WO2009073544A2 - Methods for treating a disorder by regulating gprc6a - Google Patents

Methods for treating a disorder by regulating gprc6a Download PDF

Info

Publication number
WO2009073544A2
WO2009073544A2 PCT/US2008/084943 US2008084943W WO2009073544A2 WO 2009073544 A2 WO2009073544 A2 WO 2009073544A2 US 2008084943 W US2008084943 W US 2008084943W WO 2009073544 A2 WO2009073544 A2 WO 2009073544A2
Authority
WO
WIPO (PCT)
Prior art keywords
gprc6a
mice
individual
treating
disorder
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2008/084943
Other languages
French (fr)
Other versions
WO2009073544A3 (en
Inventor
L. Darryl Quarles
Min Pi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Kansas
Original Assignee
University of Kansas
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Kansas filed Critical University of Kansas
Publication of WO2009073544A2 publication Critical patent/WO2009073544A2/en
Publication of WO2009073544A3 publication Critical patent/WO2009073544A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276Knock-out vertebrates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/24Drugs for disorders of the endocrine system of the sex hormones
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • sex steroid hormones e.g., estrogen, progesterone, and androgens
  • Sex steroid hormones are also known to have non-genomic effects.
  • Non-genomic effects of sex steroids are mediated by steroid hormones binding to cell membranes leading to rapid cellular responses.
  • GPCRs G protein coupled receptors
  • GPRC6A has recently been shown to sense extracellular cations and amino acids, and may require both extracellular cations and amino acids for optimal stimulation in vitro.
  • This dual sensitivity of GPRC6A to both divalent cations and amino acids is analogous to the related receptor CASR.
  • CASR compared to CASR, much higher extracellular calcium concentrations are needed to activate GPRC6A, and some studies suggest that cations may only be allosteric modulators of GPRC6A, whereas other studies show cation-dependent activation of GPRC6A.
  • the physiologically relevant ligands for and biological function of GPRC6A remain to be determined.
  • GPRC6A is broadly expressed in many tissues and organs, including lung, liver, spleen, heart, kidney, skeletal muscle, testis, brain, and bone.
  • the amino acid, osteocalcin, and divalent calcium ligand interaction with this receptor and its wide tissue distribution implicate GPRC6A multiple processes.
  • GPRC6A may be a candidate for the elusive extracellular calcium-sensing mechanism known to be present in osteoblasts, which respond to high local Ca 2+ concentrations (in the range of 8 to 40 mM), amino acids and osteocalcin in the bone microenvironment. GPRC6A is also a candidate for the putative osteocalcin receptor regulating energy metabolism.
  • the present invention can include a method for treating, inhibiting, and/or preventing a disorder in an individual by regulating an expression level and/or activity of GPRC6A.
  • a method can include identifying an individual with a disorder associated with a non-genomic androgen response or metabolic syndrome; and administering to the individual in need thereof an agent capable of regulating an expression level and/or activity of GPRC6A thereby treating the disorder associated with the non-genomic androgen response or metabolic syndrome.
  • the regulation of GPRC6A can increase or decrease the concentration of a sex hormone within said individual, as needed for a particular disease.
  • Such regulating can also be used to treat, inhibit, or prevent the symptoms of such a disease.
  • the regulating is upregulating the expression level and/or activity of said GPRC6A. Such upregulating can be effected by administering to the individual an androgenergic agonist of GPRC6A.
  • the disorder is an estrogen responsive breast cancer or ovarian cancer.
  • upregulation of GPRC6A can reduce the concentration of estradiol in the individual.
  • the disorder is osteoporosis or osteopenia.
  • the therapy can be provided by upregulating GPRC6A so as to increase bone density in the individual.
  • the disorder is an metabolic syndrome.
  • the therapy can be provided by upregulating GPRC6A so as to increase lean body mass and/or decreases body fat mass in the individual.
  • the disorder is diabetes, which therapy is provided by upregulating GPRC6A.
  • the upregulating can be effected by at least one approach selected from the group consisting of: (a) expressing in cells of said individual an exogenous polynucleotide encoding at least a functional portion of GPRC6A; (b) increasing expression of endogenous GPRC6A in said individual; (c) increasing endogenous GPRC6A activity in said individual; (d) introducing an exogenous polypeptide including at least a functional portion of GPRC6A to said individual; and (e) administering GPRC6A-expressing cells into said individual.
  • the regulating is downregulating the expression level and/or activity of GPRC6A.
  • Such downregulating can be effected by administering to the individual an androgenergic antagonist (i.e., anti-androgenergic) of GPRC6A.
  • an androgenergic antagonist i.e., anti-androgenergic
  • diseases that can be treated, inhibited, or prevented by downregulation of GPRC6A can include prostate cancer, benign prostatic hypertrophy, and the like.
  • the downregulation of GPRC6A can be effected by administering to individual an agent selected from the group consisting of: (a) a molecule that binds said GPRC6A; (b) an enzyme which cleaves said GPRC6A; (c) an antisense polynucleotide capable of specifically hybridizing with at least part of an mRNA transcript encoding GPRC6A; (d) a ribozyme which specifically cleaves at least part of an mRNA transcript encoding GPRC6A; (e) a small interfering RNA (siRNA) molecule which specifically cleaves at least part of a transcript encoding GPRC6A; (f) a nonfunctional analogue of at least a catalytic or binding portion of said GPRC6A; and (g) a molecule which prevent GPRC6A activation or substrate binding.
  • the present invention can include a method for upregulating
  • GPRC6A in a subject.
  • Such a method can includes administering to the subject an androgenergic agonist of said GPRC6A in a therapeutically effective amount to upregulate GPRC6A.
  • the androgenergic agonist can be selected from the group consisting of androgens, steroid hormones, androgenic hormones, anabolic steroids, testoids, testosterones, 19-carbon steroids, dehydroepiandrosterone (DHEA), dehydroepiandrosterone sulfate (DHEA-S), androstenedione, androstenediones, androstenediol, androsterone, dihydrotestosterone, androstanolone, fluoxymesterone, mesterolone, methyl testosterone, selective androgen receptor modulators (SARM), andarine, BMS-564,929, LGD-226, ostarine, S-40503, brimonidine tartrate, dexamethasone, inde
  • the present invention can include a method for downregulating GPRC6A in a subject.
  • a method for downregulating GPRC6A in a subject can include administering to the subject an androgenergic antagonist of said GPRC6A in a therapeutically effective amount to downregulate GPRC6A.
  • the androgenergic antagonist can be selected from the group consisting of allylestrenol, oxendolone, osaterone acetate, bicalutamide, steroidal anti-androgergic agents, medroxyprogesterone (MPA), cyproterone, cyproterone acetate (CPA), dienogest, flutamide, nilutamide, spironolactone, 5alpha-reductase inhibitors, dutasteride, finasteride, salts thereof, combinations thereof, and the like.
  • MPA medroxyprogesterone
  • CPA cyproterone
  • CPA cyproterone acetate
  • dienogest flutamide, nilutamide, spironolactone
  • 5alpha-reductase inhibitors dutasteride, finasteride, salts thereof, combinations thereof, and the like.
  • the present invention can include a GPRC6A knockout mouse having a GPRC6A gene having a deleted exon 2.
  • the mouse can be heterozygous GPRC6A +/" or homozygous GPRC6A " " .
  • the present invention provides a method for identifying a substance that modulates GPRC6A. Such a method can include: providing a cell expressing GPRC6A; and screening the substance against the cell so as to determine whether or not the substance modulates GPRC6A. This can also include screening a library of substances. Substances that can be identified are those that upregulate or downregulate GPRC6A.
  • the cell can naturally produce GPRC6A or can be transformed to a cell that expresses GPRC6A.
  • Figure 1 includes Figure IA is a schematic representation of a GPRC6A-deficient mouse model created by replacing exon 2 of the GPRC6A gene with the hygromycin resistance gene.
  • Figure IB is a picture of a PCR gel that shows the presence or absence of exon 2 in Wild-type GPRC6A +/+ , heterozygous GPRC6A +/” , and homozygous GPRC6A " " mice.
  • Figure 1C is a picture of an RT-PCR gel that shows GPRC6A expression in the kidney of GPRC6A +/+ but not in GPRC6A " " mice.
  • Figure ID is a picture of a Western Blot gel that shows GPRC6A expression in the kidney of GPRC6 A +/+ but not in GPRC6A " " mice.
  • Figure 2A is a picture showing the gross appearance of male GPRC6A " " mice, where the genito-anal distance is demarcated by arrows.
  • Figure 2B is a graph illustrating a comparison of the genito-anal distance in 16 week-old GPRC6A +/+ and GPRC6A " " male mice.
  • Figure 2C is a picture showing the gross appearance of testes of male GPRC6A +/+ and GPRC6A " " at age of 16 week-of-age, where the upper panel shows testis and epididymis (magnification 10X) and the lower panel shows dissected testis (magnification 20X) viewed under dissecting microscope.
  • Figure 2D is a graph illustrating a comparison of testicular weight in 16 week-old GPRC6A /+ and GPRC6A " " mice.
  • Figure 2E is a graph illustrating a comparison of seminal vessicle weight in 16 week-old GPRC6A +/+ and GPRC6A " " mice.
  • Figure 2F includes photographs of histological analysis of testes of 16 week-old
  • mice which snow no abnormality, where the arrow heads depict sites of high GPRC6A expression in Leydig cells, and the arrows indicate that
  • GPRC6A is also expressed in lower amounts in Sertoli cells, spermatogonia and spermatids.
  • Figure 2G is a photograph of mammary glands of 16 week-old GPRC6 A + and GPRC6A " " mice, which show abnormalities in GPRC6A " " mice.
  • Figure 2H is a graph illustrating an increase in mammary fat pad mass in GPRC6A " " mice.
  • Figure 21 is a graph illustrating serum testosterone of male and female GPRC6A +/+ and GPRC6A " " mice.
  • Figure 2J is a graph illustrating serum estradiol of male and female GPRC6A +/+ and GPRC6A " " mice.
  • Figure 2K is a graph illustrating serum FSH of male GPRC6A +/+ and GPRC6A " " mice.
  • Figure 2L is a graph illustrating serum LH of male GPRC6A +/+ and GPRC6A " " mice.
  • Figure 3 A shows a RT-PCR analysis of androgen receptor (AR) expression, where AR expression in testis (Te) and bone marrow (BM) was not different between GPRC6A /+ and GPRC6A " " male mice.
  • AR androgen receptor
  • Figure 3B is graph of a RT-PCR analysis of androgen receptor (AR) expression, where AR expression in testis (Te) and bone marrow (BM) was not different between GPRC6A /+ and GPRC6A " " male mice.
  • Figure 3C is a graph of a real time RT-PCR analysis of aromatase expression in testis.
  • Figure 3D is a Western blot analysis of a comparison of the aromatase protein expression in testis from GPRCoA + and GPRC6A " " male mice.
  • Figure 3E is a photograph of immunohistochemistry showing in aromatase (CPY19) localized to Leydig cells (L, arrow head) and to a lesser degree in Sertoli cells (SC), and spermatogonia (SG) (respectively indicated by arrows).
  • CPY19 aromatase
  • SC Sertoli cells
  • SG spermatogonia
  • Figures 3F and 3 G are graphs that show the real time RT-PCR analysis of Cypl 7 and Sultlel expression in testis, respectively.
  • Figure 3H is a RT-PCR analysis of GnRH expression in brain GPRCoA + and GPRC6A " " male mice.
  • Figure 31 is a graph of real time RT-PCR analysis of GnRH expression in brain GPRC6A +/+ and GPRC6A " " male mice.
  • Figure 4A is a photograph that shows expression of GPRC6A messenger in kidney by in-situ hybridization, showing localization of both proximal and distal tubular segments.
  • Figure 4B is a photograph of immunohistochemistry that shows NaPi Ha protein expression and translocation to the brush border membrane in GPRC6A " " mice.
  • Figure 4C is a photograph of a RT-PCR gel analysis that shows the loss of GPRC6A resulted in decreased NaPi Ha message expression.
  • Figure 4D is a graph of real time RT-PCR analysis that shows the loss of
  • GPRC6A resulted in decreased NaPi Ha message expression (The arrow indicates ⁇ 2- microglobulin).
  • Figure 4E is a Western blot showing an increase in urinary excretion of a low molecular weight protein in GPRC6A " " mice identified as ⁇ 2-microglobulin.
  • Figure 4F is an immunoblot that identified the low molecular weight protein in
  • mice as ⁇ 2-microglobulin by immunobloting with an anti- ⁇ 2-microglobulin antibody (The arrow indicates ⁇ 2-microglobulin).
  • Figure 5A includes photographs of a histological examination of the liver from GPRC6A +/+ and GPRC6A " " male mice at age of 16 week old by H & E stained (left panel), Oil Red O stained (right panel).
  • Figure 5B is a graph illustrating hepatic triglyceride levels in GPRC6A + + and GPRC6A " " male mice at age of 16 week old.
  • Figure 5C is a graph illustrating a glucose tolerance test (GTT) in 3 month-old male GPRC6A /+ and GPRC6A " " mice.
  • GTT glucose tolerance test
  • Figure 5D is a graph illustrating a insulin tolerance test (ITT) in 3 month-old male GPRC6A /+ and GPRC6A " " mice.
  • ITT insulin tolerance test
  • Figure 6A is a graph illustrating a comparison of the lean body mass of 6, 8, 12, and 16 week old male and female GPRCoA + + and GPRC6A " " mice.
  • Figure 6B is a graph illustrating a comparison of the fat percent of 16 week old male and female GPRC6A /+ and GPRC6A " " mice.
  • Figure 6C is a graph illustrating a comparison of the femur bone mass density (BMD) of 6, 8, 12, and 16 week old male and female GPRC6A +/+ and GPRC6A " " mice.
  • Figure 6D is an image of backscattered scanning electron microscopy analysis of tibia cortical bone in 16-week-old GPRC6A + + (upper panel) and GPRC6A " mice (lower panel), where the arrows showed the diminished mineralization layer in the bone of GPRC6A " " mice.
  • Figure 6E is an image of toluidine blue-stained plastic sections of femur from 16- week-old GPRC6A /+ (upper panel) and GPRC6A “ " mice (lower panel), where the arrows showed the unmineralized osteoid surfaces in the bone of GPRC6A " " mice.
  • Figure 6F is an image of plastic unstained sections of tibia cortical bone viewed under fluorescent light in 16-week-old GPRC6A + + (upper panel) and GPRC6A " " mice (lower panel) prelabeled with twice calcein (double label).
  • Figure 6G shows alkaline phosphatase (ALP) expression that was measured by RT-PCR from 4- and 10-day primary osteoblasts cultures derived from 8-week GPRC6A +/+ and GPRC6A ⁇ mouse calvaria.
  • ALP alkaline phosphatase
  • Figure 6H shows alkaline phosphatase (ALP) activity in BMSCs from wild-type and GPRC6A " " mice cultured for 10 and 14 days.
  • ALP alkaline phosphatase
  • Figure 61 shows alizarin Red-S for GPRC6A +/+ and GPRC6A " " showing mineralization of extracellular matrix.
  • Figure 7A shows the GPRC6A response to extracellular steroid hormones, testosterone and synthetic androgen (R1881), which stimulated the GPRC6A-mediated activation of phospho-ERK (upper panel); as control the HEK293 (middle panel) and HEK293 transfected calcium sensing receptor (CASR) cells (lower panel) did not responded to the testosterone and Rl 881.
  • R1881 extracellular steroid hormones
  • R1881 synthetic androgen
  • Figure 7B shows that testosterone-BSA stimulated the GPRC6A mediated activation of phospho-ERK.
  • Figure 7C shows that the non-steroidal anti-androgen, flutamide did not inhibited testosterone stimulated the GPRC6A mediated activation of phospho-ERK.
  • Figure 7D shows that testosterone stimulated the GPRC6A mediated activation of phospho-ERK in both the cytosol and nucleus.
  • Figure 7E shows that extracellular calcium is required for GPRC6A sensing of testosterone.
  • Figure 7F shows that dehydroandrosterone (DHEA), beta-estradiol, cholesterol, l,25(OH)2VitD3, and dexamethasone, but not progesterone stimulated GPRC6A- mediated activation of phospho-ERK.
  • DHEA dehydroandrosterone
  • beta-estradiol beta-estradiol
  • cholesterol l,25(OH)2VitD3
  • dexamethasone but not progesterone stimulated GPRC6A- mediated activation of phospho-ERK.
  • Figure 7G shows that the surface binding of testosterone-BSA-FITC was present in HEK293 cells transfected with GPRC6A, but not in untransfected HEK293 cells (the nuclei were stained by DAPi).
  • Figure 7H includes a picture of a RT-PCR gel that indicates GPRC6A and AR did not expressed in HEK-293 cells by RT-PCR.
  • Figure 71 includes a graph that shows synthetic androgen (Rl 881) stimulated the GPRC6A mediated activation of luciferase when HEK-293 cells were co-transfected with pcDNA3.mGPRC6A and SRE-luciferase reporter gene plasmid.
  • Figure 7J includes a graph that shows testosterone binding to a membrane fraction of HEK-293 cells transfected with GPRC6A.
  • Figures 8A-8C show the response to testosterone in GPRC6A knockout mice, where BMSCs derived from the male GPRC6A - mice exhibited a reduced ability to activate ERK in response to testosterone (80 nM), extracellular calcium, and the calcimimetics, NPS-R568, respectively, as assessed by Western blot analysis using an antiphospho-ERK antibody.
  • Figures 8D-8E show the impact of the loss of GPRC6A on the capacity of testosterone to stimulate phospho-ERK activity and early growth-responsive 1 (Egr-1) expression in bone marrow and testes in vivo.
  • Figure 9A is a picture of a gel that indicates Rl 881 stimulated GPRC6A-mediated non-genomic activation of intercellular phospho-Src and phospho-Raf-1.
  • Figure 9B is a picture of a gel that shows testosterone and ⁇ -estradiol stimulated GPRC6A-mediated activation of phospho-ERK were each blocked by 100 ng/ml Pertussis toxin (PTx).
  • PTx Pertussis toxin
  • Figure 9C is a picture of a gel that shows testosterone stimulated GPRC6A- mediated activation of phospho-ERK which was inhibited by 10 ⁇ M PD89059, 50 ⁇ M Ly294002, 2 ⁇ M U73122 and 10 ⁇ M PP-I.
  • Figures 9D-9F include graphs that illustrate Rl 881, synthetic androgen stimulated the GPRC6A-mediated activation of luciferase were inhibited by PD89059 ( Figure 9D), Ro31-8220 ( Figure 9E) and PP-I ( Figure 9F).
  • Figure 9G is a schematic diagram of the signal transduction pathway of GPRC6A.
  • Figure 1OA is a picture of a gel that indicates BMSCs derived from the male GPRC6A " " mice exhibited a reduced ability to activate ERK in response to testosterone (80 nM).
