WO2009043182A1 - Sequence-characterized amplified region (scar) markers for plant resistance against fungal pathogens - Google Patents
Sequence-characterized amplified region (scar) markers for plant resistance against fungal pathogens Download PDFInfo
- Publication number
- WO2009043182A1 WO2009043182A1 PCT/CA2008/001779 CA2008001779W WO2009043182A1 WO 2009043182 A1 WO2009043182 A1 WO 2009043182A1 CA 2008001779 W CA2008001779 W CA 2008001779W WO 2009043182 A1 WO2009043182 A1 WO 2009043182A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- nucleotide sequence
- seq
- set forth
- sequence set
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
- A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
- A01H5/10—Seeds
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
- A01H6/20—Brassicaceae, e.g. canola, broccoli or rucola
Definitions
- This invention relates to development of disease-resistant plant cultivars. More particularly, this invention relates to genetic markers and uses thereof for aiding the selection of disease-resistance progeny in breeding programs.
- Blackleg (Phoma stem canker) of rapeseed and canola ⁇ Brassica napus L.) is a disease with a worldwide distribution caused by a complex of fungal plant pathogens belonging to Leptosphaeria maculans (Desm.) Ces. & Not., anamorph Phoma lingam (Tode ex Fr.) Desm..
- Members of this species used to be divided into two pathotype groups, A and B also A and NA groups, or Tox + and Tox° groups
- characters such as virulence, RFLP markers, and secretion of the phytotoxin sirodesmin into culture media.
- Group A isolates are highly virulent and cause the damaging stem canker while B group isolates are weakly virulent (Rouxel et al., 2004, /N Plant Genome: Biodiversity and Evolution, vol. 2: Lower Groups, Sharma, A.K., and Sharma, A., Eds. Enf ⁇ eld: Science Publishers, Inc., pp.33-7547; Williams et al., 1999, Plant Pathol. 48:161-175.). Since group B isolates are morphologically different from and cannot sexually cross with group A isolates, they have been recently classified as a new species, L. biglobosa (Shoemaker et al., 2001, Can. J. Bot. 79:412- 419).
- Group A isolates are distributed worldwide and cause significant losses in Australia, Canada, and Europe (West et al., 2001, Plant Pathol. 50: 10-27). They have been subdivided into pathogenicity groups (PG) 2, 3, 4 and T according to differential disease reactions on a set of Brassica napus varieties (lines) with different resistance genes (Koch et al., 1991, MoI. Plant-Microbe Interact. 4:341-349; Rimmer, 2006, Can. J. Plant Pathol. 28:S288-S297). The subspecies structure of L. maculans is made even more complex by the fact that each of the four pathogenicity groups also comprises different races as revealed by analysis conducted with two differential sets (Balesent,et al., 2005, Phytopathology 95:1061-1071).
- L. maculans can infect various species under field and laboratory conditions.
- the host and the pathogen establish typical gene-for-gene interactions (Ferreira et al., 1995, Phytopathology 85:213-217; Pongam et al., 1998, Phytopathology 88: 1068-1072; Yu et al., 2005, Theor. Appl. Genet.
- the outcome of the host infection is dependent on the presence of a major resistance gene in the host and a corresponding avirulence gene in the pathogen (Ansan-Melayah et al., 1995, Phytopathology, 85: 1525-1529; Ansan-Melayah et al.,
- Resistance genes have been traced in various Brassica species such as B. juncea, B. napus, B. rapa, and B. nigra (14,40,50,52). Selection for blackleg resistance relies on cotyledon stage greenhouse and adult stage field resistance (43). Several authors have reported a significant correlation between resistance in cotyledons and adult plants (8,22,25,34,37). Loci controlling cotyledon resistance as well as field resistance against L. maculans have been mapped to the N7 linkage group of the A genome in various B. napus (16,18,32,33,41,44).
- the exemplary embodiments of the present invention are directed to isolated nucleotide sequences configured into a nucleic acid molecule that is complementary to the Rpg3Dun gene sequence, to methods for preparation of BN204, to nucleotide cassettes comprising BN204, to methods for preparing nucleotide cassettes comprising BN204, to kits comprising BN204 for using in Brassica progeny screening programs, and to screening methods for the use of BN204 to identify progeny individuals from Brassica breeding programs that contain therein putative gene sequence RpgiDun.
- a first SCAR marker complementary to the Rpg3Dun gene sequence said SCAR marker isolated from Brassica napus F 2 'Westar' and accessible with GenBank ® accession number EU 122190. According to one embodiment of the present inventions, there is disclosed a
- SCAR marker complementary to the Rpg3Dun gene sequence said SCAR marker isolated from Brassica napus 'Dunkeld' and accessible with GenBank accession number EU122191.
- BSA bulked segregant analysis
- SRAP sequence-related amplified polymorphisms.
- SCAR sequence-characterized amplified region nucleotide molecules useful as markers.
- Fig. 1 is chart showing the susceptability of selected Brassica napus and B. juncea cultivars to Leptosphaeria maculans pathogenicity groups PG2, PG3, and PG4. Disease rates for each cultivar are mean values from 12 seedlings.
- Fig. 2 is chart showing segregation of resistance in Brassica napus F 2 'Westar'
- the disease ratings for 'Glacier', 'Quinta', and the parents 'Westar' and 'Dunkeld' are mean values from 12 seedlings.
- Disease ratings for F 2 'Westar' x 'Dunkeld' progeny (F 2 WD) are average values from 94 susceptible progeny and 246 resistant ones;
- Fig. 3 is a picture of multiple DNA gel lanes showing segregation of SRAP markers linked to resistance against Leptosphaeria maculans in F 2 'Westar' x 'Dunkeld' progeny. Lanes 1-7: susceptible progeny, 7-14: resistant progeny. The four markers shown on the picture segregated within 92 F 2 'Westar' x 'Dunkeld' progeny in a ratio not significantly different from 3: 1. Markers BG 2 oSAi 2-48 o and BG 2 oSAi 2-475 were absent in all susceptible progeny (lanes 1-7) and present in all resistant ones (lanes 8-14). Markers BG 2 oSAi 2-465 and BG 2 oSAi 2-4 6o were present in 67 progeny, including all the 23 susceptible ones, and absent in the remaining 25 resistant ones, such as in lane 10;
- Fig. 4 is a picture of gel segregation of the SCAR marker BN204 linked to resistance against Leptosphaeria maculans PG3 in F2 Westar x Bisd progeny.
