WO2009045545A2 - Antidotes for agonistic aptamers - Google Patents
Antidotes for agonistic aptamers Download PDFInfo
- Publication number
- WO2009045545A2 WO2009045545A2 PCT/US2008/011531 US2008011531W WO2009045545A2 WO 2009045545 A2 WO2009045545 A2 WO 2009045545A2 US 2008011531 W US2008011531 W US 2008011531W WO 2009045545 A2 WO2009045545 A2 WO 2009045545A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- aptamer
- antidote
- aptamers
- oligonucleotide
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/50—Methods for regulating/modulating their activity
Definitions
- the present invention relates, in general, to aptamers and antidotes therefor and, in particular, to aptamers capable of binding to and activating molecules, such as receptors (e.g., the OX40 receptor) and enzymes.
- the invention further relates to antidotes to such agonistic aptamers.
- the invention also relates to compositions comprising, and to methods of using, the agonistic aptamers and the antidotes therefor.
- OX40 (CD 134, TNFRSF4) is a member of the tumor necrosis family of receptors.
- the OX40 receptor is expressed on the surface of activated T cells and interaction with its ligand, OX40 ligand, leads to increased immune function manifested by T cell proliferation and cytokine production (Weinberg, Trends Immunol. 23:102 (2002), Sugamura et al, Nat. Rev. Immunol. 4:420 (2004), Watts, Annu. Rev. Immunol. 23:23 (2005)).
- CD28, CD40, 4- IBB Interleukin-1 (CD28, CD40, 4- IBB)
- the present invention results, at least in part, to studies designed to develop an alternative and potentially safer approach to stimulate receptors, such as OX40. It has been shown that antidotes can be developed to rapidly reverse the activity of antagonistic aptamers (Nimjee et al, MoI. Ther. 14:408 (2006), Rusconi et al, Nature 419:90 (2002), Rusconi et al., Nat. Biotechnol. 22:1423
- the present invention provides antidotes that can be used to enhance the safety of therapeutic agonistic aptamers (e.g., OX40 agonist aptamers).
- therapeutic agonistic aptamers e.g., OX40 agonist aptamers
- the present invention relates generally to aptamers and antidotes therefor. More specifically, the invention relates to aptamers capable of binding to and activating molecules, such as receptors (e.g., the OX40 receptor) and enzymes.
- the invention further relates to antidotes to such agonistic aptamers.
- the invention also relates to compositions comprising, and to methods of using, agonistic aptamers and antidotes therefor. Objects and advantages of the present invention will be clear from the description that follows.
- FIGS. IA-I C Isolated OX40 aptamers and determination of binding affinities.
- Fig. IA Summary of aptamer sequences against murine OX40 including a point mutant version of aptamer 9.8 (9.8 PM) and their binding affinities.
- Fig. IB CHO cells expressing OX40 were stained with a FITC labeled aptamer. In the left panel, the aptamer (D) was compared to the point mutant aptamer control ( ⁇ ). Protein expression was verified with OX40 antibody (0X86- PE D) and isotype control mAb (B).
- Fig. 1C Aptamer dimers retain binding affinity to purified OX40 protein.
- Aptamer 9.8 or point mutant were dimerized by annealing to an oligonucleotide containing 2 sites for aptamer hybridization separated by an 18 carbon spacer (see Fig. 7).
- FIGS. 2A-2D RNA aptamer dimers are capable of inducing OX40 function in vitro.
- FIG. 2A RAPTER's effect on proliferation of SEB primed lymph node cells was assessed by fiow-cytometric analysis of the CFSE labeled cells. An OX40 antibody agonist served as positive control. The percentage of proliferating cells is noted.
- FIG. 2B Mean percentage of proliferating cells of 3 independent experiments. Error bars indicate SEM ; *p ⁇ 0.05, **p ⁇ 0.01, # not significant.
- FIG. 2C OX40 activation leads to increased IFN ⁇ release. Concentrations of IFN ⁇ in the culture supernatants of the previous experiment were determined by ELISA. Depicted are the mean values of three measurements.
- OX40 activation results in the nuclear translocation of NFKB.
- cells were cultured as above in absence of CFSE labeling. After 72 hours of culture, nuclei were isolated and subjected to western blot analysis. NFKB and the loading control ⁇ -tubulin were detected using specific antibodies and visualized by chemiluminescence.
- Figure 3 OX40 RAPTER enhances tumor immunity in mice immunized with TRP-2 RNA transfected DCs.
- mice (5-10/group) were subcutaneously implanted with 2.5 x 10 4 F 10.9 cells in the flank and immunized with 10 5 RNA transfected DCs at the base of each ear pinna. DCs were generated and electroporated with TRP-2 RNA. Mice were injected with OX40 antibody, control antibody (100 ⁇ g/mouse), OX40 RAPTER or control point mutant RAPTER (87 ⁇ g/mouse). The experiment was repeated 3 times with similar results. Enhancement in DC-TRP-2 immunotherapy is not significantly different (#, p>0.05) between OX40 Ab and OX40 RAPTER.
- FIGS 4A-4E Inhibition of the OX40 agonistic aptamer using an antidote oligonucleotide.
- FIG. 4A Schematic of five complementary oligonucleotides that can potentially serve as antidotes to aptamer 9.8.
- FIG. 4B Antidote screen against the aptamer 9.8 monomer. Antidotes (l(A), 2(T), 3( ⁇ ), 4(#), 5(D), none (O)) were mixed with radioactively labeled aptamer 9.8 monomers before addition to OX40 fusion protein and determination of binding affinities.
- FIG. 4C Antidote mediated reversal of RAPTER binding.
- Radiolabeled RAPTER was incubated with OX40 fusion protein prior to antidote addition.
- Fig. 2D Timecourse of antidote reversal.
- Figure 5. Aptamer 9.8 binds to the extracellular portion of murine OX40.
- the constant region (Fc) of human IgG and protein G were part of the selection since the selection target consisted of a fusion protein of the extracellular portion of murine OX40 to the human IgG Fc that was immobilized through binding to protein G coated beads.
- RNA aptamers were dimerized by heating the aptamer and annealing it to a DNA scaffold at a 1 :1 ratio of binding sites.
- the resulting mixture of dimer (2 aptamer + scaffold) and monomer (1 aptamer + scaffold) were PAGE purified using an 8% native polyacrylamide gel. The identity of gel-eluted dimers was verified by running the dimerized RNA on a PAGE gel and visualizing with ethidium bromide staining.
- FIG. 8 Secretion of the cytokine TNFoc is not induced upon RAPTER- mediated OX40 activation but is enhanced upon toll like receptor activation through CpG oligonucleotides.
- concentration of the cytokine TNF ⁇ in the supernatants of treated DCs was evaluated.
- the present invention provides nucleic acid ligands (e.g., aptamers) engineered to stimulate a target molecule (e.g., receptor or enzyme), preferably, the immune coreceptor, OX40.
- a target molecule e.g., receptor or enzyme
- the aptamers of the invention are well tolerated, exhibit low or no immunogenicity, and are thus suitable for repeated administration as therapeutic compounds (Floege et al, Am J Pathol 154:169-179 (1999), Ostendorf et al, J Clin Invest 104:913-923 (1999), Griffin et al, Blood 81:3271-3276 (1993), Hicke et al, J Clin Invest 106:923-928 (2000)). Properties of the instant aptamers are superior to those of antibodies.
- Aptamers of the invention can be generated by in vitro screening of complex nucleic-acid based combinatorial shape libraries (e.g., >10 14 shapes per library) employing a process termed SELEX (for Systematic Evolution of Ligands by Exponential Enrichment) (Tuerk et al, Science 249:505-10 (1990), USPs 5,270,163, 5,817,785, 5,595,887, 5,496,938, 5,475,096, 5,861,254, 5,958,691, 5,962,219, 6,013,443, 6,030,776, 6,083,696, 6,110,900, 6,127,119, 6,147,204 and WO 91/19813). (See also Fig.
- the SELEX process consists of iterative rounds of affinity purification and amplification and yields high affinity (e.g., IpM to l ⁇ M, preferably, less than 1OnM) and high specificity ligands that modulate (e.g., stimulate/activate) the function of their target (e.g., OX40).
- Combinatorial libraries employed can be front-loaded with, for example, 2'modified RNA nucleotides (e.g., 2'fluoro-pyrimidines) such that the aptamers generated are highly resistant to nucl ease-mediated degradation and amenable to immediate activity screening in cell culture or bodily fluids.
- Simple chemical modifications of the aptamer or conjugation of the aptamer to a high molecular weight inert carrier molecule can increase circulating half-life substantially (Willis et al, Bioconjug Chem 9:573-582 (1998), Tucker et al, J Chromatogr Biomed Sci Appl 732:203-212 (1999), Watson et al, Antisense Nucleic Acid Drug Dev 10:63-75 (2000)).
- Bioactive and nuclease resistant single-stranded nucleic acid ligands comprising L-nucleotides have been described (Williams et al, Proc. Natl. Acad. Sci.
- L-aptamers are reportedly stable under conditions in which aptamers comprising nucleotides of natural strandedness (D-nucleotides) (that is, “D-aptamers”) are subject to degradation.