  • Figure 1OB is an image of dissected seminal vesicle of wild-type and GPRC6A null mice after sham and castration (ORX) with or without testosterone replacement.
  • the present invention relates to compositions and methods for treating, inhibiting, and/or preventing a disorder in a subject by regulating or modulating the G-protein coupled receptor GPRC6A or functionality thereof.
  • the modulation of GPRC6A can achieve therapeutic states: (1) androgen or similar agonist can increase GPRC6A functionality to provide a non-genomic androgen response; (2) a GPRC6A antagonist can inhibit a non-genomic androgen response; (3) a GPRC6A agonist increase the activity of GPRC6A to increase anabolic responses in multiple tissues (e.g., bone, fat, muscle, liver, pancreas, kidney, and the like) with regard to a metabolic disorder; and (4) a GPRC6A antagonist can decrease the activity of GPRC6A to decrease an anabolic response in the tissues.
  • tissues e.g., bone, fat, muscle, liver, pancreas, kidney, and the like
  • treating, inhibiting, and/or preventing the disorder can be carried out by regulating or modulating the amount or activity of GPRC6A in the subject.
  • regulating or modulating can be performed by administering the subject a therapeutically effective amount of an androgenergic agonist, an androgenergic antagonist, or allosteric modulator such that the amount or activity of GPRC6A is regulated or modulated in accordance with the needed therapy for a particular disease state or symptoms thereof.
  • the therapy can be performed by increasing or decreasing the number of cell surface GPRC6A receptors that are available for binding an agonist, antagonist, or allosteric modulator.
  • GPRC6A is a widely expressed orphan G-protein coupled receptor that can sense extracellular amino acids, osteocalcin, and divalent cations. The entire scope of physiological functions of GPRC6A is unknown.
  • knockout mice were created and characterized to have the phenotype of GPRC6A " " mice.
  • a complex multiorgan, metabolic-like syndrome was in GPRC6A " " mice that suggests that GPRC6A is involved in nutritional pathways coordinating the metabolic activity of multiple tissues in response to changes in extracellular amino acids and divalent cations.
  • Complex metabolic abnormalities were found in GPRC6A " " mice involving multiple organ systems that express GPRC6A, including bone, kidney, testes, and liver were studied.
  • GPRC6A mice exhibited hepatic steatosis, hyperglycemia, glucose intolerance, and insulin resistance. In addition, high expression levels of GPRC6A in Leydig cells in the testis were observed. GPRC6A was also highly expressed in kidney proximal and distal tubules, and GPRC6A “ “ mice exhibited increments in urine Ca/Cr and POVCr ratios as well as low molecular weight proteinuria. Finally, GPRC6A " " mice exhibited a decrease in bone mineral density (BMD) in association with impaired mineralization of bone.
  • BMD bone mineral density
  • mice have a metabolic syndrome characterized by defective osteoblast-mediated bone mineralization, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, and disordered steroidogenesis. These findings suggest the overall function of GPRC6A may be to coordinate the anabolic responses of multiple tissues through the sensing of extracellular amino acids, osteocalcin and divalent cations.
  • GPRC6A previously described as an amino acid and an extracellular calcium sensing receptor, mediates the non-genomic actions of androgens.
  • GPRC6A In cells that overexpress GPRC6A, but lack the nuclear androgen receptor, GPRC6A localizes to the cell surface membrane, where it mediates testosterone binding and androgen-stimulated ERK activation. Ablation of GPRC6A in mice results in feminization, loss of lean body mass, osteopenia, and increased fat in association with increased circulating levels of estradiol, and reduced testosterone levels in males.
  • mice display attenuation of testosterone-stimulated ERK activation and Egr-1 expression in bone marrow stromal cells in vitro and in target tissues in vivo.
  • GPRC6A mice have a metabolic syndrome characterized by defective osteoblast-mediated bone mineralization, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance and disordered steroidogenesis, a phenotype resembling metabolic syndrome and Type II diabetes mellitus. These findings suggest the overall function of GPRC6A may be to coordinate the anabolic responses of multiple tissues through the sensing of extracellular amino acids, osteocalcin and divalent cations. Either pharmaceutical, genetic or biological approaches to activate or increase GPRC6A can be used as treatments for multiple organ dysfunction in metabolic syndrome. II. Therapeutic Methods
  • the methods of the present invention can be used to treat, inhibit, and/or prevent disorders by regulating or modulating the expression, amount, or activity of GPRC6A to achieve a desired non-genomic androgen response or treat a metabolic syndrome in an individual.
  • a method can include: (i) identifying an individual with or susceptible to a disorder associated with a non-genomic androgen response or metabolic disorder; and (ii) providing to the individual an agent capable of regulating or modulating an expression level, amount, and/or activity of GPRC6A in a therapeutically effective amount.
  • the regulating or modulating can be a decrease.
  • the regulating or modulating can be an increase.
  • the method can include regulating or modulating the amount or activity of GPRC6A so as to increase or a decrease the concentration of a sex hormone within the individual.
  • the regulating or modulating of the amount of GPRC6A can be carried out by upregulating or downregulating the expression level of GPRC6 A by agents that target the promoter for GPRC6A.
  • Biological agents that regulate the expression of GPRC6A can be identified or developed as described herein, and such agents can be used to modulate GPRC6A.
  • upregulation of the amount or activity of GPRC6A can be effected by using one or more of the following techniques: (a) expressing in cells of said individual an exogenous polynucleotide encoding at least a functional portion of GPRC6A; (b) increasing expression of endogenous GPRC6A in said individual; (c) increasing endogenous GPRC6A activity in said individual; (d) introducing an exogenous polypeptide including at least a functional portion of GPRC6A to said individual; (e) administering GPRC6A-expressing cells into said individual; or (f) introducing the extracellular domain of GPRC6A to a cell so as to act as a dominant negative to disrupt function of the GPRC6A receptor.
  • the upregulated expression level of GPRC6A can be effected by administration of a nucleic acid that encodes for GPRC6A.
  • a nucleic acid can include DNA that encodes GPRC6A, such as a plasmid like pcDNA3.mGPRC6A, a cDNA, or other encoding DNA.
  • RNA that encodes GPRC6A can also be administered.
  • GenBank provides the following accession numbers, which sequences are incorporated herein by specific reference: GPRC6A gene is NC_000006 (SEQ ID NO: 28); and the protein sequence of human GPRC6A (hGPRC6A) is N 148963 (SEQ ID NO: 29).
  • downregulation of the amount or activity GPRC6A can be effected by introducing into an individual one or more of the following agents: (a) a molecule that binds the GPRC6A; (b) an enzyme which cleaves the GPRC6A; (c) an antisense polynucleotide capable of specifically hybridizing with at least part of an mRNA transcript encoding GPRC6A; (d) a ribozyme which specifically cleaves at least part of an mRNA transcript encoding GPRC6A; (e) a small interfering RNA (siRNA) molecule which specifically cleaves at least part of a transcript encoding GPRC6A; (f) a non-functional analogue of at least a catalytic or binding portion of the GPRC6A; or (g) a molecule that prevent GPRC6A activation or substrate binding.
  • agents include (a) a molecule that binds the GPRC6A; (b) an enzyme which
  • the regulating or modulating of the activity of GPRC6A can be carried out by increasing or decreasing the activity level of GPRC6A.
  • upregulating the activity can be effected by administering to the individual an androgenergic agonist of the GPRC6A.
  • androgenergic agonists include, androgens, steroid hormones, androgenic hormones, anabolic steroids, testoids, testosterones, 19-carbon steroids, dehydroepiandrosterone (DHEA), dehydroepiandrosterone sulfate (DHEA-S), androstenedione, androstenediones, androstenediol, androsterone, dihydrotestosterone, androstanolone, fluoxymesterone, mesterolone, methyl testosterone, selective androgen receptor modulators (SARM), andarine, BMS-564,929, LGD-226, ostarine, S-40503, brimonidine tartrate, dexamethasone, indeloxazine hydrochloride, salts thereof, combinations thereof, and the like.
  • downregulating the activity can be effected by administering to the an androgenergic antagonist or anti-androgenergic agent.
  • Downregulating GPRC6A can be used to block androgen responses.
  • downregulators of GPRC6A e.g., androgenergic antagonist or anti-androgenergic agents
  • GPRC6A is also activated by extracellular calcium, which has direct actions on multiple organs, including osteoblasts in bone, calcimimetics, amino acids, and osteocalcin the latter of which has recently been shown to be a bone derived factor that regulates energy metabolism.
  • calcium, calcimimetics, amino acids, and osteocalcin can be used to upregulate GPRC6A, and may function as allosteric modulators of GPRC6A
  • the present invention can also include a pharmaceutical composition having a GPRC6A upregulating or downregulating agent.
  • a composition can include a pharmaceutically acceptable carrier, such as those well known in the art, and a therapeutically effective amount of the agent.
  • GPRC6A is involved, through hormonal regulatory pathways, with metabolism of energy, fat, bone, and glucose.
  • upregulation of the amount or activity of GPRC6A can be used for treating, inhibiting, and/or preventing defective mineralization of bone, impaired osteoblast function, decreases in lean body mass, increases in fat mass, hyperphosphatemia, hypercalciuria, hyperglycemia, and feminization of males associated with altered ratio of estradiol and testosterone.
  • GPRC6A can be used for treating, inhibiting, and/or preventing elevated serum glucose levels, glucose intolerance, insulin resistance, and hepatic steatosis.
  • a therapy for such disorders can include administering a therapeutically effective amount of an agent to increase GPRC6A amount or activity. As such, the amount or activity of GPRC6A can be increased by a therapeutically effective amount.
  • the disorder to be treated, inhibited, and/or prevented can be osteoporosis or osteopenia.
  • upregulating the amount or activity of GPRC6A can be used to stimulate anabolic bone mass densification.
  • Such bone mass densification can be used as a therapy for osteoporosis or osteopenia.
  • the disorder to be treated, inhibited, and/or prevented can be an estrogen responsive breast cancer or ovarian cancer.
  • the amount or activity of GPRC6A can be upregulated in a therapeutically effective amount to cause a reduction in the production of an estrogen, such as estradiol. Reducing estradiol has been shown to reduce cancer in breast cancer and ovarian cancer patients (e.g., using aromatase inhibitors).
  • estradiol concentrations can be lowered, thereby treating, inhibiting, and/or preventing estrogen responsive breast cancer and/or ovarian cancer.
  • the disorder to be treated, inhibited, and/or prevented can be prostate cancer.
  • Downregulating GPRC6A can be used to block androgen responses, which can be used to treat prostate cancer by reducing the levels of testosterone in an individual or in certain tissues of an individual.
  • the disorder that can be treated, inhibited, and/or prevented by upregulating GPRC6A can be any metabolic syndrome, which benefits from an upregulation in lean body mass and/or down-regulating body fat mass.
  • metabolic syndromes include obesity-dependent metabolic syndrome, insulin resistance syndrome, and the like.
  • the disorder to be treated, inhibited, and/or prevented can be diabetes, which benefits from an upregulation in lean body mass and/or down-regulating body fat mass.
  • the disorder to be treated, inhibited, and/or prevented can be benign prostatic hypertrophy.
  • a therapy can be achieved by downregulating the amount or activity of GPRC6A either by pharmacological means or by a dominant negative biological agent derived from GPRC6A extracellular domain
  • GPRC6A can be upregulated so as to induce feminization of male. Such feminization may be useful in certain circumstances, such as transgendered men.
  • GPRC6A can be upregulated so as to increase lean body mass. Individuals that are underweight or that have eating disorders may obtain increased health benefits from an increase in lean body mass.
  • GPRC6A can be downregulated so as to decrease lean body mass. Individuals that are overweight or that become slimmer may obtain increased health benefits from a decrease in lean body mass.
  • GPRC6A can be upregulated so as to decrease body fat mass. Individuals that are overweight or that become slimmer may obtain increased health benefits from a decrease in body fat mass. In one embodiment, GPRC6A can be downregulated so as to increase body fat mass. Individuals that are underweight or that have eating disorders may obtain increased health benefits from an increase in body fat mass. IV. Drug Screening.
  • the present invention can include a method for identifying a substance that modulates GPRC6A. As such, a cell can be provided that expresses GPRC6A. A substance can then be screened against the cell so as to determine whether or not the substance modulates GPRC6A. The substance can be in a library of substances, and the entire library or portion thereof can be screened.
  • Substances can be identified that upregulate GPRC6A or downregulate GPRC6A. Substances that are identified can be used in the therapies described herein.
  • the cell can naturally express GPRC6A.
  • the cell can be a cell that is transformed from a non-GPRC6A cell to a cell that expresses GPRC6A.
  • GPRC6A-deficient mouse model was created by replacing exon 2 of the GPRC6A gene with the hygromycin resistance gene (Fig. IA).
  • the hygromycin resistance gene under the control of the PGK promoter was cloned into the Sma I and Eco RV sites of pBS-lox, which was produced by cloning the oligonucleotide Lox71 : 5'-ctagataccgttcgtatagcatacattatacgaagttatg-3' (SEQ ID NO: 1) into the Xba I and Bam HI sites and the oligonucleotide Lox 66: 5'- agcttataacttcgtatagcatacattatacgaacggtag-3' (SEQ ID NO: 2) into the Hind III and Sal I sites of pBluescript (Stratagene), to produce pBS-lox-PGK-Hyg.
  • mice embryonic cell line RW-4 derived from 129X1 /SvJ mouse strain (Hug BA, Wesselschmidt RL, Fiering S, Bender MA, Epner E, et al. (1996) Analysis of mice containing a targeted deletion of beta-globin locus control region 5' hypersensitive site 3. MoI Cell Biol 16: 2906-2912), and kindly provided by Stephan Teglund at the Karolinska Institute Center for Trans gene Technologies, was transfected by electroporation with Not I linearized pGPRC6A-KO. Hygromycin resistant embryonic stem cell colonies were picked, expanded, and tested by PCR to identify clones in which the PGK-Hygromycin gene had correctly replaced exon 2 of the GPRC6A gene.
  • the correctly mutated embryonic stem clones were injected into blastocysts derived from C57BL/6 3.5 days after mating and implanted into B6CBAF1 pseudopregnant females. The resulting male chimeras were bred with female C57BL/6 mice. Homozygous founders were generated by mating the resulting heterozygous mice. The successful targeting of GPRC6A in embryonic stem (ES) cells was confirmed by Southern blot analysis of the genomic DNA from ES cell clones. We observed no apparent differences in the founders generated from different ES cell clones. We focused our studies on founder line 17.
  • GPRC6A mouse GPRC6A gene
  • Wild-type GPRC6A +/+ , heterozygous GPRC6A +/" , and homozygous GPRC6A " mice were geno typed by PCR (Fig. IB) and each genotype was found to be born at the expected Mendelian frequencies.
  • full-length GPRC6A transcripts and proteins were documented to be absent from various tissues of GPRC6A " mice by RT-PCR (Fig. 1C) and Western Blot (Fig. ID).
  • mice (as well as heterozygous GPRC6A + " mice) were similar in gross appearance, body weight and body length to wild-type littermates (data not shown). There were no identified abnormalities in gait or physical activity between wild-type and GPRC6A " " mice. X-ray analysis indicated no gross abnormalities in the development of the skeleton in the GPRC6A " " mice (data not shown).
  • mice had feminization of the external genitals (Figs. 2A-2C).
  • the genito-anal distance (Figs. 2A and 2B) as well as testicular size (Fig. 2C), testicular weight (Fig. 2D) and the weight of seminal vesicle (Fig. 2E) were significantly reduced in GPRC6A " " compared to wild-type littermates.
  • No histological abnormality of the testes was noted in GPRC6A " " mice (Fig. 2F).
  • GPRC6A was highly expressed in Leydig cells, and was also expressed in Sertoli cells, spermatogonia and spermatids by in-situ hybridization analysis. 2.
  • mice mammary fat pads were excised and fixed for a minimum of 2 h in Carnoy's solution (60% ethanol, 30% chloroform, and 10% glacial acetic acid). The fixed glands were washed in 70% ethanol for 15 min and then rinsed in water for 5 min. The mammary glands were stained overnight at 4°C in carmine alum stain (I g carmine and 2.5 g aluminum potassium sulfate in 500 ml water).
  • mice we also found abnormalities of mammary glands in male GPRC6A " " mice, as evidence by greater ductal outgrowth in the mammary fat pad (in 10/14 GPRC6A " " compared to 3/13 mice wild-type male mice (Fig. 2G), and increased the mammary fat pad mass (Fig. 2H).
  • Fig. 2G mice wild-type male mice
  • Fig. 2H mice wild-type male mice
  • stAR steroidogenic acute regulatory protein
  • mGPRC6A.24 The following intron-spanning primer sets were used for RT-PCR: mGPRC6A.24. For: ccagaaagatggccctattga (SEQ ID NO: 7); mGPRC6A.1754.Rev: ctccttactggggcccagtggg (SEQ ID NO: 8); mAndRF578: caacttgcatgtggatgacc (SEQ ID NO: 9) and niAndRR961 : cttgagcaggatgtgggattc (SEQ ID NO: 10).
  • mGnRH.Forl69 agcactggtcctatgggttg (SEQ ID NO: 11) and niGnRH.Rev389: gggccagtgcatctacatct (SEQ ID NO: 12).
  • NaPiII.F248 ccacctatgccatctccagt (SEQ ID NO: 13) and NaPiII.R635: accatgctgacaatgatgga (SEQ ID NO: 14); mALP.905F: aacccagacacaagcattcc (SEQ ID NO: 15) and mALP.1458R: ctgggcctggtagttgttgt (SEQ ID NO: 16), G3PDH.F143: gaccccttcattgacctcaactaca (SEQ ID NO: 17); G3PDH.R1050: ggtcttactccttggaggccatgt (SEQ ID NO: 18) for control RNA loading.
