionally, any secondary antibodies, either monoclonal or polyclonal, directed to the first antibodies would also be included within the scope of this invention.
In general, techniques for preparing antibodies (including monoclonal antibodies and hybridomas) and for detecting antigens using antibodies are well known in the art (Campbell, 1984, In "Monoclonal Antibody Technology: Laboratory Techniques in Biochemistry and Molecular Biology", Elsevier Science Publisher, Amsterdam, The Netherlands) and in Harlow et al., 1988 (in: Antibody A Laboratory Manual, CSH Laboratories). The term antibody encompasses herein polyclonal, monoclonal antibodies and antibody variants such as single- chain antibodies, humanized antibodies, chimeric antibodies and immunologically active fragments of antibodies (e.g., Fab and Fab' fragments) which inhibit or neutralize their respective interaction domains in Hyphen and/or are specific thereto.
Polyclonal antibodies are preferably raised in animals by multiple subcutaneous (sc), intravenous (iv) or intraperitoneal (ip) injections of the relevant antigen with or without an adjuvant. It may be useful to conjugate the relevant antigen to a protein that is immunogenic in the species to be immunized, e.g., keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor using a bifunctional or derivatizing agent, for example, maleimidobenzoyl sulfosuccinimide ester (conjugation through cysteine residues), N- hydroxysuccinimide (through lysine residues), glutaraldehyde, succinic anhydride, SOCI2, or R1N=C=NR, where R and R1 are different alkyl groups.
Animals may be immunized against the antigen, immunogenic conjugates, or derivatives by combining the antigen or conjugate (e.g., 100 μg for rabbits or 5 μg for mice) with 3 volumes of Freund's complete adjuvant and injecting the solution intradermal^ at multiple sites. One month later the animals are boosted with the antigen or conjugate (e.g., with 1/5 to 1/10 of the original amount used to immunize) in Freund's complete adjuvant by subcutaneous injection at multiple sites. Seven to 14 days later the animals are bled and the serum is assayed for antibody titer. Animals are boosted until the titer plateaus. Preferably, for conjugate immunizations, the animal is boosted with the conjugate of the same antigen, but conjugated to a different protein and/or through a different cross-linking reagent. Conjugates also can be made in recombinant cell culture as protein fusions. Also, aggregating agents such as alum are suitably used to enhance the immune response. Monoclonal antibodies may be made using the hybridoma method first described by Kohler ef al., Nature, 256: 495 (1975), or may be made by recombinant DNA methods (e.g., U.S. Patent No. 6,204,023). Monoclonal antibodies may also be made using the techniques described in U.S. Patent Nos. 6,025,155 and 6,077,677 as well as U.S. Patent Application Publication Nos. 2002/0160970 and 2003/0083293. In the hybridoma method, a mouse or other appropriate host animal, such as a rat, hamster or monkey, is immunized to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the antigen used for immunization. Alternatively, lymphocytes may be immunized in vitro. Lymphocytes then are fused with myeloma cells using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (see, e.g., Goding 1986).
The hybridoma cells thus prepared are seeded and grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells. For example, if the parental myeloma cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT medium), which substances prevent the growth of HGPRT-deficient cells. The agent that inhibits the activity of 4E-BP may also be in the form of non- antibody-based scaffolds, such as avimers (Avidia); DARPins (Molecular Partners); Adnectins (Adnexus), Anticalins (Pieris) and Affibodies (Affibody). The use of alternative scaffolds for protein binding is well known in the art (Binz and Plϋckthun, 2005, Curr. Opin. Biotech. 16: 1- 11). As used herein, "inhibition" of 4E-BP expression or activity refers to a reduction in
4E-BP expression or activity of at least 10% as compared to normal expression or activity {i.e., the expression or activity in the absence of an inhibitor), in an embodiment of at least 20%, in a further embodiment of at least 30%, in a further embodiment of at least 40%, in a further embodiment of at least 50%, in a further embodiment of at least 60%, in a further embodiment of at least 70%, in a further embodiment of at least 80%, in a further embodiment of at least 90%, in a further embodiment of 100% (complete inhibition).
As used herein the term "4E-BP activity" refers to detectable enzymatic, biochemical or cellular activity attributable to 4E-BP, including its translational repressor activity.
In an embodiment, the above-mentioned treatment comprises the use/administration of more than one (i.e., a combination of) active/therapeutic agent (e.g., an agent capable of inhibiting expression of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3), an agent capable of inhibiting the activity of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3)). The combination of prophylactic/therapeutic agents and/or compositions of the present invention may be administered or co-administered (e.g., consecutively, simultaneously, at different times) in any conventional dosage form. Co-administration in the context of the present invention refers to the administration of more than one therapeutic in the course of a coordinated treatment to achieve an improved clinical outcome. Such co-administration may also be coextensive, that is, occurring during overlapping periods of time. For example, a first agent may be administered to a patient before, concomitantly, before and after, or after a second active agent is administered. The agents may in an embodiment be combined/formulated in a single composition and thus administered at the same time. In an embodiment, the one or more active agent(s) of the present invention is used/administered in combination with one or more agent(s) currently used to prevent or treat the disorder in question (e.g., a vaccine, an antiviral drug, an agent that stimulates the immune response). In embodiments, the methods of the invention comprise administering pharmaceutical compositions (medicaments) that comprise one or more active agent(s) of the present invention (e.g., an agent capable of inhibiting expression of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3), an agent capable of inhibiting the activity of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3)). The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier or excipient. As used herein "pharmaceutically acceptable carrier" or "excipient" includes any and all solvents, buffers, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. The carrier can be suitable, for example, for intravenous, parenteral, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intrathecal, epidural, intracisternal, intraperitoneal, intranasal or pulmonary (e.g., aerosol) administration.
Therapeutic formulations may be in the form of liquid solutions or suspension; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols.
Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of active agent(s)/composition(s) suspended in diluents, such as water, saline or PEG 400; (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin; (c) suspensions in an appropriate liquid; and (d) suitable emulsions. Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn starch, potato starch, microcrystalline cellulose, gelatin, colloidal silicon dioxide, talc, magnesium stearate, stearic acid, and other excipients, colorants, fillers, binders, diluents, buffering agents, moistening agents, preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically compatible carriers. Lozenge forms can comprise the active ingredient in a flavor, e.g., sucrose, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art. Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for compounds/compositions of the invention include ethylenevinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, (e.g., lactose) or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel. For preparing pharmaceutical compositions from the compound(s)/composition(s) of the present invention, pharmaceutically acceptable carriers are either solid or liquid. Solid form preparations include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules. A solid carrier can be one or more substance, which may also act as diluents, flavoring agents, binders, preservatives, tablet disintegrating agents, or an encapsulating material.
In powders, the carrier is a finely divided solid, which is in a mixture with the finely divided active component. In tablets, the active component is mixed with the carrier having the necessary binding properties in suitable proportions and compacted in the shape and size desired. The powders and tablets may typically contain from 5% or 10% to 70% of the active compound/composition. Suitable carriers are magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, cocoa butter, and the like. The term "preparation" is intended to include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it. Similarly, cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be used as solid dosage forms suitable for oral administration.
Liquid form preparations include solutions, suspensions, and emulsions, for example, water or water/propylene glycol solutions. For parenteral injection, liquid preparations can be formulated in solution in aqueous polyethylene glycol solution.
Aqueous solutions suitable for oral use are prepared by dissolving the active compound(s)/composition(s) in water and adding suitable colorants, flavors, stabilizers, and thickening agents as desired. Aqueous suspensions suitable for oral use can be made by dispersing the finely divided active component in water with viscous material, such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, and other well-known suspending agents. Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is well known in the art (Rowe et al., Handbook of pharmaceutical excipients, 2003, 4th edition, Pharmaceutical Press, London UK). Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the invention is contemplated.
The composition may also contain more than one active compound for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. It may be desirable to use the above-mentioned composition in addition to one or more agents currently used to prevent or treat the disorder in question (e.g., an antiviral agent, a vaccine, an immunostimulating agent). The above-mentioned agents may be formulated in a single composition or in several individual compositions which may be coadministered in the course of the treatment.