- the aptamers of the invention can be monomelic but are preferably multimerized using any of a variety of approaches, including multimerization on solid supports (e.g. beads or nanoparticles) or via annealing to a complementary oligonucleotide that comprises a repeat of the complementary sequence to, for example, the 3' region of the aptamers (advantageously, separated by a carbon spacer (for example, a 5-50 carbon spacer, preferably, 16-20 carbon spacer, more preferably an 18 carbon spacer)), as described in the Example that follows.
- a carbon spacer for example, a 5-50 carbon spacer, preferably, 16-20 carbon spacer, more preferably an 18 carbon spacer
- Aptamers of the invention capable of activating/stimulating target molecules (e.g., OX40), can be used in lieu of stimulatory antibodies and recombinant proteins in a variety of therapeutic settings.
- the aptamers can be safely repeatedly administered without eliciting compound-specific antibodies (Macugen Study Group, Ophthalmology 114:1702-1712 (2007)) as is the case with therapeutic antibodies developed in animal hosts. This is particularly important for treatment of patients with chronic diseases.
- OX40 is a therapeutic target for cancer immunotherapy and various autoimmune diseases (including diabetes, asthma, and autoimmune encephalitis) and the aptamers (e.g., multimerized (preferably, dimerized or trimerized)) described herein are capable of enhancing tumor immune responses.
- Agonistic aptamers of the invention can also be used as vaccine adjuvants in the context of, for example, viral vaccines and cancer vaccines.
- the aptamers of this invention can be formulated into compositions (e.g., sterile compositions suitable for injection) using methods well known in the art.
- Appropriate carriers can be selected depending, for example, on the aptamer and route of administration (e.g., IV, IP, IM or SC).
- Optimum dosing regimens can be readily established by one skilled in the art and can vary, for example, with the aptamer, the patient and the effect sought.
- doses in the range of 1 ⁇ g/kg to 1 OOmg/kg can be used, preferably, 0.1 mg/kg to 10 mg/kg.
- RNA aptamers capable of binding OX40 e.g., the extracellular domain thereof
- the multimerization e.g. dimerization
- the invention includes aptamers suitable for use in targeting human OX40.
- a variety of approaches such as changing the length of the carbon spacer connecting the dimerized aptamers, can be used.
- Such modification has the potential, for example, to enhance the aptamers' ability to crosslink two OX40 receptor monomers and induce signaling.
- solution of the crystal structure of the OX40-OX40 Ligand complex has revealed that the receptor and ligand appear to interact as two trimers (Compaan et al, Structure 14:1321 (2006).
- trimerization of the aptamers may yield an even more effective agonist.
- oligonucleotide antidotes e.g., targeted to single-stranded structures of the aptamer (e.g., loops or bulges)
- antidotes described in US Prov. Appln. 60/920,807 see also Example below.
- oligonucleotide antidotes can be stabilized in the same manner as aptamers. Antidotes can provide physicians additional control over an aptamer' s activity if patient safety becomes a concern.
- antidotes can be used in the event of over activation of the immune system (e.g., cytokine storm) which can result in global inflammation, autoimmune disease being a potential long term effect.
- the immune system e.g., cytokine storm
- the ability to rapidly control the activity of, for example, therapeutic receptor agonists via antidote administration is challenging since limiting signaling after it has initiated can be difficult. Nonetheless, the ability to limit additional "unsafe" activation of a receptor improves patient safety.
- optimum dosing regimens can vary with, for example, the antidote, the aptamer targeted, the route of administration (e.g., IV), the patient and the effect sought, it is preferable that the ratio of antidote/aptamer administered be in the range of 1 : 1 to 100: 1.
- Aptamer-antidote pairs represent a broadly applicable strategy that can be useful to improve the safety of therapeutic agonists.
- PCT/US06/36090 is also incorporated herein by reference.
- the entire content of PCT/US2007/022357 is also incorporated herein by reference.
- RNA aptamers specific to the extracellular portion of murine OX40 were isolated using the SELEX method (Fitzwater et al, Methods Enzymol. 267:275 (1996), Tuerk et al, Science 249:505 (1990)).
- a 80 nucleotide combinatorial RNA library was created by transcription of a partially randomized DNA oligonucleotide
- RNA bound to OX40 was extracted by a 30 minute incubation in phenol: chloroform: isoamyl alcohol (25:24:1). The RNA was amplified by reverse transcription followed by PCR.
- RNA pool was created with transcription using a 2'OH purine, 2'F pyrimidine nucleotide mixture using T7 polymerase. Transcripts were gel purified and eluted into TE, pH 7.5 (10 mM Tris pH 7.5, 0.ImM EDTA). Following overnight elution, RNA was washed three times in TE, pH 7.5 using Centricon 30 columns (Millipore).
- Binding constants were determined using filter binding assays (Wong et al, Proc. Natl. Acad. Sci. USA 90:5428 (1993)) in buffer composed of 2OmM Hepes pH 7.4, 15OmM NaCl, 2mM CaC12. To determine the affinities of monomeric aptamers, serial dilutions of murine OX40 IgG Fc fusion protein
- the predicted secondary structure of generated aptamers was determined by utilizing the algorithm m-fold
- the point mutant RNA aptamer was generated by in vitro transcription of
- DNA template produced by annealing two oligonucleotides.
- One nmole of each oligonucleotide (5 ' GGGGGAATTCTAATACGACTCACTATAGGGAGGACGATGCGGCAGT
- ATTCCTACGATGCAGACTG 3' were heated to 95°C for 5 minutes and annealed by cooling to 4°C.
- a double stranded DNA transcription template was created using treatment with Exo-Klenow fragment (New England Biolabs). The reaction was stopped by the additon of 2mM EDTA followed by phenol: chloroform and chloroform extraction. The template was purified by triplicate washing using a centricon 30 column and 10 mM Tris pH 7.5, O.lmM EDTA buffer. 2 'F modified point mutant RNA aptamer was generated through in vitro transcription using T7 polymerase.
- OX40 mRNA was generated by in vitro transcription of a Spel digested OX40 plasmid using mMessagemMachine T7 kit (Ambion). Generated RNA was purified using RNeasy kit (Qiagen) according to manufacturers instruction. CHO cells were harvested by trypzination followed by washing in phosphate buffered saline (Gibco). Cells were counted in the presence of tryphan blue, pelleted by centrifugation and resuspended in Opti-MEM media (Gibco) before transfection via electroporation.
- OX40 RNA per one million cells were used to transfect 6 million cells by pulsing at 300V for 500 ⁇ s. Following electroporation, cells were grown for 24 hours at 37°C, 5% CO 2 in a humidified incubator in DMEM (Gibco) containing 10% fetal bovine serum (HyClone).
- RNA aptamers were stained using a modified published protocol (Davis et al, Nucleic Acids Res. 26:3915 (1998)).
- a 20mer complimentary fluorescently modified DNA oligonucleotide (Operon) (5' FITC TCTCGGATCCTCAGCGAGT 3') was heated and annealed to RNA aptamers at a 1 : 1 molar ratio at 65 0 C for 5 minutes and cooling to room temperature. Retention of binding affinity upon complement oligonucleotide binding was demonstrated by filter binding to recombinant OX40 (R&D systems).
- Fluorescently labeled aptamers were incubated with 10 5 mock- or OX40-transfected CHO cells for 20 minutes in PBS 0.1 % BSA, 1 OmM MgCl 2 at room temperature and washed as described above before analysis by flow cytometry.
- RNA aptamers were mixed with this scaffold at a 2:1 molar ratio of RNA to scaffold. The mixture was heated to 95°C for 5 minutes followed by slow cooling to room temperature.
- aptamer dimers were purified using 8% native PAGE purification followed by overnight elution into 2mL of TE, pH 7.5 buffer at 4°C followed by extensive washing as described above.
- Radioactive labelling of monomelic RNA normally involves a dephosphorylation step at 65°C using bacterial alkaline phosphatase (Invitrogen) followed by radioactive labeling using T4 kinase and 32 P gamma labeled ATP.
- gel purified RNA dimers are heat labile and, therefore, could not be heated to 65°C. Therefore, dimers were 3' radiolabeled by incubation with T4 RNA ligase (Ambion) according to manufacturer's instructions at 4°C. This method leads to a lower incorporation efficiency but has the advantage of avoiding exposure of the dimer to heat. Binding affinities were determined as described for the aptamer monomer.
- Activation of OX40 leads to increased T cell proliferation (AIi et al, Vaccine 22:3585 (2994)). Therefore, the effect of the dimerized aptamers on activation of OX40 was tested, as was the consequent increase in lymph node cell proliferation.
- 50 ⁇ g of Staphyloccocal enterotoxin B (Sigma) resuspended in PBS (Gibco) was administered to female Balb/c mice intraperitoneally. Auxiliary, inguinal and mesenteric lymph nodes were harvested after 24 hours.
- Cells were teased into single cell suspension and labelled with carboxyfluoroscein succinimidyl ester (CFSE/ Pierce) by incubating cells at a concentration of 1 million cells/mL in PBS (Gibco) containing 5% fetal bovine serum (HyClone) and 2mM CFSE at room temperature for 5 minutes. Cells were washed twice using phosphate buffered saline with 5% fetal bovine serum followed by a final wash with RPMI containing 10% fetal bovine serum.
- PBS Gibco
- fetal bovine serum HyClone
- NFKB is translocated to the nucleus as a result of OX40 signaling.
