WO2009070872A1 - Method of increasing erucic acid production by hairpin rna fad2 gene silencing and fae gene overexpression - Google Patents

Method of increasing erucic acid production by hairpin rna fad2 gene silencing and fae gene overexpression Download PDF

Info

Publication number
WO2009070872A1
WO2009070872A1 PCT/CA2008/002084 CA2008002084W WO2009070872A1 WO 2009070872 A1 WO2009070872 A1 WO 2009070872A1 CA 2008002084 W CA2008002084 W CA 2008002084W WO 2009070872 A1 WO2009070872 A1 WO 2009070872A1
Authority
WO
WIPO (PCT)
Prior art keywords
construct
erucic acid
plant
fad2
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2008/002084
Other languages
French (fr)
Inventor
Elzbieta Mietkiewska
David C. Taylor
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National Research Council of Canada
Original Assignee
National Research Council of Canada
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Research Council of Canada filed Critical National Research Council of Canada
Publication of WO2009070872A1 publication Critical patent/WO2009070872A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0071Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0083Miscellaneous (1.14.99)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8247Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition

Definitions

  • This invention relates generally to biotechnology and, more particularly to methods for producing bio-products in plants.
  • erucic acid high erucic acid
  • Brassicaceae Modification of high erucic acid (HEA) germplasm of the Brassicaceae to increase the content of erucic acid (22:1 ⁇ 13) in the seed oil for industrial niche markets (Jadhav et al., 2005) is an important goal in the industry.
  • HEA cultivars are of high interest for industrial purposes because 22:1 is a valuable feedstock with more than 1000 potential or patented industrial applications (Scarth and Tang, 2006).
  • erucamide which is used as a surface-active additive in coatings and in the production of plastic films as an anti-block or slip-promoting agent.
  • Many other applications are foreseen for erucic acid and its hydrogenated derivative behenic acid, e.g.
  • the fatty acid desaturase (oleate desaturase), FAD2 is one of the crucial enzymes for the production of polyunsaturated fatty acids in plants (Okuley et al., 1994).
  • FAD2 fatty acid desaturase
  • antisense and cosuppression approaches it was possible to increase the pool of 18:1 available for elongation to enhance production of erucic acid in B. ca ⁇ nata seeds (Jadhav et al., 2005).
  • the antisense and cosuppression strategies have variable and unpredictable effectiveness and require the production of large populations of transgenic plants to obtain a reasonable number of lines showing sufficient levels of target gene suppression (Liu et al., 2002).
  • RNA interference in plants is mediated by sequence-specific degradation of dsRNA has led to the development of highly efficient methods of post transcriptional gene silencing (PTGS).
  • Constructs specially designed to express dsRNA in plants in the form of self-complementary hairpin RNA (hpRNA) elicit a high degree and frequency of PTGS of endogenous genes (Smith et al., 2000; Stoutjesdijk et al., 2002).
  • hpRNA constructs have great potential for genetic manipulation to improve crop traits (Wang et al., 2000).
  • B. carinata holds considerable promise as an alternative crop platform for industrial oil production and high-erucic oils in particular.
  • S. carinata is easily transformed at very high efficiency (Babic et al., 1998), is highly disease (e.g. blackleg)-resistant, and is drought-resistant, amenable to growth in hotter, drier regions such as the brown soil areas of southern Saskatchewan. It also has negligible out-crossing to canola, and therefore poses little or no risk of contaminating oils destined for the food and feed chain.
  • nucleic acid construct for increasing production of erucic acid in Brassica carinata plants, the construct comprising: an intron-spliced hairpin RNA nucleotide sequence for silencing fatty acid desaturase (FAD2) gene expression, the hairpin RNA nucleotide sequence comprising intron-interrupted inverted repeats of a nucleotide sequence cloned from the 3' untranslated region of a fatty acid desaturase (FAD2) gene of Brassica carinata; a heterologous nucleotide sequence from Crambe abyssinica coding for a fatty acid elongase (FAE); and, a seed-specific promoter.
  • FAD2 intron-spliced hairpin RNA nucleotide sequence for silencing fatty acid desaturase
  • a partial 3'-UTR of the B. carinata FAD2 gene was used to prepare an intron-spliced hpRNA construct to silence the FAD2 gene and consequently, to increase the pool of oleic acid available for elongation.
  • the increased pool of oleic acid contributes to a dramatic increase in the content of erucic acid in Brassica seeds when combined with heterologous C. abyssinica FAE expression.
  • Any suitable intron for example the intron from pyruvate orthophosphate dikinase (pdk) gene, may be used to separate the inverted repeats of the hairpin RNA.
  • the level of erucic acid (22:1) in the triacylglycerols (TAGs) of cells, seeds and plants of the present invention is elevated by at least 10% by weight, based on weight of total TAGs, over the level of erucic acid in wild type cells, seeds and plants.
  • the seed-specific promoter allows for over-expression in seeds without affecting expression in other tissues.
  • preferred promoters used in over- expression of enzymes in seed tissue are the seed-specific napin promoter, and an ACP promoter as described in PCT International Publication WO 92/18634, published October 29, 1992, the disclosure of which is herein incorporated by reference.
  • the promoter and termination regulatory regions will be functional in the host plant cell and may be heterologous (that is, not naturally occurring) or homologous (derived from the plant host species) to the plant cell and the gene.
  • the seed-specific napin promoter is particularly preferred.
  • the termination regulatory region may be derived from the 3' region of the gene from which the promoter was obtained or from another gene. Suitable termination regions which may be used are well known in the art and include Agrobacterium tumefaciens nopaline synthase terminator (Nos T), A. tumefaciens mannopine synthase terminator (Mas T) and the CaMV 35S terminator (T35S). Particularly preferred termination regions for use herein include the Nos T termination region.
  • a construct for use herein is comprised within a vector, most suitably an expression vector adapted for expression in an appropriate host (plant) cell.
  • a vector most suitably an expression vector adapted for expression in an appropriate host (plant) cell.
  • any vector which is capable of producing a plant comprising the introduced nucleic acid sequence will be sufficient.
  • Suitable vectors are well known to those skilled in the art and are described in general technical references such as Pouwels et al., (1986).
  • Particularly suitable vectors include the pCR2.1 vector, the pRD400 vector and the Ti plasmid vector.
  • Transformation techniques for introducing the nucleic acid constructs into host cells are well known in the art and include such methods as micro-injection, using polyethylene glycol, electroporation, or high velocity ballistic penetration.
  • a preferred method relies on /4gro ⁇ actem//77-mediated transformation.
  • those plant cells or plants into which the desired nucleic acid has been incorporated may be selected by such methods as antibiotic resistance, herbicide resistance, tolerance to amino-acid analogues or using phenotypic markers.
  • Various assays may be used to determine whether the plant cell shows an increase in gene expression, for example, Northern blotting or quantitative reverse transcriptase PCR (qRT-PCR).
  • Whole transgenic plants may be regenerated from the transformed cell by conventional methods. Such plants produce seeds containing the genes for the introduced trait and can be grown to produce plants that will produce the selected phenotype.
  • Plants transformed with a construct of the instant invention may be grown. Seeds of the transgenic plants are harvested and the product of interest is extracted. The extracted product is used for subsequent incorporation into a composition, for example a pharmaceutical composition, a nutraceutical composition or a food composition.
  • Fig. 1 is a schematic diagram (not to scale) of XD and XS constructs used to transform Brassica carinata plants. Both constructs, driven by napin promoter (Napin P), have an inverted repeat of a 142 bp fragment (3'-UTR) corresponding to the 3'-UTR of the B. carinata FAD2 gene (GenBank accession no: DQ250814) separated by the intron of pdk (Wesley et al. 2001).
  • the XS construct also contains the coding region of the C. abyssinica FAE gene (CaFAE).
  • NPTW neomycin phosphotransferase gene
  • NosP NOS promoter
  • LB T-DNA left border
  • RB right border
  • the positions of the restriction enzyme sites used for the cloning are as indicated.
  • Fig. 2 depicts proportion of unsaturated fatty acids in seed oils from nontransformed B. carinata (WT) and B. carinata T 1 independent lines transformed with XD (A) and XS (B) constructs. The values are the average ⁇ SD of three determinations.
  • Fig. 3 depicts correlation of FAD2 gene silencing activity expressed as an oleic acid desaturation proportion (ODP) value (gray bars) with erucic acid content ( ⁇ ) in seed oils from nontransformed B. carinata (WT) and selected B. carinata T 1 independent lines transformed with the XD and the XS constructs.
  • ODP oleic acid desaturation proportion
  • Fig. 4 depicts northern blot analysis of FAD2 gene expression in nontransformed ⁇ . carinata (WT) and in T1 transgenic seeds carrying the XD and XS constructs.
