WO2009074331A2 - Early and differential diagnosis test for alzheimer's disease - Google Patents
Early and differential diagnosis test for alzheimer's disease Download PDFInfo
- Publication number
- WO2009074331A2 WO2009074331A2 PCT/EP2008/010552 EP2008010552W WO2009074331A2 WO 2009074331 A2 WO2009074331 A2 WO 2009074331A2 EP 2008010552 W EP2008010552 W EP 2008010552W WO 2009074331 A2 WO2009074331 A2 WO 2009074331A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- marker
- disease
- marker gene
- gene product
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
- G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/28—Neurological disorders
- G01N2800/2814—Dementia; Cognitive disorders
- G01N2800/2821—Alzheimer
Definitions
- the present invention is related to an in vitro method for diagnosing Alzheimer's disease.
- AD Alzheimer's disease
- amyloid plaques which are extracellular deposits consisting mainly of aggregated ⁇ -amyloid peptide
- NFT neurofibrillary tangles
- AD Alzheimer's disease
- susceptibility genes include genetic mutations, susceptibility genes and environmental factors such as aluminum that promote formation and accumulation of insoluble amyloid-beta (A- ⁇ ) and hyperphosphorylated tau (R. A. Yokel, Neurotoxicology 21, 813 (2000)).
- A- ⁇ amyloid-beta
- PS presenilin
- Apolipoprotein E is a fourth genetic factor involved in the development of AD. Unlike the three deterministic genes, APOE is a susceptibility locus that accounts for approximately half of the late onset AD (A. M. Saunders, J Neuropathol Exp Neurol 59, 751 (2000), C. L. Masters, K. Beyreuther, Bmj 316, 446 (1998)) .
- IL-I interleukin-1
- Fig. 1 recapitulates that current diagnosis options either provide a late diagnosis when the degeneration of the neurons already occurred or act as confirmatory methods in post-mortem material according to Braak and Braak or the CERAD methodology (Fig 1).
- a problem underlying the present invention is to provide a non-invasive and cost- efficient method to diagnose Alzheimer's disease that can be applied at an early stage of the disease.
- a further problem underlying the present invention is to detect in an early stage of the degeneration, either before subjects will become MCI or during MCI phase, whether this person will develop AD and provide respective means therefore.
- the problem underlying the present invention is solved in a first aspect which is also a first embodiment of the first aspect, by the use of a marker gene or a gene product thereof or a combination of marker genes or a combination of the gene products thereof, wherein the marker gene(s) is/are selected from the group comprising SLC 1A7, SLC 1A2, TF, GRIK4, CNR2, IGF-IR, CHAK2, GRINLlA, CHRNAl, GSTMl, FTHl, NDUFS3, LYST, SYNII, COG2, PEX5, STX5A, HIST1H3E, IRS4, RPL36A, GFAP, IDE and DEFAl; as a peripheral marker for diagnosing a neurodegenerative disease.
- the marker gene(s) is/are selected from the group comprising SLC 1A7, SLC 1A2, TF, GRIK4, CNR2, IGF-IR, CHAK2, GRINLlA, CHRNAl, GSTMl, FTHl, NDUFS
- the neurodegenerative disease is Alzheimer's disease.
- the marker gene is HISTH3E.
- the marker or marker gene is increased with decreased MMSE scores.
- the marker gene is CNR2.
- the marker or marker gene is increased with decreased MMSE score.
- the combination of marker genes or combination of the gene products thereof comprises at least HISTH3E or CNR2.
- the combination of marker genes or combination of the gene products thereof comprise at least HISTH3E and CNR2.
- the marker gene or gene product thereof or combination of marker genes or combination of gene products thereof is used as a marker for diagnosing the neurodegenerative disease at an early stage of the neurodegenerative disease.
- the problem underlying the present invention is solved in a second aspect which is also a first embodiment of the second aspect, by the use of a detector molecule that binds to a marker gene or a gene product thereof, whereby the marker gene is as defined in connection with any embodiment of the first aspect, for diagnosing a neurodegenerative disease, preferably Alzheimer's disease.
- the detector molecule consists of at least two species of detector molecule, whereby each species binds to a marker gene or a gene product thereof and whereby the marker gene or gene product thereof is different for each species of detector molecule.
- the detector molecule is a nucleic acid selected from the group comprising oligonucleotides, deoxyribonucleic acids, ribonucleic acids, aptamers and spiegelmers.
- the detector molecule is selected from the group comprising peptides, proteins, antibodies, anticalines, peptide-aptamers and small molecules.
- a third aspect which is also a first embodiment of the third aspect, by a method for the diagnosis of a disease comprising the following steps:
- the presence, concentration and/or activity of said one or more marker gene(s) or product(s) thereof correlate(s) or is/are correlated with the disease.
- the said one or more marker gene product(s) is a/are RNA molecule(s).
- said marker gene(s) product(s) thereof is a/are peptide(s) or protein(s).
- a fifth embodiment of the third aspect which is also an embodiment of the first, second, third and fourth embodiment of the third aspect, the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using PCR-related techniques.
- the PCR-related techniques comprise real-time, reverse transcriptase PCR techniques and RNA protection assays.
- a seventh embodiment of the third aspect which is also an embodiment of the first, second, third and fourth embodiment of the third aspect, the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using blotting techniques and/or chip-based techniques.
- the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using enzymatic assays or binding assays.
- the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using detection methods, whereby such detection methods are selected from the group comprising chromatography, mass spectrometry, electrophoresis, GS-MS and LC-MS.
- the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using an interaction partner of such a molecule/ such molecules, whereby the interaction partner is selected from the group comprising antibodies, anticalines, peptide-aptamers, aptamers and spiegelmers.
- said assessing is performed using a technique selected from the group comprising blotting techniques, enzymatic assays, binding assays and chip-based techniques.
- the disease is a neurodegenerative disease.
- the neurodegenerative disease is Alzheimer's disease.
- the subject is a mammal.
- the mammal is a human being.
- the sample is derived from one or more body fluids.
- the body fluid is selected from the group comprising blood, whole blood, peripheral blood, plasma, blood cells, CSF and saliva.
- the present invention is based on the surprising finding that peripheral markers exist the expression of which, as detectable in vitro using material from sources other than brain tissue, indicates, at an early stage, affliction with Alzheimer's disease.
- a marker gene or a gene product thereof which is also referred to herein as a marker gene product, or a combination of such marker or marker gene products thereof may be used as (a) peripheral marker(s) for diagnosing a disease, more preferably a neurodegenerative disease and most preferably Alzheimer's disease.
- the marker gene(s) is/are SLC1A7, SLC1A2, TF, GRIK4, CNR2, IGF-IR, CHAK2, GRINLlA, CHRNAl, GSTMl, FTHl, NDUFS3, LYST, SYNII, COG2, PEX5, STX5A, HIST1H3E, IRS4, RPL36A, GFAP, IDE DEFAl as depicted in Table 1.
- the marker gene is HIST3H3E.
- These genes comprise genes from groups of transporter and Channel related genes; receptor and channels related genes; vesicle, synapse and protein transport related genes; oxidative-stress and toxin metabolism related genes; transcription, translation and signal transduction related genes; and structural proteins and enzymes related genes.
- marker genes and marker gene products are used as peripheral markers of a disease such as a neurodegenerative disease, including, but not limited to Alzheimer's disease.
- a disease such as a neurodegenerative disease, including, but not limited to Alzheimer's disease.
- the presence, concentration and/or activity of the marker genes and/or the marker gene products may differ in the diseased state compared to a healthy subject as a result of intracellular events associated with Alzheimer's disease, such as, for example, elevated levels of reactive oxygen species.
- Samples indicative of the affliction of a subject suffering from or suspected of suffering from Alzheimer's disease may be derived from any tissue and body fluid other than the brain and CSF for the purpose of diagnosing Alzheimer's disease in accordance with the present invention, despite the fact that the brain is separated from the blood through barriers such as the blood-brain-barrier, at least in a healthy subject.
- peripheral blood refers to blood circulating through the body as well as any component thereof such as cellular components, with non-limiting examples being red blood cells, white blood cells and platelets.
- the peripheral blood may comprise molecules such as electrolytes, metabolites, peptide proteins, carbohydrates, liquids, nucleic acids or combinations thereof, which may or may not originate from other tissues or other parts of the body, i.e. tissues and parts of the body different from the brain.
- the term "peripheral blood”, as used herein comprises fractions of the peripheral blood.
- peripheral blood comprises a preparation of red blood cells.
- whole blood refers to peripheral blood from which no fractions or components have been removed or separated, although the blood may have been processed, for example through the addition of chemicals.
- peripheral blood refers to peripheral blood from which no fractions or components have been removed or separated, although the blood may have been processed, for example through the addition of chemicals.
- peripheral blood refers to peripheral blood from which no fractions or components have been removed or separated, although the blood may have been processed, for example through the addition of chemicals.
- peripheral blood may be used synonymously.
- the term ,,metabolites refers to molecules that are products and intermediates of the metabolism.
- Non-limiting examples include, but are not limited to sugars, organic acids, amino acids, nucleotides, lipids, fatty acids and the like.
- nucleic acid refers to a polymer comprising at least two nucleotide units attached to each other, preferably via phosphodiester bonds. Nucleotide units typically include a sugar moiety, for example ribose or deoxyribose, attached to a nitrogen base, for instance adenine, guanine, thymine, cytosine or uracil, although the scope of the invention includes alternative sugar moiety, bases and backbones such as the ones incorporated through the use of artificial nucleotide in chemical syntheses including phosphothioates.
- a nucleic acid is deoxyribonucleic acid (DNA), in another preferred embodiment of the present invention, the nucleic acid is a ribonucleic acid (RNA).
- a nucleic acid is an aptamer.
- the term "aptamer”, as used herein, refers to a D-nucleic acid which is either single-stranded or double-stranded and which specifically interact with a target molecule.
- the manufacture or selection of aptamers is, e. g., described in European patent EP 0 533 838.
- the length of aptamers typically ranges from as little as 15 to as much as 80 nucleotides, and preferably ranges from about 20 to about 50 nucleotides.
- a nucleic acid is a aptamer.
- the term "aptamer”, as used herein, refers to a are molecule similar to an aptamer.
- spiegelmers consist either completely or mostly of L- nucleotides rather than D-nucleotides in contrast to aptamers. Otherwise, particularly with regard to possible lengths of aptamers, the same applies to aptmers as outlined in connection with aptamers. The manufacture of aptmers is described in international patent application WO 98/08856.
- the term "peptide”, as used herein, refers to any polymer consisting of at least two amino acids which are covalently linked to each other, preferably through a peptide bond. More preferably, a peptide consists of two to ten amino acids. A particularly preferred embodiment of the peptide is an oligopeptide which even more preferably comprises from about 10 to about 100 amino acids.
- Amino acids typically include the natural proteinogenic L-amino acids, in particular glycine, alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, tryptophan, cystein, methionine, serine, threonine, lysine, arginine, histidine, aspartate, glutamate, asparagine and glutamine, but also any other kind of amino acid that can be chemically or enzymatically synthesised.
- the term "amino acid”, as used herein also comprises derivatives and isomers of the proteinogenic L-amino acids, for example D-amino acids.
- the term "proteins”, as used herein, refers to polymers consisting of a plurality of amino acids which are covalently linked to each other, preferably through a peptide bond. Preferably, such proteins comprise about at least 100 amino acids or amino acid residues.
- the peptide or protein is a so-called “anticaline” which is, among others, described in German patent application DE 197 42 706.
- the peptide is a peptide-aptamer.
- peptide aptamer refers to a high affinity binding peptide which can be identified from random sequence peptide libraries comprising 10 to 10 peptides differing in their amino acid sequence in a manner similar to aptamers.
- the term "marker”, as used herein, refers to any kind of molecule that is, directly or indirectly, for example by itself or through precursors, derivatives or products thereof, or interactions with other molecules, organelles, cells, tissues or the like, associated with and, preferably, indicative of a certain physiological state of an organism.
- the physiological state is a disease.
- the marker can be used to diagnose a disease.
- the term "marker gene”, as used herein, is a gene that is differentially expressed in a disease or a diseased organism compared to the healthy organism, and the disease can be diagnosed by way of analysis of the differential expression of said marker gene. In a particularly preferred embodiment of the present invention, such differential expression, but also other mechanisms lead to changes concerning the presence, concentration and/or activity of a gene product of such marker gene.
- peripheral marker is a marker that can support a diagnosis comprising the analysis of peripheral blood based on or making use of a sample which is preferably different from neuronal tissue and/or cerebrospinal fluid.
- a sample which is preferably different from neuronal tissue and/or cerebrospinal fluid.
- the sample contains or is derived from a body fluid.
- the body fluid is different from cerebrospinal fluid.
- the term "gene product”, as used herein, refers to any molecule that is the result of a transcription process of the gene of interest or fragments thereof and all forms derived thereof, comprising, but not limited to transcripts or fragments thereof, including, but not limited to truncated, spliced, fused, rearranged, cleaved and covalently modified forms thereof and the like; as well as any molecule that is the result of a translation process of the gene or fragments thereof, comprising, but not limited to peptides, proteins, cleaved, rearranged, fused, covalently modified, oxidised, reduced, truncated forms thereof.
- the gene product is a mature mRNA transcript or polypeptide or a protein.
- a fragment gene product has the essential features of the respective full length gene.
- the term "marker gene product”, as used herein, refers to the gene product of a marker gene.
- a gene product may, among others, as a consequence of its differential expression or any other mechanism, affect the metabolism, so that the presence, concentration and/or activity of metabolites in the brain and/or in any body fluid may be altered.
- the presence of metabolites in fluids of the body may be altered in an indicative manner, thus, in a preferred embodiment of the invention, such changes of the presence, concentration and/or activity of a metabolite could be detected for the purpose of supporting a diagnosis.
- detection is based or performed on a on a sample as defined herein.
- neurodegenerative disease refers to a disease that is associated with an altered, preferably decreasing degree of neuronal viability and/or activity.
- Non-limiting examples of neurodegenerative disease include, but are not limited to Alzheimer's disease, Parkinson's disease, Huntington disease, Lewy body dementia, Prion diseases.
- the marker gene or a gene product thereof or a combination of marker genes or a combination of gene products thereof may be released into the peripheral blood, where their presence, concentration and/or activity directly correlate with the disease and can be detected.
- even minute concentrations of such marker gene or gene product thereof or combination of marker genes or combination of gene products thereof released into the peripheral blood may trigger signal transduction cascades, affect the activity of peripheral enzymes, receptors, ion channels, transport molecules or the like to the effect that the presence, concentrations and/or activities of downstream molecules will be affected, thus contributing directly or indirectly to the symptoms of such neurodegenerative disease.
- detector molecules are used so as to detect the marker gene and/or a gene product thereof, whereby the interaction between the detector molecule and the marker gene and the gene product thereof, respectively is used in order to diagnose the disease.
- a detector molecule is any type of molecule that interacts with or detects a marker gene or marker gene product, which may be used for diagnosing the disease.
- the disease is a neurodegenerative disease and preferably Alzheimer's disease and is diagnosed as a result of the detector molecule binding to a marker gene or marker gene product.
- the term "to bind" means any contact between at least two molecules beyond any random interaction.
- the binding involves the formation of a stable complex characterized by dissociation constants in the range of 1 fM - 100 ⁇ M, preferably 1 pM - 100 nM, more preferably 0,1 nM — 10 nM.
- the detector molecule is a nucleic acid such as a primer or probe and the marker gene and/or gene product thereof is another nucleic acid such as a DNA or RNA molecule
- the binding involves the formation of a double stranded piece of nucleic acid based on specific base pairing such as the formation of Watson-Crick base pairs.
- specific base pairing such as the formation of Watson-Crick base pairs.
- the person skilled in the art knows how to design such molecules, how to synthesize such molecules, either through synthetic or recombinant approaches, and how to evaluate their ability to act as detector molecules.
- the detector molecule is a nucleic acid selected from the group comprising oligonucleotides, deoxyribonucleic acids, ribonucleic acids, aptamers and spiegelmers.
- oligonucleotide is a relatively short pieces of any type of nucleic acid; typically a oligonucleotide, irrespective of whether it is an oligoribonucleic acid or a deoxyribonucleic acid, comprises about 10 - 100 pairs.
- the terms "primers” and “probes” are oligonucleotides used for analytical purposes.
- a probe is a deoxyribonucleic acid of about 20 - 30 bases used to detect an RNA transcript of a gene through a stable hybridization.
- a primer is a deoxyribonucleic acid of the same length used to perform an analytical or preparative PCR reaction.
- the detector molecule is selected from the group comprising peptides, proteins, antibodies, anticalines, and peptide-aptamers.
- the term "antibody”, as used herein, comprises any construct, fragment, derivate, fusion or the like including at least one binding domain of an antibody.
- the person skilled in the art is aware of procedures to identify peptides, proteins, antibodies, anticalines, and peptide-aptamers that bind to a molecule of interest and how to obtain peptides, proteins, antibodies, anticalines, and peptide-aptamers, either through synthetic or recombinant approaches, and how to evaluate their ability to act as detector molecules.
- the detector molecule is a small molecule.
- the term "small molecule”, as used herein, refers to a compound of any chemical identity having a molecular weight of approximately 1000 Dalton and following the Lepinsky Rules of Five. Small molecules are typically provided in the form of chemical libraries comprising thousands of different species. The person skilled in the art knows how to synthesize small molecules and how to evaluate their ability to act as detector molecules.