- OX40 activation a determination was made of the presence of nuclear NFKB in murine lymph node cells incubated with the aptamer or point mutant dimer compared to the agonisitic OX40 antibody. Mice were injected with Staphylococcal enterotoxin B and lymph nodes harvested as described in the proliferation assay. Cells were teased into single cell suspension and 10 5 cells per 96 well plate well were seeded in complete RPMI containing 0.5ng/mL staphylococcal enterotoxin B. Aptamer dimers or antibodies were added at a concentration of 66 nM.
- Protein was visualized using the ECL plus chemiluminescence detection kit (GE Amersham) and captured through exposure to film. Antibodies were removed from the membranes by a 15-minute incubation with Restore Western Blotting Stripping Buffer (Pierce). Successful stripping was verified by treatment with chemiluminescence reagents and exposure to film. The nuclear protein loading control beta tubulin was detected through incubation with a primary followed by a secondary HRP conjugated antibody.
- Murine bone marrow precursor-derived DC Marrow from tibias and femurs of C57BL/6 mice were harvested followed by treatment of the precursors with ammonium chloride Tris buffer for 3 min at 37 0 C to deplete the red blood cells.
- the precursors were plated in RPMI with 5% FCS and GM-CSF (15 ng/ml) and IL-4 (10 ng/ml).
- GM-CSF and IL-4 were obtained from Peprotech (Rocky Hill, NJ). Cells were plated at 10 6 /ml and incubated at 37°C and 5% CO 2 .
- the floating cells Mostly granulocytes
- the adherent cells replenished with fresh GM- CSF and IL-4 containing medium.
- the non-adherent cells were harvested, washed and electroporated with RNA.
- Electroporating murine DC with RNA Electroporating murine DC with RNA.
- DC were harvested on day 7, washed and gently resuspended in Opti- MEM (GIBCO, Grand Island, NY) at 2.5 x 10 7 / ml. The used DC culture media was saved as conditioned media for later use. Cells were electroporated in 2 mm cuvettes (200 ⁇ l of DC (5 x 10 6 cells) at 300 V for 500 ⁇ s using an Electro Square Porator ECM 830, BTX, San Diego, CA). The amount of TRP-2 or actin RNA used was 3 ⁇ g, per 1 O ⁇ DC. Cells were immediately transferred to 6-well plates containing a 1 : 1 combination of conditioned DC growth media and fresh RPMI with GMCSF and IL4.
- Transfected cells were incubated at 37°C, 5% CO 2 for 4h in the presence of 100 ng/ml LPS (Sigma product # L265L, E.coli 026:B6), washed two times in PBS and then injected into mice.
- LPS Sigma product # L265L, E.coli 026:B6
- Antidote mediated inhibition of aptamer monomer binding to murine OX40 was demonstrated by filter binding.
- One of 5 different DNA oligonucleotides complementary to a portion of the aptamer (Antidote 1 : 5' GATTC CTACG ATGCA GACTG 3 ' , Antidote 2: 5' GTGGC GATTC CTACG ATGCA 3', Antidote 3: 5' ATACG GTGGC GATTC CTACG 3', Antidote 4: 5' AAAGT ATACG GTGGC GATTC 3', and Antidote 5: 5' GTGGG AAAGT ATACG GTGGC 3') were added to the included radiolabeled aptamer to a final concentration of 1 ⁇ M before addition to serially diluted murine OX40 IgG Fc fusion protein (R&D systems). Fractions of aptamer bound to OX40 were determined by differential filter binding and calculated as above.
- AAAGUAUACGGUGGCGAUUC 3' or scramble control were added to this mixture.
- the mixture was incubated at 37 0 C for 45 minutes before determining the binding affinities by differential filter binding analysis.
- RNA aptamers can be developed as OX40 agonists.
- SELEX SELEX for those RNAs that bound to the extracellular domain of OX40 with high affinity
- this process yielded a number of RNA aptamers that bound OX40 with high affinity (kos 8-625nM) and specificity.
- Aptamer 9.8 was chosen for further study since it had the highest affinity for the purified extracellular domain of OX40.
- Point Mutant 9.8 a mutant version of the aptamer, termed Point Mutant 9.8, was created containing two point mutations rendering it unable to bind OX40 (Figs. IA, 1C and 6).
- Figs. IA, 1C and 6 To determine if aptamer 9.8 is able to bind OX40 expressed on the surface of cells, flow cytometry analysis was performed using a fluorescently labeled aptamer (Davis et al, Nucleic Acids Res. 26:3915 (1998)). As shown in Fig. IB, aptamer 9.8 also binds the full length OX40 receptor. Unfortunately, this monomelic version of the 9.8 aptamer is unable to stimulate OX40 (data not shown).
- OX40 agonistic activity In an attempt to convey OX40 agonistic activity to aptamer 9.8, a consideration was made of characteristics of known OX40 agonists. Agonists known to functionally activate the OX40 receptor include antibody formulations (al-Shamkhani et al, Eur. J. Immunol. 26:1695 (2996)) and multimerized versions (dimerized/trimerized (Morris et al, MoI. Immunol. 44:3112 (2007)) of OX40's natural ligand (OX40 Ligand). These proteins share the common feature of possessing multiple binding sites for OX40. They have the capacity to crosslink receptor subunits, leading to signal transduction.
- aptamer 9.8 was created using an oligonucleotide scaffold (Fig. 7).
- the aptamer dimer retains its high affinity binding for the OX40 protein (Fig.1C).
- OX40 activation is known to serve as costimulatory signal and enhance T cell proliferation (AIi et al, Vaccine 22:3585 (2004)), induce cytokine secretion (Kawamata et al, J. Biol. Chem. 273:5808 (1998)) and initiate T cell signaling events (Aggarwal, Nat. Rev. Immunol. 3:745 (2003)). It was next determined whether the dimeric version of aptamer 9.8 could elicit these effects.
- the aptamers' ability to induce OX40 function was evaluated in a tumor immunotherapy setting. More precisely, the RAPTER' s ability to enhance antitumor responses generated by dendritic cells (DC) transfected with tumor antigen was evaluated (Nair et al, Expert Rev. Vaccines 1 :507 (2002)).
- DC dendritic cells
- Female C57/BL6 mice were implanted with B16-F10.9 melanoma tumor cells and vaccinated with DCs pulsed with either the melanoma antigen tyrosinase-related protein 2 (TRP-2) or actin (control) mRNA.
- This vaccine was administered in the presence of OX40 RAPTER, mutant OX40 RAPTER, OX40 agonistic antibody or an isotype control antibody (Nair et al, Cancer Res. 67:371 (2007)).
- administration of DCs containing the TRP-2 antigen alone delayed the development of a palpable tumor compared to control antigen treated animals but did not lead to a cure in mice.
- administration of either the OX40 RAPTER or the OX40 agonistic antibody to animals receiving the DC-TRP-2 vaccination resulted in tumor eradication in 30-40% of the animals.
- DC-TRP-2 based immunotherapy was significantly enhanced through the addition of OX40 RAPTER or antibody (DC-TRP-2 + control Ab versus DC- TRP-2 + OX40 Ab, p ⁇ 0.05 and DC-TRP-2 + control aptamer versus DC-TRP-2 + OX40 aptamer, p ⁇ 0.05). Therefore, as with an OX40 agonistic antibody, the OX40 RAPTER is a potent adjuvant for a DC-based tumor vaccine in vivo.
- Antidote oligonucleotide 4 was chosen for further study and a 2'OMethyl (2'OMe) modified version of it was created to stabilize the oligonucleotide in the presence of serum nucleases. As shown in Fig. 4C, this stabilized antidote can decrease dimeric OX40 RAPTER binding to OX40. To further characterize the nature of antidote function, an effort was made to determine the timeframe needed for reversal of the aptamer protein interaction. Using a 25 fold excess of antidote, the antidote required between 30 and 45 minutes to dissociate half of the bound aptamer dimers from the dimeric OX40 IgG-Fc fusion protein (Fig.
- antidote addition resulted in blocking at least one of the OX40 RAPTER binding sites.
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates, in general, to aptamers and antidotes therefor and, in particular, to aptamers capable of binding to and activating molecules, such as receptors (e.g., the OX40 receptor) and enzymes. The invention further relates to antidotes to such agonistic aptamers. The invention also relates to compositions comprising, and to methods of using, the agonistic aptamers and the antidotes therefor.
Description
ANTIDOTES FOR AGONISTIC APTAMERS
This application claims priority from U.S. Provisional Application No. 60/977,589, filed October 4, 2007, the entire content of which is incorporated herein by reference. This invention was made with government support under Grant Nos.
HL065222 and IULl RR024128-01 awarded by the National Institutes of Health. The government has certain rights in the invention.
TECHNICAL FIELD
The present invention relates, in general, to aptamers and antidotes therefor and, in particular, to aptamers capable of binding to and activating molecules, such as receptors (e.g., the OX40 receptor) and enzymes. The invention further relates to antidotes to such agonistic aptamers. The invention also relates to compositions comprising, and to methods of using, the agonistic aptamers and the antidotes therefor.