  • Fig. 5 depicts fatty acid composition of individual lipids from mature seeds of wild type S. carinata (WT) and XS-18A transgenic line. The values are the average ⁇ SD of three determinations.
  • Brassica carinata plants were grown under sterile conditions on MS medium (Murashige and Skoog, 1962) during transformation and tissue culture.
  • Transgenic B. carinata plants were grown in the greenhouse at the Kristjanson Biotechnology Complex greenhouses, Saskatoon, SK, under natural light conditions supplemented with high- pressure sodium lamps with a 16 h photoperiod (16 h of light and 8 h of darkness) at 22 0 C and a relative humidity of 25 to 30%.
  • GTCTGCTACGGTCTCTACCG-3' was performed using the SMARTTM RACE kit (CLONTECH).
  • a cDNA prepared from S. carinata developing seeds was used as a template for PCR amplification during 30 cycles of the following program: 94 0 C for 30 sec,
  • a 142 bp region of the FAD2 3'-UTR (SEQ ID NO: 3) was amplified by PCR with primers: 5'-ctcgag GGATGATGATGGTTTAAGA-3' (SEQ ID NO: 4) (lower case shows restriction site for Xho ⁇ ) and 5'-ggtaccCCATATCACATAATTTAAAGCC-3' (SEQ ID NO: 5) (lower case shows restriction site for Kpn ⁇ ) and cloned in the sense orientation into Xho ⁇ and Kpn ⁇ sites of pKannibal resulting in pKannibal/A plasmid.
  • the 3' UTR was amplified with primers 5'-tctagaGGATGATGATGGTTAAGA-3' (SEQ ID NO: 6) (lower case shows restriction site for Xho ⁇ ) and 5'-aagcttCCATATCACATAATTTAAAGCC-3' (SEQ ID NO: 7) (lower case shows restriction site for Hind ⁇ ) and then cloned in the antisense orientation in Hind ⁇ and Xba ⁇ sites of pKannibal/A giving pKannibal/A-B.
  • the napin promoter (Josefsson et al., 1987) was ligated into pCR2.1 as an Xho ⁇ -Sac ⁇ fragment.
  • Xho ⁇ -Xba ⁇ cassette carrying intron-interrupted inverted repeats of the FAD2 3'-UTR was excised from pKANNIBAL/A-B and subsequently cloned into the respective sites of pCR2.1 vector (Invitrogen) behind the napin promoter.
  • the resulting plasmid was named XC.
  • a NOS terminator (Bevan, 1983) amplified by PCR with primers 5'-tctagaGATCGTTCAAACATTTGGCAA-3' (SEQ ID NO: 8) (lower case shows restriction site for Xba ⁇ ) and 5'-ggtcgacCGATCTAGTAACATAGATGAC-3' (SEQ ID NO: 9) (lower case shows restriction site for Sa/I) and subsequently as Xba ⁇ -Sal ⁇ fragment, was ligated with the Xba ⁇ -Sac ⁇ fragment from the XC plasmid into the respective sites of pRD400 (CLONTECH). The resulting plasmid was named XD (Fig. 1).
  • a C. abyssinica ORF (SEQ ID NO: 10) was amplified by PCR with the primers: 5'-cccgggATGACGTTCCATTAACGTAAAG-3' (SEQ ID NO: 11) (lower case restriction site for Sma ⁇ ) and 5'-ggatccTTAGGACCGACCGTTTTGG-3' (SEQ ID NO: 12) (lower case restriction site for BamH ⁇ ).
  • the napin promoter was amplified with primers 5'-gaattcAAGCTTTCTTCATCGGTG-3' (SEQ ID NO: 13) (lower case restriction site for EcoRI) and 5'-cccgggGTCCGTGTATGTTTTTAATC-3' (SEQ ID NO: 14) (lower case restriction site for Smal).
  • the NOS terminator was generated by PCR with the primers 5'-ggatccGATCGTTCAAACATTTGGCAA-3' (SEQ ID NO: 15) (lower case restriction site for BamH ⁇ ) and 5'-gagctcCGATCTAGTAACATAGATGAC-3' (SEQ ID NO: 16) (lower case restriction site for Sacl).
  • the napin promoter as an EcoR ⁇ -Sma ⁇ fragment, the C. abyssinica FAE as an Sma ⁇ -BamH ⁇ fragment and the Nos terminator as a BamH ⁇ -Sac ⁇ fragment were ligated into the EcoRI-Sacl sites of pBluescript Il (SK+), resulting in plasmid ZB. Subsequently the EcoRI-Sacl cassette was excited from the ZB plasmid and cloned into the respective sites of the XD plasmid resulting in plasmid XS (Fig. 1).
  • the final binary vectors XD and XS were electroporated into Agrobacterium tumefaciens cells strain GV3101 containing helper plasmid pMP90 (Koncz and Schell, 1986). Plasmid integrity was verified by DNA sequencing following its re-isolation from A. tumefaciens and transformation into E. coli.
  • Brassica carinata plants were transformed by the method of Babic et al. (1998). Transgenic plants were selected and analyzed as described by Montgomerykiewska et al. (2007).
  • RNA from B. carinata plant material was isolated as described by Lindstom and Vodkin (1991). 20 micrograms of RNA was fractionated on a 1.4% (w/v) formaldehyde-agarose gel and the gels were then stained with ethidium bromide to ensure that all lanes had been loaded equally (Sambrook et al., 1989). The RNA was subsequently transferred to Hybond N+ membrane (Amersham Biosciences, Baie d ' Urfe, Canada).
  • a 0.5-kb probe containing the 3' part of FAD2 gene was generated by PCR using primers ⁇ '-GTCTGCTACGGTCTCTACCG-S' (SEQ ID NO: 17) and ⁇ '-TCATAACTTATTGTTGTACCAG-S' (SEQ ID NO: 18) and subsequently radioactively labeled with 32 P using a Random Primers Labeling kit (Invitrogen).
  • Membranes were hybridized at 60 0 C overnight. The filters were washed once in 1x SSPE, 0.1% SDS for 15 min and in 0.1x SSPE, 0.1% SDS for 5-10 min at the temperature of hybridization. The blots were exposed to X-OMAT-AR film (Kodak, Rochester, NY, USA).
  • abyssinica FAE was generated by PCR using primers ⁇ '-ATGACGTCCATTAACGTAAAG-S' (SEQ ID NO: 21) and ⁇ '-GGACCGACCGTTTTGGGC-S' (SEQ ID NO: 22) and was used for the analysis of plants transformed with the XS construct.
  • the labeling and hydridization were as described above.
  • the total fatty acid content and acyl composition of B. carinata seed oils were determined by gas chromatography of the FAMEs with 17:0 FAME as an internal standard as described (Katavic et al., 2001 , Taylor et al., 2002, Ricokiewska et al., 2007).
  • the lipid class separation was carried out according to the method of Christie (1982). Polar and neutral lipids species were separated by TLC on Silica Gel 60 H plates developed 4 cm in diethyl ether, air dried and then developed in hexane:diethyl ethe ⁇ acetic acid (70:30:1 , v/v/v).
  • Brassica carinata plants were transformed with two constructs: XD, targeted at the endogenous FAD2 gene utilizing intron-spliced hpRNA-mediated gene silencing, and XS targeted at silencing the FAD2 gene along with heterologous expression of the Crambe abyssinica FAE gene (Fig. 1). Eleven T 0 plants carrying the XD construct arising from 7 independent transgenic lines, were identified that were both resistant to kanamycin and PCR-positive for the presence of the transgene. Thirty six plants were transformed with the XS construct representing 20 independent lines (data not shown).
  • the fatty acid composition of T 1 seeds from individual plants was determined for all transformants.
  • the best independent transgenic lines are shown in Fig. 2A.
  • Seed specific silencing of the FAD2 gene resulted in a significant reduction of the level of 18:2 from 19.0% in the wild type background to as low as 4.5 % in line XD-4D.
  • the strong reduction of the level of 18:2 was directly correlated with a significant increase in the proportion of oleic acid up to 21.2% in the best transgenic line carrying the XD construct, compared to 5.7% in the wild type background.
  • the increased pool of 18:1 was utilized by the endogenous microsomal elongation complex (FAE) and this led to the increase in the proportion of erucic acid to as high as 50.6% in line XD-5A, compared with 40.0% in WT seeds, a 26.5% proportional increase over wild-type levels.
  • the high increase in erucic acid achieved in the current study through ihpRNA-mediated silencing of the FAD2 gene is considerably greater than that reported by Jadhav et al. (2005), where transformation with FAD2 sequence in an antisense orientation resulted in a net maximum of 17% increase in the proportion of erucic acid in the best line, compared to the WT B. carinata seeds.
  • Oleate desaturase is highly active in developing seeds of wild type ⁇ . carinata, with 85% of 18:1 being converted to 18:2 and 18:3, for an oleic acid desaturation proportion (ODP) value of 0.85 (Table 1).
  • ODP oleic acid desaturation proportion
  • Many transgenic T1 plants carrying XD and XS constructs showed a considerable reduction in the ODP value, to as low as 0.39, indicating a profound (55%) down-regulation of oleate desaturation.
  • Most transgenic plants have ODP values from 0.4-0.7 meaning that only 40-70% of oleic acid produced in developing seeds carrying the silencing constructs was converted to polyunsaturated 18- carbon fatty acids compared with 85% in nontransformed B. carinata seeds. As shown in Fig.
  • thaliana the highest efficiency of FAD2 gene silencing was achieved using an iHP construct utilizing a 120-bp fragment of FAD2 3'- UTR (Stoutjesdijk et al., 2002).
  • the presence of the intron in an iHP construct may result in increased or more stable transcript levels than in the nonintron-containing hpRNA constructs (Tanaka et al., 1990; Stoutjesdijk et al., 2002).
  • TL-DNA gene 5 controls the tissue-specific expression of chimaeric genes by a novel type of Agrobacterium binary vector. MoI. Gen. Genet. 204, 383-396.
  • Arabidopsis FAD2 gene encodes the enzymes that is essential for polyunsaturated lipid synthesis. Plant Cell 6, 147-158.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Nutrition Science (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The 3'-UTR of the FAD2 gene from Brassica carinata was cloned by PCR and used to prepare an intron-spliced hairpin RNA (ihpRNA) construct. This construct, when expressed in B. carinata, resulted in a high degree of FAD2 gene silencing accompanied with a strong increase in oleic and erucic acid content by up to 267% and 27% respectively, compared to that of the wild type background (WT). A second construct containing ihpRNA targeted to the endogenous FAD2 gene in addition to the heterologous Crambe abyssinica FAE gene under the control of seed-specific napin promoter, was used to transform B. carinata. This approach resulted in a more dramatic increase in erucic acid content, by up to 41 % in T1 segregating seeds as compared to that of WT control.