- the term "the detector molecule consists of at least two species of detector molecule”, as used herein, means that the detector molecule consists of at least two separate entities of detector molecules, whereby the first entity detects a first marker gene or product thereof, the second entity detects a second marker gene or products thereof other than the first marker gene or gene product thereof, and so on. Consequently, the detector molecule comprises at least one entity for each marker gene or gene product thereof to be detected.
- the detector molecule may consist of two probes that have been separately synthesized and are not physically associated with each other, and the first probe detects an mRNA transcript of one marker gene and the second probe detects an mRNA transcript of another marker gene.
- marker genes and or gene products thereof for the diagnosis of a neurodegenerative disease, preferably Alzheimer's disease, by detecting a combination of marker genes and/or gene products thereof and by using, accordingly, a combination of detector molecules to detect the presence, concentration and/or activity of each marker gene or gene product thereof.
- 23 detector molecules are used to detect 23 marker genes or gene products thereof for the diagnosis of a neurodegenerative disease, preferably Alzheimer's disease. Typically, this involves the use of 23 different probes to detect the presence of 23 marker gene transcripts.
- marker genes and/or gene products thereof can be plausibly implemented in methods that are straightforward to perform and known to a person skilled in the art and are suitable to support or allow the diagnosis of a neurodegenerative disease, preferably Alzheimer's disease. Such methods have the potential for routine use and for use on a high- throughput scale.
- a state that is usually associated with the presence, elevated concentrations and/or activities of the marker gene or gene products thereof, the presence, elevated concentration and/or activity of said marker gene or gene product thereof detected in samples derived from him or her indicate that a subject suspected of suffering from said neurodegenerative disease, preferably Alzheimer's disease, actually suffers from said neurodegenerative disease.
- a marker gene the absence or normal or decreased concentration and/or activity of said marker gene or gene product thereof in a sample derived from a subject would indicate that he or she does not suffer from said neurodegenerative disease, preferably Alzheimer's disease.
- the expression of the gene encoding for channel kinase 2 is up-regulated in subjects suffering from Alzheimer's disease. Therefore, the presence, elevated concentration and/or activity of the channel kinase 2 gene or gene products thereof in a sample derived from a subject suspected of suffering from Alzheimer's disease indicates that said subject actually suffers from Alzheimer's disease.
- the expression of a known marker gene is known to be down-regulated in a diseased subject, a state that is usually associated with the absence or a decreased concentration and/or activity of the marker gene, the absence or decreased concentration and/or activity detected in samples derived from him or here, indicate that a subject suspect of suffering from said neurodegenerative disease, preferably Alzheimer's disease, actually suffers from said neurodegenerative disease.
- the expression of the gene encoding for transferrin is down-regulated in subjects suffering from Alzheimer's disease. Therefore, the absence, decreased concentration and/or activity of the transferrin gene or gene products thereof in a sample derived from a subject suspected of suffering from Alzheimer's disease indicates that said subject actually suffers from Alzheimer's disease.
- the nature of the marker gene product(s) is diverse.
- the marker gene product(s) is/are RNA molecule(s).
- the marker gene product(s) is/are peptide(s) or protein(s).
- the methods according to the present invention are applicable following the derivation of a sample from a subject.
- all steps comprised by the methods according to the present invention are performed in vitro.
- the provision of the sample explicitly excludes any interaction with the body of a subject.
- a method for the diagnosis of a neurodegenerative disease preferably Alzheimer's disease, by detecting a combination of marker genes and/or gene products thereof preferably using a combination of detector molecules to detect the presence, concentration and/or activity of each marker gene or gene product thereof.
- the method for diagnosing a neurodegenerative disease preferably Alzheimer's disease makes use of 23 detector molecules to detect 23 marker genes or gene products thereof.
- a step of the method comprises the analysis of a whole blood sample with respect to the presence, concentration and/or activity of 23 marker genes or gene products thereof.
- sample contains or is suspected to contain one or more of the marker genes or gene products means that one or more marker genes and/or gene products thereof may be detected in the sample in order to support or allow the diagnosis of a disease.
- the sample is based on or derived from a body fluid or from a skin biopsy.
- body fluid refers to any material comprising a liquid component that is obtainable from an organism of interest. Non- limiting examples include, but are not limited to cerebrospinal fluid (CSF), saliva, peripheral blood or whole blood.
- CSF cerebrospinal fluid
- body fluids comprise fractions or processed forms of any material comprising a liquid component that is obtainable from an organism of interest.
- body fluids comprise preparations of blood cells.
- the term ,,derived as used herein, comprises obtained by way of biopsy.
- a sample that can be used to support the diagnosis of a disease, preferably a neurodegenerative disease, most preferably Alzheimer's disease
- a multitude of different approaches may be used or followed for the detection of the presence, the concentration and/or the activity of a marker gene or a product thereof.
- said marker gene product is a nucleic acid molecule and a technique selected from the group comprising PCR-related techniques, spotted arrays, Northern blotting, Southern blotting, chip-based techniques or the like, is used for the detection.
- PCR-related techniques refers to any technique, process, method or methodology that makes use, in some form, of a polymerase chain reaction (PCR), reagents, products or intermediates thereof.
- PCR polymerase chain reaction
- Non-limiting examples include, but are not limited to real time PCR, reverse transcriptase PCR, RNA protection assays or the use of primers or probes attached to fluorescent dyes for the purpose of monitoring binding or product formation using fluorescence.
- blotting techniques involve the permanent or transient attachment of a molecule to a surface and a detection step that results in a readout.
- a multitude of molecules can be detected using blotting techniques, with non-limiting examples including proteins, peptides, RNA, DNA, carbohydrates and combinations thereof.
- chip-based techniques involved the attachment of a detector molecule to a chip and the subsequent exposure to a sample, with interactions between the detector molecule with the target to be detected being recorded.
- chips include peptide chips, protein chips such as antibody chips, nucleic acid chips and the like.
- enzymatic assays may also be used for the gene, gene products and interaction partners thereof such as the detector molecule for assessing the presence, concentration and/or activity thereof.
- the term "enzymatic assay”, as used herein, refers to any method that can be used to determine an enzymatic activity of interest.
- Non-limiting examples include, but are not limited to continuous assays, typically involving the use of UV/vis spectroscopy to monitor the turnover of chromogenic substrate molecules in the presence of enzyme molecules or the use of a light detector to record the activity of an enzyme that emits light upon turning over substrate, or discontinuous assays, wherein the concentration of substrate molecules is determined in regular intervals, for example through the use of High Pressure Liquid Chromatography, Western blotting or other quantitative methods.
- the term "enzymatic assays” comprises the use of ELISA (enzyme-linked immunosorbent assay) approaches and all variations thereof.
- proteomic approaches refers to any kind of method that allows for the detection of changes with respect to the protein composition of a sample, both in terms of the concentration and/or activity of one or more proteins.
- such approaches include the use of mass spectrometry, electrophoretic techniques, one or two dimensional protein gels, NMR (nuclear magnetic resonance) spectroscopy, protein chips, chromatographic methods including Liquid Chromatography Mass Spectrometry (LC-MS), Gas Source Mass Spectrometry (GS - MS) and the like, all of which are known to a person skilled in the art.
- a Multiplex particle assay refers to a method based on flow cytometry that makes use of antigen-coated beads in a multiplex test system, allowing for the use of more than one antibody to detect antigens in a single sample (Leinfelder et al. (2007) LABO (April 2007), pages 54-56).
- the marker gene or gene product thereof or combination of marker genes or combination of gene products thereof affect the presence, concentration and/or activity of a small molecule, preferably a metabolite, and metabolomic approaches or enzymatic assays are used to detect its presence, concentration and/or activity. Therefore, in a preferred embodiment, the presence, concentration and/or activity of a small molecule, which correlates with the presence, concentration and/or activity of a marker gene or gene product thereof, is detected to support or allow the diagnosis of a disease rather than the marker gene or gene product thereof itself.
- the term "metabolomic approach”, as used herein, comprises the use of NMR spectroscopy and mass spectrometry to detect a small molecule or combinations of small molecules.
- a disease preferably a neurodegenerative disease, and most preferably Alzheimer's Disease, can be diagnosed at any stage of the disease, preferably at an early stage of the disease.
- the term "early stage of a disease”, as used herein, refers to a state of an individual, wherein the individual suffers, knowingly or unknowingly, from said disease prior to the onset of clinical symptoms.
- the term "early stage of a disease”, as used herein, refers to a stage where symptoms are considered as MCI (mild cognitive impaired).
- MCI mimild cognitive impaired
- the term “MCI”, as used herein, refers to a state of cognitive functioning that is below defined norms, yet falls short of dementia in severity, and exists across a cognitive continuum with borders that are difficult to define precisely.
- MMSE refers to a scale that can be used for the determination of a cognitive deficit
- a score in the range of 27- 30 score is assigned to a cognitive healthy subject
- a score in the range of 24-26 is a assigned to a mild-cognitive-impaired (MCI) subject
- MCI mild-cognitive-impaired
- a score in the range of 19-23 is assigned to a slightly demented subject
- a score in the range of 12-18 score is assigned to a subject suffering from medium dementia
- a score in the range of 0-11 score is assigned to a severely demented subject.
- the term "subject”, as used herein, refers to any being which may or may not be ridden with a disease.
- the subject is a bird or a mammal.
- the subject is a human.
- Table 1 Gene markers useful to diagnose Alzheimer's disease Transporter and Channel related genes
- Oxidative-stress ana toxin metabolism related genes Oxidative-stress ana toxin metabolism related genes
- Affy ID represents the Affymetrix ID number as used in the microarray (gives the whole information on the gene, such as annotations, sequences etc.); Gene Name: the whole name of the protein/gene; Symbol: the consensus symbol of the gene; Expected expression: the alteration of expression expected compared to a healthy control; Gene Bank Accession No.: the number assigned to the sequence in NCBI; Function: the functional group the gene belongs to; Protein family: the protein family to which the gene belongs to.
- Fig. 1 depicts various timings of diagnosis and treatment in relation to the time course of a patient's mental capacities/accomplishments.
- Fig. 2 lists the genes investigated; house keeping genes are in bold.
- Fig. 3 depicts a time course (every 3 months in a period of 1 year) for each subject for gene expression and MMSE. Each line represents one subject. Time 1- February to March; Time 2- May to June; Time 3- August to September; Time 4- November to December. The t-Test p-values are given under each schema.
- Fig. 4 lists the descriptive statistics for the 33 gene expressions.
- Fig. 5 lists Pearson correlation coefficients and univariate p-values of the linear regression analysis between MMSE and the 33 genes. Significant results are in bold, and the lowest p- values in italics.
- Fig. 6 Scatter plot describing the correlation between MMSE scores and HIST1H3E mRNA expression in all four time points.
- Example 1 Peripheral blood mononuclear cells gene expression profile in Alzheimer's disease
- Fig. 2 In order to investigate the influence of gene expression alterations on MMSE, 33 genes (Fig. 2) were investigated separately. Figs. 3A and 3B show the time course for each gene where each line represents one patient. A very large variation between the time points (every 3 months, up to 4 times in a period of one year) could be found.
- Pearson correlation coefficients between the gene and MMSE were calculated in order to investigate the influence of time (up to 4 recruitments). T-tests were used if these correlation coefficients differed from zero, which would mean that the MMSE and the gene expression in a patient change over time in the same manner.
- CNRl are expressed primarily in the brain and in some peripheral tissues, while CNR2 are thought to be expressed primarily by immune cells in peripheral tissues, but nowadays are found to be expressed also in the brain (Onaivi, E.S., Ishiguro, H., Gong, J.P., Patel, S., Perchuk, A., Meozzi, P.A., Myers, L., Mora, Z., Tagliaferro, P., Gardner, E., et al., Ann N Y Acad Sci 1074:514-536 (2006)).
- histone proteins play key roles in the regulation of transcription. Transcription becomes active when histones are acetylated by histone acetyltransferase (HATs), silenced when histones are deacetylated by histone deacetylases (HDACs) and silenced or activated when methylated by histone methyltransferases (HMTs) (Berger, S. L. Curr Opin Genet Dev 12:142-148 (2002)). Soon as early as 1993 Mecocci et al.
- HATs histone acetyltransferase
- HDACs histone deacetylases
- HMTs histone methyltransferases
- Phosphorylated histone H3 a key component involved in chromosome compaction during cell division, was found to be increased in the cytoplasma of hippocampal neurons in AD subjects (Ogawa, O., Zhu, X., Lee, H.G., Raina, A., Obrenovich, M.E., Bowser, R., Ghanbari, H.A., Castellani, R.J., Perry, G., and Smith, M.A., Acta Neuropathol (Berl) 105:524-528 (2003)). Therefore, the aberrant cytoplasmic localization of phosphorylated histone H3 indicates a mitotic disruption that leads to neuronal dysfunction and neurodegeneration in AD. Accordingly the present inventors found in peripheral blood samples a significant increase of HIST1H3E mRNA with decreased MMSE scores, which points to the progress of the dementia stage.
- the inventors of the present invention confronted these points by using a larger group of subjects with one ethnical background (total 52 subjects, white Caucasian). Regarding gender, the inventors of the present invention had nearly 1:1 female to male in order to eliminate these variations (30:22, respectively).
- the present inventors used four time points for withdrawal of samples over the period of one year.
- the circadian and seasonal environment may influence gene expression and processes in the CNS as well as the periphery (Hofman, M.A., and Swaab, D.F., Prog Brain Res 138:255-280 (2002)).
- the present inventors did not find any significant correlation between the withdrawal time point and gene expression profile, but still some tendencies toward seasonal effects can be observed.
- RNA and the expression profile was shown to be strongly influence by the blood collection technique.
- the effects in gene expression alterations as a consequence of blood withdrawal and isolation methodology were eliminated by using the newly PAXgene methodology containing preserving fluid in order to "freeze" the RNA profile and eliminate extractions' variations and RNA degradation (Whitney, A.R., Diehn, M., Popper, S.J., Alizadeh, A.A., Boldrick, J.C., Relman, D.A., and Brown, P.O., Proc Natl Acad Sci U S A 100:1896-1901 (2003), Rainen, L., Oelmueller, U., Jurgensen, S., Wyrich, R., Ballas, C, Schram, J., Herdman, C, Bankaitis-Davis, D., Nicholls, N., Trollinger,
- Example 2 Studies on gene expression alterations in living humans with and without Alzheimer's disease
- Alzheimer's Disease and Related Disorders Association criteria McKhann G, Drachman D, Folstein M, Katzman R, Price D, Stadlan EM (1984) Clinical diagnosis of Alzheimer's disease: report of the NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer's Disease. Neurology 34, 939-944.)- Alzheimer's Disease Assessment Scale-cognitive subscale (ADAS- cog) (Pena-Casanova J (1997) Alzheimer's Disease Assessment Scale— cognitive in clinical practice.
- ADAS- cog Alzheimer's Disease Assessment Scale— cognitive in clinical practice.
- the MMSE was used for following up the progression, while the other two were used for rough estimation of the diagnosis assessment. Further information was obtained by Unified Parkinson Scale. Depressive and anxiety symptoms were assessed with Hamilton Depression Scale, Short Geriatric Depression Scale and State Trait Anxiety Inventory (Xl, X2) (for details see Table 4). These scales were used in order to rule out subjects with sever neurologic of psychiatric disorders. In addition detailed information on medication and smoking habits were collected. Subjects were retested every 3 months in a period of one year for all parameters (4 recruitments, see Table 4).
- MMSE ⁇ 24 52 subjects from both genders (30 females and 22 males) aged between 54.5-95 years were recruited for this study. 34 were non-demented control subjects with no cognitive deficits and MMSE scores 25-30 and 18 subjects were diagnosed as demented with AD (multiple cognitive deficits with significant psychosocial impairment) (MMSE ⁇ 24).
- Whole blood was collected with PAXgeneTM Blood RNA system (Becton Dickinson GmbH, Heidelberg, Germany). The blood samples were frozen at -20 0 C until further process for RNA isolation.
- RNA isolation reagents were prepared from 0.2 ⁇ M filtered, diethyl pyrocarbonate (DEPC) -treated water (Fermentas Inc., Hanover, MD, USA) throughout the isolation procedure.
- Total RNA samples were spectrophotometrically scanned (Experion, BioRad Co., Hercules, CA, USA) from 220 to 320 nm; the A260/A280 of total RNA was typically >1.9. 3.
- RNA (1 ⁇ g) from each sample was reverse transcribed with random hexamer & oligo-dT primer mix using iScript (BioRad Co., Hercules, CA, USA).
- Quantitative real-time PCR was performed in the iCycler iQ system (BioRad Co., Hercules, CA, USA) as described previously (Gr ⁇ nblatt E, Zander N, Bartl J, Jie L, Monoranu CM, Arzberger T, Ravid R, Roggendorf W, Gerlach M, Riederer P (2007) Comparison Analysis of Gene Expression Patterns between Sporadic Alzheimer's and Parkinson's Disease. J Alzheimers Dis 12, 291-311).
- the genes were normalized to the 5 most stable house-keeping genes: ACTB, RPL13A, PPIA, GAPDH and R18S.
- Standard curves for each amplification product were generated from 10-fold dilutions of pooled PCR-amplicons (isolated using MiniElute Gel Extraction Kit (Qiagen, Hilden, Germany) to determine primer efficiency and quantization. Data was analyzed with Microsoft Excel 2000 to generate raw expression values.