BACKGROUND
OX40 (CD 134, TNFRSF4) is a member of the tumor necrosis family of receptors. The OX40 receptor is expressed on the surface of activated T cells and interaction with its ligand, OX40 ligand, leads to increased immune function manifested by T cell proliferation and cytokine production (Weinberg, Trends Immunol. 23:102 (2002), Sugamura et al, Nat. Rev. Immunol. 4:420 (2004), Watts, Annu. Rev. Immunol. 23:23 (2005)). As with many other receptors involved in modulating immune cell function (e.g., CD28, CD40, 4- IBB) (Melero et al, Nat. Rev. Cancer 7:95 (2007)), agonistic antibodies targeting OX40 have been developed (al-Shamkhani et al, Eur. J. Immunol. 26: 1695 (1996)). In vitro and in vivo studies have demonstrated that such antibodies can stimulate T cell
activity and have led to the initiation of phase I clinical trials to evaluate OX40 agonistic antibodies as potential cancer therapeutics (Weinberg et al, J. Immunother. 29:575 (2006)). However, recent devastating clinical results with an agonistic antibody to the receptor CD28 have called the safety of such compounds into question (Suntharalingam et al, N. Engl. J. Med. 355:1018 (2006)).
The present invention results, at least in part, to studies designed to develop an alternative and potentially safer approach to stimulate receptors, such as OX40. It has been shown that antidotes can be developed to rapidly reverse the activity of antagonistic aptamers (Nimjee et al, MoI. Ther. 14:408 (2006), Rusconi et al, Nature 419:90 (2002), Rusconi et al., Nat. Biotechnol. 22:1423
(2004)). The present invention provides antidotes that can be used to enhance the safety of therapeutic agonistic aptamers (e.g., OX40 agonist aptamers).
SUMMARY OF THE INVENTION
The present invention relates generally to aptamers and antidotes therefor. More specifically, the invention relates to aptamers capable of binding to and activating molecules, such as receptors (e.g., the OX40 receptor) and enzymes.
The invention further relates to antidotes to such agonistic aptamers. The invention also relates to compositions comprising, and to methods of using, agonistic aptamers and antidotes therefor. Objects and advantages of the present invention will be clear from the description that follows.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures IA-I C. Isolated OX40 aptamers and determination of binding affinities. (Fig. IA) Summary of aptamer sequences against murine OX40 including a point mutant version of aptamer 9.8 (9.8 PM) and their binding
affinities. (Fig. IB) CHO cells expressing OX40 were stained with a FITC labeled aptamer. In the left panel, the aptamer (D) was compared to the point mutant aptamer control (■). Protein expression was verified with OX40 antibody (0X86- PE D) and isotype control mAb (B). (Fig. 1C) Aptamer dimers retain binding affinity to purified OX40 protein. Aptamer 9.8 or point mutant were dimerized by annealing to an oligonucleotide containing 2 sites for aptamer hybridization separated by an 18 carbon spacer (see Fig. 7). Gel purified aptamer dimers were radioactively labeled and their binding affinities to murine OX40-IgG Fc fusion protein were determined by differential filter binding. Shown are binding curves of OX40-Fc fusion protein to aptamer monomer ( ■ ), aptamer dimer (A), point mutant monomer (T) or point mutant dimer (♦) (n=3). Error bars indicate SEM.
Figures 2A-2D. RNA aptamer dimers are capable of inducing OX40 function in vitro. (Fig. 2A) RAPTER's effect on proliferation of SEB primed lymph node cells was assessed by fiow-cytometric analysis of the CFSE labeled cells. An OX40 antibody agonist served as positive control. The percentage of proliferating cells is noted. (Fig. 2B) Mean percentage of proliferating cells of 3 independent experiments. Error bars indicate SEM ; *p<0.05, **p<0.01, # not significant. (Fig. 2C) OX40 activation leads to increased IFNγ release. Concentrations of IFNγ in the culture supernatants of the previous experiment were determined by ELISA. Depicted are the mean values of three measurements. Error bars indicate SEM; *p<0.05. (Fig. 2D) OX40 activation results in the nuclear translocation of NFKB. TO measure the effect of the OX40 RAPTER on NFKB localization, cells were cultured as above in absence of CFSE labeling. After 72 hours of culture, nuclei were isolated and subjected to western blot analysis. NFKB and the loading control β-tubulin were detected using specific antibodies and visualized by chemiluminescence.
Figure 3. OX40 RAPTER enhances tumor immunity in mice immunized with TRP-2 RNA transfected DCs. Mice (5-10/group) were subcutaneously implanted with 2.5 x 104 F 10.9 cells in the flank and immunized with 105 RNA transfected DCs at the base of each ear pinna. DCs were generated and electroporated with TRP-2 RNA. Mice were injected with OX40 antibody, control antibody (100 μg/mouse), OX40 RAPTER or control point mutant RAPTER (87μg/mouse). The experiment was repeated 3 times with similar results. Enhancement in DC-TRP-2 immunotherapy is not significantly different (#, p>0.05) between OX40 Ab and OX40 RAPTER.
Figures 4A-4E. Inhibition of the OX40 agonistic aptamer using an antidote oligonucleotide. (Fig. 4A) Schematic of five complementary oligonucleotides that can potentially serve as antidotes to aptamer 9.8. (Fig. 4B) Antidote screen against the aptamer 9.8 monomer. Antidotes (l(A), 2(T), 3(Φ), 4(#), 5(D), none (O)) were mixed with radioactively labeled aptamer 9.8 monomers before addition to OX40 fusion protein and determination of binding affinities. (Fig. 4C) Antidote mediated reversal of RAPTER binding. Radiolabeled RAPTER was incubated with OX40 fusion protein prior to antidote addition. RAPTER affinities in the presence of antidote A4 (O), a non- complementary control antidote (A) or the aptamer alone (■) were determined (n=2). (Fig. 2D) Timecourse of antidote reversal. RAPTER (5nM + radiolabeled trace) and OX40 protein (4OnM) were incubated with a 25 fold excess of antidote A4 (O) or scrambled antidote (D) (n=2) for the indicated times and the bound fraction of OX40 RAPTER determined. (Fig. 4E) Effect of antidote addition on OX40 RAPTER function. Antidote 4 reverses OX40 RAPTER-mediated activation of OX40 and limits IFNg production from primed lymph node cells (n=3); *p<0.05, # n.s. Error bars indicate SEM.
Figure 5. Aptamer 9.8 binds to the extracellular portion of murine OX40. The constant region (Fc) of human IgG and protein G were part of the selection since the selection target consisted of a fusion protein of the extracellular portion of murine OX40 to the human IgG Fc that was immobilized through binding to protein G coated beads. The binding specificity of aptamer 9.8 to the extracellular portion of murine OX40 was, therefore, verified. Binding affinities to murine OX40 human IgG Fc fusion protein (■) were compared to human IgG (O) as well as protein G (#) to demonstrate aptamer specificity to the extracellular portion of OX40 (n=3, error bars represent SEM).
Figure 6. Point mutant aptamer design. Lowest free energy predicted secondary structure of the OX40 aptamer was determined using the structure prediction program M-FoId by Michael Zuker
(http://bioweb.pasteur.fr/sequanal/interfaces/mfold.html). The two nucleotides that are altered in the control mutant aptamer are circled.
Figure 7. Dimerization of RNA aptamers using a DNA scaffold. RNA aptamers were dimerized by heating the aptamer and annealing it to a DNA scaffold at a 1 :1 ratio of binding sites. The resulting mixture of dimer (2 aptamer + scaffold) and monomer (1 aptamer + scaffold) were PAGE purified using an 8% native polyacrylamide gel. The identity of gel-eluted dimers was verified by running the dimerized RNA on a PAGE gel and visualizing with ethidium bromide staining.
Figure 8. Secretion of the cytokine TNFoc is not induced upon RAPTER- mediated OX40 activation but is enhanced upon toll like receptor activation through CpG oligonucleotides. To rule out that the observed in vitro effects on T-
cells could stem from toll like receptor activation, the concentration of the cytokine TNFα in the supernatants of treated DCs was evaluated. To this end, bone marrow derived DCs were generated. After 6 days of culture in the presence of IL4 and GMCSF, 66 nM aptamer dimer, point mutant aptamer dimer, 1 μM CpG or 20μg/mL polyI:C were added to the cells. After overnight culture, supernatants were harvested. The concentration of TNFα in these supernatants was determined using the OptEIA mouse TNFα ELISA kit (BD biosciences); n=3, error bars represent SEM; # n.s.
Figure 9. Overview of SELEX round.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides nucleic acid ligands (e.g., aptamers) engineered to stimulate a target molecule (e.g., receptor or enzyme), preferably, the immune coreceptor, OX40. The aptamers of the invention are well tolerated, exhibit low or no immunogenicity, and are thus suitable for repeated administration as therapeutic compounds (Floege et al, Am J Pathol 154:169-179 (1999), Ostendorf et al, J Clin Invest 104:913-923 (1999), Griffin et al, Blood 81:3271-3276 (1993), Hicke et al, J Clin Invest 106:923-928 (2000)). Properties of the instant aptamers are superior to those of antibodies.