Description

METHOD OF INCREASING ERUCIC ACID PRODUCTION BY HAIRPIN RNA FAD2 GENE SILENCING AND FAE GENE OVEREXPRESSION
Cross-reference to Related Application
This application claims the benefit of United States Provisional Patent Application USSN 60/996,739 filed December 3, 2007, the entire contents of which is herein incorporated by reference.
Field of the Invention
This invention relates generally to biotechnology and, more particularly to methods for producing bio-products in plants.
Background of the Invention
Modification of high erucic acid (HEA) germplasm of the Brassicaceae to increase the content of erucic acid (22:1Δ13) in the seed oil for industrial niche markets (Jadhav et al., 2005) is an important goal in the industry. HEA cultivars are of high interest for industrial purposes because 22:1 is a valuable feedstock with more than 1000 potential or patented industrial applications (Scarth and Tang, 2006). Currently the major derivative of erucic acid is erucamide, which is used as a surface-active additive in coatings and in the production of plastic films as an anti-block or slip-promoting agent. Many other applications are foreseen for erucic acid and its hydrogenated derivative behenic acid, e.g. in lubricants, detergents, film processing agents and coatings, as well as in cosmetics and pharmaceuticals (Leonard, 1993; Derksen et al., 1995; Puyaubert et al., 2005; McVetty and Scarth, 2002; Mietkiewska et al., 2007). For many of these industrial uses, the economics are limited by the proportion of 22:1 in the seed oil. A Brassica cultivar containing erucic acid at levels approaching 80% would significantly reduce the cost of producing erucic acid and its derivatives and could meet the forecasted demand for erucic acid as a renewable, environmentally friendly industrial feedstock (Leonard, 1994; Taylor et al., 2002; Jadhav et al., 2005).
Over-expression of the Crambe abyssinica FAE gene in Brassica caήnata results in a substantial increase in the proportion of erucic acid in seeds compared to the wild type control (Mietkiewska et al., 2007). The synthesis of erucic acid in transgenic B. carinata plants was probably, in part, limited by the smaller microsomal pool of oleoyl- moieties (7-8%) available for elongation. As pointed out previously by Bao et al. (1998) and subsequently by Jadhav et al. (2005) the flux of oleic acid (18:1) through distinct intermediate lipid pools before elongation might be a factor that limits the availability of 18:1 for elongation. The fatty acid desaturase (oleate desaturase), FAD2, is one of the crucial enzymes for the production of polyunsaturated fatty acids in plants (Okuley et al., 1994). By altering the level of FAD2 gene expression using antisense and cosuppression approaches, it was possible to increase the pool of 18:1 available for elongation to enhance production of erucic acid in B. caήnata seeds (Jadhav et al., 2005). However, the antisense and cosuppression strategies have variable and unpredictable effectiveness and require the production of large populations of transgenic plants to obtain a reasonable number of lines showing sufficient levels of target gene suppression (Liu et al., 2002).
The discovery that RNA interference in plants is mediated by sequence-specific degradation of dsRNA has led to the development of highly efficient methods of post transcriptional gene silencing (PTGS). Constructs specially designed to express dsRNA in plants in the form of self-complementary hairpin RNA (hpRNA) elicit a high degree and frequency of PTGS of endogenous genes (Smith et al., 2000; Stoutjesdijk et al., 2002). Such hpRNA constructs have great potential for genetic manipulation to improve crop traits (Wang et al., 2000).
B. carinata holds considerable promise as an alternative crop platform for industrial oil production and high-erucic oils in particular. S. carinata is easily transformed at very high efficiency (Babic et al., 1998), is highly disease (e.g. blackleg)-resistant, and is drought-resistant, amenable to growth in hotter, drier regions such as the brown soil areas of southern Saskatchewan. It also has negligible out-crossing to canola, and therefore poses little or no risk of contaminating oils destined for the food and feed chain.
There remains a need for transgenic B. carinata that produces high-erucic acid oils.
Summary of the Invention
There is provided a nucleic acid construct for increasing production of erucic acid in Brassica carinata plants, the construct comprising: an intron-spliced hairpin RNA nucleotide sequence for silencing fatty acid desaturase (FAD2) gene expression, the hairpin RNA nucleotide sequence comprising intron-interrupted inverted repeats of a nucleotide sequence cloned from the 3' untranslated region of a fatty acid desaturase (FAD2) gene of Brassica carinata; a heterologous nucleotide sequence from Crambe abyssinica coding for a fatty acid elongase (FAE); and, a seed-specific promoter. There is further provided cells, plants and seeds of B. carinata comprising a construct of the present invention.
There is yet further provided a method of increasing erucic acid production in a Brassica carinata plant comprising transforming the plant with a construct of the present invention and growing the plant under conditions where the construct is expressed.
Thus, a partial 3'-UTR of the B. carinata FAD2 gene was used to prepare an intron-spliced hpRNA construct to silence the FAD2 gene and consequently, to increase the pool of oleic acid available for elongation. The increased pool of oleic acid contributes to a dramatic increase in the content of erucic acid in Brassica seeds when combined with heterologous C. abyssinica FAE expression. Any suitable intron, for example the intron from pyruvate orthophosphate dikinase (pdk) gene, may be used to separate the inverted repeats of the hairpin RNA.
Advantageously, as a result of the present invention, the level of erucic acid (22:1) in the triacylglycerols (TAGs) of cells, seeds and plants of the present invention is elevated by at least 10% by weight, based on weight of total TAGs, over the level of erucic acid in wild type cells, seeds and plants.
The seed-specific promoter allows for over-expression in seeds without affecting expression in other tissues. By way of illustration, preferred promoters used in over- expression of enzymes in seed tissue are the seed-specific napin promoter, and an ACP promoter as described in PCT International Publication WO 92/18634, published October 29, 1992, the disclosure of which is herein incorporated by reference. The promoter and termination regulatory regions will be functional in the host plant cell and may be heterologous (that is, not naturally occurring) or homologous (derived from the plant host species) to the plant cell and the gene. The seed-specific napin promoter is particularly preferred.
The termination regulatory region may be derived from the 3' region of the gene from which the promoter was obtained or from another gene. Suitable termination regions which may be used are well known in the art and include Agrobacterium tumefaciens nopaline synthase terminator (Nos T), A. tumefaciens mannopine synthase terminator (Mas T) and the CaMV 35S terminator (T35S). Particularly preferred termination regions for use herein include the Nos T termination region.