- Diazepam binding inhibitor GABA receptor modulator, acyl- DBI NM_020548 Coenzyme A binding protein
- Transient receptor potential cation channel, subfamily M, member 6 TRPM6 AF350881 Cannabinoid receptor 2 CNR2 NMJ)01841 amyloid beta (A4) precursor protein APP BC004369
- Table 3 Pearson correlation coefficients and univariate p-values of the linear regression analysis between MMSE and the 33 genes.
- Subject Age Gender Diagnose (a) MMSE MMSE MMSE MMSE
- Int Psychogeriatr 9 Suppl 1, 173-176; discussion 177-178. were administered to all subjects.
- the MMSE was used for following up the progression, while the other two were used for rough estimation of the diagnosis assessment. Further information was obtained by Unified Parkinson Scale (Goetz CG, Stebbins GT, Shale HM, Lang AE, Chernik DA, Chmura TA, Ahlskog JE, Dorflinger EE (1994) Utility of an objective dyskinesia rating scale for Parkinson's disease: inter- and intrarater reliability assessment. Mov Disord 9, 390-394.). Depressive and anxiety symptoms were assessed with Hamilton Depression Scale (Hamilton M (1960) A rating scale for depression.
- Subject A6 and subject Al 1 showed at assessment period-Ill and subject Al 7 showed at assessment period-II unspecific symptoms of physical diseases.
- Subject A9 underwent surgery some days before assessment. At assessment period-I and -II the same 10 subjects took anticholinergic drugs only 2 of them have increased dosage. At assessment period-II, additional 4 subjects that were assessed the first time took anticholinergic drugs. At assessment period-Ill, again, 14 subjects took anticholinergic drugs two of these subjects have discontinued anticholinergic medication, two have started medication and one has decreased dosage. At assessment period-IV, one of these subjects has discontinued anticholinergic medication, and one has decreased dosage. At all four assessment periods all the subjects underwent any pharmacological treatment with the exception of 2 healthy controls.
- cDNA (1 :10 diluted final amount of 10-30ng) and gene specific primers (probes, when assays with probes) were used in each reaction with total volume of 25 ⁇ l.
- gene specific primers probes, when assays with probes
- the same amount of cDNA was used for analysis, high abundant genes were assayed with the lower amount of cDNA while the lower abundant genes were assayed with the higher amount of cDNA.
- QuantiTect assays we used QuantiTectTM Custome Assay (Qiagen Inc., Valencia, CA, USA) (Supplementary Table 2) were added to QuantiTect (Probe/SYBR Green) PCR Master Mix (Qiagen Inc., Valencia, CA, USA).
- the assays with designed primers we used the iQ-SYBR Green Supermix (BioRad, Hercules, California, USA).
- Amyloid beta APBA3 CAGGCAAGGGATGAGGTG SYBR 170 40 67 91 8 precursor CTTGAGATCAATGGGCAGAG protein-binding, family A, member 3 (AI141541) beta-site APP- BACEl QuantiTect Primer Assay SYBR 146 40 manual 95 3 cleaving enzyme 1 (NM_012104)
- Insulin-like IGF-IR QuantiTect Primer Assay SYBR 106 40 manual 98 5 growth factor 1 receptor (NM_000875)
- Transferrin TF QuantiTect P ⁇ mer Assay SYBR 190 40 manual 96 8 (NM_ 00106 3) ferritin, heavy CTGGAGCTCTACGCCTCCTA SYBR 232 30 64 882 polypeptide 1 FTHl CACACTCCATTGCATTCAGC (NM_002032) glutathione S- GSTMl CCTCCTCGTTCCTTTCTCCT SYBR 28 5 40 63 882 transferase Ml, ACCAGTCAATGCTGCTCCTT transcript variant 1 (X08020)
- Heme HMOX 1 GCCAGGTGACCCGAGACG SYBR 120 40 60 99 oxygenase GGAAGTAGACAGGGGCGAAGA C (decycling) 1 (NM_002133)
- the mean values and standard deviations are calculated over all time points and patients.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Pathology (AREA)
- Urology & Nephrology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention is related to a use of a marker gene or a gene product thereof or a combination of marker genes or a combination of the gene products thereof, wherein the marker gene(s) is/are selected from the group comprising SLC1A7, SLC1A2, TF, GRIK4, CNR2, IGF-1R, CHAK2, GRINL1A, CHRNA1, GSTM1, FTH1, NDUFS3, LYST, SYNII, COG2, PEX5, STX5A, HIST1H3E, IRS4, RPL36A, GFAP, IDE and DEFA1; as a peripheral marker for diagnosing a neurodegenerative disease.
Description
Early and differential diagnosis test for Alzheimer's disease
The present invention is related to an in vitro method for diagnosing Alzheimer's disease.
Alzheimer's disease (AD) is the most common cause of dementia in late life. More than 40% of those aged 85 years or older may be affected (R. Terry, E. Masliah, L. Hansen, in Alzheimer Disease, R. Terry, R. Katzman, K. Bick, S. Sisodia, Eds. (Lippincott Williams & Wilkins, USA, 1999), pp. 187-206).
In terms of behaviour, the disease is characterized by global cognitive decline, and defining histological features including two distinguishing pathologies: amyloid plaques, which are extracellular deposits consisting mainly of aggregated β-amyloid peptide, and neurofibrillary tangles (NFT), which are intracellular deposits consisting predominantly of hyperphosphorylated tau protein.
The mechanism of cell death in AD is largely unknown. Among the hippocampal pyramids and neurons of the entorhinal region, cell death seems to be closely related to the presence of NFT, many of which are left behind in the neuropil when the neuronal nucleus and cytoplasm disappear. In the cortex, however, this does not seem to be true, since there is no apparent relationship between the presence of tangles and the number of missing neurons. Extraneuronal tangles are extremely rare in the neocortex (R. Terry, E. Masliah, L. Hansen, in Alzheimer Disease, R. Terry, R. Katzman, K. Bick, S. Sisodia, Eds. (Lippincott Williams & Wilkins, USA, 1999), pp. 187-206).
Epidemiological and molecular studies suggest that AD has multiple etiologies, including genetic mutations, susceptibility genes and environmental factors such as aluminum that promote formation and accumulation of insoluble amyloid-beta (A-β) and hyperphosphorylated tau (R. A. Yokel, Neurotoxicology 21, 813 (2000)). Mutations in three known genes, the amyloid precursor protein (APP) and presenilin (PS) 1 and 2 genes, nearly
always cause the disease (M. Cruts, C. Van Broeckhoven, Ann Med 30, 560 (1998), C. D. Steele, Nurs Clin North Am 35, 687 (2000)). However, from the perspective of the common form of AD seen in clinical practice, the autosomal dominant forms represent less than 2% of the incidence or prevalence (A. M. Saunders, J Neuropathol Exp Neurol 59, 751 (2000)). Apolipoprotein E (APO E) is a fourth genetic factor involved in the development of AD. Unlike the three deterministic genes, APOE is a susceptibility locus that accounts for approximately half of the late onset AD (A. M. Saunders, J Neuropathol Exp Neurol 59, 751 (2000), C. L. Masters, K. Beyreuther, Bmj 316, 446 (1998)) . Several polymorphisms were found to be associated with early or late-onset AD, such as interleukin-1 (IL-I) polymorphisms in the IL-IA and IL-IB genes ( J. A. Nicoll et al, Ann Neurol 47, 365 (2000); R. E. Tanzi, Ann Neurol 47, 283 (2000); Y. Du et al, Neurology 55, 480 (2000)), transforming growth factor-βl gene (E. K. Luedecking, S. T. DeKosky, H. Mehdi, M. Ganguli, M. I. Kamboh, Hum Genet 106, 565 (2000)) and alpha-antichymotrypsin gene (G. Meng et al, Hum Mutat 16, 275 (2000)). Unfortunately, all these gene mutations and polymorphisms still cannot account for all AD cases, and the possibility of multiple gene involvement, such as up or down regulation of some gene expression in addition to polymorphisms or gene mutations and environmental involvement should be considered.
The diagnosis of dementia, AD as well as other diseases resulting into dementia is still a decision based on multiple sources of information that are considered simultaneously. The reason for this situation is that no single biological marker exists for AD or other dementias (O. Almkvist, B. Winblad, Eur Arch Psychiatry Clin Neurosci 249, 3 (1999)). The diagnostic methods used until now are suitable to detect AD only at a relatively late stage of the disease (O. Almkvist, B. Winblad, EMr Arch Psychiatry Clin Neurosci 249, 3 (1999)). In addition, some of the methods are quite invasive; therefore, they may not be used regularly. The psychological diagnostic tools, such as Mini-Mental Status Examination (MMSE) (D. W. O'Connor et al, J Psychiatr Res 23, 87 (1989) or by indices of stage such as Clinical Dementia Rating (CDR) (L. Berg, Psychopharmacol Bull 24, 637 (1988)), are somewhat inaccurate, and their accuracy is approximately 85% (S. T. Dinsmore, J Am Osteopath Assoc 99, Sl (1999)). The new techniques of imaging studies with single photon emission tomorgaphy (SPECT) or positron emission tomography (PET) are still extremely expensive and inaccurate (O. Almkvist, B. Winblad, Ewr Arch Psychiatry Clin Neurosci 249, 3 (1999)). Biochemical studies carried out using the cerebrospinal fluid (CSF) are invasive, require the
determination of more than one parameter in order to achieve a high degree of specificity and sensitivity and are still inaccurate (O. Almkvist, B. Winblad, Eur Arch Psychiatry Clin Neurosci 249, 3 (1999), 16) (Simonsen et al. 2007a and b). Recently, biomarkers in plasma were studied using protein arrays which may provide an early prediction for AD from mild cognitive impairment state (MCI) (Ray et al. 2007). However, as the panel of proteins used belong to the inflammatory functional group it may overlap with other neurodegenerative diseases that show also inflammation features. The final diagnostic method is the brain biopsy, which is rarely performed in practice. This is the only method available for accomplishing a diagnostic accuracy of near 100% (S. T. Dinsmore, J Am Osteopath Assoc 99, Sl (1999)), but highly invasive and rarely justified to confirm a diagnosis. Fig. 1 recapitulates that current diagnosis options either provide a late diagnosis when the degeneration of the neurons already occurred or act as confirmatory methods in post-mortem material according to Braak and Braak or the CERAD methodology (Fig 1).
Moreover, all these diagnostic methods are able to detect AD in subjects only when nearly 60-70% of the neurons are degenerate, as symptoms appear only at this stage (A. M. Saunders, JNeuropathol Exp Neurol 59, 751 (2000), P. Riederer, K. Jellinger, Exp Brain Res Suppl, 158 (1982), H. Braak, E. Braak, Acta Neuropathol (Berl) 82, 239 (1991)). As a result, it is almost impossible to treat, let alone rescue such neurons.
Thus, a problem underlying the present invention is to provide a non-invasive and cost- efficient method to diagnose Alzheimer's disease that can be applied at an early stage of the disease. A further problem underlying the present invention is to detect in an early stage of the degeneration, either before subjects will become MCI or during MCI phase, whether this person will develop AD and provide respective means therefore.
The problem underlying the present invention is solved by the subject matter of the independent claims. Preferred embodiments may be taken from the dependent claims.
The problem underlying the present invention is solved in a first aspect which is also a first embodiment of the first aspect, by the use of a marker gene or a gene product thereof or a combination of marker genes or a combination of the gene products thereof, wherein the marker gene(s) is/are selected from the group comprising SLC 1A7, SLC 1A2, TF, GRIK4,
CNR2, IGF-IR, CHAK2, GRINLlA, CHRNAl, GSTMl, FTHl, NDUFS3, LYST, SYNII, COG2, PEX5, STX5A, HIST1H3E, IRS4, RPL36A, GFAP, IDE and DEFAl; as a peripheral marker for diagnosing a neurodegenerative disease.
In a second embodiment of the first aspect which is also an embodiment of the first embodiment of the first aspect, the neurodegenerative disease is Alzheimer's disease.
In a third embodiment of the first aspect which is also an embodiment of the first and the second embodiment of the first aspect, the marker gene is HISTH3E. Preferably, the marker or marker gene is increased with decreased MMSE scores.
In a fourth embodiment of the first aspect which is also an embodiment of the first and the second embodiment of the first aspect, the marker gene is CNR2. Preferably, the marker or marker gene is increased with decreased MMSE score.
In a fifth embodiment of the first aspect which is also an embodiment of the first, second, third and fourth embodiment of the first aspect, the combination of marker genes or combination of the gene products thereof comprises at least HISTH3E or CNR2.
In a sixth embodiment of the first aspect which is also an embodiment of the first, second, third and fourth embodiment of the first aspect, the combination of marker genes or combination of the gene products thereof comprise at least HISTH3E and CNR2.
In a seventh embodiment of the first aspect which is also an embodiment of the first, second, third, fourth, fifth and sixth embodiment of the first aspect, the the marker gene or gene product thereof or combination of marker genes or combination of gene products thereof is used as a marker for diagnosing the neurodegenerative disease at an early stage of the neurodegenerative disease.
The problem underlying the present invention is solved in a second aspect which is also a first embodiment of the second aspect, by the use of a detector molecule that binds to a marker gene or a gene product thereof, whereby the marker gene is as defined in connection
with any embodiment of the first aspect, for diagnosing a neurodegenerative disease, preferably Alzheimer's disease.
In a second embodiment of the second aspect which is also an embodiment of the first embodiment of the second aspect, the detector molecule consists of at least two species of detector molecule, whereby each species binds to a marker gene or a gene product thereof and whereby the marker gene or gene product thereof is different for each species of detector molecule.
In a third embodiment of the second aspect which is also an embodiment of the first and the second embodiment of the second aspect, the detector molecule is a nucleic acid selected from the group comprising oligonucleotides, deoxyribonucleic acids, ribonucleic acids, aptamers and spiegelmers.
In a fourth embodiment of the second aspect which is also an embodiment of the first and the second embodiment of the second aspect, the detector molecule is selected from the group comprising peptides, proteins, antibodies, anticalines, peptide-aptamers and small molecules.
The problem underlying the present invention is solved in a third aspect which is also a first embodiment of the third aspect, by a method for the diagnosis of a disease comprising the following steps:
(a) providing a sample from a subject to be diagnosed, whereby the sample contains or is suspected to contain one or more marker gene(s) or gene product(s) thereof as defined in connection with the first aspect and more specifically any embodiment of the first aspect; and
(b) detecting the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof.
In a second embodiment of the third aspect which is also an embodiment of the first embodiment of the third aspect, the presence, concentration and/or activity of said one or more marker gene(s) or product(s) thereof correlate(s) or is/are correlated with the disease.
In a third embodiment of the third aspect which is also an embodiment of the first and the second embodiment of the third aspect, the said one or more marker gene product(s) is a/are RNA molecule(s).
In a fourth embodiment of the third aspect which is also an embodiment of the first and the second embodiment of the third aspect, said marker gene(s) product(s) thereof is a/are peptide(s) or protein(s).
In a fifth embodiment of the third aspect which is also an embodiment of the first, second, third and fourth embodiment of the third aspect, the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using PCR-related techniques.
In a sixth embodiment of the third aspect which is also an embodiment of the fifth embodiment of the third aspect, the PCR-related techniques comprise real-time, reverse transcriptase PCR techniques and RNA protection assays.
In a seventh embodiment of the third aspect which is also an embodiment of the first, second, third and fourth embodiment of the third aspect, the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using blotting techniques and/or chip-based techniques.
In an eighth embodiment of the third aspect which is also an embodiment of the first, second, third and fourth embodiment of the third aspect, the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using enzymatic assays or binding assays.
In a ninth embodiment of the third aspect which is also an embodiment of the first, second, third and fourth embodiment of the third aspect, the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using detection methods, whereby such detection methods are selected from the group comprising chromatography, mass spectrometry, electrophoresis, GS-MS and LC-MS.
In a tenth embodiment of the third aspect which is also an embodiment of the first, second, third and fourth embodiment of the third aspect, the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using an interaction partner of such a molecule/ such molecules, whereby the interaction partner is selected from the group comprising antibodies, anticalines, peptide-aptamers, aptamers and spiegelmers.
In an eleventh embodiment of the third aspect which is also an embodiment of the tenth embodiment of the third aspect, said assessing is performed using a technique selected from the group comprising blotting techniques, enzymatic assays, binding assays and chip-based techniques.
In a twelfth embodiment of the third aspect which is also an embodiment of any of the first to the eleventh embodiment of the third aspect, the disease is a neurodegenerative disease.
In a 13 th embodiment of the third aspect which is also an embodiment of the twelfth embodiment of the third aspect, the neurodegenerative disease is Alzheimer's disease.
In a 14th embodiment of the third aspect which is also an embodiment of any of the first to the 13th embodiment of the third aspect, the subject is a mammal.
In a 15th embodiment of the third aspect which is also an embodiment of the 14th embodiment of the third aspect, the mammal is a human being.
In a 16th embodiment of the third aspect which is also an embodiment of any of the first to the 15th embodiment of the third aspect, the sample is derived from one or more body fluids.
In a 17th embodiment of the third aspect which is also an embodiment of the 16 embodiment of the third aspect, the body fluid is selected from the group comprising blood, whole blood, peripheral blood, plasma, blood cells, CSF and saliva.
The present invention is based on the surprising finding that peripheral markers exist the expression of which, as detectable in vitro using material from sources other than brain tissue, indicates, at an early stage, affliction with Alzheimer's disease.