Formulations to be used for in vivo administration are preferably sterile. This is readily accomplished, for example, by filtration through sterile filtration membranes. The amount of the pharmaceutical composition (e.g., an agent capable of inhibiting expression of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3), an agent capable of inhibiting the activity of a 4E-BP (4E-BP1 , 4E-BP2 and/or 4E-BP3)) which is effective for inducing or enhancing the immune response and/or in the prevention and/or treatment of a particular disease, disorder or condition (e.g., viral infection and/or viral-related disease) will depend on the nature and severity of the disease/condition, the chosen prophylactic/therapeutic regimen (i.e., compound, DNA construct, protein, cells), the target site of action, the patient's weight, special diets being followed by the patient, concurrent medications being used, the administration route and other factors that will be recognized by those skilled in the art. The dosage will be adapted by the clinician in accordance with conventional factors such as the extent of the disease and different parameters from the patient. Typically, 0.001 to 1000 mg/kg of body weight/day will be administered to the subject. In an embodiment, a daily dose range of about 0.01 mg/kg to about 500 mg/kg, in a further embodiment of about 0.1 mg/kg to about 200 mg/kg, in a further embodiment of about 1 mg/kg to about 100 mg/kg, in a further embodiment of about 10 mg/kg to about 50 mg/kg, may be used. The dose administered to a patient, in the context of the present invention should be sufficient to effect a beneficial prophylactic and/or therapeutic response in the patient over time. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration. Effective doses may be extrapolated from dose response curves derived from in vitro or animal model test systems. For example, in order to obtain an effective mg/kg dose for humans based on data generated from rat studies, the effective mg/kg dosage in rat may be divided by six.
The terms "treat/treating/treatment" and "prevent/preventing/prevention" as used herein, refers to eliciting the desired biological response, i.e., a therapeutic and prophylactic effect, respectively. In accordance with the subject invention, the therapeutic effect comprises one or more of a decrease/reduction in viral load (viremia), a control or stabilization of the viral load, an amelioration of symptoms and viral-related effects, and increased survival time of the affected host animal, following administration of an agent that inhibit 4E-BP expression and/or activity. In embodiments, the decrease in viral load or viremia may be, for example, a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or 100% (i.e., complete elimination of the virus) decrease in viremia. In accordance with the invention, a prophylactic effect may comprise a decrease in the onset of or of the severity of one or more of viral load or viremia, symptoms and parasite-related effects, and increased survival time of the affected host animal, following administration of an agent that inhibit 4E-BP expression and/or activity. As such, a "therapeutically effective" or "prophylactically effective" amount of an agent that inhibit 4E-BP expression and/or activity, or any combinations thereof, may be administered to an animal, in the context of the methods of treatment and prevention, respectively, described herein.
In an embodiment, the herein-mentioned immune response is an innate immune response. As used herein, "innate immune response" or "innate immunity" generally refers to the early immune response induced in a host by a foreign organism (e.g., viruses, bacteria, parasites) and which precedes (or do not involve) the clonal expansion of antigen-specific lymphocytes (T and B lymphocytes). "Inducing or enhancing an innate immune response" thus refers to the induction or activation of one or more of the biological mechanisms involved in the innate immune response, such as phagocytosis, expression of chemokines, expression of cytokines, etc. In an embodiment, the above-mentioned innate immune response involves the activation of a Toll-like receptor (TLR) pathway, such as a TLR3 pathway, in a cell. In another embodiment, the above-mentioned innate immune response is the innate immune response to a viral infection, such as the innate immune response triggered by double-stranded RNA (dsRNA). In an embodiment, the above-mentioned biological mechanism is the expression of interferons (IFNs), such as type-l IFNs (IFNα and/or IFNβ).
In another aspect, the present invention also provides a kit or package comprising the above-mentioned agent or pharmaceutical compositions. Such kit may further comprises, for example, instructions (e.g., for the prevention and/or treatment of viral infection, and/or for inducing/increasing an immune response), containers, devices for administering the agent/composition, etc.
Having shown that low 4E-BP expression/activity is associated with increased resistance (or lower susceptibility) to viral infections and higher innate immunity, the present invention further provides a method (e.g., an in vivo or in vitro method) of identifying a compound for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said method comprising determining whether:
(a) a level of expression of a 4E-BP nucleic acid or encoded polypeptide; (b) a level of 4E-BP activity; or
(c) both (a) and (b), is decreased in the presence of a test compound relative to in the absence of said test compound, wherein said decrease is indicative that said test compound can be used for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection, or (iii) both (i) and (ii).
The present invention also provides a method (e.g., an in vivo or in vitro method) of identifying or characterizing a compound for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said method comprising:
(a) contacting a test compound with a cell comprising a first nucleic acid comprising a transcriptionally regulatory element normally associated with a 4E-BP gene, operably linked to a second nucleic acid comprising a reporter gene capable of encoding a reporter protein; and
(b) determining whether reporter gene expression or reporter protein activity is decreased in the presence of said test compound; wherein a decrease in said reporter gene expression or reporter protein activity is indicative that said test compound may be used for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection, or (iii) both (i) and (ii).
The level of 4E-BP activity may be measured, for example, by measuring the level expression of a gene whose expression is modulated or controlled by 4E-BP activity, such as the genes listed in Fig. 11 (i.e., genes which are up-regulated in 4E-BP1/2 DKO cells). For example, a decreased 4E-BP activity may be detected by an increase in the expression of one or more gene(s) whose expression is/are directly or indirectly controlled through 4E-BP activity, such as IRF-7, RIG-1 and MDA5.
Expression levels of 4E-BP may be detected by either detecting nucleic acids (e.g., mRNA) from the cells and/or detecting expression products, such as polypeptides and proteins. Expression of the transcripts and/or proteins encoded by the nucleic acids described herein may be measured by any of a variety of known methods in the art. In general, the nucleic acid sequence of a nucleic acid molecule {e.g., DNA or RNA) in a patient sample can be detected by any suitable method or technique of measuring or detecting gene sequence or expression. Such methods include, but are not limited to, polymerase chain reaction (PCR), reverse transcriptase- PC R (RT-PCR), in situ PCR, quantitative PCR (q-PCR), in situ hybridization, Southern blot, Northern blot, sequence analysis, microarray analysis, detection of a reporter gene, or other DNA/RNA hybridization platforms. For RNA expression, preferred methods include, but are not limited to: extraction of cellular mRNA and Northern blotting using labeled probes that hybridize to transcripts encoding all or part of a 4E-BP gene; amplification of mRNA expressed from a 4E-BP gene using gene-specific primers, polymerase chain reaction (PCR), quantitative PCR (q-PCR), and reverse transcriptase-polymerase chain reaction (RT- PCR), followed by quantitative detection of the product by any of a variety of means; extraction of total RNA from the cells, which is then labeled and used to probe cDNAs or oligonucleotides encoding all or part of a 4E-BP gene, arrayed on any of a variety of surfaces; in situ hybridization; and detection of a reporter gene. The term "quantifying" or "quantitating" when used in the context of quantifying transcription levels of a gene can refer to absolute or to relative quantification. Absolute quantification may be accomplished by inclusion of known concentration(s) of one or more target nucleic acids and referencing the hybridization intensity of unknowns with the known target nucleic acids (e.g., through generation of a standard curve). Alternatively, relative quantification can be accomplished by comparison of hybridization signals between two or more genes, or between two or more treatments to quantify the changes in hybridization intensity and, by implication, transcription level.
Methods that may be used to measure 4E-BP protein expression levels, include, but are not limited to: Western blot, immunoblot, enzyme-linked immunosorbant assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, surface plasmon resonance, chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical analysis, matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, microcytometry, microarray, microscopy, fluorescence activated cell sorting (FACS), flow cytometry, and assays based on a property of the protein including but not limited to DNA binding, ligand binding, or interaction with other protein partners.
Methods for normalizing the level of expression of a gene are well known in the art. For example, the expression level of a gene of the present invention can be normalized on the basis of the relative ratio of the mRNA level of this gene to the mRNA level of a housekeeping gene or the relative ratio of the protein level of the protein encoded by this gene to the protein level of the housekeeping protein, so that variations in the sample extraction efficiency among cells or tissues are reduced in the evaluation of the gene expression level. A "housekeeping gene" is a gene the expression of which is substantially the same from sample to sample or from tissue to tissue, or one that is relatively refractory to change in response to external stimuli. A housekeeping gene can be any RNA molecule other than that encoded by the gene of interest that will allow normalization of sample RNA or any other marker that can be used to normalize for the amount of total RNA added to each reaction. For example, the GAPDH gene, the G6PD gene, the ACTIN gene, ribosomal RNA, 36B4 RNA, PGK1 , RPLPO, or the like, may be used as a housekeeping gene.
Methods for calibrating the level of expression of a gene are well known in the art. For example, the expression of a gene can be calibrated using reference samples, which are commercially available. Examples of reference samples include, but are not limited to: Stratagene® QPCR Human Reference Total RNA, Clontech™ Universal Reference Total RNA, and XpressRef™ Universal Reference Total RNA.