Aptamers of the invention can be generated by in vitro screening of complex nucleic-acid based combinatorial shape libraries (e.g., >1014 shapes per library) employing a process termed SELEX (for Systematic Evolution of Ligands by Exponential Enrichment) (Tuerk et al, Science 249:505-10 (1990), USPs 5,270,163, 5,817,785, 5,595,887, 5,496,938, 5,475,096, 5,861,254, 5,958,691, 5,962,219, 6,013,443, 6,030,776, 6,083,696, 6,110,900, 6,127,119, 6,147,204 and WO 91/19813). (See also Fig. 9.) The SELEX process consists of
iterative rounds of affinity purification and amplification and yields high affinity (e.g., IpM to l μM, preferably, less than 1OnM) and high specificity ligands that modulate (e.g., stimulate/activate) the function of their target (e.g., OX40). Combinatorial libraries employed can be front-loaded with, for example, 2'modified RNA nucleotides (e.g., 2'fluoro-pyrimidines) such that the aptamers generated are highly resistant to nucl ease-mediated degradation and amenable to immediate activity screening in cell culture or bodily fluids. Simple chemical modifications of the aptamer or conjugation of the aptamer to a high molecular weight inert carrier molecule (e.g., PEG) can increase circulating half-life substantially (Willis et al, Bioconjug Chem 9:573-582 (1998), Tucker et al, J Chromatogr Biomed Sci Appl 732:203-212 (1999), Watson et al, Antisense Nucleic Acid Drug Dev 10:63-75 (2000)). Bioactive and nuclease resistant single-stranded nucleic acid ligands comprising L-nucleotides have been described (Williams et al, Proc. Natl. Acad. Sci. 94:11285 (1997); USP 5,780,221). These "L-aptamers" are reportedly stable under conditions in which aptamers comprising nucleotides of natural strandedness (D-nucleotides) (that is, "D-aptamers") are subject to degradation.
The aptamers of the invention can be monomelic but are preferably multimerized using any of a variety of approaches, including multimerization on solid supports (e.g. beads or nanoparticles) or via annealing to a complementary oligonucleotide that comprises a repeat of the complementary sequence to, for example, the 3' region of the aptamers (advantageously, separated by a carbon spacer (for example, a 5-50 carbon spacer, preferably, 16-20 carbon spacer, more preferably an 18 carbon spacer)), as described in the Example that follows. Various synthetic schemes can also be used to generate aptamer multimers (see, for example, Ringquist et al, Cytometry 33:394-405 (1998), Shchepinov et al, Nucleic Acids Res 25:4447-4454 (1997), Beier et al, Nucleic Acids Res 27:1970- 1977 (1999), Davis et al, Nucleic Acids Res 26:3915-3924 (1998), Crothers et al,
Immunochemistry 9:341-357 (1972), Kaufman et al, Cancer Res 52:4157-4167 (1992)).
Aptamers of the invention, capable of activating/stimulating target molecules (e.g., OX40), can be used in lieu of stimulatory antibodies and recombinant proteins in a variety of therapeutic settings. The aptamers can be safely repeatedly administered without eliciting compound-specific antibodies (Macugen Study Group, Ophthalmology 114:1702-1712 (2007)) as is the case with therapeutic antibodies developed in animal hosts. This is particularly important for treatment of patients with chronic diseases. OX40 is a therapeutic target for cancer immunotherapy and various autoimmune diseases (including diabetes, asthma, and autoimmune encephalitis) and the aptamers (e.g., multimerized (preferably, dimerized or trimerized)) described herein are capable of enhancing tumor immune responses. Administration of an effective amount of same can be used, for example, to inhibit tumor growth in a human or non-human animal in need of such therapy. Agonistic aptamers of the invention can also be used as vaccine adjuvants in the context of, for example, viral vaccines and cancer vaccines.
The aptamers of this invention can be formulated into compositions (e.g., sterile compositions suitable for injection) using methods well known in the art. Appropriate carriers can be selected depending, for example, on the aptamer and route of administration (e.g., IV, IP, IM or SC). Optimum dosing regimens can be readily established by one skilled in the art and can vary, for example, with the aptamer, the patient and the effect sought. By way of example, doses in the range of 1 μg/kg to 1 OOmg/kg can be used, preferably, 0.1 mg/kg to 10 mg/kg. The Example that follows describes the isolation of RNA aptamers capable of binding OX40 (e.g., the extracellular domain thereof) with high specificity and affinity, the multimerization (e.g. dimerization) of these high affinity aptamers which enables them to crosslink OX40 and results in the
protein's activation, and the functional characterization of the generated multimers, specifically their capacity to enhance T cell proliferation and function. While the invention is described below with specific reference to murine systems, it will be appreciated that the invention includes aptamers suitable for use in targeting human OX40.
To optimize the activity of a particular aptamer agonist, a variety of approaches, such as changing the length of the carbon spacer connecting the dimerized aptamers, can be used. Such modification has the potential, for example, to enhance the aptamers' ability to crosslink two OX40 receptor monomers and induce signaling. Moreover, solution of the crystal structure of the OX40-OX40 Ligand complex has revealed that the receptor and ligand appear to interact as two trimers (Compaan et al, Structure 14:1321 (2006). Thus, trimerization of the aptamers may yield an even more effective agonist.
The safety of agonist aptamers of the invention is enhanced through the fact that target-specific side effects can be controlled through the use of specific antidotes (e.g., oligonucleotide antidotes (e.g., targeted to single-stranded structures of the aptamer (e.g., loops or bulges)) and antidotes described in US Prov. Appln. 60/920,807) (see also Example below). It will be appreciated from a reading of this disclosure that oligonucleotide antidotes can be stabilized in the same manner as aptamers. Antidotes can provide physicians additional control over an aptamer' s activity if patient safety becomes a concern. For example, in the case of OX40 agonistic aptamers, antidotes can be used in the event of over activation of the immune system (e.g., cytokine storm) which can result in global inflammation, autoimmune disease being a potential long term effect. The ability to rapidly control the activity of, for example, therapeutic receptor agonists via antidote administration is challenging since limiting signaling after it has initiated can be difficult. Nonetheless, the ability to limit additional "unsafe" activation of a receptor improves patient safety. While optimum dosing regimens can vary
with, for example, the antidote, the aptamer targeted, the route of administration (e.g., IV), the patient and the effect sought, it is preferable that the ratio of antidote/aptamer administered be in the range of 1 : 1 to 100: 1. Aptamer-antidote pairs represent a broadly applicable strategy that can be useful to improve the safety of therapeutic agonists.
Certain aspects of the invention can be described in greater detail in the non-limiting Example that follows. This application is related to U.S. Provisional Application Nos. 60/716,976 and 60/852,705, the entire contents of which are incorporated herein by reference. The entire contents of U.S. Published Applications 20030083294, 20030175703 and 20060246123 and of
PCT/US06/36090 is also incorporated herein by reference. The entire content of PCT/US2007/022357 is also incorporated herein by reference.
EXAMPLE
EXPERIMENTAL DETAILS Aptamer isolation using the SELEX method
2' Fluoro pyrimidine RNA aptamers specific to the extracellular portion of murine OX40 were isolated using the SELEX method (Fitzwater et al, Methods Enzymol. 267:275 (1996), Tuerk et al, Science 249:505 (1990)). A 80 nucleotide combinatorial RNA library was created by transcription of a partially randomized DNA oligonucleotide
(5'GGGGAATTCTAATACGACTCACTATAGGGAGGACGATGCGG N40 CAGACGACTCGCTGAGGATCCGAGA3') as described (Layzer et al, Oligonucleotides 17:1 (2007)). This library was subjected to two "preclearing" steps to remove RNAs specific to human IgG Fc as well as protein G. To this end, the randomized RNA library was incubated with 1 nmol of human IgGl (Sigma) at 37°C for 30 minutes. IgG-bound RNA was removed by centrifugation over a
0.4 micron nitrocellulose Centrex column (Whatman). The preclearing step was subsequently followed by incubation with magnetic protein G coated beads (Dynal). After bead pelleting through exposure to a magnet, the supernatant was applied to a nitrocellulose Centrex column (Whatman). All binding reactions were carried out in 15OmM NaCl, 2mM CaCl2, 2OmM Hepes (pH 7.4), 0.01% BSA buffer.
To enrich for OX40 binding RNAs, murine OX40 human IgG Fc fusion protein (R&D systems) was immobilized by coupling to protein G coated magnetic beads (Dynal) according to manufacturers instructions. The bead coupled OX40 fusion protein was incubated with the "precleared" RNA pool and washed three times with a 20 fold excess volume wash buffer (15OmM NaCl, 2mM CaC12, 2OmM Hepes (pH 7.4)) to remove non-interacting RNA. RNA bound to OX40 was extracted by a 30 minute incubation in phenol: chloroform: isoamyl alcohol (25:24:1). The RNA was amplified by reverse transcription followed by PCR.
A secondary, enriched RNA pool was created with transcription using a 2'OH purine, 2'F pyrimidine nucleotide mixture using T7 polymerase. Transcripts were gel purified and eluted into TE, pH 7.5 (10 mM Tris pH 7.5, 0.ImM EDTA). Following overnight elution, RNA was washed three times in TE, pH 7.5 using Centricon 30 columns (Millipore).
Eleven rounds of selection were performed with increasing stringency throughout the selection process by increasing the RNA: Protein ratio in the selection reaction. Aptamers from rounds 9 and 11 DNA were cloned into the EcoRI/ BamHI (New England Biolabs) sites in a pUC18 plasmid. Single colonies were sequenced and amplified by low cycle PCR amplification following by in vitro transcription (Layzer et al, Oligonucleotides 17:1 (2007)).
