WO2009020236A2 - Baculoviral vectors with a dual vertebrate and baculovirus promoter controlling an immunogenic fusion gene - Google Patents

Baculoviral vectors with a dual vertebrate and baculovirus promoter controlling an immunogenic fusion gene Download PDF

Info

Publication number
WO2009020236A2
WO2009020236A2 PCT/JP2008/064503 JP2008064503W WO2009020236A2 WO 2009020236 A2 WO2009020236 A2 WO 2009020236A2 JP 2008064503 W JP2008064503 W JP 2008064503W WO 2009020236 A2 WO2009020236 A2 WO 2009020236A2
Authority
WO
WIPO (PCT)
Prior art keywords
acnpv
cap
pfcsp
pcap
hal
Prior art date
Application number
PCT/JP2008/064503
Other languages
French (fr)
Other versions
WO2009020236A3 (en
Inventor
Shigeto Yoshida
Masanori Kawasaki
Makoto Matsumoto
Yoshio Ohba
Masahiro Saito
Yoshihiro Goto
Katsuya Inagaki
Masami Mizukoshi
Norimitsu Hariguchi
Kuniko Hirota
Original Assignee
Educational Foundation Jichi Medical University
Otsuka Pharmaceutical Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to RU2010108248/10A priority Critical patent/RU2491093C2/en
Priority to JP2010504369A priority patent/JP5409605B6/en
Application filed by Educational Foundation Jichi Medical University, Otsuka Pharmaceutical Co., Ltd. filed Critical Educational Foundation Jichi Medical University
Priority to MX2010001499A priority patent/MX2010001499A/en
Priority to AU2008284664A priority patent/AU2008284664B2/en
Priority to EP08792433.8A priority patent/EP2191002B1/en
Priority to CN200880102191.5A priority patent/CN101772576B/en
Priority to AP2010005146A priority patent/AP2010005146A0/en
Priority to CA2695894A priority patent/CA2695894C/en
Priority to DK08792433.8T priority patent/DK2191002T3/en
Priority to BRPI0815034 priority patent/BRPI0815034A2/en
Priority to US12/192,927 priority patent/US9333249B2/en
Publication of WO2009020236A2 publication Critical patent/WO2009020236A2/en
Publication of WO2009020236A3 publication Critical patent/WO2009020236A3/en
Priority to IL203411A priority patent/IL203411A/en
Priority to ZA2010/00422A priority patent/ZA201000422B/en
Priority to HK10109135.5A priority patent/HK1142629A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1018—Orthomyxoviridae, e.g. influenza virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/002—Protozoa antigens
    • A61K39/015—Hemosporidia antigens, e.g. Plasmodium antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/145—Orthomyxoviridae, e.g. influenza virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A61P33/06—Antimalarials
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • C07K14/445—Plasmodium
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/20—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans from protozoa
    • C07K16/205—Plasmodium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/735—Fusion polypeptide containing domain for protein-protein interaction containing a domain for self-assembly, e.g. a viral coat protein (includes phage display)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14111—Nucleopolyhedrovirus, e.g. autographa californica nucleopolyhedrovirus
    • C12N2710/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14111—Nucleopolyhedrovirus, e.g. autographa californica nucleopolyhedrovirus
    • C12N2710/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2710/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/15—Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/60—Vector systems having a special element relevant for transcription from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
    • C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention provides a novel transfer vector, a recombinant baculovirus obtained by homologous recombination of the transfer vector and a baculovirus DNA, and methods for production thereof.
  • the present invention further provides pharmaceuticals (e.g., vaccines, and preventive or therapeutic drugs for infectious diseases such as malaria and influenza) containing the recombinant baculovirus as an active ingredient.
  • pharmaceuticals e.g., vaccines, and preventive or therapeutic drugs for infectious diseases such as malaria and influenza
  • Patent Document 1 discloses a recombinant baculovirus expression vector containing multiple independent promoters comprising a promoter derived from an early gene of baculovirus, which has a DNA region containing a gene encoding a viral non-structural protein, and a promoter derived from a late gene of baculovirus, which has a DNA region containing a gene encoding a viral structural protein.
  • Patent Document 2 discloses a method comprising introducing into mammalian cells a non-mammalian DNA viral vector containing multiple independent promoters controlled to express a desired foreign gene linked to the promoters; and expressing the foreign gene in the mammalian cells.
  • Patent Document 3 discloses a method of producing a protein with gene recombination technology using a baculovirus.
  • the method comprises expressing a fusion gene obtained by linking the gp64 gene of baculovirus to a gene encoding a desired protein to produce the desired protein in a form fused with viral particles, collecting the viral particles fused with the desired protein, and cleaving the desired protein from the viral particles to collect the protein.
  • Patent Document 4 discloses a recombinant baculovirus expression vector having multiple independent promoters containing a first nucleic acid sequence encoding a detection marker, which is linked, in a form capable of functioning, to a first promoter that is active in host cells and inactive in non-acceptable cells, and a second nucleic acid sequence containing a foreign nucleic acid sequence, which is linked, in a form capable of functioning, to a second promoter that is active in non-acceptable cells.
  • Patent Document 5 discloses that an influenza virus hemagglutinin (HA) antigen-expressing recombinant baculovirus vector linked to a CAG promoter derived from chicken ⁇ actin has influenza virus infection-preventing effects and is therefore useful as a vaccine formulation.
  • HA hemagglutinin
  • Patent Document 6 discloses a method of ' ' producing a baculovirus vector comprising the step of co-transfecting into insect cells a plasmid containing a baculovirus promoter and a mammalian cell-derived promoter having linked thereto a gene encoding a protein expressible on the cell surface, or a plasmid containing two baculovirus promoters having linked thereto a gene encoding a protein expressible on the cell surface has been linked.
  • Patent Document 7 describes research on anti-influenza virus activity, i.e., activity against influenza virus infection, of a recombinant baculovirus having cDNA of influenza virus HA incorporated in a CAG promoter, and discloses that not only the recombinant baculovirus but also wild-type baculovirus have anti- influenza virus activity.
  • Patent Document 1 Japanese Patent No. 3366328, Multiple Promoter
  • Patent Document 2 WO98/011243, Non-mammalian DNA Virus Having
  • Patent Document 3 JP No. 2002-235236-A, Methods of Producing
  • Patent Document 4 JP No. 2003-284557-A, Novel Baculovirus- Transfecting Vector and Recombinant Baculovirus for Expression of
  • Patent Document 5 WO02/062381, Baculovirus Vector Vaccine.
  • Patent Document 6 WO04/029259, Baculovirus Vector, Method of
  • Patent Document 7 JP No. 2005-15346-A, Baculovirus-containing
  • FIG. 1 shows the test results of the expression of vaccine antigens from recombinant baculoviruses of the present invention in insect cells in Example 3.
  • FIG. 2 (A) shows a Western blotting analysis showing the expression of the CSP gene (PfCSP) of human malaria in viral particles of recombinant baculoviruses produced from recombinant transfer vectors. Detected by Anti-PfCSP Monoclonal Antibody (2A10) -A-
  • FIG. 2 (B) shows a Western blotting analysis showing the expression of H5N1/HA1 gene in viral particles of recombinant baculoviruses produced from recombinant transfer vectors.
  • FIG. 3 shows HepG2 cells stained with a fluorescence- labeled antibody, which indicates that an antigen has been expressed by a recombinant baculovirus containing a fusion gene of PfMSPl gene and PfCSP gene in the HepG2 cells.
  • the results of FIG. 3 (A) confirmed that a PfCSP antigen has been expressed.
  • the results of FIG. 3 (B) confirmed that a PfMSP-Ii 9 antigen has been expressed.
  • FIG. 4 shows the results of measurement of antibody titers obtained in Example 6.
  • FIG. 5 shows the transfer vectors of the present invention. DISCLOSURE OF THE INVENTION
  • An object of the present invention is to provide a novel recombinant transfer vector, a recombinant baculovirus obtained by homologous recombination of the recombinant transfer vector and a baculovirus DNA, and methods for production thereof.
  • Another object of the present invention is to provide a pharmaceutical preparation, particularly a vaccine formulation containing the recombinant baculovirus as an active ingredient.
  • the present inventors found a transfer vector having a novel structure capable of expressing a fusion protein of a protein having a desired immunogenicity or a partial protein thereof with a viral structural protein in insect cells and in vertebrate (particularly mammalian and avian) cells; and a recombinant baculovirus obtained by homologous recombination of the transfer vector and a baculovirus DNA.
  • a transfer vector having a novel structure capable of expressing a fusion protein of a protein having a desired immunogenicity or a partial protein thereof with a viral structural protein in insect cells and in vertebrate (particularly mammalian and avian) cells
  • a recombinant baculovirus obtained by homologous recombination of the transfer vector and a baculovirus DNA.
  • the present inventors carried out extensive research on pharmaceuticals containing as an active ingredient a recombinant baculovirus having infectious disease- preventive and therapeutic effects.
  • the inventors of the present invention found a recombinant transfer vector having a novel structure, a recombinant baculovirus obtained by homologous recombination of the transfer vector and a baculovirus DNA, and methods for the production thereof, and ascertained that the recombinant baculovirus itself is useful as a pharmaceutical capable of expressing a protein having the desired immunogenicity in target cells, and as a pharmaceutical for preventing infectious diseases such as malaria and influenza.
  • the present invention has been accomplished, based on these findings.
  • a transfer vector which is any one of pCAP-PfCSP, pCAP- PfCSP/272, pCAP-PfCSP/467, pCAP-PfCSP(A361E) , pCAP- PfCSP (A361E) /272, pCAP-PfCSP(A361E) /467, pCAP-PfCSP-76, pCAP- PfCSP-76/467, pCAP-PfCSP+209, pCAP-PfCSP+209/467, pCAP- PfCSP+76/209, pCAP-PfCSP+76/209/467, pCAP-HAl/Anhui, pCAP- HAl/Anhui/272, pCAP-HAl/Anhui/467, pCAP-HAl/Vietnam, pCAP-
  • HAl/Vietnam/51 pCAP-HAl/Vietnam/101, pCAP-HAl/Vietnam/154, pCAP- HAl/Vietnam/201, pCAP-HAl/Vietnam/272, pCAP-HAl/Vietnam/467, pCAP-AH/345, pCAP-AH/345/467, pCAP-AH/410, pCAP-AH/410/467, pCAP-AH/473, pCAP-AH/473/467, pCAP-AH/520, pCAP-AH/520/467, pCAP- VN/346, pCAP-VN/346/467, pCAP-VN/410, pCAP-VN/410/467, pCAP- VN/473, pCAP-VN/473/467, pCAP-VN/520, pCAP-VN/410/467, pCAP- VN/473, pCAP-VN/473
  • a recombinant baculovirus which is any one of AcNPV-CAP- PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E) , AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HAl/
  • Item 3 A composition for infectious diseases comprising the recombinant baculovirus of item 2 as an active ingredient.
  • Item 4. A composition for infectious diseases comprising the recombinant baculovirus of item 2 as an active ingredient, the composition being administered by the intramuscular, respiratory, or nasal route.
  • Item 5. A vaccine comprising the recombinant baculovirus of item 2 as an active ingredient.
  • a vaccine comprising the recombinant baculovirus of item
  • a therapeutic or preventive agent for influenza virus infection comprising as an active ingredient any one of AcNPV- CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP-HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP- HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP- HAl/Vietnam/201, AcNPV-CAP-HAl/Vietnam/272, AcNPV-CAP- HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV- CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-
  • Item 8 A therapeutic or preventive agent for influenza virus infection according to item 7, which is administered by the intramuscular, respiratory, or nasal route.
  • a vaccine against influenza virus infection comprising as an active ingredient any one of AcNPV-CAP-HAl/Anhui, AcNPV- CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP-HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP- HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP-AH/473/467, AcNPV-CAP-AH/520
  • Item 10 A vaccine against influenza virus infection according to item 7, which is administered by the intramuscular, respiratory, or nasal route.
  • Item 11 A therapeutic or preventive agent for human malaria infection, comprising as an active ingredient any one of AcNPV- CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E), AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-CO/full, AcNPV-CAP-
  • a therapeutic or preventive agent for human malaria infection comprising as an active ingredient any one of AcNPV- CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E), AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP-
  • PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP-CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-
  • a therapeutic or preventive agent for human malaria infection according to item 13, which is administered by the intramuscular, respiratory, or nasal route.
  • Item 15 A method of preventing malaria or influenza infection or of treating malaria or influenza, comprising administering to a subject an effective amount of the recombinant baculovirus of item 2, the composition for infectious diseases of item 3 or 4, or the vaccine of item 5, 6, 9, 10, 13 or 14.
  • Item 16 A method according to item 15, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject as a liposomal formulation.
  • Item 17 A method according to item 15, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject by the intramuscular, respiratory, or nasal route.
  • Item 18 A method according to item 16, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject by the intramuscular, respiratory, or nasal route.
  • Item 19 A method of immunostimulation comprising administering to a subject an effective amount of the recombinant baculovirus of item 2, the composition for infectious diseases of item 3 or 4, or the vaccine of item 5, 6, 9, 10, 13 or 14.
  • Item 20 A method according to item 19, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject as a liposomal formulation.
  • Item 21 A method according to item 19, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject by the intramuscular, respiratory, or nasal route.
  • Item 22 A method according to item 20, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject by the intramuscular, respiratory, or nasal route.
  • a novel recombinant transfer vector, a recombinant baculovirus obtained by homologous recombination of the recombinant transfer vector and a baculovirus DNA, and methods for production thereof are provided.
  • Pharmaceuticals containing the recombinant baculovirus of the present invention as an active ingredient are useful as therapeutic or preventive drugs for infectious diseases such as malaria and influenza, or as cellular medicine and vaccine formulations .
  • BEST MODE FOR CARRYING OUT THE INVENTION The abbreviations used for the amino acids, peptides, base sequences, and nucleic acids in the present specification are based on the abbreviations specified in the IUPAC-IUB Communication on Biochemical Nomenclature, Eur. J.
  • the DNA molecule may include not only double strand DNA but also single strand DNA, i.e., a sense chain and an antisense chain constituting the double strand DNA, and is not limited to a full length thereof.
  • the polynucleotide (DNA molecule) encoding the immunogenic foreign gene of the present invention encompasses double strand DNA containing genomic DNA, single strand DNA (sense chain) containing cDNA, and single strand DNA (antisense chain) having a sequence complementary to the sense chain, synthetic DNA, and fragments thereof, unless otherwise mentioned.
  • the polynucleotide or DNA molecule used herein is not limited in the functional region, and may include at least one of an expression suppression region, a coding region, a leader sequence, an exon, and an intron.
  • examples of the polynucleotide include RNA and DNA.
  • the polypeptide containing a specific amino acid sequence and the polynucleotide containing a specific DNA sequence include fragments, homologs, derivatives, and mutants of the polynucleotide.
  • mutants of the polynucleotide include naturally occurring allelic mutants; artificial mutants; and mutants having deletion, substitution, addition, and/or insertion.
  • mutants encode polypeptides having substantially the same function as the polypeptide encoded by the original non-mutated polynucleotide.
  • the transfer vector refers to a plasmid for producing a recombinant baculovirus having a structure in which a fusion gene, formed by linking at least one gene encoding a protein capable of being a component of viral particles to at least one immunogenic foreign gene, is incorporated downstream of a dual promoter comprising two linked promoters, i.e., one vertebrate promoter (e.g., a mammalian promoter or an avian promoter) and one baculovirus promoter.
  • a dual promoter comprising two linked promoters, i.e., one vertebrate promoter (e.g., a mammalian promoter or an avian promoter) and one baculovirus promoter.
  • the immunogenic foreign gene is located downstream of the dual promoter and upstream of the gene encoding a protein capable of being a component of viral particles.
  • the recombinant baculovirus of the present invention is used as an active ingredient of pharmaceuticals or vaccines for vertebrates.
  • vertebrates include mammals such as humans, cattle, horses, swine, sheep, goats, monkeys, mice, dogs, and cats.
  • birds include chickens, quail, geese, wild ducks, pigeons, turkeys, guinea fowls, and parrots.
  • the present invention provides a transfer vector containing a novel structure having incorporated therein a fusion gene of one immunogenic foreign gene and a gene encoding a viral membrane protein that can be expressed in insect cells under the control of a dual promoter comprising one vertebrate promoter and one baculovirus promoter linked to each other.
  • Co-transfection of this transfer vector with a baculovirus DNA into insect cells induces a homologous recombination and thereby produces a recombinant baculovirus having incorporated therein the fusion gene that is expressed under the control of a baculovirus promoter in insect cells and that can produce a fusion protein capable of being a component of budded viral particles.
  • a fusion protein of a protein capable of being a component of budded viral particles with an immunogenic protein seems to function as a component vaccine.
  • the recombinant baculovirus administered to the vertebrate enters the vertebrate cell, and a fusion antigen with the desired immunogenic foreign antigen is produced from the viral genome in the vertebrate cell, and functions as a DNA vaccine .