- M 100 bp ladder
- W 'Westar'
- D 'Dunkeld'
- 1-12 F 2 'Westar' x 'Dunkeld' progeny.
- 1-3 and 9 represent homozygote susceptible progeny, 4, 5, and 7 are homozygote resistant progeny, and 6, 8 as well as 10-12 are heterozygote resistant progeny;
- Fig. 5 is map showing the linkage group of 'Westar' x 'Dunkeld' population with marker loci linked to resistance gene against Leptosphaeria maculans PG3 from 'Dunkeld' (Rpg3Dun). Genetic distance values are expressed in cM units;
- Fig. 6 is a sequence listing for a first SCAR marker referred to herein as BN204A (SEQ ID NO: 1) complementary to the Rpg3Dun gene sequence and accessible with GenBank ® accession number EU122190; and
- Fig. 7 is a sequence listing for a second SCAR marker referred to herein as BN204B (SEQ ID NO: 2) complementary to the Rpg3Dun gene sequence and accessible with GenBank" accession number EU122191.
- the present invention is directed to a first nucleic acid molecule having the nucleotide sequence set forth in SEQ ID NO: 1 (Fig. 6) and named "BN204A", and a second nucleic acid molecule set forth in SEQ ID NO:2 (Fig. 7) and named "BN204B".
- BN204A and BN204B are configured to be complementary to a putative gene sequence "Rpg 3 Dun” occasionally present in Brassica cultivars, to methods for preparation of BN204A and BN204B, to nucleotide cassettes comprising at least one of BN204A and BN204B, to methods for preparing nucleotide cassettes comprising at least one of BN204A and BN204B, to screening methods for the use of at least one of BN204A and BN204B to identify progeny individuals from Brassica breeding programs that contain therein putative gene sequence RpgsDun, to kits comprising at least one of BN204A and BN204B for using in Brassica progeny screening programs.
- Rpg 3 Dun putative gene sequence
- cultivariered was used as a resistant parent in reciprocal crosses with the susceptible cultivar Westar. Fi progeny from a 'Westar' female parent were evaluated for cotyledon resistance and self-pollinated for the production of F 2 progeny. Segregation of resistance against blackleg caused by L. m ⁇ cul ⁇ ns PG3 in the F 2 generation was analyzed at the cotyledon stage, with 'Westar', 'Glacier', and 'Quinta' being included as references. Progeny that exhibited a severity rating of 5 or less on a 0-9 rating scale were considered resistant while those with a higher score were considered susceptible.
- Leaf and stem tissues from 340 F 2 progeny were collected, freeze dried, ground, and used for genomic DNA isolation with a salt buffer based extraction protocol (Aljanabi et al., 1997, Nucleic Acids Res. 25: 4692-4693).
- Bulked segregant analysis as described by Michelmore et al. (1991, Proc. Natl. Acad. Sci. USA 88:9828-9832), was used together with sequence-related amplified polymorphisms (SRAP) as described by Li et al., (2001, Theor. Appl. Genet. 103:455- 461), to search for markers polymorphic among the progeny and to identify those canola resistance against L.
- BG 16 /ODD3 SEQ ID NO: 3
- BGi 8 /ODD 20 SEQ ID NO: 4
- BG 20 /SA 12 SEQ ID NO: 5
- EM 2 /ME 2 SEQ ID NO: 7
- ME 2 /DCi SEQ ID NO: 8
- Na 12 A 02 FZNa 12 A 02 R SEQ ID NO: 9
- NA 12 D O 4F/NA 12 Do 4 R (SEQ ID NO: 11), Na 12 Fi 2 F/Nai 2 Fi 2 R (SEQ ID NO: 13), NGAiiiF/NGAi ⁇ R (SEQ ID NO: 15), PMl 11/ODD 3 (SEQ ID NO: 18).
- PCR amplification reactions were performed in a 13- ⁇ L reaction volume containing 15 ng template DNA, 0.4 ⁇ M for each of two primers, 0.75 units of Taq polymerase (Fisher brand), 100 mM Tris-HCl (pH 8.0), 500 mM KCl, 1.5 mM MgCl 2 , and 0.1 mM each of dNTPs.
- PCR amplification was ran in a programmable thermal controller (Eppendorf ® MasterCycler ® Gradient, Eppendorf Canada Ltd., Mississauga, ON. Canada; Eppendorf and MasterCycler are registered trademarks of Eppendorf AG, Hamburg, Fed. Rep. Germany). The first 5 cycles were run at 94 0 C for 1 min, 35°C for 50 sec, and 72 0 C for 1 min for denaturing, annealing and extension, respectively. Then, the remainder of the amplification was 36 cycles at 94°C for 50 sec, 5O 0 C for 50 sec and 72 0 C for 1 min. PCR products were separated by electrophoresis using a denaturing 5% polyacrylamide gel containing 7.5M urea.
- PCR products were purified using the Qiaquick ® PCR purification kit (Qiaquick is a registered trademark of Qiagen GMBH Corp., Hilden Fed. Rep. Germany) according to the producer specifications (Qiagen Inc., Mississauga, ON. Canada).
- Genbank library sequence with a genomic region similar to our query was used to design new primers in order to develop sequence characterized amplified region (SCAR) markers linked to resistance in 'Dunkeld' against L. maculans PG3. These new primers were used to amplify genomic DNA from 'Westar' and 'Dunkeld'.
- SCAR sequence characterized amplified region
- the segregation of polymorphic markers was then analyzed with the 22-progeny sample set used for screening of SRAP primer combinations.
- Primer sets with markers that segregated as expected were used in analyzing the 92-progeny sample set for linkage mapping. The markers were later confirmed using the additional 248-progeny sample set.
- BSA Bulked segregant analysis
- Three additional SRAP markers including two from BG 2 o/SAi 2 and one from
- BGi 8 /ODD 2 o were located at 11.3 and 16.4 cM respectively each side of the core region with the resistance gene.