Preferably, a construct for use herein is comprised within a vector, most suitably an expression vector adapted for expression in an appropriate host (plant) cell. It will be appreciated that any vector which is capable of producing a plant comprising the introduced nucleic acid sequence will be sufficient. Suitable vectors are well known to those skilled in the art and are described in general technical references such as Pouwels et al., (1986). Particularly suitable vectors include the pCR2.1 vector, the pRD400 vector and the Ti plasmid vector.
Transformation techniques for introducing the nucleic acid constructs into host cells are well known in the art and include such methods as micro-injection, using polyethylene glycol, electroporation, or high velocity ballistic penetration. A preferred method relies on /4groόactem//77-mediated transformation. After transformation of the plant cells or plant, those plant cells or plants into which the desired nucleic acid has been incorporated may be selected by such methods as antibiotic resistance, herbicide resistance, tolerance to amino-acid analogues or using phenotypic markers.
Various assays may be used to determine whether the plant cell shows an increase in gene expression, for example, Northern blotting or quantitative reverse transcriptase PCR (qRT-PCR). Whole transgenic plants may be regenerated from the transformed cell by conventional methods. Such plants produce seeds containing the genes for the introduced trait and can be grown to produce plants that will produce the selected phenotype.
Plants transformed with a construct of the instant invention may be grown. Seeds of the transgenic plants are harvested and the product of interest is extracted. The extracted product is used for subsequent incorporation into a composition, for example a pharmaceutical composition, a nutraceutical composition or a food composition.
The invention is susceptible to various modifications and alternative forms in addition to specific embodiments shown by way of example in the drawings and described in detail herein. Thus, the invention is not limited to the particular forms disclosed. Rather, the scope of the invention encompasses all modifications, equivalents, and alternatives falling within the following appended claims. Further features of the invention will be described or will become apparent in the course of the following detailed description.
Brief Description of the Drawings
In order that the invention may be more clearly understood, embodiments thereof will now be described in detail by way of example, with reference to the accompanying drawings, in which: Fig. 1 is a schematic diagram (not to scale) of XD and XS constructs used to transform Brassica carinata plants. Both constructs, driven by napin promoter (Napin P), have an inverted repeat of a 142 bp fragment (3'-UTR) corresponding to the 3'-UTR of the B. carinata FAD2 gene (GenBank accession no: DQ250814) separated by the intron of pdk (Wesley et al. 2001). The XS construct also contains the coding region of the C. abyssinica FAE gene (CaFAE). The neomycin phosphotransferase gene (NPTW) is driven by the NOS promoter (NosP). The T-DNA left border (LB) and right border (RB) are shown. The positions of the restriction enzyme sites used for the cloning are as indicated.
Fig. 2 depicts proportion of unsaturated fatty acids in seed oils from nontransformed B. carinata (WT) and B. carinata T1 independent lines transformed with XD (A) and XS (B) constructs. The values are the average ± SD of three determinations.
Fig. 3 depicts correlation of FAD2 gene silencing activity expressed as an oleic acid desaturation proportion (ODP) value (gray bars) with erucic acid content (♦) in seed oils from nontransformed B. carinata (WT) and selected B. carinata T1 independent lines transformed with the XD and the XS constructs.
Fig. 4 depicts northern blot analysis of FAD2 gene expression in nontransformed β. carinata (WT) and in T1 transgenic seeds carrying the XD and XS constructs. (A) Total
RNA was isolated from mid developing seeds, blotted and probed with a 32P-labeled 0.5- kb fragment of the FAD2 gene. (B) The amount of RNA loaded per line was calibrated by the relative ethidium bromide staining of the ribosomal RNA bands.
Fig. 5 depicts fatty acid composition of individual lipids from mature seeds of wild type S. carinata (WT) and XS-18A transgenic line. The values are the average ± SD of three determinations.
Description of Preferred Embodiments
Materials and Methods:
Plant materials and growth conditions
Brassica carinata plants were grown under sterile conditions on MS medium (Murashige and Skoog, 1962) during transformation and tissue culture. Transgenic B. carinata plants were grown in the greenhouse at the Kristjanson Biotechnology Complex greenhouses, Saskatoon, SK, under natural light conditions supplemented with high- pressure sodium lamps with a 16 h photoperiod (16 h of light and 8 h of darkness) at 220C and a relative humidity of 25 to 30%. Cloning of 3'-UTR of FAD2 gene
The ORF sequence of FAD2-gene (GenBank accession no. AF124360, SEQ ID
NO: 1) from B. carinata was used to design the forward primer 5'-
GTCTGCTACGGTCTCTACCG-3'. 3'-RACE was performed using the SMARTTM RACE kit (CLONTECH). A cDNA prepared from S. carinata developing seeds was used as a template for PCR amplification during 30 cycles of the following program: 940C for 30 sec,
580C for 30 sec, and 720C for 1 min. A 686-bp PCR product was cloned into the pCR2.1-
TOPO (Invitrogen) cloning vector and subsequently sequenced. Sequence comparison of the PCR product with the FAD2 ORF sequence showed the presence of 236-bp 3'-UTR. The 3'-UTR sequence was submitted to GenBank (accession no. DQ250814, SEQ ID
NO: 2).
Gene-silencing constructs
A 142 bp region of the FAD2 3'-UTR (SEQ ID NO: 3) was amplified by PCR with primers: 5'-ctcgag GGATGATGATGGTTTAAGA-3' (SEQ ID NO: 4) (lower case shows restriction site for Xhoϊ) and 5'-ggtaccCCATATCACATAATTTAAAGCC-3' (SEQ ID NO: 5) (lower case shows restriction site for Kpn\) and cloned in the sense orientation into Xho\ and Kpn\ sites of pKannibal resulting in pKannibal/A plasmid. Subsequently the 3' UTR was amplified with primers 5'-tctagaGGATGATGATGGTTAAGA-3' (SEQ ID NO: 6) (lower case shows restriction site for Xhoϊ) and 5'-aagcttCCATATCACATAATTTAAAGCC-3' (SEQ ID NO: 7) (lower case shows restriction site for Hind\\\) and then cloned in the antisense orientation in Hind\\\ and Xba\ sites of pKannibal/A giving pKannibal/A-B. The napin promoter (Josefsson et al., 1987) was ligated into pCR2.1 as an Xho\-Sac\ fragment. Then the Xho\-Xba\ cassette carrying intron-interrupted inverted repeats of the FAD2 3'-UTR was excised from pKANNIBAL/A-B and subsequently cloned into the respective sites of pCR2.1 vector (Invitrogen) behind the napin promoter. The resulting plasmid was named XC. A NOS terminator (Bevan, 1983) amplified by PCR with primers 5'-tctagaGATCGTTCAAACATTTGGCAA-3' (SEQ ID NO: 8) (lower case shows restriction site for Xba\) and 5'-ggtcgacCGATCTAGTAACATAGATGAC-3' (SEQ ID NO: 9) (lower case shows restriction site for Sa/I) and subsequently as Xba\-Sal\ fragment, was ligated with the Xba\-Sac\ fragment from the XC plasmid into the respective sites of pRD400 (CLONTECH). The resulting plasmid was named XD (Fig. 1).