  • a fusion protein of a protein capable of being a component of viral particles with an immunogenic protein is presented as an antigen on the surface of virus particles, and a fusion protein of a protein capable of being a component of viral particles with an immunogenic protein is produced in the mammalian cell, and seems to function as a preventive or therapeutic agent for infectious diseases, such as viral, protozoan, and bacterial infection, due to its immunopotentiative action.
  • the baculovirus DNA to be co-transfected with the transfer vector may be a wild type, mutant, or recombinant baculovirus DNA.
  • host cells to be co-transfected include insect cells such as cells of Spodoptera frugiperda.
  • the immunogenic foreign gene refers to a gene encoding the amino acid sequence of an antigenic protein used as an immunogen in immunotherapy, such as vaccine therapy, for the prevention and treatment of infectious diseases, such as malaria and influenza.
  • infectious diseases such as malaria and influenza.
  • specific examples thereof include genes encoding the amino acid sequences of proteins, such as malaria antigen and influenza virus antigen.
  • the "foreign" gene as used herein refers to a gene introduced from the outside. Even if the same gene is present in the cell, the gene introduced from the outside is referred to as the "foreign" gene.
  • the gene encoding the amino acid sequence of a protein used as the immunogen is not particularly limited, as long as the gene is capable of encoding the amino acid sequence of an antigenic protein having immunogenicity against a substance that causes diseases such as infectious diseases.
  • Examples of genes encoding the amino acid sequence of an antigenic protein having immunogenicity are as f ollows .
  • genes encoding the amino acid sequence of a malaria antigen include genes encoding the amino acid sequences of sporozoite surface antigen CSP (Circumsporozoite Protein) of malaria parasites, merozoite surface membrane protein MSPl
  • influenza virus antigens include genes encoding the amino acid sequences of HA antigen (hemagglutinin antigen) , NA antigen (neuraminidase antigen) , M2 antigen (matrix protein antigen) , NP antigen (nucleoprotein antigen), and like proteins.
  • examples of mammalian genes include genes encoding the amino acid sequences of antigenic proteins of infectious diseases in humans, cattle, horses, swine, sheep, monkeys, mice, dogs, and cats.
  • examples of avian genes include antigen genes (e.g., avian influenza HA antigen) of infectious diseases in chickens, wild ducks, pigeons, turkeys, guinea fowls, and parrots.
  • Pathogen genes whose association with infectious diseases in mammals and birds as mentioned above has been reported are easily available from institutions storing registered public data on pathogen genes, such as Genbank.
  • the present invention can provide a transfer vector having such an immunogenic foreign gene, and a recombinant baculovirus obtained by homologous recombination of the transfer vector. Further, the present invention can provide a pharmaceutical composition containing as an active ingredient the recombinant baculovirus having the immunogenic foreign gene, and a vaccine formulation of the pharmaceutical composition.
  • the baculovirus used in the present invention refers to insect pathogen viruses that cause infection in insects, which are one group (Baculoviridae) of DNA viruses having a cyclic double strand DNA as a gene.
  • insect pathogen viruses that cause infection in insects
  • one group of the viruses referred to as the nucleopolyhedrosis virus (NPV) produce an inclusion body, referred to as a polyhedron, in the nucleus of infected cells in the late phase of infection. Even if a foreign gene to be expressed is inserted in place of the polyhedrin gene, virus infection and growth sufficiently occur to produce a large amount of the desired foreign gene product. Therefore, this virus has been used for the production of desired proteins in recent years .
  • baculovirus used in the present invention examples include Autographa californica nucleopolyhedrosis virus: AcNPV, Bombyx mori nucleopolyhedrosis virus: BmNPV, Orgyia pseudotsugata nucleopolyhedrosis virus: OpNPV, and Lymantria disper nucleopolyhedrosis virus: LdNPV.
  • the baculovirus DNA may be any DNA that can be homologously recombined with the transfer vector of the present invention.
  • the viral gene of the baculovirus DNA that can be homologously recombined with the transfer vector of the present invention is as huge as 130 kbp in size, and an immunogenic foreign gene of 15 kbp or more can be inserted therein. Because the baculovirus gene itself is scarcely expressed in vertebrate cells, there is almost no need to consider its cytotoxicity. Thus, it is thought that no harmful immune response is induced.
  • the immunogenic foreign gene DNA capable of being fused to the viral gene which is one of the components of the baculovirus transfer vector, can be easily produced or obtained by synthesis based on the nucleic acid sequence information of the polynucleotide encoding the amino acid sequence of an antigenic protein having the desired immunogenicity disclosed in this specification, or directly synthesizing the DNA corresponding to the nucleic acid sequence of the coding region of the immunogenic foreign gene, based on the nucleic acid sequence information of the immunogenic foreign gene (chemical DNA synthesis method) .
  • General gene engineering techniques can be used for this production (see, for example, "Molecular Cloning” 2d Ed, Cold Spring Harbor Lab. Press (1989); Zoku Seikagaku Jikken Kouza, "Idenshi Kenkyuho I, II, III", edited by the Japanese Biochemistry Society, 1986) .
  • Examples of methods for synthesizing the DNA include chemical synthesis means, such as the phosphate triester method and the phosphate amidite method (J. Am. Chem. Soc, 89, 4801 (1967); ibid., 91, 3350 (1969); Science, 150, 178 (1968); Tetrahedron Lett., 22, 1859 (1981); ibid., 24, 245 (1983)) and combination methods thereof.
  • the DNA can also be chemically synthesized by the phosphoramidite method or the triester method, or synthesized by using a commercially available automatic oligonucleotide synthesizer.
  • a double strand fragment can be obtained by synthesizing a complementary strand and annealing the complementary strand with a chemically synthesized single strand under appropriate conditions, or adding the complementary strand with appropriate primer sequences to a chemically synthesized single strand using a DNA polymerase.
  • immunogenic foreign gene DNA produced in the present invention include DNA comprising a DNA sequence encoding the amino acid sequence of a malaria antigen protein, and a DNA sequence encoding the amino acid sequence of an influenza virus antigen protein.
  • the DNA used in the present invention is not limited to a full-length DNA sequence encoding the amino acid sequence of the polypeptide of an antigenic protein having the immunogenicity, and may be a DNA sequence encoding a partial sequence thereof, as long as the protein of the amino acid sequence encoded by the DNA sequence has the immunogenicity.
  • the DNA of the immunogenic foreign gene used in the present invention is not limited to DNA molecules having such a specific DNA sequence, and may be DNA molecules having a DNA sequence produced by suitably selecting codons for each amino acid residue.
  • the choice of codons can be made in accordance with a standard method, for example, by considering the frequency of codon use in the host used (Nucleic Acids Res., 9, 43(1981)).
  • the DNA of the immunogenic foreign gene used in the present invention can be produced by gene engineering techniques, more specifically by preparing a cDNA library from an appropriate origin that expresses the DNA of an immunogenic foreign gene in accordance with a standard method, and selecting a desired clone from the library using an appropriate probe or antibody against the expressed product, which is specific to the immunogenic foreign gene (see, for example, Proc. Natl. Acad. Sci., USA., 78, 6613 (1981); Science, 222, 778 (1983)).
  • genomic DNA origin examples include various cells, tissues, and cultured cells derived therefrom, which express the DNA of the immunogenic foreign gene. Extracts of erythrocytes infected with malaria parasites, and extracts of cells infected with influenza viruses are particularly preferable.
  • the extraction and separation of total DNA and RNA from the origin, separation and purification of mRNA, and the production and cloning of cDNA can be performed in accordance with standard methods .
  • the DNA of the immunogenic foreign gene can be produced by using the cDNA library of each immunogen prepared by extraction, separation and purification of the mRNA of the immunogenic tissue or cells from the above-mentioned extract.
  • the DNA of the immunogenic foreign gene can also be produced by using a phage library prepared by extracting the mRNA of each immunogen, adding poly A to the RNA, collecting the poly A-added RNA, producing cDNA using a reverse transcriptase, adding restriction enzyme sites to both ends of the cDNA, and incorporating the cDNA into a phage.
  • the method of screening the immunogenic foreign gene DNA from the cDNA library is not particularly limited, and can be performed in accordance with a usual method. Specific examples of such methods include a method of selecting a corresponding cDNA clone by immunological screening using a specific antibody (e.g., anti-malaria antibody, anti-influenza virus antibody, etc.) against the protein produced by the cDNA; a plaque hybridization method using a probe selectively binding to the target DNA sequence; a colony hybridization method; and combinations thereof.
  • a specific antibody e.g., anti-malaria antibody, anti-influenza virus antibody, etc.
  • the probe used in such hybridization methods is usually a DNA fragment chemically synthesized based on the information on the DNA sequence of the immunogenic foreign gene.
  • the DNA sequences of the immunogenic foreign gene already obtained or fragments thereof can also be advantageously used as the probe.
  • a sense primer and an antisense primer designed based on the DNA sequence information of the immunogenic foreign gene can also be used as the probe for the screening.
  • the DNA (nucleotides) used as the probe is a partial
  • DNA corresponding to the DNA sequence of an immunogenic foreign gene.
  • the DNA has an at least 15 consecutive DNA, preferably at least 20 consecutive DNA, and more preferably at least 30 consecutive DNA sequence.
  • a positive clone itself for producing the DNA as mentioned above can also be used as the probe.
  • a DNA/RNA amplification method by PCR (Science, 230, 1350 (1985)) is preferably used.
  • the RACE method Rapid amplification of cDNA ends; Jikken Igaku 12(6), 35(1994)
  • 5'-RACE method M. A. Frohman, et al., Proc. Natl. Acad. Sci., USA., 8, 8998(1988) is preferably used.
  • the primers used for PCR can be designed, based on the DNA sequence information of the immunogenic foreign gene, and synthesized in accordance with standard methods.
  • DNA portions SP6 promoter/primer and T7 terminator/primer
  • the isolation/purification of the DNA/RNA fragment amplified by PCR can be performed in accordance with standard methods, for example, by gel electrophoresis.
  • the DNA sequence of the DNA of the immunogenic foreign gene thus obtained or various DNA fragments thereof can be determined in accordance with standard methods, for example, by the dideoxy method (Proc. Natl. Acad. Sci., USA., 74, 5463(1977)) or Maxam-Gilbert method (Methods in Enzymology, 65, 499(1980)), or by simply using a commercially available sequencing kit.
  • the gene encoding the amino acids of a protein capable of being a component of viral particles may be any gene that can encode a protein that is formed into a fusion protein with an immunogenic foreign gene as mentioned above in target cells and can be expressed as a protein capable of being a component of viral particles in insect cells.
  • Examples of the gene encoding the amino acids of a protein capable of being a component of viral particles include genes of gp64 protein (GenBank Accession No. L22858) , vesicular stomatitis virus glycoprotein G (VSVG: GenBank Accession No. J02428), herpes simplex virus glycoprotein (KOS: GenBank
  • the DNA of the gene encoding the amino acids of a protein capable of being a component of viral particles can be easily produced or obtained by synthesis based on the nucleic acid sequence information of the polynucleotide encoding the amino acid sequence of the polypeptide of the gene encoding the amino acids of the target protein capable of being a component of viral particles; or by directly synthesizing the DNA corresponding to the nucleotide sequence encoding the amino acid sequence, based on the amino acid sequence information of the gene encoding the amino acids of the protein capable of being a component of viral particles (chemical DNA synthesis) , as in the case of the production of the DNA of the immunogenic foreign gene.
  • the DNA sequence corresponding to the nucleic acid sequence encoding the amino acids of a protein capable of being a component of viral particles is not limited to a full-length coding region, and may be DNA containing a partial DNA sequence thereof .
  • the DNA of the gene encoding the amino acids of a protein capable of being a component of viral particles can be produced by general gene engineering techniques (see, for example, Molecular Cloning 2d Ed, Cold Spring Harbor Lab. Press (1989) ; Zoku Seikagaku Jikken Kouza, "Idenshi Kenkyuho I, II, III", edited by the Japanese Biochemistry Society, 1986) .
  • vertebrate promoter capable of functioning in vertebrate cells
  • Examples of the vertebrate promoter that is one of the components of the transfer vector used in the present invention include mammalian promoters and avian promoters.
  • Mammalian Promoters include mammalian promoters and avian promoters.
  • mammalian promoter capable of functioning in mammalian cells
  • examples of the mammalian promoter include cytomegalovirus promoters, SV40 promoters, retrovirus promoters, metallothionein promoters, heat shock protein promoters, CAG promoters, elongation factor l ⁇ promoters, actin promoters, ubiquitin promoters, albumin promoters, and MHC promoters.
  • avian promoter examples include ⁇ actin promoters, heat shock protein promoters, elongation factor promoters, ubiquitin promoters, and albumin promoters.
  • Baculovirus Promoters include ⁇ actin promoters, heat shock protein promoters, elongation factor promoters, ubiquitin promoters, and albumin promoters.
  • baculovirus promoter that is one of the components of the baculovirus transfer vector used in the present invention include polyhedrin promoter, plO promoter, iel promoter, p35 promoter, vp39 promoter, and gp64 promoter.
  • the present invention relates to a novel transfer vector having a structure capable of expressing the desired immunogenic foreign gene as an antigenic protein in both insect cells and vertebrate cells, particularly mammalian cells.
  • the novel transfer vector produced in the present invention has a structure in which a DNA sequence encoding the amino acid sequence of the desired immunogenic protein and a DNA sequence encoding the amino acid sequence of a protein capable of being a component of viral particles are linked downstream of linked promoters comprising one vertebrate promoter, particularly a mammalian promoter, and one baculovirus promoter.
  • the DNA regions containing the DNA sequences of the two promoters may be directly linked to each other, or an intervening DNA sequence may be present between the DNA sequences of the two promoters (provided, however, that the two promoters should have promoter activity in insect cells and in vertebrate cells, and particularly mammalian cells) .
  • the promoter region has a structure such that either of a vertebrate promoter, particularly a mammalian promoter, and a baculovirus promoter, linked to each other, may be disposed more closely to the gene to be expressed.
  • a baculovirus promoter is disposed more closely to the gene to be expressed than a mammalian promoter.
  • the DNA sequence of the fusion gene of a gene encoding a protein capable of being a component of viral particles and a desired immunogenic foreign gene may be such that these two genes are directly linked to each other, or an intervening DNA sequence is present between the genes (provided, however, that it is necessary not to cause a frameshift of the downstream gene and the upstream gene) .
  • the antigen-presenting domain of the protein of a foreign gene having the desired immunogenicity is fused to a protein capable of being a component of viral particles. Therefore, the protein of a foreign gene having the desired immunogenicity should not be cut off from the protein capable of being a component of viral particles, but should be used in a form fused therewith.
  • a fusion gene containing these two genes may be prepared in advance, and then incorporated into the vector.
  • one of the genes may first be incorporated into the vector and then the other may be incorporated into the vector to form a fusion gene in the vector.
  • a promoter region containing a vertebrate promoter, particularly a mammalian promoter, and a baculovirus promoter, and a gene region encoding the amino acid sequence of a protein capable of being a component of viral particles may be used, and the required components can be inserted by optionally cleaving such a commercially available expression vector with restriction enzymes and incorporating other promoter to insert a fused DNA sequence of a foreign gene having the desired immunogenicity and a gene encoding the amino acid sequence of a protein capable of being a component of viral particles into the cloning region of the vector, or by inserting a foreign gene having the desired immunogenicity into the N terminus side of the DNA region of a gene encoding the amino acid sequence of a protein capable of being a component of viral particles, already incorporated in a plasmid.
  • the plasmid vector having a structure capable of expressing a foreign protein having the desired immunogenicity. as an antigenic protein in both insect cells and vertebrate cells, particularly mammalians cells may be produced by using a commercially available plasmid already having a partial structure thereof.
  • the amino acid sequence of a peptide for cleaving the fusion protein with enzymes in vertebrate cells may intervene.
  • an enhancer for increasing the transcription activity in vertebrate cells may be disposed upstream of the two promoters, or a DNA sequence encoding the amino acid sequence of a signal peptide for facilitating extracellular secretion of the expressed protein from host cells may be bound to the gene to be fused and expressed.
  • a vertebrate terminator region such as a rabbit ⁇ globin terminator, which is effective in vertebrate cells, may be disposed downstream of the gene to be fused and expressed.
  • a transfer vector capable of expressing a fusion gene of an immunogenic foreign gene capable of expressing the desired immunogenicity in baculovirus particles and a gene encoding the amino acid sequence of a protein capable of being a component of viral particles can be thereby produced.