The above-mentioned methods may be employed either with a single test compound or a plurality or library [e.g., a combinatorial library) of test compounds. In the latter case, synergistic effects provided by combinations of compounds may also be identified and characterized. The above-mentioned compounds may be used for enhancing an immune response and/or for the prevention and/or treatment of a viral infection, or may be used as lead compounds for the development and testing of additional compounds having improved specificity, efficacy and/or pharmacological (e.g., pharmacokinetic) properties. In an embodiment the compound may be a prodrug which is altered into its active form at the appropriate site of action, (e.g., a cell, tissue or organ affected by a viral infection). In certain embodiments, one or a plurality of the steps of the screening/testing methods of the invention may be automated.
Such assay systems may comprise a variety of means to enable and optimize useful assay conditions. Such means may include but are not limited to: suitable buffer solutions, for example, for the control of pH and ionic strength and to provide any necessary components for optimal 4E-BP activity and stability (e.g. protease inhibitors), temperature control means for 4E-BP activity and or stability, and detection means to enable the detection of a 4E-BP activity reaction product. A variety of such detection means may be used, including but not limited to one or a combination of the following: radiolabelling (e.g., 32P, 14C, 3H), antibody- based detection, fluorescence, chemiluminescence, spectroscopic methods (e.g., generation of a product with altered spectroscopic properties), various reporter enzymes or proteins (e.g., horseradish peroxidase, green fluorescent protein), specific binding reagents (e.g. biotin/(strept)avidin), and others.
The assay may be carried out in vitro utilizing a source of 4E-BP which may comprise naturally isolated or recombinantly produced 4E-BP, in preparations ranging from crude to pure. Recombinant 4E-BP may be produced in a number of prokaryotic or eukaryotic expression systems, which are well known in the art. Such assays may be performed in an array format.
As noted above, the invention further relates to methods for the identification and characterization of compounds capable of decreasing 4E-BP gene expression. Such a method may comprise assaying 4E-BP gene expression in the presence versus the absence of a test compound. Such gene expression may be measured by detection of the corresponding RNA or protein, or via the use of a suitable reporter construct comprising one or more transcriptional regulatory element(s) normally associated with a 4E-BP gene, operably-linked to a reporter gene (e.g., a gene whose level of expression may be measured, for example a gene encoding a fluorescent protein (such as GFP) or encoding a protein having an enzymatic activity (e.g., using a detectable substrate) such as alkaline phosphatase or β-galactosidase.
A first nucleic acid sequence is "operably-linked" with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably-linked to a coding sequence if the promoter affects the transcription or expression of the coding sequences. Generally, operably-linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in reading frame. However, since, for example, enhancers generally function when separated from the promoters by several kilobases and intronic sequences may be of variable lengths, some polynucleotide elements may be operably-linked but not contiguous. "Transcriptional regulatory element" is a generic term that refers to DNA sequences, such as initiation and termination signals, enhancers, and promoters, splicing signals, polyadenylation signals which induce or control transcription of protein coding sequences with which they are operably-linked. The expression of such a reporter gene may be measured on the transcriptional or translational level, e.g., by the amount of RNA or protein produced. RNA may be detected by for example Northern analysis or by the reverse transcriptase-polymerase chain reaction (RT-PCR) method (see for example Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA).
Having shown that low 4E-BP expression/activity is associated with increased resistance (or lower susceptibility) to viral infections and higher innate immunity, the present invention further provides a method (e.g., an in vivo or in vitro method) for diagnosing viral infection or disease or susceptibility thereto, in a subject, the method comprising (a) determining in a biological sample from said subject:
(i) a level of expression of a 4E-BP nucleic acid or encoded polypeptide;
(ii) a level of 4E-BP activity; or (iii) both (i) and (ii); (b) comparing said level to a corresponding reference level; and
(c) diagnosing said viral infection or disease or susceptibility thereto in accordance with said comparison.
A "reference" or "control" level may be determined, for example, by measuring the level of expression of a 4E-BP nucleic acid or encoded polypeptide, or the level of 4E-BP activity, in a corresponding biological sample obtained from one or more healthy subject(s) (i.e., not suffering from viral infection or disease) known not to be susceptible to (or to be resistant to) viral infection or disease. When such a control level is used, a higher or increased level measured in a biological sample from a subject (i.e., test sample) is indicative that said subject is suffering from or is susceptible to viral infection or disease, whereas a substantially similar level is indicative that said subject is not suffering from or is not susceptible to parasite infection or disease.
Alternatively, a "reference" level may be determined, for example, by measuring the level of expression of a 4E-BP nucleic acid or encoded polypeptide, or the level of 4E-BP activity, in a biological sample obtained from one or more subject(s) known to be suffering from or susceptible to viral infection or disease. When such a reference level is used, a substantially similar level measured in a biological sample from a subject (i.e., test sample) is indicative that said subject is suffering from or is susceptible to viral infection or disease, whereas a lower or decreased level is indicative that said subject is not suffering from or is not susceptible to parasite infection or disease.
As used herein, a substantially similar level refers to a difference in the level of expression or activity between the level determined in a biological sample of a given subject (i.e., test sample) and the reference level which is 20% or less; in a further embodiment, 15% or less; in a further embodiment, 10% or less; in a further embodiment, 5% or less.
As used herein, a "higher" or "increased" level refers to a level of expression or activity in a biological sample of a given subject (i.e., test sample) which is at least 20% higher, in an embodiment at least 30% higher, in a further embodiment at least 40% higher; in a further embodiment at least 50% higher, in a further embodiment at least 100% higher (i.e., 2-fold), in a further embodiment at least 200% higher (i.e., 3-fold), in a further embodiment at least 300% higher (i.e., 4-fold), relative to the reference level.
As used herein, a "lower" or "decreased" level refers to a level of expression or activity in a biological sample of a given subject (i.e. test sample) which is at least 20% lower, in an embodiment at least 30% lower, in a further embodiment at least 40% lower; in a further embodiment at least 50% lower, in a further embodiment at least 100% lower (i.e., 2-fold), in a further embodiment at least 200% lower (i.e., 3-fold), in a further embodiment at least 300% lower (i.e., 4-fold), relative to the reference level.
The present invention provides kits or packages for diagnosing viral infection or disease or susceptibility thereto in a subject, the kit comprising means for determining in a biological sample from said subject:
(a) a level of expression of a 4E-BP nucleic acid or encoded polypeptide;
(b) a level of 4E-BP activity; or (C) both (a) and (b); together with instructions for correlating said level with viral infection or disease or susceptibility thereto.
Kits for evaluating expression of nucleic acids can include, for example, probes or primers that specifically bind a nucleic acid of interest (e.g., a 4E-BP nucleic acid). The kits for evaluating nucleic acid expression can provide substances useful as standard (e.g., a sample containing a known quantity of a nucleic acid which may be used as a reference level and to which test results can be compared, with which one can assess factors that may alter the readout of a diagnostic test, such as variations in an enzyme activity or binding conditions). Kits for assessing nucleic acid expression can further include other reagents useful in assessing levels of expression of a nucleic acid (e.g., buffers and other reagents for performing PCR reactions, or for detecting binding of a probe to a nucleic acid).
In addition to, or as an alternative, kits can include reagents for detecting polypeptides/proteins (e.g., antibodies) and, for example, a standard (e.g., a sample containing a known quantity of a polypeptide, which may be used as a reference level to which test results can be compared). The kits can provide instructions for performing the assay used to evaluate gene expression instructions for determining susceptibility to viral infection or disease based on the results of the assay. For example, the instructions can indicate that levels of expression of a gene of interest {e.g., a 4E-BP gene), relative to a standard or a control, correlate with increased or decreased susceptibility to viral infection or disease. Kits can also provide instructions, containers, computer readable media (comprising, for example, a data analysis program, a reference standard, etc.), control samples, and other reagents for obtaining and processing samples for analysis. In general, typical biological samples include, but are not limited to, sputum, serum, lymphatic fluid, blood, plasma, tissue or fine needle biopsy samples, urine, peritoneal fluid, colostrums, breast milk, fetal fluid, tears, and pleural fluid, or cells therefrom {e.g., blood cells, such as peripheral blood mononuclear cells).
In an embodiment, the above-mentioned subject is a mammal. A mammal, including for purposes of treatment, prevention or diagnosis, refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports or pet animals such as dogs, horses, cats, cows etc. In an embodiment, the mammal is human.
In further embodiments, the invention relates to nucleic acid(s) which is substantially identical or substantially complementary (e.g., for hybridization under suitable conditions) to a nucleic acid sequence selected from nucleic acid sequences among SEQ ID NOs: 1-40, a complement thereof, or a portion thereof, in the methods, products, uses, kits and agents described herein. In further embodiments, the invention relates to a polypeptide which is substantially identical to a polypeptide comprising an amino acid sequence selected from amino acid sequences among SEQ ID NOs: 1-40, or a fragment thereof, in the methods, products, uses, kits and agents described herein. For example, a polypeptide which is substantially identical to a 4E-BP polypeptide and retains 4E-BP function, or a fragment thereof which retains 4E-BP function, may be used in the methods of the invention. As a further example, a nucleic acid which encodes a polypeptide which is substantially identical to a 4E-BP polypeptide and retains 4E-BP function, or a fragment thereof which retains 4E-BP function, may be used in the methods of the invention.