The inventors of the present invention have more specifically found that a marker gene or a gene product thereof, which is also referred to herein as a marker gene product, or a combination of such marker or marker gene products thereof may be used as (a) peripheral marker(s) for diagnosing a disease, more preferably a neurodegenerative disease and most preferably Alzheimer's disease., whereby the marker gene(s) is/are SLC1A7, SLC1A2, TF, GRIK4, CNR2, IGF-IR, CHAK2, GRINLlA, CHRNAl, GSTMl, FTHl, NDUFS3, LYST, SYNII, COG2, PEX5, STX5A, HIST1H3E, IRS4, RPL36A, GFAP, IDE DEFAl as depicted in Table 1. hi a preferred embodiment, the marker gene is HIST3H3E. These genes comprise genes from groups of transporter and Channel related genes; receptor and channels related genes; vesicle, synapse and protein transport related genes; oxidative-stress and toxin metabolism related genes; transcription, translation and signal transduction related genes; and structural proteins and enzymes related genes.
Without wishing to be bound to by any theory, the present inventors assume that barriers separating the blood and brain tissue are, to a certain extent, permeable to marker genes and marker gene products, which are released as a result of neuronal damages or loss and thus being present in body fluids and peripheral organs which are different from the brain. In accordance with the present invention such marker genes and marker gene products are used as peripheral markers of a disease such as a neurodegenerative disease, including, but not limited to Alzheimer's disease. Alternatively, the presence, concentration and/or activity of the marker genes and/or the marker gene products may differ in the diseased state compared to a healthy subject as a result of intracellular events associated with Alzheimer's disease, such as, for example, elevated levels of reactive oxygen species. In connection with such events, the marker genes and/or marker gene products and thus the amount of molecules leave the cell in a different way or to a different extent, thus, changing their presence, concentration and/or activity.
Samples indicative of the affliction of a subject suffering from or suspected of suffering from Alzheimer's disease may be derived from any tissue and body fluid other than the brain and CSF for the purpose of diagnosing Alzheimer's disease in accordance with the present invention, despite the fact that the brain is separated from the blood through barriers such as the blood-brain-barrier, at least in a healthy subject.
In a preferred embodiment of the invention, the term "peripheral blood", as used herein, by contrast to solid tissues such as neuronal tissues, refers to blood circulating through the body as well as any component thereof such as cellular components, with non-limiting examples being red blood cells, white blood cells and platelets. The peripheral blood may comprise molecules such as electrolytes, metabolites, peptide proteins, carbohydrates, liquids, nucleic acids or combinations thereof, which may or may not originate from other tissues or other parts of the body, i.e. tissues and parts of the body different from the brain. In another preferred embodiment, the term "peripheral blood", as used herein, comprises fractions of the peripheral blood. In a particularly preferred embodiment, the term "peripheral blood", as used herein, comprises a preparation of red blood cells. In a preferred embodiment, the term "whole blood", as used herein, refers to peripheral blood from which no fractions or components have been removed or separated, although the blood may have been processed, for example through the addition of chemicals. In another preferred embodiment, the term "whole blood" and the term "peripheral blood", as used herein, may be used synonymously.
In a preferred embodiment, the term ,,metabolites", as used herein, refers to molecules that are products and intermediates of the metabolism. Non-limiting examples include, but are not limited to sugars, organic acids, amino acids, nucleotides, lipids, fatty acids and the like.
In a preferred embodiment, the term "nucleic acid", as used herein, refers to a polymer comprising at least two nucleotide units attached to each other, preferably via phosphodiester bonds. Nucleotide units typically include a sugar moiety, for example ribose or deoxyribose, attached to a nitrogen base, for instance adenine, guanine, thymine, cytosine or uracil, although the scope of the invention includes alternative sugar moiety, bases and backbones such as the ones incorporated through the use of artificial nucleotide in chemical syntheses including phosphothioates. In a preferred embodiment of the present invention, a nucleic
acid is deoxyribonucleic acid (DNA), in another preferred embodiment of the present invention, the nucleic acid is a ribonucleic acid (RNA).
In another embodiment of the invention, a nucleic acid is an aptamer. In a preferred embodiment of the invention, the term "aptamer", as used herein, refers to a D-nucleic acid which is either single-stranded or double-stranded and which specifically interact with a target molecule. The manufacture or selection of aptamers is, e. g., described in European patent EP 0 533 838. The length of aptamers typically ranges from as little as 15 to as much as 80 nucleotides, and preferably ranges from about 20 to about 50 nucleotides.
In another embodiment of the invention, a nucleic acid is a spiegelmer. In a preferred embodiment of the invention, the term "spiegelmer", as used herein, refers to a are molecule similar to an aptamer. However, spiegelmers consist either completely or mostly of L- nucleotides rather than D-nucleotides in contrast to aptamers. Otherwise, particularly with regard to possible lengths of spiegelmers, the same applies to spiegelmers as outlined in connection with aptamers. The manufacture of spiegelmers is described in international patent application WO 98/08856.
In a preferred embodiment of the present invention, the term "peptide", as used herein, refers to any polymer consisting of at least two amino acids which are covalently linked to each other, preferably through a peptide bond. More preferably, a peptide consists of two to ten amino acids. A particularly preferred embodiment of the peptide is an oligopeptide which even more preferably comprises from about 10 to about 100 amino acids. Amino acids typically include the natural proteinogenic L-amino acids, in particular glycine, alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, tryptophan, cystein, methionine, serine, threonine, lysine, arginine, histidine, aspartate, glutamate, asparagine and glutamine, but also any other kind of amino acid that can be chemically or enzymatically synthesised. In a preferred embodiment, the term "amino acid", as used herein, also comprises derivatives and isomers of the proteinogenic L-amino acids, for example D-amino acids. In a preferred embodiment of the invention, the term "proteins", as used herein, refers to polymers consisting of a plurality of amino acids which are covalently linked to each other, preferably through a peptide bond. Preferably, such proteins comprise about at least 100 amino acids or amino acid residues. In a preferred embodiment, the peptide or protein is a so-called
"anticaline" which is, among others, described in German patent application DE 197 42 706. In a preferred embodiment, the peptide is a peptide-aptamer. In a preferred embodiment, the term "peptide aptamer", as used herein, refers to a high affinity binding peptide which can be identified from random sequence peptide libraries comprising 10 to 10 peptides differing in their amino acid sequence in a manner similar to aptamers.
In a preferred embodiment of the invention, the term "marker", as used herein, refers to any kind of molecule that is, directly or indirectly, for example by itself or through precursors, derivatives or products thereof, or interactions with other molecules, organelles, cells, tissues or the like, associated with and, preferably, indicative of a certain physiological state of an organism. In a more preferred embodiment, the physiological state is a disease. In another preferred embodiment, the marker can be used to diagnose a disease. In another preferred embodiment of the invention, the term "marker gene", as used herein, is a gene that is differentially expressed in a disease or a diseased organism compared to the healthy organism, and the disease can be diagnosed by way of analysis of the differential expression of said marker gene. In a particularly preferred embodiment of the present invention, such differential expression, but also other mechanisms lead to changes concerning the presence, concentration and/or activity of a gene product of such marker gene.
In a preferred embodiment of the invention, the term "peripheral marker", as used herein, is a marker that can support a diagnosis comprising the analysis of peripheral blood based on or making use of a sample which is preferably different from neuronal tissue and/or cerebrospinal fluid. Preferably the sample contains or is derived from a body fluid. In an embodiment, the body fluid is different from cerebrospinal fluid.
In a preferred embodiment, the term "gene product", as used herein, refers to any molecule that is the result of a transcription process of the gene of interest or fragments thereof and all forms derived thereof, comprising, but not limited to transcripts or fragments thereof, including, but not limited to truncated, spliced, fused, rearranged, cleaved and covalently modified forms thereof and the like; as well as any molecule that is the result of a translation process of the gene or fragments thereof, comprising, but not limited to peptides, proteins, cleaved, rearranged, fused, covalently modified, oxidised, reduced, truncated forms thereof.
Typically, the gene product is a mature mRNA transcript or polypeptide or a protein. In an embodiment, a fragment gene product has the essential features of the respective full length gene. In another preferred embodiment, the term "marker gene product", as used herein, refers to the gene product of a marker gene.
In a preferred embodiment of the invention, a gene product may, among others, as a consequence of its differential expression or any other mechanism, affect the metabolism, so that the presence, concentration and/or activity of metabolites in the brain and/or in any body fluid may be altered. In such a case, the presence of metabolites in fluids of the body may be altered in an indicative manner, thus, in a preferred embodiment of the invention, such changes of the presence, concentration and/or activity of a metabolite could be detected for the purpose of supporting a diagnosis. Preferably such detection is based or performed on a on a sample as defined herein.
In a preferred embodiment of the invention, the term "neurodegenerative disease", as used herein, refers to a disease that is associated with an altered, preferably decreasing degree of neuronal viability and/or activity. Non-limiting examples of neurodegenerative disease include, but are not limited to Alzheimer's disease, Parkinson's disease, Huntington disease, Lewy body dementia, Prion diseases.
Again, without wishing to be bound to a particular theory, upon penetrating and passing a barrier, the marker gene or a gene product thereof or a combination of marker genes or a combination of gene products thereof may be released into the peripheral blood, where their presence, concentration and/or activity directly correlate with the disease and can be detected. Alternatively, even minute concentrations of such marker gene or gene product thereof or combination of marker genes or combination of gene products thereof released into the peripheral blood may trigger signal transduction cascades, affect the activity of peripheral enzymes, receptors, ion channels, transport molecules or the like to the effect that the presence, concentrations and/or activities of downstream molecules will be affected, thus contributing directly or indirectly to the symptoms of such neurodegenerative disease.
In one aspect of the present invention, detector molecules are used so as to detect the marker gene and/or a gene product thereof, whereby the interaction between the detector molecule and the marker gene and the gene product thereof, respectively is used in order to diagnose the disease. In a preferred embodiment, a detector molecule is any type of molecule that interacts with or detects a marker gene or marker gene product, which may be used for diagnosing the disease. In a most preferred embodiment, the disease is a neurodegenerative disease and preferably Alzheimer's disease and is diagnosed as a result of the detector molecule binding to a marker gene or marker gene product. In a preferred embodiment, the term "to bind", as used herein, means any contact between at least two molecules beyond any random interaction. In a more preferred embodiment, the binding involves the formation of a stable complex characterized by dissociation constants in the range of 1 fM - 100 μM, preferably 1 pM - 100 nM, more preferably 0,1 nM — 10 nM. hi a particularly preferred embodiment, when the detector molecule is a nucleic acid such as a primer or probe and the marker gene and/or gene product thereof is another nucleic acid such as a DNA or RNA molecule, the binding involves the formation of a double stranded piece of nucleic acid based on specific base pairing such as the formation of Watson-Crick base pairs. The person skilled in the art knows how to design such molecules, how to synthesize such molecules, either through synthetic or recombinant approaches, and how to evaluate their ability to act as detector molecules.
In a preferred embodiment, the detector molecule is a nucleic acid selected from the group comprising oligonucleotides, deoxyribonucleic acids, ribonucleic acids, aptamers and spiegelmers. In a preferred embodiment, the term "oligonucleotide", as used herein, is a relatively short pieces of any type of nucleic acid; typically a oligonucleotide, irrespective of whether it is an oligoribonucleic acid or a deoxyribonucleic acid, comprises about 10 - 100 pairs. In another particularly preferred embodiment of the invention, the terms "primers" and "probes" are oligonucleotides used for analytical purposes. Typically, a probe is a deoxyribonucleic acid of about 20 - 30 bases used to detect an RNA transcript of a gene through a stable hybridization. Typically, a primer is a deoxyribonucleic acid of the same length used to perform an analytical or preparative PCR reaction.
In another preferred embodiment, the detector molecule is selected from the group comprising peptides, proteins, antibodies, anticalines, and peptide-aptamers. In a preferred
embodiment, the term "antibody", as used herein, comprises any construct, fragment, derivate, fusion or the like including at least one binding domain of an antibody. The person skilled in the art is aware of procedures to identify peptides, proteins, antibodies, anticalines, and peptide-aptamers that bind to a molecule of interest and how to obtain peptides, proteins, antibodies, anticalines, and peptide-aptamers, either through synthetic or recombinant approaches, and how to evaluate their ability to act as detector molecules.
In another preferred embodiment, the detector molecule is a small molecule. In a preferred embodiment, the term "small molecule", as used herein, refers to a compound of any chemical identity having a molecular weight of approximately 1000 Dalton and following the Lepinsky Rules of Five. Small molecules are typically provided in the form of chemical libraries comprising thousands of different species. The person skilled in the art knows how to synthesize small molecules and how to evaluate their ability to act as detector molecules.
In a preferred embodiment, the term "the detector molecule consists of at least two species of detector molecule", as used herein, means that the detector molecule consists of at least two separate entities of detector molecules, whereby the first entity detects a first marker gene or product thereof, the second entity detects a second marker gene or products thereof other than the first marker gene or gene product thereof, and so on. Consequently, the detector molecule comprises at least one entity for each marker gene or gene product thereof to be detected. For example, the detector molecule may consist of two probes that have been separately synthesized and are not physically associated with each other, and the first probe detects an mRNA transcript of one marker gene and the second probe detects an mRNA transcript of another marker gene.
In many cases, it may be possible to increase the accuracy and reliability of uses of marker genes and or gene products thereof for the diagnosis of a neurodegenerative disease, preferably Alzheimer's disease, by detecting a combination of marker genes and/or gene products thereof and by using, accordingly, a combination of detector molecules to detect the presence, concentration and/or activity of each marker gene or gene product thereof. In a preferred embodiment, 23 detector molecules are used to detect 23 marker genes or gene products thereof for the diagnosis of a neurodegenerative disease, preferably Alzheimer's
disease. Typically, this involves the use of 23 different probes to detect the presence of 23 marker gene transcripts.
The use of marker genes and/or gene products thereof can be plausibly implemented in methods that are straightforward to perform and known to a person skilled in the art and are suitable to support or allow the diagnosis of a neurodegenerative disease, preferably Alzheimer's disease. Such methods have the potential for routine use and for use on a high- throughput scale.
Knowledge with respect to the differences between diseased and healthy subjects with respect to the presence, concentration and/or activity of marker genes or gene products thereof support or allow the diagnosis of a neurodegenerative disease, preferably Alzheimer's disease. In a preferred embodiment, the presence, concentration and/or activity of said one or more marker gene(s) or product(s) thereof correlate(s) or is/are correlated with the disease. The present inventors have found such differences, and relevant results are shown in Table 1.
If the expression of a known marker gene is known to be up-regulated in a diseased subject, a state that is usually associated with the presence, elevated concentrations and/or activities of the marker gene or gene products thereof, the presence, elevated concentration and/or activity of said marker gene or gene product thereof detected in samples derived from him or her, indicate that a subject suspected of suffering from said neurodegenerative disease, preferably Alzheimer's disease, actually suffers from said neurodegenerative disease. In the case of such a marker gene, the absence or normal or decreased concentration and/or activity of said marker gene or gene product thereof in a sample derived from a subject would indicate that he or she does not suffer from said neurodegenerative disease, preferably Alzheimer's disease.
For example, the expression of the gene encoding for channel kinase 2 is up-regulated in subjects suffering from Alzheimer's disease. Therefore, the presence, elevated concentration and/or activity of the channel kinase 2 gene or gene products thereof in a sample derived from a subject suspected of suffering from Alzheimer's disease indicates that said subject actually suffers from Alzheimer's disease.
Likewise, if, the expression of a known marker gene is known to be down-regulated in a diseased subject, a state that is usually associated with the absence or a decreased concentration and/or activity of the marker gene, the absence or decreased concentration and/or activity detected in samples derived from him or here, indicate that a subject suspect of suffering from said neurodegenerative disease, preferably Alzheimer's disease, actually suffers from said neurodegenerative disease.
For example, the expression of the gene encoding for transferrin is down-regulated in subjects suffering from Alzheimer's disease. Therefore, the absence, decreased concentration and/or activity of the transferrin gene or gene products thereof in a sample derived from a subject suspected of suffering from Alzheimer's disease indicates that said subject actually suffers from Alzheimer's disease.
The nature of the marker gene product(s) is diverse. In an embodiment, the marker gene product(s) is/are RNA molecule(s). In another embodiment, the marker gene product(s) is/are peptide(s) or protein(s).
In a preferred embodiment, the methods according to the present invention are applicable following the derivation of a sample from a subject. In a preferred embodiment, all steps comprised by the methods according to the present invention are performed in vitro. In another preferred embodiment, the provision of the sample explicitly excludes any interaction with the body of a subject.
In analogy to uses, it is possible to increase the accuracy of a method for the diagnosis of a neurodegenerative disease, preferably Alzheimer's disease, by detecting a combination of marker genes and/or gene products thereof preferably using a combination of detector molecules to detect the presence, concentration and/or activity of each marker gene or gene product thereof. In a preferred embodiment, the method for diagnosing a neurodegenerative disease, preferably Alzheimer's disease makes use of 23 detector molecules to detect 23 marker genes or gene products thereof. Typically, a step of the method comprises the analysis of a whole blood sample with respect to the presence, concentration and/or activity of 23 marker genes or gene products thereof.
In a preferred embodiment of the invention, the term "sample contains or is suspected to contain one or more of the marker genes or gene products", as used herein, means that one or more marker genes and/or gene products thereof may be detected in the sample in order to support or allow the diagnosis of a disease.