  • Specific examples of the transfer vector and the method for production thereof according to the present invention are as shown in the Examples described later. More specifically, transfer vectors having a structure in which a CAG promoter modified from a cytomegalovirus (CMV) promoter as a vertebrate promoter, particularly a mammalian promoter, and a polyhedrin
  • polypeptide (polh) promoter, vp39 promoter, or gp64 promoter as a baculovirus promoter are linked to each other, and a fused DNA sequence of an influenza virus antigen gene or malaria antigen gene as a foreign gene and a gp64 antigen gene as a gene encoding the amino acid sequence of a protein capable of being a component of the viral particle is inserted can be mentioned as examples of pCAP- PfCSP, pCAP-PfCSP/272, pCAP-PfCSP/467, pCAP-PfCSP (A361E) , pCAP- PfCSP (A361E) /272, pCAP-PfCSP(A361E) /467, pCAP-PfCSP-76, pCAP- PfCSP-76/467, pCAP-PfCSP+209, pCAP-PfCSP+209/467, pCAP- PfCSP+76/209,
  • the present invention provides a method of producing a recombinant baculovirus comprising the step of producing a transfer vector having a structure in which a fusion gene containing at least one gene encoding a protein capable of being a component of the viral particle and at least one immunogenic foreign gene is incorporated downstream of a dual promoter consisting of two linked promoters, i.e., one vertebrate promoter and one baculovirus promoter, and the step of co-transfecting the transfer vector and a baculovirus DNA into a host cell and isolating the recombinant baculovirus.
  • the method of introducing the desired recombinant DNA (transfer vector) into the host cell and the method of transformation thereby are not particularly limited.
  • Various methods that are well known and commonly used in this field can be used.
  • general genetic recombination techniques e.g., Science, 224, 1431 (1984); Biochem. Biophys. Res. Coirim. , 130, 692 (1985); Proc. Natl. Acad. Sci. USA, 80, 5990 (1983) can be used to prepare the recombinant baculovirus.
  • the recombinant DNA (transfer vector) can be expressed and produced with reference to Ohno et al., "Tanpaku Jikken Protocol 1 Functional Analysis, Saibo Kogaku Bessatsu, Jikken Protocol Series, 1997, Shujun-sha".
  • the general methods used for the handling of insect cells, gene recombination, and co-transfection may be the same as well-known methods of producing a recombinant virus in insect cells (BACULOVIRUS EXPRESSION VECTORS: A LABORATORY MANUAL, Oxford University Press, 1994) .
  • the resulting recombinant baculovirus can be cultured in accordance with standard methods.
  • a fusion product (expressed product) of the DNA of a foreign gene having the desired immunogenicity with the DNA encoding the amino acid sequence of a protein capable of being a component of viral particles of the present invention is expressed and produced (accumulated and secreted) inside, outside, or on the cell membrane of insect cells by the culturing of the baculovirus.
  • various commonly used media can be selectively used according to the host cell used.
  • the culture can be performed under conditions suitable for the growth of the host cell.
  • the method of producing the recombinant baculovirus comprises the step of preparing a baculovirus DNA to be subjected to homologous recombination with a transfer vector produced above, and the step of co-transfecting the transfer vector and the baculovirus DNA into insect cells, such as Sf9 cells and Sf21 cells derived from Spodoptera frugiperda, and Tn5 cells (High Five cells) derived from Trichoplusia ni, as host cells.
  • insect cells such as Sf9 cells and Sf21 cells derived from Spodoptera frugiperda
  • Tn5 cells High Five cells
  • the baculovirus DNA thus produced to be subjected to homologous recombination with the transfer vector may be a wild type, mutant, or recombinant baculovirus DNA.
  • the baculovirus DNA can enhance the probability of its homologous recombination with the transfer vector of the present invention as long as it has a DNA structure homologous to the baculovirus-derived DNA containing DNA of the dual promoter region, and DNA of a fusion gene obtained by fusion of an immunogenic foreign gene and a gene encoding a protein capable of being a component of viral particles.
  • the mixing ratio of the transfer vector to the baculovirus DNA by weight is preferably about 1:1 to about 10:1.
  • the cells are cultured, and viral plaques are obtained from the culture supernatant and then suspended in a medium.
  • the virus is eluted from agar by vortex and centrifuged to yield a solution containing the recombinant virus.
  • commercially available products may be used as the baculovirus DNA.
  • BacVector-1000 DNA and BacVector-2000 DNA supplied from Novagen in which the polyhedrin gene has been removed from AcNPV can be used.
  • the co-transfection for the homologous recombination of the obtained transfer vector and baculovirus DNA into insect cells can be performed using a commercially available vector transfection kit (BacVector Transfection Kits, supplied from Novagen) as described above in accordance with the instructions packaged with the vector transfection kit.
  • the obtained transfer vector can be co-transfected together with the baculovirus DNA into insect cells such as Sf9 cell to yield a recombinant baculovirus .
  • a transfer vector that is any one of pCAP-PfCSP, pCAP-PfCSP/272, pCAP-PfCSP/467, pCAP-PfCSP(A361E) , pCAP-PfCSP (A361E) /272, pCAP-PfCSP (A361E) /467, pCAP-PfCSP-76, pCAP-PfCSP-76/467, pCAP-PfCSP+209, pCAP- PfCSP+209/467, pCAP-PfCSP+76/209, pCAP-PfCSP+76/209/467, pCAP- HAl/Anhui, pCAP-HAl/Anhui/272, pCAP-HAl/Anhui/467, pCAP- HAl/Vietnam, pCAP-HAl
  • other methods of producing a recombinant baculovirus include, for example, a method of using a transposon as a phagemid (bacmid) having the entire baculovirus genome incorporated therein to efficiently insert a foreign gene into Escherichia coli.
  • a bacmid bearing a viral gene is extracted from bacterial cells and transfected into insect cells to thereby easily produce and collect a recombinant baculovirus .
  • the purification of the recombinant baculovirus of the present invention obtained by the above method of producing a recombinant baculovirus can be performed by using known virus purification methods.
  • a stock virus obtained by the above method of producing a recombinant baculovirus is inoculated into insect cells (1 x 10 7 cells/10 cm dish) , such as Sf9 cells, the culture supernatant is collected several days after the infection, and a virus pellet obtained by centrifugation is suspended in a buffer, such as PBS.
  • the resulting suspension is subjected to a sucrose gradient of 10 to 60%, and then centrifuged (25,000 rpm,
  • the infectivity titer of the above resulting purified recombinant virus can be measured by plaque assay (BACULOVIRUS EXPRESSION VECTORS: A LABORATORY MANUAL, Oxford University Press, 1994) using insect cells such as Sf9 cells.
  • the N terminus of the baculovirus protein gp64 is exposed outside the particle, whereas the C terminus thereof is inside the particle. Therefore, if the protein encoded by a foreign gene having the desired immunogenicity is fused to the N terminus of gp64, the entity thereof is exposed as a component of the viral particle outside the viral protein particle in insect cells, and thus the antigen is more easily presented, which is suitable for use as the vaccine formulation of the present invention.
  • Pharmaceutical Composition of the Present Invention (Pharmaceutical Containing the Recombinant Baculovirus of the Present Invention as an Active Ingredient)
  • the recombinant baculovirus of the present invention which is an active ingredient of the pharmaceutical composition of the present invention, can be obtained by the genetic engineering techniques shown in the above (2) .
  • the pharmaceutical composition of the present invention essentially contains as the active ingredient a recombinant baculovirus obtained by homologous recombination of a baculovirus DNA and a transfer vector constructed so that a fusion gene obtained by the fusion of an immunogenic foreign gene of the present invention to a gene encoding the amino acid sequence of a protein capable of being a component of the viral particle can be expressed in insect cells and vertebrate cells, particularly cells of mammalians, including humans.
  • the present invention particularly provides a pharmaceutical composition
  • a specific recombinant baculovirus that is any one of AcNPV-CAP- PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E) , AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP-CAP-
  • the recombinant baculovirus of the present invention that is any one of AcNPV-CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV- CAP-PfCSP/467, AcNPV-CAP-PfCSP (A361E) , AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP-PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP- 76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-
  • the recombinant baculovirus can be used for the treatment of diseases associated with infection of target cells and tissues.
  • target cells affected by such infection include blood cells, hepatic cells, renal cells, brain cells, lung cells, epithelial cells, and muscular cells.
  • tissues comprising such cells include the lung, liver, kidney, brain, arteries and veins, the stomach, intestines, urethra, skin, and muscle.
  • the pharmaceutical composition enhances infection- preventing effects against infectious antigens, for example, malaria antigens such as sporozoite surface antigens (CSP and TRAP) of malaria parasites, merozoite surface membrane protein MSPl, malaria S antigen secreted from erythrocytes infected with malaria, PfEMPl protein present in the knobs of erythrocytes infected with malaria, SERA protein, TRAMP protein, AMAl protein, and Pfs25 known as a transmission-blocking antigen; and influenza antigens such as HA antigen, NA antigen, M2 antigen, and NP antigen, and reduces the infectivity titer (e.g., viral infectivity titer) , thereby increasing the survival period and survival rate of mammals including humans, compared to the group not administered the pharmaceutical composition of the present invention. Therefore, the pharmaceutical composition is particularly useful as a preventive or therapeutic agent for malaria and influenza virus infections.
  • malaria antigens such as sporozoite surface
  • the pharmaceutical composition of the invention has the action of enhancing infection-preventing effects against infectious antigens and reducing the infectivity titers, and is therefore useful as a preventive or therapeutic agent for infectious diseases caused by pathogens such as influenza viruses and malaria, and complications thereof.
  • a chicken influenza vaccine By using a gene immunogenic to non-human vertebrates as an immunogenic foreign gene of the transfer vector to obtain a recombinant baculovirus used as an active ingredient of the pharmaceutical composition of the present invention, for example, a chicken influenza vaccine can be prepared, which has the action of enhancing infection-preventing effects against the infectious antigen and reducing the infectivity titer. By utilizing this action and activity, the pharmaceutical composition can be used for the treatment of diseases associated with the infection of target cells and tissues.
  • the pharmaceutical composition of the present invention can be prepared as a composition containing a pharmaceutically effective amount of the recombinant baculovirus of the invention and a pharmaceutically acceptable carrier.
  • the infection-preventing effect of the recombinant baculovirus of the present invention in vertebrates, particularly mammals, including humans, or mammalian cells can be provided, for example, by administering the pharmaceutical composition containing the recombinant baculovirus of the present invention and additives for pharmaceutical administration to vertebrates, particularly mammals, including humans, by the intramuscular, subcutaneous, intracutaneous, intraperitoneal, nasal, or respiratory route, and then immunizing the vertebrates with the pharmaceutical composition containing the recombinant baculovirus of the present invention as an active ingredient several times. Respiratory administration of the pharmaceutical composition of the invention is particularly preferable.
  • the infection-preventing effect can be evaluated by comparing the survival rate of vertebrates, particularly mammals, including humans, that have been immunized with the pharmaceutical composition of the invention several times and then infected with a target pathogen with the survival rate of those not administered with the pharmaceutical composition.
  • Vaccine of the present invention
  • the recombinant baculovirus that is any one of AcNPV- CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E), AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HAl/V
  • CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP- CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl- PfCSP-gp64 used as the active ingredient of the pharmaceutical composition of the present invention can enhance pathogen infection-preventing effects as described in the Examples below, and an expressed fusion product of the DNA sequence obtained by fusion of a gene encoding the amino acid sequence of a protein capable of being a component of viral particles and a foreign gene with the desired immunogenicity of the present invention capable of reducing the infectivity titer is produced as viral particles budded from insect cells.
  • the pharmaceutical composition of the invention When the pharmaceutical composition of the invention is administered in the form of viral particles to vertebrates, particularly mammals, including humans, a foreign antigen protein contained as a component of viral particles promotes acquired immunity (humoral immunity and cellular immunity) , and further, the antigenic protein as an expressed product of the fusion DNA sequence seems to promote acquired immunity (humoral immunity and cellular immunity) in vertebrate cells, particularly cells of mammals, including humans.
  • the recombinant baculovirus of the present invention is useful as a vaccine.
  • the present invention particularly provides a vaccine containing as an active ingredient a specific recombinant baculovirus that is any one of AcNPV-CAP-PfCSP, AcNPV-CAP- PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP-PfCSP (A361E) , AcNPV- CAP-PfCSP (A361E) /272, AcNPV-CAP-PfCSP (A361E) /467, AcNPV-CAP- PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP- PfCSP+209/467, AcNPV-CAP-PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-CAP-PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNP
  • the vaccine enhances infection-preventing effects against infectious antigens such as malaria antigens such as sporozoite surface antigens (CSP and TRAP) of the malaria parasite, merozoite surface membrane protein MSPl, malaria S antigen secreted from erythrocytes infected with malaria, PfEMPl protein present in the knobs of erythrocytes infected with malaria, SERA protein, TRAMP protein, and AMAl protein; and influenza antigens such as influenza virus HA antigen, influenza virus NA antigen, influenza virus M2 antigen, and influenza virus NP antigen; the vaccine also reduces the infectivity titer (e.g., the viral infectivity titer) , thereby increasing the survival period and survival rate of mammals, including humans, compared with the group not administered with the pharmaceutical composition of the present invention.
  • the vaccine is particularly useful as a preventive or therapeutic agent for malaria and influenza virus infection.
  • the vaccine of the invention enhances infection- preventing effects against infectious antigens and reduces the infectivity titer, and is therefore useful as a preventive or therapeutic agent for infectious diseases caused by pathogens such as influenza viruses and malaria, and complications thereof.
  • a gene immunogenic to non-human vertebrates as an immunogenic foreign gene of the transfer vector to obtain a recombinant baculovirus used as an active ingredient of the pharmaceutical composition of the present invention, for example, a chicken influenza vaccine, that can enhance infection- prevention effects against the infectious antigen and reduce the infectivity titer, can be prepared.
  • the vaccine can be used for the treatment of diseases associated with the infection of target cells and tissues.
  • the recombinant baculovirus that is any one of AcNPV- CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E) , AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP-CAP-
  • target cells affected by such infection include blood cells, hepatic cells, renal cells, brain cells, lung cells, epithelial cells, and muscular cells.
  • tissues containing such cells include lung, liver, kidney, brain, arterial and venous veins, stomach, intestine, urethra, skin, and muscle tissues.
  • the vaccine of the present invention can be prepared as a pharmaceutical composition of the above (3) containing a pharmaceutically effective amount of the recombinant baculovirus of the invention (any one of AcNPV-CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP-PfCSP (A361E), AcNPV-CAP- PfCSP (A361E) /272, AcNPV-CAP-PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-
  • a pharmaceutically effective amount of the recombinant baculovirus of the invention any one of AcNPV-CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP
  • the vaccine can be prepared in the form of a pharmaceutical composition by using a pharmaceutically acceptable carrier as used in the pharmaceutical composition of the above (3) , according to a standard method.
  • a pharmaceutically acceptable carrier as used in the pharmaceutical composition of the above (3) , according to a standard method.
  • carriers include physiologically acceptable solutions, such as sterile saline and sterile buffered saline.
  • the vaccine (the formulation is hereinafter the same as in the pharmaceutical composition) can be prepared as a liposomal formulation containing as an active ingredient the recombinant baculovirus of the invention (any one of AcNPV-CAP- PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E), AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP-
  • PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HA
  • the liposomal formulation may be one in which the recombinant baculovirus of the present invention is retained in a liposome containing an acidic phospholipid as a membrane component, or containing a neutral phospholipid and an acidic phospholipid as membrane components.
  • the acidic phospholipid and neutral phospholipid used as membrane components are not particularly limited, and various lipids commonly used for liposomal formulations can be used alone or in a combination of two or more.
  • the liposome membrane is produced in accordance with a standard method by using an acidic phospholipid alone or together with a neutral phospholipid.
  • an acidic phospholipid is used together with a neutral phospholipid
  • the proportion of the acidic phospholipids in the liposome membrane components is preferably about 0.1 to about 100 mol%, more preferably 1 to 90 mol%, and even more preferably about 10 to about 50 mol%.
  • the liposome for example, cholesterol or the like can be added. This can control the fluidity of phospholipids and facilitates the liposome preparation.
  • the cholesterol is preferably added in an equivalent amount or less, and preferably in a 0.5-fold amount to an equivalent amount by weight, to the phospholipid.
  • the mixing ratio of the acidic phospholipid to the active ingredient in the liposomal formulation is about 0.5 to about 100 equivalents, preferably about 1 to about 60 equivalents, and more preferably about 1.5 to about 20 equivalents.
  • the recombinant baculovirus of the present invention as an active ingredient is used in an amount of several mol% to several tens mol%, preferably about 5 to about 10 mol%, and usually around 5 mol%, based on the total amount of the lipids.
  • the production, concentration, and particle diameter control of the liposomal formulation can be performed in accordance with standard methods. If desired, the various additives as described above can also be incorporated into the liposomal formulation.
  • the recombinant baculovirus of the invention as an active ingredient can be used in the form of being bound to a fatty acid (e.g., behenic acid, stearic acid, palmitic acid, myristic acid, and oleic acid) , an alkyl group, a cholesteryl group, or the like.
  • a fatty acid e.g., behenic acid, stearic acid, palmitic acid, myristic acid, and oleic acid
  • alkyl group e.g., behenic acid, stearic acid, palmitic acid, myristic acid, and oleic acid
  • a cholesteryl group e.g., cholesteryl group
  • the liposomal formulation containing such bound components can also be produced in accordance with a standard method (see, for example, Long Circulating Liposomes: Old Drugs, New Therapeutics., M. C. Woodle, G. Storm, Eds: Springer-Verlag
  • the vaccine (pharmaceutical composition) of the present invention can preferably be used as a vaccine composition.