  • the following primer sets were used for realtime PCR: aromatase forward primer: tgagaacggcatcatatttaacaac (SEQ ID NO: 19) and reverse primer: gcccgtcagagctttcataag (SEQ ID NO: 20); Cypl7 forward primer: tggaggccactatccgagaa (SEQ ID NO: 21) and reverse primer: tgttagccttgtgtgggatgag (SEQ ID NO: 22); and Sultlel forward primer: tcatgcgaaagggaattatagga (SEQ ID NO: 23) and reverse primer: tgcttgtagtgctcatcaaatctct (SEQ ID NO: 24).
  • Figure 3A shows that GPRC6A does not effect expression of the androgen receptor, providing further support for a direct role of GPRC6A in mediating androgen responses.
  • the probe was amplified by RT-PCR using following intron spanning primer: mGPRC6A.189F (in Exon I) cgggatccagacgaccacaaatccag (SEQ ID NO: 25) and mGPRC6A.539R (spanned over Exon II and III) ccaagcttgattcataactcacctgtggc (SEQ ID NO: 26).
  • mGPRC6A.189F in Exon I
  • cgggatccagacgaccacaaatccag SEQ ID NO: 25
  • mGPRC6A.539R spanned over Exon II and III
  • Figure 4B shows the effect of GPRC6A ablation to reduce the transporter for phosphate in the proximal tubule of the kidney.
  • Activation of GPRC6A might increase phosphate conservation whereas inhibition of GPRC6A would lead to increased phosphate excretion by the kidney
  • the expression of sodium-phosphate co transporter, NaPi Ha was decreased (both the transcript and protein) in GPRC6A " mice (Figs. 4C and D), suggesting adaptive responses in the kidney to excrete phosphate.
  • mice were placed in metabolic cages (Hatteras Instrument), and urine was collected for 24 h. The urine volume was measured before storage at -70 0 C.
  • Serum testosterone and estradiol levels were measured by testosterone enzyme immunoassay test kit and estradiol (E2) enzyme immunoassay test kit from BioCheck, Inc.
  • Follicle stimulating hormone (FSH) and luteinizing hormone (LH) were measured by mouse FSH radioimmunoassay and the mouse LH sandwich assay as described by the University of Virginia Center for Research in Reproduction Ligand and Analysis Core (NICHD (SCCPRR) Grant U54-HD28934).
  • Serum and urinary calcium was measured by the colorimetric cresolphthalein binding method, and phosphorus was measured by the phosphomolybdate-ascorbic acid method.
  • Serum TRAP was assayed with the ELISA- based SBA Sciences mouseTRAPTM assay.
  • Serum PTH and 1,25(OH) 2 vitamin D were measured the kits from Immutopics, Inc. and Immunodiagnostic system, Ltd., respectively.
  • Serum Fgf23 levels were measured by using FGF-23 ELISA kit (Kainos Laboratories Inc.) following the manufacturer's protocol. Creatinine was measured by the colorimetric alkaline picrate method (Sigma kit 555, Sigma-Aldrich). Urinary protein and Dpd were measured by Bio-Rad and Metra Biosystems, Inc., respectively.
  • mice had mild but significant increases in urinary calcium and phosphate excretion (calcium/creatinine ratio: 0.19 ⁇ 0.02; phosphorus/creatinine ratio: 5.32 ⁇ 0.31) compared to wild-type controls (calcium/creatinine ratio: 0.13 ⁇ 0.01 ; phosphorus/creatinine ratio: 3.93 ⁇ 0.28) (Table 1).
  • the mild hypercalciuria was not evident at 6-weeks-of-age, but was present at subsequent ages, whereas the increased urinary phosphate levels were observed only in 16-week old GPRC6A " mice.
  • the level of serum phosphorus was also significantly higher in 16 week-old knockout mice (6.52 ⁇ 0.18 mg/dl) compared to wild-type littermates (5.18 ⁇ 0.21 mg/dl) (Table 1). Circulating concentrations of calcium, PTH, FGF23, and 1,25(OH) 2 vitamin D levels were not significantly different between wild-type and
  • mice mice (Table 1).
  • Wild-type and GPRC6A mouse kidney were routinely processed and embedded in paraffin.
  • the paraffin sections at thickness of 5 ⁇ m were prepared and collected on commercially available, positively charged glass slides (Superfrost Plus, Fisher Scientific). The sections were dried on a hot plate to increase adherence to the slides. Representative sections were de-paraffined and re-hydrated through conventional methods. The sections were digested by 10 mg/ml hyaluronidase for 20 minutes. Nonspecific protein binding was blocked by incubation with 10% normal goat serum.
  • the sections were incubated in polyclonal rabbit against mouse NaPi Ha (1 :500 dilution) or polyclonal goat anti-human aromatase antibody (1 :200 dilution) (CYP19, Santa Cruz Biotechnology, Inc.) at 4°C overnight.
  • the negative control sections were incubated with 0.01 M PBS. Thereafter, the sections were treated sequentially with FITC-conjugated Donkey anti Rabbit IgG secondary antibody (Jackson Labs). The nucleus was stained with ready to use Hoechst (Sigma).
  • liver of GPRC6A " " mice exhibited histological features of hepatic steatosis by H&E and Oil Red O staining (Fig. 5A). Lipid positive droplets were present in hepatocytes of GPRC6A " " mice but not wild-type mice. This correlated with increased triglyceride content in the livers of GPRC6A " " mice (Fig 5B).
  • GTT glucose tolerance test
  • IP intraperitoneally
  • ITT insulin tolerance test mice were fasted for 6 hours, injected IP with insulin (0.2
  • mice for evidence of glucose intolerance We performed glucose tolerance tests following IP injection of glucose (2 g/kg of body weight) after an overnight fast
  • GTT insulin tolerance tests by IP injection of insulin (0.2 units/kg of body weight) after 6 hours fast (ITT).
  • Bone mineral density (BMD) of whole skeletons and femurs were assessed at 6, 8,
  • mice were prelabeled twice with calcein (Sigma C-0875, 30 119/g body weight) by intraperitoneal injection at 8 and 3 days prior to sacrifice. Tibias and femurs were removed from 8- and 16-week-old mice, fixed in 70% ethanol, prestained in
  • mice had a significant reduction in lean body mass compared to wild-type littermates (7.9% and 10% in male and 11.2% and 13% in female GPRC6A “ “ mice at 12 and 16 weeks, respectively) as assessed by PIXImusTM densitometry (Fig. 6A). There were no apparent differences, however, in muscle histology between wild-type and GPRC6A “ “ mice (data not shown). Body fat as assessed by PIXImusTM densitometry (Fig. 6B) and white fat by gross inspection of various organs, such as testis, were increased in GPRC6A " " compared to wild-type mice.
  • mice did not have the expected age-dependent increase in bone mineral density (BMD). Indeed, BMD was significantly less at 8, 12, and 16 weeks-of-age in GPRC6A " " mice as compared to age-matched wild type mice (Fig. 6C).
  • the distal femoral metaphyses were scanned using a micro-CT 40 (Scanco Medical AG); 167 slices of the metaphyses under the growth plate, constituting 1.0 mm in length, were selected.
  • the three-dimensional (3D) images were generated using the following values for a gauss filter (sigma 0.8, support 1) and a threshold of 275.
  • a 3D image analysis was performed to determine bone volume (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb. Th), and trabecular separation (Tb. Sp).
  • Cortical bone was measured on the mid-shaft region of cortical bone in 50 slices of the diaphysis, constituting 0.3 mm in length.
  • the mean cortical thickness (Ct. Th) was determined at 8 different points on the cortical slice.
  • Figure 6H shows alkaline phosphatase (ALP) activity in BMSCs from wild-type and GPRC6A " " mice cultured for 10 and 14 days.
  • Figure 61 shows alizarin Red-S for GPRC6A +/+ and GPRC6A " ⁇ .
  • the alizarin Red-S stains mineralized matrix. The decrease in staining indicates that mineralization is impaired in the absence of GPRC6A.
  • a GPRC6A antagonist can be used to inhibit mineralization of the extracellular matrix.
  • HEK-293 cells were co-transfected with pcDNA3.mGPRC6A or pcDNA3 or pcDNA3.rCASR plasmid as previously described (Estrada, M., Uhlen, P. & Ehrlich, B. E. Ca2+ oscillations induced by testosterone enhance neurite outgrowth. Journal of cell science 119, 733-743 (2006). Agonist stimulation was performed in quiescent cells. Quiescence was achieved in subconfluent cultures by removing the media and washing with Hanks' Balanced Salt Solution (Invitrogen) to remove residual serum, followed by incubation for an additional 24 h in serum-free media.
  • Hanks' Balanced Salt Solution Invitrogen
  • lysis buffer 25 mM HEPES pH 7.2, 5 mM MgCl 2 , 5 mM EDTA, 1 % Triton X-100, 0.02 tablet/ml of protease inhibitor mixture. Equal amounts of lysates were subjected to 10% SDS-PAGE, and phospho-ERKl/2 levels were determined by immunoblotting using antiphospho-ERKl/2 mitogen-activated protein kinase antibody (Cell Signaling Technology).
  • an anti-ERKl/2 mitogen-activated protein kinase antibody (Cell Signaling Technology) to measure ERK levels.
  • An anti-peptide antibody was raised in a rabbit against a peptide (AIHEKMLS SDDHPRRPQIQKC (SEQ ID NO: 27)) corresponding to a sequence in the extracellular domain of mouse GPRC6A (in exon 1 of mouse GPRC6A gene) produced by Abgent (San Diego, CA).
  • the phospho-ERKl/2 levels were determined by immunoblotting using anti- phospho-ERKl/2 mitogen-activated protein kinase antibody (Cell Signaling Technology).
  • Urinary ⁇ 2-microglobulin was detected by rabbit polyclonal anti- ⁇ 2-microglobulin antibody (Abeam Inc.).
  • rabbit polyclonal anti- aromatase antibody Abeam Inc.
  • goat anti-rabbit IgG HRP secondary antibody Santa Cruz Biotechnology Inc.
  • Mouse anti-Actin antibody was used for control protein loading.
  • RT-PCR was also performed using two-step RNA PCR (Perkin-Elmer). In separate reactions, 2.0 ⁇ g of DNase-treated total RNA was reverse-transcribed into cDNA with the respective reverse primers specified below and Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.). Reactions were carried out at 42 0 C for 60 min followed by 94 0 C for 5 min and 5 0 C for 5 min. The products of first strand cDNA synthesis were directly amplified by PCR using AmpliTaq DNA polymerase (Perkin-Elmer).
  • hGPRC6A.F203 caggagtgtgttggctttga (SEQ ID NO: 30) and hGPRC6A.R630: atcaggtgagccattgcttt (SEQ ID NO: 31);
  • mGPRC6A.189F cgggatccagacgaccacaaatccag (SEQ ID NO: 32) and mGPRC6A.539R: ccaagcttgattcataactcacctgt (SEQ ID NO: 33);
  • hAR.Forl612 cctggcttccgcaacttacac (SEQ ID NO: 34) and hAR.Revl779: ggacttgtgcatgcggtactca;
  • G3PDH.F143 gaccccttcattgacctcaactaca (SEQ ID NO: 35);
  • GPRC6A is a amino acid- and calcium-sensing receptor.
  • testosterone and a synthetic androgen stimulated extracellular signal-regulated kinase phosphorylation (phospho-ERK) in a dose- dependent fashion in HEK-293 cells transfected with GPRC6A, but not in the non- transfected HEK-293, HEK-293 transfected with GPRC6A ( Figure 71), or HEK-293 transfected with the related G-protein-coupled calcium sensing receptor (CASR) (Fig 7A).
  • the concentration of testosterone required to activate GPRC6A was in the normal physiological range (e.g., 20 to 80 nM).
  • testosterone coupled to BSA which is impermeable to the cell membrane, stimulated phospho-ERK in GPRC6A expressing HEK-293 cells (Fig 7B), consistent with a cell surface effect.
  • the synthetic androgen receptor antagonist, flutamide neither stimulated phospho-ERK nor inhibited GPRC ⁇ Adependent testosterone activation of phospho-ERK in HEK-293 cells (Fig 7C).
  • Testosterone also stimulated activation of phospho-ERK in both the cytosol and nucleus in GPRC6A expressing HEK-293 cells (Fig 7D).
  • testosterone activation of GPRC6A required medium calcium concentrations in excess of 0.5 mM (Fig 7E), a concentration similar to the calcium requirement for amino acids and osteocalcin activation of GPRC6A.
  • Dehydroandrosterone (DHEA), 17p-estradiol, cholesterol, l,25(OH)2Vit D3, and dexamethasone also stimulated the GPRC6A-mediated activation of phospho-ERK, but progesterone had no effect at concentrations up to 80 nM (Fig 7F).
  • Supraphysiological concentrations (60 - 80 nM) of 17p-estradiol were required to activate GPRC6A-mediated phosphorylation of ERK.
  • As control, HEK-293 without GPRC6A did not responded (data not shown).
  • the synthetic androgen receptor antagonist, flutamide neither stimulated phosphor-ERK nor inhibited GPRC6A-dependent testosterone activation of phospho-ERK in HEK-293 cells (Fig. 7C).
  • testosterone activation of GPRC6A required medium calcium concentrations in excess of 0.5 mM (Fig. 7E), a concentration similar to the calcium requirement for amino acids and osteocalcin activation of GPRC6A.
  • the extracellular calcium may be also a positive modulator for the GPRC6A in response to steroids.
  • GPRC6A overexpression results in cell surface expression of this receptor.
  • testosterone-BSA testosterone coupled to BSA which is impermeable to the cell membrane; to stimulate the HEK-293 cells stably transfected GPRC6A.
  • Testosterone-BSA induced a dose-dependent stimulation of phospho-ERK in GPRC6A expressing HEK-293 cells (Fig. 7B), consistent with a cell surface effect.
  • we elucidated androgen binding sites were identified on the surface of HEK-293 cells transfected with GPRC6A cDNA constructs.
  • HEK-293 cells stably expressing GPRC6A or untransfected HEK-293 cells were grown on glass cover slips for 48 hours, washed with PSS and then incubated with testosterone-BSA-FITC at room temperature for 5 minutes, followed by two washings with PBS and cell fixation with 2% paraformaldehyde for 30 minutes. The cellular distribution of testosterone-BSA-FITC was then determined by fluorescent microscopy. FITC-conjugated testosterone accumulated on the surface of HEK-293 cells transfected with GPRC6A, but not in empty HEK-293 cells (Fig 7G), indicating that GPRC6A imparts cell surface binding of testosterone. 12.
  • mice The femurs and tibias from 8-week-old wild-type and GPRC6A " mice were dissected, the ends of the bones were cut, and marrow was flushed out with 2 mL of ice- cold a-MEM containing 10% FBS using a needle and syringe. A suspension of bone marrow cells was obtained by repeated aspiration of the cell preparation through a 22- gauge needle, and nucleated cells were counted with a hemocytometer.
  • BMSC bone marrow stromal cells 1,10,18-20. Therefore, we next compared the ability of BMSC obtained from wild-type and GPRC6A " " mice to respond to testosterone added to the culture media (Fig 8A). We observed that testosterone at concentrations up to 80 nM had only minimal effects to stimulate phospho-ERK activity in GPRC6A " " mice compared to its substantial stimulation of ERK in wild-type cells (Fig 8A). BMSC derived from GPRC6A " mice also displayed an attenuated response to extracellular calcium and calcimimetics (Fig 8B and 8C).
  • GPRC6A has multiple functions as evidenced by abnormalities in GPRC6A null mice that include alterations in circulating testosterone and estrogen levels and feminization of male mice, defects of bone density and bone cell function and abnormalities in the renal handling of calcium and phosphate, hyperglycemia and liver steatosis.
  • the ligand profile of GPRC6A which includes extracellular calcium, calcimimetics, amino acids, and osteocalcin, along with the complex phenotype of GPRC6A null mice suggests that GPRC6A is an anabolic receptor that responds to a variety of nutritional and hormonal signals and may serve to coordinate the functions of multiple organs in response to changes of these ligands.
  • regulation of GPRC6A can be used in the treatment, inhibition, and prevention of diseases associated with a non-genomic androgen response.
  • Increasing the activity or amount of GPRC6A can increase a non-genomic androgen response, and decreasing the activity or amount of GPRC6A can decrease a non-genomic androgen response. 13.
  • HEK-293 cells were co-transfected with pcDNA3.mGPRC6A and SRE-luciferase reporter gene plasmid.
  • Quiescence of transfected cells was achieved in subconfluent cultures by removing the media and washing with Hanks' balanced salt solution (Invitrogen) to remove residual serum followed by incubation for an additional 24 h in serum-free quiescent media.
  • Luciferase activity was assessed after 6 h of stimulation.
  • the luciferase activity in cell extracts was measured using the luciferase assay system (Promega) following the manufacturer's protocol using a BG-luminometer (Gem Biomedical, Inc., Hamden, CT).
  • Membranes from HEK and HEK stably transfected with GPRC6A were prepared and stored at -80 0 C.
  • the membrane preparations were diluted to 0.15-0.5 mg protein/ml in binding buffer (in mM: 20 HEPES, 100 NaCl, 6 MgCl 2 , 1 EDTA, and 1 EGTA) immediately before all binding assays.
  • Total binding saturation curves were generated by incubating 250 ⁇ l of membrane preparation and 250 ⁇ l of [ 3 H]Testoterone (Testosterone- [1,2,6,7-3H(N)] ; 1 mCi; Sigma, Chemicals, St.
  • binding buffer in mM: 20 HEPES, 100 NaCl, 6 MgCl 2 , 1 EDTA, and 1 EGTA
  • binding buffer in mM: 20 HEPES, 100 NaCl, 6 MgCl 2 , 1 EDTA, and 1 EGTA
  • the binding reactions were terminated by rapidly filtering 400 ⁇ l of the reaction over a presoaked Whatman, glass-fiber filter (pore size, 1 ⁇ m) to separate bound steroid from free steroid.
  • the filter was immediately washed twice with 12.5 ml of wash buffer (PBS) and placed in a scintillation vial. Radioactivity was counted in a liquid scintillation counter (Beckman Instruments, Fullerton, CA).
  • Pertussis toxin catalyzes the transfer of ADP-ribose from NAD to the guanine nucleotide-binding regulatory protein to specify inhibit G ⁇ i subunit.
  • GPRC6A-mediated extracellular testosterone stimulated signaling were blocked by PD89059 (MAPK inhibitor), Ly294002 (PI3K inhibitor), PP-I (Src inhibitor) and Ro31- 8220 (PKC inhibitor) using either phospho-ERK or SRE-luciferase as read-outs (Figs. 9D-9F).
  • mice compared to its substantial stimulation of ERK in cells from wild-type littermates (Fig. 10B).
  • BMSC from GPRC6A " mice failed to responds to extracellular calcium and the calcimimetic NPS-R568, whereas BMSC from WT mice exhibited both extracellular-calcium- and NPS-R568- dependent stimulation of ERK phosphorylation (data not shown).
  • mice Given that the testicular feminization phenotype is observed in androgen receptor mutant mice that exhibit reduced testosterone levels as well as end organ resistance to exogenous androgen administration, we examined if the GPRC6A " " mice exhibited resistance to the non-genomic effects of androgens.
  • the male WT and GPRC6A " " littermates will be castrated by removal of the testicles (orchiectomy) and hormone recovered by implanting testosterone slow releasing pellet. The size of seminal vesicles from orchidectomized was shrunk, but not significantly different between wild-type and GPRC6A " littermates (Fig. 8D).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Pathology (AREA)
  • Biomedical Technology (AREA)
  • Environmental Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Animal Husbandry (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Diabetes (AREA)
  • Gastroenterology & Hepatology (AREA)