In a preferred embodiment, the sample is based on or derived from a body fluid or from a skin biopsy. In a preferred embodiment, the term "body fluid", as used herein, refers to any material comprising a liquid component that is obtainable from an organism of interest. Non- limiting examples include, but are not limited to cerebrospinal fluid (CSF), saliva, peripheral blood or whole blood. In another embodiment, body fluids comprise fractions or processed forms of any material comprising a liquid component that is obtainable from an organism of interest. In a most preferred embodiment, body fluids comprise preparations of blood cells. In a preferred embodiment, the term ,,derived", as used herein, comprises obtained by way of biopsy.
Once a sample is provided that can be used to support the diagnosis of a disease, preferably a neurodegenerative disease, most preferably Alzheimer's disease, a multitude of different approaches may be used or followed for the detection of the presence, the concentration and/or the activity of a marker gene or a product thereof. In a preferred embodiment, said marker gene product is a nucleic acid molecule and a technique selected from the group comprising PCR-related techniques, spotted arrays, Northern blotting, Southern blotting, chip-based techniques or the like, is used for the detection.
In a preferred embodiment, the term "PCR-related techniques", as used herein, refers to any technique, process, method or methodology that makes use, in some form, of a polymerase chain reaction (PCR), reagents, products or intermediates thereof. Non-limiting examples include, but are not limited to real time PCR, reverse transcriptase PCR, RNA protection assays or the use of primers or probes attached to fluorescent dyes for the purpose of monitoring binding or product formation using fluorescence.
In a preferred embodiment of the invention, the presence, concentration and/or activity of a marker gene or gene product thereof or a combination of marker genes or a combination of gene products thereof is detected using blotting techniques and/or chip based techniques. In a
preferred embodiment, blotting techniques involve the permanent or transient attachment of a molecule to a surface and a detection step that results in a readout. A multitude of molecules can be detected using blotting techniques, with non-limiting examples including proteins, peptides, RNA, DNA, carbohydrates and combinations thereof. In a preferred embodiment, chip-based techniques involved the attachment of a detector molecule to a chip and the subsequent exposure to a sample, with interactions between the detector molecule with the target to be detected being recorded. Non-limiting examples of chips include peptide chips, protein chips such as antibody chips, nucleic acid chips and the like.
However, it will be acknowledged by the person skilled in the art that enzymatic assays may also be used for the gene, gene products and interaction partners thereof such as the detector molecule for assessing the presence, concentration and/or activity thereof. In a preferred embodiment, the term "enzymatic assay", as used herein, refers to any method that can be used to determine an enzymatic activity of interest. Non-limiting examples include, but are not limited to continuous assays, typically involving the use of UV/vis spectroscopy to monitor the turnover of chromogenic substrate molecules in the presence of enzyme molecules or the use of a light detector to record the activity of an enzyme that emits light upon turning over substrate, or discontinuous assays, wherein the concentration of substrate molecules is determined in regular intervals, for example through the use of High Pressure Liquid Chromatography, Western blotting or other quantitative methods. In a preferred embodiment, the term "enzymatic assays" comprises the use of ELISA (enzyme-linked immunosorbent assay) approaches and all variations thereof.
In a preferred embodiment of the invention, the presence, concentration and/or activity of a marker gene or gene product thereof or a combination of marker genes or a combination of gene products thereof is detected using proteomic approaches. In a preferred embodiment of the invention, the term "proteomic approaches", as used herein, refers to any kind of method that allows for the detection of changes with respect to the protein composition of a sample, both in terms of the concentration and/or activity of one or more proteins. In a more preferred embodiment of the invention, such approaches include the use of mass spectrometry, electrophoretic techniques, one or two dimensional protein gels, NMR (nuclear magnetic resonance) spectroscopy, protein chips, chromatographic methods including Liquid
Chromatography Mass Spectrometry (LC-MS), Gas Source Mass Spectrometry (GS - MS) and the like, all of which are known to a person skilled in the art.
In another preferred embodiment of the invention, the presence, concentration and/or activity of a marker gene or product thereof is detected using a Multiplex particle assay approach. In a preferred embodiment, a Multiplex particle assay, as used herein, refers to a method based on flow cytometry that makes use of antigen-coated beads in a multiplex test system, allowing for the use of more than one antibody to detect antigens in a single sample (Leinfelder et al. (2007) LABO (April 2007), pages 54-56).
The presence or absence of genes or genes products often affect the metabolism in parts of the body, where such gene is not normally expressed. In another preferred embodiment, the marker gene or gene product thereof or combination of marker genes or combination of gene products thereof affect the presence, concentration and/or activity of a small molecule, preferably a metabolite, and metabolomic approaches or enzymatic assays are used to detect its presence, concentration and/or activity. Therefore, in a preferred embodiment, the presence, concentration and/or activity of a small molecule, which correlates with the presence, concentration and/or activity of a marker gene or gene product thereof, is detected to support or allow the diagnosis of a disease rather than the marker gene or gene product thereof itself.
In a preferred embodiment, the term "metabolomic approach", as used herein, comprises the use of NMR spectroscopy and mass spectrometry to detect a small molecule or combinations of small molecules.
In a preferred embodiment, using the marker gene or a gene product thereof or a combination of marker genes or a combination of gene products thereof, a disease, preferably a neurodegenerative disease, and most preferably Alzheimer's Disease, can be diagnosed at any stage of the disease, preferably at an early stage of the disease.
In a preferred embodiment of the invention, the term "early stage of a disease", as used herein, refers to a state of an individual, wherein the individual suffers, knowingly or unknowingly, from said disease prior to the onset of clinical symptoms. In another preferred
embodiment of the invention, the term "early stage of a disease", as used herein, refers to a stage where symptoms are considered as MCI (mild cognitive impaired). In a preferred embodiment, the term "MCI", as used herein, refers to a state of cognitive functioning that is below defined norms, yet falls short of dementia in severity, and exists across a cognitive continuum with borders that are difficult to define precisely. (Albert, M. S., et al. (2006) Ann. Rev. Clin. Psychol., (2) 379-388; Dierckx, E. et al. (2007) Gerontology 53 (1), 28 - 35; Feldmann, H. H., and Jacova, C. (2005) Am. J. Geriatr. Psychiatry 13(8), 645 - 655.) In a preferred embodiment, the stage of the disease is assessed by means of MMSE. In a preferred embodiment of the invention, as used herein, the term "MMSE" refers to a scale that can be used for the determination of a cognitive deficit (Folstein et al. 1983), whereby a score in the range of 27- 30 score is assigned to a cognitive healthy subject, a score in the range of 24-26 is a assigned to a mild-cognitive-impaired (MCI) subject, a score in the range of 19-23 is assigned to a slightly demented subject, a score in the range of 12-18 score is assigned to a subject suffering from medium dementia, and a score in the range of 0-11 score is assigned to a severely demented subject.
In a preferred embodiment of the invention, the term "subject", as used herein, refers to any being which may or may not be ridden with a disease. In a preferred embodiment, the subject is a bird or a mammal. In a most preferred embodiment, the subject is a human.
It will be acknowledged that all of the Gene Bank Accession Nos. are according to NCBI- NIH.
Table 1: Gene markers useful to diagnose Alzheimer's disease Transporter and Channel related genes
Vesicle, synapse and protein transport related genes
Transcription, translation and signal transduction related genes
Structure proteins and enzymes related genes
"Affy ID" represents the Affymetrix ID number as used in the microarray (gives the whole information on the gene, such as annotations, sequences etc.); Gene Name: the whole name of the protein/gene; Symbol: the consensus symbol of the gene; Expected expression: the alteration of expression expected compared to a healthy control; Gene Bank Accession No.: the number assigned to the sequence in NCBI; Function: the functional group the gene belongs to; Protein family: the protein family to which the gene belongs to.
The present invention is further illustrated by the following figures and non-limiting examples from which further features, embodiments, aspects and advantages of the present invention may be taken.
Fig. 1 depicts various timings of diagnosis and treatment in relation to the time course of a patient's mental capacities/accomplishments.
Fig. 2 lists the genes investigated; house keeping genes are in bold.
Fig. 3 depicts a time course (every 3 months in a period of 1 year) for each subject for gene expression and MMSE. Each line represents one subject. Time 1- February to March; Time 2- May to June; Time 3- August to September; Time 4- November to December. The t-Test p-values are given under each schema.
Fig. 4 lists the descriptive statistics for the 33 gene expressions.
Fig. 5 lists Pearson correlation coefficients and univariate p-values of the linear regression analysis between MMSE and the 33 genes. Significant results are in bold, and the lowest p- values in italics.
Fig. 6: Scatter plot describing the correlation between MMSE scores and HIST1H3E mRNA expression in all four time points. Time I=O, time 2=Δ, time 3=+, time 4=x. R2=0.21; regression equation 28.9-42.3 x HIST1H3E; Pearson correlation coefficients, rho=-0.459 univariate p-value=0.00063.
EXAMPLES
In summary, the following examples demonstrate the finding of a peripheral marker of Alzheimer's disease the expression of which correlates with the development of the disease and is straightforward to assess.
Example 1: Peripheral blood mononuclear cells gene expression profile in Alzheimer's disease
In order to investigate the influence of gene expression alterations on MMSE, 33 genes (Fig. 2) were investigated separately. Figs. 3A and 3B show the time course for each gene where each line represents one patient. A very large variation between the time points (every 3 months, up to 4 times in a period of one year) could be found. For each gene and each patient Pearson correlation coefficients between the gene and MMSE were calculated in order to investigate the influence of time (up to 4 recruitments). T-tests were used if these correlation coefficients differed from zero, which would mean that the MMSE and the gene expression in a patient change over time in the same manner. The only gene showing a p-value lower than 0.05 was SNX2 (p=0.038). However, when the False Discovery Rate was controlled, this gene showed no statistical significance. Thus no influence of time on the relationship between the genes and MMSE was found (compare time courses and p-values in Fig. 3A and 3B).
For further analysis, for each subject the mean was taken over the different time points (up to four), for each gene and for the MMSE. Fig. 4 shows descriptive statistics for the gene expressions. Regression analyses for all 33 genes on MMSE were conducted. The p-values of five genes were below 0.05 (SNX2, HIST1H3E, COG2, CNR2 and GRIK; see Fig. 5). The genes, HIST1H3E and CNR2 showed the lowest p-value out of the 5 significant results. However, applying the False Discovery Rate-controlling procedure only HIST1H3E could be identified as statistically significant (p=0.00053). HIST1H3E mRNA increases significantly with decreasing MMSE scores, (R2=0.2153; regression equation 28.88-43.33 x HIST1H3E). With a negative correlation coefficient of rho=-0.46 (Fig. 5).
In this study there are presented for the first time the peripheral gene expression changes in a large clinical study for AD, with respect to annual rhythm. The gene expression of HIST1H3E was significantly correlated to the dementia score, the MMSE. CNR2 gene was showing some tendency to significant correlation. The present inventors found in a previous study that these two genes were altered in post mortem brain tissue of AD (submitted manuscript).
There are two currently well-characterized cannabinoid receptors, CNRl and CNR2, with functional evidence for the existence of other subtypes, whose identities have been elusive. CNRl are expressed primarily in the brain and in some peripheral tissues, while CNR2 are thought to be expressed primarily by immune cells in peripheral tissues, but nowadays are found to be expressed also in the brain (Onaivi, E.S., Ishiguro, H., Gong, J.P., Patel, S., Perchuk, A., Meozzi, P.A., Myers, L., Mora, Z., Tagliaferro, P., Gardner, E., et al., Ann N Y Acad Sci 1074:514-536 (2006)). Although controversially discussed, many showed the neuroprotective and anti-oxidant effects of cannabinoids in animal models and cell culture with neurodegeneration (Guzman, M., Sanchez, C, and Galve-Roperh, L, JMo/ Med 78:613- 625 (2001); Meschler, J.P., Howlett, A.C., and Madras, B.K., Psychopharmacology (Berl) 156:79-85 (2001); Marsicano, G., Moosmann, B., Hermann, H., Lutz, B., and Behl, C, J Neurochem 80:448-456 (2002); Lastres-Becker, L, and Fernandez-Ruiz, J., Curr Med Chem 13:3705-3718 (2006)). In AD hippocampus and entorhinal cortex sections it was found that CNR2 are abundantly and selectively expressed in neuritic plaque-associated astrocytes and microglia, whereas the expression of CNRl remains unchanged (Benito, C, Nunez, E., Tolon, R.M., Carrier, E.J., Rabano, A., Hillard, C.J., and Romero, J, J Neurosci 23:11136- 11141 (2003)). This is in accordance with the present inventors' finding in respect to the gene expression profiles, in which we found an increased expression of CNR2 in subjects with dementia phenotypes. The activation of microglia might be the cause of this increase and the inhibition of activated microglia might prevent the process of the disease. This approach was discussed by Ramirez et al and Pazos et al (Ramirez, B. G., Blazquez, C, Gomez del Pulgar, T., Guzman, M., and de Ceballos, MX., J Neurosci 25:1904-1913 (2005); Pazos, M.R., Nunez, E., Benito, C, Tolon, R.M., and Romero, J., Life Sci 75:1907-1915 (2004)) This multifocal expression of CB2 immunoreactivity in the brain suggests that CB2 receptors may play broader roles in the brain than previously anticipated and may be exploited as new targets in the treatment of depression, substance abuse and dementia.
The histone proteins play key roles in the regulation of transcription. Transcription becomes active when histones are acetylated by histone acetyltransferase (HATs), silenced when histones are deacetylated by histone deacetylases (HDACs) and silenced or activated when methylated by histone methyltransferases (HMTs) (Berger, S. L. Curr Opin Genet Dev 12:142-148 (2002)). Already as early as 1993 Mecocci et al. observed that histones are
increased in the serum of AD subjects, which matches our observations (Mecocci, P., Ekman, R., Parnetti, L., and Senin, U., Biol Psychiatry 34:380-385 (1993)). In search for β-amyloid peptide precursor ligands it was found that histones bind with high affinity and specificity to the secreted precursor. This finding was further confirmed for the cytotoxic of histones in the presence of amyloids (Currie, J.R., Chen-Hwang, M.C., Denman, R., Smedman, M., Potempska, A., Ramakrishna, N., Rubenstein, R., Wisniewski, H.M., and Miller, D.L., Biochim Biophys Acta 1355:248-258 (1997)). Another line of involvement was shown years ago concerning the insulin pathways and histones (Burant, CF. , Treutelaar, M.K., and Buse, M.G., J Clin Invest 77:260-270 (1986); Vu, T.H., Li, T., and Hoffman, A.R., Hum MoI Genet 13:2233-2245 (2004); Li, T., Vu, T.H., Ulaner, G.A., Littman, E., Ling, J.Q., Chen, H.L., Hu, J.F., Behr, B., Giudice, L., and Hoffman, A.R., MoI Hum Reprod 11:631-640 (2005); Tang, B. L., Neurobiol Aging 27:501-505 (2006)). In all of these publications a correlation between methylation of the histone and activation/deactivation of the insulin growth factor-receptor was shown. This fact supports the notion of brain insulin resistance in AD subjects ( Hoyer, S., and Frδlich, L., In: Research Progress in Alzheimer's Disease and Dementia. M.K. Sun, editor. New York: Nova Science (2006); Qiu, W.Q., and Folstein, M.F., Neurobiol Aging 27:190-198 (2006); Steen, E., Terry, B.M., Rivera, E.J., Cannon, J.L., Neely, T.R., Tavares, R., Xu, X.J., Wands, J.R., and de Ia Monte, S.M., J Alzheimers Dis 7:63-80 (2005)). Phosphorylated histone H3, a key component involved in chromosome compaction during cell division, was found to be increased in the cytoplasma of hippocampal neurons in AD subjects (Ogawa, O., Zhu, X., Lee, H.G., Raina, A., Obrenovich, M.E., Bowser, R., Ghanbari, H.A., Castellani, R.J., Perry, G., and Smith, M.A., Acta Neuropathol (Berl) 105:524-528 (2003)). Therefore, the aberrant cytoplasmic localization of phosphorylated histone H3 indicates a mitotic disruption that leads to neuronal dysfunction and neurodegeneration in AD. Accordingly the present inventors found in peripheral blood samples a significant increase of HIST1H3E mRNA with decreased MMSE scores, which points to the progress of the dementia stage.