  • the vaccine is preferably used in combination with a pharmaceutically effective amount of an adjuvant to enhance the anti-infection (anti-malaria or anti-influenza) effects.
  • any adjuvant commonly used for this type of vaccine can be used as the adjuvant.
  • adjuvants include Freund's complete adjuvant, muramyl dipeptide, aluminium hydroxide, BCG, IL-12, N-acetylmuramine-L-alanyl-D-isoglutamine (MDP), thymosin ⁇ l, and QS-21.
  • the amount of adjuvant used can be suitably selected according to the degree of symptoms, such as softening of the skin, pain, erythema, fever, headache, and muscular pain, which might be expressed as part of the immune response in humans or animals after the administration of this type of vaccine.
  • the vaccine (pharmaceutical composition) of the present invention may be used in combination with other publicly known pharmaceutical products, such as immune response-promoting peptides and antibacterial agents (synthetic antibacterial agents) .
  • the vaccine may further contain other drugs and additives.
  • drugs that aid intracellular uptake of the recombinant baculovirus of the present invention such as calcium ions.
  • the liposome, and other drugs and additives that facilitate the transfection such as fluorocarbon emulsifiers, cochleates, tubules, golden particles, biodegradable microspheres, and cationic polymers, can also be used.
  • the amount of the active ingredient contained in the vaccine (pharmaceutical composition) (drug) of the present invention is not particularly limited and can be selected from a wide range as long as it is a pharmaceutically effective amount.
  • the dosage of the vaccine (pharmaceutical composition) is not particularly limited, and can be appropriately selected from a wide range according to the desired therapeutic effect, the administration method (administration route) , the therapeutic period, the patient's age, gender, and other conditions, etc.
  • the recombinant baculovirus as an active ingredient of the vaccine (pharmaceutical composition) of the present invention is administered to a human
  • the recombinant baculovirus is administered in an amount corresponding to 10 2 to 10 14 PFU, preferably 10 5 to 10 12 PFU, and more preferably 10 6 to 10 10 PFU per patient, calculated as the PFU of the recombinant virus .
  • the dosage of the recombinant baculovirus any one of
  • AcNPV-CAP-PfCSP AcNPV-CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV- CAP-PfCSP (A361E) , AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HAl/Vietnam
  • the vaccine (pharmaceutical composition) of the present invention is administered by directly injecting a recombinant baculovirus suspension prepared by suspending the recombinant baculovirus in PBS (phosphate buffered saline) or saline into a local site (e.g., into the lung tissue, liver, muscle or brain) , or by nasal or respiratory inhalation, or by intravascular (e.g., intra-arterial, intravenous, and portal venous) , subcutaneous, intracutaneous, or intraperitoneal administration.
  • the vaccine of the invention is preferably administered by respiratory inhalation.
  • the vaccine (pharmaceutical composition) of the present invention is preferably administered more than once. More specifically, after the initial administration, additional vaccinations are preferably performed once to several times while . the condition is observed. This can enhance the desired effect.
  • booster immunization with a pharmaceutical composition containing the recombinant baculovirus of the present invention any one of AcNPV-CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP-PfCSP (A361E) , AcNPV-CAP- PfCSP (A361E) /272, AcNPV-CAP-PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP- PfCSP+209/467, AcNPV-CAP- PfCSP+209,
  • the recombinant baculovirus used as one of the active ingredients of the vaccine (pharmaceutical composition) of the invention, is generally prepared by homologous recombination of a baculovirus DNA and a transfer vector into which a fusion gene obtained by fusion of a foreign gene having the desired immunogenicity and a gene encoding a protein capable of being a component of viral particles has been introduced.
  • the recombinant baculovirus is mixed, in an injectable dosage form (a solution, suspension or emulsion), with a pharmaceutically acceptable carrier (i.e., nontoxic to humans and other vertebrates in the dosage and concentration used, and compatible with other ingredients in the formulation) to produce a formulation.
  • a pharmaceutically acceptable carrier i.e., nontoxic to humans and other vertebrates in the dosage and concentration used, and compatible with other ingredients in the formulation.
  • the formulation thus obtained does not contain oxidizing agents or any other compound that is publicly known to be harmful to recombinant baculovirus .
  • the carrier may contain a trace amount of additives, such as substances that enhance the isotonicity and chemical stability.
  • additives are non-toxic to mammals, including humans, in the dosage and concentration used, and examples thereof include buffers such as phosphoric acid, citric acid, succinic acid, acetic acid, and other organic acids, and salts thereof; antioxidants such as ascorbic acid; low molecular weight (e.g., less than about 10 residues) polypeptides (e.g., polyarginine and tripeptide) proteins (e.g., serum albumin, gelatin, and immunoglobulin); amino acids (e.g., glycine, glutamic acid, aspartic acid, and arginine) ; monosaccharides, disaccharides, and other carbohydrates (e.g., cellulose and derivatives thereof, glucose, mannose, and dextrin) , chelating agents (e.g., EDTA); sugar alcohols (e.g., mannitol and sorbi
  • the pharmaceutical vaccine (composition) containing the recombinant baculovirus can typically be stored as an aqueous solution or a lyophilized product in a unit or multiple dose container such as a sealed ampoule or a vial.
  • the present invention further provides a method of preventing malaria or influenza infection, or a method of treating malaria or influenza, comprising administering an effective amount of the recombinant baculovirus, vaccine, formulation, and pharmaceutical composition of the invention to a subject.
  • the present invention further provides a method of immunostimulation comprising administering an effective amount of the recombinant baculovirus, vaccine, formulation, and pharmaceutical composition of the invention to a subject.
  • the subjects used include those that may be infected with malaria parasites or influenza viruses, such as humans and other animals (such as mammals, birds, reptiles, fish, and amphibians) , and those infected with malaria parasites or influenza viruses.
  • influenza virus with which the subject is infected is preferably an influenza A virus, and more preferably an influenza A subtype Hl virus, or an influenza A subtype H3 virus.
  • influenza parasites include Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale.
  • the recombinant baculovirus of the present invention is formed alone or together with a pharmaceutically acceptable carrier into a vaccine, formulation, or pharmaceutical composition, and administered to the subject.
  • the administration route may be, for example, any administration route mentioned above.
  • the pharmaceutically acceptable carrier for use in the present invention can be suitably selected from carriers commonly used in this technical field, according to the form of the pharmaceutical composition to be produced.
  • the pharmacological composition when the pharmacological composition is formed into an aqueous solution, purified water (sterile water) or a physiological buffer solution can be used as the carrier.
  • purified water sterile water
  • a physiological buffer solution When the pharmaceutical composition is formed into other appropriate solutions, organic esters capable of being injected, such as glycol, glycerol and olive oil, can be used as the carrier.
  • the composition may contain stabilizers, excipients and the like commonly used in this technical field, and particularly in the field of vaccine formulations.
  • the amount of recombinant baculovirus in the vaccine, formulation, or pharmaceutical composition of the present invention is not particularly limited, and can be suitably selected from a wide range. In general, the amount of recombinant baculovirus in the composition is preferably about 0.0002 to about 0.2 (w/v %) , and more preferably 0.001 to 0.1 (w/v %) .
  • the administration method of the recombinant baculovirus, vaccine, formulation, or pharmaceutical composition of the invention is not particularly limited, and can be suitably selected according to the dosage form, the patient's age, gender and other conditions, the severity of the disease, etc.
  • a preferable dosage form thereof is a form for parenteral administration, such as injections, drops, nasal drops, and inhalants. When the composition is formed into an injection or drops, the injection can be intravenously administered as mixed with a replacement fluid such as a glucose solution or an amino acid solution as required, or can be administered intramuscularly, intracutaneously, subcutaneously or intra
  • the daily dosage of the recombinant baculovirus, vaccine, formulation, or pharmaceutical composition of the present invention may vary depending on the subject's condition, body weight, age, gender, etc., and therefore cannot be completely specified. However, the dosage is usually such that the recombinant baculovirus is administered in an amount of 0.001 to 100 mg per kg of body weight per day.
  • the vaccine, formulation, or composition of the invention can be administered in one or more administrations per day.
  • the recombinant baculovirus as an active ingredient of the vaccine (formulation or pharmaceutical composition) of the present invention
  • the recombinant baculovirus is administered in an amount corresponding to 10 2 to 10 14 PFU, preferably 10 5 to 10 12 PFU, and more preferably 10 6 to 10 10 PFU per patient, calculated as the PFU of the recombinant virus.
  • the vaccine (composition) of the present invention is administered according to Good Medical Practice, considering the clinical condition (for example, the condition to be prevented or treated) of each patient, the delivery site of the vaccine (composition) containing the recombinant baculovirus, the target tissue, the administration method, the dosage regimen, and other factors publicly known to those skilled in the art. Therefore, the proper dosage of the vaccine (composition) herein is determined in consideration of the above.
  • Example 1 Transfer Vector Plasmid and Method for Production thereof of the Present Invention
  • Hsp65 Construction of Transfer Vector Plasmids pCAP-PfCSP, pCAP- PfCSP/272, and pCAP-PfCSP/467 of the Present Invention (1.1) Construction of Plasmid pBACsurf-Hsp65 An Hsp65 gene was obtained by extracting genomic DNA from M. tuberculosis H37Rv strain using a QIAamp DNA Midi Kit (Qiagen) , and cloning by PCR. More specifically, the genomic DNA extracted from the M.
  • tuberculosis H37Rv strain was amplified by PCR using primers phsp65-Fl (5' - AATAATAGATCTAATGGCCAAGACAATTGCGTACGACGAAGA -3' (SEQ ID NO: 1) ; the BgIII site is underlined) and phsp65-Rl (5' -
  • PCR product was purified, cleaved with restriction enzymes BgIII and Notl, ligated to pcDNA3.1(+) (from Invitrogen) digested with BamHI and Notl.
  • the resulting plasmid was designated pcDNA-hsp65.
  • PCR was performed with pcDNA-hsp65 as a template using primers phsp65-F2
  • AATTGCGTACGACGAAGAGGCC - 3' (SEQ ID NO: 3); the Sse8387I and EcoRI sites are underlined, and the FLAG sequence is italicized) , and phsp65-R2 (5' - CCCGGGCGAAATCCATGCCACCCATGTCGCCGCCACC - 3' (SEQ ID NO: 3); the Sse8387I and EcoRI sites are underlined, and the FLAG sequence is italicized) , and phsp65-R2 (5' - CCCGGGCGAAATCCATGCCACCCATGTCGCCGCCACC - 3' (SEQ ID NO: 3); the Sse8387I and EcoRI sites are underlined, and the FLAG sequence is italicized) , and phsp65-R2 (5' - CCCGGGCGAAATCCATGCCACCCATGTCGCCGCCACC - 3' (SEQ ID NO: 3); the Sse8387I and EcoRI sites are
  • Hsp65 gene DNA fragment was cloned into pENTR/D-TOPO (from Invitrogen), then cleaved with Sse8387I/Cfr9l and inserted into the PstI/Cfr9I site of pBACsurf-CSP (Yoshida et al., Virology 316: 161-70, 2003).
  • PCR was performed with pBACsurf-1 (from Novagen) as a template using primers pPolh-F2 (5' - CACCCGGACCGGATAATTAAAATGATAACCATCTCGCAAATAAATAAG - 3' (SEQ ID NO: 5); the RsrII site is underlined), and pgp64-R2 (5' - GGTACCATATTGTCTATTACGGTTTCTAATCATAC - 3' (SEQ ID NO: 6) ; the Kpnl site is underlined) .
  • the resulting gp64 gene DNA fragment was inserted into pENTR/D-TOPO to construct a plasmid pENTR-gp64.
  • the plasmid thus constructed was designated pENTR-gp64.
  • the pENTR- Hsp65-gp64 was cleaved with RsrII/Kpnl, and a DNA fragment consisting of a polyhedrin promoter and hsp65-gp64 gene was inserted into pTriEx-3.1 (Novagen) cleaved with RsrII and Kpnl to construct a transfer vector plasmid pDual-Hsp65-gp64 enabling the expression of a fusion protein of Hsp65 antigen and gp64 protein in mammalian and insect cells under the control of the desired dual promoter consisting of CMA promoter and polyhedrin promoter.
  • GCCCGGGCGATGCATATTCTGCA - 3 (SEQ ID NO: 8); the Sbfl site is underlined) .
  • the resulting influenza virus HA gene fragment was cloned into pCR-Blunt II-TOPO (from Invitrogen) .
  • the resulting plasmid was designated as pCR-Blunt-HA.
  • PCR was performed with the pCR-Blunt-HA as a template using primers pHA-Fl (5' -
  • PCR was performed with pBACsurf-HAl as a template using Polh-f RsrII (5' - GGGCGGACCGGATAATTAAAATGATAACCATCTCG - 3' (SEQ ID NO: 11) ; the RsrII site is underlined) and GP64-r DraIII (5' - GGGCACTTAGTGATATTGTCTATTACGGTTTCTAATC - 3' (SEQ ID NO: 12); the DraIII site is underlined) .
  • the resulting DNA fragment was inserted into pDual-HlNl/HAl-gp64 digested with RsrII and DraIII to yield pCP-HlNl/HAl-gp64.
  • Plasmid pCAP-HlNl/HAl-gp64 was cleaved with restriction enzymes RsrII and DraIII to prepare HAl and gp64 gene fragments.
  • the fragments were inserted into a vector prepared by digesting pTriEx-1.1 (from Novagen) with restriction enzymes RsrII and DraIII to yield a transfer vector plasmid pCAP-HlNl/HAl-gp64 enabling the expression of a fusion protein of HAl antigen and gp64 protein in mammalian and insect cells under the control of the desired dual promoter consisting of CAG promoter and polyhedrin promoter.
  • RT-PCR was performed with genomic RNA of influenza virus PR/8/34 strain as a template using NP-f EcoRI (5' - ACGGAATTCCATTCAATTCAAACTGGA - 3' (SEQ ID NO: 13); the EcoRI site is underlined) and NP-r Cfr9I (5' -
  • GACTCCCCGGGTCGAGCACCGAGTCAAGAAG - 3' (SEQ ID NO: 15); the Xmal site is underlined), gp64(467)-f (5' -
  • GACTCCCCGGGACATCACTTCCATGGCTGAA -3' (SEQ ID NO: 16) ; the Xmal site is underlined), and GP64-r DraIII (5'-
  • GGGCACTTAGTGATATTGTCTATTACGGTTTCTAATC-3' (SEQ ID NO: 12); the DraIII site is underlined) of pCAP-HlNl/HAl-gp64.
  • the obtained fragments were digested with restriction enzymes Xmal and DraIII, and inserted into pCAP-HlNl/NP-gp64 digested with Xmal and DraIII to yield pCAP-HlNl/NP/272 and pCAP-HlNl/NP/467.
  • the PCR was performed using primers PfCSP- f (19) (5' - GACTCTGCAGTTATTCCAGGAATACCAGTGCTATGGAAG - 3' (SEQ ID NO: 17); the Pstl site is underlined) and PfCSP-r (373) (5' - CGATCCCGGGCTTTTTCCATTTTACAAATTTTTTTTTCAATATC - 3' (SEQ ID NO: 18) ; the Xmal site is underlined) .
  • the resulting DNA fragment was inserted into pCAP-HlNl/NP-gp64, pCAP-HlNl/NP/272, and pCAP- H1N1/NP/467, each digested with Pstl and Xmal.
  • the constructed plasmids were designated pCAP-PfCSP, pCAP-PfCSP/272, and pCAP- PfCSP/467.
  • GenBank accession number of the amino acid sequence of the Plasmodium falciparum 3D7 circumporozoite (CS) protein is XP_001351122.
  • a blood sample was collected from a BALB/c mouse infected with malaria parasite P. berghei ANKA strain, and P. berghei genomic DNA was extracted using a QIAamp DNA Midi Kit (Qiagen) .
  • a PbAMAl gene domain 123 (D123) was cloned by PCR with this genomic DNA as a template according to the following method.
  • PCR was performed using primers pAMA-Fl (5' - CACCGAATTCAATCCATGGGAAAAGTATACGGAAAAATAT - 3' (SEQ ID NO: 19); the EcoRI site is underlined) and pAMAl-Rl (5' -
  • a PfCSP gene was cloned by PCR with P. falciparum genomic DNA as a template according to the following method.
  • PCR was performed using primers pPfCSP-Fl (5' - CACCGAATTCTTATTCCAGGAATACCAGTGCTATGGAAGT-3' (SEQ ID NO: 21); the
  • a Pfs25 gene was cloned by PCR with P. falciparum genomic DNA as a template according to the following method.
  • a PfMSPl gene was cloned by PCR with P. falciparum genomic DNA as a template according to the following method.