Abstract

A disorder related to a non-genomic androgen response or a metabolic syndrome can be treated, inhibited, and/or prevented by regulating an expression level and/or activity of GPRC6A. Such a method can include identifying an individual with a disorder associated with a non-genomic androgen response or metabolic syndrome; and administering to the individual in need thereof an agent capable of regulating an expression level and/or activity of GPRC6A thereby treating the disorder associated with the non-genomic androgen response or metabolic syndrome. The regulation of GPRC6A can increase or decrease the concentration of a sex hormone within said individual, as needed for a particular disease. Such regulating can also be used to treat, inhibit, or prevent the symptoms of such a disease.

Description

METHODS FOR TREATING A DISORDER BY REGULATING GPRC6A
BACKGROUND
The classical genomic actions of sex steroid hormones (e.g., estrogen, progesterone, and androgens) are carried out by steroid binding to specific nuclear receptors, translocation of the steroid-receptor complex to the nucleus, and binding of this complex to steroid response elements in promoters, thereby modulating gene expression over a period of hours. Sex steroid hormones are also known to have non-genomic effects. Non-genomic effects of sex steroids are mediated by steroid hormones binding to cell membranes leading to rapid cellular responses. These cellular responses can be mediated by several potential mechanisms, including translocation of steroid receptors to the cell surface membrane, nonspecific effects of steroids on the fluidity of lipids in the plasma membrane, direct allosteric modification of ligand-gated ion channels, and activation of G-protein coupled receptors (GPCRs). GPRC6A is a recently identified member of family C of G protein-coupled receptors (GPCRs), and is thought to be most closely related to the calcium-sensing receptor (CASR). Structural homologies and conservation of specific domains in members of this family of receptors suggest an evolutionary link between extracellular calcium and amino acid-sensing. Indeed, GPRC6A has recently been shown to sense extracellular cations and amino acids, and may require both extracellular cations and amino acids for optimal stimulation in vitro. This dual sensitivity of GPRC6A to both divalent cations and amino acids is analogous to the related receptor CASR. However, compared to CASR, much higher extracellular calcium concentrations are needed to activate GPRC6A, and some studies suggest that cations may only be allosteric modulators of GPRC6A, whereas other studies show cation-dependent activation of GPRC6A. The calcimimetic NPS-R578, an allosteric modulator of CASR, and osteocalcin, a bone derived calcium binding protein, both enhance the functional responses of GPRC6A to extracellular calcium in vitro. The physiologically relevant ligands for and biological function of GPRC6A remain to be determined. GPRC6A is broadly expressed in many tissues and organs, including lung, liver, spleen, heart, kidney, skeletal muscle, testis, brain, and bone. The amino acid, osteocalcin, and divalent calcium ligand interaction with this receptor and its wide tissue distribution implicate GPRC6A multiple processes. For example, GPRC6A may be a candidate for the elusive extracellular calcium-sensing mechanism known to be present in osteoblasts, which respond to high local Ca2+ concentrations (in the range of 8 to 40 mM), amino acids and osteocalcin in the bone microenvironment. GPRC6A is also a candidate for the putative osteocalcin receptor regulating energy metabolism.
Various methods for regulating GPRC6A expression and/or activity and detecting GPRC6A are described in Ekema, U.S. Published Patent Application No. 2004/0081970, which is incorporated by reference in its entirety. However, the function of GPRC6A and its physiological ligands have not been previously established.
SUMMARY In one embodiment, the present invention can include a method for treating, inhibiting, and/or preventing a disorder in an individual by regulating an expression level and/or activity of GPRC6A. Such a method can include identifying an individual with a disorder associated with a non-genomic androgen response or metabolic syndrome; and administering to the individual in need thereof an agent capable of regulating an expression level and/or activity of GPRC6A thereby treating the disorder associated with the non-genomic androgen response or metabolic syndrome. The regulation of GPRC6A can increase or decrease the concentration of a sex hormone within said individual, as needed for a particular disease. Such regulating can also be used to treat, inhibit, or prevent the symptoms of such a disease. In one embodiment, the regulating is upregulating the expression level and/or activity of said GPRC6A. Such upregulating can be effected by administering to the individual an androgenergic agonist of GPRC6A.
In one embodiment, the disorder is an estrogen responsive breast cancer or ovarian cancer. In a treatment for estrogen responsive breast cancer or ovarian cancer, upregulation of GPRC6A can reduce the concentration of estradiol in the individual.
In one embodiment, the disorder is osteoporosis or osteopenia. The therapy can be provided by upregulating GPRC6A so as to increase bone density in the individual.
In one embodiment, the disorder is an metabolic syndrome. The therapy can be provided by upregulating GPRC6A so as to increase lean body mass and/or decreases body fat mass in the individual.
In one embodiment, the disorder is diabetes, which therapy is provided by upregulating GPRC6A.
In one embodiment, the upregulating can be effected by at least one approach selected from the group consisting of: (a) expressing in cells of said individual an exogenous polynucleotide encoding at least a functional portion of GPRC6A; (b) increasing expression of endogenous GPRC6A in said individual; (c) increasing endogenous GPRC6A activity in said individual; (d) introducing an exogenous polypeptide including at least a functional portion of GPRC6A to said individual; and (e) administering GPRC6A-expressing cells into said individual.
In one embodiment, the regulating is downregulating the expression level and/or activity of GPRC6A. Such downregulating can be effected by administering to the individual an androgenergic antagonist (i.e., anti-androgenergic) of GPRC6A. Examples of diseases that can be treated, inhibited, or prevented by downregulation of GPRC6A can include prostate cancer, benign prostatic hypertrophy, and the like.
In one embodiment, the downregulation of GPRC6A can be effected by administering to individual an agent selected from the group consisting of: (a) a molecule that binds said GPRC6A; (b) an enzyme which cleaves said GPRC6A; (c) an antisense polynucleotide capable of specifically hybridizing with at least part of an mRNA transcript encoding GPRC6A; (d) a ribozyme which specifically cleaves at least part of an mRNA transcript encoding GPRC6A; (e) a small interfering RNA (siRNA) molecule which specifically cleaves at least part of a transcript encoding GPRC6A; (f) a nonfunctional analogue of at least a catalytic or binding portion of said GPRC6A; and (g) a molecule which prevent GPRC6A activation or substrate binding. In one embodiment, the present invention can include a method for upregulating
GPRC6A in a subject. Such a method can includes administering to the subject an androgenergic agonist of said GPRC6A in a therapeutically effective amount to upregulate GPRC6A. For example, the androgenergic agonist can be selected from the group consisting of androgens, steroid hormones, androgenic hormones, anabolic steroids, testoids, testosterones, 19-carbon steroids, dehydroepiandrosterone (DHEA), dehydroepiandrosterone sulfate (DHEA-S), androstenedione, androstenediones, androstenediol, androsterone, dihydrotestosterone, androstanolone, fluoxymesterone, mesterolone, methyl testosterone, selective androgen receptor modulators (SARM), andarine, BMS-564,929, LGD-226, ostarine, S-40503, brimonidine tartrate, dexamethasone, indeloxazine hydrochloride, salts thereof, combinations thereof, and the like.
In one embodiment, the present invention can include a method for downregulating GPRC6A in a subject. Such a method can include administering to the subject an androgenergic antagonist of said GPRC6A in a therapeutically effective amount to downregulate GPRC6A. For example, the androgenergic antagonist can be selected from the group consisting of allylestrenol, oxendolone, osaterone acetate, bicalutamide, steroidal anti-androgergic agents, medroxyprogesterone (MPA), cyproterone, cyproterone acetate (CPA), dienogest, flutamide, nilutamide, spironolactone, 5alpha-reductase inhibitors, dutasteride, finasteride, salts thereof, combinations thereof, and the like.
In one embodiment, the present invention can include a GPRC6A knockout mouse having a GPRC6A gene having a deleted exon 2. The mouse can be heterozygous GPRC6A+/" or homozygous GPRC6A " ". In one embodiment, the present invention provides a method for identifying a substance that modulates GPRC6A. Such a method can include: providing a cell expressing GPRC6A; and screening the substance against the cell so as to determine whether or not the substance modulates GPRC6A. This can also include screening a library of substances. Substances that can be identified are those that upregulate or downregulate GPRC6A. The cell can naturally produce GPRC6A or can be transformed to a cell that expresses GPRC6A.
These and other embodiments and features of the present invention will become more fully apparent from the following description and appended claims, or may be learned by the practice of the invention as set forth hereinafter.
FIGURES
To further clarify the above and other advantages and features of the present invention, a more particular description of the invention will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings. It is appreciated that these drawings depict only illustrated embodiments of the invention and are therefore not to be considered limiting of its scope. The invention will be described and explained with additional specificity and detail through the use of the accompanying drawings in which:
Figure 1 includes Figure IA is a schematic representation of a GPRC6A-deficient mouse model created by replacing exon 2 of the GPRC6A gene with the hygromycin resistance gene.
Figure IB is a picture of a PCR gel that shows the presence or absence of exon 2 in Wild-type GPRC6A+/+, heterozygous GPRC6A+/", and homozygous GPRC6A " " mice.
Figure 1C is a picture of an RT-PCR gel that shows GPRC6A expression in the kidney of GPRC6A+/+ but not in GPRC6A" " mice.
Figure ID is a picture of a Western Blot gel that shows GPRC6A expression in the kidney of GPRC6 A+/+ but not in GPRC6A" " mice.
Figure 2A is a picture showing the gross appearance of male GPRC6A" " mice, where the genito-anal distance is demarcated by arrows.
Figure 2B is a graph illustrating a comparison of the genito-anal distance in 16 week-old GPRC6A+/+ and GPRC6A " " male mice.
Figure 2C is a picture showing the gross appearance of testes of male GPRC6A+/+ and GPRC6A" " at age of 16 week-of-age, where the upper panel shows testis and epididymis (magnification 10X) and the lower panel shows dissected testis (magnification 20X) viewed under dissecting microscope.
Figure 2D is a graph illustrating a comparison of testicular weight in 16 week-old GPRC6A /+ and GPRC6A " " mice.
Figure 2E is a graph illustrating a comparison of seminal vessicle weight in 16 week-old GPRC6A+/+ and GPRC6A" " mice.
Figure 2F includes photographs of histological analysis of testes of 16 week-old
GPRC6A and GPRC6A" " mice, which snow no abnormality, where the arrow heads depict sites of high GPRC6A expression in Leydig cells, and the arrows indicate that
GPRC6A is also expressed in lower amounts in Sertoli cells, spermatogonia and spermatids.
Figure 2G is a photograph of mammary glands of 16 week-old GPRC6 A + and GPRC6A" " mice, which show abnormalities in GPRC6A" " mice.
Figure 2H is a graph illustrating an increase in mammary fat pad mass in GPRC6A " " mice. Figure 21 is a graph illustrating serum testosterone of male and female GPRC6A+/+ and GPRC6A " " mice.
Figure 2J is a graph illustrating serum estradiol of male and female GPRC6A+/+ and GPRC6A " " mice.
Figure 2K is a graph illustrating serum FSH of male GPRC6A+/+ and GPRC6A " " mice.
Figure 2L is a graph illustrating serum LH of male GPRC6A+/+ and GPRC6A" " mice.
Figure 3 A shows a RT-PCR analysis of androgen receptor (AR) expression, where AR expression in testis (Te) and bone marrow (BM) was not different between GPRC6A /+ and GPRC6A " " male mice.
Figure 3B is graph of a RT-PCR analysis of androgen receptor (AR) expression, where AR expression in testis (Te) and bone marrow (BM) was not different between GPRC6A /+ and GPRC6A " " male mice. Figure 3C is a graph of a real time RT-PCR analysis of aromatase expression in testis.
Figure 3D is a Western blot analysis of a comparison of the aromatase protein expression in testis from GPRCoA + and GPRC6A" " male mice.
Figure 3E is a photograph of immunohistochemistry showing in aromatase (CPY19) localized to Leydig cells (L, arrow head) and to a lesser degree in Sertoli cells (SC), and spermatogonia (SG) (respectively indicated by arrows).
Figures 3F and 3 G are graphs that show the real time RT-PCR analysis of Cypl 7 and Sultlel expression in testis, respectively.
Figure 3H is a RT-PCR analysis of GnRH expression in brain GPRCoA + and GPRC6A" " male mice.
Figure 31 is a graph of real time RT-PCR analysis of GnRH expression in brain GPRC6A+/+ and GPRC6A " " male mice.
Figure 4A is a photograph that shows expression of GPRC6A messenger in kidney by in-situ hybridization, showing localization of both proximal and distal tubular segments.
Figure 4B is a photograph of immunohistochemistry that shows NaPi Ha protein expression and translocation to the brush border membrane in GPRC6A" " mice.
Figure 4C is a photograph of a RT-PCR gel analysis that shows the loss of GPRC6A resulted in decreased NaPi Ha message expression. Figure 4D is a graph of real time RT-PCR analysis that shows the loss of
GPRC6A resulted in decreased NaPi Ha message expression (The arrow indicates β2- microglobulin).
Figure 4E is a Western blot showing an increase in urinary excretion of a low molecular weight protein in GPRC6A " " mice identified as β2-microglobulin. Figure 4F is an immunoblot that identified the low molecular weight protein in
GPRC6A" " mice as β2-microglobulin by immunobloting with an anti-β2-microglobulin antibody (The arrow indicates β2-microglobulin).
Figure 5A includes photographs of a histological examination of the liver from GPRC6A+/+ and GPRC6A" " male mice at age of 16 week old by H & E stained (left panel), Oil Red O stained (right panel).
Figure 5B is a graph illustrating hepatic triglyceride levels in GPRC6A+ + and GPRC6A" " male mice at age of 16 week old.
Figure 5C is a graph illustrating a glucose tolerance test (GTT) in 3 month-old male GPRC6A /+ and GPRC6A " " mice.
Figure 5D is a graph illustrating a insulin tolerance test (ITT) in 3 month-old male GPRC6A /+ and GPRC6A " " mice.
Figure 6A is a graph illustrating a comparison of the lean body mass of 6, 8, 12, and 16 week old male and female GPRCoA+ + and GPRC6A" " mice. Figure 6B is a graph illustrating a comparison of the fat percent of 16 week old male and female GPRC6A /+ and GPRC6A " " mice.
Figure 6C is a graph illustrating a comparison of the femur bone mass density (BMD) of 6, 8, 12, and 16 week old male and female GPRC6A+/+ and GPRC6A" " mice.
Figure 6D is an image of backscattered scanning electron microscopy analysis of tibia cortical bone in 16-week-old GPRC6A+ + (upper panel) and GPRC6A " mice (lower panel), where the arrows showed the diminished mineralization layer in the bone of GPRC6A " " mice.
Figure 6E is an image of toluidine blue-stained plastic sections of femur from 16- week-old GPRC6A /+ (upper panel) and GPRC6A " " mice (lower panel), where the arrows showed the unmineralized osteoid surfaces in the bone of GPRC6A" " mice.
Figure 6F is an image of plastic unstained sections of tibia cortical bone viewed under fluorescent light in 16-week-old GPRC6A+ + (upper panel) and GPRC6A" " mice (lower panel) prelabeled with twice calcein (double label).
Figure 6G shows alkaline phosphatase (ALP) expression that was measured by RT-PCR from 4- and 10-day primary osteoblasts cultures derived from 8-week GPRC6A+/+ and GPRC6A Λ mouse calvaria.
Figure 6H shows alkaline phosphatase (ALP) activity in BMSCs from wild-type and GPRC6A" " mice cultured for 10 and 14 days.
Figure 61 shows alizarin Red-S for GPRC6A+/+ and GPRC6A" " showing mineralization of extracellular matrix.
Figure 7A shows the GPRC6A response to extracellular steroid hormones, testosterone and synthetic androgen (R1881), which stimulated the GPRC6A-mediated activation of phospho-ERK (upper panel); as control the HEK293 (middle panel) and HEK293 transfected calcium sensing receptor (CASR) cells (lower panel) did not responded to the testosterone and Rl 881.
Figure 7B shows that testosterone-BSA stimulated the GPRC6A mediated activation of phospho-ERK.
Figure 7C shows that the non-steroidal anti-androgen, flutamide did not inhibited testosterone stimulated the GPRC6A mediated activation of phospho-ERK.
Figure 7D shows that testosterone stimulated the GPRC6A mediated activation of phospho-ERK in both the cytosol and nucleus.
Figure 7E shows that extracellular calcium is required for GPRC6A sensing of testosterone. Figure 7F shows that dehydroandrosterone (DHEA), beta-estradiol, cholesterol, l,25(OH)2VitD3, and dexamethasone, but not progesterone stimulated GPRC6A- mediated activation of phospho-ERK.
Figure 7G shows that the surface binding of testosterone-BSA-FITC was present in HEK293 cells transfected with GPRC6A, but not in untransfected HEK293 cells (the nuclei were stained by DAPi).
Figure 7H includes a picture of a RT-PCR gel that indicates GPRC6A and AR did not expressed in HEK-293 cells by RT-PCR.
Figure 71 includes a graph that shows synthetic androgen (Rl 881) stimulated the GPRC6A mediated activation of luciferase when HEK-293 cells were co-transfected with pcDNA3.mGPRC6A and SRE-luciferase reporter gene plasmid.
Figure 7J includes a graph that shows testosterone binding to a membrane fraction of HEK-293 cells transfected with GPRC6A.
Figures 8A-8C show the response to testosterone in GPRC6A knockout mice, where BMSCs derived from the male GPRC6A - mice exhibited a reduced ability to activate ERK in response to testosterone (80 nM), extracellular calcium, and the calcimimetics, NPS-R568, respectively, as assessed by Western blot analysis using an antiphospho-ERK antibody.
Figures 8D-8E show the impact of the loss of GPRC6A on the capacity of testosterone to stimulate phospho-ERK activity and early growth-responsive 1 (Egr-1) expression in bone marrow and testes in vivo.
Figure 9A is a picture of a gel that indicates Rl 881 stimulated GPRC6A-mediated non-genomic activation of intercellular phospho-Src and phospho-Raf-1.
Figure 9B is a picture of a gel that shows testosterone and β-estradiol stimulated GPRC6A-mediated activation of phospho-ERK were each blocked by 100 ng/ml Pertussis toxin (PTx).
Figure 9C is a picture of a gel that shows testosterone stimulated GPRC6A- mediated activation of phospho-ERK which was inhibited by 10 μM PD89059, 50 μM Ly294002, 2 μM U73122 and 10 μM PP-I. Figures 9D-9F include graphs that illustrate Rl 881, synthetic androgen stimulated the GPRC6A-mediated activation of luciferase were inhibited by PD89059 (Figure 9D), Ro31-8220 (Figure 9E) and PP-I (Figure 9F).