Monomeric aptamer binding affinity
Binding constants were determined using filter binding assays (Wong et al, Proc. Natl. Acad. Sci. USA 90:5428 (1993)) in buffer composed of 2OmM Hepes pH 7.4, 15OmM NaCl, 2mM CaC12. To determine the affinities of monomeric aptamers, serial dilutions of murine OX40 IgG Fc fusion protein
(R&D systems), human IgGl (Sigma) or protein G (Zymed) were incubated with monomeric 5' 32P radiolabeled aptamers at 2000 cpm/μL (Fitzwater et al, Methods Enzymol. 267:275 (1996)). The mixture was passed over a stack of membranes consisting of a Protran nitrocellulose and GeneScreen Plus nylon membrane through application of a vacuum. The membranes were exposed to a phosphoimager screen, scanned and quantitated using a Molecular Dynamics Storm 840 phosphoimager. Finally, differential fractions of RNA bound were calculated and graphed using Prism.
Aptamer structure prediction
The predicted secondary structure of generated aptamers was determined by utilizing the algorithm m-fold
(http://bioweb.pasteur.fr/seqanal/interfaces/mfold.html) using default settings for folding parameters.
Generation of point mutant aptamer
The point mutant RNA aptamer was generated by in vitro transcription of
DNA template produced by annealing two oligonucleotides. One nmole of each oligonucleotide (5 ' GGGGGAATTCTAATACGACTCACTATAGGGAGGACGATGCGGCAGT
CTGCATCGTAGGAATCGC 3' and
5'TCTCGGATCCTCAGCGAGTCGTCTGGTGGGAAAGCGTACGGTGGCG
ATTCCTACGATGCAGACTG 3') were heated to 95°C for 5 minutes and
annealed by cooling to 4°C. A double stranded DNA transcription template was created using treatment with Exo-Klenow fragment (New England Biolabs). The reaction was stopped by the additon of 2mM EDTA followed by phenol: chloroform and chloroform extraction. The template was purified by triplicate washing using a centricon 30 column and 10 mM Tris pH 7.5, O.lmM EDTA buffer. 2 'F modified point mutant RNA aptamer was generated through in vitro transcription using T7 polymerase.
Transfection of mammalian cell lines Chinese hamster ovary (CHO) cells were cultured in Dulbecco's Modified
Eagle's Medium (DMEM)/10% Fetal Calf Serum (Gibco). OX40 mRNA was generated by in vitro transcription of a Spel digested OX40 plasmid using mMessagemMachine T7 kit (Ambion). Generated RNA was purified using RNeasy kit (Qiagen) according to manufacturers instruction. CHO cells were harvested by trypzination followed by washing in phosphate buffered saline (Gibco). Cells were counted in the presence of tryphan blue, pelleted by centrifugation and resuspended in Opti-MEM media (Gibco) before transfection via electroporation. Briefly, 4μg of OX40 RNA per one million cells were used to transfect 6 million cells by pulsing at 300V for 500μs. Following electroporation, cells were grown for 24 hours at 37°C, 5% CO2 in a humidified incubator in DMEM (Gibco) containing 10% fetal bovine serum (HyClone).
Aptamer cell staining
Cells were stained using a modified published protocol (Davis et al, Nucleic Acids Res. 26:3915 (1998)). In short, a 20mer complimentary fluorescently modified DNA oligonucleotide (Operon) (5' FITC TCTCGGATCCTCAGCGAGT 3') was heated and annealed to RNA aptamers at
a 1 : 1 molar ratio at 650C for 5 minutes and cooling to room temperature. Retention of binding affinity upon complement oligonucleotide binding was demonstrated by filter binding to recombinant OX40 (R&D systems).
Fluorescently labeled aptamers were incubated with 105 mock- or OX40-transfected CHO cells for 20 minutes in PBS 0.1 % BSA, 1 OmM MgCl2 at room temperature and washed as described above before analysis by flow cytometry.
Aptamer dimeήzation A DNA scaffold consisting of a 20 nucleotide repeat of the complementary sequence of 3' fixed region of the aptamer separated by an 18 carbon spacer (Operon) (5' TCTCGGATCCTCAGCGAGT carbon spacer TCTCGGATCCTCAGCGAGT 3') was used to dimerize RNA aptamers. RNA aptamers were mixed with this scaffold at a 2:1 molar ratio of RNA to scaffold. The mixture was heated to 95°C for 5 minutes followed by slow cooling to room temperature.
For binding affinity determination, aptamer dimers were purified using 8% native PAGE purification followed by overnight elution into 2mL of TE, pH 7.5 buffer at 4°C followed by extensive washing as described above.
Quantification ofdimer aptamer binding affinity
Radioactive labelling of monomelic RNA normally involves a dephosphorylation step at 65°C using bacterial alkaline phosphatase (Invitrogen) followed by radioactive labeling using T4 kinase and 32P gamma labeled ATP. However, gel purified RNA dimers are heat labile and, therefore, could not be heated to 65°C. Therefore, dimers were 3' radiolabeled by incubation with T4 RNA ligase (Ambion) according to manufacturer's instructions at 4°C. This
method leads to a lower incorporation efficiency but has the advantage of avoiding exposure of the dimer to heat. Binding affinities were determined as described for the aptamer monomer.
Proliferation assay
Activation of OX40 leads to increased T cell proliferation (AIi et al, Vaccine 22:3585 (2994)). Therefore, the effect of the dimerized aptamers on activation of OX40 was tested, as was the consequent increase in lymph node cell proliferation. 50μg of Staphyloccocal enterotoxin B (Sigma) resuspended in PBS (Gibco) was administered to female Balb/c mice intraperitoneally. Auxiliary, inguinal and mesenteric lymph nodes were harvested after 24 hours. Cells were teased into single cell suspension and labelled with carboxyfluoroscein succinimidyl ester (CFSE/ Pierce) by incubating cells at a concentration of 1 million cells/mL in PBS (Gibco) containing 5% fetal bovine serum (HyClone) and 2mM CFSE at room temperature for 5 minutes. Cells were washed twice using phosphate buffered saline with 5% fetal bovine serum followed by a final wash with RPMI containing 10% fetal bovine serum.
105 cells were seeded in wells of a round bottom 96 well plate (Corning) and were cultured for 72 hours in complete RPMI (Gibco) containing 10% fetal bovine serum (HyClone) in the presence of 0.5ng/mL Staphyloccocal enterotoxin B in a humidified chamber at 37°C/ 5% CO2. Experimental groups also included 33nM OX40 agonistic antibody (OX86), isotype control (ebiosciences), 66nM of aptamer dimer or point mutant aptamer dimer. Groups were set up in five replicates and pooled for analysis. Cell proliferation data was collected using flow cytometry using a FACScalibur and evaluated using CellQuest software (Becton Dickson).
Determination of IFN γ concentration in tissue culture supernatants
Supernatants of proliferation assay replicates were pooled after 72 hours of culture. Interferon γ secretion was measured in triplicate using the Ready Set Go Elisa kit (ebiosciences) following manufacturer's instructions.
Nuclear NFKB detection
NFKB is translocated to the nucleus as a result of OX40 signaling. As a measure of OX40 activation, a determination was made of the presence of nuclear NFKB in murine lymph node cells incubated with the aptamer or point mutant dimer compared to the agonisitic OX40 antibody. Mice were injected with Staphylococcal enterotoxin B and lymph nodes harvested as described in the proliferation assay. Cells were teased into single cell suspension and 105 cells per 96 well plate well were seeded in complete RPMI containing 0.5ng/mL staphylococcal enterotoxin B. Aptamer dimers or antibodies were added at a concentration of 66 nM. After 72 hour culturing, cells were pelleted and nuclei were isolated using to the Sigma CelLytic NuCLEAR Extraction kit according to manufacturer's instructions for hypotonic nuclear isolation (Mi et al, Nucleic Acids Res. 34:3577 (2006)). The absorbance of the generated protein fractions at A280 was determined. Equivalent amounts of protein were loaded onto a 4-15% denaturing PAGE gel (Biorad) and transferred to a polyvinylidene difluoride (PDVF) membrane by electroblotting. NFKB was detected using a specific primary antibody (Santa Cruz) followed by incubation with a horseradish peroxidase labeled secondary antibody (goat anti rabbit Santa Cruz). Protein was visualized using the ECL plus chemiluminescence detection kit (GE Amersham) and captured through exposure to film. Antibodies were removed from the membranes by a 15-minute incubation with Restore Western Blotting Stripping Buffer (Pierce). Successful stripping was verified by treatment with chemiluminescence reagents and exposure to film. The nuclear protein loading
control beta tubulin was detected through incubation with a primary followed by a secondary HRP conjugated antibody.
Murine bone marrow precursor-derived DC Marrow from tibias and femurs of C57BL/6 mice were harvested followed by treatment of the precursors with ammonium chloride Tris buffer for 3 min at 370C to deplete the red blood cells. The precursors were plated in RPMI with 5% FCS and GM-CSF (15 ng/ml) and IL-4 (10 ng/ml). GM-CSF and IL-4 were obtained from Peprotech (Rocky Hill, NJ). Cells were plated at 106/ml and incubated at 37°C and 5% CO2. Three days later, the floating cells (mostly granulocytes) were removed and the adherent cells replenished with fresh GM- CSF and IL-4 containing medium. Four days later, the non-adherent cells were harvested, washed and electroporated with RNA.
Electroporating murine DC with RNA.