  • the PCR was performed using primers pPfMSP119-Fl (5' - CACCGAATTCAACATTTCACAACACCAATGCGTAAAAAAAC - 3': (SEQ ID NO: 25); the EcoRI site is underlined) and pPfMSP119-R2 (5' - CAATTGAGATCCGCCGCCACCGCCACCGTTAGAGGAACTGCAGAAAATACCATCGAAAAGTGGA - 3' (SEQ ID NO: 26) ; the Muni site is underlined) .
  • the resulting PfMSPH9 DNA fragment was cloned into pENTR/D-TOPO, then cleaved with EcoRI and Muni, and inserted into pDual-PbCSP-gp64 digested with EcoRI.
  • the constructed plasmid was designated pDual-PfMSPl- PfCSP-gp64.
  • PCR was performed with pCAP-PfCSP using PfCSP- f(19) (5' -GACTCTGCAGTTATTCCAGGAATACCAGTGCTATGGAAG-S' : (SEQ ID NO: 17); the Pstl site is underlined) and PfCSP-r(373 A361E) (5'- CGATCCCGGGCTTTTTCCATTTTACAAATTTTTTTTTCAATATCATTTTC-S' : (SEQ ID NO: 27); the Xmal site is underlined).
  • the obtained DNA fragment was cleaved with Pstl and Xmal, and inserted into pCAP-HlNl/NP- gp64, pCAP-HlNl/NP/272, and pCAP-HlNl/NP/467, each digested with Pstl and Xmal.
  • the constructed plasmids were designated pCAP- PfCSP(A36lE), pCAP-PfCSP(A361E)/272, and pCAP-PfCSP(A361E)/467.
  • PCR was performed with pCAP-PfCSP(A361E) using PfCSP- f(76) (5' -GACTCTGCAGGATGATGGAAATAACGAAGACAACG - 3': (SEQ ID NO: 28); the Pstl site is underlined) and PfCSP-r(373 A361E) (5' - CGATCCCGGGCTTTTTCCATTTTACAAATTTTTTTTTTTCAATATCATTTTC - 3' : (SEQ ID NO: 27) ; the Xmal site is underlined) .
  • the resulting DNA fragment was cleaved with Pstl and Xmal, and then inserted into pCAP- HlNl/NP-gp64 and pCAP-HlNl/NP/467, each cleaved with Pstl and Xmal.
  • the constructed plasmids were designated pCAP-PfCSP-76 and pCAP-PfCSP-76/467.
  • PfCSP+ SEQ ID NO: 29
  • PfCSP-f (+209)
  • PfCSP-r (+A361E
  • PfCSP+ SEQ ID NO: 29
  • PCR was performed using PfCSP-f (+76) (5'- GACTCTGCAGGACGACGGCAACAACGAAGACAACG -3' (SEQ ID NO: 32); the Pstl site is underlined), PfCSP-r (+128) (5'-
  • CGATCCCGGGCTTTTTCCATTTTGCAAATTTTTTT -3' (SEQ ID NO: 31) ; the Xmal site is underlined) from the obtained artificial gene sequence.
  • the resulting DNA fragments were cleaved with Pstl/BamHl and BamHl/Xmal, respectively, and then inserted into pCAP-HlNl/NP- gp64 and pCAP-HlNl/NP/467, each digested with Pstl and Xmal.
  • the constructed plasmids were designated pCAP-PfCSP+76/209 and pCAP- PfCSP+76/209/467.
  • PCR was performed using AH-Fl (5'- CAGTCTGCAGGACCAGATTTGCATC-3' : (SEQ ID NO: 36) ; the Pstl site is underlined) and AH-R4 (5'-CAGTCCCGGGCTCTCTTGCGCCTGC-S' : (SEQ ID NO: 37) ; the Xmal site is underlined) .
  • the obtained DNA fragment was cleaved with Pstl and Xmal, and then inserted into pCAP- HlNl/NP-gp64, pCAP-HlNl/NP/272 and pCAP-HlNl/NP/467, each digested with Pstl and Xmal.
  • the constructed plasmids were designated pCAP-HAl/Anhui, pCAP-HAl/Anhui/272, and pCAP- HAl/Anhui/467.
  • GenBank accession number of the amino acid sequence of the hemagglutinin of influenza virus A/H5N1/Anhui/1/O5 is ABD28180.
  • PCR was performed using VN-Fl (5'-CAGTCTGCAGGACCAGATCTGTATC-S' : (SEQ ID NO: 39); the Pstl site is underlined), and VN-R4 (5' -CAGTCCCGGGCTCTCTTCTTCCTGC-3' : (SEQ ID NO: 40); the Xmal site is underlined).
  • the obtained DNA fragment was cleaved with Pstl and Xmal, and inserted into pCAP- HlNl/NP-gp64, pCAP-HlNl/NP/272 and pCAP-HlNl/NP/467, each digested with Pstl and Xmal.
  • the constructed plasmids were designated pCAP-HAl/Vietnam, pCAP-HAl/Vietnam/272, and pCAP-
  • PCR was performed using gp64(51)-f (5'- GACTCCCCGGGTGGAAATCACCATCGTGGAGACG-3' : (SEQ ID NO: 41); the Xmal site is underlined), or gp64(101)-f (5'-
  • GACTCCCCGGGATTTGCTTATGTGGAGCATCAGG-3' (SEQ ID NO: 42); the Xmal site is underlined), or gp64(154)-f (5'-
  • GACTCCCCGGGCGCACCACACGTGCAACAAATCG-3' (SEQ ID NO: 43) ; the Xmal site is ' underlined) , or gp64(201)-f (5'-
  • GACTCCCCGGGACACTGTGCTTCATCGAGACGGC-3' (SEQ ID NO: 44); the Xmal site is underlined), and GP64-r DraIII (5'-
  • Dralll site is underlined) .
  • the obtained DNA fragments were cleaved with Xmal and DraIII, and inserted into pCAP-HAl/Vietnam digested with Xmal and DraIII.
  • the constructed plasmids were designated pCAP-HAl/Vietnam/51, pCAP-HAl/Vietnam/101, pCAP-
  • A/H5Nl/Vietnam/1203/2004 is AAW80717.
  • An artificial gene sequence (SEQ ID NO: 45) was prepared from the amino acid sequence of the HA region of the hemagglutinin of influenza virus A/H5N1/Anhui/1/O5 by codon optimization using Gene Designer available from DNA2.0, Inc.
  • PCR was perfomed using AH17-F (5'-GACTCTGCAGGATCAGATCTGTATTGGGTACC-S' : (SEQ ID NO:
  • CGATCCCGGGCACCACTAATTTCCTCTCGCTTC-3' (SEQ ID NO: 50); the Xmal site is underlined) .
  • the obtained DNA fragment was cleaved with Pstl and Xmal, and inserted into pCAP-HAl/Anhui or pCAP- HAl/Anhui/467 digested with Pstl and Xitial.
  • the constructed plasmids were designated pCAP-AH/345, pCAP-AH/345/467, pCAP- AH/410, pCAP-AH/410/467, pCAP-AH/473, pCAP-AH/473/467, pCAP- AH/520, and pCAP-AH/520/467.
  • An artificial gene sequence (SEQ ID NO: 51) was prepared from the amino acid sequence of the HA region of the hemagglutinin of influenza virus A/H5Nl/Vietnam/1203/2004 by codon optimization using Gene Designer available from DNA2.0, Inc. Using this artificial sequence as a template, PCR was performed using VN17-F (5'-GACTCTGCAGGATCAGATCTGTATCGGATATC-S' : (SEQ ID NO: 52); the Pstl site is underlined), and VN346-R (5'-
  • VN473-R CGATCCCGGGCTCTAAGCTGGAGCCTGACTTTGTC-S' : (SEQ ID NO: 55) ; the Xmal site is underlined, or VN520-R (5'-
  • the constructed plasmids were designated pCAP-VN/346, pCAP-VN/346/467, pCAP- VN/410, pCAP-VN/410/467, pCAP-VN/473, pCAP-VN/473/467, pCAP- VN/520, and pCAP-VN/520/467.
  • An artificial gene sequence (SEQ ID NO: 57) was prepared from the amino acid sequence of the CSP of Plasmodium falciparum 3D7 strain by codon optimization using Gene Designer available from DNA2.0, Inc. Using this artificial sequence as a template, PCR was performed using a pair of primers consisting of PfCSP_opt-f (5' -GACTCTGCAGATGATGCGAAAATTGGCCATACTG-B' : (SEQ ID NO: 58); the Pstl site is underlined) and PfCSP_opt-r (397) (5'- CGATCCCGGGCATTGAGGAACAGAAAGGAAAGAACCATG-3' : (SEQ ID NO: 59) ; the Xmal site is underlined); PfCSP_opt-f (19) (5'- GACTCTGCAGCTGTTTCAGGAATACCAGTGCTATGG-3' : (SEQ ID NO: 60); (the Pstl site is underlined) and PfCSP_opt-r (
  • GACTCTGCAGGACGACGGAAATAATGAGGACAACG-3' (SEQ ID NO: 62); the Pstl site is underlined) and PfCSP_opt-r (373) (5'-
  • the obtained DNA fragments were cleaved with Pstl and Xmal, and inserted into pCAP-HAl/Anhui or pCAP-HAl/Anhui/467 digested with Pstl and Xmal.
  • the constructed plasmids were designated pCAP-CO/full, pCAP- CO/full/467, pCAP-CO/19, pCAP-CO/19/467, pCAP-CO/76, pCAP- CO/76/467, pCAP-CO/205, and pCAP-CO/205/467.
  • GACTCGGACCGGCCAGATAAAAATAATCTTATCAATTAAG-S' (SEQ ID NO: 64); the RsrII site is underlined) and gp64-p-r (5'- CGATACTAGTAGCACTGAGGCTTCTTATATACCCG-3' : (SEQ ID NO: 65); the Spel site is underlined) .
  • the obtained DNA fragment was cleaved with RsrII and Spel, and inserted into pCAP-HAl/Anhui or pCAP- PfCSP (A361E) digested with RsrII and Spel to construct transfer vector plasmids pCA64-HAl/Anhui and pCA64-PfCSP (A361E) enabling the expression of a fusion protein of HAl antigen or PfCSP antigen and gp64 protein in mammalian and insect cells under the control of the desired dual promoter consisting of CAG promoter and gp64 promoter.
  • PCR was performed using vp39-p-f (5'- GACTCGGACCGCGTCGTACAAATCGAAATATTGTTGTG-3' : (SEQ ID NO: 66); the RsrII site is underlined) and vp39-p-r (5'- CGATACTAGTGTGATTGAGAAAGAAATCTCTTATTC-S': (SEQ ID NO: 67); the
  • the obtained DNA fragment was cleaved with RsrII and Spel, and inserted into pCAP-HAl/Anhui or pCAP- PfCSP (A361E) digested with RsrII and Spel to construct transfer vector plasmids pCA39-HAl/Anhui and pCA39-PfCSP (A361E) enabling the expression of a fusion protein of HAl antigen or PfCSP antigen and gp64 protein in mammalian and insect cells under the control of the desired dual promoter consisting of CAG promoter and vp39 promoter.
  • VSV-G-f 5'-GACTCCCCGGGCGTTCGAACATCCTCACATTCAAG - 3' (SEQ ID NO: 68); the Xmal site is underlined
  • VSV-G-r 5'- GACTCACTTAGTGCTTTCCAAGTCGGTTCATCTC-3' : (SEQ ID NO: 69); the ' DraIII site is underlined
  • the obtained DNA fragment was inserted into pCAP-CO/full, pCAP-CO/19, pCAP-CO/76, and pCAP- CO/205, each digested with Xmal and DraIII.
  • the constructed plasmids were designated pCAP-CO/full/VSV, pCAP-CO/19/VSV, pCAP- CO/76/VSV, and pCAP-CO/205/VSV.
  • Example 2 Recombinant Baculoviruses of the Present Invention and Method for Production thereof
  • Recombinant baculoviruses were produced using a kit for producing recombinant baculoviruses (BacVector-2000 Transfection Kit from Novagen) by co-transfecting BacVector-2000 DNA with each of the following transfer vectors constructed in Example 1: pCAP-PfCSP, pCAP-PfCSP/272, pCAP-PfCSP/467, pCAP- PfCSP(A36lE) , pCAP-PfCSP(A36lE)/272, pCAP-PfCSP (A361E) /467, pCAP- PfCSP-76, pCAP-PfCSP-76/467, pCAP-PfCSP+209, pCAP-PfCSP+209/467, pCAP-PfCSP+76/209, pCAP-PfCSP+76/209/467, pCAP-HAl/Anhui, pCAP- HAl/An
  • HAl/Vietnam/51 pCAP-HAl/Vietnam/101, pCAP-HAl/Vietnam/154, pCAP- - HAl/Vietnam/201, pCAP-HAl/Vietnam/272, pCAP-HAl/Vietnam/467, pCAP-AH/345, pCAP-AH/345/467, pCAP-AH/410, pCAP-AH/410/467, pCAP-AH/410/467, pCAP-AH/473, pCAP-AH/473/467, pCAP-AH/520, pCAP-AH/520/467, pCAP- VN/346, pCAP-VN/346/467, pCAP-VN/410, pCAP-VN/410/467, pCAP- VN/473, pCAP-VN/473/467, pCAP-VN/520, pCAP-VN/410/467, pCAP- V
  • the resulting recombinant baculoviruses were designated AcNPV- CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E) , AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HA
  • Example 3 Test of Expression of Vaccine Antigen from Recombinant Baculovirus of the Present Invention in Insect Cells
  • Sf9 cells were cultured at a concentration of 1 x 10 5 cells per well in a 48-well plate (from Corning), and infected with baculoviruses AcNPV-CAP-PfCSP, AcNPV-CAP-HAl/Anhui, and AcNPV-CAP-HAl/Vietnam obtained in Example 2, or a wild-type baculovirus AcNPV-WT as a control at an infection multiplicity of about 0.1. After 5 days, the culture supernatant was removed from each well, and then Sample Buffer Solution (+2ME, x2) (from Wako) was added in an amount of 0.05 mL per well to completely lyse the cells. The cell lysate was heated at 100 0 C for 5 minutes, and electrophoresed on 7.5% SDS-PAGE. After electrophoresis, the protein was transferred to a PVDF membrane (Immobilon-P from
  • FIG. 1 shows the results.
  • FIG. 1 shows Western blotting analysis showing the expression of fusion antigens in insect cells from recombinant baculoviruses containing PfCSP gene of human malaria, HAl gene of influenza virus H5N1/Anhui/1/O5 strain, and HAl gene of H5Nl/Vietnam/1203/04 strain.
  • Lane 1 shows the band of a wild-type baculovirus (AcNPV-WT) ; Lane 2 shows the band of a recombinant baculovirus (AcNPV-CAP-PfCSP) containing PfCSP gene and full-length gp64 gene inserted downstream of the dual promoter of the present invention; Lane 3 shows the band of a recombinant baculovirus (AcNPV-CAP-HAl/Anhui) containing HAl gene of influenza virus H5N1/Anhui/1/O5 strain and full-length gp64 gene inserted downstream of the dual promoter of the present invention; and Lane 4 shows the band of a recombinant baculovirus ( (AcNPV-CAP-HAl/Vietnam) containing HAl gene of influenza virus H5Nl/Vietnam/1203/04 strain and full-length gp64 gene inserted downstream of the dual promoter of the present invention.
  • Example 4 Test of Identification of Fusion Antigen in Vaccine Antigen Presented on Viral Particle (Virion) of Recombinant Baculovirus of the Present Invention
  • Sf9 cells were cultured to a concentration of 1 x 10 7 cells per 150 mm cell culture plate (from Sumilon) , and infected with each of the above-mentioned baculoviruses at an infection multiplicity of about 0.1. After 7 days, the medium was centrifuged at 3,000 xg at 4°C for 15 minutes twice, and the virus solution was layered over a 25% sucrose solution, and centrifuged using an ultracentrifuge at 25,000 rpm at 4°C for 90 minutes to yield viral particles.
  • Sample Buffer Solution (+2ME, x2) (from Wako) was added to 0.05 mL each of the virus concentrates (1 x 10 8 PFU/mL) of AcNPV-CAP-PfCSP, AcNPV-CAP- PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP-HAl/Vietnam, and AcNPV- WT collected by ultracentrifugation.
  • the resulting mixtures were heated at 100 0 C for 5 minutes, and electrophoresed on 7.5% SDS- PAGE.
  • the obtained proteins were transferred to PVDF membranes (Immobilon-P from Millipore), and immersed in 2.5% Skim Milk/SuperBlock (from Pierce) to perform blocking at 4°C overnight.
  • the membranes to which the virus solutions of AcNPV-CAP-PfCSP, AcNPV-CAP-PfCSP/272, and AcNPV-CAP- PfCSP/467 had been transferred were incubated with an anti-PfCSP antibody (2A10, MR-4) as the primary antibody, and then incubated with a HRP-labeled goat anti-mouse IgG (H+L) antibody (from
  • FIG. 2 (A) shows Western blotting analysis showing the expression of the CSP gene (PfCSP) of human malaria in viral particles of recombinant baculoviruses prepared using recombinant transfer vectors.