Several early studies have posed the question of whether gene expression in the periphery alters in AD subjects (Maes, O. C, Xu, S., Yu, B., Chertkow, H.M., Wang, E., and Schipper, H.M, Neurobiol Aging (2006); Kalman, J., Kitajka, K., Pakaski, M., Zvara, A., Juhasz, A., Vincze, G., Janka, Z., and Puskas, L.G., Psychiatr Genet 15:1-6 (2005)). But these did not confront several biases such as the time point of blood withdrawals (seasonal effects), gender,
age, ethnical group and the methodological procedure of RNA isolation. Variations associated with age and gender have been previously reported (Eady, J.J., Wortley, G.M., Wormstone, Y.M., Hughes, J.C., Astley, S.B., Foxall, R.J., Doleman, J.F., and Elliott, R.M., Physiol Genomics 22:402-411 (2005); Whitney, A.R., Diehn, M., Popper, S.J., Alizadeh, A. A., Boldrick, J.C., Relman, D. A., and Brown, P.O., Proc Natl Acad Sci U S A 100:1896- 1901 (2003); Radich, J.P., Mao, M., Stepaniants, S., Biery, M., Castle, J., Ward, T., Schimmack, G., Kobayashi, S., Carleton, M., Lampe, J., et al., Genomics 83:980-988 (2004)), with some gender differences being directly attributable to differences in sex chromosomes (Whitney, A.R., Diehn, M., Popper, S.J., Alizadeh, A.A., Boldrick, J.C., Relman, D.A., and Brown, P.O., Proc Natl Acad Sci U SA 100:1896-1901 (2003)). However, the contributions of age and gender appeared to be modest in several previous studies (McLoughlin, K., Turteltaub, K., Bankaitis-Davis, D., Gerren, R., Siconolfi, L., Storm, K., Cheronis, J., Trollinger, D., Macejak, D., Tryon, V., et al., MoI Med 12:185-195 (2006); Kim, S.J., Dix, D.J., Thompson, K.E., Murrell, R.N., Schmid, J.E., Gallagher, J.E., and Rockett, J.C., Clin Chem. (2007)). Variations between ethnical groups were reported to be large while within ethnical populations to be minor (Storey, J.D., Madeoy, J., Strout, J.L., Wurfel, M., Ronald, J., and Akey, J.M., Am J Hum Genet 80:502-509 (2007)). Several studies have indicated the importance of extraction and storage methods in order to reduce variations (Kim, S.J., Dix, D.J., Thompson, K.E., Murrell, R.N., Schmid, J.E., Gallagher, J.E., and Rockett, J.C., Clin Chem. (2007); Madabusi, L.V., Latham, GJ., and Andruss, B.F., Methods Enzymol 411:1-14 (2006)). Especially EDTA-blood tubes seems to contribute largely to gene expression variations and RNA degradation comparing to the PAXgene tubes (Liu, J., Walter, E., Stenger, D., and Thach, D., J Mo/ Diagn 8:551-558 (2006); Rainen, L., Oelmueller, U., Jurgensen, S., Wyrich, R., Ballas, C, Schram, J., Herdman, C, Bankaitis-Davis, D., Nicholls, N., Trollinger, D., et al., Clin Chem 48:1883-1890 (2002)). In this study the inventors of the present invention confronted these points by using a larger group of subjects with one ethnical background (total 52 subjects, white Caucasian). Regarding gender, the inventors of the present invention had nearly 1:1 female to male in order to eliminate these variations (30:22, respectively). The present inventors used four time points for withdrawal of samples over the period of one year. In this regard, it is well known that the circadian and seasonal environment may influence gene expression and processes in the CNS as well as the periphery (Hofman, M.A., and Swaab, D.F., Prog Brain Res 138:255-280 (2002)). In this study, the present inventors did not find any significant correlation between the withdrawal
time point and gene expression profile, but still some tendencies toward seasonal effects can be observed. These non significant effects may result from sample size or other environmental influences. In addition, the integrity of the RNA and the expression profile was shown to be strongly influence by the blood collection technique. Hence, in the inventors' study the effects in gene expression alterations as a consequence of blood withdrawal and isolation methodology were eliminated by using the newly PAXgene methodology containing preserving fluid in order to "freeze" the RNA profile and eliminate extractions' variations and RNA degradation (Whitney, A.R., Diehn, M., Popper, S.J., Alizadeh, A.A., Boldrick, J.C., Relman, D.A., and Brown, P.O., Proc Natl Acad Sci U S A 100:1896-1901 (2003), Rainen, L., Oelmueller, U., Jurgensen, S., Wyrich, R., Ballas, C, Schram, J., Herdman, C, Bankaitis-Davis, D., Nicholls, N., Trollinger, D., et al., CHn Chem 48:1883-1890 (2002); Thach, D.C., Lin, B., Walter, E., Kruzelock, R., Rowley, R.K., Tibbetts, C, and Stenger, D.A., J Immunol Methods 283:269-279 (2003)).
In conclusion, the results of this preliminary study already show the importance of this diagnostic tool and point to some important facts such as time points of blood sampling and methodology.
Example 2: Studies on gene expression alterations in living humans with and without Alzheimer's disease
1. Subjects
The subjects gave informed consent according to the Helsinki Declaration. The study protocol was approved by the local Ethics committee of the University of Wϋrzburg, Germany. Written informed consent was obtained from all subjects or their primary caregivers. Recruited patients with sporadic AD and normal elderly controls which were not affected with MCI or dementia recruited as volunteers were assessed in the memory clinic of the department of psychiatry by an experienced psychiatrist. All subjects underwent formal diagnostic procedure according to the National Institute of Neurological and Communicative Disorders and Stroke — Alzheimer's Disease and Related Disorders Association criteria (McKhann G, Drachman D, Folstein M, Katzman R, Price D, Stadlan EM (1984) Clinical diagnosis of Alzheimer's disease: report of the NINCDS-ADRDA Work Group under the
auspices of Department of Health and Human Services Task Force on Alzheimer's Disease. Neurology 34, 939-944.)- Alzheimer's Disease Assessment Scale-cognitive subscale (ADAS- cog) (Pena-Casanova J (1997) Alzheimer's Disease Assessment Scale— cognitive in clinical practice. Int Psychogeriatr 9 Suppl 1, 105-114 / Wouters H, van Gool WA, Schmand B, Lindeboom R (2008) Revising the ADAS-cog for a More Accurate Assessment of Cognitive Impairment. Alzheimer Dis Assoc Disord.), MMSE (O'Connor DW, Pollitt PA, Hyde JB, Fellows JL, Miller ND, Brook CP, Reiss BB (1989) The reliability and validity of the Mini- Mental State in a British community survey. J Psychiatr Res 23, 87-96) and CDR (Berg L (1988) Clinical Dementia Rating (CDR). Psychopharmacol Bull 24, 637-639) were administered to all subjects. The MMSE was used for following up the progression, while the other two were used for rough estimation of the diagnosis assessment. Further information was obtained by Unified Parkinson Scale. Depressive and anxiety symptoms were assessed with Hamilton Depression Scale, Short Geriatric Depression Scale and State Trait Anxiety Inventory (Xl, X2) (for details see Table 4). These scales were used in order to rule out subjects with sever neurologic of psychiatric disorders. In addition detailed information on medication and smoking habits were collected. Subjects were retested every 3 months in a period of one year for all parameters (4 recruitments, see Table 4).
52 subjects from both genders (30 females and 22 males) aged between 54.5-95 years were recruited for this study. 34 were non-demented control subjects with no cognitive deficits and MMSE scores 25-30 and 18 subjects were diagnosed as demented with AD (multiple cognitive deficits with significant psychosocial impairment) (MMSE < 24). Whole blood was collected with PAXgene™ Blood RNA system (Becton Dickinson GmbH, Heidelberg, Germany). The blood samples were frozen at -200C until further process for RNA isolation.
2. Total RNA extraction
Total RNA was prepared with PAXgene™ Blood RNA Kit 50 (PreAnalytiX, Qiagen and BD company, Hilden, Germany). RNA isolation reagents were prepared from 0.2 μM filtered, diethyl pyrocarbonate (DEPC) -treated water (Fermentas Inc., Hanover, MD, USA) throughout the isolation procedure. Total RNA samples were spectrophotometrically scanned (Experion, BioRad Co., Hercules, CA, USA) from 220 to 320 nm; the A260/A280 of total RNA was typically >1.9.
3. Quantitative real-time RT-PCR
Quantitative real-time PCR for 33 genes and 6 house-keeping genes (used as internal control) was conducted (Table 2). Total RNA (1 μg) from each sample was reverse transcribed with random hexamer & oligo-dT primer mix using iScript (BioRad Co., Hercules, CA, USA). Quantitative real-time PCR was performed in the iCycler iQ system (BioRad Co., Hercules, CA, USA) as described previously (Grϋnblatt E, Zander N, Bartl J, Jie L, Monoranu CM, Arzberger T, Ravid R, Roggendorf W, Gerlach M, Riederer P (2007) Comparison Analysis of Gene Expression Patterns between Sporadic Alzheimer's and Parkinson's Disease. J Alzheimers Dis 12, 291-311). The genes were normalized to the 5 most stable house-keeping genes: ACTB, RPL13A, PPIA, GAPDH and R18S. This normalization was chosen after analysis with GeNorm for most stable house-keeping genes in whole blood RNA samples according to previous publication (Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of real-time quantitative RT- PCR data by geometric averaging of multiple internal control genes. Genome Biol 3, RESEARCH0034). Real-time PCR was subjected to PCR amplification as described in the supplement (Supplementary Table S2). All PCR reactions were run in duplicate. The amplified transcripts were quantified using the comparative CT method analyzed with the BioRad iCycler iQ system program. Standard curves for each amplification product were generated from 10-fold dilutions of pooled PCR-amplicons (isolated using MiniElute Gel Extraction Kit (Qiagen, Hilden, Germany) to determine primer efficiency and quantization. Data was analyzed with Microsoft Excel 2000 to generate raw expression values.
4. Statistics
In order to investigate the influence of 33 gene expression alterations on MMSE, each gene was investigated separately: For each subjects the mean was taken over the different time points (up to four) for each gene and for the MMSE. Linear regression analyses were performed to analyze the influence of one gene on MMSE over the subjects. This resulted in 33 p-values, each for one regression analysis. Due to the multiplicity problem we applied the 33 p-values in a multiple testing procedure. We wanted to control the False Discovery Rate (defined as the expected proportion of erroneously rejected hypotheses under all rejected hypotheses, (Benjamini Y, Hochberg Y (1995) Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Statist. Soc. 57, 289-300.)) of all regression analyses at 0.05 and performed the Benjamini-Hochberg procedure. This means
that under all significant hypotheses, 5% false positives were tolerated. In addition Pearson correlation coefficients (rho) were calculated.
To investigate the correlation between the genes and MMSE over a time period of one year, the following procedure was applied for each gene: For each patient the correlation between gene expression levels and MMSE over time was calculated. T-tests were applied for the resulting correlation coefficients, to analyze if these correlation coefficients differed from zero. Time courses for each gene were plotted.
Some descriptive statistics (mean, standard deviation, minimum, and maximum) and the analyses were performed using SAS 9.1 (SAS Institute Inc., Carly, NC, USA) and R 2.4 (http://www.r-project.org/, Department of Statistics and Mathematics of the WU Vienna, Austria).
Results
In order to investigate the influence of gene expression alterations on MMSE, 33 genes were investigated independently (Table 2). In this study we could present for the first time the peripheral gene expression changes in a large clinical study for AD, with respect to annual rhythm. Figure 6 displays the time course for each gene where each line represents one patient. A very large variation between the time points (every 3 months, up to 4 times in a period of one year) can be found. For each gene and each patient Pearson correlation coefficients between the gene and MMSE were calculated in order to investigate the influence of time (up to 4 recruitments). We use the t-tests if these correlation coefficients differ from zero, which would mean that the MMSE and the gene expression in a patient change over time in the same manner. The only gene showing a p-value lower than 0.05 was sorting nexin 2 (SNX2; p=0.0044). The insulin degrading enzyme (IDE) gene had a p-value of 0.05. However, when the False Discovery Rate was controlled, these genes showed no statistical significance. Thus no influence of time on the relationship between the genes and MMSE was found (compare time courses and p-values in Figures 3A and 3B).
For regression analysis, for each subject the mean was taken over the different time points (up to four), for each gene and for the MMSE. Descriptive statistics for the gene profiles are displayed in the supplementary table (Table 6). Regression analyses for all 33 genes on
MMSE were conducted. The p-values of four genes were below 0.05 (SNX2), histone cluster 1 H3e (HIST1H3E), cannabinoid receptor 2 (CNR2) and glutamate receptor, ionotropic, Kainate 4 (GRIK) (Table 2). One gene, component of oligomeric golgi complex 2 (COG2), had p-value of exactly 0.05 (Table 2). The genes, HIST1H3E and CNR2 showed the lowest p-value out of the 5 significant results. However, applying the False Discovery Rate- controlling procedure (adjusting for multiple testing) only HIST1H3E could be identified as statistically significant (p=0.00063). HIST1H3E mRNA increases significantly with decreasing MMSE scores, (R2=0.21; regression equation 28.9-42.3 x HIST1H3E) with a negative correlation coefficient of rho=-0.46 (Table 3, Figure 6).
Table 2: List of genes investigated
Gene Name Symbol Gene Bank Accession Number
18s ribosomal R18S VO 1270
Beta Actin ACTB NM OOl 101 aminolevulinate delta synthase 1 ALASl NM_000688 glyceraldehydes-3-phosphate dehydrogenase GAPDH NM_002046
Ribosomal protein L13a RPL13A NM_012423 peptidylprolyl isomerase A (cyclophilin A) PPIA NM_021130
Tubulin beta 2A TUB2A NM_001069
Diazepam binding inhibitor (GABA receptor modulator, acyl- DBI NM_020548 Coenzyme A binding protein)
Synaptotagmin I SYTl NM_005639
Synapsin II SYN2 AWl 39618 component of oligomeric golgi complex 2 COG2 NM_007357 vacuolar protein sorting 35 VPS35 NM_018206 vacuolar protein sorting 41 VPS41 NM O 14396 olfactory receptor, family 10, subfamily H, member 3 ORl 0H3 NM_013938
Catalase CAT NM_001752
Transient receptor potential cation channel, subfamily M, member 6 TRPM6 AF350881
Cannabinoid receptor 2 CNR2 NMJ)01841 amyloid beta (A4) precursor protein APP BC004369
Sorting nexin II SNX2 NM_003100
Amyloid beta precursor protein-binding, family A, member 3 APBA3 AI141541 beta-site APP-cleaving enzyme 1 BACEl NM_012104
Insulin degrading enzyme IDE NM_004969
Insulin-like growth factor 1 receptor IGF-IR NM 000875
Growth factor receptor-bound protein 10 GBPlO NM_005311
Insulin receptor substrate 4 IRS4 NM_003604
Transferrin TF NM_001063 ferritin, heavy polypeptide 1 FTHl NM_002032 glutathione S-transferase Ml, transcript variant 1 GSTMl X08020
Heme oxygenase (decycling) 1 HMOXl NM_002133
Glial fibrillary acidic protein GFAP NM_002055
Neugrin, neurite outgrowth associated NGRN AF225423
Histone cluster 1, H3e HIST1H3E NM_003532
Histone cluster 1, H4i HIST1H4I NM_003542
Kruppel-like Factor 12 KLF12 NM O 16285
Oligophrenin 1 OPHNl NM_002547
Myelin Basis protein MBP M13577
Lysosomal trafficking regulator LYST U84744 glutamate receptor, ionotropic, N-methyl D-aspartate-like IA Gcoml NM_015532 (GRINLlA), transcript variant 1
Glutamate receptor, ionotropic, Kainate 4 GRIK NM_014619
House Keeping genes, Bold. These genes were chosen after gene expression alterations had been observed in post mortem brain tissue of AD subjects (Grϋnblatt E, Zander N, Bartl J, Jie L, Monoranu CM, Arzberger T, Ravid R, Roggendorf W, Gerlach M, Riederer P (2007)
Comparison Analysis of Gene Expression Patterns between Sporadic Alzheimer's and Parkinson's Disease. J Alzheimer s Dis 12, 291-311).
Table 3: Pearson correlation coefficients and univariate p-values of the linear regression analysis between MMSE and the 33 genes.
MMSE CAT APP OR10H3 TRPM6 SNX2 GSTMl FTHl KLF12
Correlation coefficient -0.077 -0.087 0.094 -0.202 -0.30080 0.176 -0.053 -0.135 p- value of regression analysis 0.59 0.54 0.51 0.15 0.03 0.21 0.71 0.34
No. common observations 52 52 52 52 52 52 52 52
MMSE HIST1H4I LYST TUB2A COG2 SYN2 HMOXl NGRN MBP
Correlation coefficient -0.004 0.224 0.048 0.271 -0.184 -0.064 -0.111 -0.157 p-value of regression analysis 0.98 0.11 0.74 0.05 0.19 0.65 0.43 0.27
No. common observations 52 52 52 52 52 52 52 52
MMSE OPHNl Gcoml GRIK IRS4 SYTl VPS35 BACEl ffiE
Correlation coefficient 0.003 -0.183 0.297 0.131 0.007 -0.067 0.135 0.177 p- value of regression analysis 0.98 0.19 0.033 0.36 0.96 0.64 0.34 0.21
No. common observations 52 52 52 52 52 52 52 52
MMSE APBA3 CNR2 HIST1H3E DBI VPS41 IGF-IR TF GFAP GBPlO
Correlation coefficient 0.074 -0.345 -0.459 -0.097 0.066 0.245 0.213 0.179 -0.152 p-value of regression analysis 0.60 0.012 0.00063 0.50 0.64 0.08 0.13 0.20 0.28
No. common observations 52 52 52 52 52 52 52 52 52
Significant results are in Bold, and the lowest p-values in cursive.