"Homology" and "homologous" refers to sequence similarity between two polypeptides or two nucleic acid molecules. Homology can be determined by comparing each position in the aligned sequences. A degree of homology between nucleic acid or between amino acid sequences is a function of the number of identical or matching nucleotides or amino acids at positions shared by the sequences. As the term is used herein, a nucleic acid or polypeptide sequence is "homologous" to another sequence if the two sequences are substantially identical and the functional activity of the sequences is conserved (as used herein, the term 'homologous' does not infer evolutionary relatedness). Two nucleic acid or polypeptide sequences are considered "substantially identical" if, when optimally aligned (with gaps permitted), they share at least about 50% sequence similarity or identity and/or if the sequences share defined functional motifs. In alternative embodiments, sequence similarity in optimally aligned substantially identical sequences may be at least 60%, 70%, 75%, 80%, 85%, 90% or 95%. As used herein, a given percentage of homology between sequences denotes the degree of sequence identity in optimally aligned sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, though preferably less than about 25 % identity, with a nucleic acid sequence or polypeptide amino acid sequence described herein, e.g., any of SEQ ID NOs: 1-33. "Substantially complementary" nucleic acids are nucleic acids in which the complement of one molecule is substantially identical to the other molecule.
Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms, such as the local homology algorithm of Smith and Waterman, 1981 , Adv. Appl. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J. MoI. Biol. 48:443, the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85: 2444, and the computerised implementations of these algorithms (such as GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Madison, Wl, U.S.A.). Sequence identity may also be determined using the BLAST algorithm, described in Altschul et al., 1990, J. MoI. Biol. 215:403-10 (using the published default settings). Software for performing BLAST analysis may be available through the National Center for Biotechnology Information (through the internet at http://www.ncbi.nlm.nih.gov/). The BLAST algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold. Initial neighbourhood word hits act as seeds for initiating searches to find longer HSPs. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction is halted when the following parameters are met: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program may use as defaults a word length (W) of 11 , the BLOSUM62 scoring matrix (Henikoff and Henikoff, 1992, Proc. Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10 (or 1 or 0.1 or 0.01 or 0.001 or 0.0001), M=5, N=4, and a comparison of both strands. One measure of the statistical similarity between two sequences using the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. In alternative embodiments of the invention, nucleotide or amino acid sequences are considered substantially identical if the smallest sum probability in a comparison of the test sequences is less than about 1 , preferably less than about 0.1 , more preferably less than about 0.01 , and most preferably less than about 0.001.
An alternative indication that two nucleic acid sequences are substantially complementary is that the two sequences hybridize to each other under moderately stringent, or preferably highly stringent, conditions. Hybridisation to filter-bound sequences under moderately stringent conditions may, for example, be performed in 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and washing in 0.2 x SSC/0.1% SDS at 420C (see Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1 , Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3). Alternatively, hybridization to filter-bound sequences under high stringency conditions may, for example, be performed in 0.5 M NaHPO4, 7% SDS, 1 mM EDTA at 65CC, and washing in 0.1 x SSC/0.1% SDS at 68°C (see Ausubel, et al. (eds), 1989, supra). Hybridization conditions may be modified in accordance with known methods depending on the sequence of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York). Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
Although various embodiments of the invention are disclosed herein, many adaptations and modifications may be made within the scope of the invention in accordance with the common general knowledge of those skilled in this art. Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way. Numeric ranges are inclusive of the numbers defining the range. In the claims, the word "comprising" is used as an open-ended term, substantially equivalent to the phrase "including, but not limited to". The articles "a," "an" and "the" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. The following examples are illustrative of various aspects of the invention, and do not limit the broad aspects of the invention as disclosed herein.
MODE(S) FOR CARRYING OUT THE INVENTION
The present invention is illustrated in further details by the following non-limiting examples.
Example 1 : Materials and Methods Mice and Cell Culture. 4E-BP1 and 4E-BP2 KO mice were previously described (Banko JL et al., J Neurosci. 2005, 25(42): 9581-90; Tsukiyama-Kohara K et al., Nat Med. 2001, 10: 1128-32). Single knockout mice were backcrossed for 10 generations to inbred Balb/c mice (Charles River Laboratories). To generate 4E-BP1 and 4E-BP2 DKO mice, heterozygous mice were intercrossed. MEFs derived from WT and 4E-BP1/2 DKO mice were immortalized by sequential passaging. MEFs were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and antibiotics. All experiments were performed at least three times and repeated with independently derived MEFs. Splenic pDCs were isolated using anti-mPDCA1 (murine plasmacytoid dendritic cell antigen-1) magnetic beads according to the manufacturer's instructions (Miltenyi Biotech). The IFN neutralization experiment was performed using a monoclonal antibody against mouse IFNβ according to the manufacturer's procedure (PBL Biomedical Laboratories).
Viruses. The Indiana serotype of VSV was previously described (Stojdl DF et al., Nat Med. 2000, 7: 821-5). Other viruses used in the studies described herein include: Influenza virus A/HK/1/68-MA20 (Brown et al., Proc. Natl. Acad. Sci. USA 98(12): 6883-6888), EMCV K-2 (Svitkin, Y. V. et al. (1974) Intervirology 4: 214-220), Sindbis virus (Berlanga et al. (2006) EMBO Journal, 25(8): 1730-1740), Myxoma virus (Lun X et al., Cancer Res. 2005, 65(21): 9982-90), HSV-1 (Sanchez R and Mohr I1 J Virol. 2007, 81(7): 3455-64) and HIV-1 (Finzi A et al., J Virol. 2007, 81(14): 7476-90). EMCV, Sindbis virus and VSV were propagated in BHK21 cells. Ex-vivo virus infection and metabolic labeling were performed as described (Costa-Mattioli, M. et al., MoI. Cell. Biol. 2004, 24: 6861-6870). Virus titers were determined by a standard plaque assay method. For in vivo experiments, mice were infected intranasally (i.n.) with VSV and sacrificed 5 days post-infection. Lungs were aseptically removed and snap-frozen in liquid nitrogen. Specimens were homogenized in 3 ml of PBS on ice, and titers were determined in BHK21 cells.
RT-PCR and RNA extractions. Total RNA was extracted using Trizol™ reagent (Invitrogen) according to the manufacturer's instructions. Total RNA (1 microgram) was reverse transcribed (RT) with Superscript™ III reverse transcriptase (Invitrogen) for 1 h at 500C using oligodT. One microliter (μl) of RT template was incubated with specific primers (described below) and with Taq Polymerase (Fermentas) according to the manufacturer's instructions. The number of PCR cycles ranged from 23 to 34 depending on the linearity of the reaction. The PCR primers used were the following (5' to 3'): IFNα-sense (CCTTCCACAGGATCACTGTGTACCT; SEQ ID NO: 1), IFNα-antisense (TTCTGCTCTGACCACCTCCC; SEQ ID NO: 2), IFNβ-sense (CACAG CCCTCTCCATCAACT; SEQ ID NO: 3), IFNβ-antisense (TCCCACGTCAATCTTTCCTC; SEQ ID NO: 4), IRF7-sense (ATGATGGTCACATCCAGGAACCC; SEQ ID NO: 5), IRF7 antisense (TCAGGTCTGCAGTACAGCCACAT; SEQ ID NO: 6); β-actin-sense (GGACTCCTATGTGGGTGACGAGG; SEQ ID NO: 7); β-actin-antisense (GGGAGAGCATAGCCCTCGTAGAT; SEQ ID NO: 8).
Polysome profiling. MEFs were washed twice with cold PBS containing 100 μg/ml cycloheximide, suspended in lysis buffer (5 mM Tris-HCI, pH 7.5, 2.5 mM MgCb, 1.5 mM KCI, 100 μg/ml cycloheximide, 2 mM DTT, 0.5% Triton™ X-100, and 0.5% sodium deoxycholate), and centrifuged for 2 miπ at 14,00Og (Eppendorf™ centrifuge). The supernatant was loaded onto a 10-50% sucrose gradient prepared in 20 mM HEPES™-KOH, pH 7.6, 100 mM KCI, and 5 mM MgCI2 and centrifuged at 35,000 rpm for 2 h at 4°C in an SW40™ rotor. Fractions were collected by piercing the tube with a Brandel™ tube piercer, passing 60% sucrose through the bottom of the tube, followed by monitoring the absorbance using an ISCO™ UA-6 UV Detector. RNA was isolated from individual fractions using Trizol™ reagent (Invitrogen).
Microarray analysis. Total RNA or polysomal RNA was isolated from WT and 4E- BP1/2 DKO MEFs using Trizol™. RNA samples were purified using the Qiagen RNeasy™ kit (according to the manufacturer's instructions, Qiagen, Mississauga, Ontario, Canada) followed by sodium acetate/ethanol precipitation. Twenty micrograms of each RNA sample were processed according to manufacturer's protocol (Affymetrix, Santa Clara, CA) and hybridized to an Affymetrix™ Mouse430_2 chip. Primary image analysis of the arrays was performed using the Genechip™ 3.2 software package (Affymetrix, Santa Clara, CA). The data was normalized using Robust Multichip Averaging (RMA) (REF: PMIO: 12582260) using updated probe set definitions "REFSEQ_8" (REF: PMIO: 16284200, PMIO: 17288599). RMA leads to a reduced dynamic range of obtained fold changes and hence a moderate threshold was used. To identify genes up-regulated in 4E-BP1/2 DKO MEFs, total RNA samples were analyzed using normalization that reduced the range for the fold change (>1.5 fold used as threshold). Translationally up-regulated genes were identified by selecting genes whose regulation in total RNA samples was low < 1.5 fold), but their abundance on polysomes was > 4 fold (by calculating the ratio between the translational microarray and the total gene expression microarray and then comparing between 4E-BP1/2 DKO and WT MEFs). Genes that were related to inflammation or IFN responses were identified manually using information from the Gene Ontology Consortium (REF: PMIO: 16381878).