Isolation of the Crambe abyssinica FAE gene was performed as described previously (Mietkiewska et al., 2007). A C. abyssinica ORF (SEQ ID NO: 10) was amplified by PCR with the primers: 5'-cccgggATGACGTTCCATTAACGTAAAG-3' (SEQ ID NO: 11) (lower case restriction site for Sma\) and 5'-ggatccTTAGGACCGACCGTTTTGG-3' (SEQ ID NO: 12) (lower case restriction site for BamH\). The napin promoter was amplified with primers 5'-gaattcAAGCTTTCTTCATCGGTG-3' (SEQ ID NO: 13) (lower case restriction site for EcoRI) and 5'-cccgggGTCCGTGTATGTTTTTAATC-3' (SEQ ID NO: 14) (lower case restriction site for Smal). The NOS terminator was generated by PCR with the primers 5'-ggatccGATCGTTCAAACATTTGGCAA-3' (SEQ ID NO: 15) (lower case restriction site for BamH\) and 5'-gagctcCGATCTAGTAACATAGATGAC-3' (SEQ ID NO: 16) (lower case restriction site for Sacl). The napin promoter as an EcoR\-Sma\ fragment, the C. abyssinica FAE as an Sma\-BamH\ fragment and the Nos terminator as a BamH\-Sac\ fragment were ligated into the EcoRI-Sacl sites of pBluescript Il (SK+), resulting in plasmid ZB. Subsequently the EcoRI-Sacl cassette was excited from the ZB plasmid and cloned into the respective sites of the XD plasmid resulting in plasmid XS (Fig. 1).
The final binary vectors XD and XS were electroporated into Agrobacterium tumefaciens cells strain GV3101 containing helper plasmid pMP90 (Koncz and Schell, 1986). Plasmid integrity was verified by DNA sequencing following its re-isolation from A. tumefaciens and transformation into E. coli.
Plant transformation
Brassica carinata plants were transformed by the method of Babic et al. (1998). Transgenic plants were selected and analyzed as described by Mietkiewska et al. (2007).
Northern and Southern analysis
Total RNA from B. carinata plant material was isolated as described by Lindstom and Vodkin (1991). 20 micrograms of RNA was fractionated on a 1.4% (w/v) formaldehyde-agarose gel and the gels were then stained with ethidium bromide to ensure that all lanes had been loaded equally (Sambrook et al., 1989). The RNA was subsequently transferred to Hybond N+ membrane (Amersham Biosciences, Baie d'Urfe, Canada). A 0.5-kb probe containing the 3' part of FAD2 gene was generated by PCR using primers δ'-GTCTGCTACGGTCTCTACCG-S' (SEQ ID NO: 17) and δ'-TCATAACTTATTGTTGTACCAG-S' (SEQ ID NO: 18) and subsequently radioactively labeled with 32P using a Random Primers Labeling kit (Invitrogen). Membranes were hybridized at 600C overnight. The filters were washed once in 1x SSPE, 0.1% SDS for 15 min and in 0.1x SSPE, 0.1% SDS for 5-10 min at the temperature of hybridization. The blots were exposed to X-OMAT-AR film (Kodak, Rochester, NY, USA). Twenty micrograms of S. carinata genomic DNA was digested with the restriction enzyme EcoRI, and the resulting fragments were separated on a 0.9% (w/v) agarose gei and transferred to Hybond N+ nylon membrane via an alkali blotting protocol. For plants transformed with the XD construct, a 1.1-kb DNA fragment containing the napin promoter amplified by PCR using primers δ'-AAGCTTTCTTCATCGGTG-S' (SEQ ID NO: 19) and δ'-TCCGTGTATGTTTTTAATC-S' (SEQ ID NO: 20) was used as the probe. A 1.5-kb probe containing the coding sequence of C. abyssinica FAE was generated by PCR using primers δ'-ATGACGTCCATTAACGTAAAG-S' (SEQ ID NO: 21) and δ'-GGACCGACCGTTTTGGGC-S' (SEQ ID NO: 22) and was used for the analysis of plants transformed with the XS construct. The labeling and hydridization were as described above.
Lipid analyses
The total fatty acid content and acyl composition of B. carinata seed oils were determined by gas chromatography of the FAMEs with 17:0 FAME as an internal standard as described (Katavic et al., 2001 , Taylor et al., 2002, Mietkiewska et al., 2007). The lipid class separation was carried out according to the method of Christie (1982). Polar and neutral lipids species were separated by TLC on Silica Gel 60 H plates developed 4 cm in diethyl ether, air dried and then developed in hexane:diethyl etheπacetic acid (70:30:1 , v/v/v). Subsequently polar lipids were further developed in chloroform:methanol:acetic acid:water (25:10:3:1 , v/v/v). TLC regions containing lipid species were scraped and samples saponified with 2ml of 10% KOH in methanol at 800C for 2 h. Following isolation of the free fatty acids, FAMEs were produced using 3N methanolic HCI and extracted and analyzed by GC as described earlier (Taylor et al., 2002). Relative fatty acid compositions were calculated as the percentage that each fatty acid represented of the total fatty acids. An additional indirect method of assessing the cumulative effects of FAD2 activity during seed fatty acid synthesis through an oleic desaturation proportion (ODP) parameter was calculated as described by Stoutjesdijk et al. (2002).
Results and Discussion:
Fatty acid composition of preliminary transformants
Brassica carinata plants were transformed with two constructs: XD, targeted at the endogenous FAD2 gene utilizing intron-spliced hpRNA-mediated gene silencing, and XS targeted at silencing the FAD2 gene along with heterologous expression of the Crambe abyssinica FAE gene (Fig. 1). Eleven T0 plants carrying the XD construct arising from 7 independent transgenic lines, were identified that were both resistant to kanamycin and PCR-positive for the presence of the transgene. Thirty six plants were transformed with the XS construct representing 20 independent lines (data not shown).
The fatty acid composition of T1 seeds from individual plants was determined for all transformants. The best independent transgenic lines are shown in Fig. 2A. Seed specific silencing of the FAD2 gene resulted in a significant reduction of the level of 18:2 from 19.0% in the wild type background to as low as 4.5 % in line XD-4D. The strong reduction of the level of 18:2 was directly correlated with a significant increase in the proportion of oleic acid up to 21.2% in the best transgenic line carrying the XD construct, compared to 5.7% in the wild type background. The increased pool of 18:1 was utilized by the endogenous microsomal elongation complex (FAE) and this led to the increase in the proportion of erucic acid to as high as 50.6% in line XD-5A, compared with 40.0% in WT seeds, a 26.5% proportional increase over wild-type levels. The high increase in erucic acid achieved in the current study through ihpRNA-mediated silencing of the FAD2 gene is considerably greater than that reported by Jadhav et al. (2005), where transformation with FAD2 sequence in an antisense orientation resulted in a net maximum of 17% increase in the proportion of erucic acid in the best line, compared to the WT B. carinata seeds.
In order to study whether the increased pool of oleic acid can contribute to the higher accumulation of erucic acid obtained by heterologous expression of C. abyssinica FAE, we also designed the XS construct (Fig. 1). As expected, the pronounced silencing of the oleoyl desaturase resulted in large reduction in linoleic acid and concomitant increases in the proportions of oleic acid (Fig. 2B). The level of 18:2 in transgenic lines carrying the XS transgene was as low as 3.2 % in XS-18A compared with 19.0% in WT. The increased pool of oleic acid in seeds of the XS transgenic plants was subsequently utilized by the heterologously-expressed C. abyssinica FAE which resulted in a net increase of the proportion of erucic acid in T1 segregating seeds of up to 41% compared to the wild type. Our current approach resulted in a higher accumulation of erucic acid than that formerly reported utilizing C. abyssinica FAE alone, which resulted in a 33% increase in 22:1 of T1 seed oils (Mietkiewska et al., 2007). Effect of gene silencing on oleate desaturation levels in seed from preliminary transformants