- RpgiDun a major gene known as RpgiDun is responsible for resistance in 'Dunkeld' against PG3 was supported by the resistance segregation ratio of 3:1 in F2 'Westar' x 'Dunkeld' progeny.
- Rpg ⁇ Dun is likely similar to the Rlm4 gene, which was previously suggested to be the major resistance gene in 'Dunkeld' (Rouxel et al., 2003, Euphytica 133:219- 231).
- Rlm4 has also been located in a cluster of four other tightly linked genes including Rlm3, Rlm7 and Rlm9 (Delourme, 2004, Phytopathology 94:578-583).
- maculans PG3 might be associated with a gene encoding protein kinase.
- the gene analysis revealed that it contains open reading frames producing different putative transcripts that could be alternatively expressed in different stress conditions (9, 36).
- the SCAR marker BN204 linked to Rpg3Dun resistance gene can be used in marker-assisted selection of canola resistance against blackleg caused by L. maculans PG3.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Environmental Sciences (AREA)
- Physiology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
An isolated nucleic acid molecule comprising one of a nucleotide sequence set forth in SEQ ID NO: 1 and a nucleotide sequence set forth in SEQ ID NO: 2, the nucleotide sequence complementary to a Rpg3Dun gene sequence. A method for screening a plurality of plant cultivars to identify individual cultivars containing Rpg3Dun gene sequences, comprising the steps of: (a) collecting a biomass sample from individual cultivars; (b) preparing a nucleic acid preparation from each biomass sample; (c) contacting each nucleic acid preparation with at least one of the nucleic acid molecules set forth in SEQ ID NO: 1 and SEQ ID NO: 2, (d) performing a PCR amplification reaction therein; and (e) assessing each amplified sample to detect hybridization with one of the nucleic acid molecules set forth in SEQ ID NO: 1 and SEQ ID NO: 2. A hybridization reaction indicates the cultivar contains therein Rpg3Dun gene sequences.
Description
SEQUENCE-CHARACTERIZED AMPLIFIED REGION (SCAR) MARKERS
FOR PLANT RESISTANCE AGAINST FUNGAL PATHOGENS
TECHNICAL FIELD
This invention relates to development of disease-resistant plant cultivars. More particularly, this invention relates to genetic markers and uses thereof for aiding the selection of disease-resistance progeny in breeding programs.
BACKGROUND OF THE INVENTION
Blackleg (Phoma stem canker) of rapeseed and canola {Brassica napus L.) is a disease with a worldwide distribution caused by a complex of fungal plant pathogens belonging to Leptosphaeria maculans (Desm.) Ces. & Not., anamorph Phoma lingam (Tode ex Fr.) Desm.. Members of this species used to be divided into two pathotype groups, A and B (also A and NA groups, or Tox+ and Tox° groups), based on characters such as virulence, RFLP markers, and secretion of the phytotoxin sirodesmin into culture media. Group A isolates are highly virulent and cause the damaging stem canker while B group isolates are weakly virulent (Rouxel et al., 2004, /N Plant Genome: Biodiversity and Evolution, vol. 2: Lower Groups, Sharma, A.K., and Sharma, A., Eds. Enfϊeld: Science Publishers, Inc., pp.33-7547; Williams et al., 1999, Plant Pathol. 48:161-175.). Since group B isolates are morphologically different from and cannot sexually cross with group A isolates, they have been recently classified as a new species, L. biglobosa (Shoemaker et al., 2001, Can. J. Bot. 79:412- 419). Group A isolates are distributed worldwide and cause significant losses in Australia, Canada, and Europe (West et al., 2001, Plant Pathol. 50: 10-27). They have been subdivided into pathogenicity groups (PG) 2, 3, 4 and T according to differential disease reactions on a set of Brassica napus varieties (lines) with different resistance genes (Koch et al., 1991, MoI. Plant-Microbe Interact. 4:341-349; Rimmer, 2006, Can. J. Plant Pathol. 28:S288-S297). The subspecies structure of L. maculans is made even more complex by the fact that each of the four pathogenicity groups also comprises different races as revealed by analysis conducted with two differential sets (Balesent,et al., 2005, Phytopathology 95:1061-1071).
Although restricted to the crucifers, L. maculans can infect various species under field and laboratory conditions. The host and the pathogen establish typical
gene-for-gene interactions (Ferreira et al., 1995, Phytopathology 85:213-217; Pongam et al., 1998, Phytopathology 88: 1068-1072; Yu et al., 2005, Theor. Appl. Genet.
110:969-979). The outcome of the host infection is dependent on the presence of a major resistance gene in the host and a corresponding avirulence gene in the pathogen (Ansan-Melayah et al., 1995, Phytopathology, 85: 1525-1529; Ansan-Melayah et al.,
1998, Plant Breed. 117:373-378; Balesdent et al., 2002, Phytopathology 92: 1122-
1133). Resistance genes have been traced in various Brassica species such as B. juncea, B. napus, B. rapa, and B. nigra (14,40,50,52). Selection for blackleg resistance relies on cotyledon stage greenhouse and adult stage field resistance (43). Several authors have reported a significant correlation between resistance in cotyledons and adult plants (8,22,25,34,37). Loci controlling cotyledon resistance as well as field resistance against L. maculans have been mapped to the N7 linkage group of the A genome in various B. napus (16,18,32,33,41,44). Molecular markers associated with Brassica resistance against blackleg caused by PG2 and useful for maker-assisted-selection have also been reported (Ananga, et al., 2006, Afr. J. Biotechnol. 5:2041-2048).
Blackleg of canola, which had been prevalent in the Canadian prairies for the last two decades, was caused by Z. maculans PG2 and is well controlled by resistance. In 2002 and 2004, PG3 and PG4 isolates of L. maculans were discovered in Manitoba (Chen et al., Plant Disease 89: 339; Fernando et al., 2003, Plant Disease 87:1268). Since then, PG3 and PG4 have been also found in Alberta, North Dakota (USA), and more regions in Manitoba (Chen et al., 2006, Can. J. Plant Pathol. 28:533-539). These new strains of L. maculans pose a serious threat to the Prairie canola industry because varieties currently grown are not resistant against them.