Western Blot analysis. MEFs were homogenizated in Buffer A (50 mM Tris-HCI, pH 7.4,100 mM NaCI, 1% Triton™ X-100, 1 mM EDTA, 1 mM DTT, protease inhibitors cocktail (Roche), 20 mM β-glycerophosphate, 0.25 mM Na3VO4, 10 mM NaF, 10 nM okadaic acid, 1 mM PMSF), and incubated for 30 min at 40C. Cell debris was removed by centrifugation at 10,000g (Eppendorf centrifuge) for 10 min at 4°C and total protein content was determined using a Bio- Rad™ assay. Laemmli sample buffer was added to the supernatant, which was subjected to 15% SDS-PAGE. Proteins were transferred onto a nitrocellulose membrane, which was blocked for 2h at room temperature with 5% skim milk in PBS containing 0.2% Tween™ 20 (PBS-T) and washed twice with PBS-T. The membrane was incubated overnight at 4°C with primary antibodies followed by three 10-min washes in PBS-T and further incubated with peroxidase- coupled secondary antibody for 30 min at room temperature, and washed three times. Detection of peroxidase-coupled secondary antibody was performed with ECL™ (GE-Healthcare). RIG-I and MDA5 antibodies were kindly provided by H. Kato (Kato H et at., Nature 2006, 441(7089): 101-5). IRF-7 antibody was purchased from Santa Cruz Biotechnology.
ELISA. MEFs were transfected with poly(hC) using FuGENE™ 6 transfection reagent (Roche) according to the manufacturer's protocol. Cultured medium was recovered at 3h and 6h post-transfection. Murine IFNα and IFNβ production was detected in the cultured medium by ELISA according to the manufacturer's procedure (PBL Biomedical Laboratories).
Plasmid Construction, Transfection and Luciferase Assay. A 411 bp DNA corresponding to the 5'UTR of mouse IRF-7 mRNA was amplified by PCR from MEF genomic DNA. HinάW and Λ/col restriction sites were added to the 5' and 3' ends, respectively. Using the same restriction sites, the IRF-7 5'UTR was cloned into the pGL3™ firefly luciferase (Flue) reporter vector (Promega). MEFs were co-transfected with 500 ng of 5'UTR-IRF-7-FLuc and 100 ng of Renilla luciferase (Rluc; Promega) in 24-well plates using Lipofectamine™ 2000 as described. Cell extracts were prepared in Passive lysis buffer (Promega) 2Oh after transfection and assayed for RLuc and FLuc activity in a Lumat™ LB9507 bioluminometer (EG&G Bertold) using a dual-luciferase reporter assay system (Promega), according to the manufacturer's instructions. Flue activity was normalized against Rluc activity, which was used as a transfection control.
Rescue experiments. pBABE-4E-BP1 , PBABE-4E-BP2 and empty vector constructs were transfected into phoenix-293-T packaging cells. After 48h, virus-containing medium was filtered, collected and used to infect 4E-BP1/2 DKO MEFs in the presence of 5 mg/ml of polybrene (Sigma-Aldrich). Cells were re-infected the next day and supplemented with puromycin (2 μg/ml, Sigma-Aldrich) for selection for five days. shRNA against IRF-7. 4E-BP1/2 DKO MEFs were transfected with PLKO.1-puro- Ctrl-shRNA (Origene; CAACAAGATGAAGAGCACCAA; SEQ ID NO: 9) or PLKO.1-puro- /f?F7- shRNA (Origene; GTCACCACACTACACCATCTA; SEQ ID NO: 10) as described. Next, transfected-MEFs were selected with puromycin for 1 week and colonies were picked up. shRNA against 4E-BP1 and 4E-BP2. Sequence-verified shRNA lentiviral plasimids for 4E-BP1 and 4E-BP2 gene silencing in mammalian cells were obtained from Sigma's MISSION™ shRNA. The plasmid pLKO.1<-puro 4E-BP1 shRNA (CCGGGCCAGGCCTTATGAAAGTGATCTCGAGATCACTTTCAT AAGGCCTGGCTTTTTG;
SEQ ID NO: 11) [product number: SHDNAC-TRCN0000030203] and 4E-BP2 (CCGGGCTGTATTTCTGTAGAGCTAACTCGAGTTAGCTCTACAGAAATACAGC I I I I I G; SEQ ID NO: 12) [product number SHDNAC-TRCN00001 17812] were used to generate lentiviral transduction particles in packaging cells (HEK293T) by co-transfection with compatible packaging plasmids. Lentiviral containing mediums were filtered and used directly to transduce the different cell lines. Transduction was performed in 6-well plates by addition of 1 ml of medium containing lentiviruses carrying shRNA sequences against 4E-BP1 , 4E-BP2, or both, twice at 24h interval. After transduction, stable cell lines expressing the shRNA were selected with puromycin for 5 days and the efficiency of knockdown was evaluated by Western blotting. siRNA synthesis. Standard conditions for solid-phase oligonucleotide synthesis were used for the synthesis of all oligonucleotides, 1.0 μmol scale. 5-ethylthiotetrazole (0.25 M in acetonitrile) was used as an activator, and 0.10 M iodine in 1 :2:10 pyridine:water:THF was used as oxidant (wait time during the oxidation step was 24 seconds). Phosphoramidites were prepared as 0.15 M solutions (RNA amidites) or 0.08-0.15 M solutions (DNA, 2'-fluoro amidites). Coupling times were extended to 10-30 minutes for modified nucleotides. Cyanoethyl groups were removed with 3:1 Triethylamine:ACN solution following synthesis. The oligonucleotides were treated with 3:1 ammonium hydroxide:ethanol for 48 h at 23 0C to cleave them from the solid support and deprotect the bases. Sequences containing ribonucleotides were concentrated and desilylated with Et3N»3HF (100 μl_) for 48 h at room temperature. Sequence purification was accomplished by preparative denaturing PAGE. Desalting was effected on NAP-25 columns. Sequence purity was verified using denaturing PAGE and mass spectroscopy. 5'-phosphorylation of oligonucleotides was generally accomplished on the CPG solid support, by treating the newly-synthesized oligonucleotide with bis(2-cyanoethyl)- diisopropylaminophosphoramidite and ethylthiotetrazole, followed by normal deprotection conditions. In all cases, ESI-MS was used to confirm the success of the phosphorylation reaction. The sequences of the siRNAs used herein are provided in Table I.
Table I: Sequences of the siRNAs used in the experiments described herein
Figure imgf000034_0001
Figure imgf000035_0001
Uppercase = RNA Lowercase = DNA Bold underline = FANA (2'F ANA) Bold italic = 2'F RNA p = 5'-Phosphate
Assessment of IFN production using the HEK-Blue™ IFN detection assay. 48 hours after siRNA transfection, cells were left untreated or treated with 1 ug/ml of poly(l:C) for 24 hours. The amount of IFN in the supernatant was measured according to the manufacturer's instructions (InvivoGen). Briefly, supernatants were mixed with HEK-Blue™ cells that carry a reporter gene expressing a secreted alkaline phosphatase under the control of the interferon stimulated response element 9 (ISRE9) promoter. In response to IFN exposure, the HEK-Blue™ cells release soluble alkaline phosphatase that is quantified by mixing the supernatant with Quanti Blue™ (InvivoGen) reagent and measuring the absorbance at 650 nm.
Example 2: Virus infection is suppressed in 4E-BP1/2 DKO MEFs.
To study the role of 4E-BPs in the cell's response to virus infection ex-vivo, MEFs derived from 4E-BP1 and 4E-BP2 double knockout (DKO) and wild-type (WT) mice were used. The 4E-BP1/2 DKO MEFs lack all three 4E-BPs, since 4E-BP3 is not expressed in MEFs. MEFs were first infected with VSV (rhabdovirus, negative strand RNA virus) at a multiplicity of infection (MOI) of 0.5 plaque forming units (PFU)/cell and viral protein synthesis was analyzed by pulse labeling with [35S]methionine at various times post-infection (p.i). In WT MEFs, synthesis of VSV proteins was first detected at 4h p.i. (Fig. 1A). Strikingly, in 4E-BP1/2 DKO MEFs, no viral proteins were detected at this, or even later time points (Fig. 1A). Western blot analysis over the time-course of infection demonstrated a robust expression of VSV proteins in WT MEFs, but not in 4E-BP1/2 DKO MEFs (Fig. 1B). VSV-induced cytopathic effect (ePE) evaluated at 1 Oh p.i. was observed only in WT MEFs (Fig. 1C). The lack of 4E-BPs resulted in reduced (~700-fold) virus titers, as assayed on BHK21 cell monolayers (Fig. 1 D). These data demonstrate that removing 4E-BPs inhibits VSV propagation.
When MEFs were infected at a higher MOI (5 PFU/cell), the difference in the kinetics of VSV replication in WT and DKO MEFs was less pronounced than with a low MOI. In WT MEFs, [35S]methionine-labeled VSV proteins were first detected as early as 2h p.i., as compared to 4h p.i. in 4E-BP1/2 DKO MEFs (Fig. 2A). VSV-induced shut off of host translation in WT MEFs occurred at 5h p.i, whereas in 4E-BP1/2 DKO MEFs, the reduction of cellular translation was barely detectable at 6h p.i. In agreement with these data, the lack of 4E-BPs resulted in a decrease in infectious virus production (Fig. 2B). To confirm that the VSV-resistant phenotype observed in the 4E-BP1/2 DKO MEFs is due to the absence of 4E-BPs, and not to some unintended effect of the gene targeting manipulation, 4E-BP1/2 DKO MEFs were transfected with vectors encoding 4E-BP1 and 4E-BP2. Subsequently, MEFs were infected with VSV. Expression of 4E-BP1 and 4E-BP2, but not empty vector, restored the susceptibility of the 4E-BP1/2 DKO MEFs to VSV (Fig. 3).
To assess whether the lack of 4E-BP1/2 activity is generally associated to lower susceptibility to viral infection, 4E-BP1/2 DKO MEFs were infected with different viruses and viral replication was determined. As shown in Figs. 4 and 5, 4E-BP1/2 DKO MEFs are less susceptible to infection by Sindbis (alphavirus, positive strand RNA virus), EMCV (picornavirus, positive strand RNA virus), Influenza (orthomyxovirus, negative strand RNA virus), Myxoma (Poxviridae, double-stranded DNA virus) and HSV-1 (Herpesviridae, double-stranded DNA virus). Fig. 6A shows that cells deficient in 4E-BP1 or 4E-BP2 are less susceptible to
VSV infection, with a more pronounced effect in the absence of 4E-BP1. Fig. 6B shows the expression of 4E-BP1 and/or 4E-BP2 in 4E-BP1 KO, 4E-BP2 KO and 4E-BP1/2 DKO cells, demonstrating the lack of expression of the knockout gene(s).
Example 3: The IFN response is up-regulated in 4E-BP1/2 DKO MEFs.
WT and 4E-BP1/2 DKO MEFs were treated with polyinosine-polycytidylic acid (poly(l:C)), a synthetic double-stranded RNA (dsRNA) analogue, which is a potent inducer of type-l IFN. The production of IFN was determined by assessing the inhibition of VSV-induced cytopathic effect (CPE). Six hours after treatment with poly(l:C), culture medium from WT and 4E-BP1/2 DKO MEFs was collected and added to WT MEFs (Fig. 7A). After overnight incubation, MEFs were infected with VSV (MOI of 0.1 PFU/cell) and virus yield was determined by a plaque assay. Culture medium from WT MEFs treated with a low concentration of poly(l:C) (0.1 μg/ml), failed to protect cells from VSV infection (Fig. 7B). In contrast, no CPE was observed and virus production was significantly reduced (~200-fold) in WT MEFs incubated with the culture medium from 4E-BP1/2 DKO MEFs. Consistent with the notion that the enhanced resistance of the 4E-BP1/2 DKO MEFs to virus infection is associated with increased type-l IFN production, incubation with a neutralizing antibody against IFNβ rescued the VSV-resistant phenotype (Fig. 9A).
Expression of IFNα and IFNβ mRNAs was more responsive to the treatment with either 0.1 μg/ml (Fig. 7C) or 1 μg/ml (Fig. 9B) of poly(l:C) in 4E-BP1/2 DKO MEFs than in WT MEFs, as determined by reverse transcription-PCR (RT-PCR). Moreover, the induction of IFNα and IFNβ mRNA synthesis after VSV infection was greater in 4E-BP1/2 DKO than in WT MEFs (Fig. 9C). Consistent with these data, poly(l:C) treatment of 4E-BP1/2 DKO, but not WT MEFs, elicited a robust production of IFNα (Figs. 7D and 10C) and IFNβ (Figs. 1OA and 10B), as determined by enzyme-linked immunosorbent assay (ELISA). Collectively, these data show that the lack of 4E-BPs results in enhanced type-l IFN production.