Oleate desaturase is highly active in developing seeds of wild type β. carinata, with 85% of 18:1 being converted to 18:2 and 18:3, for an oleic acid desaturation proportion (ODP) value of 0.85 (Table 1). Many transgenic T1 plants carrying XD and XS constructs showed a considerable reduction in the ODP value, to as low as 0.39, indicating a profound (55%) down-regulation of oleate desaturation. Most transgenic plants have ODP values from 0.4-0.7 meaning that only 40-70% of oleic acid produced in developing seeds carrying the silencing constructs was converted to polyunsaturated 18- carbon fatty acids compared with 85% in nontransformed B. carinata seeds. As shown in Fig. 3 a positive correlation between the degree of FAD2 gene silencing (expressed as ODP value) and the content of erucic acid was observed. All transgenic plants analyzed in the current study showed some degree of FAD2 gene silencing (Table 1). An intron- spliced hpRNA-mediated (iHP) gene silencing technique used in the present study to modify the expression of the oleate desaturase in B. carinata seed resulted in a much higher efficacy of gene silencing than reported earlier antisense or cosuppression approach (Jadhav et al. 2005). In A. thaliana the highest efficiency of FAD2 gene silencing was achieved using an iHP construct utilizing a 120-bp fragment of FAD2 3'- UTR (Stoutjesdijk et al., 2002). The presence of the intron in an iHP construct may result in increased or more stable transcript levels than in the nonintron-containing hpRNA constructs (Tanaka et al., 1990; Stoutjesdijk et al., 2002).
Table 1
Frequency distribution of ODP value in seed of Brassica carinata (WT) and T1 seed of B. carinata transformed with XD and XS construct.
Figure imgf000012_0001
The stability and inheritance of ihpRNA-mediated gene silencing for lipid metabolism related genes has been shown (Stoutjesdijk et al., 2002: Liu et al., 2002); specifically, two published papers on the application of an ihpRNA approach for silencing FAD2 (Yang et al., 2006) and DGAT (Zhang et al., 2005) were based on the results from TO plants. The high efficiency of gene silencing obtained through the use of ihpRNA- mediated PTGS makes this technique a very valuable contribution to practical trait modification in agricultural plants. This is particularly important for plants with low efficiency of transformation (Liu et al., 2002).
Effect of silencing construct on the FAD2 mRNA level
Based on high oleic acid levels, the 6 best lines were selected to examine the FAD2 mRNA level in transgenic seeds by northern analysis (Fig. 4). In all lines, the FAD2 mRNA level decreased compared to that of the wild type (WT). These results demonstrated a high correlation between the increase of the content of 18:1 in total seed lipids and the decrease of FAD2 transcript level. The highly elevated level of 18:1 in transgenic seeds resulted from lower expression of FAD2 mRNA in transgenic lines induced by PTG silencing. Similar trends have been reported from silencing FAD2 gene in tobacco and FAD2-1 in cotton (Yang et al., 2006; Liu et al., 2002).
Effect of silencing constructs on individual lipid classes in transgenic B. carinata seeds.
Individual lipids extracted from seed tissue were analyzed for fatty acid composition. In the seeds of XS-18A both polar and neutral lipids showed an increase in the level of 18:1 compared with WT seeds (Fig. 5). In particular, the XS-18A TAG content of 18:1 increased by 2.6 fold compared to the WT seeds at the expense of 18-carbon polyunsaturated fatty acids. Among polar lipids, the most pronounced increase of 18:1 was found in phosphatidylethanolamine (PE) and phosphatidylcholine (PC), as high as 7- fold and 4-fold, respectively. In PC from F>4D2-silenced seeds, the increase in the level of 18:1 was accompanied by strong reduction in the level of palmitic acid (16:0) of up to 37%. Similar changes in polar lipid class composition were reported for leaves and seeds of FAD2 silenced tobacco plants (Yang et al., 2006). These phenomena were also found in an Arabidopsis thaliana FAD2 mutant and in F/\D2-silenced Gossypium hirsutum plants (Miquel and Browse, 1992: Liu et al., 2002). As proposed by Yang et al. (2006) F/\D2-silencing may have effect on de novo 16:0 synthesis. The profound increase of 18:1 with the concomitant decrease of 18:2 may affect the fluidity of membranes, which could result in down-regulation of 16:0 content by a mechanism which is not yet understood. Nonetheless, the average reduction in total saturates from 6.8% in wild type B. carinata to 5.3% in present XS transgenic lines represents a significant improvement in the undesirable saturated fat content of the oil. More importantly, the increase in erucic acid in TAGs, from 52.7% in WT, to 62.9% in the RNAi FAD2 + Crambe FAE transgenic line XS-18A (Fig. 5), constitutes the best result observed in transgenic manipulations of B. caήnata seed oil to date.
Informal Listing of Sequences:
SEQ ID NO: 1 - Brassica carinata FAD2 atgggtgcaggtggaagaatgcaggtttctccttctcccaagaagtccgaaaccgataccatcaagcgtgttccctgcgaga cgcctcccttcacagtaggagagctcaagaaagccatcccaccgcactgtttcaaacgctccatccctcgctctttctcctacc tcatctgggacatcatcgtagcctcctgcttctactacgtcgccaccacctacttccccctcctccctcaccctctctcttacattgc ttggcctctctactgggcctgccaaggctgcgtcctaaccggcgtctgggtcatagcccacgaatgcggccaccacgctttca gcgactaccagtggctagacgacaccgtcggtctcatcttccattccttcctcctcgtcccttacttctcctggaagtacagccat cgccgtcaccactccaacaccggttcgctcgagagagacgaggtgtttgtccccaagaaaaaatcagacatcaagtggta cggcaagtacctcaacaaccctctcggacgcaccgtgatgctaaccgtccagttcactctcggctggcccttgtacttggcctt caacgtctcgggcagaccttaccccgaggggttcgcctgccatttccacccgaacgctcccatctacaacgaccgtgaacg cctccagatatacgtctccgacgctggcatcctcgccgtctgctacggtctctaccgttacgctgccgcgcagggagtggcctc gatggtctgcctctacggagttccgcttctgatagtcaacgcgttcctcgtcttgatcacttacttgcagcacacgcatccttcgct gcctcactacgactcctctgagtgggattggttgaggggagcgttggccactgttgacagagactacggaatcttgaacaag gtcttccacaacatcacggacacgcacgtggcgcatcatctgttctccacgatgccgcattatcacgcgatggaggctacga aggcgataaagccgattctgggagactattaccagttcgatgggacaccatgggttaaggcgatgtggagggaggcgaag gagtgtatctatgttgaaccggacaggcaaggtgagaagaaaggtgtgttctggtacaacaataagttatga SEQ ID NO: 2 - Brassica caήnata - 3'-UTR ggatgatgatggtttaagaacaaaaagatctattgtctctggtcgtctttgttttaagaagctatgttttcatttcaataatctaaatta tccattttgttgtgttttctgacattttggctttaaattatgtgatatgggaagttttagtgtctaaatgtctttgtgtctgtattgttctcgaac tatcttaatgttgtggcgttagtgtaaaaaaaaaaaaaaaaaaaaaaaaa
SEQ ID NO: 3 - Brassica carinata - 3'-UTR 142 bp fragment ggatgatgatggtttaagaacaaaaagatctattgtctctggtcgtctttgttttaagaagctatgttttcatttcaataatctaaatta tccattttgttgtgttttctgacattttggctttaaattatgtgatatggga
SEQ ID NO: 4 - Primer ctcgagggat gatgatggtt taaga
SEQ ID NO: 5 - Primer ggtaccccat atcacataat ttaaagcc
SEQ ID NO: 6 - Primer tctagaggat gatgatggtt aaga SEQ ID NO: 7 - Primer aagcttccat atcacataat ttaaagcc
SEQ ID NO: 8 - Primer tctagagatc gttcaaacat ttggcaa