SUMMARY OF THE INVENTION
The exemplary embodiments of the present invention are directed to isolated nucleotide sequences configured into a nucleic acid molecule that is complementary to the Rpg3Dun gene sequence, to methods for preparation of BN204, to nucleotide cassettes comprising BN204, to methods for preparing nucleotide cassettes comprising BN204, to kits comprising BN204 for using in Brassica progeny screening programs, and to screening methods for the use of BN204 to identify progeny individuals from Brassica breeding programs that contain therein putative gene sequence RpgiDun.
According to one embodiment of the present inventions, there is disclosed a first SCAR marker complementary to the Rpg3Dun gene sequence, said SCAR marker isolated from Brassica napus F2 'Westar' and accessible with GenBank® accession number EU 122190. According to one embodiment of the present inventions, there is disclosed a
SCAR marker complementary to the Rpg3Dun gene sequence, said SCAR marker isolated from Brassica napus 'Dunkeld' and accessible with GenBank accession number EU122191.
For clarity, the term "BSA" as used herein refers to bulked segregant analysis.
The term "SRAP" as used herein refers to sequence-related amplified polymorphisms.
The term "SCAR" as used herein refers to sequence-characterized amplified region nucleotide molecules useful as markers.
BRIEF DESCRIPTION OF THE DRAWINGS The present invention will be described in conjunction with reference to the following drawings, in which:
Fig. 1 is chart showing the susceptability of selected Brassica napus and B. juncea cultivars to Leptosphaeria maculans pathogenicity groups PG2, PG3, and PG4. Disease rates for each cultivar are mean values from 12 seedlings.
Fig. 2 is chart showing segregation of resistance in Brassica napus F2 'Westar'
X 'Dunkeld' progeny against Leptosphaeria maculans PG3. The disease ratings for 'Glacier', 'Quinta', and the parents 'Westar' and 'Dunkeld' are mean values from 12 seedlings. Disease ratings for F2 'Westar' x 'Dunkeld' progeny (F2WD) are average values from 94 susceptible progeny and 246 resistant ones;
Fig. 3 is a picture of multiple DNA gel lanes showing segregation of SRAP markers linked to resistance against Leptosphaeria maculans in F2 'Westar' x 'Dunkeld' progeny. Lanes 1-7: susceptible progeny, 7-14: resistant progeny. The four markers shown on the picture segregated within 92 F2 'Westar' x 'Dunkeld' progeny in a ratio not significantly different from 3: 1. Markers BG2oSAi2-48o and BG2oSAi2-475 were absent in all susceptible progeny (lanes 1-7) and present in all resistant ones
(lanes 8-14). Markers BG2oSAi2-465 and BG2oSAi2-46o were present in 67 progeny, including all the 23 susceptible ones, and absent in the remaining 25 resistant ones, such as in lane 10;
Fig. 4 is a picture of gel segregation of the SCAR marker BN204 linked to resistance against Leptosphaeria maculans PG3 in F2 Westar x Dunkeld progeny. M: 100 bp ladder, W: 'Westar', D: 'Dunkeld', and 1-12: F2 'Westar' x 'Dunkeld' progeny. 1-3 and 9 represent homozygote susceptible progeny, 4, 5, and 7 are homozygote resistant progeny, and 6, 8 as well as 10-12 are heterozygote resistant progeny;
Fig. 5 is map showing the linkage group of 'Westar' x 'Dunkeld' population with marker loci linked to resistance gene against Leptosphaeria maculans PG3 from 'Dunkeld' (Rpg3Dun). Genetic distance values are expressed in cM units;
Fig. 6 is a sequence listing for a first SCAR marker referred to herein as BN204A (SEQ ID NO: 1) complementary to the Rpg3Dun gene sequence and accessible with GenBank® accession number EU122190; and
Fig. 7 is a sequence listing for a second SCAR marker referred to herein as BN204B (SEQ ID NO: 2) complementary to the Rpg3Dun gene sequence and accessible with GenBank" accession number EU122191.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is directed to a first nucleic acid molecule having the nucleotide sequence set forth in SEQ ID NO: 1 (Fig. 6) and named "BN204A", and a second nucleic acid molecule set forth in SEQ ID NO:2 (Fig. 7) and named "BN204B". BN204A and BN204B are configured to be complementary to a putative gene sequence "Rpg3Dun" occasionally present in Brassica cultivars, to methods for preparation of BN204A and BN204B, to nucleotide cassettes comprising at least one of BN204A and BN204B, to methods for preparing nucleotide cassettes comprising at least one of BN204A and BN204B, to screening methods for the use of at least one of BN204A and BN204B to identify progeny individuals from Brassica breeding programs that contain therein putative gene sequence RpgsDun, to kits comprising at least one of BN204A and BN204B for using in Brassica progeny screening programs.
We have determined that the presence of putative gene sequence RpgsDun, in the genome of a Brαssicα cultivar is highly associated with the cultivar's resistance to infection by L. mαculαns PG3. Because of the recent rapid spread of the occurrence of canola blackleg disease caused by L. mαculαns PG3, it is desirable to incorporate L. mαculαns PG3 -resistant cultivars comprising the putative gene sequence RpgsDun, into canola breeding programs. We have created SCAR markers exemplified by nucleic acid molecules BN204A and BN204B, and have determined that they are closely linked to the putative gene sequence RpgsDun, as disclosed in more detail below.
EXAMPLE 1
Search of sources of resistance. A growth chamber experiment repeated once was conducted with entries from the University of Manitoba Canola and Brαssicα Germplasm Bank to screen for resistance against isolates of L. mαculαns PG2, PG3, and PG4 using the cotyledon inoculation and symptom assessment procedures as previously described by Chen at al. (2006, Can. J. Plant Pathol. 28: 533-539) and and Williams (1985, Crucifer Genetic Cooperatives (CrGC) Resource Book. University of Wisconsin, Madison, WS, USA). Differential canola cultivars Westar, Glacier, and Quinta were used as references. Cultivars screened for resistance included B. nαpus 'Cresor', 'Dunkeld', 'Oscar', 'Rainbow', and 'Surpass 400', as well as B. junceα 'Cutlass' and 'Domo'.