Example 4: 4E-BP1/2 DKO mice are protected against VSV infection.
To determine whether the virus-resistant phenotype of 4E-BP1/2 DKO MEFs is recapitulated in vivo, WT and 4E-BP1/2 DKO mice were infected intranasally (i.n.) with VSV at a dose of 5 x 107 PFU. VSV replication is known to be sensitive to inhibition by IFN. By day 6 p.i, 80% of VSV-infected 4E-BP1/2 DKO mice survived, in comparison to 20% of the WT mice (Fig. 8A). Furthermore, VSV-infected 4E-BP1/2 DKO mice did not exhibit severe respiratory distress, in contrast to the WT controls. In a second experiment, mice were infected i.n. with VSV (105 PFU) and sacrificed 5 days after infection. In lungs from 4E-BP1/2 DKO mice, virus load was reduced (~100-fold; Fig. 8B) and the expression of both IFNα and IFNβ mRNAs, as assayed by RT-PCR analysis, was significantly increased (~3-fold) already by 2 days post-infection (d.p.L), as compared to WT mice (Fig. 8C). In addition, the serum of VSV-infected 4E-BP1/2 DKO mice contained increased IFNα levels, as compared to the serum of VSV-infected WT mice (Fig. 8F). Thus, mice lacking 4E-BP1/2 are more resistant to VSV infection and produce more type-l IFN, as compared to their WT counterparts. Plasmacytoid dendritic cells (pDCs) are the main producers of systemic type-l
IFN in response to virus infection. To determine whether pDCs from 4E-BP1/2 DKO mice contribute to the virus-resistant phenotype, splenic pDCs were isolated and incubated with VSV (MOI of 1 and 10 PFU/cell) for 6h. pDCs from 4E-BP1/2 DKO mice generated significantly more (>7-fold) IFNα, as compared to pDCs from WT littermates (Fig. 8D). Similarly, pDCs from 4E- BP1/2 DKO mice, which were co-cultured with synthetic CpG oligodeoxynucleotides (CpG- ODN), elicited higher IFNα levels (>4-fold) than pDCs from WT littermates (Fig. 8E). Thus, the virus-resistant phenotype of 4E-BP1/2 DKO mice correlates with the ability of their pDCs to produce increased amounts of IFNα in response to virus infection.
Example 5: Gene expression profiling in 4E-BP1/2 MEFs.
To determine the molecular mechanism by which type-l IFN production is enhanced in 4EBP1/2 DKO cells, gene expression profiling was performed on 4EBP1/2 DKO MEFs and WT MEFs. A 1.5-fold increase in RNA abundance was used as a cut-off. A number of genes in the IFN pathway [e.g., 2'-5" oligoadenylate synthetase, signal transducer and activator of transcription 1 (Stati), IFN-induced proteins, and others] were up-regulated in uninfected 4E-BP1/2 OKO MEFs as compared to WT MEFs (Fig. 11A and Table II). Furthermore, a number of genes involved in inflammation and the immune response [e.g., chemokine (C-X-C) ligand 5, complement component 4 binding protein, and a variety of cytokines] were also up-regulated (Fig. 1OA; for a complete list of genes up-regulated in 4E- BP1/2 DKO MEFs, see Fig. 11C).
To identify mRNAs encoding for proteins involved in the production of IFN, polysomal RNA from WT and DKO MEFs was analyzed by gene-expression microarrays. mRNAs with low or no induction at the mRNA level (<1.5-fold) but a robust induction of translation (> 4-fold) were identified (Fig. 11 B and Table III). The microarray analysis revealed that IRF-7 mRNA, which encodes a regulator of the type-l IFN response, was the highest ranked gene in this analysis as its expression was increased ~12-fold in 4E-BP1/2 DKO MEFs as compared to WT MEFs (Fig. 11 B).
Table II: IFN-related genes up-regulated in uninfected 4E-BP1/2 OKO MEFs as compared to WT MEFs
Figure imgf000038_0001
Figure imgf000039_0001
Table III: Genes showing increased translational activity (>4-fold) in DKO MEFs as compared to WT MEFs
Figure imgf000039_0002
Figure imgf000040_0001
Example 6: IRF-7 expression and activity in 4E-BP1/2 DKO MEFs
To validate the results of the polysomal microarray analysis, the recruitment of ribosomes to IRF-7 mRNA was studied using an RT-PCR assay that tracks the polysomal distribution of mRNAs in extracts from WT and 4E-BP1/2 DKO MEFs along a sucrose density gradient (Fig. 12A). IRF-7 mRNA was mainly associated with light polysomes in WT MEFs (Fig. 12B, left panel), consistent with its inefficient translation initiation, β-actin mRNA, by contrast, was distributed mainly in heavy polysomes (Fig. 12C). Consistent with the lower repression of IRF-7 mRNA translation in 4E-BP1/2 DKO MEFs, the distribution of the IRF-7 mRNA was significantly shifted to heavier gradient fractions (Fig. 12B, right panel). Accordingly, in the absence of 4E-BP1/2, IRF-7 protein amounts were increased (>4-fold) as determined by Western-blotting (Fig. 12D). These data support a role for the 4E-BPs in the repression of translation of IRF-7 mRNA. Changes in the 4E-BPs/elF4E ratio do not alter general translation, but rather affect the translation of a subset of mRNAs which harbor a structured 5' untranslated region (5'UTR). Strikingly, the IRF-7 mRNA has a highly structured 51UTR which is evolutionarily conserved. To directly examine the role of the 51UTR in the regulation of IRF-7 mRNA expression, a construct in which the SV40 promoter drives the expression of the 5' UTR of IRF- 7 mRNA fused to a firefly luciferase (Flue) reporter (5'UTR-IRF-7-Fluc; Fig. 12E) was generated. The expression of the 5'UTR-I RF-7-Fluc in WT MEFs was reduced relative to the control (lacking the 5'UTR) Flue reporter and a Renilla Luciferase (Rluc) reporter plasmid, which is under the control of the CMV promoter and used as a transfection control (Fig. 12E).
Next, WT and DKO MEFs were co-transfected with 51UTR-I RF-7-Fluc and a Rluc reporter plasmid. Consistent with the repression of IRF-7 mRNA translation by 4E-BPs, the normalized Fluc/Rluc ratio was significantly increased (~6-fold) in 4E-BP1/2 DKO as compared to WT MEFs (Fig. 12F). Therefore, these results suggest that the IRF-7 mRNA 5'UTR plays a role in its translational repression by 4E-BPs.
It is thought that plasmacytoid dendritic cells produce large amounts of type-l IFN as a consequence of a high constitutive expression of IRF-7. Consistent with the control of Irf7 mRNA translation by 4E-BPs, the level of 4E-BP1 and 4E-BP2 in plasmacytoid dendritic cells is significantly lower as compared to MEFs (Fig. 13). Thus, the low levels of 4E-BPs could explain at least in part the constitutive expression of IRF-7 in plasmacytoid dendritic cells. It is known that the activation of the IRF-7-mediated type-l IFN response induces the expression of RIG-I and MDA5, which triggers the induction of NF-κB, IRF-3 and IRF-7 that cooperate in the production of the antiviral type-l IFN response. In the presence or absence of poly(l:C), enhanced expression of retinoic acid inducible gene I (RIG-I) and melanoma-differentiation- associated gene 5 (MDA5) proteins was measured in 4E-BP1/2 DKO MEFs as compared to WT MEFs (FJg. 14).
To determine whether the virus-resistant phenotype and the enhanced type-l IFN production in 4E-BP1/2 DKO MEFs is associated with increased IRF-7 expression, IRF-7 levels were reduced the in 4E-BP1/2 DKO MEFs using a specific shRNA against IRF-7 mRNA. Expressing the shRNA against IRF-7 mRNA, but not a control shRNA, not only restored the sensitivity to VSV infection but also blocked type-l IFN production in these cells (Fig. 15). These data provide genetic evidence that the enhanced IFN response in 4E-BP1/2 DKO MEFs is caused by up-regulation of IRF-7 expression.
Example 7: Knockdown of 4E-BP1/2 in different human cell lines using lentivirus shRNA vectors and effects on viral replication.
As shown in Fig. 16A, transfection of various human cell lines (HEK293T, Jurkat, THP-1 and U937 cells) using lentivirus shRNA vectors against 4E-BP1 and/or 4E-BP2 results in the knockdown of the respective target(s). Knockdown is almost complete for both 4E-BPs for all four cell lines. Fig. 16B shows that single knockdown of 4E-BP1 or 4E-BP2 in HEK293T cells results in a restriction of VSV replication 1Oh post-infection, an effect which is more pronounced with 4E-BP1 knockdown. Fig. 16C shows that VSV proteins 6h post-infection are expressed at lower levels in Jurkat cells in which both 4E-BP1/2 has been knockdown as compared to control Jurkat cells. Also, knockdown of both 4E-BP1/2 in HEK293T cells results in an inhibition of HIV- 1 release from infected cells as compared to controls (Fig. 16D).
Example 8: Knockdown of 4E-BP1/2 using specific siRNA and effects on IFN production.
The results presented at Fig. 17A indicate that unmodified siRNAs targeting human 4E-BP1 and 4E-BP2 are eliciting potent gene silencing (far right lanes in the two gels).
As well, none of the scrambled (non-targeting) siRNAs affect expression levels of 4E-BP1 or 4E-BP2. Because Scrambled modified control 1 and 2 are chemically modified with 2'F-ANA and 2'F-RNA, these data indicate that the chemical modifications alone are not responsible for changes in expression of 4E-BP1 or 2. Looking at the knockdown of 4E-BP1 and 2 with the H_14 modification architecture (fully 2'F-ANA sense strand, fully 2'F-RNA antisense strand), it is shown that siRNAs comprising this modification are capable of silencing both 4E-BP1 and 2, although not as potently as the unmodified control after 24 hours, especially in the case of 4E- BP1. The H_611 modification architecture (alternating 2'F-ANA/2'F-RNA sense strand, fully 2'F- RNA antisense strand) appears to be more potent than H_14 in both cases, possibly even exceeding the potency of the unmodified control for 4E-BP2.
The ability of chemically modified siRNAs to reproduce the 4E-BP1/2 double knockout phenotype was next determined using the HEK-Blue™ system according to the manufacturer's protocol (InvivoGen). The results of experiments performed to monitor the relative levels of interferon 3 days post-siRNAs transfection and in the presence or absence of poly(l:C) are presented in Fig. 18. When cells are treated with modified scrambled siRNA and poly(l:C), the relative IFN levels are similar to that of cells treated with unmodified scrambled sequence, showing the modification does not trigger a significant immunostimulatory response. In the case of treatment of cells with unmodified siRNAs targeting both 4E-BP1 and 2 at the same time, the relative levels of IFN in the cells increase to around 5 units in the absence of poly(l:C). When the cells were treated with poly(l:C), relative IFN levels are around 18, versus about 11 in scrambled siRNA treated cells, demonstrating that silencing 4E-BP1 and 2 increases the IFN response, similar to what was observed in the 4E-BP1/2 knockout mice. Finally, treatment with fully modified siRNA (corresponding to the H_611 architecture) against 4E-BP1 and 2 in the presence of poly(l:C) results in relative IFN levels of about 42 units, which is a 4-fold increase as compared to scrambled treated cells, and a 2-fold increase as compared to cells treated with regular unmodified 4E-BP1 and 2 siRNA.
Although the present invention has been described hereinabove by way of specific embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims.