DC were harvested on day 7, washed and gently resuspended in Opti- MEM (GIBCO, Grand Island, NY) at 2.5 x 107/ ml. The used DC culture media was saved as conditioned media for later use. Cells were electroporated in 2 mm cuvettes (200 μl of DC (5 x 106 cells) at 300 V for 500 μs using an Electro Square Porator ECM 830, BTX, San Diego, CA). The amount of TRP-2 or actin RNA used was 3 μg, per 1 O^ DC. Cells were immediately transferred to 6-well plates containing a 1 : 1 combination of conditioned DC growth media and fresh RPMI with GMCSF and IL4. Transfected cells were incubated at 37°C, 5% CO2 for 4h in the presence of 100 ng/ml LPS (Sigma product # L265L, E.coli 026:B6), washed two times in PBS and then injected into mice.
Demonstration ofaptamer antidote function
Antidote mediated inhibition of aptamer monomer binding to murine OX40 was demonstrated by filter binding. One of 5 different DNA oligonucleotides complementary to a portion of the aptamer (Antidote 1 : 5' GATTC CTACG ATGCA GACTG 3 ' , Antidote 2: 5' GTGGC GATTC CTACG ATGCA 3', Antidote 3: 5' ATACG GTGGC GATTC CTACG 3', Antidote 4: 5' AAAGT ATACG GTGGC GATTC 3', and Antidote 5: 5' GTGGG AAAGT ATACG GTGGC 3') were added to the included radiolabeled aptamer to a final concentration of 1 μM before addition to serially diluted murine OX40 IgG Fc fusion protein (R&D systems). Fractions of aptamer bound to OX40 were determined by differential filter binding and calculated as above.
Reversal ofOX40 RAPTER binding
To determine if the antidote was also capable of reversing OX40 RAPTER binding, 40nmoles of murine OX40 IgG Fc fusion protein were incubated with
5nmoles of cold RAPTER as well as trace amounts of 3' end radiolab led aptamer 9.8 RAPTER. After a brief incubation at 370C, increasing amounts of a
2'OMethyl modified RNA version of antidote 4 (5'
AAAGUAUACGGUGGCGAUUC 3') or scramble control were added to this mixture. The mixture was incubated at 370C for 45 minutes before determining the binding affinities by differential filter binding analysis.
Timecourse of antidote mediated RAPTER inhibition
To address the time dependency of antidote mediated reversal, 40nmoles of murine OX40 fusion protein were incubated with 5nmoles of OX40 RAPTER in the presence of trace amounts of 3 'end radiolabeled aptamer dimmer. A 25 fold excess of antidote over RAPTER was added to this mixture and it was
incubated for the indicated time frames. Reversal of RAPTER binding was assessed through the use of differential filter binding.
Assessment of in vitro antidote function The effect of antidote addition to the OX40 RAPTER on OX40 activation was determined by adding a 25 fold excess of antidote 4 over the aptamer in the proliferation assay setting. The effect on IFNγ secretion was determined after 72 hours of culture by ELISA.
Statistical analysis
Statistical analysis was performed using the graphing software Prism. Two-tailed, nonparametric t-tests were carried out using the default parameters. Statistical analysis of in vivo data was completed using the logrank (Mantel- Haenszel test). Confidence intervals equal to or less than 0.05 were considered to constitute statistical significance.
RESULTS
To determine if RNA aptamers can be developed as OX40 agonists, a large library of 2'flouro-modifϊed RNA molecules was screened using SELEX for those RNAs that bound to the extracellular domain of OX40 with high affinity (Tuerk et al, Science 249:505 (1990), Irvine et al, J. MoI. Biol. 222:739 (1991)). As shown in Figs. IA and 5, this process yielded a number of RNA aptamers that bound OX40 with high affinity (kos 8-625nM) and specificity. Aptamer 9.8 was chosen for further study since it had the highest affinity for the purified extracellular domain of OX40. In addition, a mutant version of the aptamer, termed Point Mutant 9.8, was created containing two point mutations rendering it unable to bind OX40 (Figs. IA, 1C and 6). To determine if aptamer 9.8 is able to bind OX40 expressed on the surface of cells, flow cytometry analysis was
performed using a fluorescently labeled aptamer (Davis et al, Nucleic Acids Res. 26:3915 (1998)). As shown in Fig. IB, aptamer 9.8 also binds the full length OX40 receptor. Unfortunately, this monomelic version of the 9.8 aptamer is unable to stimulate OX40 (data not shown). In an attempt to convey OX40 agonistic activity to aptamer 9.8, a consideration was made of characteristics of known OX40 agonists. Agonists known to functionally activate the OX40 receptor include antibody formulations (al-Shamkhani et al, Eur. J. Immunol. 26:1695 (2996)) and multimerized versions (dimerized/trimerized (Morris et al, MoI. Immunol. 44:3112 (2007)) of OX40's natural ligand (OX40 Ligand). These proteins share the common feature of possessing multiple binding sites for OX40. They have the capacity to crosslink receptor subunits, leading to signal transduction. Therefore, an effort was made to mimic this feature and a dimeric version of aptamer 9.8 was created using an oligonucleotide scaffold (Fig. 7). Importantly, the aptamer dimer retains its high affinity binding for the OX40 protein (Fig.1C).
OX40 activation is known to serve as costimulatory signal and enhance T cell proliferation (AIi et al, Vaccine 22:3585 (2004)), induce cytokine secretion (Kawamata et al, J. Biol. Chem. 273:5808 (1998)) and initiate T cell signaling events (Aggarwal, Nat. Rev. Immunol. 3:745 (2003)). It was next determined whether the dimeric version of aptamer 9.8 could elicit these effects. To this end, cells from lymph nodes from mice primed with Staphylococcal enterotoxin B (SEB) were isolated and subsequently labeled the cells with Carboxy Fluorescein Succinimidyl Ester (CFSE) (AIi et al, Vaccine 22:3585 (2004)). As shown in Figs. 2A and 2B, treatment of the cells with either the aptamer 9.8 dimer or an agonisitic OX40 antibody (OX86) (al-Shamkhani et al, Eur. J. Immunol. 26:1695 (2996)) in the presence of SEB led to an increase in cell proliferation whereas the 9.8 point mutant aptamer dimer and an isotype control antibody had no effect. The increase in proliferation engendered by the aptamer and antibody is
statistically significant compared to the respective control, as indicated in Fig. 2B (p<0.05). However, the percent proliferation induced by the agonisitic antibody is not significantly different from the percentage induced by OX40 activation using the dimerized aptamer (p>0.05). Activation of the OX40 receptor leads to the induction of IFNγ secretion (Aggarwal, Nat. Rev. Immunol. 3:745 (2003),
(Kawamata et al, J. Biol. Chem. 273:5808 (1998)). Therefore, the levels of IFNγ secreted from aptamer treated lymph node cells were evaluated in an ELISA assay. As shown in Fig. 2C, treatment with the OX40 agonistic antibody resulted in a significant increase in IFNγ production. Similarly, addition of the aptamer 9.8 dimer also resulted in a dramatic increase in the production of this cytokine. By contrast, the aptamer 9.8 dimer did not induce TNFα expression, indicating that the effect was not mediated by toll like receptors (Fig. 8). Finally, since activation of OX40 is known to result in the increased nuclear translocation of NFKB (Aggarwal, Nat. Rev. Immunol. 3:745 (2003), Arch et al, MoI. Cell Biol. 18:558 (1998)), western blot analysis was performed on nuclear fractions isolated from T cells treated with the aptamer 9.8 dimer and agonistic antibody (Mi et al, Nucleic Acids Res. 34:3577 (2006)). As shown in Fig. 2D, treatment with either the aptamer dimer or the antibody resulted in the NFKB nuclear localization as would be expected following OX40 activation. Once again, treatment with the point mutant aptamer had no effect. Collectively, these results indicate that the dimeric version of aptamer 9.8 is able to activate the OX40 receptor on primed T cells in culture.
To determine if the OX40 Receptor Activating aPTamER (RAPTER) can also act as an agonist in vivo, the aptamers' ability to induce OX40 function was evaluated in a tumor immunotherapy setting. More precisely, the RAPTER' s ability to enhance antitumor responses generated by dendritic cells (DC) transfected with tumor antigen was evaluated (Nair et al, Expert Rev. Vaccines
1 :507 (2002)). Female C57/BL6 mice were implanted with B16-F10.9 melanoma tumor cells and vaccinated with DCs pulsed with either the melanoma antigen tyrosinase-related protein 2 (TRP-2) or actin (control) mRNA. This vaccine was administered in the presence of OX40 RAPTER, mutant OX40 RAPTER, OX40 agonistic antibody or an isotype control antibody (Nair et al, Cancer Res. 67:371 (2007)). As shown in Fig. 3, administration of DCs containing the TRP-2 antigen alone delayed the development of a palpable tumor compared to control antigen treated animals but did not lead to a cure in mice. However, administration of either the OX40 RAPTER or the OX40 agonistic antibody to animals receiving the DC-TRP-2 vaccination resulted in tumor eradication in 30-40% of the animals. DC-TRP-2 based immunotherapy was significantly enhanced through the addition of OX40 RAPTER or antibody (DC-TRP-2 + control Ab versus DC- TRP-2 + OX40 Ab, p< 0.05 and DC-TRP-2 + control aptamer versus DC-TRP-2 + OX40 aptamer, p< 0.05). Therefore, as with an OX40 agonistic antibody, the OX40 RAPTER is a potent adjuvant for a DC-based tumor vaccine in vivo.