Table 4: Subjects MMSE scores information at all recruitment time points
Subject Age Gender Diagnose (a) MMSE MMSE MMSE MMSE
Code (Years) Female=0 0= Control (Score) (Score) (Score) (Score)
MaIe=I 2=Demented Basis second third Forth
Al 58 1 2 17* 15* 13* 14*
A2 84 0 2 23 23 23 —
A3 80 0 2 23* 22* 18 17
A4 82 0 2 18* 13* 10* 10*
A5 77 1 2 11 12 — —
A6 61 1 2 24* 24* 9* 22*
A8 75 1 2 15* 15* 8* 5*
A9 74 0 2 14 9 22 5
AlO 76 0 2 24* 24* 24* 25*
Al l 66 1 2 23* 25* 13* 24*
A12 90.5 0 2 -- 14 — —
A13 65.5 0 2 — 20 — —
A14 54.5 0 2 — 21* 22* 20*
A15 67.5 0 2 — 25 25 ~
A16 62.5 0 2 — 21 18 21
A17 69.5 0 2 — 11* — 24*
A19 64.7 1 0 — — 27 29
A20 82.7 1 2 — — 4* ~
A21 66 0 0 30 30 28 28
A22 64 1 0 29* 29* 28* 29*
A23 57 0 0 30 30 30 30
A24 60 1 0 28* 28* 25* 24*
A25 69 1 0 29 ~ 29 29
A26 83 1 0 29 29 — —
All 68 0 0 28 29 30 30
A28 77 0 0 30 30 30 30
A29 57 0 0 30 30 30 30
A30 61 1 0 29 29 28* 29*
A31 74 0 0 30* 30* 30 30
A32 77 0 0 30 30 30 30
A33 79 1 0 30 29 30 30
A34 63 1 0 30 30 30 30
A35 65 0 0 30 — 30 30
A36 67 1 0 30 — 30 —
A37 80 0 0 28 29 30 29
A38 65 0 0 30 30 30 30
A39 69 1 0 30 30 30 30
A40 82 1 0 29 30 30 29
A41 59.5 0 0 — 28 30* 29*
A42 59.5 1 0 — 30 30 30
A43 64 1 0 30 30 30 30
A44 58 0 0 30 30 — 30
A45 95 0 0 29 29 29 30
A46 79 0 0 30 30 30 30
A47 74 0 0 30 30 30 30
A48 75 1 0 30 30 —
A49 65 1 0 30 30 30 30
A50 66 0 0 30 30 30 30
A51 77.5 0 0 — 27* 27* 25*
A52 66 0 0 30 30 30 30
A53 76.7 0 0 — — 27* --
A55 58.7 1 2 -- — 24 26
(a) Diagnose- at baseline (first recruitment) according to the National Institute of Neurological and Communicative Disorders and Stroke- Alzheimer's Disease and Related Disorders Association criteria. Abbreviation: — , no information and no blood withdrawal due to subjects refusal/death.
* Medication with anticholinergic drugs
All subjects underwent formal diagnostic procedure according to the National Institute of Neurological and Communicative Disorders and Stroke — Alzheimer's Disease and Related Disorders Association criteria (McKhann G, Drachman D, Folstein M, Katzman R, Price D, Stadlan EM (1984) Clinical diagnosis of Alzheimer's disease: report of the NINCDS- ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer's Disease. Neurology 34, 939-944). ADAS-cog (Pena-Casanova J (1997) Alzheimer's Disease Assessment Scale— cognitive in clinical practice. Int Psychogeriatr 9 Suppl 1, 105-114. / Wouters H, van Gool WA, Schmand B, Lindeboom R (2008) Revising the ADAS-cog for a More Accurate Assessment of Cognitive Impairment. Alzheimer Dis Assoc Disord.), MMSE (O'Connor DW, Pollitt PA, Hyde JB, Fellows JL, Miller ND, Brook CP, Reiss BB (1989) The reliability and validity of the Mini-Mental State in a British community survey. J Psychiatr Res 23, 87-96.) and CDR (Morris JC (1997) Clinical dementia rating: a reliable and valid diagnostic and staging measure for dementia of the Alzheimer type. Int Psychogeriatr 9 Suppl 1, 173-176; discussion 177-178.) were administered to all subjects. The MMSE was used for following up the progression, while the
other two were used for rough estimation of the diagnosis assessment. Further information was obtained by Unified Parkinson Scale (Goetz CG, Stebbins GT, Shale HM, Lang AE, Chernik DA, Chmura TA, Ahlskog JE, Dorflinger EE (1994) Utility of an objective dyskinesia rating scale for Parkinson's disease: inter- and intrarater reliability assessment. Mov Disord 9, 390-394.). Depressive and anxiety symptoms were assessed with Hamilton Depression Scale (Hamilton M (1960) A rating scale for depression. J Neurol Neurosurg Psychiatry 23, 56-62.), Short Geriatric Depression Scale (Yesavage JA (1988) Geriatric Depression Scale. Psychopharmacol Bull 24, 709-711.) and State Trait Anxiety Inventory (Xl, X2) (Spielberger C, Ritterband L, Sydeman S, Reheiser E, Unger K (1995) Assessment of Emotional States and Personality Traits: Measuring Psychological Vital Signs In Clinical Personality Assessment: Practical Approaches, Butcher J, ed. Oxford University Press, New York.). These scales were used in order to rule out subjects with sever neurologic of psychiatric disorders (data not shown). In addition detailed information on medication and smoking habits were collected.
Continuous decrease of cognitive and mnestic functions is typical in Alzheimer's disease, as can be seen in most of the subjects. Subject A6 and subject Al 1 showed at assessment period-Ill and subject Al 7 showed at assessment period-II unspecific symptoms of physical diseases. Subject A9 underwent surgery some days before assessment. At assessment period-I and -II the same 10 subjects took anticholinergic drugs only 2 of them have increased dosage. At assessment period-II, additional 4 subjects that were assessed the first time took anticholinergic drugs. At assessment period-Ill, again, 14 subjects took anticholinergic drugs two of these subjects have discontinued anticholinergic medication, two have started medication and one has decreased dosage. At assessment period-IV, one of these subjects has discontinued anticholinergic medication, and one has decreased dosage. At all four assessment periods all the subjects underwent any pharmacological treatment with the exception of 2 healthy controls.
Example 3: Analysis of gene expression using gene specific primers
Briefly, 1-3 μl cDNA (1 :10 diluted final amount of 10-30ng) and gene specific primers (probes, when assays with probes) were used in each reaction with total volume of 25 μl. For
each assay (one gene expression analysis) the same amount of cDNA was used for analysis, high abundant genes were assayed with the lower amount of cDNA while the lower abundant genes were assayed with the higher amount of cDNA. For the QuantiTect assays we used QuantiTect™ Custome Assay (Qiagen Inc., Valencia, CA, USA) (Supplementary Table 2) were added to QuantiTect (Probe/SYBR Green) PCR Master Mix (Qiagen Inc., Valencia, CA, USA). For the assays with designed primers we used the iQ-SYBR Green Supermix (BioRad, Hercules, California, USA).
Absence of DNA contamination was verified by amplifying the house-keeping gene, Rl 8S. The products were visualized on gel-electrophoresis to observe no product. Minus reverse transcribed (RT) samples were tested simultaneously with experimental samples.
Real-time PCR was performed in the iCycler iQ system (BioRad Co., Hercules, CA, USA). The amplifications were conducted on the real-time thermocycler:
For assays with primers the following program scheme was used- 1 cycle at 95° C for 3 min, 35-45 cycles at 95° C for 10 s and T-annealing for 45 s, 1 cycle at 95° C for 1 min, 1 cycle at 550C for 1 min, 80 cycles beginning at 550C and increasing each cycle by 0.5° C for melting point analysis. All PCR reactions were run in duplicate.
For assays using the QuantiTect assay- we used the PCR amplification scheme as indicated in the manual (Qiagen, Hilden, Germany).
Table 5: Assays details for real time quantitative PCR
Gene (accession Symbol QuantiTect Probe/primer assay Detection Product Cycle Annealing Reaction number; form method size No. Temperature Efficiency
NCBI- NIH) (bp) (0C) (%)
18s ribosomal R18S QuantiTect Gene Expression Assay FAM I5O 36 manual 95.0 (VO 1270) (Probe)
Beta Actin ACTB QuantiTect Gene Expression Assay FAM 150 40 manual 87.9 (NMJ)OI lOl) (Probe)
Gene (accession Symbol QuantiTect Probe/primer assay Detection Product Cycle Annealing Reaction number; form method size No. Temperature Efficiency NCBI- NIH) (bp) (0C) (%) aminolevulinate ALASl QuantiTect Gene Expression Assay FAM 100 40 manual 80.7 delta synthase 1 (Probe) (NM_000688) glyceraldehydes- GAPDH QuantiTect Gene Expression Assay FAM 130 35 manual 89.0 3-phosphate (Probe) dehydrogenase (NM_002046)
Ribosomal RPL13A QuantiTect Gene Expression Assay FAM 100 35 manual 99.5 protein L13a (Probe) (NM_012423) peptidylprolyl PPIA QuantiTect Gene Expression Assay FAM 150 40 manual 99.9 isomerase A (Probe) (cyclophilin A) (NM_021130)
Tubulin beta 2A TUB2A CACCTTCATCGGCAACAG SYBR 375 40 61 97 (NM_001069) TTCCACATCATTACATCAACAG
Diazepam DBI GAGCTGAAAGGGACTTCCAA SYBR 226 40 63 98 binding inhibitor TTAGAGCCGTATGGTGAGCA (GABA receptor modulator, acyl- Coenzyme A binding protein) (NM_020548)
Synaptotagmin I SYTl QuantiTect Primer Assay SYBR 129 35 manual 95.2 (NM_005639)
Synapsin II SYN2 CATACTGCTGTCATAGTG SYBR 223 40 60 92.8 (AW139618) GTCATACCTGTGTTACTG
Gene (accession Symbol QuantiTect Probe/primer assay Detection Product Cycle Annealing Reaction number; form method size No. Temperature Efficiency NCBI- NIH) (bp) (0C) (%) component of COG2 TCCTCACCATTGCCGCCTTC SYBR 228 40 61 964 oligomeric golgi CCACACTGCCGTTCCAATCTTC complex 2 (NM_007357) vacuolar protein VPS35 QuantiTect Primer Assay SYBR 127 40 manual 96 1 sorting 35 (NM_018206) vacuolar protein VPS41 QuantiTect Primer Assay SYBR 124 40 manual 90 2 sorting 41 (NM_014396) olfactory OR10H3 ATGCCTGGTCAGAAC SYBR 144 40 58 98 1 receptor, family CAGATGATGTCTTGCTC 10, subfamily H, member 3 (NM_013938)
Catalase CAT GCCTGGGACCCAATTATCT SYBR 203 40 62 98 7
(NM_001752) GAATCTCCGCACTT
Transient TRPM6 GCACTC GCACTTCATCCTGTC SYBR 130 40 61 96 6 receptor CGGCACGCCTTGTCTTGAG potential cation channel, subfamily M, member 6 (AF350881)
Cannabinoid CNR2 QuantiTect Primer Assay SYBR 87 40 manual 95 receptor 2
(NM 001841)
Gene (accession Symbol QuantiTect Probe/primer assay Detection Product Cycle Annealing Reaction number; form method size No. Temperature Efficiency NCBI- NIH) (bp) (0C) (%) amyloid beta APP GATGCGGAGGAGGATGAC SYBR 203 35 61 999 (A4) precursor TCTGTGGCTTCTTCGTAGG protein (BC004369)
Sorting nexin II SNX2 AGAAGACTCATCATCCACTG SYBR 326 40 52 88 7
(NM_003100) AGACCAAGGCTTCAACAC
Amyloid beta APBA3 CAGGCAAGGGATGAGGTG SYBR 170 40 67 91 8 precursor CTTGAGATCAATGGGCAGAG protein-binding, family A, member 3 (AI141541) beta-site APP- BACEl QuantiTect Primer Assay SYBR 146 40 manual 95 3 cleaving enzyme 1 (NM_012104)
Insulin IDE QuantiTect Pnmer Assay SYBR 126 40 manual 91 1 degrading enzyme (NM_004969)
Insulin-like IGF-IR QuantiTect Primer Assay SYBR 106 40 manual 98 5 growth factor 1 receptor (NM_000875)
Growth factor GBPlO QuantiTect Primer Assay SYBR 127 45 55 91 receptor-bound protein 10 (NM_005311)
Insulin receptor IRS4 QuantiTect Primer Assay SYBR 80 40 manual 80 8 substrate 4
(NM 003604)
Gene (accession Symbol QuantiTect Probe/primer assay Detection Product Cycle Annealing Reaction number; form method size No. Temperature Efficiency NCBI- NIH) (bp) (0C) (%)
Transferrin TF QuantiTect Pπmer Assay SYBR 190 40 manual 96 8 (NM_001063) ferritin, heavy CTGGAGCTCTACGCCTCCTA SYBR 232 30 64 882 polypeptide 1 FTHl CACACTCCATTGCATTCAGC (NM_002032) glutathione S- GSTMl CCTCCTCGTTCCTTTCTCCT SYBR 285 40 63 882 transferase Ml, ACCAGTCAATGCTGCTCCTT transcript variant 1 (X08020)
Heme HMOX 1 GCCAGGTGACCCGAGACG SYBR 120 40 60 99 oxygenase GGAAGTAGACAGGGGCGAAGA C (decycling) 1 (NM_002133)
Glial fibrillary GFAP QuantiTect Primer Assay SYBR 96 40 manual 91 acidic protein (NM_002055)
Neugrin, neuπte NGRN CATGGAGCAGATACGGTATTTAC SYBR 100 45 63 94 outgrowth TCTTCGGATCACATCATCAGTGC associated (AF225423)
Histone cluster H1ST1H3E GGTGCGAGAAATAGCTCAGG SYBR 173 40 63 97 6 l, H3e GGGCAAGCTGGATGTCTTTA
(NM_003532)
Histone cluster HIST1H4I ACTTGCAAACACCCTTCCAC SYBR 172 40 64 992 l, H4i ATACAAACTTGGCGGACCTG
(NM_003542)
Kruppel-like KLF12 CAGTCGGTGCCTGTTGTCTA SYBR 179 38 64 85 Factor 12 AAGGTCACATTTGGCAGGTC (NMJ) 16285)
Gene (accession Symbol QuantiTect Probe/primer assay Detection Product Cycle Annealing Reaction number; form method size No. Temperature Efficiency NCBI- NIH) (bp) (0C) (%)
Ohgophrenin 1 OPHN 1 QuantiTect Primer Assay SYBR 100 45 55 97 (NM_002547)
Myelin Basis MBP QuantiTect Pπmer Assay SYBR 60 45 55 93 protein
(M13577)
Lysosomal LYST ATTCCGAGGTTTCTGTGGTG SYBR 194 40 64 99 9 trafficking GATCCTGGCTTCTGTTCAGC regulator (U84744) glutamate Gcoml QuantiTect Pπmer Assay SYBR 105 45 55 91 2 receptor, lonotropic, N- methyl D- aspartate-like IA (GRINLlA), transcript variant 1 (NM_015532)
Glutamate GRIK QuantiTect Pπmer Assay SYBR 135 45 55 96 receptor, ionotropic, Kamat 4 (NM_014619)
Manual, according to the manual (Qiagen). Bold, house-keeping genes used for normalization.
Table 6: Descriptive statistics for the 33 gene expressions
Variable N Mean Std Dev Variable N Mean Std Dev
CAT 178 0.10 0.16 NGRN 178 0.15 0.16
APP 178 0.17 0.21 MBP 178 0.33 0.23
OR10H3 178 0.09 0.13 OPHNl 178 0.05 0.05
TRPM6 178 0.12 0.17 GFAP 178 0.21 0.26
SNX2 178 0.15 0.21 APBA3 178 0.20 0.25
GSTMl 178 0.08 0.17 Gcoml 178 0.19 0.19
FTHl 178 0.20 0.25 CNR2 178 0.31 0.26
DBI 178 0.10 0.16 GRIK 178 0.12 0.15
KLF12 178 0.22 0.22 IRS4 178 0.03 0.11
HIST1H4I 178 0.09 0.15 SYTl 178 0.09 0.13
HIST1H3E 178 0.08 0.12 VPS35 178 0.28 0.21
LYST 178 0.16 0.16 BACEl 178 0.05 0.13
TUB2A 178 0.08 0.24 IDE 178 0.29 0.24
COG2 178 0.17 0.20 VPS41 178 0.19 0.18
SYN2 178 0.18 0.23 IGF-IR 178 0.27 0.25
HMOXl 178 0.20 0.22 TF 178 0.20 0.20
Variable N Mean Std Dev Variable N Mean Std Dev
GBPlO 178 0.08 0.17
The mean values and standard deviations are calculated over all time points and patients.
The analyses were repeated twice, once age was included as continuous variable and once age was subdivided in 8 groups. The resulting p-values of the genes did not differ in both methods.
REFERENCES
To the extent it is referred herein to various documents of the prior art, such documents are incorporated herein in their entirety by reference. The complete bibliographic data of the not fully recited documents of the prior art is as follows:
R. Terry, E. Masliah, L. Hansen, in Alzheimer Disease, R. Terry, R. Katzman, K. Bick, S.
Sisodia, Eds. (Lippincott Williams & Wilkins, USA, 1999), pp. 187-206.
R. A. Yokel, Neurotoxicology 21, 813 (2000).
M. Cruts, C. Van Broeckhoven, Ann Med 30, 560 (1998).
C. D. Steele, Nurs CHn North Am 35, 687 (2000).
A. M. Saunders, JNeuropathol Exp Neurol 59, 751 (2000).
C. L. Masters, K. Beyreuther, BmJ 316, 446 (1998). J. A. Nicoll et al, Ann Neurol 47, 365 (2000).
R. E. Tanzi, Ann Neurol 4,1, 283 (2000).
Y. Du et al, Neurology 55, 480 (2000).
E. K. Luedecking, S. T. DeKosky, H. Mehdi, M. Ganguli, M. I. Kamboh, Hum Genet 106,
565 (2000).