  • Lane 1 the left side lane of FIG.
  • FIG. 2 shows the band of a recombinant baculovirus (AcNPV-CAP-PfCSP) containing PfCSP gene and full-length gp64 gene inserted downstream of the dual promoter of the invention
  • Lane 2 shows the band of a recombinant baculovirus (AcNPV-CAP-PfCSP/272) containing PfCSP gene and partial-length gp64 gene (241 amino acid residues from the C terminus) inserted downstream of the dual promoter of the invention
  • Lane 3 shows the band of a recombinant baculovirus (AcNPV-CAP-PfCSP/467) containing PfCSP gene and partial-length gp64 gene (46 amino acid residues from the C terminus) inserted downstream of the dual promoter of the invention.
  • the baculoviruses were electrophoresed, and the presence of an expressed fusion product of the PfCSP gene and gp64 gene was checked. A strong band, indicating the presence of a fusion antigen of PfCSP gene and gp64 gene in the recombinant viral particles, was detected in all the lanes of FIG. 2 (A) .
  • FIG. 2 (B) shows Western blotting analysis showing the expression of H5N1/HA1 gene in viral particles of recombinant baculoviruses prepared using recombinant transfer vectors.
  • Lane 1 left side lane of FIG. 2 (B), shows the results obtained using the infected AcNPV-WT cell lysate prepared in Example 3;
  • Lane 2 shows the results obtained using the AcNPV-CAP-HAl/Anhui-infected cell lysate prepared in Example 3;
  • Lane 3 shows the results obtained using the AcNPV-CAP-HAl/Vietnam-infected cell lysate prepared in Example 3;
  • Lane 4 shows the results of viral particles of a wild-type baculovirus (AcNPV-WT) ;
  • Lane 5 shows the results of viral particles of a recombinant baculovirus (AcNPV- CAP-HAl/Vietnam) containing the HAl gene of influenza virus H5N1/Vie
  • the baculoviruses were electrophoresed, and the presence of an expressed fusion product of the PfCSP gene and gp64 gene was checked. A strong band, indicating the presence of a fusion antigen of HAl gene of H5Nl/Vietnam/1203/04 and gp64 gene in the recombinant viral particles, was detected in Lane 5 of FIG. 2(B).
  • Example 4 show that a foreign gene having the desired immunogenicity and gp64 gene can be fused and expressed in recombinant viral particles of the recombinant baculovirus of the present invention produced by using the recombinant transfer vector of the present invention.
  • Example 5 Test of Expression of Vaccine Antigen from Recombinant Baculovirus of the Present Invention in Mammals
  • HepG2 cells were infected with AcNPV-Dual-PfMSPl-PfCSP at an infection multiplicity of 1. After 48 hours, the culture supernatant was removed, and the plate was rinsed with PBS three times. An acetone/ethanol solution (a mixed ratio of 7:3) cooled to -2O 0 C was added to immobilize the cells at -20°C for 5 minutes. A 5% normal goat serum (from Sigma) was added to perform blocking at room temperature for 1 hour.
  • FIG. 3 shows the results.
  • FIG. 3 shows HepG2 cells stained with a fluorescence- labeled antibody, which indicates that an antigen has been expressed from a recombinant baculovirus containing a fusion gene of the PfMSPl gene and PfCSP gene in the HepG2 cells.
  • FIG. 3 (A) confirmed that a PfCSP antigen has been expressed.
  • the results of FIG. 3 (B) confirmed that a PfMSP-Ii 9 antigen has been expressed. It was thus confirmed that fusion antigens can be expressed in mammalian cells.
  • the results of FIG. 3 (A) and (B) clearly show that the recombinant baculovirus produced by using the transfer vector containing the dual promoter of the present invention can express the desired antigen in mammalian cells.
  • the virus particles enter the mammalian cells, and a mammalian promoter operates to produce a fusion product of the desired foreign antigen gene and gp64 gene in the mammalian cells, thus inducing the acquired immunity.
  • Example 6 Induction of Antibody by PfCSP Antigen Recombinant Virus and H5N1/HA1 Antigen Recombinant Virus 1. Inoculation of Virus Solution Virus solutions of AcNPV-WT, AcNPV-CAP-PfCSP, AcNPV-
  • CAP-PfCSP/467, AcNPV-CAP-HAl/Anhui, and AcNPV-CAP-HAl/Vietnam concentrated by ultracentrifugation were inoculated into the thigh muscles of BALB/c female mice in an amount of 1 x 10 8 PUF twice at two week-intervals.
  • the mice were euthanized two weeks after the final immunization, and sera were collected from the mice and used for measuring antigen-specific antibody titers. Induction of PfCSP antigen-specific antibody titers by AcNPV-CAP-PfCSP and AcNPV- CAP-PfCSP/467 was measured by ELISA using a plate on which
  • NANP 4 NVDPC peptide (from Sigma), i.e., B-cell epitope of PfCSP, had been immobilized.
  • the absorbance at OD450 ran was measured using MaxiSorp (from NUNC) as the ELISA plate, HRP-labeled goat anti- mouse IgG (H&L) antibody (from American Qualex) as the secondary antibody, and TMB (from Calbiochem) for the color reaction.
  • MaxiSorp from NUNC
  • HRP-labeled goat anti- mouse IgG (H&L) antibody from American Qualex
  • TMB from Calbiochem
  • FIG. 4 (A) is a graph plotting the average absorbance of each group at OD450 nm obtained when the mouse sera were subjected to two-fold serial dilution from 800-fold to 102, 400- fold dilutions.
  • absorbance of even the 800-fold dilutions was 0.1 or less, indicating low reactivity.
  • absorbance of the 800-fold dilutions was 1.138 and 1.878, respectively, indicating strong reactivity and clearly showing that antigen-specific antibodies were induced.
  • FIG. 4 (A) is a graph plotting the average absorbance of each group at OD450 nm obtained when the mouse sera were subjected to two-fold serial dilution from 800-fold to 102, 400- fold dilutions.
  • FIG. 4 is a graph plotting the average absorbance of each group at OD450 nm obtained when the mouse sera were subjected to two-fold serial dilution from 400-fold to 25, 600-fold dilutions.
  • absorbance of the 800-fold dilutions was 0.1 or less, indicating low reactivity.
  • absorbance of the 3, 200- fold dilution was 1.551 and 2.503, respectively, indicating strong reactivity and clearly showing that antigen-specific antibodies were induced.
  • FIG. 4 clearly shows that the recombinant baculovirus produced using a transfer vector containing the dual promoter of the present invention can induce an antibody to the desired antigen in mammals. 3. Measurement of Neutralization Value
  • HI test was performed using a mouse serum inoculated with AcNPV-CAP-PiAl/Anhui. More specifically, the test was performed according to the method described in the instructions packaged with an influenza HI reagent "Seiken” (from Denka Seiken Co., Ltd.), using purified HA antigen of H5N1 virus (IT-003-0053p from Immune Technology) . Absorption of non-specific agglutinins was performed using erythrocyte, and removal of non-specific agglutination inhibitors was performed using RDE (II) of "Seiken” (from Denka Seiken Co., Ltd.). The HI test was performed in the following manner.
  • 0.025 mL of 10-fold diluted antiserum in a 96-well plate was subjected to 2-fold serial dilution using a diluent.
  • 0.025 mL of HA antigen of H5N1 virus diluted to obtain an HA titer of 4 per 0.025 mL thereof was added.
  • the plate was allowed to stand at room temperature for 30 minutes.
  • 0.05 mL of an erythrocyte suspension for the reaction was added and stirred well. The mixture was allowed to stand at room temperature for 60 minutes.
  • the final dilution of the test sample at which hemagglutination was completely inhibited was defined as the HI antibody titer.
  • SEQ ID NOS: 3 and 4 are the sequences of primers phsp65-F2 and phsp65-R2 for PCR with pcDNA-hps65 as a template.
  • SEQ ID NOS: 5 and 6 are the sequences of primers pPolh-F2 and pgp64-R2 for PCR with pBACsurf-1 as a template to produce a gp64 gene DNA fragment.
  • SEQ ID NOS: 7 and 8 are the sequences of primers HA-f and HA-r for PCR to produce an influenza virus HA gene fragment.
  • SEQ ID NOS: 9 and 10 are the sequences of primers pHA- Fl and pHA-Rl for PCR with pCR-Blunt-HA as a template.
  • SEQ ID NOS: 11 and 12 are the sequences of primers Polh-f RsrII and GP64-r DraIII for PCR with pBACsurf-HAl as a template.
  • SEQ ID NOS: 13 and 14 are the sequences of primers NP- f EcoRI and NP-r Cfr9I for RT-PCR of genomic RNA of influenza virus PR/8/34 strain.
  • SEQ ID NOS: 15, 16, and 12 are the sequences of primers gp64(272)-f, gp64(467)-f, and GP64-r DraIII for PCR of pCAP-HlNl/HAl-gp64.
  • SEQ ID NOS: 17 and 18 are the sequences of primers PfCSP-f (19) and PfCSP-r(373) for PCR with P. falciparum genomic DNA as a template.
  • SEQ ID NOS: 19 and 20 are the sequences of primers pAMA-Fl and pAMAl-Rl for PCR with P. berghei genomic DNA as a template .
  • SEQ ID NOS: 21 and 22 are the sequences of primers pPfCSP-Fl and pPfCSP-Rl for PCR with P. falciparum genomic DNA as a template.
  • SEQ ID NOS: 23 and 24 are the sequences of primers pPfs25-Fl and pPfs25-R2 for PCR with P. falciparum genomic DNA as a template.
  • SEQ ID NOS: 25 and 26 are the sequences of primers pPfMSP119-Fl and pPfMSP119-R2 for PCR with P. falciparum genomic DNA as a template.
  • SEQ ID NOS: 17 and 27 are the sequences of primers PfCSP-f (19) and PfCSP-r(373 A361E) for PCR with pCAP-PfCSP as a template .
  • SEQ ID NOS: 28 and 27 are the sequences of primers
  • SEQ ID NO: 29 is the sequence of an artificial gene (PfCSP+) produced from the amino acid sequence of the PfCSP of P. falciparum 3D7 strain (in which, however, the A at the 361- position was replaced by E) using codons frequently used in Sf9 and human cells.
  • PfCSP+ an artificial gene produced from the amino acid sequence of the PfCSP of P. falciparum 3D7 strain (in which, however, the A at the 361- position was replaced by E) using codons frequently used in Sf9 and human cells.
  • SEQ ID NOS: 30 and 31 are the sequences of primers PfCSP-f (+209) and PfCSP-r (+A361E) for PCR with PfCSP+ as a template.
  • SEQ ID NOS: 32, 33, 34 and 31 are the sequences of primers PfCSP-f (+76) , PfCSP-r (+128) , PfCSP-f (+209) BamHI, and PfCSP-r(+A361E) for PCR with PfCSP+ as a template.
  • SEQ ID NO: 35 is the sequence of an artificial gene produced from the amino acid sequence of the HAl region of the hemagglutinin of influenza virus H5N1/Anhui/1/O5 using codons frequently used in Sf9 and human cells.
  • SEQ ID NOS: 36 and 37 are the sequences of primers AH- Fl (5' -CAGTCTGCAGGACCAGATTTGCATC-S' : (SEQ ID NO: 36); the Pstl site is underlined) and AH-R4 (5' -CAGTCCCGGGCTCTCTTGCGCCTGC-3' : (SEQ ID NO: 37); the Xmal site is underlined) for PCR with the artificial gene sequence of SEQ ID NO: 35 as a template.
  • SEQ ID NO: 38 is the sequence of an artificial gene produced from the amino acid sequence of the HAl region of the hemagglutinin of influenza virus H5Nl/Vietnam/1203/04 using codons frequently used in Sf9 and human cells.
  • SEQ ID NOS: 39 and 40 are the sequences of primers VN- Fl (5'-CAGTCTGCAGGACCAGATCTGTATC-S' : (SEQ ID NO: 39); the Pstl site is underlined), and VN-R4 (5' -CAGTCCCGGGCTCTCTTCTTCCTGC-3' : (SEQ ID NO: 40); the Xmal site is underlined) for PCR with the artificial gene sequence of SEQ ID NO: 38 as a template.
  • SEQ ID NOS: 41, 42, 43, 44, and 12 are the sequences of primers gp64(51)-f (5'-GACTCCCCGGGTGGAAATCACCATCGTGGAGACG-S' :
  • GACTCCCCGGGCGCACCACACGTGCAACAAATCG-3' (SEQ ID NO: 43); the Xmal site is underlined), gp64(201)-f (5'-
  • GACTCCCCGGGACACTGTGCTTCATCGAGACGGC-3' (SEQ ID NO: 44); the Xmal site is underlined), and GP64-r DraIII (5'-
  • Dralll site is underlined (Dralll site is underlined) .
  • SEQ ID NO: 45 is the sequence of an artificial gene produced from the amino acid sequence of the HAl region of the hemagglutinin of influenza virus H5N1/Anhui/1/O5 by codon optimization using Gene Designer available from DNA2.0, Inc.
  • SEQ ID NOS: 46, 47, 48, 49, and 50 are the sequences of AH17-F (5'-GACTCTGCAGGATCAGATCTGTATTGGGTACC-S' : (SEQ ID NO:
  • SEQ ID NO: 45 as a template.
  • SEQ ID NO: 51 is the sequence of an artificial gene produced from the amino acid sequence of the HAl region of the hemagglutinin of influenza virus H5Nl/Vietnam/1203/04 by codon optimization using Gene Designer available from DNA2.0, Inc.
  • SEQ ID NOS: 52, 53, 54, 55, and 56 are the sequences of primers VN17-F (5'-GACTCTGCAGGATCAGATCTGTATCGGATATC-S' : (SEQ ID NO: 52); the Pstl site is underlined), and VN346-R (5'- CGATCCCGGGCCCGCTTTTTCCTCCTCCGTTCG-3' : (SEQ ID NO: 53); the Xmal site is underlined), VN410-R (5'-
  • VN473-R CGATCCCGGGCTCTAAGCTGGAGCCTGACTTTGTC-3' : (SEQ ID NO: 55); the Xmal site is underlined
  • VN520-R 5'-
  • SEQ ID NO: 51 as a template.
  • SEQ ID NO: 57 is the sequence of an artificial gene produced from the amino acid sequence of the CSP of Plasmodium falciparum 3D7 strain by codon optimization using Gene Designer available from DNA2.0, Inc.
  • SEQ ID NOS: 58, 59, 60, 61, and 62 are the sequences of primers PfCSP_opt-f (5'-GACTCTGCAGATGATGCGAAAATTGGCCATACTG-
  • GACTCTGCAGCTGTTTCAGGAATACCAGTGCTATGG-3' (SEQ ID NO: 60); (the Pstl site is underlined), PfCSP_opt-r (373) (5'-
  • GACTCTGCAGGACGACGGAAATAATGAGGACAACG-3' (SEQ ID NO: 62); the Pstl site is underlined), and PfCSP_opt-f (205) (5'- GACTCTGCAGAATGCAAACCCAAATGCCAATCCAAACGC-3' : (SEQ ID NO: 63) ; the
  • Pstl site is underlined) for PCR with the artificial gene sequence of SEQ ID NO: 57 as a template.
  • SEQ ID NOS: 64, 65, 66, and 67 are the sequences of primers gp64-p-f (5'-GACTCGGACCGGCCAGATAAAAATAATCTTATCAATTAAG-S' : (SEQ ID NO: 64); the RsrII site is underlined), gp64-p-r (5'-
  • SEQ ID NOS: 68 and 69 are the sequences of primers VSV-G-f (5'-GACTCCCCGGGCGTTCGAACATCCTCACATTCAAG -3' (SEQ ID NO: 68); the Xmal site is underlined), and VSV-G-r (5'-
  • GACTCACTTAGTGCTTTCCAAGTCGGTTCATCTC-3' (SEQ ID NO: 69); the DraIII site is underlined) for PCR with pVSV-G as a template.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Wood Science & Technology (AREA)
  • Communicable Diseases (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pulmonology (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The present invention provides a novel transfer vector and a recombinant baculovirus; methods for the production thereof; and pharmaceuticals containing the recombinant baculovirus as an active ingredient, which are useful as preventive or therapeutic drugs for infectious diseases such as malaria and influenza. More specifically, the invention provides a recombinant transfer vector capable of expressing a foreign gene fused to a virus gene under the control of a dual promoter; a recombinant baculovirus; methods for the production thereof; and pharmaceuticals containing the recombinant baculovirus as an active ingredient.

Description

DESCRIPTION NOVEL VIRAL VECTOR
TECHNICAL FIELD The present invention provides a novel transfer vector, a recombinant baculovirus obtained by homologous recombination of the transfer vector and a baculovirus DNA, and methods for production thereof.