As mentioned above, one emerging clinical concern about the use of immunostimulatory antibodies is the difficulty to control their activity largely because it is extremely challenging to develop antidotes for such protein-based receptor agonists. To determine if an antidote can be created to modulate OX40 RAPTER activity, five DNA oligonucleotides were designed that could potentially bind to the OX40 RAPTER via base pairing (Fig. 4A) and they were screened them for their ability to block aptamer 9.8's ability to bind the purified OX40 protein. As shown in Fig. 4B, several of these antidote oligonucleotides are able to inhibit aptamer 9.8 binding to OX40. Antidote oligonucleotide 4 was chosen for further study and a 2'OMethyl (2'OMe) modified version of it was created to stabilize the oligonucleotide in the presence of serum nucleases. As shown in Fig. 4C, this stabilized antidote can decrease dimeric OX40 RAPTER binding to OX40. To further characterize the nature of antidote function, an effort
was made to determine the timeframe needed for reversal of the aptamer protein interaction. Using a 25 fold excess of antidote, the antidote required between 30 and 45 minutes to dissociate half of the bound aptamer dimers from the dimeric OX40 IgG-Fc fusion protein (Fig. 4D). When taking into account that aptamer monomers are not able to induce OX40 function, the timeframe to completely dissociate the aptamer dimer from its protein target, overestimates the time necessary to reverse aptamer function, given that this will be achieved as soon as just one of the two possible dimer binding sites will be blocked. Therefore, the activity of the antidote in a biological assay was next evaluated. Finally, a determination was made as to whether the 2'OMe modified antidote oligonucleotide 4 could inhibit OX40 RAPTER-mediated activation of T cells. The ability of the antidote to reverse RAPTER-mediated induction of cytokine production from primed T cells was evaluated. As shown in Fig. 4E, addition of the 2'OMe modified antidote oligonucleotide 4 at 25 fold excess over aptamer totally reversed the ability of the OX40 RAPTER to induce IFNγ production over a 72 hour period. Thus, antidote addition resulted in blocking at least one of the OX40 RAPTER binding sites.
All documents and other information sources cited above are hereby incorporated in their entirety by reference.
Claims
1. An antidote for a nucleic acid aptamer that binds to a target molecule with high affinity, said aptamer stimulating activity of at least one transcription factor.
2. The antidote according to claim 1 wherein said target molecule is OX40.
3. The antidote according to claim 1 wherein said aptamer is a monomer.
4. The antidote according to claim 1 wherein said aptamer is a mul timer.
5. The antidote according to claim 1 wherein said aptamer is multimerized and is 9.8.
6. The antidote according to claim 1 wherein said antidote is an oligonucleotide.
7. The antidote according to claim 6 wherein said oligonucleotide binds to a single-stranded structure of said aptamer.
8. The antidote according to claim 7 wherein said single-stranded structure is a loop or bulge.
9. The antidote according to claim 6 wherein said antidote comprises the sequence AAAGTATACGGTGGCGATTC.
10. A composition comprising said antidote according to claim 1 and a carrier.
1 1. A method of controlling the stimulatory activity of an agonistic nucleic acid aptamer, wherein said aptamer binds to a cell surface receptor, comprising: i) contacting a cell surface receptor with said aptamer so that said aptamer binds said cell surface receptor with high affinity and stimulates the activity of said cell surface receptor, and ii) contacting said aptamer with an oligonucleotide antidote that binds to said aptamer and thereby controls said stimulatory activity of said aptamer, wherein said antidote is administered in an amount sufficient to control said aptamer stimulatory activity.
12. The method according to claim 1 1 wherein said cell surface receptor is an immune coreceptor.
13. The method according to claim 12 wherein said coreceptor is OX40.
14. The method according to claim 13 wherein said aptamer is 9.8.
15. The method according to claim 1 1 wherein said antidote is an oligonucleotide that binds to a singe-stranded structure of said aptamer.
16. The method according to claim 15 wherein said antidote oligonucleotide is modified by 2'0 methylation.
17. The method according to claim 15 wherein said antidote oligonucleotide comprises the sequence AAAGTATACGGTGGCGATTC.
18. The method according to claim 17 wherein said antidote oligonucleotide is modified by 2'0 methylation.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US97758907P | 2007-10-04 | 2007-10-04 | |
| US60/977,589 | 2007-10-04 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2009045545A2 true WO2009045545A2 (en) | 2009-04-09 |
| WO2009045545A3 WO2009045545A3 (en) | 2009-12-30 |
Family
ID=40526889
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2008/011531 Ceased WO2009045545A2 (en) | 2007-10-04 | 2008-10-06 | Antidotes for agonistic aptamers |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2009045545A2 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8389488B2 (en) | 2007-11-05 | 2013-03-05 | Isis Pharmaceuticals, Inc. | Antidotes to antisense compounds |
| WO2018175918A1 (en) * | 2017-03-23 | 2018-09-27 | Duke University | Antidote-mediated reversal of extracellular aptamer staining |
| US12312588B2 (en) | 2017-09-08 | 2025-05-27 | Duke University | Nucleolin-targeting aptamers and methods of using the same |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6288302B1 (en) * | 1992-11-04 | 2001-09-11 | National Science Council Of R.O.C. | Application of α-amylase gene promoter and signal sequence in the production of recombinant proteins in transgenic plants and transgenic plant seeds |
| DK2070939T3 (en) * | 2001-05-25 | 2014-06-23 | Univ Duke | Modulators of pharmacological agents |
| US20060246123A1 (en) * | 2003-03-12 | 2006-11-02 | Eli Gilboa | Oligonucleotide mimetics |
| US20060046253A1 (en) * | 2004-09-02 | 2006-03-02 | Suntory Limited | Method for analyzing genes of industrial yeasts |
-
2008
- 2008-10-06 WO PCT/US2008/011531 patent/WO2009045545A2/en not_active Ceased
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8389488B2 (en) | 2007-11-05 | 2013-03-05 | Isis Pharmaceuticals, Inc. | Antidotes to antisense compounds |
| WO2018175918A1 (en) * | 2017-03-23 | 2018-09-27 | Duke University | Antidote-mediated reversal of extracellular aptamer staining |
| JP2020514765A (en) * | 2017-03-23 | 2020-05-21 | デューク ユニバーシティ | Antidote-mediated release of extracellular aptamer staining |
| EP3601592A4 (en) * | 2017-03-23 | 2020-11-25 | Duke University | ANTIDOT-MEDIATED INVERSION OF EXTRACELLULAR APTAMER STAIN |
| US11634772B2 (en) | 2017-03-23 | 2023-04-25 | Duke University | Antidote-mediated reversal of extracellular aptamer staining |
| US12398425B2 (en) | 2017-03-23 | 2025-08-26 | Duke University | Antidote-mediated reversal of extracellular aptamer staining |
| US12312588B2 (en) | 2017-09-08 | 2025-05-27 | Duke University | Nucleolin-targeting aptamers and methods of using the same |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2009045545A3 (en) | 2009-12-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dollins et al. | Assembling OX40 aptamers on a molecular scaffold to create a receptor-activating aptamer | |
| JP4874801B2 (en) | Stabilized immunomodulatory oligonucleotide | |
| Reyes-Sandoval et al. | CpG methylation of a plasmid vector results in extended transgene product expression by circumventing induction of immune responses | |
| EP2901856B1 (en) | Immunostimulatory oligonucleotide multimers | |
| Coban et al. | Effect of plasmid backbone modification by different human CpG motifs on the immunogenicity of DNA vaccine vectors | |
| EP2152889B1 (en) | Vectors and methods for genetic immunization | |
| JP6118491B2 (en) | Methods for increasing immune response | |
| JP5805088B2 (en) | Compositions that inhibit gene expression and uses thereof | |
| JP2007500018A6 (en) | Stabilized immunomodulatory oligonucleotide | |
| Herzog et al. | Regulatory T cells and TLR9 activation shape antibody formation to a secreted transgene product in AAV muscle gene transfer | |
| AU2018245749A1 (en) | Stimulatory cell lines for ex vivo expansion and activation of natural killer cells | |
| US20250255947A1 (en) | Method for inducing a tolerogenic immune response | |
| AU2017322733A1 (en) | Genome edited primary B cell and methods of making and using | |
| WO2009045545A2 (en) | Antidotes for agonistic aptamers | |
| WO2008048685A2 (en) | Ox40 aptamers | |
| JP6385732B2 (en) | Immune response control agent | |
| KR20240005903A (en) | Non-viral DNA vectors for vaccine delivery | |
| Dollins | Novel applications of RNA aptamers for enhancement of immune responses | |
| WO2025158069A1 (en) | CONSTRUCT COMPRISING mRNA-STRAND AND RETINOIC ACID-INDUCIBLE GENE I (RIG-I)-LIGAND(S), PHARMACEUTICAL COMPOSITION AND KIT COMPRISING THE SAME | |
| JP2025509607A (en) | Heterologous prime-boost vaccine compositions and methods of use | |
| HK40043435A (en) | Bacterial strains expressing methylase genes and uses thereof | |
| CN103357009A (en) | Application of Hemokinin-1 in preparation of vaccine adjuvant | |
| Class et al. | Patent application title: BACTERIAL STRAINS EXPRESSING METHYLASE GENES AND USES THEREOF Inventors: Alan P. Escher (Redlands, CA, US) | |
| HK40025376B (en) | Double-stranded rna molecule targeting ckip-1 and use thereof | |
| HK1211179B (en) | Immunostimulatory oligonucleotide multimers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08835178 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 08835178 Country of ref document: EP Kind code of ref document: A2 |