Figure 9G is a schematic diagram of the signal transduction pathway of GPRC6A.
Figure 1OA is a picture of a gel that indicates BMSCs derived from the male GPRC6A" " mice exhibited a reduced ability to activate ERK in response to testosterone (80 nM).
Figure 1OB is an image of dissected seminal vesicle of wild-type and GPRC6A null mice after sham and castration (ORX) with or without testosterone replacement.
DETAILED DESCRIPTION
The present invention relates to compositions and methods for treating, inhibiting, and/or preventing a disorder in a subject by regulating or modulating the G-protein coupled receptor GPRC6A or functionality thereof. The modulation of GPRC6A can achieve therapeutic states: (1) androgen or similar agonist can increase GPRC6A functionality to provide a non-genomic androgen response; (2) a GPRC6A antagonist can inhibit a non-genomic androgen response; (3) a GPRC6A agonist increase the activity of GPRC6A to increase anabolic responses in multiple tissues (e.g., bone, fat, muscle, liver, pancreas, kidney, and the like) with regard to a metabolic disorder; and (4) a GPRC6A antagonist can decrease the activity of GPRC6A to decrease an anabolic response in the tissues. As such, treating, inhibiting, and/or preventing the disorder can be carried out by regulating or modulating the amount or activity of GPRC6A in the subject. Accordingly, regulating or modulating can be performed by administering the subject a therapeutically effective amount of an androgenergic agonist, an androgenergic antagonist, or allosteric modulator such that the amount or activity of GPRC6A is regulated or modulated in accordance with the needed therapy for a particular disease state or symptoms thereof. Also, the therapy can be performed by increasing or decreasing the number of cell surface GPRC6A receptors that are available for binding an agonist, antagonist, or allosteric modulator. I. Introduction
GPRC6A is a widely expressed orphan G-protein coupled receptor that can sense extracellular amino acids, osteocalcin, and divalent cations. The entire scope of physiological functions of GPRC6A is unknown. In order to study GPRC6A, knockout mice were created and characterized to have the phenotype of GPRC6A" " mice. A complex multiorgan, metabolic-like syndrome was in GPRC6A " " mice that suggests that GPRC6A is involved in nutritional pathways coordinating the metabolic activity of multiple tissues in response to changes in extracellular amino acids and divalent cations. Complex metabolic abnormalities were found in GPRC6A" " mice involving multiple organ systems that express GPRC6A, including bone, kidney, testes, and liver were studied. GPRC6A" " mice exhibited hepatic steatosis, hyperglycemia, glucose intolerance, and insulin resistance. In addition, high expression levels of GPRC6A in Leydig cells in the testis were observed. GPRC6A was also highly expressed in kidney proximal and distal tubules, and GPRC6A" " mice exhibited increments in urine Ca/Cr and POVCr ratios as well as low molecular weight proteinuria. Finally, GPRC6A" " mice exhibited a decrease in bone mineral density (BMD) in association with impaired mineralization of bone.
GPRC6A" " mice have a metabolic syndrome characterized by defective osteoblast-mediated bone mineralization, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, and disordered steroidogenesis. These findings suggest the overall function of GPRC6A may be to coordinate the anabolic responses of multiple tissues through the sensing of extracellular amino acids, osteocalcin and divalent cations.
It has now been found that GPRC6A, previously described as an amino acid and an extracellular calcium sensing receptor, mediates the non-genomic actions of androgens. In cells that overexpress GPRC6A, but lack the nuclear androgen receptor, GPRC6A localizes to the cell surface membrane, where it mediates testosterone binding and androgen-stimulated ERK activation. Ablation of GPRC6A in mice results in feminization, loss of lean body mass, osteopenia, and increased fat in association with increased circulating levels of estradiol, and reduced testosterone levels in males. In addition, GPRC6A" " mice display attenuation of testosterone-stimulated ERK activation and Egr-1 expression in bone marrow stromal cells in vitro and in target tissues in vivo. Taken together, these data provide the first evidence that the orphan receptor GPRC6A is a biologically relevant androgen sensor, and thereby related to non-genomic androgen response and metabolic syndromes.
Also, GPRC6A " mice have a metabolic syndrome characterized by defective osteoblast-mediated bone mineralization, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance and disordered steroidogenesis, a phenotype resembling metabolic syndrome and Type II diabetes mellitus. These findings suggest the overall function of GPRC6A may be to coordinate the anabolic responses of multiple tissues through the sensing of extracellular amino acids, osteocalcin and divalent cations. Either pharmaceutical, genetic or biological approaches to activate or increase GPRC6A can be used as treatments for multiple organ dysfunction in metabolic syndrome. II. Therapeutic Methods
In one embodiment, the methods of the present invention can be used to treat, inhibit, and/or prevent disorders by regulating or modulating the expression, amount, or activity of GPRC6A to achieve a desired non-genomic androgen response or treat a metabolic syndrome in an individual. Such a method can include: (i) identifying an individual with or susceptible to a disorder associated with a non-genomic androgen response or metabolic disorder; and (ii) providing to the individual an agent capable of regulating or modulating an expression level, amount, and/or activity of GPRC6A in a therapeutically effective amount. In some instances in some disease states, the regulating or modulating can be a decrease. In other instances in some disease states, the regulating or modulating can be an increase.
In one embodiment, the method can include regulating or modulating the amount or activity of GPRC6A so as to increase or a decrease the concentration of a sex hormone within the individual. The regulating or modulating of the amount of GPRC6A can be carried out by upregulating or downregulating the expression level of GPRC6 A by agents that target the promoter for GPRC6A. Biological agents that regulate the expression of GPRC6A can be identified or developed as described herein, and such agents can be used to modulate GPRC6A.
In one embodiment, upregulation of the amount or activity of GPRC6A can be effected by using one or more of the following techniques: (a) expressing in cells of said individual an exogenous polynucleotide encoding at least a functional portion of GPRC6A; (b) increasing expression of endogenous GPRC6A in said individual; (c) increasing endogenous GPRC6A activity in said individual; (d) introducing an exogenous polypeptide including at least a functional portion of GPRC6A to said individual; (e) administering GPRC6A-expressing cells into said individual; or (f) introducing the extracellular domain of GPRC6A to a cell so as to act as a dominant negative to disrupt function of the GPRC6A receptor.
For example, the upregulated expression level of GPRC6A can be effected by administration of a nucleic acid that encodes for GPRC6A. Examples of such a nucleic acid can include DNA that encodes GPRC6A, such as a plasmid like pcDNA3.mGPRC6A, a cDNA, or other encoding DNA. RNA that encodes GPRC6A can also be administered. GenBank provides the following accession numbers, which sequences are incorporated herein by specific reference: GPRC6A gene is NC_000006 (SEQ ID NO: 28); and the protein sequence of human GPRC6A (hGPRC6A) is N 148963 (SEQ ID NO: 29).
In one embodiment, downregulation of the amount or activity GPRC6A can be effected by introducing into an individual one or more of the following agents: (a) a molecule that binds the GPRC6A; (b) an enzyme which cleaves the GPRC6A; (c) an antisense polynucleotide capable of specifically hybridizing with at least part of an mRNA transcript encoding GPRC6A; (d) a ribozyme which specifically cleaves at least part of an mRNA transcript encoding GPRC6A; (e) a small interfering RNA (siRNA) molecule which specifically cleaves at least part of a transcript encoding GPRC6A; (f) a non-functional analogue of at least a catalytic or binding portion of the GPRC6A; or (g) a molecule that prevent GPRC6A activation or substrate binding.
The regulating or modulating of the activity of GPRC6A can be carried out by increasing or decreasing the activity level of GPRC6A.
For example, upregulating the activity can be effected by administering to the individual an androgenergic agonist of the GPRC6A. Examples of androgenergic agonists include, androgens, steroid hormones, androgenic hormones, anabolic steroids, testoids, testosterones, 19-carbon steroids, dehydroepiandrosterone (DHEA), dehydroepiandrosterone sulfate (DHEA-S), androstenedione, androstenediones, androstenediol, androsterone, dihydrotestosterone, androstanolone, fluoxymesterone, mesterolone, methyl testosterone, selective androgen receptor modulators (SARM), andarine, BMS-564,929, LGD-226, ostarine, S-40503, brimonidine tartrate, dexamethasone, indeloxazine hydrochloride, salts thereof, combinations thereof, and the like.
In another example, downregulating the activity can be effected by administering to the an androgenergic antagonist or anti-androgenergic agent. Downregulating GPRC6A can be used to block androgen responses. Examples of downregulators of GPRC6A (e.g., androgenergic antagonist or anti-androgenergic agents) can include allylestrenol, oxendolone, osaterone acetate, bicalutamide, steroidal anti-androgergic agents, medroxyprogesterone (MPA), cyproterone, cyproterone acetate (CPA), dienogest, flutamide, nilutamide, spironolactone, 5alpha-reductase inhibitors, dutasteride, finasteride, salts thereof, combinations thereof, and the like.
GPRC6A is also activated by extracellular calcium, which has direct actions on multiple organs, including osteoblasts in bone, calcimimetics, amino acids, and osteocalcin the latter of which has recently been shown to be a bone derived factor that regulates energy metabolism. As such, calcium, calcimimetics, amino acids, and osteocalcin can be used to upregulate GPRC6A, and may function as allosteric modulators of GPRC6A
Accordingly, the present invention can also include a pharmaceutical composition having a GPRC6A upregulating or downregulating agent. Such a composition can include a pharmaceutically acceptable carrier, such as those well known in the art, and a therapeutically effective amount of the agent. III. Diseases
GPRC6A is involved, through hormonal regulatory pathways, with metabolism of energy, fat, bone, and glucose. As such, upregulation of the amount or activity of GPRC6A can be used for treating, inhibiting, and/or preventing defective mineralization of bone, impaired osteoblast function, decreases in lean body mass, increases in fat mass, hyperphosphatemia, hypercalciuria, hyperglycemia, and feminization of males associated with altered ratio of estradiol and testosterone. Additionally, GPRC6A can be used for treating, inhibiting, and/or preventing elevated serum glucose levels, glucose intolerance, insulin resistance, and hepatic steatosis. A therapy for such disorders can include administering a therapeutically effective amount of an agent to increase GPRC6A amount or activity. As such, the amount or activity of GPRC6A can be increased by a therapeutically effective amount.
In one embodiment, the disorder to be treated, inhibited, and/or prevented can be osteoporosis or osteopenia. As such, upregulating the amount or activity of GPRC6A can be used to stimulate anabolic bone mass densification. Such bone mass densification can be used as a therapy for osteoporosis or osteopenia.
In one embodiment, the disorder to be treated, inhibited, and/or prevented can be an estrogen responsive breast cancer or ovarian cancer. The amount or activity of GPRC6A can be upregulated in a therapeutically effective amount to cause a reduction in the production of an estrogen, such as estradiol. Reducing estradiol has been shown to reduce cancer in breast cancer and ovarian cancer patients (e.g., using aromatase inhibitors). Thus, by upregulating the amount or activity of GPRC6A, estradiol concentrations can be lowered, thereby treating, inhibiting, and/or preventing estrogen responsive breast cancer and/or ovarian cancer.
In one embodiment, the disorder to be treated, inhibited, and/or prevented can be prostate cancer. Downregulating GPRC6A can be used to block androgen responses, which can be used to treat prostate cancer by reducing the levels of testosterone in an individual or in certain tissues of an individual.
In one embodiment, the disorder that can be treated, inhibited, and/or prevented by upregulating GPRC6A can be any metabolic syndrome, which benefits from an upregulation in lean body mass and/or down-regulating body fat mass. Examples of metabolic syndromes include obesity-dependent metabolic syndrome, insulin resistance syndrome, and the like.
In one embodiment, the disorder to be treated, inhibited, and/or prevented can be diabetes, which benefits from an upregulation in lean body mass and/or down-regulating body fat mass.
In one embodiment, the disorder to be treated, inhibited, and/or prevented can be benign prostatic hypertrophy. Such a therapy can be achieved by downregulating the amount or activity of GPRC6A either by pharmacological means or by a dominant negative biological agent derived from GPRC6A extracellular domain
In one embodiment, GPRC6A can be upregulated so as to induce feminization of male. Such feminization may be useful in certain circumstances, such as transgendered men.
In one embodiment, GPRC6A can be upregulated so as to increase lean body mass. Individuals that are underweight or that have eating disorders may obtain increased health benefits from an increase in lean body mass.
In one embodiment, GPRC6A can be downregulated so as to decrease lean body mass. Individuals that are overweight or that become slimmer may obtain increased health benefits from a decrease in lean body mass.
In one embodiment, GPRC6A can be upregulated so as to decrease body fat mass. Individuals that are overweight or that become slimmer may obtain increased health benefits from a decrease in body fat mass. In one embodiment, GPRC6A can be downregulated so as to increase body fat mass. Individuals that are underweight or that have eating disorders may obtain increased health benefits from an increase in body fat mass. IV. Drug Screening. In one embodiment, the present invention can include a method for identifying a substance that modulates GPRC6A. As such, a cell can be provided that expresses GPRC6A. A substance can then be screened against the cell so as to determine whether or not the substance modulates GPRC6A. The substance can be in a library of substances, and the entire library or portion thereof can be screened. Substances can be identified that upregulate GPRC6A or downregulate GPRC6A. Substances that are identified can be used in the therapies described herein. The cell can naturally express GPRC6A. Alternatively, the cell can be a cell that is transformed from a non-GPRC6A cell to a cell that expresses GPRC6A.
EXPERIMENTAL
1.
To address the function of GPRC6A in vivo, we selectively deleted exon 2 of the mouse GPRC6A gene. The GPRC6A-deficient mouse model was created by replacing exon 2 of the GPRC6A gene with the hygromycin resistance gene (Fig. IA). To generate the targeting construct, the hygromycin resistance gene under the control of the PGK promoter was cloned into the Sma I and Eco RV sites of pBS-lox, which was produced by cloning the oligonucleotide Lox71 : 5'-ctagataccgttcgtatagcatacattatacgaagttatg-3' (SEQ ID NO: 1) into the Xba I and Bam HI sites and the oligonucleotide Lox 66: 5'- agcttataacttcgtatagcatacattatacgaacggtag-3' (SEQ ID NO: 2) into the Hind III and Sal I sites of pBluescript (Stratagene), to produce pBS-lox-PGK-Hyg. A genomic fragment from intron 1 of GPRC6A gene, representing the 5' homologous targeting region, was amplified by PCR using Advantage 2 Taq polymerase (BD Biosciences) and primers PP 232-Avr: 5'-aaacctagggccattcatgaaaaaatgttgtcctcagatgaccatcc-3' (SEQ ID NO: 3), and PP 233-Avr: 5'-aaacctaggctcactcaacccccatgtccttccaactctagctg-3' (SEQ ID NO: 4), digested with Avr II, and cloned into the Xba I site of pBS-lox-PGK-Hyg to produce pBS- GPRC6A-Intron 1. A genomic fragment from intron 2 of GPRC6A, representing the 3' homologous targeting region, was then amplified by PCR using Advantage 2 Taq polymerase and primers 298: 5'-aaagtcgacctacattggtccatcgattacattagttcttgg-3' (SEQ ID NO: 5) and PP 299: 5'-aaagtcgacgaggccttgaggtcaaactccagaaccccagag-3' (SEQ ID NO: 6), digested with Sal I, and cloned into the Sal I site of pBS-GPRC6A-Intron I to produce pGPRC6A-KO. The methods for knocking out the GPRC6A gene have been described previously in detail (Svard J, Heby-Henricson K, Persson-Lek M, Rozell B, Lauth M, et al. (2006), Genetic elimination of Suppressor of fused reveals an essential repressor function in the mammalian Hedgehog signaling pathway; Dev Cell 10: 187-197).
Briefly, the mouse embryonic cell line RW-4, derived from 129X1 /SvJ mouse strain (Hug BA, Wesselschmidt RL, Fiering S, Bender MA, Epner E, et al. (1996) Analysis of mice containing a targeted deletion of beta-globin locus control region 5' hypersensitive site 3. MoI Cell Biol 16: 2906-2912), and kindly provided by Stephan Teglund at the Karolinska Institute Center for Trans gene Technologies, was transfected by electroporation with Not I linearized pGPRC6A-KO. Hygromycin resistant embryonic stem cell colonies were picked, expanded, and tested by PCR to identify clones in which the PGK-Hygromycin gene had correctly replaced exon 2 of the GPRC6A gene. The correctly mutated embryonic stem clones were injected into blastocysts derived from C57BL/6 3.5 days after mating and implanted into B6CBAF1 pseudopregnant females. The resulting male chimeras were bred with female C57BL/6 mice. Homozygous founders were generated by mating the resulting heterozygous mice. The successful targeting of GPRC6A in embryonic stem (ES) cells was confirmed by Southern blot analysis of the genomic DNA from ES cell clones. We observed no apparent differences in the founders generated from different ES cell clones. We focused our studies on founder line 17.
We selectively deleted exon 2 of the mouse GPRC6A gene (Fig. IA). Wild-type GPRC6A+/+, heterozygous GPRC6A+/", and homozygous GPRC6A" " mice were geno typed by PCR (Fig. IB) and each genotype was found to be born at the expected Mendelian frequencies. In addition, full-length GPRC6A transcripts and proteins were documented to be absent from various tissues of GPRC6A " mice by RT-PCR (Fig. 1C) and Western Blot (Fig. ID). GPRC6A" " mice (as well as heterozygous GPRC6A+ " mice) were similar in gross appearance, body weight and body length to wild-type littermates (data not shown). There were no identified abnormalities in gait or physical activity between wild-type and GPRC6A " " mice. X-ray analysis indicated no gross abnormalities in the development of the skeleton in the GPRC6A" " mice (data not shown).