The present invention further provides pharmaceuticals (e.g., vaccines, and preventive or therapeutic drugs for infectious diseases such as malaria and influenza) containing the recombinant baculovirus as an active ingredient.
BACKGROUND ART
Baculovirus has been used as a vector in methods of industrially producing a desired protein using insect cells. In recent years, it has been found that baculovirus can introduce a foreign gene not only into insect cells but also into mammalian cells, and the possibility of their use as a vector, for introducing a therapeutic gene has been found. Patent Document 1 discloses a recombinant baculovirus expression vector containing multiple independent promoters comprising a promoter derived from an early gene of baculovirus, which has a DNA region containing a gene encoding a viral non-structural protein, and a promoter derived from a late gene of baculovirus, which has a DNA region containing a gene encoding a viral structural protein.
Patent Document 2 discloses a method comprising introducing into mammalian cells a non-mammalian DNA viral vector containing multiple independent promoters controlled to express a desired foreign gene linked to the promoters; and expressing the foreign gene in the mammalian cells.
Further, Patent Document 3 discloses a method of producing a protein with gene recombination technology using a baculovirus. The method comprises expressing a fusion gene obtained by linking the gp64 gene of baculovirus to a gene encoding a desired protein to produce the desired protein in a form fused with viral particles, collecting the viral particles fused with the desired protein, and cleaving the desired protein from the viral particles to collect the protein.
With respect to a baculovirus expression system, Patent Document 4 discloses a recombinant baculovirus expression vector having multiple independent promoters containing a first nucleic acid sequence encoding a detection marker, which is linked, in a form capable of functioning, to a first promoter that is active in host cells and inactive in non-acceptable cells, and a second nucleic acid sequence containing a foreign nucleic acid sequence, which is linked, in a form capable of functioning, to a second promoter that is active in non-acceptable cells.
Patent Document 5 discloses that an influenza virus hemagglutinin (HA) antigen-expressing recombinant baculovirus vector linked to a CAG promoter derived from chicken β actin has influenza virus infection-preventing effects and is therefore useful as a vaccine formulation.
Patent Document 6 discloses a method of ''producing a baculovirus vector comprising the step of co-transfecting into insect cells a plasmid containing a baculovirus promoter and a mammalian cell-derived promoter having linked thereto a gene encoding a protein expressible on the cell surface, or a plasmid containing two baculovirus promoters having linked thereto a gene encoding a protein expressible on the cell surface has been linked.
Patent Document 7 describes research on anti-influenza virus activity, i.e., activity against influenza virus infection, of a recombinant baculovirus having cDNA of influenza virus HA incorporated in a CAG promoter, and discloses that not only the recombinant baculovirus but also wild-type baculovirus have anti- influenza virus activity.
As shown above, various recombinant baculovirus vectors have been developed in recent years, and many attempts have been made to develop pharmaceuticals for mammals containing such a recombinant baculovirus vector as an active ingredient. In this technical field, the development of pharmaceutical formulations, particularly vaccine formulations containing, as an active ingredient, a novel recombinant baculovirus, which is a recombinant baculovirus vector having a novel structure and being effective against malaria, influenza, tuberculosis, and like infectious diseases, or diseases such as cancer, has been desired.
Patent Document 1: Japanese Patent No. 3366328, Multiple Promoter
Baculovirus Expression System and Defect Particle Products. Patent Document 2: WO98/011243, Non-mammalian DNA Virus Having
Modified Coating Protein.
Patent Document 3: JP No. 2002-235236-A, Methods of Producing
Proteins.
Patent Document 4: JP No. 2003-284557-A, Novel Baculovirus- Transfecting Vector and Recombinant Baculovirus for Expression of
Foreign Gene.
Patent Document 5: WO02/062381, Baculovirus Vector Vaccine.
Patent Document 6: WO04/029259, Baculovirus Vector, Method of
Producing Baculovirus Vector, and Method of Introducing Gene. Patent Document 7: JP No. 2005-15346-A, Baculovirus-containing
Anti-viral Agent.
BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows the test results of the expression of vaccine antigens from recombinant baculoviruses of the present invention in insect cells in Example 3.
Detected by gp64 Monoclonal Antibody (AcV5)
Lane 1: AcNPV-WT
Lane 2: AcNPV-CAP-PfCSP
Lane 3: AcNPV-CAP-HAl/Anhui Lane 4: AcNPV-CAP-HAl/Vietnam
FIG. 2 (A) shows a Western blotting analysis showing the expression of the CSP gene (PfCSP) of human malaria in viral particles of recombinant baculoviruses produced from recombinant transfer vectors. Detected by Anti-PfCSP Monoclonal Antibody (2A10) -A-
Lane 1: AcNPV-CAP-PfCSP Lane 2: AcNPV-CAP-PfCSP/272 Lane 3: AcNPV-CAP-PfCSP/467
FIG. 2 (B) shows a Western blotting analysis showing the expression of H5N1/HA1 gene in viral particles of recombinant baculoviruses produced from recombinant transfer vectors. Detected by H5N1/Vietnam Rabbit Polyclonal Antibody (IT-003-005) Lane 1: AcNPV-WT (Cell Lysate) Lane 2: AcNPV-CAP-HAl/Anhui (Cell Lysate) Lane 3: AcNPV-CAP-HAl/Vietnam (Cell Lysate) Lane 4: AcNPV-WT (Virion) Lane 5: AcNPV-CAP-HAl/Vietnam (Virion) Lane 6: Purified H5N1/Anhui Antigen (IT-003-0053p)
FIG. 3 shows HepG2 cells stained with a fluorescence- labeled antibody, which indicates that an antigen has been expressed by a recombinant baculovirus containing a fusion gene of PfMSPl gene and PfCSP gene in the HepG2 cells. The results of FIG. 3 (A) confirmed that a PfCSP antigen has been expressed. The results of FIG. 3 (B) confirmed that a PfMSP-Ii9 antigen has been expressed.
FIG. 4 shows the results of measurement of antibody titers obtained in Example 6.
FIG. 5 shows the transfer vectors of the present invention. DISCLOSURE OF THE INVENTION
PROBLEMS TO BE SOLVED BY THE INVENTION An object of the present invention is to provide a novel recombinant transfer vector, a recombinant baculovirus obtained by homologous recombination of the recombinant transfer vector and a baculovirus DNA, and methods for production thereof. Another object of the present invention is to provide a pharmaceutical preparation, particularly a vaccine formulation containing the recombinant baculovirus as an active ingredient.
MEANS FOR SOLVING THE PROBLEMS The present inventors found a transfer vector having a novel structure capable of expressing a fusion protein of a protein having a desired immunogenicity or a partial protein thereof with a viral structural protein in insect cells and in vertebrate (particularly mammalian and avian) cells; and a recombinant baculovirus obtained by homologous recombination of the transfer vector and a baculovirus DNA. Using the obtained recombinant baculovirus, the present inventors carried out extensive research on pharmaceuticals containing as an active ingredient a recombinant baculovirus having infectious disease- preventive and therapeutic effects. As a result, the inventors found that the obtained recombinant baculovirus has the desired pharmaceutical effects.
Thus, the inventors of the present invention found a recombinant transfer vector having a novel structure, a recombinant baculovirus obtained by homologous recombination of the transfer vector and a baculovirus DNA, and methods for the production thereof, and ascertained that the recombinant baculovirus itself is useful as a pharmaceutical capable of expressing a protein having the desired immunogenicity in target cells, and as a pharmaceutical for preventing infectious diseases such as malaria and influenza. The present invention has been accomplished, based on these findings.
The present invention provides the inventions shown in the following items 1 to 22 : Item 1. A transfer vector which is any one of pCAP-PfCSP, pCAP- PfCSP/272, pCAP-PfCSP/467, pCAP-PfCSP(A361E) , pCAP- PfCSP (A361E) /272, pCAP-PfCSP(A361E) /467, pCAP-PfCSP-76, pCAP- PfCSP-76/467, pCAP-PfCSP+209, pCAP-PfCSP+209/467, pCAP- PfCSP+76/209, pCAP-PfCSP+76/209/467, pCAP-HAl/Anhui, pCAP- HAl/Anhui/272, pCAP-HAl/Anhui/467, pCAP-HAl/Vietnam, pCAP-
HAl/Vietnam/51, pCAP-HAl/Vietnam/101, pCAP-HAl/Vietnam/154, pCAP- HAl/Vietnam/201, pCAP-HAl/Vietnam/272, pCAP-HAl/Vietnam/467, pCAP-AH/345, pCAP-AH/345/467, pCAP-AH/410, pCAP-AH/410/467, pCAP- AH/473, pCAP-AH/473/467, pCAP-AH/520, pCAP-AH/520/467, pCAP- VN/346, pCAP-VN/346/467, pCAP-VN/410, pCAP-VN/410/467, pCAP- VN/473, pCAP-VN/473/467, pCAP-VN/520, pCAP-VN/520/467, pCAP- CO/full, pCAP-CO/full/467, pCAP-CO/19, pCAP-CO/19/467, pCAP-CO/76, pCAP-CO/76/467, pCAP-CO/205, pCAP-CO/205/467, pCA39-HAl/Anhui, pCA64-HAl/Anhui, pCA39-PfCSP(A361E) , pCA64-PfCSP (A361E) , pCAP- CO/full/VSV, pCAP-CO/19/VSV, pCAP-CO/76/VSV, pCAP-CO/205/VSV, pDual-Pfs25-PfCSP-gp64, and pDual-PfMSPl-PfCSP-gp64. Item 2. A recombinant baculovirus which is any one of AcNPV-CAP- PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E) , AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP-AH/473/467, AcNPV-CAP-AH/520, AcNPV- CAP-AH/520/467, AcNPV-CAP-VN/346, AcNPV-CAP-VN/346/467, AcNPV- CAP-VN/410, AcNPV-CAP-VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP- VN/473/467, AcNPV-CAP-VN/520, AcNPV-CAP-VN/520/467, AcNPV-CAP- CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP- CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-CAP-CO/205/467, AcNPV-CA39-HAl/Anhui, AcNPV-CA64-HAl/Anhui, AcNPV-CA39-PfCSP(A36lE), AcNPV-CA64-PfCSP (A361E) , AcNPV-CAP-
CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP- CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl- PfCSP-gp64. Item 3. A composition for infectious diseases comprising the recombinant baculovirus of item 2 as an active ingredient.
Item 4. A composition for infectious diseases comprising the recombinant baculovirus of item 2 as an active ingredient, the composition being administered by the intramuscular, respiratory, or nasal route. Item 5. A vaccine comprising the recombinant baculovirus of item 2 as an active ingredient.
Item 6. A vaccine comprising the recombinant baculovirus of item
3 as an active ingredient, the composition being administered by the intramuscular, respiratory, or nasal route. Item 7. A therapeutic or preventive agent for influenza virus infection, comprising as an active ingredient any one of AcNPV- CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP-HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP- HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP- HAl/Vietnam/201, AcNPV-CAP-HAl/Vietnam/272, AcNPV-CAP- HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV- CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP- AH/473/467, AcNPV-CAP-AH/520, AcNPV-CAP-AH/520/467, AcNPV-CAP- VN/346, AcNPV-CAP-VN/346/467, AcNPV-CAP-VN/410, AcNPV-CAP- VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP-VN/473/467, AcNPV-CAP- VN/520, AcNPV-CAP-VN/520/467, AcNPV-CA39-HAl/Anhui, and AcNPV- CA64-HAl/Anhui.
Item 8. A therapeutic or preventive agent for influenza virus infection according to item 7, which is administered by the intramuscular, respiratory, or nasal route.
Item 9. A vaccine against influenza virus infection, comprising as an active ingredient any one of AcNPV-CAP-HAl/Anhui, AcNPV- CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP-HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP- HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP-AH/473/467, AcNPV-CAP-AH/520, AcNPV- CAP-AH/520/467, AcNPV-CAP-VN/346, AcNPV-CAP-VN/346/467, AcNPV- CAP-VN/410, AcNPV-CAP-VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP- VN/473/467, AcNPV-CAP-VN/520, AcNPV-CAP-VN/520/467, AcNPV-CA39- HAl/Anhui, and AcNPV-CA64-HAl/Anhui.
Item 10. A vaccine against influenza virus infection according to item 7, which is administered by the intramuscular, respiratory, or nasal route. Item 11. A therapeutic or preventive agent for human malaria infection, comprising as an active ingredient any one of AcNPV- CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E), AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP-CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV- CAP-CO/205/467, AcNPV-CA39-PfCSP (A361E) , AcNPV-CA64-PfCSP(A36lE) , AcNPV-CAP-CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP-CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV- Dual-PfMSPl-PfCSP-gp64. Item 12. A therapeutic or preventive agent for human malaria infection according to item 11, which is administered by the intramuscular, respiratory, or nasal route.
Item 13. A therapeutic or preventive agent for human malaria infection, comprising as an active ingredient any one of AcNPV- CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E), AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP-
PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP-CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-
CAP-CO/205/467, AcNPV-CA39-PfCSP (A361E) , AcNPV-CA64-PfCSP (A361E) , AcNPV-CAP-CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP-CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV- Dual-PfMSPl-PfCSP-gp64. Item 14. A therapeutic or preventive agent for human malaria infection according to item 13, which is administered by the intramuscular, respiratory, or nasal route.
Item 15. A method of preventing malaria or influenza infection or of treating malaria or influenza, comprising administering to a subject an effective amount of the recombinant baculovirus of item 2, the composition for infectious diseases of item 3 or 4, or the vaccine of item 5, 6, 9, 10, 13 or 14.
Item 16. A method according to item 15, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject as a liposomal formulation.
Item 17. A method according to item 15, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject by the intramuscular, respiratory, or nasal route. Item 18. A method according to item 16, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject by the intramuscular, respiratory, or nasal route. Item 19. A method of immunostimulation comprising administering to a subject an effective amount of the recombinant baculovirus of item 2, the composition for infectious diseases of item 3 or 4, or the vaccine of item 5, 6, 9, 10, 13 or 14.
Item 20. A method according to item 19, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject as a liposomal formulation. Item 21. A method according to item 19, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject by the intramuscular, respiratory, or nasal route. Item 22. A method according to item 20, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject by the intramuscular, respiratory, or nasal route. EFFECT OF THE INVENTION
According to the present invention, a novel recombinant transfer vector, a recombinant baculovirus obtained by homologous recombination of the recombinant transfer vector and a baculovirus DNA, and methods for production thereof are provided. Pharmaceuticals containing the recombinant baculovirus of the present invention as an active ingredient are useful as therapeutic or preventive drugs for infectious diseases such as malaria and influenza, or as cellular medicine and vaccine formulations . BEST MODE FOR CARRYING OUT THE INVENTION The abbreviations used for the amino acids, peptides, base sequences, and nucleic acids in the present specification are based on the abbreviations specified in the IUPAC-IUB Communication on Biochemical Nomenclature, Eur. J. Biochem. , 138: 9 (1984) and "Guideline for Preparing Specifications Including Base Sequences and Amino Acid Sequences" (Patent Office) , and those commonly used in this technical field. In the present specification, the DNA molecule may include not only double strand DNA but also single strand DNA, i.e., a sense chain and an antisense chain constituting the double strand DNA, and is not limited to a full length thereof. The polynucleotide (DNA molecule) encoding the immunogenic foreign gene of the present invention encompasses double strand DNA containing genomic DNA, single strand DNA (sense chain) containing cDNA, and single strand DNA (antisense chain) having a sequence complementary to the sense chain, synthetic DNA, and fragments thereof, unless otherwise mentioned.
The polynucleotide or DNA molecule used herein is not limited in the functional region, and may include at least one of an expression suppression region, a coding region, a leader sequence, an exon, and an intron.
Further, examples of the polynucleotide include RNA and DNA. The polypeptide containing a specific amino acid sequence and the polynucleotide containing a specific DNA sequence include fragments, homologs, derivatives, and mutants of the polynucleotide.
Examples of mutants of the polynucleotide, such as mutant DNA, include naturally occurring allelic mutants; artificial mutants; and mutants having deletion, substitution, addition, and/or insertion. However, it should be understood that such mutants encode polypeptides having substantially the same function as the polypeptide encoded by the original non-mutated polynucleotide.
In the present invention, the transfer vector refers to a plasmid for producing a recombinant baculovirus having a structure in which a fusion gene, formed by linking at least one gene encoding a protein capable of being a component of viral particles to at least one immunogenic foreign gene, is incorporated downstream of a dual promoter comprising two linked promoters, i.e., one vertebrate promoter (e.g., a mammalian promoter or an avian promoter) and one baculovirus promoter.
In one preferable embodiment of the invention, the immunogenic foreign gene is located downstream of the dual promoter and upstream of the gene encoding a protein capable of being a component of viral particles. The recombinant baculovirus of the present invention is used as an active ingredient of pharmaceuticals or vaccines for vertebrates. Examples of vertebrates include mammals such as humans, cattle, horses, swine, sheep, goats, monkeys, mice, dogs, and cats. Examples of birds include chickens, quail, geese, wild ducks, pigeons, turkeys, guinea fowls, and parrots.