SEQ ID NO: 9 - Primer ggtcgaccga tctagtaaca tagatgac SEQ ID NO: 10 - Crambe abyssinica FAE ORF atgacgtccattaacgtaaagctcctttaccattacgtcataaccaacctttttaacctctgtttctttccgttaacggcgatcgtcgc cgggaaagcctctcggcttaccatagacgatcttcaccacttatattattcctatctccaacacaacgtcataaccatagctcca ctctttgcctttaccgttttcggttcgattctctacatcgtgacccggcccaaaccggtttacctcgttgagtactcatgctaccttcc accaacgcagtgtagatcaagtatctccaaggtcatggatatattttatcaagtaagaaaagctgatccttttcgtaacgggac atgcgatgactcgtcctggcttgacttcttgaggaagattcaagaacgttcaggtctaggcgacgaaactcacggccccgag ggactgcttcaggtccctccccggaagacttttgcggcggcgcgtgaagagacggagcaagtaatcgtcggtgcgctgaaa aatctattcgagaacaccaaagttaaccctaaagatataggtatacttgtggtgaactcaagcatgtttaatccaactccttcac tctcagcgatggtcgttaatactttcaagctccgaagtaacgtaagaagctttaaccttggtggcatgggttgtagtgctggcgtt atagccattgatctggctaaggacttgttgcatgtccataaaaacacgtatgctcttgtggtgagcacagagaacatcacttata acatttacgctggcgataatagatccatgatggtttcaaactgcttgttccgtgttggcggggccgctattttgctctccaacaagc ctagagatcgaagacggtccaaatacgagctagttcacacggtccgaacacataccggagctgatgacaagtctttccgat gcgtccaacaaggagacgatgagaacggcaaaaccggagtgagtttgtccaaggacataaccgaggttgctggtcgaac ggttaagaaaaacatagcaacattgggtcctttgattcttcctttaagcgagaaacttctttttttcgttaccttcatggccaagaaa cttttcaaagataaagttaagcattactatgtcccggacttcaagcttgctattgaccatttttgtatacatgcgggaggcagagc cgtgatcgatgtgctagagaagaatttaggcctagcaccgatcgatgtagaggcatcaagatcaacgttacatagatttggta acacatcatctagctcaatatggtatgagttggcatacatagaggcaaaaggaaggatgaagaaaggtaataaagtttggc agattgctttagggtcaggctttaagtgtaacagtgcggtttgggtagctttaagcaatgtcaaggcttcgacaaatagtccttgg gaacattgcatcgatagatacccggttaaaattgattctgattcagctaagtcagagactcgtgcccaaaacggtcggtccta a SEQ ID NO: 11 - Primer cccgggatga cgttccatta acgtaaag
SEQ ID NO: 12 - Primer ggatccttag gaccgaccgt tttgg
SEQ ID NO: 13 - Primer gaattcaagc tttcttcatc ggtg
SEQ ID NO: 14 - Primer cccggggtcc gtgtatgttt ttaatc
SEQ ID NO: 15 - Primer ggatccgatc gttcaaacat ttggcaa SEQ ID NO: 16 - Primer gagctccgat ctagtaacat agatgac
SEQ ID NO: 17 - Primer gtctgctacg gtctctaccg
SEQ ID NO: 18 - Primer tcataactta ttgttgtacc ag
SEQ ID NO: 19 - Primer aagctttctt catcggtg
SEQ ID NO: 20 - Primer tccgtgtatg tttttaatc SEQ ID NO: 21 - Primer atgacgtcca ttaacgtaaa g
SEQ ID NO: 22 - Primer ggaccgaccg ttttgggc
References: The contents of the entirety of each of which are incorporated by this reference.
Babic, V., Datla, R.S., Scoles, G.J., Keller, W.A., 1998. Development of an efficient Agrobacterium-medlated transformation system for Brassica carinata. Plant Cell Reports 17, 183-188.
Bao, X., Pollard, M., Ohlrogge, J., 1998. The biosynthesis of erucic acid in developing embryos of Brassica rapa. Plant Physiol. 118, 183-190.
Bevan, M., 1983. Binary Agrobacterium vectors for plant transformation. Nucleic Acid Res. 12, 8711-8721. Derksen, J.T.P., Cuperus, F.P. and Kolster, P., 1995. Paints and coatings from renewable resources. Industrial Crops and Products 3, 225-236.
Christie, W. W., 1982. Lipid Analysis. 2nd edition. Pergamon Press, Oxford, England.
Jadhav, A., Katavic, V., Marillia, E-F., Giblin E. M., Barton D.L., Kumar, A., Sonntag C, Bablic, V., Keller W.A., Taylor, D.C., 2005. Increased levels of erucic acid in Brassica carinata by co-suppression and antisense repression of the endogenous FAD2 gene. Metab. Eng. 7, 215-220.
Josefsson, L.G., Lenman, M., Ericson, M. L., Rask, L, 1987. Structure of a gene encoding the 1.7 S storage protein, napin, from Brassica napus. J. Biol. Chem. 262, 12196-12201.
Koncz, C, Schell, J., 1986. The promoter of TL-DNA gene 5 controls the tissue-specific expression of chimaeric genes by a novel type of Agrobacterium binary vector. MoI. Gen. Genet. 204, 383-396.
Lindstrom, J. T., Vodkin, L.O., 1991. A soybean cell wall protein is affected by seed color genotype. Plant Cell 3, 561-571.
Liu, Q., Singh, S. P., Green, A.G., 2002. High-stearic and high-oleic Cottonseed oils produced by hairpin RNA-mediated post transcriptional gene silencing. Plant Physiol. 129, 1732-1743.
Leonard, E.G., 1993. High-erucic vegetable oils. Industrial Crops and Products 1 , 119- 123.
Leonard, C, 1994. Sources and commercial applications of high erucic vegetable oils. Lipid Tech. 4, 79-83.
Mietkiewska E., Brost JM., Giblin EM., Barton DL., Taylor DC, 2007. Cloning and functional characterization of the Fatty Acid Elongase 1 (FAE1) gene from high erucic Crambe abyssinica cv. Prophet. Plant Biotech. J. 5, 636-645.
Miquel, MF., Browse, JA., 1992. Arabidopsis mutants deficient in polyunsaturated fatty acid synthesis. J. Biol. Chem. 267, 1502-1509.
McVetty, P. B. E., Scarth, S., 2002. Breeding for improved oil quality in Brassica oilseed species. J. Crop. Prod. 5, 345-369. Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 15, 493-497.
Okuley, J., Lightner, J., Feldmann, K., Yadav, N., Lark, E., Browse, J., 1994. Arabidopsis FAD2 gene encodes the enzymes that is essential for polyunsaturated lipid synthesis. Plant Cell 6, 147-158.
Pouwels et al., Cloning Vectors. A Laboratory Manual, Elsevier, Amsterdam (1986).
Puyaubert, J., Garcia, C, Chevalier, S., Lessire, R., 2005. Acyl-CoA elongase, a key enzyme in the development of high-erucic acid rapeseed? Eur. J. Lipid Sci. Technol. 107, 263-267.
Sambrook, J., Fritsch, E. F., Maniatis, T., 1989. Molecular cloning: A laboratory manual, 2nd ed. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Scarth, R., Tang, J., 2006. Modification of Brassica oil using conventional and transgenic approaches. Crop ScL 46, 1225-1236.
Smith N.A., Singh S. P., Wang M. B., Stoutjesdijk PA, Green A.G., Waterhouse P.M., 2000. Totally silencing by intron-spliced hairpin RNAs. Nature 407, 319-320.
Stoutjesdijk, P.A., Singh, S. P., Liu, Q., Hurlstone CJ. , Watherhouse, PA, Green, A.G., 2002. hpRNA-mediated targeting of the Arabidopsis FAD2 gene gives highly efficient and stable silencing. Plant Physiol. 129, 1723-1731.
Tanaka, A., Mita, A., Ohta S., Kyozuka, J., Shimamoto, K., Nakamura, K., 1990. Enhancement of foreign gene expression by a dicot intron in rice but not in tobacco is correlated with an increased level of mRNA and efficient splicing of the intron. Nucleic Acid Res 18, 6767-6770.
Taylor, D.C., Katavic, V., Zou, J., Mackenzie, S1L1, Keller, WA, An, J., Friesen, W., Barton, D.L., Pedersen, K.K., Giblin, E. M., Ge, Y., Dauk, M., Sonntag, C, Luciw, T., Males, D., 2002. Field testing of transgenic rapeseed cv. Hero transformed with a yeast sn-2 acyltransferase results in increased oil content, erucic acid content and seed yield. MoI. Breeding 8, 317-322.
Wang, M. B., Abbott, D., Watherhouse, P.M., 2000. A single copy of a virus derived transgene encoding hairpin RNA gives immunity to barley yellow dwarf virus. MoI. Plant Pathol. 1 , 401-410. Wesley, S.V., Helliwell, CA, Smith, NA, Wang, M., Rouse, D.T., Liu, Q., Gooding, P.S, Singh, S. P., Abbott, D., Stoutjesdijk, PA, Robinson, S. P., Gleave, A.P., Green, A.G., Waterhouse, P.M., 2001. Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J. 27, 581-590.
Yang, M., Zheng, G., Zhang F., Xu, Y., 2006. F/\D2-silencing has pleiotropic effect on polar lipids of leaves and varied effect in different organs of transgenic tobacco. Plant Sci. 170, 170-177.
Zhang, F-Y., Yang, M-F., Xu-Y-N., 2005. Silencing of DGAT1 in tobacco causes a reduction in seed oil content. Plant Sci. 169, 689-694.
Other advantages that are inherent to the structure are obvious to one skilled in the art. The embodiments are described herein illustratively and are not meant to limit the scope of the invention as claimed. Variations of the foregoing embodiments will be evident to a person of ordinary skill and are intended by the inventor to be encompassed by the following claims.