Claims

WHAT IS CLAIMED IS:
1. A method for inducing or enhancing an immune response in a subject comprising administering an effective amount of an agent that inhibits the expression and/or activity of a elF4E-binding protein (4E-BP) to said subject.
2. A method for preventing or treating a viral infection in a subject comprising administering an effective amount of an agent that inhibits the expression and/or activity of a elF4E-binding protein (4E-BP) to said subject.
3. The method of claim 1 or 2, wherein said agent inhibits the expression of a 4E-BP.
4. The method of claim 3, wherein said agent inhibits the expression of
4E-BP1 , 4E-BP2, or both.
5. The method of claim 3 or 4, wherein said agent is a short-hairpin RNA (ShRNA).
6. The method of claim 4, comprising administering to said subject an effective amount of:
(a) an shRNA derived from a 4E-BP1 nucleic acid sequence;
(b) an shRNA derived from a 4E-BP2 nucleic acid sequence; or
(c) both (a) and (b).
7. The method of claim 5, comprising administering to said subject an effective amount of:
(a) an shRNA encoded by a nucleic acid comprising the sequence of SEQ ID NO: 1 1 ;
(b) an shRNA encoded by a nucleic acid comprising the sequence of SEQ ID NO: 12; or
(c) both (a) and (b).
8. The method of claim 6, wherein said shRNA is derived from a 4E-BP1 nucleic acid sequence.
9. The method of claim 8, wherein said shRNA is encoded by a nucleic acid comprising the sequence of SEQ ID NO: 11.
10. The method of claim 3 or 4, wherein said agent is a small-interfering RNA (SiRNA).
11. The method of claim 10, wherein said siRNA is derived from a 4E-BP1 nucleic acid sequence, a 4E-BP2 nucleic acid sequence, or both.
12. The method of claim 11 , wherein said siRNA comprises the sequence of
(a) SEQ ID NOs: 13 and 14; (b) SEQ ID NOs: 21 and 22; (c) SEQ ID NOs: 27 and 28; (d) SEQ ID NOs: 15 and 16; (e) SEQ ID NOs: 23 and 24; (f) SEQ ID NOs: 29 and 30, or (g) any combination of (a) to (f).
13. The method of claim 10, wherein said siRNA is derived from a 4E-BP1 nucleic acid sequence.
14. The method of claim 13, wherein said siRNA comprises the sequence of (a) SEQ ID NOs: 13 and 14; (b) SEQ ID NOs: 21 and 22; (c) SEQ ID NOs: 27 and 28, or (d) any combination of (a) to (c).
15. Use of an agent that inhibits the expression and/or activity of a 4E-BP for inducing or enhancing an immune response in a subject.
16. Use of an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for inducing or enhancing an immune response in a subject.
17. Use of an agent that inhibits the expression or activity of a 4E-BP for preventing or treating a viral infection or disease in a subject.
18. Use of an agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for preventing or treating a viral infection or disease in a subject.
19. The use of any one of claims 15 to 18, wherein said agent inhibits the expression of a 4E-BP.
20. The use of claims 19, wherein said agent inhibits the expression of 4E- BP1. 4E-BP2, or both.
21. The use of claim 19 or 20, wherein said agent is a short-hairpin RNA (shRNA).
22. The use of claim 21 , comprising a use of:
(a) an shRNA derived from a 4E-BP1 nucleic acid sequence; (b) an shRNA derived from a 4E-BP2 nucleic acid sequence; or
(c) both (a) and (b).
23. The use of claim 22, comprising a use of:
(a) an shRNA encoded by a nucleic acid comprising the sequence of SEQ ID NO: 11 ;
(b) an shRNA encoded by a nucleic acid comprising the sequence of SEQ ID NO:12; or
(c) both (a) and (b).
24. The use of claim 22, wherein said shRNA is derived from a 4E-BP1 nucleic acid sequence.
25. The use of claim 24, wherein said shRNA is encoded by a nucleic acid comprising the sequence of SEQ ID NO: 11.
26. The use of claim 19 or 20, wherein said agent is a small-interfering RNA (siRNA).
27. The use of claim 26, wherein said siRNA is derived from a 4E-BP1 nucleic acid sequence, a 4E-BP2 nucleic acid sequence, or both.
28. The use of claim 27, wherein said siRNA comprises the sequence of (a)
SEQ ID NOs: 13 and 14; (b) SEQ ID NOs: 21 and 22; (c) SEQ ID NOs: 27 and 28; (d) SEQ ID NOs: 15 and 16; (e) SEQ ID NOs: 23 and 24; (f) SEQ ID NOs: 29 and 30, or (g) any combination of (a) to (f).
29. The use of claim 27, wherein said siRNA is derived from a 4E-BP1 nucleic acid sequence.
30. The use of claim 29, wherein said siRNA comprises the sequence of SEQ ID NOs: 13 and 14; (b) SEQ ID NOs: 21 and 22; (c) SEQ ID NOs: 27 and 28; or (d) any combination of (a) to (c).
31. A method of identifying a compound for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said method comprising determining whether:
(a) a level of expression of a 4E-BP nucleic acid or encoded polypeptide;
(b) a level of 4E-BP activity; or
(c) both (a) and (b), is decreased in the presence of a test compound relative to in the absence of said test compound, wherein said decrease is indicative that said test compound can be used for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection, or (iii) both (i) and (ii).
32. A method of identifying or characterizing a compound for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said method comprising:
(a) contacting a test compound with a cell comprising a first nucleic acid comprising a transcriptionally regulatory element normally associated with a 4E- BP gene, operably linked to a second nucleic acid comprising a reporter gene capable of encoding a reporter protein; and
(b) determining whether reporter gene expression or reporter protein activity is decreased in the presence of said test compound; wherein a decrease in said reporter gene expression or reporter protein activity is indicative that said test compound may be used for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection, or (iii) both (i) and (ii).
33. The method of claim 31 , wherein said 4E-BP is 4E-BP1.
34. The method of claim 33, wherein said 4E-BP1 comprises the amino acid sequence of SEQ ID NO: 32.
35. The method of claim 33, wherein said 4E-BP1 nucleic acid encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 32.
36. The method of claim 35, wherein said 4E-BP1 nucleic acid comprises the coding sequence of the nucleotide sequence of SEQ ID NO: 31.
37. A method for diagnosing viral infection or disease or susceptibility thereto, in a subject, the method comprising:
(a) determining in a biological sample from said subject:
(i) a level of expression of a 4E-BP nucleic acid or encoded polypeptide;
(ii) a level of 4E-BP activity; or (iii) both (i) and (ii);
(b) comparing said level to a corresponding reference level; and
(c) diagnosing said viral infection or disease or susceptibility thereto in accordance with said comparison.
38. The method of claim 37, wherein said corresponding reference level is the level measured in a corresponding biological sample from one or more healthy subject(s) who are not suffering from or are known not to be susceptible to viral infection or disease, and wherein an increase in said level relative to said corresponding reference level is indicative that the subject is suffering from or is susceptible to viral infection or disease; or a substantially similar level relative to said corresponding reference level is indicative that the subject is not suffering from or is not susceptible to viral infection or disease.
39. The method of claim 37, wherein said corresponding reference level is the level measured in a corresponding biological sample from one or more subject(s) who are suffering from or are known to be susceptible to viral infection or disease, and wherein a substantially similar level relative to said corresponding reference level is indicative that the subject is suffering from or has a susceptibility to viral infection or disease; or an decrease in said level relative to said corresponding reference level is indicative that the subject is not suffering from or is not susceptible to viral infection or disease.
40. The method of any one of claims 37 to 39, wherein said 4E-BP is 4E-
BP1.
41. The method of claim 40, wherein said 4E-BP1 comprises the amino acid sequence of SEQ ID NO: 32.
42. The method of claim 40, wherein said 4E-BP1 nucleic acid encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 32.
43. The method of claim 42, wherein said 4E-BP nucleic acid comprises the coding sequence of the nucleotide sequence of SEQ ID NO: 31.
44. A kit or package for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii), said kit or package comprising (a) an agent that inhibit the expression or activity of a elF4E-binding protein (4E-BP) and (b) a container.
45. The kit or package of claim 48, further comprising instructions for (i) inducing or enhancing an immune response, (ii) preventing or treating a viral infection or disease, or (iii) both (i) and (ii).
46. A kit or package for diagnosing viral infection or disease or susceptibility thereto in a subject, the kit comprising means for determining in a biological sample from said subject: (a) a level of expression of a 4E-BP nucleic acid or encoded polypeptide;
(b) a level of 4E-BP activity; or
(c) both (a) and (b); together with instructions for correlating said level with viral infection or disease or susceptibility thereto.
47. An agent that inhibits the expression or activity of 4E-BP for preventing or treating a viral infection or disease in a subject.
48. An agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for preventing or treating a viral infection or disease in a subject.
49. A composition for preventing or treating a viral infection or disease in a subject comprising an agent that inhibits the expression or activity of a 4E-BP, and a pharmaceutically acceptable carrier.
50. An agent that inhibits the expression or activity of 4E-BP for inducing or enhancing an immune response in a subject.
51. An agent that inhibits the expression or activity of a 4E-BP for the preparation of a medicament for inducing or enhancing an immune response in a subject.
52. A composition for inducing or enhancing an immune response in a subject comprising an agent that inhibits the expression or activity of a 4E-BP, and a pharmaceutically acceptable carrier.
PCT/CA2008/002259 2007-12-19 2008-12-19 Immune response modulation and uses thereof Ceased WO2009076775A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
CA2764456A CA2764456C (en) 2008-06-05 2009-06-05 Oligonucleotide duplexes comprising dna-like and rna-like nucleotides and uses thereof
PCT/CA2009/000789 WO2009146556A1 (en) 2008-06-05 2009-06-05 Oligonucleotide duplexes comprising dna-like and rna-like nucleotides and uses thereof
ES09757018.8T ES2643576T3 (en) 2008-06-05 2009-06-05 Oligonucleotide duplexes comprising DNA and RNA type nucleotides and uses thereof
JP2011511949A JP5684116B2 (en) 2008-06-05 2009-06-05 Oligonucleotide duplexes comprising DNA-like and RNA-like nucleotides and uses thereof
US12/996,362 US9090649B2 (en) 2008-06-05 2009-06-05 Oligonucleotide duplexes comprising DNA-like and RNA-like nucleotides and uses thereof
EP09757018.8A EP2294195B1 (en) 2008-06-05 2009-06-05 Oligonucleotide duplexes comprising dna-like and rna-like nucleotides and uses thereof
US14/810,148 US9719091B2 (en) 2008-06-05 2015-07-27 Oligonucleotide duplexes comprising DNA-like and RNA-like nucleotides and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US1503307P 2007-12-19 2007-12-19
US61/015,033 2007-12-19