G. Meng et al, Hum Mutat 16, 275 (2000). O. Almkvist, B. Winblad, Eur Arch Psychiatry Clin Neurosci 249, 3 (1999).
D. W. O'Connor et al., J Psychiatr Res 23, 87 (1989). L. Berg, Psychopharmacol Bull 24, 637 (1988).
S. T. Dinsmore, JAm Osteopath Assoc 99, Sl (1999).
C. Wallesch, H. Fδrstl, Demenzen. (Thieme, Stuttgart, ed. 1, 2005).
P. Riederer, K. Jellinger, Exp Brain Res Suppl, 158 (1982).
H. Braak, E. Braak, Acta Neuropathol (Berl) 82, 239 (1991).
W. J. Lorentz, J. M. Scanlan, S. Borson, Can J Psychiatry 47, 723 (2002).
O. J. Thienhaus, J. T. Hartford, M. F. Skelly, H. B. Bosmann, JAm Geriatr Soc 33, 715
(1985).
H. Sawada et al. , J Neurosci Res 54, 707 (1998).
A. Heidrich, M. Rosier, P. Riederer, Fortschr Neurol Psychiatr 65, 108 (1997). K. Hager, A. Marahrens, M. Kenklies, P. Riederer, G. Munch, Arch Gerontol Geriatr 32, 275
(2001).
R. M. Wu, D. L. Murphy, C. C. Chiueh, Ann N Y Acad Sd 786, 379 (1996).
W. E. Muller, E. Mutschler, P. Riederer, Pharmacopsychiatry 28, 113 (1995).
W. Berger et al, Neuroreport 5, 1237 (1994).
J. Kornhuber, M. Weller, K. Schoppmeyer, P. Riederer, J Neural Transm Suppl 43, 91
(1994).
M. Weinstock et al., Ann N YAcadSci 939, 148 (2001).
J. Fernandez-Ruiz et al. , Prostaglandins Leukot Essent Fatty Acids 66, 257 (2002). M. P. Mattson, S. L. Chan, W. Duan, Physiol Rev 82, 637 (2002). M. Marvanova et al., MoI Cell Neurosci 18, 247 (2001). M. Hartbauer, B. Hutter-Paier, G. Skofitsch, M. Windisch, J Neural Transm 108, 459 (2001).
D. Young, P. A. Lawlor, P. Leone, M. Dragunow, M. J. During, Nat Med 5, 448 (1999). J. W. Simpkins et al., Am J Med 103, 19S (1997).
M. B. Youdim, M. Weinstock, Mech Ageing Dev 123, 1081 (2002).
J. C. Delumeau et al, J Neural Transm Suppl 41, 259 (1994).
A. Blesch, R. J. Grill, M. H. Tuszynski, Prog Brain Res 117, 473 (1998).
N. Chinnasamy, L. J. Fairbairn, J. Laher, M. A. Willington, J. A. Rafferty, Mutat Res 416, 1
(1998).
M. H. Tuszynski et al., JMol Neurosci 19, 207 (Aug-Oct, 2002). A. D. Cash, G. Perry, M. A. Smith, Curr Med Chem 9, 1605 (Sep, 2002). J. S. Jacobsen, Curr Top Med Chem 2, 343 (Apr, 2002). A. J. Zermansky et al, MoI Ther 4, 490 (Nov, 2001). M. Gimenez y Ribotta, Histol Histopathol 16, 883 (JuI, 2001). W. Mak, S. L. Ho, Hong Kong Med Jl, 40 (Mar, 2001). R. K. Sobel, US News World Rep 130, 54 (Apr 23, 2001). C. Gorman, Time 157, 64 (Apr 23, 2001). C. Jacob et al, J Alzheimer Dis In Press, (2007) A. H. Simonsen et al., Arch. Neurol. 64, 366 (2007). . A. H. Simonsen et al., Dement. Geriatr. Cogn. Disord. 23, 246 (2007). S. Ray et al., Nat. Med. 13, 1359 (2007). M. S. Albert et al., Annu. Rev. Clin. Psychol. 2, 379 (2006
E. Dierckx et al., Gerontology 53, 28 (2007)
H. H. Feldman, and C. Jacova, Am. J. Geriatr. Psychiatry, 13, 645 (2005)
The features of the present invention disclosed in the specification, the sequence listing, the claims and/or the drawings may both separately and in any combination thereof be material for realizing the invention in various forms thereof.
Claims
1. Use of a marker gene or a gene product thereof or a combination of marker genes or a combination of the gene products thereof, wherein the marker gene(s) is/are selected from the group comprising SLC1A7, SLC1A2, TF, GRIK4, CNR2, IGF-IR, CHAK2, GRINLlA, CHRNAl, GSTMl, FTHl, NDUFS3, LYST, SYNII, COG2, PEX5, STX5A, HIST1H3E, IRS4, RPL36A, GFAP, IDE and DEFAl; as a peripheral marker for diagnosing a neurodegenerative disease.
2. The use according to claim 1, wherein the neurodegenerative disease is Alzheimer's disease.
3. The use according to claims 1 or 2, whereby the marker gene is HISTH3E, whereby the marker preferably is increased with decreased MMSE scores.
4. The use according to claim 1 or 2, whereby the marker gene is CNR2, whereby the marker preferably is increased with decreased MMSE score.
5. The use according to any of claims 1 to 4, wherein the combination of marker genes or combination of the gene products thereof comprises at least HISTH3E or CNR2.
6. The use according to any of claims 1 to 4, wherein the combination of marker genes or combination of the gene products thereof comprise at least HISTH3E and CNR2.
7. The use according to any of claims 1 - 6, whereby the marker gene or gene product thereof or combination of marker genes or combination of gene products thereof is used as a marker for diagnosing the neurodegenerative disease at an early stage of the neurodegenerative disease.
8. Use of a detector molecule that binds to a marker gene or a gene product thereof, whereby the marker gene is as defined in any of claims 1 to 7, for diagnosing a neurodegenerative disease, preferably Alzheimer's disease.
9. The use according to claim 8, wherein the detector molecule consists of at least two species of detector molecule, whereby each species binds to a marker gene or a gene product thereof and whereby the marker gene or gene product thereof is different for each species of detector molecule.
10. The use according to claims 8 or 9, whereby the detector molecule is a nucleic acid selected from the group comprising oligonucleotides, deoxyribonucleic acids, ribonucleic acids, aptamers and spiegelmers.
11. The use according to claim 8 or 9, whereby the detector molecule is selected from the group comprising peptides, proteins, antibodies, anticalines, peptide-aptamers and small molecules.
12. A method for the diagnosis of a disease comprising the following steps:
(a) providing a sample from a subject to be diagnosed, whereby the sample contains or is suspected to contain one or more marker gene(s) or gene product(s) thereof as defined in any of claims 1 to 7; and
(b) detecting the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof.
13. The method according to claim 12, wherein the presence, concentration and/or activity of said one or more marker gene(s) or product(s) thereof correlate(s) or is/are correlated with the disease.
14. The method according to claims 12 or 13, wherein said one or more marker gene product(s) is a/are RNA molecule(s).
15. The molecules according to claims 12 or 13, wherein said marker gene(s) product(s) thereof is a/are peptide(s) or protein(s).
16. The method according to any of claims 12 - 15, wherein the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using PCR-related techniques.
17. The method according to claim 16, wherein the PCR-related techniques comprise realtime, reverse transcriptase PCR techniques and RNA protection assays.
18. The method according to any of claims 12 - 15, wherein the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using blotting techniques and/or chip-based techniques.
19. The method according to any of claims 12 - 15, wherein the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using enzymatic assays or binding assays.
20. The method according to any of claims 12 - 15, wherein the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using detection methods, whereby such detection methods are selected from the group comprising chromatography, mass spectrometry, electrophoresis, GS-MS and LC-MS.
21. The method according to any of claims 12 - 15, wherein the presence, concentration and/or activity of said one or more marker gene(s) or gene product(s) thereof is/are assessed using an interaction partner of such a molecule/ such molecules, whereby the interaction partner is selected from the group comprising antibodies, anticalines, peptide-aptamers, aptamers and spiegelmers.
22. The method according to claim 21, wherein said assessing is performed using a technique selected from the group comprising blotting techniques, enzymatic assays, binding assays and chip-based techniques.
23. The method according to any of claims 12 - 22, wherein the disease is a neurodegenerative disease.
24. The method according to claim 23, wherein the neurodegenerative disease is Alzheimer's disease.
25. The method according to any of claims 12 - 24, wherein the subject is a mammal.
26. The method according to claim 25, wherein the mammal is a human being.
27. The method according to any of claims 12 - 26, wherein the sample is derived from one or more body fluids.
28. The method according to claim 27, wherein the body fluid is selected from the group comprising blood, whole blood, peripheral blood, plasma, blood cells, CSF and saliva.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP07024011 | 2007-12-11 | ||
| EP07024011.4 | 2007-12-11 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2009074331A2 true WO2009074331A2 (en) | 2009-06-18 |
| WO2009074331A3 WO2009074331A3 (en) | 2009-08-20 |
Family
ID=40459843
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2008/010552 Ceased WO2009074331A2 (en) | 2007-12-11 | 2008-12-11 | Early and differential diagnosis test for alzheimer's disease |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2009074331A2 (en) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009144424A3 (en) * | 2008-03-28 | 2010-02-25 | Exonhit Therapeutics Sa | Process and method for diagnosing alzheimer’s disease |
| WO2012012725A2 (en) | 2010-07-23 | 2012-01-26 | President And Fellows Of Harvard College | Methods of detecting diseases or conditions using phagocytic cells |
| WO2013188828A1 (en) | 2012-06-15 | 2013-12-19 | Harry Stylli | Methods of detecting diseases or conditions using circulating diseased cells |
| WO2013188846A1 (en) | 2012-06-15 | 2013-12-19 | Harry Stylli | Methods of detecting diseases or conditions |
| CN103713120A (en) * | 2013-12-20 | 2014-04-09 | 浙江大学 | Method for judging cell state in body liquid environment based on liquid-phase chip technology |
| EP3171174A1 (en) | 2015-11-20 | 2017-05-24 | Geroa Diagnostics, S.L | Lactoferrin for use in the diagnosis or prognosis of alzheimer's disease |
| US10494675B2 (en) | 2013-03-09 | 2019-12-03 | Cell Mdx, Llc | Methods of detecting cancer |
| US10626464B2 (en) | 2014-09-11 | 2020-04-21 | Cell Mdx, Llc | Methods of detecting prostate cancer |
| US10934589B2 (en) | 2008-01-18 | 2021-03-02 | President And Fellows Of Harvard College | Methods of detecting signatures of disease or conditions in bodily fluids |
| US10961578B2 (en) | 2010-07-23 | 2021-03-30 | President And Fellows Of Harvard College | Methods of detecting prenatal or pregnancy-related diseases or conditions |
| US11111537B2 (en) | 2010-07-23 | 2021-09-07 | President And Fellows Of Harvard College | Methods of detecting autoimmune or immune-related diseases or conditions |
| US11585814B2 (en) | 2013-03-09 | 2023-02-21 | Immunis.Ai, Inc. | Methods of detecting prostate cancer |
| EP4303584A2 (en) | 2010-07-23 | 2024-01-10 | President and Fellows of Harvard College | Methods for detecting signatures of disease or conditions in bodily fluids |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL137865A0 (en) * | 2000-08-15 | 2001-10-31 | Yeda Res & Dev | Method for the diagnosis and follow-up of schizophrenia |
| US20070105105A1 (en) * | 2003-05-23 | 2007-05-10 | Mount Sinai School Of Medicine Of New York University | Surrogate cell gene expression signatures for evaluating the physical state of a subject |
| GB0414894D0 (en) * | 2004-07-02 | 2004-08-04 | King S College London | Biomarkers of alzheimer's disease |
| GB0512401D0 (en) * | 2005-06-17 | 2005-07-27 | Randox Lab Ltd | Method |
-
2008
- 2008-12-11 WO PCT/EP2008/010552 patent/WO2009074331A2/en not_active Ceased
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10934589B2 (en) | 2008-01-18 | 2021-03-02 | President And Fellows Of Harvard College | Methods of detecting signatures of disease or conditions in bodily fluids |
| US11001894B2 (en) | 2008-01-18 | 2021-05-11 | President And Fellows Of Harvard College | Methods of detecting signatures of disease or conditions in bodily fluids |
| US10934588B2 (en) | 2008-01-18 | 2021-03-02 | President And Fellows Of Harvard College | Methods of detecting signatures of disease or conditions in bodily fluids |
| US8481701B2 (en) | 2008-03-28 | 2013-07-09 | Exonhit Therapeutics Sa | Process and method for diagnosing Alzheimer's disease |
| WO2009144424A3 (en) * | 2008-03-28 | 2010-02-25 | Exonhit Therapeutics Sa | Process and method for diagnosing alzheimer’s disease |
| WO2012012725A2 (en) | 2010-07-23 | 2012-01-26 | President And Fellows Of Harvard College | Methods of detecting diseases or conditions using phagocytic cells |
| EP4303584A2 (en) | 2010-07-23 | 2024-01-10 | President and Fellows of Harvard College | Methods for detecting signatures of disease or conditions in bodily fluids |
| US11111537B2 (en) | 2010-07-23 | 2021-09-07 | President And Fellows Of Harvard College | Methods of detecting autoimmune or immune-related diseases or conditions |
| US10961578B2 (en) | 2010-07-23 | 2021-03-30 | President And Fellows Of Harvard College | Methods of detecting prenatal or pregnancy-related diseases or conditions |
| WO2013188846A1 (en) | 2012-06-15 | 2013-12-19 | Harry Stylli | Methods of detecting diseases or conditions |
| WO2013188828A1 (en) | 2012-06-15 | 2013-12-19 | Harry Stylli | Methods of detecting diseases or conditions using circulating diseased cells |
| US10494675B2 (en) | 2013-03-09 | 2019-12-03 | Cell Mdx, Llc | Methods of detecting cancer |
| US11585814B2 (en) | 2013-03-09 | 2023-02-21 | Immunis.Ai, Inc. | Methods of detecting prostate cancer |
| US12037645B2 (en) | 2013-03-09 | 2024-07-16 | Immunis.Ai, Inc. | Methods of detecting cancer |
| US12181477B2 (en) | 2013-03-09 | 2024-12-31 | Immunis.Ai, Inc. | Methods of detecting prostate cancer |
| CN103713120A (en) * | 2013-12-20 | 2014-04-09 | 浙江大学 | Method for judging cell state in body liquid environment based on liquid-phase chip technology |
| US10626464B2 (en) | 2014-09-11 | 2020-04-21 | Cell Mdx, Llc | Methods of detecting prostate cancer |
| US12529109B2 (en) | 2014-09-11 | 2026-01-20 | Immunis.Ai, Inc. | Methods of detecting prostate cancer |
| EP3171174A1 (en) | 2015-11-20 | 2017-05-24 | Geroa Diagnostics, S.L | Lactoferrin for use in the diagnosis or prognosis of alzheimer's disease |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2009074331A3 (en) | 2009-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6338530B2 (en) | Methods for treating, diagnosing, and monitoring Alzheimer's disease | |
| Allen et al. | Divergent brain gene expression patterns associate with distinct cell-specific tau neuropathology traits in progressive supranuclear palsy | |
| JP5917460B2 (en) | Diagnosis and treatment of Alzheimer's disease | |
| EP2326729B1 (en) | Stimulus-elicited genomic profile markers of alzheimer's disease | |
| WO2021067850A2 (en) | METHODS OF DETECTING circRNA | |
| EP0946753A2 (en) | Pharmacogenetic methods for use in the treatment of nervous system diseases | |
| Wachter et al. | Landscape of brain myeloid cell transcriptome along the spatiotemporal progression of Alzheimer’s disease reveals distinct sequential responses to Aβ and tau | |
| US20080248470A1 (en) | Genetic screening for predicting antidepressant drug response based on the monoamine transporter gene polymorphism combination | |
| EP1724588B1 (en) | Methods for diagnosing Alzheimer's disease | |
| van der Zee et al. | Family-based exome sequencing identifies RBM45 as a possible candidate gene for frontotemporal dementia and amyotrophic lateral sclerosis | |
| US20090286238A1 (en) | Methods to Monitor, Diagnose and Identify Biomarkers for Psychotic Disorders | |
| US8377640B2 (en) | Diagnostic screens for Alzheimer's disease | |
| WO2011112397A2 (en) | Mrna as biomarkers for liver injury or other liver perturbations | |
| JP2008506406A (en) | Molecular diagnosis and treatment in dementia with Lewy bodies | |
| KR102658119B1 (en) | Biomarker composition for diagnosing depression with earlier age at onset using the GPRASP1 gene, information provision method and diagnostic kit for diagnosing depression with earlier age at onset using the same | |
| Vachev | COMPARATIVE GENOMICS, TRANSCRIPTOMICS AND PROTEOMICS RESEARCH IN NEURODEVELOPMENTAL DISORDERS | |
| Chua et al. | Genetic and Genomic Aspects of Alzheimer's Disease | |
| Lee et al. | Genomic and molecular characterization of Alzheimer Disease | |
| Lee et al. | Alzheimer’s Disease Genomics and Clinical Applications | |
| HK1226781A1 (en) | Methods for treating, diagnosing and monitoring alzheimer's disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08859210 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 08859210 Country of ref document: EP Kind code of ref document: A2 |