On closer inspection, we noted that male GPRC6A " mice had feminization of the external genitals (Figs. 2A-2C). In 16-week-old male mice, the genito-anal distance (Figs. 2A and 2B) as well as testicular size (Fig. 2C), testicular weight (Fig. 2D) and the weight of seminal vesicle (Fig. 2E) were significantly reduced in GPRC6A " " compared to wild-type littermates. No histological abnormality of the testes was noted in GPRC6A" " mice (Fig. 2F). GPRC6A was highly expressed in Leydig cells, and was also expressed in Sertoli cells, spermatogonia and spermatids by in-situ hybridization analysis. 2.
Mice mammary fat pads were excised and fixed for a minimum of 2 h in Carnoy's solution (60% ethanol, 30% chloroform, and 10% glacial acetic acid). The fixed glands were washed in 70% ethanol for 15 min and then rinsed in water for 5 min. The mammary glands were stained overnight at 4°C in carmine alum stain (I g carmine and 2.5 g aluminum potassium sulfate in 500 ml water).
We also found abnormalities of mammary glands in male GPRC6A" " mice, as evidence by greater ductal outgrowth in the mammary fat pad (in 10/14 GPRC6A" " compared to 3/13 mice wild-type male mice (Fig. 2G), and increased the mammary fat pad mass (Fig. 2H). We found no evidence of embryonic lethality or reduced fertility in homozygous null male or female mice when breed to their respective wild-type mates; however we observed a reduced litter size from breeding pairs consisting of both male and female homozygous null mice. 3.
We compared the serum testosterone, estradiol, follicle-stimulating hormone (FSH), and luteinizing hormone (LH) concentration in 16-week-old mice wild-type and GPR6CA" " mice. Testosterone concentrations in male GPRC6A knockout mice were significantly lower (Figure 21) and the estradiol concentrations were significantly higher in male GPRC6A " " mice compared to wild-type littermates (Figure 2J). Estradiol levels were not different between wild-type and GPRC6A " " female mice (Figure 2J), although the circulating testosterone levels were lower in female GPRC6A null mice (Figure 21). Furthermore, serum follicle-stimulating hormone (FSH) and luteinizing hormone (LH) levels in male mice were not significantly different between wild-type and the GPRC6A" " male mice, Figure 2K and Figure 2L, respectively. 4. Since inactivation of the androgen receptor is reported to lower testosterone levels in mice, we examined if loss of GPRC6A lowered androgen receptor expression. RT- PCR was performed using two-step RNA PCR (Perkin-Elmer) as previously described (Pi M, Faber P, Ekema G, Jackson PD, Ting A, et al. (2005) Identification of a novel extracellular cation-sensing G-protein-coupled receptor. J Biol Chem 280: 40201-40209). Specific intron-spanning primer sets were to amply the specified transcripts. For quantitative real-time RT-PCR assessment of bone markers expression, we isolated and reverse transcribed 2.0 μg total RNA from long bone of 8-week-old mice as previously described (Xiao ZS, Simpson LG, Quarles LD (2003) IRE S -dependent translational control of Cbfal/Runx2 expression. J Cell Biochem 88: 493-505). For quantitative real time RT-PCR assessment of aromatase, CYPl 7 and Sutllel genes expression we isolated and reverse transcribled total RNA isolated from testis, brain, fat, liver and pituitary of 33 week-old GPRC6A+/+ (n=5) and GPRC6A " " mice (n=5) as previously described (Hiroi H, Christenson LK, Chang L, Sammel MD, Berger SL, et al. (2004) Temporal and spatial changes in transcription factor binding and histone modifications at the steroidogenic acute regulatory protein (stAR) locus associated with stAR transcription. MoI Endocrinol 18: 791-806) using specific primer sets.
The following intron-spanning primer sets were used for RT-PCR: mGPRC6A.24. For: ccagaaagatggccctattga (SEQ ID NO: 7); mGPRC6A.1754.Rev: ctccttactggggcccagtggg (SEQ ID NO: 8); mAndRF578: caacttgcatgtggatgacc (SEQ ID NO: 9) and niAndRR961 : cttgagcaggatgtgggattc (SEQ ID NO: 10). mGnRH.Forl69: agcactggtcctatgggttg (SEQ ID NO: 11) and niGnRH.Rev389: gggccagtgcatctacatct (SEQ ID NO: 12). NaPiII.F248: ccacctatgccatctccagt (SEQ ID NO: 13) and NaPiII.R635: accatgctgacaatgatgga (SEQ ID NO: 14); mALP.905F: aacccagacacaagcattcc (SEQ ID NO: 15) and mALP.1458R: ctgggcctggtagttgttgt (SEQ ID NO: 16), G3PDH.F143: gaccccttcattgacctcaactaca (SEQ ID NO: 17); G3PDH.R1050: ggtcttactccttggaggccatgt (SEQ ID NO: 18) for control RNA loading. The following primer sets were used for realtime PCR: aromatase forward primer: tgagaacggcatcatatttaacaac (SEQ ID NO: 19) and reverse primer: gcccgtcagagctttcataaag (SEQ ID NO: 20); Cypl7 forward primer: tggaggccactatccgagaa (SEQ ID NO: 21) and reverse primer: tgttagccttgtgtgggatgag (SEQ ID NO: 22); and Sultlel forward primer: tcatgcgaaagggaattatagga (SEQ ID NO: 23) and reverse primer: tgcttgtagtgctcatcaaatctct (SEQ ID NO: 24).
Figure 3A shows that GPRC6A does not effect expression of the androgen receptor, providing further support for a direct role of GPRC6A in mediating androgen responses.
We observed no difference in AR transcripts in the testis and bone marrow by RT- PCR (Fig. 3B). To explore the possibility that the reduction in testosterone was due to increased aromatase-mediated conversion for testosterone to estrogen, we examined aromatase gene (Cypl9al) expression by real-time RT-PCR. The quantitative real-time PCR using primers located in exon 4 and the interface between exons 4 and 5 failed to document any difference in the expression of Cypl9al in GPRC6A null mice testis (Fig. 3C).
We did, however, detect a small increase in aromatase (CPYl 9) protein levels in testis of GPRC6A" " mice by Western Blot analysis (Fig 3D) that was localized by immunohisto chemistry (Fig. 3E) to Leydig cells, Sertoli cells, and spermatocytes site where CPYl 9 is known to be expressed. Aromatase protein level was slightly increased by approximately 11% in testis of GPRC6A" " male mice (Fig. 3D). The significance of these changes in explaining the alterations in the testosterone and estradiol levels are uncertain, since we did not measure aromatase enzyme activity.
We found substantially no reductions in the expression of P450 17α-hydroxylase gene (Cypl7), an enzyme that converts pregnenolone to dehydroandrosterone (DHEA) in the testosterone synthesis pathway, or estrogen sulfotransferase gene (EST/Sultlel), which catalyzes the sulfoconjugation and inactivation of estrogens, in the GPRC6A" " male mice testes by real-time PCR (Figs. 3F and 3G).
Similarly, aromatase and Sultlel were not different in brain, fat, liver and pituitary of GPRC6A deficient and wild-type mice (data not shown). Gonadotrophin- releasing hormone gene (GnRH) message expression in the brain, however, was not altered in GPRC6A null mice (Fig. 3H-3I). 5.
For GPRC6A gene expression, the probe was amplified by RT-PCR using following intron spanning primer: mGPRC6A.189F (in Exon I) cgggatccagacgaccacaaatccag (SEQ ID NO: 25) and mGPRC6A.539R (spanned over Exon II and III) ccaagcttgattcataactcacctgtggc (SEQ ID NO: 26). After RT-PCR, the product was subclone into pre-cut by BamH I and Hind III of pBluescript SK(+). Using T7 promoter will create sense RNA, and T3 promoter will create Anti-sense RNA ribo- probe.
We previously demonstrated that GPRC6A is highly expressed in the kidney. We extended these observations by showing that GPRC6A is expressed in both proximal and distal tubules by in situ hybridization (Fig. 4A).
Figure 4B shows the effect of GPRC6A ablation to reduce the transporter for phosphate in the proximal tubule of the kidney. Activation of GPRC6A might increase phosphate conservation whereas inhibition of GPRC6A would lead to increased phosphate excretion by the kidney Interestingly, the expression of sodium-phosphate co transporter, NaPi Ha, was decreased (both the transcript and protein) in GPRC6A " mice (Figs. 4C and D), suggesting adaptive responses in the kidney to excrete phosphate.
In addition, we found that urinary protein excretion was elevated in GPRC6A" " mice by Western blot analysis (Fig. 4E). Immunohisto chemical analysis revealed that this protein band in the urine represents β2-microglobulin (Fig. 4F), providing evidence for abnormalities in the proximal tubule function in GPRC6A null mice. 6.
Serum was collected using a retroorbital bleeding technique. For urine samples collection, mice were placed in metabolic cages (Hatteras Instrument), and urine was collected for 24 h. The urine volume was measured before storage at -700C. Serum testosterone and estradiol levels were measured by testosterone enzyme immunoassay test kit and estradiol (E2) enzyme immunoassay test kit from BioCheck, Inc. Follicle stimulating hormone (FSH) and luteinizing hormone (LH) were measured by mouse FSH radioimmunoassay and the mouse LH sandwich assay as described by the University of Virginia Center for Research in Reproduction Ligand and Analysis Core (NICHD (SCCPRR) Grant U54-HD28934). Serum and urinary calcium was measured by the colorimetric cresolphthalein binding method, and phosphorus was measured by the phosphomolybdate-ascorbic acid method. Serum TRAP was assayed with the ELISA- based SBA Sciences mouseTRAP™ assay. Serum PTH and 1,25(OH)2 vitamin D were measured the kits from Immutopics, Inc. and Immunodiagnostic system, Ltd., respectively. Serum Fgf23 levels were measured by using FGF-23 ELISA kit (Kainos Laboratories Inc.) following the manufacturer's protocol. Creatinine was measured by the colorimetric alkaline picrate method (Sigma kit 555, Sigma-Aldrich). Urinary protein and Dpd were measured by Bio-Rad and Metra Biosystems, Inc., respectively.
We also found that GPRC6A" " mice had mild but significant increases in urinary calcium and phosphate excretion (calcium/creatinine ratio: 0.19 ± 0.02; phosphorus/creatinine ratio: 5.32 ± 0.31) compared to wild-type controls (calcium/creatinine ratio: 0.13 ± 0.01 ; phosphorus/creatinine ratio: 3.93 ± 0.28) (Table 1). The mild hypercalciuria was not evident at 6-weeks-of-age, but was present at subsequent ages, whereas the increased urinary phosphate levels were observed only in 16-week old GPRC6A " mice. The level of serum phosphorus was also significantly higher in 16 week-old knockout mice (6.52 ± 0.18 mg/dl) compared to wild-type littermates (5.18 ± 0.21 mg/dl) (Table 1). Circulating concentrations of calcium, PTH, FGF23, and 1,25(OH)2 vitamin D levels were not significantly different between wild-type and
GPRC6A i -l-" mice (Table 1).
Serum
Calcium Phophorus FGF23 PTH 1,25(OH)2 ViI D3 (ms'dl) (mg/dl) (pg/ml) (pg/ml) (pmol/L) TRAP(UZL)
GPRC6A+* >• C 5 ± C ' : ' ÷. ± c 21 " '- F I ± ,3 24 TO :. ± T Li ό . > 17 ± Vb Oi-- 4 tι>: z 0 55 GPRCSA- : 05> ± c 1 1 1 12 ± C ' 8 d \> Oc1 ± O ~" 50 2l' ± 4 ': « l 25 1 ?G ± ?a 5t 5 25 z 0 74
Urine
Dpd/Creatinine Calcium Phophorus Protein The Ratio /Creatinine Ratio /Creatinine Ratio 'Creatinine Ratio PhosphateExc (mg/mg) (mg/mg) (mg/mg) (mg/mg) ration Index
GPRC6A** I C C" ± 1 I1"] Ci It - 0 01 3 M - - 0 H I f 32 ± 1 83 I ό ?2 ± 4o 2H GPRC6A' ic 73 ± 1 :u'ι 0 1y = 0 Jl" 1 32 - 0 - 1 " 21 ? :- + ?5 5ι
Data me mean = SEM fiem inoie than 10 mJivulual mice tn each aioup mid Sisiiificaiit diffeieπce fiom wild-type and GPRC oA null mice at;1 0 05 >ind;j 0,U l re^pectu ely, In addition, we found that fasting serum glucose levels were significantly greater and insulin levels were lower in GPRC6A" " mice compared to wild-type littermates (Table 1) Additional figures, which are described below, shows abnormal glucose tolerance test and insulin tolerance test in GPRC6A null mice. Loss of GPRC6A leads to hyperglycemia and insulin resistance. Activation of GPRC6A would be predicted to lower glucose and increase insulin sensitivity, and be a therapy for Type II diabetes and metabolic syndrome. 7.
Wild-type and GPRC6A mouse kidney were routinely processed and embedded in paraffin. The paraffin sections at thickness of 5 μm were prepared and collected on commercially available, positively charged glass slides (Superfrost Plus, Fisher Scientific). The sections were dried on a hot plate to increase adherence to the slides. Representative sections were de-paraffined and re-hydrated through conventional methods. The sections were digested by 10 mg/ml hyaluronidase for 20 minutes. Nonspecific protein binding was blocked by incubation with 10% normal goat serum. The sections were incubated in polyclonal rabbit against mouse NaPi Ha (1 :500 dilution) or polyclonal goat anti-human aromatase antibody (1 :200 dilution) (CYP19, Santa Cruz Biotechnology, Inc.) at 4°C overnight. The negative control sections were incubated with 0.01 M PBS. Thereafter, the sections were treated sequentially with FITC-conjugated Donkey anti Rabbit IgG secondary antibody (Jackson Labs). The nucleus was stained with ready to use Hoechst (Sigma).
We also found that the liver of GPRC6A" " mice exhibited histological features of hepatic steatosis by H&E and Oil Red O staining (Fig. 5A). Lipid positive droplets were present in hepatocytes of GPRC6A" " mice but not wild-type mice. This correlated with increased triglyceride content in the livers of GPRC6A" " mice (Fig 5B).
8.
For glucose tolerance test (GTT) glucose (2 g/kg body weight) was injected intraperitoneally (IP) after an overnight fast, and blood glucose was monitored using blood glucose strips and the Accu-Check glucometer (Roche) at indicated times. For insulin tolerance test (ITT) mice were fasted for 6 hours, injected IP with insulin (0.2
U/kg body weight, Lilly Research Laboratories), and blood glucose levels were measured at indicated times as described. ITT data are presented as percentage of initial blood glucose concentration. Since fatty liver disease is a manifestation of "metabolic syndrome", we examined
GPRC6A" " mice for evidence of glucose intolerance. We performed glucose tolerance tests following IP injection of glucose (2 g/kg of body weight) after an overnight fast
(GTT), and insulin tolerance tests by IP injection of insulin (0.2 units/kg of body weight) after 6 hours fast (ITT). These tests revealed that GPRC6A" " mice had a significantly higher serum glucose levels during the GTT and lower sensitivity to insulin than wild- type mice in the ITT (Fig. 5C and 5D, respectively).
9.
Bone mineral density (BMD) of whole skeletons and femurs were assessed at 6, 8,
12, and 16 weeks of age using a PIXImus™ bone densitometer (Lunar Corp.) as previously described (Tu Q, Pi M, Karsenty G, Simpson L, Liu S, et al. (2003) Rescue of the skeletal phenotype in CasR-deficient mice by transfer onto the Gcm2 null background. J Clin Invest 111 : 1029-1037).
Skeletons of mice were prelabeled twice with calcein (Sigma C-0875, 30 119/g body weight) by intraperitoneal injection at 8 and 3 days prior to sacrifice. Tibias and femurs were removed from 8- and 16-week-old mice, fixed in 70% ethanol, prestained in
Villanueva stain and processed for methyl methacrylate embedding. Villanueva prestained sections were evaluated under fluorescent light.
Both male and female GPRC6A" " mice had a significant reduction in lean body mass compared to wild-type littermates (7.9% and 10% in male and 11.2% and 13% in female GPRC6A" " mice at 12 and 16 weeks, respectively) as assessed by PIXImus™ densitometry (Fig. 6A). There were no apparent differences, however, in muscle histology between wild-type and GPRC6A" " mice (data not shown). Body fat as assessed by PIXImus™ densitometry (Fig. 6B) and white fat by gross inspection of various organs, such as testis, were increased in GPRC6A" " compared to wild-type mice. Both male and female GPRC6A " " mice did not have the expected age-dependent increase in bone mineral density (BMD). Indeed, BMD was significantly less at 8, 12, and 16 weeks-of-age in GPRC6A" " mice as compared to age-matched wild type mice (Fig. 6C).
To determine if the decreased bone density might be due to defective mineralization of bone, we performed backscatter EM and bone histological analysis. Briefly, plastic embedded bone from 8 week-old wild-type and GPRC6A knockout mice (GPRC6A " ") were cut and polished, and mounted on aluminum sockets with bone surface facing above, sputter-coated with gold and palladium, and examined with field emission scanning electron microscopy (Philips XL30, FEI Company) equipped with a backscatter electron imaging system. Backscatter EM of cortical bone demonstrated diminished mineralization surrounding osteocyte lacunae and on the perisoteal and endosteal surfaces (Fig. 6D).
Analysis of bone histology also revealed an increase in unmineralized osteoid surfaces (Fig. 6E) and diffuse calcien labeling of bone compared to the distinct double labels in wild-type mice (Fig. 6F), indicative of impaired mineralization, but no appreciable differences in osteoblasts or osteoclast number or appearance.
The distal femoral metaphyses were scanned using a micro-CT 40 (Scanco Medical AG); 167 slices of the metaphyses under the growth plate, constituting 1.0 mm in length, were selected. The three-dimensional (3D) images were generated using the following values for a gauss filter (sigma 0.8, support 1) and a threshold of 275. A 3D image analysis was performed to determine bone volume (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb. Th), and trabecular separation (Tb. Sp). Cortical bone was measured on the mid-shaft region of cortical bone in 50 slices of the diaphysis, constituting 0.3 mm in length. The mean cortical thickness (Ct. Th) was determined at 8 different points on the cortical slice.
Although micro-CT analysis also detected a significant reduction in BOM in both the metaphyseal area, which predominately consists of trabecular bone, and the mid-shaft region, which is composed of cortical bone (Table 2), there were no demonstrable changes in bone structural parameters, including bone volume (BV/TV) and cortical thickness (Ct.Th), between GPRC6A" " and wild-type mice. This suggests that the decreased BMO might be due to defective mineralization of bone.
Table 2 u-C T aualyiis of bone from 16 week -old wild-type and G? RC oA knockout mice
Bone Density BV/TV Ct.Th (mm) (mg HA/ccm)
G P RC 6A- 0.3579 ± O.C 124 0.25 ' 5 ± 0 C 104 1 fii 1 z - 5.6ι3'
GPRC 6A-* 0.3723 ± 0.C 1 12 0.2 : 5 ± D 0 ' ' 018 9 ± 5 ;-i
"'Significant difference from τπlcl-type <a::d GPRCOA- - mice at y C 05. Data represent the mean = SEiI from 6 mice for each group.
Assessment of expression of osteoblast markers in bone from 16-week-old GPRC6A" " mice, however, revealed reductions in osteocalcin, alkaline phosphatase, osteoprotegerin and Runx2-l l message levels compared to wild-type mice by real time RT-PCR (Table 3). The osteoclastic marker TRAP, chondrocyte marker Col II, and adipocyte markers aP2 and LpI were not significantly different between wildtype and GPRC6A mice (Table 3).
Table 3
Accession
Gene Number GPRC6A+ - GPRC 6 A
ALP NM_007431 0.493 = 0,096 0.194 = 0,0045 '
Osteocalcin NM_007541 1.101 = 0,068 0,41 1 = 0.1
Osreoproregeπ a MMU94331 0.0^55 = 0 021 0.0159 = 0.0045 :
Rιπ/x2-II NM_009820 0.156 = 0,034 0.0563 = 0,0061 :
Os lerix AF 184902 0.00187 ± 0 00078 0. 00136 = 0. 00047
RAXKL NMJ)1 1613 0 000987 = 0,00011 0.00124 = 0.00037
TfLiP NM_00738S 0.793 = 0, 188 0,742 ± 0 12
Colli NM_031 163 0.457 = 0,219 0,186 = 0.056 aP2 NM_024406 1.229 = 0,305 1.624 ± 0.342
LpI NM 008509 0,0803 = 0,0149 0,118 = 0.054
Denote-- sisni:ieanr diήei ence between wild- type ai;u GPRC OA" " mice aτ _r 0.1 1? . Data are mean = S E, tiom S weeks-c»k> mice
Values m e l elative to the housekeeping gene CM IOV-'I IITU A. AbIn evicti
Figure imgf000026_0001
^Pl. adipocyte fatty acid-binunig pioteiπ 2. Colli, collagen type II. and LpI. lipopiotem lipase