Publications (1)

Publication Number Publication Date
WO2009076775A1 true WO2009076775A1 (en) 2009-06-25

Family

ID=40795154

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2008/002259 Ceased WO2009076775A1 (en) 2007-12-19 2008-12-19 Immune response modulation and uses thereof

Country Status (1)

Country Link
WO (1) WO2009076775A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011017583A1 (en) * 2009-08-07 2011-02-10 The Wistar Institute Compositions containing jarid1b inhibitors and methods for treating cancer
WO2021067752A1 (en) * 2019-10-04 2021-04-08 Yale University Targeting cap-dependent translation to reduce seizures in mtor disorders

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050181400A1 (en) * 2004-01-22 2005-08-18 Monia Brett P. Modulation of eIF4E-BP1 expression
US20050196787A1 (en) * 2004-01-22 2005-09-08 Sanjay Bhanot Modulation of eIF4E-BP2 expression
WO2008094181A2 (en) * 2007-02-01 2008-08-07 The Regents Of The University Of Michigan Compositions and methods for detecting, preventing and treating seizures and seizure related disorders

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050181400A1 (en) * 2004-01-22 2005-08-18 Monia Brett P. Modulation of eIF4E-BP1 expression
US20050196787A1 (en) * 2004-01-22 2005-09-08 Sanjay Bhanot Modulation of eIF4E-BP2 expression
WO2008094181A2 (en) * 2007-02-01 2008-08-07 The Regents Of The University Of Michigan Compositions and methods for detecting, preventing and treating seizures and seizure related disorders

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK NCBI; 13 July 2007 (2007-07-13), "Small hairpin RNA (shRNA) probe TRCN0000117812 for Homo sapiens gene eukaryotic translation initiation factor 4E binding protein 2 (EIF4EBP2)", retrieved from http://www.ncbi.nlm.nih.gov/genome/probe/reports/probereport.cgi? uid=8756533 Database accession no. TRCN0000117812 *
DATABASE GENBANK NCBI; 13 November 2006 (2006-11-13), "Homo sapiens eukaryotic translation initiation factor 4E binding protein 1 (EIF4EBP 1), mRNA", retrieved from http://www.ncbi.nlm.nih.gov/nuccore/ 11793 83 08 Database accession no. NM 004095.3 *
DATABASE GENBANK NCBI; 13 November 2006 (2006-11-13), "Homo sapiens eukaryotic translation initiation factor 4E binding protein 2 (EIF4EBP2), mRNA", retrieved from http://www.ncbi.nlm.nih.gov/nuccore/208879409 Database accession no. NM_004096 *
DATABASE GENBANK NCBI; 14 March 2007 (2007-03-14), "Small hairpin RNA (shRNA) probe TRCN0000040203 for Homo sapiens gene eukaryotic translation initiation factor 4E binding protein 1 (EIF4EBP 1)", retrieved from http://www.ncbi.nlm.nih.gov/genome/probe/reports/probereport.cgi? uid=8678595 Database accession no. TRCN0000040203 *
GINGRAS, A.C. ET AL.: "Activation of the translational suppressor 4E-BP 1 following infection with encephalomyocarditis virus and poliovirus.", PROC. NATL. ACAD. SCI. U.S.A., vol. 93, no. 11, 28 May 1996 (1996-05-28), pages 5578 - 5583 *
PAUSE A. ET AL.: "Insulin-dependent stimulation of protein synthesis by phosphorylation of a regulator of 5'-cap function.", NATURE., vol. 371, no. 6500, 27 October 1994 (1994-10-27), pages 762 - 767 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011017583A1 (en) * 2009-08-07 2011-02-10 The Wistar Institute Compositions containing jarid1b inhibitors and methods for treating cancer
WO2021067752A1 (en) * 2019-10-04 2021-04-08 Yale University Targeting cap-dependent translation to reduce seizures in mtor disorders
US20240052004A1 (en) * 2019-10-04 2024-02-15 Yale University Targeting cap-dependent translation to reduce seizures in mtor disorders

Similar Documents

Publication Publication Date Title
Ramos et al. Innate immune response to influenza virus at single-cell resolution in human epithelial cells revealed paracrine induction of interferon lambda 1
Pei et al. Nuclear-localized human respiratory syncytial virus NS1 protein modulates host gene transcription
Guo et al. Respiratory syncytial virus infection upregulates NLRC5 and major histocompatibility complex class I expression through RIG-I induction in airway epithelial cells
EP3246409A1 (en) Antibiotic-resistance-free vectors
JP2021138721A (en) Hiv pre-immunization and immunotherapy
JP2006512906A (en) Influenza treatment
WO2011100841A1 (en) Pd-1 modulation and uses thereof for modulating hiv replication
Sun et al. Inhibition of neddylation pathway represses influenza virus replication and pro-inflammatory responses
JP7332585B2 (en) Inhibitor for use in preventing and/or treating hepatitis B virus infection
US20240060131A1 (en) Method for identifying and/or regulating senescence
Guo et al. Inhibition of histone deacetylase 1 suppresses pseudorabies virus infection through cGAS-STING antiviral innate immunity
Cao et al. The matrix protein of respiratory syncytial virus suppresses interferon signaling via RACK1 association
Wang et al. Coronavirus transmissible gastroenteritis virus antagonizes the antiviral effect of the microRNA miR-27b via the IRE1 pathway
Chiu et al. SARS-CoV-2 Nsp15 antagonizes the cGAS-STING-mediated antiviral innate immune responses
Arai et al. Stimulation of interferon-β responses by aberrant SARS-CoV-2 small viral RNAs acting as retinoic acid-inducible gene-I agonists
JP2021169416A (en) Hepatitis A virus replication inhibitor targeting mTOR
WO2009076775A1 (en) Immune response modulation and uses thereof
WO2020023776A2 (en) Compositions and methods for inhibiting cancers and viruses
Tang et al. Zinc finger antiviral protein (ZAP) inhibits small ruminant morbillivirus replication in vitro
CN103045592B (en) Long-chain non-encoding nucleic acid segment related with duplication of flu viruses and application thereof
Lee et al. Systems biology from virus to humans
EP3154579A1 (en) New treatment against influenza virus
CN109966497A (en) Application using IPAN or its encoding gene as the substance of target spot in preparation influenza virus inhibitor
JP7403777B2 (en) Method for suppressing virus infection and activity
Huang et al. IAV NS1 carried by exosomes promotes IL-10 production by the PI3K-AKT-GSK3β-CREB pathway

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08863308

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08863308

Country of ref document: EP

Kind code of ref document: A1