Mapping populations. Based on results from the resistance-screening experiment, cultivar Dunkeld was used as a resistant parent in reciprocal crosses with the susceptible cultivar Westar. Fi progeny from a 'Westar' female parent were evaluated for cotyledon resistance and self-pollinated for the production of F2 progeny. Segregation of resistance against blackleg caused by L. mαculαns PG3 in the F2 generation was analyzed at the cotyledon stage, with 'Westar', 'Glacier', and 'Quinta' being included as references. Progeny that exhibited a severity rating of 5 or less on a 0-9 rating scale were considered resistant while those with a higher score were considered susceptible.
DNA isolation and SRAP assays. Leaf and stem tissues from 340 F2 progeny were collected, freeze dried, ground, and used for genomic DNA isolation with a salt buffer based extraction protocol (Aljanabi et al., 1997, Nucleic Acids Res. 25: 4692-4693). Bulked segregant analysis (BSA) as described by Michelmore et al. (1991, Proc. Natl.
Acad. Sci. USA 88:9828-9832), was used together with sequence-related amplified polymorphisms (SRAP) as described by Li et al., (2001, Theor. Appl. Genet. 103:455- 461), to search for markers polymorphic among the progeny and to identify those canola resistance against L. maculans PG3 from 'Dunkeld'. A 22-sample set of genomic DNA from 'Westar' and 'Dunkeld' parents, 10 susceptible progeny, andlO resistant progeny, along with 2 bulk samples, one from resistant and the other from susceptible progeny, were used for screening 180 primer combinations. Ten primer sets that had amplified markers that were polymorphic between parents and among the progeny samples were used to analyze marker segregation within a 92-progeny mapping population. These primer sets, listed in Table 1, are: BG16/ODD3 (SEQ ID NO: 3), BGi8/ODD20 (SEQ ID NO: 4), BG20/SA12 (SEQ ID NO: 5), EM2/ME2 (SEQ ID NO: 7), ME2/DCi (SEQ ID NO: 8), Na12A02FZNa12A02R (SEQ ID NO: 9), NA12DO4F/NA12Do4R (SEQ ID NO: 11), Na12Fi2F/Nai2Fi2R (SEQ ID NO: 13), NGAiiiF/NGAiπR (SEQ ID NO: 15), PMl 11/ODD3 (SEQ ID NO: 18). The segregation of 2 SRAP markers amplified by Nai2Ao2F/Na12Ao2R primer set that were linked to resistance from 'Dunkeld' was confirmed in an additional 248-progeny sample set. PCR amplification reactions were performed in a 13-μL reaction volume containing 15 ng template DNA, 0.4 μM for each of two primers, 0.75 units of Taq polymerase (Fisher brand), 100 mM Tris-HCl (pH 8.0), 500 mM KCl, 1.5 mM MgCl2, and 0.1 mM each of dNTPs. PCR amplification was ran in a programmable thermal controller (Eppendorf® MasterCycler® Gradient, Eppendorf Canada Ltd., Mississauga, ON. Canada; Eppendorf and MasterCycler are registered trademarks of Eppendorf AG, Hamburg, Fed. Rep. Germany). The first 5 cycles were run at 940C for 1 min, 35°C for 50 sec, and 720C for 1 min for denaturing, annealing and extension, respectively. Then, the remainder of the amplification was 36 cycles at 94°C for 50 sec, 5O0C for 50 sec and 720C for 1 min. PCR products were separated by electrophoresis using a denaturing 5% polyacrylamide gel containing 7.5M urea. Gels were then silver-stained with the Promega® kit (Promega Corp., Madison, WI, USA; Promega is a registered trademark of the Promega Corp.) according to the manufacturer's specifications. PCR assays were replicated once in order to confirm observed markers. The presence and absence of all fragments between molecular sizes of 50 and 500 base pairs (bp) were scored for each sample. Bands larger than 500bp or less than 50bp were not scored because of the insufficient resolution.
DNA sequencing and SCAR development. DNA bands of SRAP markers linked to resistance were collected from polyacrylamide gels, ground in 50 μL of TE and incubated overnight at 4°C in order to isolate DNA fragments. These fragments were used as template for PCR assays with the corresponding original SRAP primers. The PCR mixture composition used was similar to the one used in the SRAP assays except that cycling protocol was as follows: initial denaturation at 95°C for 5 min; 35 cycles at 94°C for 30 sec, 550C for 20 sec and 720C for 1 min; and a final DNA extension at 720C for 6 min. PCR products were purified using the Qiaquick® PCR purification kit (Qiaquick is a registered trademark of Qiagen GMBH Corp., Hilden Fed. Rep. Germany) according to the producer specifications (Qiagen Inc., Mississauga, ON. Canada). Purified PCR products were sent for sequencing at Macrogen® DNA Sequencing Service (Macrogen USA, Rockville, MD; Macrogen is a registered trademark of Oxford BioMedica PLC Corp., Oxford, Great Britain). The software ClustalX was used as suggested by Thompson et al. (1997, Nucl. Acids Res 24:4876- 4882) for sequence alignment, while sequence alignments were edited with the GeneDoc software (GeneDoc is a registered trademark owned by Karl B. Nicholas, San Raphael, CA, USA) as outlined by Nicholas et al. (1997, EMBNEW.NEWS 4:14). Similarity searching with public library sequences was performed with BLASTn following the method of Altschul et al (1990, J. MoI. Biol. 215:403-10). A Genbank library sequence with a genomic region similar to our query was used to design new primers in order to develop sequence characterized amplified region (SCAR) markers linked to resistance in 'Dunkeld' against L. maculans PG3. These new primers were used to amplify genomic DNA from 'Westar' and 'Dunkeld'. The segregation of polymorphic markers was then analyzed with the 22-progeny sample set used for screening of SRAP primer combinations. Primer sets with markers that segregated as expected were used in analyzing the 92-progeny sample set for linkage mapping. The markers were later confirmed using the additional 248-progeny sample set.