In addition, bone marrow stromal cells cultured from GPRC6A null mice exhibited reduced expression of alkaline phosphate expression and activity compared to wild-type cultures, which demonstrated the typical culture duration-dependent increase in alkaline phosphate (Figures 6G-6I). Reduced Alkaline phosphatase in primary calvarial osteoblasts and bone marrow stromal cells (BMSC) derived from GPRC6A" " mice. Figure 6G shows alkaline phosphatase (ALP) expression that was measured by RT-PCR from 4- and 10-day primary osteoblasts cultures derived from 8-week GPRC6A+/+ and GPRC6A" " mouse calvaria. Figure 6H shows alkaline phosphatase (ALP) activity in BMSCs from wild-type and GPRC6A" " mice cultured for 10 and 14 days. Figure 61 shows alizarin Red-S for GPRC6A+/+ and GPRC6A. The alizarin Red-S stains mineralized matrix. The decrease in staining indicates that mineralization is impaired in the absence of GPRC6A. Thus, a GPRC6A antagonist can be used to inhibit mineralization of the extracellular matrix. 10.
HEK-293 cells were co-transfected with pcDNA3.mGPRC6A or pcDNA3 or pcDNA3.rCASR plasmid as previously described (Estrada, M., Uhlen, P. & Ehrlich, B. E. Ca2+ oscillations induced by testosterone enhance neurite outgrowth. Journal of cell science 119, 733-743 (2006). Agonist stimulation was performed in quiescent cells. Quiescence was achieved in subconfluent cultures by removing the media and washing with Hanks' Balanced Salt Solution (Invitrogen) to remove residual serum, followed by incubation for an additional 24 h in serum-free media. After agonist treatment at the specified concentrations and duration, cells were washed twice with ice-cold PSS and scraped into of lysis buffer (25 mM HEPES pH 7.2, 5 mM MgCl2, 5 mM EDTA, 1 % Triton X-100, 0.02 tablet/ml of protease inhibitor mixture). Equal amounts of lysates were subjected to 10% SDS-PAGE, and phospho-ERKl/2 levels were determined by immunoblotting using antiphospho-ERKl/2 mitogen-activated protein kinase antibody (Cell Signaling Technology). To confirm that variations in the amount of ERK did not contribute to stimulated ERK activity, we used an anti-ERKl/2 mitogen-activated protein kinase antibody (Cell Signaling Technology) to measure ERK levels. An anti-peptide antibody was raised in a rabbit against a peptide (AIHEKMLS SDDHPRRPQIQKC (SEQ ID NO: 27)) corresponding to a sequence in the extracellular domain of mouse GPRC6A (in exon 1 of mouse GPRC6A gene) produced by Abgent (San Diego, CA). For phospho- ERK, the phospho-ERKl/2 levels were determined by immunoblotting using anti- phospho-ERKl/2 mitogen-activated protein kinase antibody (Cell Signaling Technology). Urinary β2-microglobulin was detected by rabbit polyclonal anti-β2-microglobulin antibody (Abeam Inc.). For aromatase expression analysis, the rabbit polyclonal anti- aromatase antibody (Abeam Inc.) and goat anti-rabbit IgG HRP secondary antibody (Santa Cruz Biotechnology Inc.) were used. Mouse anti-Actin antibody (Santa Cruz Biotechnology Inc.) was used for control protein loading.
RT-PCR was also performed using two-step RNA PCR (Perkin-Elmer). In separate reactions, 2.0 μg of DNase-treated total RNA was reverse-transcribed into cDNA with the respective reverse primers specified below and Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.). Reactions were carried out at 42 0C for 60 min followed by 94 0C for 5 min and 5 0C for 5 min. The products of first strand cDNA synthesis were directly amplified by PCR using AmpliTaq DNA polymerase (Perkin-Elmer). The primer sets used to amplify various gene transcripts with intron- spanning are as follows: hGPRC6A.F203: caggagtgtgttggctttga (SEQ ID NO: 30) and hGPRC6A.R630: atcaggtgagccattgcttt (SEQ ID NO: 31); mGPRC6A.189F: cgggatccagacgaccacaaatccag (SEQ ID NO: 32) and mGPRC6A.539R: ccaagcttgattcataactcacctgt (SEQ ID NO: 33); hAR.Forl612: cctggcttccgcaacttacac (SEQ ID NO: 34) and hAR.Revl779: ggacttgtgcatgcggtactca; G3PDH.F143: gaccccttcattgacctcaactaca (SEQ ID NO: 35); G3PDH.R1050: ggtcttactccttggaggccatgt (SEQ ID NO: 36).
To define the role of GPRC6A in androgen-mediated cell function, we expressed GPRC6A in human embryonic kidney 293 cells (HEK-293) lacking the nuclear androgen receptor. First, we confirmed that HEK-293 cells express GPRC6A and classic androgen receptors by RT-PCR analysis. We used human prostate cancer cell line 22Rv-I as positive control, and found that the GPRC6A and classic androgen receptor (AR) expressed in 22Rv-I cells, but not expressed in HEK-293 cells (Fig. 7H). Therefore, we used HEK-293 as host cell to investigate the function of GPRC6A. In previously reports, GPRC6A is a amino acid- and calcium-sensing receptor. To explore the function of GPRC6A in respond to extracellular androgen, we first examined androgen response in HEK-293 cells cotransfected cDNAs of GPRC6A and a reporter gene construct, SRE- luciferase.
We found that testosterone and a synthetic androgen (R1881) stimulated extracellular signal-regulated kinase phosphorylation (phospho-ERK) in a dose- dependent fashion in HEK-293 cells transfected with GPRC6A, but not in the non- transfected HEK-293, HEK-293 transfected with GPRC6A (Figure 71), or HEK-293 transfected with the related G-protein-coupled calcium sensing receptor (CASR) (Fig 7A). The concentration of testosterone required to activate GPRC6A was in the normal physiological range (e.g., 20 to 80 nM). Moreover, testosterone coupled to BSA, which is impermeable to the cell membrane, stimulated phospho-ERK in GPRC6A expressing HEK-293 cells (Fig 7B), consistent with a cell surface effect. In contrast, the synthetic androgen receptor antagonist, flutamide, neither stimulated phospho-ERK nor inhibited GPRCβAdependent testosterone activation of phospho-ERK in HEK-293 cells (Fig 7C). Testosterone also stimulated activation of phospho-ERK in both the cytosol and nucleus in GPRC6A expressing HEK-293 cells (Fig 7D). Finally, testosterone activation of GPRC6A required medium calcium concentrations in excess of 0.5 mM (Fig 7E), a concentration similar to the calcium requirement for amino acids and osteocalcin activation of GPRC6A. Dehydroandrosterone (DHEA), 17p-estradiol, cholesterol, l,25(OH)2Vit D3, and dexamethasone also stimulated the GPRC6A-mediated activation of phospho-ERK, but progesterone had no effect at concentrations up to 80 nM (Fig 7F). Supraphysiological concentrations (60 - 80 nM) of 17p-estradiol were required to activate GPRC6A-mediated phosphorylation of ERK. ). As control, HEK-293 without GPRC6A did not responded (data not shown).
In addition, the synthetic androgen receptor antagonist, flutamide, neither stimulated phosphor-ERK nor inhibited GPRC6A-dependent testosterone activation of phospho-ERK in HEK-293 cells (Fig. 7C). In contrast, testosterone activation of GPRC6A required medium calcium concentrations in excess of 0.5 mM (Fig. 7E), a concentration similar to the calcium requirement for amino acids and osteocalcin activation of GPRC6A. The extracellular calcium may be also a positive modulator for the GPRC6A in response to steroids.
We previously demonstrated that GPRC6A overexpression results in cell surface expression of this receptor. To further confirm that GPRC6A is a membrane located G- protein coupled androgen sensing receptor, we used testosterone-BSA, testosterone coupled to BSA which is impermeable to the cell membrane; to stimulate the HEK-293 cells stably transfected GPRC6A. Testosterone-BSA induced a dose-dependent stimulation of phospho-ERK in GPRC6A expressing HEK-293 cells (Fig. 7B), consistent with a cell surface effect. Moreover, we elucidated androgen binding sites were identified on the surface of HEK-293 cells transfected with GPRC6A cDNA constructs. When cells were incubated with the impeded ligand testosterone-BSA coupled to FITC for 5 to 10 seconds, revealed increased fluorescence intensity on the surface of HEK-293 cells transfected with GPRC6A, but not in empty HEK-293 cells (Fig. 7G). In addition, we isolated the membrane fractions from the HEK-293 cells stably transfected GPRC6A and control HEK-293 cells. Significant amounts of specific testosterone binding were detected in plasma membranes of the HEK-293 cells transfected with GPRC6A, whereas negligible specific binding was detected in the plasma membranes of untransfected cells (Fig. 7J). All those data indicated that GPRC6A imparts cell surface binding of testosterone. 11.
Cell surface binding of testosterone was evaluated by modifications of previously described methods, Briefly, HEK-293 cells stably expressing GPRC6A or untransfected HEK-293 cells were grown on glass cover slips for 48 hours, washed with PSS and then incubated with testosterone-BSA-FITC at room temperature for 5 minutes, followed by two washings with PBS and cell fixation with 2% paraformaldehyde for 30 minutes. The cellular distribution of testosterone-BSA-FITC was then determined by fluorescent microscopy. FITC-conjugated testosterone accumulated on the surface of HEK-293 cells transfected with GPRC6A, but not in empty HEK-293 cells (Fig 7G), indicating that GPRC6A imparts cell surface binding of testosterone. 12.
The femurs and tibias from 8-week-old wild-type and GPRC6A " mice were dissected, the ends of the bones were cut, and marrow was flushed out with 2 mL of ice- cold a-MEM containing 10% FBS using a needle and syringe. A suspension of bone marrow cells was obtained by repeated aspiration of the cell preparation through a 22- gauge needle, and nucleated cells were counted with a hemocytometer. Cells were seeded into 6-well plates at a density of 3x 107 cells/mL and cultured for three days in a-MEM supplemented with 10% FBS, 100 kU/L of sodium penicillin G and 100 mg/L of streptomycin sulfate in a humidified incubator with 5% CO2 and 95% air at a temperature of 37°C. On day 3, all nonadherent cells were then removed with the first medium change and then the adherent cells (representing bone marrow-derived mesenchymal stem cells, BMSCs) were grown for additional periods of up 3 days in the same medium. After overnight quiescence, the cells were stimulated for 5 minutes by testosterone and p- estradiol at the concentrations as indicated.
The non-genomic effects of androgens are present in many cell types, including osteoblasts and bone marrow stromal cells (BMSC) 1,10,18-20. Therefore, we next compared the ability of BMSC obtained from wild-type and GPRC6A" " mice to respond to testosterone added to the culture media (Fig 8A). We observed that testosterone at concentrations up to 80 nM had only minimal effects to stimulate phospho-ERK activity in GPRC6A" " mice compared to its substantial stimulation of ERK in wild-type cells (Fig 8A). BMSC derived from GPRC6A " mice also displayed an attenuated response to extracellular calcium and calcimimetics (Fig 8B and 8C).
To establish a linkage between non-genomic effects of androgens and tissue responses in vivo, we examined the impact of loss of GPRC6A on the capacity of testosterone to stimulate phospho-ERK activity and early growth-responsive 1 (Egr-1) expression in bone marrow and testes in vivo (Fig 8D and 8E). To accomplish this, we administered testosterone at a dose of 200 MG/KG or vehicle intraperitonealy to wild- type and GPRC6A" " male mice. We found that testosterone treatment stimulated both phospho-ERK activity and Egr-1 expression in bone marrow and testes of wild-type mice, but this response was markedly attenuated in GPRC6A" " mice (Fig 8D and 8D).
In summary, we have shown that GPRC6A has multiple functions as evidenced by abnormalities in GPRC6A null mice that include alterations in circulating testosterone and estrogen levels and feminization of male mice, defects of bone density and bone cell function and abnormalities in the renal handling of calcium and phosphate, hyperglycemia and liver steatosis. The ligand profile of GPRC6A, which includes extracellular calcium, calcimimetics, amino acids, and osteocalcin, along with the complex phenotype of GPRC6A null mice suggests that GPRC6A is an anabolic receptor that responds to a variety of nutritional and hormonal signals and may serve to coordinate the functions of multiple organs in response to changes of these ligands. Thus, regulation of GPRC6A can be used in the treatment, inhibition, and prevention of diseases associated with a non-genomic androgen response. Increasing the activity or amount of GPRC6A can increase a non-genomic androgen response, and decreasing the activity or amount of GPRC6A can decrease a non-genomic androgen response. 13.
The non-genomic actions of androgens have been implicated in a number of cellular effects, resulting in stimulation of Src kinase activity within minutes in the LNCaP prostate cancer cell line in response to 10 nM Rl 881, and stimulation of Akt activity in the osteoblastic cells in response to 10 nM DHT. Several physiological processes arising as a result of the rapid action of the Src-Ras-ERK signaling pathway in steroids non-genomic action also have been reported. To define the role of GPRC6A in androgen-mediated cell signaling activation, we examine the Src and Raf-1 are involved in GPRC6A-mediated androgen stimulated intercellular signaling pathway. The results of western blot revealed a synthetic androgen, Rl 881, stimulated GPRC6A-mediated activation of phospho-Src (Fig. 9A) and phospho-Raf-1 (Fig. 9A).
HEK-293 cells were co-transfected with pcDNA3.mGPRC6A and SRE-luciferase reporter gene plasmid. Quiescence of transfected cells was achieved in subconfluent cultures by removing the media and washing with Hanks' balanced salt solution (Invitrogen) to remove residual serum followed by incubation for an additional 24 h in serum-free quiescent media. Luciferase activity was assessed after 6 h of stimulation. The luciferase activity in cell extracts was measured using the luciferase assay system (Promega) following the manufacturer's protocol using a BG-luminometer (Gem Biomedical, Inc., Hamden, CT). Membranes from HEK and HEK stably transfected with GPRC6A were prepared and stored at -800C. The membrane preparations were diluted to 0.15-0.5 mg protein/ml in binding buffer (in mM: 20 HEPES, 100 NaCl, 6 MgCl2, 1 EDTA, and 1 EGTA) immediately before all binding assays. Total binding saturation curves were generated by incubating 250 μl of membrane preparation and 250 μl of [3H]Testoterone (Testosterone- [1,2,6,7-3H(N)] ; 1 mCi; Sigma, Chemicals, St. Louis, MO), dissolved in binding buffer (in mM: 20 HEPES, 100 NaCl, 6 MgCl2, 1 EDTA, and 1 EGTA) for final reaction concentrations ranging from 0.3 to 25 nM, for 40 min. After the 40-min incubation, the binding reactions were terminated by rapidly filtering 400 μl of the reaction over a presoaked Whatman, glass-fiber filter (pore size, 1 μm) to separate bound steroid from free steroid. The filter was immediately washed twice with 12.5 ml of wash buffer (PBS) and placed in a scintillation vial. Radioactivity was counted in a liquid scintillation counter (Beckman Instruments, Fullerton, CA). All steps of the binding assays were conducted at 4°C Testosterone also stimulated activation of phospho-ERK in both the cytosol and nucleus in GPRC6A expressing HEK-293 cells (Fig 7A). We and others have previously shown that mGPRC6A can couple to two different signaling pathways, Gαq and Gαi. To determine whether GPRC6A mediates signaling through which G-protein subunits by androgen stimulation, we expressed GPRC6A in HEK-293 cells and then stimulated with extracellular testosterone and β-esteroid at concentration of 50 nM. Those stimulated activation of phospho-ERK were significantly blocked by 100 ng/ml pertussis toxin (PTx) (Fig. 9B). Pertussis toxin catalyzes the transfer of ADP-ribose from NAD to the guanine nucleotide-binding regulatory protein to specify inhibit Gαi subunit. We also shown that the GPRC6A-mediated extracellular testosterone stimulated signaling were blocked by PD89059 (MAPK inhibitor), Ly294002 (PI3K inhibitor), PP-I (Src inhibitor) and Ro31- 8220 (PKC inhibitor) using either phospho-ERK or SRE-luciferase as read-outs (Figs. 9D-9F). These results suggest that Gαi, PI3K, PKC, Src and Ras/Raf/ERK may be involved testosterone stimulated GPRC6A-mediated signaling pathway (Fig. 9G). 14. The non-genomic effects of androgens are present in many cell types, including osteoblasts and bone marrow stromal cells. Expression profiling by reverse transcriptase- mediated polymerase chain reaction (RT-PCR) revealed the presence of messenger RNA for GPRC6A in bone marrow, testis and seminal vesicle in wild-type mice, but not in GPRC6A null mice (GPRC6A" ") (Fig. 10A). We compared the ability of bone marrow stromal cells (BMSC) obtained from wild-type and GPRC6A" " mice to respond to testosterone added to the culture media (Fig. 10B). Indeed we observed that testosterone at concentrations up to 80 nM had only minimal effects to stimulate phospho-ERK activity in BMSC from GPRC6A" " mice compared to its substantial stimulation of ERK in cells from wild-type littermates (Fig. 10B). In addition, BMSC from GPRC6A" " mice failed to responds to extracellular calcium and the calcimimetic NPS-R568, whereas BMSC from WT mice exhibited both extracellular-calcium- and NPS-R568- dependent stimulation of ERK phosphorylation (data not shown).
Given that the testicular feminization phenotype is observed in androgen receptor mutant mice that exhibit reduced testosterone levels as well as end organ resistance to exogenous androgen administration, we examined if the GPRC6A" " mice exhibited resistance to the non-genomic effects of androgens. First, the male WT and GPRC6A " " littermates will be castrated by removal of the testicles (orchiectomy) and hormone recovered by implanting testosterone slow releasing pellet. The size of seminal vesicles from orchidectomized was shrunk, but not significantly different between wild-type and GPRC6A " littermates (Fig. 8D). Then testosterone were given to orchidectomized GPRC6A" " and wild-type littermates, testosterone effectively recovered the size of seminal vesicles in wild-type mice, the recovery in GPRC6A" " mice was weaker compared to wild-type (Fig. 8D), which suggests that androgen actions mediated GPRC6A are impaired in GPRC6A " " mice. 15.
To establish a linkage between non-genomic effects of androgens and tissue responses in vivo, we examined the impact of loss of GPRC6A on the capacity of testosterone to stimulate phospho-ERK activity and early growth-responsive 1 (Egr-1) expression in bone marrow and testes (Fig. 8E). To accomplish this, we administered testosterone at a dose of 200 mg/kg or vehicle intraperitoneally to wild-type and GPRC6A" " male mice. Bone marrow was harvested at 20 and 60 minutes for assessment of ERK phosphorylation and Egr-1 mRNA expression. We found that testosterone treatment stimulated both phospho-ERK activity and Egr-1 expression in bone marrow and testes of wild-type mice, but this response was markedly attenuated in GPRC6A " " mice (Fig. 8E).
The present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. The described embodiments are to be considered in all respects only as illustrative and not restrictive. The scope of the invention is, therefore, indicated by the appended claims rather than by the foregoing description. All changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope. All references or citations of publications or presentations (e.g., patents, published patent applications, journal articles, abstracts, posters, and the like) disclosed herein are incorporated into this provisional patent application by specific reference in their entirety. What is claimed is:

Claims

1. A method for treating, inhibiting, or preventing a disorder, comprising: identifying an individual with a disorder associated with GPRC6A; and administering to the individual an agent capable of regulating an expression level and/or activity of GPRC6A.
2. The method of treating of claim 1, wherein said regulating increases or decreases the concentration of a sex hormone within said individual.
3. The method of treating of claim 1, wherein said regulating is upregulating said expression level and/or activity of said GPRC6A.
4. The method of treating of claim 3, wherein said upregulating is effected by administering to the individual an androgenergic agonist of said GPRC6A.
5. The method of treating of claim 3, wherein said disorder is an estrogen responsive breast cancer or ovarian cancer and said upregulating reduces the concentration of estradiol in the individual.
6. The method of treating of claim 3, wherein said disorder is osteoporosis or osteopenia and said upregulating increases bone density in said individual.
7. The method of treating of claim 3, wherein said disorder is an metabolic syndrome and said upregulating increases lean body mass and/or decreases body fat mass in the individual.
8. The method of treating of claim 3, wherein said disorder is diabetes.
9. The method of treating of claim 3, wherein said upregulating is effected by at least one approach selected from the group consisting of: (a) expressing in cells of said individual an exogenous polynucleotide encoding at least a functional portion of GPRC6A; (b) increasing expression of endogenous GPRC6A in said individual; (c) increasing endogenous GPRC6A activity in said individual; (d) introducing an exogenous polypeptide including at least a functional portion of GPRC6A to said individual; and (e) administering GPRC6A-expressing cells into said individual.
10. The method of treating of claim 1, wherein said regulating is down- regulating said expression level and/or activity of said GPRC6A.
11. The method of treating of claim 10, wherein said downregulating is effected by administering to said individual an androgenergic antagonist of said GPRC6A.
12. The method of treating of claim 10, wherein said disorder is prostate cancer.
13. The method of treating of claim 10, wherein said disorder is benign prostatic hypertrophy.
14. The method of treating of claim 10, wherein said downregulating is effected by introducing into said individual an agent selected from the group consisting of: (a) a molecule that binds said GPRC6A; (b) an enzyme which cleaves said GPRC6A; (c) an antisense polynucleotide capable of specifically hybridizing with at least part of an mRNA transcript encoding GPRC6A; (d) a ribozyme which specifically cleaves at least part of an mRNA transcript encoding GPRC6A; (e) a small interfering RNA (siRNA) molecule which specifically cleaves at least part of a transcript encoding GPRC6A; (f) a non-functional analogue of at least a catalytic or binding portion of said GPRC6A; and (g) a molecule which prevent GPRC6A activation or substrate binding.
15. A method for upregulating GPRC6A in a subject, comprising: administering to the subject an androgenergic agonist of said GPRC6A in a therapeutically effective amount to upregulate GPRC6A.
16. A method as in claim 15, wherein the androgenergic agonist is selected from the group consisting of androgens, steroid hormones, androgenic hormones, anabolic steroids, testoids, testosterones, 19-carbon steroids, dehydroepiandrosterone (DHEA), dehydroepiandrosterone sulfate (DHEA-S), androstenedione, androstenediones, androstenediol, androsterone, dihydrotestosterone, androstanolone, fluoxymesterone, mesterolone, methyl testosterone, selective androgen receptor modulators (SARM), andarine, BMS-564,929, LGD-226, ostarine, S-40503, brimonidine tartrate, dexamethasone, indeloxazine hydrochloride, salts thereof, combinations thereof, and the like.
17. A method for downregulating GPRC6A in a subject, comprising: administering to the subject an androgenergic antagonist of said GPRC6A in a therapeutically effective amount to downregulate GPRC6A.
18. A method as in claim 17, wherein the androgenergic antagonist is selected from the group consisting of allylestrenol, oxendolone, osaterone acetate, bicalutamide, steroidal anti-androgergic agents, medroxyprogesterone (MPA), cyproterone, cyproterone acetate (CPA), dienogest, flutamide, nilutamide, spironolactone, 5alpha-reductase inhibitors, dutasteride, finasteride, salts thereof, combinations thereof, and the like.
19. A GPRC6A knockout mouse comprising a GPRC6A gene having a deleted exon 2.
20. A mouse as in claim 19, wherein the mouse is heterozygous GPRCoA+ ".
21. A mouse as in claim 19, wherein the mouse is homozygous GPRC6A" ".
22. A method for identifying a substance that modulates GPRC6A, said method comprising: providing a cell expressing GPRC6A; and screening the substance against the cell so as to determine whether or not the substance modulates GPRC6A.
23. A method as in claim 22, further comprising screening a library of substances.
24. A method as in claim 22, wherein the substance upregulates GPRC6A.
25. A method as in claim 22, wherein the substance downregulates GPRC6A.
26. A method as in claim 22, wherein the cell is transformed from a non- GPRC6A cell to a cell that expresses GPRC6A.
PCT/US2008/084943 2007-11-29 2008-11-26 Methods for treating a disorder by regulating gprc6a Ceased WO2009073544A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US99118807P 2007-11-29 2007-11-29
US60/991,188 2007-11-29

Publications (2)

Publication Number Publication Date
WO2009073544A2 true WO2009073544A2 (en) 2009-06-11
WO2009073544A3 WO2009073544A3 (en) 2009-08-27

Family

ID=40675943

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/084943 Ceased WO2009073544A2 (en) 2007-11-29 2008-11-26 Methods for treating a disorder by regulating gprc6a

Country Status (2)

Country Link
US (1) US20090142323A1 (en)
WO (1) WO2009073544A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2413139A1 (en) * 2010-07-30 2012-02-01 Universität Leipzig Method and compositions for the identification of agents that have a potential effect against chronic inflammatory diseases
IT201900000367A1 (en) 2019-01-10 2020-07-10 Altergon Sa COMPOSITIONS INCLUDING A PEPTIDE ABLE TO STIMULATE THE GPRC6A-DEPENDENT SIGNAL PATH

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107709290B (en) 2015-04-21 2023-02-28 Gtx公司 Selective androgen receptor degrader (SARD) ligands and methods of use thereof
US10806720B2 (en) 2015-04-21 2020-10-20 University Of Tennessee Research Foundation Selective androgen receptor degrader (SARD) ligands and methods of use thereof
US10441570B2 (en) 2015-04-21 2019-10-15 University Of Tennessee Research Foundation Selective androgen receptor degrader (SARD) Ligands and methods of use thereof
US9834507B2 (en) 2015-04-21 2017-12-05 University Of Tennessee Research Foundation Selective androgen receptor degrader (SARD) ligands and methods of use thereof
RU2724103C2 (en) 2015-04-21 2020-06-22 Джи Ти Икс, ИНК. Selective androgen receptor destroying agents (sard) and methods of using thereof
US10035763B2 (en) 2015-04-21 2018-07-31 Gtx, Inc. Selective androgen receptor degrader (SARD) ligands and methods of use thereof
US10654809B2 (en) 2016-06-10 2020-05-19 University Of Tennessee Research Foundation Selective androgen receptor degrader (SARD) ligands and methods of use thereof
US10017471B2 (en) 2015-04-21 2018-07-10 University Of Tennessee Research Foundation Selective androgen receptor degrader (SARD) ligands and methods of use thereof
US10865184B2 (en) 2015-04-21 2020-12-15 University Of Tennessee Research Foundation Selective androgen receptor degrader (SARD) ligands and methods of use thereof
US10093613B2 (en) 2015-04-21 2018-10-09 Gtx, Inc. Selective androgen receptor degrader (SARD) ligands and methods of use thereof
US11230523B2 (en) 2016-06-10 2022-01-25 University Of Tennessee Research Foundation Selective androgen receptor degrader (SARD) ligands and methods of use thereof
WO2018094106A2 (en) 2016-11-16 2018-05-24 University Of South Florida ALLOSTERIC ANTAGONISTS OF GPRC6a AND THEIR USE IN MITIGATING PROTEINOPATHIES
WO2019165242A1 (en) * 2018-02-23 2019-08-29 Paraskevi Giannakakou Assay for detection of androgen receptor variants
WO2020051344A1 (en) 2018-09-05 2020-03-12 University Of Tennessee Research Foundation Selective androgen receptor degrader (sard) ligands and methods of use thereof
CN115813934B (en) * 2022-05-07 2025-03-14 温州医科大学 Application of androsterone and its combination with fibroblast growth factor in the treatment of hyperglycemia
CN119601223B (en) * 2024-07-18 2025-09-12 安徽农业大学 A method for predicting reproductive performance of mutton sheep

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CHRISTIANSEN B ET AL.: 'Known regulators of nitric oxide synthase and arginase are agonists at the human G-protein-coupled receptor GPRC6A.' BR J PHARMACOL. vol. 147, no. 8, April 2006, pages 855 - 863 *
KUANG D ET AL.: 'Cloning and characterization of a family C orphan G-protein coupled receptor.' J. NEUROCHEM. vol. 93, no. 2, April 2005, pages 383 - 391 *
PI M ET AL.: 'GPRC6A null mice exhibit osteopenia, feminization and metabolic syndrome.' PLOS ONE. vol. 3, no. 12, 2008, page E3858 *
ROHRER D.K. ET AL.: 'G protein-coupled receptors: functional and mechanistic insights through altered gene expression.' PHYSIOL REV. vol. 78, no. 1, January 1998, pages 35 - 52 *
WANG M ET AL.: 'Activation of family C G-protein-coupled receptors by the tripeptide glutathione.' J. BIOL. CHEM. vol. 281, no. 13, 31 March 2006, pages 8864 - 8870 *
WELLENDORPH P ET AL.: 'Molecular cloning, expression, and sequence analysis of GPRC6A, a novel family C G-protein-coupled receptor.' GENE vol. 335, 23 June 2004, pages 37 - 46 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2413139A1 (en) * 2010-07-30 2012-02-01 Universität Leipzig Method and compositions for the identification of agents that have a potential effect against chronic inflammatory diseases
WO2012013799A1 (en) * 2010-07-30 2012-02-02 Universität Leipzig Method and compositions for the identification of agents that have a potential effect against chronic inflammatory diseases
US8680259B2 (en) 2010-07-30 2014-03-25 Universität Leipzig Method and compositions for the identification of agents that have a potential effect against chronic inflammatory diseases
IT201900000367A1 (en) 2019-01-10 2020-07-10 Altergon Sa COMPOSITIONS INCLUDING A PEPTIDE ABLE TO STIMULATE THE GPRC6A-DEPENDENT SIGNAL PATH

Also Published As

Publication number Publication date
US20090142323A1 (en) 2009-06-04
WO2009073544A3 (en) 2009-08-27

Similar Documents

Publication Publication Date Title
US20090142323A1 (en) Methods for treating a disorder by regulating gprc6a
Pi et al. GPRC6A null mice exhibit osteopenia, feminization and metabolic syndrome
Fernandez-Valdivia et al. The RANKL signaling axis is sufficient to elicit ductal side-branching and alveologenesis in the mammary gland of the virgin mouse
Davey et al. Calcitonin receptor plays a physiological role to protect against hypercalcemia in mice
Yong et al. Essential role for Co-chaperone Fkbp52 but not Fkbp51 in androgen receptor-mediated signaling and physiology
Ferron et al. GGCX and VKORC1 inhibit osteocalcin endocrine functions
Shavlakadze et al. A growth stimulus is needed for IGF-1 to induce skeletal muscle hypertrophy in vivo
Yuan et al. The role of RXFP2 in mediating androgen-induced inguinoscrotal testis descent in LH receptor knockout mice
Nakonechnaya et al. Differential effects of exogenous and autocrine growth hormone on LNCaP prostate cancer cell proliferation and survival
Zubair et al. Transgenic expression of Ad4BP/SF-1 in fetal adrenal progenitor cells leads to ectopic adrenal formation
Kyrönlahti et al. GATA4 deficiency impairs ovarian function in adult mice
Jiao et al. Mex3c regulates insulin-like growth factor 1 (IGF1) expression and promotes postnatal growth
Farias Quipildor et al. Modulation of glucose production by central insulin requires IGF-1 receptors in AgRP neurons
Tascau et al. Activation of protein kinase A in mature osteoblasts promotes a major bone anabolic response
Chang et al. The transgenic expression of human follistatin-344 increases skeletal muscle mass in pigs
Fynn-Thompson et al. Inhibition of steroidogenesis in Leydig cells by Müllerian-inhibiting substance
George et al. The E3 ubiquitin ligase RNF216/TRIAD3 is a key coordinator of the hypothalamic-pituitary-gonadal axis
Ishida et al. Involvement of cAMP response element-binding protein in the regulation of cell proliferation and the prolactin promoter of lactotrophs in primary culture
Mann et al. Consequences of elevated luteinizing hormone on diverse physiological systems: use of the LHßCTP transgenic mouse as a model of ovarian hyperstimulation-induced pathophysiology
Yamada et al. SRC‐1 is necessary for skeletal responses to sex hormones in both males and females
Liu et al. Protein kinase A is a dependent factor and therapeutic target in mouse models of fibrous dysplasia
Arao et al. A novel mouse model to analyze non-genomic ERα physiological actions
US10220069B2 (en) Compositions and methods for treating diabetes
Dungan Lemko et al. Kiss of the mutant mouse: how genetically altered mice advanced our understanding of kisspeptin's role in reproductive physiology
Badri et al. Expression of Evc2 in craniofacial tissues and craniofacial bone defects in Evc2 knockout mouse

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08855973

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08855973

Country of ref document: EP

Kind code of ref document: A2