Claims

Claims:
1. A nucleic acid construct for increasing production of erucic acid in Brassica carinata plants, the construct comprising:
an intron-spliced hairpin RNA nucleotide sequence for silencing fatty acid desaturase (FAD2) gene expression, the hairpin RNA nucleotide sequence comprising intron-interrupted inverted repeats of a nucleotide sequence cloned from the 3' untranslated region of a fatty acid desaturase (FAD2) gene of Brassica carinata;
a heterologous nucleotide sequence from Crambe abyssinica coding for a fatty acid elongase (FAE); and,
a seed-specific promoter.
2. The construct of claim 1 , wherein the nucleotide sequence from the 3' untranslated region comprises SEQ ID NO: 3.
3. The construct of claim 1 or 2, wherein the heterologous nucleotide sequence coding for fatty acid elongase comprises SEQ ID NO: 10.
4. The construct of any one of claims 1 to 3, wherein the promoter comprises a seed-specific napin promoter.
5. A Brassica carinata cell comprising the construct of any one of claims 1 to 4.
6. The cell of claim 5 having at least 10% by weight more erucic acid, based on total weight of triacylglycerols, than a wild type cell.
7. A Brassica carinata plant comprising the construct of any one of claims 1 to 4.
8. The plant of claim 7 having at least 10% by weight more erucic acid, based on total weight of triacylglycerols, than a wild type plant.
9. A Brassica carinata seed comprising the construct of any one of claims 1 to 4.
10. The seed of claim 9 having at least 10% by weight more erucic acid, based on total weight of triacylglycerols, than a wild type seed.
11. A method of increasing erucic acid production in a Brassica carinata plant comprising transforming the plant with a construct of any one of claims 1 to 4 and growing the plant under conditions where the construct is expressed.
2. The method of claim 11 , wherein erucic acid is produced in an amount of at least0% by weight more, based on total weight of triacylglycerols, than in a wild plant.
PCT/CA2008/002084 2007-12-03 2008-11-26 Method of increasing erucic acid production by hairpin rna fad2 gene silencing and fae gene overexpression Ceased WO2009070872A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US99673907P 2007-12-03 2007-12-03
US60/996,739 2007-12-03

Publications (1)

Publication Number Publication Date
WO2009070872A1 true WO2009070872A1 (en) 2009-06-11

Family

ID=40717220

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2008/002084 Ceased WO2009070872A1 (en) 2007-12-03 2008-11-26 Method of increasing erucic acid production by hairpin rna fad2 gene silencing and fae gene overexpression

Country Status (1)

Country Link
WO (1) WO2009070872A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005052162A1 (en) * 2003-11-25 2005-06-09 National Research Council Of Canada Fatty acid elongase (fae) genes and their utility in increasing erucic acid and other very long-chain fatty acid proportions in seed oil.

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005052162A1 (en) * 2003-11-25 2005-06-09 National Research Council Of Canada Fatty acid elongase (fae) genes and their utility in increasing erucic acid and other very long-chain fatty acid proportions in seed oil.

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
KANRAR, S. ET AL.: "Modification of erucic acid content in Indian mustard (Brassica juncea) by up-regulation and down-regulation of the Brassica juncea fatty acid elongationl (BjFAEl) gene.", PLANT CELL REPORTS, vol. 25, May 2005 (2005-05-01), pages 148 - 155 *
MIETKIEWSKA, E. ET AL.: "Cloning and functional characterization of the fatty acid elongase 1 (FAE1) gene from high erucic Crambe abyssinica cv. Prophet.", PLANT BIOTECHNOLOGY JOURNAL, vol. 5, September 2007 (2007-09-01), pages 636 - 645 *
MIETKIEWSKA, E. ET AL.: "Hairpin-RNA mediated silencing of endogenous FAD2 gene combined with heterologous expression of Crambe abyssinica FAE gene causes an increase in the level of erucic acid in transgenic Brassica carinata seeds.", MOLECULAR BREEDING, vol. 22, 4 July 2008 (2008-07-04), pages 619 - 627 *
MIETKIEWSKA, E. ET AL.: "Seed-specific heterologous expression of a nasturtium FAE gene in Arabidopsis results in a dramatic increase in the proportion of erucic acid.", PLANT PHYSIOLOGY, vol. 136, September 2004 (2004-09-01), pages 2265 - 2675 *
SMITH, N.A. ET AL.: "Total silencing by intron-spliced hairpin RNAs.", NATURE, vol. 407, September 2000 (2000-09-01), pages 319 - 320 *
STOUTJESDIJK, P.A. ET AL.: "hpRNA-mediated targeting of the arabidopsis FAD2 gene gives highly efficient and stable silencing.", PLANT PHYSIOLOGY, vol. 129, August 2002 (2002-08-01), pages 1723 - 1731 *

Similar Documents

Publication Publication Date Title
US11319549B2 (en) Use of the soybean sucrose synthase promoter to increase plant seed lipid content
EP2315519B1 (en) Improved cottonseed oil and uses
CN107858204B (en) Enzymes and methods for producing omega-3 fatty acids
WO2010009500A1 (en) Improved vegetable oils and uses therefor
US20090099378A1 (en) Generation of plants with altered oil content
KR20170098810A (en) Generation of transgenic canola with low or no saturated fatty acids
Tian et al. Decreasing erucic acid level by RNAi-mediated silencing of fatty acid elongase 1 (BnFAE1. 1) in rapeseeds (Brassica napus L.)
US10975380B2 (en) Seed-specific and endosperm-preferental promoters and uses thereof
Liu et al. Isolation and characterization of two different microsomal ω-6 desaturase genes in cotton (Gossypium hirsutum L.)
CA3019984C (en) Seed-specific and endosperm-preferential promoters and uses thereof
WO2014137289A1 (en) Gene silencing of sugar-dependent 1 in jatropha curcas
AU2002334151B2 (en) Production of oil with higher erucic acid content
US20190127747A1 (en) Seed-specific and endosperm-preferential promoters and uses thereof
EP3443101A1 (en) Seed-specific and endosperm-preferential promoters and uses thereof
CA3020397A1 (en) Seed-specific and embryo-preferential promoters and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08856392

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08856392

Country of ref document: EP

Kind code of ref document: A1