Data analysis. Chi-square test was run with MS Excel® software (Excel is a registered trademark of the Microsoft Corp., Redmond, WA, USA) to verify if segregation ratios of the resistance trait and molecular markers fit Mendelian ratios. Linkage analysis was performed with MapMaker Exp 3.0 computer program following methods taught by Lander et al. (1987, Genomics 1 : 174-181) and Lincoln et al., (1992, Whitehead Institute Technical Report. 3rd Ed.) in order to identify
molecular markers linked to the 'Dunkeld' resistance gene against blackleg caused by
L. maculans PG3.
Results. The winter cultivar 'Quinta' used as a differential in L. maculans pathogenicity group testing is known to carry cotyledon stage resistance genes against L. maculans PG2 and PG3. We found a comparable level of resistance against PG3 in the Australian spring canola cultivar Dunkeld. B. juncea cultivars Cutlass and Domo exhibited resistance against PG2, PG3, and PG4 (Fig.l).
Tests of 340 F2 'Westar' x 'Dunkeld' progeny for response to PG3 revealed that 94 progeny were susceptible and 246 were resistant. Disease symptom ratings, on a 0-9 scale, ranged from 1 to 5 for resistant progeny, with an overall average rating of 2, while the rating for all susceptible progeny was 9 (Fig. 2). According to chi-square analysis (χ2 = 0.96), the segregation ratio of the resistance against L. maculans PG3 within F2 'Westar' x 'Dunkeld' progeny was not significantly different from 3:1, which was consistent with a single dominant gene model.
Bulked segregant analysis (BSA) used together with the SRAP methods allowed to select from 180 primer combinations 10 primer pairs (Table 1) that produced polymorphic markers between parents and within progeny. 52 polymorphic markers within 92 F2 'Westar' x 'Dunkeld' progeny were obtained from these 10 primer combinations. The segregation of four SRAP markers including two from each of Nai2Ao2F/Nai2Ao2R and BG2o/SAi2 primer combinations was consistent with the resistance segregation within the 92 tested progeny. The two markers from the first primer combination were 200 bp and 190 bp and the markers from the last primer pair were 480 bp and 475 bp (Fig. 3).
Sequence results from the two NA12A02 markers showed that they are from CT simple sequence repeat (SSR) regions and that the two units differentiate 'Westar' from 'Dunkeld' with 17 and 19 repeats, respectively. BLASTn analysis revealed that this sequence has 96% homology (e-value = Ie"27) with a region of the Brassica rapa subsp. pekinensis BAC clone KBrO334I14 available in Genbank under the accession number ACl 89311.1. Forward primer BN204F and reverse primer BN204R (Table 1 ; SEQ ID NO: 20 and SEQ ID NO: 21 respectively) were designed from that clone sequence and provided SCAR markers that are also linked to the variety Dunkeld resistance against L. maculans. The segregation ratio of the BN204 markers within the
F2 'Westar' x 'Dunkeld' was consistent with a single dominant gene model and also allowed differentiation of homozygote from heterozygote resistant progeny (Fig. 4). Linkage analysis identified a linkage group on which the 'Dunkeld' resistance gene (Rpg3Dun) against L. maculans PG3 was closely linked to the two BN204 SCAR markers and four SRAP markers (Fig. 5).
Three additional SRAP markers including two from BG2o/SAi2 and one from
BGi8/ODD2o were located at 11.3 and 16.4 cM respectively each side of the core region with the resistance gene. The number of progeny recombinant for the resistance trait and the molecular markers analyzed in 340 progeny, the SRAP marker NAi2Ao2-2oo and the SCAR marker BN204, was not significant (Table 2).
The screening of the University of Manitoba Brassica germplasm revealed that sources of canola resistance against blackleg caused by L. maculans PG3 were available in two B. napus and two B.juncea varieties. We have selected 'Dunkeld' for further analysis because, being a spring type, it is easier to manipulate than the winter cultivar 'Quinta' and the B. juncea 'Cutlass' and 'Domo' in crossing with B. napus spring cultivars, such as 'Westar', and commercial cultivars for genetics studies and gene pyramiding. The resistance in 'Dunkeld' against blackleg is thought to be polygenic in part and can be traced back to possible sources present into its pedigree such as B. napus 'Chikuzen' and 'Norin' and B. juncea BJ168 (Gororo et al., 2004, Proceedings of the 4th International crop Science Congress. Brisbane, Australia, Sept 26-Oct. 1, 2004; Mailer et al., Aust. J. Exp. Agric. 37: 793-800). Our resistance screening experiment revealed that 'Dunkeld' was resistant against L. maculans PG3, but was susceptible to PG2 and PG4. The results suggest the presence of at least one major resistance gene in addition to polygenic resistance. These results also support the supposition that the decline of 'Dunkeld' blackleg resistance and reduced grain yield recorded in Australia from 1999 to 2001 was due to a change in virulence in the blackleg pathogen (Gororo et al.). As the three pathogenicity groups coexist in Australia (Balesdent, 2005, Phytopathology 92:1122-1133), the change in virulence may have resulted from the pathogen population composition shifting to higher proportions of PG2 and PG4 after the release of 'Dunkeld'. The conclusion that a major gene known as RpgiDun is responsible for resistance in 'Dunkeld' against PG3 was supported by the resistance segregation ratio of 3:1 in F2 'Westar' x 'Dunkeld' progeny. Rpg^Dun is likely similar to the Rlm4 gene, which was previously suggested
to be the major resistance gene in 'Dunkeld' (Rouxel et al., 2003, Euphytica 133:219- 231). Rlm4 has also been located in a cluster of four other tightly linked genes including Rlm3, Rlm7 and Rlm9 (Delourme, 2004, Phytopathology 94:578-583).
Table 1. Characteristics of primers used in this study Primer name Primer sequence (5'-3') Source SEQ ID NO:
BG16 TGATACCACTTGCGATACCA Dr. G. Li1 3 BG18 GCAAGTCTCTCAGGTTATTC Dr. G. Li 4 BG20 TCCTCTCCACTTTTGTCTTC Dr. G. Li 5 DC1 TAAACAATGGCTACTCAAG Dr. G. Li 6 EM2 GACTGCGTACGAATTCTG C Dr. G. Li 7 ME2 TGAGTCCAAACCGGAGC Dr. G. Li 8
Na12A02F AGCCTTGTTGCTTTTCAACG Dr. M. Trick2 9 Na12A1^R AGTGAATCGATGATCTCGCC Dr. M. Trick 10 Na12D04F ACGGAGTGATGATGGGTCTC Dr. M. Trick 11 NanD04R CCTCAATGAAACTGAAATATGTGTG Dr. M. Trick 12 Na12F12F CGTTCTCACCTCCGATAAGC Dr. M. Trick 13 Na12F12R TCCGATGTAGAATCAGCAGC Dr. M. Trick 14 NGA111F TGTTTTTTAGGACAAATGGCG Dr. M. Trick 15 NGA111R CTCCAGTTGGAAGCTAAAGGG Dr. M. Trick 16 ODD3 CCAAAACCTAAAACCAGGA Dr. G. Li 17 PM111 CTTTAGCAGCATTGTTACCA Dr. G. Li 18 SA12 TTCTAGGTAATCCAACAACA Dr. G. Li 19 BN204F GGTGCAAACGATGTATTCAAGA This study 20 BN204R CGTTTGTAAAACCGACCTTCA This study 21 1Dr G. Li, University of Manitoba, Winnipeg, Manitoba, Canada
2Dr M. Trick, Brassica DB, John Innes Centre, Norwich, UK
Table 2: Segregation of markers linked to the cultivar 'Dunkeld' resistance against Z. maculans PG3 within 340 F2 'Westar' x 'Dunkeld' progeny
Marker χ2
BN204 0.25
* Resistance testing results
Molecular markers linked to the 'Dunkeld' resistance gene against L. maculans PG3 were identified with a combination of BSA and SRAP procedures. A linkage group with eight molecular markers linked to this resistance trait was identified. DNA sequencing and BLAST analysis of a sequence from one of these markers allowed us to physically locate this resistance gene on a BAC clone from Brassica rapa subsp. pekinensis. BLASTx results also revealed that these markers are located close to a genomic region homologous to the Arabidopsis region encoding a serine/threonine ste20-like kinase. Protein kinases have several functions including defense responses (Hardie, 1999, Annu. Rev. Plant Physiol. Plant MoI. Biol. 50: 97- 131). Plant serine/threonine kinases and kinase receptors involved in disease resistance have been reported in crops such as barley, tomato and rice (Brueggeman et al., 2006, Theor appl Genet 113: 1147-1158; , Liu et al., 2002, J. Biol. Chem 277:20264-20269; Loh et al., 1995, Plant Physiol 108: 1735-1739; Nirmala et al., 2006, Proc. Natl. Acad. Sci. USA 103:7518-7523). Results from linkage mapping and sequence analysis suggested that the 'Dunkeld' resistance trait against L. maculans PG3 might be associated with a gene encoding protein kinase. The gene analysis revealed that it contains open reading frames producing different putative transcripts that could be alternatively expressed in different stress conditions (9, 36). The SCAR marker BN204 linked to Rpg3Dun resistance gene can be used in marker-assisted selection of canola resistance against blackleg caused by L. maculans PG3.
In view of numerous changes and variations that will be apparent to persons skilled in these arts, the scope of the present invention is to be considered limited solely by the appended claims.
Claims
1. An isolated nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 1, said nucleotide sequence complementary to a RpgSDun gene sequence.
2. An isolated nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 2, said nucleotide sequence complementary to a Rpg3Dun gene sequence.
3. An isolated nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 20, said nucleotide sequence complementary to a RpgSDun gene sequence.
4. An isolated nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 21, said nucleotide sequence complementary to a RpgSDun gene sequence.
5. A method for screening a plurality of plant cultivars for identification of individual cultivars resistant to infection by Leptosphaeήa maculans, said method comprising the steps of : collecting from each individual cultivar comprising the plurality of cultivars, a biomass sample; preparing a nucleic acid preparation from each of said biomass samples; contacting each of said nucleic acid preparations with at least one of a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 1, a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 2, a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 20, and a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 21, and intermixing therewith; conducting an amplification reaction therewith each of said intermixed nucleic acid preparations; and assessing each of said amplified nucleic acid preparations to identify individual nucleic acid preparations wherein a hybridization reaction with one of said nucleotide sequences occurred during the amplication reaction, wherein a hybridization reaction is indicative of the cultivar 's resistance to infection by Leptosphaeria maculans.
6. A method according to claim 5, wherein the plant cultivars are Brassica plant cultivars.
7. A method for screening a plurality of plant cultivars for identification of individual cultivars containing therein Rpg3Dun gene sequences, said method comprising the steps of : collecting from each individual cultivar comprising the plurality of cultivars, a biomass sample; preparing a nucleic acid preparation from each of said biomass samples; contacting each of said nucleic acid preparations with at least one of a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 1, a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 2, a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 20, and a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 21, and intermixing therewith; conducting an amplification reaction therewith each of said intermixed nucleic acid preparations; and assessing each of said amplified nucleic acid preparations to identify individual nucleic acid preparations wherein a hybridization reaction with one of said nucleotide sequences occurred during the amplication reaction, wherein a hybridization reaction is indicative of the cultivar' s containing therein Rpg3Dun gene sequences.
8. A method according to claim 7, wherein the plant cultivars are Brassica plant cultivars.
9. A method for generating or increasing the resistance of Brassica plants to infection by Leptosphaeria maculans pathogenicity group PG3, the method comprising the steps of: using the method of claim 8 to select a Brassica plant cultivar containing therein Rpg3Dun genes; including the selected Brassica plant cultivar in a Brassica breeding program for resistance to Leptosphaeria maculans pathogenicity group PG3, and producing progeny therefrom; screening the progeny with the method of claim 8 to further select Brassica plant cultivars containing therein the Rpg3Dun gene; and challenging the further selected Brassica plant cultivars with Leptosphaeria maculans pathogenicity group PG3, to confirm resistance of the further selected Brassica plant cultivars to infection by Leptosphaeria maculans pathogenicity group PG3.
10. A gene cassette comprising at least one nucleotide sequence selected from the group consisting of a nucleotide sequence set forth in SEQ ID NO: 2, a nucleotide sequence set forth in SEQ ID NO: 2, a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 20, and a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 21.
11. A kit comprising a nucleotide sequence selected from the group consisting of a nucleotide sequence set forth in SEQ ID NO: 1, a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 2, a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 20, and a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 21, said nucleotide sequence complementary to a Rpg3Dun gene sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US12/680,315 US20110219466A1 (en) | 2007-10-05 | 2008-10-03 | Sequence-characterized amplified region (scar) markers for plant resistance against fungal pathogens |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US97793307P | 2007-10-05 | 2007-10-05 | |
| US60/977,933 | 2007-10-05 | ||
| US2152908P | 2008-01-16 | 2008-01-16 | |
| US61/021,529 | 2008-01-16 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2009043182A1 true WO2009043182A1 (en) | 2009-04-09 |
Family
ID=40525815
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CA2008/001779 Ceased WO2009043182A1 (en) | 2007-10-05 | 2008-10-03 | Sequence-characterized amplified region (scar) markers for plant resistance against fungal pathogens |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20110219466A1 (en) |
| WO (1) | WO2009043182A1 (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0689591A1 (en) * | 1993-03-22 | 1996-01-03 | Ca Nat Research Council | Testing for infestation of rapeseed and other cruciferae by the fungus leptosphaeria maculans (blackleg infestation) |
| WO2000001824A2 (en) * | 1998-07-03 | 2000-01-13 | The University Of Manitoba | Method for genetic engineering of disease resistance using the drr206 class of proteins |
| WO2001018221A1 (en) * | 1999-09-08 | 2001-03-15 | Plant Bioscience Limited | Nucleic and amino acid sequences relating to resistance to blackleg in plants |
| EP1547462A1 (en) * | 2003-12-24 | 2005-06-29 | Bayer BioScience N.V. | Brassica plant resistant to the fungus Leptosphaeria maculans (blackleg) |
-
2008
- 2008-10-03 US US12/680,315 patent/US20110219466A1/en not_active Abandoned
- 2008-10-03 WO PCT/CA2008/001779 patent/WO2009043182A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0689591A1 (en) * | 1993-03-22 | 1996-01-03 | Ca Nat Research Council | Testing for infestation of rapeseed and other cruciferae by the fungus leptosphaeria maculans (blackleg infestation) |
| WO2000001824A2 (en) * | 1998-07-03 | 2000-01-13 | The University Of Manitoba | Method for genetic engineering of disease resistance using the drr206 class of proteins |
| WO2001018221A1 (en) * | 1999-09-08 | 2001-03-15 | Plant Bioscience Limited | Nucleic and amino acid sequences relating to resistance to blackleg in plants |
| EP1547462A1 (en) * | 2003-12-24 | 2005-06-29 | Bayer BioScience N.V. | Brassica plant resistant to the fungus Leptosphaeria maculans (blackleg) |
Non-Patent Citations (4)
| Title |
|---|
| CHEN, Y. ET AL.: "Induced Resistance to Blackleg (Leptosphaeria maculans) Disease of Canola (Brassica napus) caused by a Weakly Virulent Isolate of Leptosphaeria biglobosa.", PLANT DISEASE, vol. 90, August 2006 (2006-08-01), pages 1059 - 1064 * |
| DATABASE GENBANK NCBI; 15 September 2007 (2007-09-15), Database accession no. EU122190 * |
| DATABASE GENBANK NCBI; 15 September 2007 (2007-09-15), Database accession no. EU122191 * |
| DUSABENYAGASANI, M. ET AL.: "Brassica napus cultivar Westar SCAR marker BN204 genomic sequence", 15 September 2007 (2007-09-15) * |
Also Published As
| Publication number | Publication date |
|---|---|
| US20110219466A1 (en) | 2011-09-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1874935B2 (en) | Polynucleotides and methods for making plants resistant to fungal pathogens | |
| CA2729563C (en) | Genetic loci associated with head smut resistance in maize | |
| Wanchana et al. | A rapid construction of a physical contig across a 4.5 cM region for rice grain aroma facilitates marker enrichment for positional cloning | |
| BR122019002801B1 (en) | method for selecting a maize plant and method for identifying a transformed maize plant | |
| BR112021013923A2 (en) | METHODS OF IDENTIFICATION, SELECTION AND PRODUCTION OF RUST RESISTANT HARVEST OF SOUTHERN CORN | |
| WO2021143587A1 (en) | Methods of identifying, selecting, and producing disease resistant crops | |
| US12565662B2 (en) | Plant pathogen effector and disease resistance gene identification, compositions, and methods of use | |
| WO2023023419A1 (en) | Methods of identifying, selecting, and producing anthracnose stalk rot resistant crops | |
| EP2451269A1 (en) | Plant resistant to a pathogen | |
| US11661609B2 (en) | Methods of identifying, selecting, and producing disease resistant crops | |
| Sharma et al. | A Solanum lycopersicum× Solanum pimpinellifolium linkage map of tomato displaying genomic locations of R‐genes, RGAs, and candidate resistance/defense‐response ESTs | |
| US12091673B2 (en) | Methods of identifying, selecting, and producing southern corn rust resistant crops | |
| CN107338254B (en) | Polynucleotides and methods for making plants resistant to fungal pathogens | |
| EP4017252A1 (en) | Methods of identifying, selecting, and producing anthracnose stalk rot resistant crops | |
| Dusabenyagasani et al. | Development of a SCAR marker to track canola resistance against blackleg caused by Leptosphaeria maculans pathogenicity group 3 | |
| US20110219466A1 (en) | Sequence-characterized amplified region (scar) markers for plant resistance against fungal pathogens | |
| WO2025076505A1 (en) | Scn-007 genes, compositions, methods, and markers for scn resistance | |
| WO2025085449A1 (en) | Compositions and methods to increase resistance to soybean cyst nematode | |
| EP4192232A2 (en) | Compositions and methods for enhancing resistance to northern leaf blight in maize | |
| Ebrahim et al. | Resistance gene analogues in mango against mango malformation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08836330 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12680315 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 08836330 Country of ref document: EP Kind code of ref document: A1 |