In one embodiment, the present invention provides a transfer vector containing a novel structure having incorporated therein a fusion gene of one immunogenic foreign gene and a gene encoding a viral membrane protein that can be expressed in insect cells under the control of a dual promoter comprising one vertebrate promoter and one baculovirus promoter linked to each other. Co-transfection of this transfer vector with a baculovirus DNA into insect cells induces a homologous recombination and thereby produces a recombinant baculovirus having incorporated therein the fusion gene that is expressed under the control of a baculovirus promoter in insect cells and that can produce a fusion protein capable of being a component of budded viral particles. In the present invention, when the recombinant baculovirus is administered to a vertebrate, a fusion protein of a protein capable of being a component of budded viral particles with an immunogenic protein seems to function as a component vaccine. Further, the recombinant baculovirus administered to the vertebrate enters the vertebrate cell, and a fusion antigen with the desired immunogenic foreign antigen is produced from the viral genome in the vertebrate cell, and functions as a DNA vaccine .
Thus, for example, when the recombinant baculovirus of the present invention is administered to a mammal, a fusion protein of a protein capable of being a component of viral particles with an immunogenic protein is presented as an antigen on the surface of virus particles, and a fusion protein of a protein capable of being a component of viral particles with an immunogenic protein is produced in the mammalian cell, and seems to function as a preventive or therapeutic agent for infectious diseases, such as viral, protozoan, and bacterial infection, due to its immunopotentiative action.
The baculovirus DNA to be co-transfected with the transfer vector may be a wild type, mutant, or recombinant baculovirus DNA. Examples of host cells to be co-transfected include insect cells such as cells of Spodoptera frugiperda.
In the present invention, the immunogenic foreign gene refers to a gene encoding the amino acid sequence of an antigenic protein used as an immunogen in immunotherapy, such as vaccine therapy, for the prevention and treatment of infectious diseases, such as malaria and influenza. Specific examples thereof include genes encoding the amino acid sequences of proteins, such as malaria antigen and influenza virus antigen. The "foreign" gene as used herein refers to a gene introduced from the outside. Even if the same gene is present in the cell, the gene introduced from the outside is referred to as the "foreign" gene.
In the present invention, the gene encoding the amino acid sequence of a protein used as the immunogen is not particularly limited, as long as the gene is capable of encoding the amino acid sequence of an antigenic protein having immunogenicity against a substance that causes diseases such as infectious diseases. Examples of genes encoding the amino acid sequence of an antigenic protein having immunogenicity are as f ollows .
Examples of genes encoding the amino acid sequence of a malaria antigen include genes encoding the amino acid sequences of sporozoite surface antigen CSP (Circumsporozoite Protein) of malaria parasites, merozoite surface membrane protein MSPl
(Merozoite Surface Protein 1) , malaria S antigen secreted from erythrocytes infected with malaria, PfEMPl protein present in the knobs of erythrocytes infected with malaria, SERA protein, TRAMP protein, AMAl protein, and like proteins. Examples of genes encoding the amino acid sequences of influenza virus antigens include genes encoding the amino acid sequences of HA antigen (hemagglutinin antigen) , NA antigen (neuraminidase antigen) , M2 antigen (matrix protein antigen) , NP antigen (nucleoprotein antigen), and like proteins. Of the vertebrate genes, examples of mammalian genes include genes encoding the amino acid sequences of antigenic proteins of infectious diseases in humans, cattle, horses, swine, sheep, monkeys, mice, dogs, and cats. Examples of avian genes include antigen genes (e.g., avian influenza HA antigen) of infectious diseases in chickens, wild ducks, pigeons, turkeys, guinea fowls, and parrots.
Pathogen genes whose association with infectious diseases in mammals and birds as mentioned above has been reported are easily available from institutions storing registered public data on pathogen genes, such as Genbank.
The present invention can provide a transfer vector having such an immunogenic foreign gene, and a recombinant baculovirus obtained by homologous recombination of the transfer vector. Further, the present invention can provide a pharmaceutical composition containing as an active ingredient the recombinant baculovirus having the immunogenic foreign gene, and a vaccine formulation of the pharmaceutical composition.
The baculovirus used in the present invention refers to insect pathogen viruses that cause infection in insects, which are one group (Baculoviridae) of DNA viruses having a cyclic double strand DNA as a gene. Among these, one group of the viruses referred to as the nucleopolyhedrosis virus (NPV) produce an inclusion body, referred to as a polyhedron, in the nucleus of infected cells in the late phase of infection. Even if a foreign gene to be expressed is inserted in place of the polyhedrin gene, virus infection and growth sufficiently occur to produce a large amount of the desired foreign gene product. Therefore, this virus has been used for the production of desired proteins in recent years . Examples of the baculovirus used in the present invention include Autographa californica nucleopolyhedrosis virus: AcNPV, Bombyx mori nucleopolyhedrosis virus: BmNPV, Orgyia pseudotsugata nucleopolyhedrosis virus: OpNPV, and Lymantria disper nucleopolyhedrosis virus: LdNPV. The baculovirus DNA may be any DNA that can be homologously recombined with the transfer vector of the present invention. More specifically, the viral gene of the baculovirus DNA that can be homologously recombined with the transfer vector of the present invention is as huge as 130 kbp in size, and an immunogenic foreign gene of 15 kbp or more can be inserted therein. Because the baculovirus gene itself is scarcely expressed in vertebrate cells, there is almost no need to consider its cytotoxicity. Thus, it is thought that no harmful immune response is induced. (1) Transfer Vector and Production of the Transfer Vector of the Present Invention Production of Immunogenic Foreign Gene DNA
The immunogenic foreign gene DNA capable of being fused to the viral gene, which is one of the components of the baculovirus transfer vector, can be easily produced or obtained by synthesis based on the nucleic acid sequence information of the polynucleotide encoding the amino acid sequence of an antigenic protein having the desired immunogenicity disclosed in this specification, or directly synthesizing the DNA corresponding to the nucleic acid sequence of the coding region of the immunogenic foreign gene, based on the nucleic acid sequence information of the immunogenic foreign gene (chemical DNA synthesis method) . General gene engineering techniques can be used for this production (see, for example, "Molecular Cloning" 2d Ed, Cold Spring Harbor Lab. Press (1989); Zoku Seikagaku Jikken Kouza, "Idenshi Kenkyuho I, II, III", edited by the Japanese Biochemistry Society, 1986) .
Examples of methods for synthesizing the DNA include chemical synthesis means, such as the phosphate triester method and the phosphate amidite method (J. Am. Chem. Soc, 89, 4801 (1967); ibid., 91, 3350 (1969); Science, 150, 178 (1968); Tetrahedron Lett., 22, 1859 (1981); ibid., 24, 245 (1983)) and combination methods thereof. The DNA can also be chemically synthesized by the phosphoramidite method or the triester method, or synthesized by using a commercially available automatic oligonucleotide synthesizer. A double strand fragment can be obtained by synthesizing a complementary strand and annealing the complementary strand with a chemically synthesized single strand under appropriate conditions, or adding the complementary strand with appropriate primer sequences to a chemically synthesized single strand using a DNA polymerase.
Specific examples of the immunogenic foreign gene DNA produced in the present invention include DNA comprising a DNA sequence encoding the amino acid sequence of a malaria antigen protein, and a DNA sequence encoding the amino acid sequence of an influenza virus antigen protein.
The DNA used in the present invention is not limited to a full-length DNA sequence encoding the amino acid sequence of the polypeptide of an antigenic protein having the immunogenicity, and may be a DNA sequence encoding a partial sequence thereof, as long as the protein of the amino acid sequence encoded by the DNA sequence has the immunogenicity.
The DNA of the immunogenic foreign gene used in the present invention is not limited to DNA molecules having such a specific DNA sequence, and may be DNA molecules having a DNA sequence produced by suitably selecting codons for each amino acid residue. The choice of codons can be made in accordance with a standard method, for example, by considering the frequency of codon use in the host used (Nucleic Acids Res., 9, 43(1981)). The DNA of the immunogenic foreign gene used in the present invention can be produced by gene engineering techniques, more specifically by preparing a cDNA library from an appropriate origin that expresses the DNA of an immunogenic foreign gene in accordance with a standard method, and selecting a desired clone from the library using an appropriate probe or antibody against the expressed product, which is specific to the immunogenic foreign gene (see, for example, Proc. Natl. Acad. Sci., USA., 78, 6613 (1981); Science, 222, 778 (1983)).
Examples of the genomic DNA origin include various cells, tissues, and cultured cells derived therefrom, which express the DNA of the immunogenic foreign gene. Extracts of erythrocytes infected with malaria parasites, and extracts of cells infected with influenza viruses are particularly preferable. The extraction and separation of total DNA and RNA from the origin, separation and purification of mRNA, and the production and cloning of cDNA can be performed in accordance with standard methods .
As described above, the DNA of the immunogenic foreign gene can be produced by using the cDNA library of each immunogen prepared by extraction, separation and purification of the mRNA of the immunogenic tissue or cells from the above-mentioned extract. The DNA of the immunogenic foreign gene can also be produced by using a phage library prepared by extracting the mRNA of each immunogen, adding poly A to the RNA, collecting the poly A-added RNA, producing cDNA using a reverse transcriptase, adding restriction enzyme sites to both ends of the cDNA, and incorporating the cDNA into a phage.
The method of screening the immunogenic foreign gene DNA from the cDNA library is not particularly limited, and can be performed in accordance with a usual method. Specific examples of such methods include a method of selecting a corresponding cDNA clone by immunological screening using a specific antibody (e.g., anti-malaria antibody, anti-influenza virus antibody, etc.) against the protein produced by the cDNA; a plaque hybridization method using a probe selectively binding to the target DNA sequence; a colony hybridization method; and combinations thereof.
The probe used in such hybridization methods is usually a DNA fragment chemically synthesized based on the information on the DNA sequence of the immunogenic foreign gene. The DNA sequences of the immunogenic foreign gene already obtained or fragments thereof can also be advantageously used as the probe. A sense primer and an antisense primer designed based on the DNA sequence information of the immunogenic foreign gene can also be used as the probe for the screening. The DNA (nucleotides) used as the probe is a partial
DNA (nucleotides) corresponding to the DNA sequence of an immunogenic foreign gene. The DNA (nucleotides) has an at least 15 consecutive DNA, preferably at least 20 consecutive DNA, and more preferably at least 30 consecutive DNA sequence. A positive clone itself for producing the DNA as mentioned above can also be used as the probe.
To obtain the DNA of the immunogenic foreign gene, a DNA/RNA amplification method by PCR (Science, 230, 1350 (1985)) is preferably used. In particular, when a full length cDNA is hardly obtained from the library, the RACE method (Rapid amplification of cDNA ends; Jikken Igaku 12(6), 35(1994)), particularly the 5'-RACE method (M. A. Frohman, et al., Proc. Natl. Acad. Sci., USA., 8, 8998(1988)) is preferably used.
The primers used for PCR can be designed, based on the DNA sequence information of the immunogenic foreign gene, and synthesized in accordance with standard methods. As the primers, DNA portions (SP6 promoter/primer and T7 terminator/primer) added to both ends of a vector plasmid having the DNA of the immunogenic foreign gene incorporated therein can also be used, as described in the Examples below. The isolation/purification of the DNA/RNA fragment amplified by PCR can be performed in accordance with standard methods, for example, by gel electrophoresis.
The DNA sequence of the DNA of the immunogenic foreign gene thus obtained or various DNA fragments thereof can be determined in accordance with standard methods, for example, by the dideoxy method (Proc. Natl. Acad. Sci., USA., 74, 5463(1977)) or Maxam-Gilbert method (Methods in Enzymology, 65, 499(1980)), or by simply using a commercially available sequencing kit. The gene encoding the amino acids of a protein capable of being a component of viral particles may be any gene that can encode a protein that is formed into a fusion protein with an immunogenic foreign gene as mentioned above in target cells and can be expressed as a protein capable of being a component of viral particles in insect cells.
Examples of the gene encoding the amino acids of a protein capable of being a component of viral particles include genes of gp64 protein (GenBank Accession No. L22858) , vesicular stomatitis virus glycoprotein G (VSVG: GenBank Accession No. J02428), herpes simplex virus glycoprotein (KOS: GenBank
Accession No. K01760), human immunodeficiency virus type I gpl20 (GenBank Accession No. U47783) , human respiratory syncytial virus membrane glycoprotein (GenBank Accession No. M86651) , influenza A virus hemagglutinin protein (GenBank Accession No. U38242), and genes of envelope proteins of viruses closely related to baculovirus. In the present invention, the gp64 gene described in Examples below can be preferably used.
The DNA of the gene encoding the amino acids of a protein capable of being a component of viral particles can be easily produced or obtained by synthesis based on the nucleic acid sequence information of the polynucleotide encoding the amino acid sequence of the polypeptide of the gene encoding the amino acids of the target protein capable of being a component of viral particles; or by directly synthesizing the DNA corresponding to the nucleotide sequence encoding the amino acid sequence, based on the amino acid sequence information of the gene encoding the amino acids of the protein capable of being a component of viral particles (chemical DNA synthesis) , as in the case of the production of the DNA of the immunogenic foreign gene. The DNA sequence corresponding to the nucleic acid sequence encoding the amino acids of a protein capable of being a component of viral particles is not limited to a full-length coding region, and may be DNA containing a partial DNA sequence thereof . As in the case of the production of the DNA molecule of the immunogenic foreign gene, the DNA of the gene encoding the amino acids of a protein capable of being a component of viral particles can be produced by general gene engineering techniques (see, for example, Molecular Cloning 2d Ed, Cold Spring Harbor Lab. Press (1989) ; Zoku Seikagaku Jikken Kouza, "Idenshi Kenkyuho I, II, III", edited by the Japanese Biochemistry Society, 1986) .
In the present invention, commercially available vector plasmids into which a part of the promoter that controls the expression of the immunogenic foreign gene described later has been incorporated and a (partial) gene encoding the amino acids of a protein capable of being a component of viral particles has been introduced can also be used. Vertebrate Promoters
Examples of the vertebrate promoter (promoter capable of functioning in vertebrate cells) that is one of the components of the transfer vector used in the present invention include mammalian promoters and avian promoters. Mammalian Promoters
Examples of the mammalian promoter (promoter capable of functioning in mammalian cells) that is one of the components of the transfer vector used in the present invention include cytomegalovirus promoters, SV40 promoters, retrovirus promoters, metallothionein promoters, heat shock protein promoters, CAG promoters, elongation factor lα promoters, actin promoters, ubiquitin promoters, albumin promoters, and MHC promoters. Avian Promoters
Examples of the avian promoter include β actin promoters, heat shock protein promoters, elongation factor promoters, ubiquitin promoters, and albumin promoters. Baculovirus Promoters
Examples of the baculovirus promoter that is one of the components of the baculovirus transfer vector used in the present invention include polyhedrin promoter, plO promoter, iel promoter, p35 promoter, vp39 promoter, and gp64 promoter. Production of Recombinant Transfer Vector
The present invention relates to a novel transfer vector having a structure capable of expressing the desired immunogenic foreign gene as an antigenic protein in both insect cells and vertebrate cells, particularly mammalian cells. The novel transfer vector produced in the present invention has a structure in which a DNA sequence encoding the amino acid sequence of the desired immunogenic protein and a DNA sequence encoding the amino acid sequence of a protein capable of being a component of viral particles are linked downstream of linked promoters comprising one vertebrate promoter, particularly a mammalian promoter, and one baculovirus promoter. The DNA regions containing the DNA sequences of the two promoters, i.e., one vertebrate promoter, particularly a mammalian promoter, and one baculovirus promoter, may be directly linked to each other, or an intervening DNA sequence may be present between the DNA sequences of the two promoters (provided, however, that the two promoters should have promoter activity in insect cells and in vertebrate cells, and particularly mammalian cells) . The promoter region has a structure such that either of a vertebrate promoter, particularly a mammalian promoter, and a baculovirus promoter, linked to each other, may be disposed more closely to the gene to be expressed. In the Examples described later, a baculovirus promoter is disposed more closely to the gene to be expressed than a mammalian promoter. In the above structure, the DNA sequence of the fusion gene of a gene encoding a protein capable of being a component of viral particles and a desired immunogenic foreign gene may be such that these two genes are directly linked to each other, or an intervening DNA sequence is present between the genes (provided, however, that it is necessary not to cause a frameshift of the downstream gene and the upstream gene) . Preferably, the antigen-presenting domain of the protein of a foreign gene having the desired immunogenicity is fused to a protein capable of being a component of viral particles. Therefore, the protein of a foreign gene having the desired immunogenicity should not be cut off from the protein capable of being a component of viral particles, but should be used in a form fused therewith.
A fusion gene containing these two genes may be prepared in advance, and then incorporated into the vector.
Alternatively, one of the genes may first be incorporated into the vector and then the other may be incorporated into the vector to form a fusion gene in the vector.
To produce such a transfer vector, commercially available expression vectors already having some essential components of the transfer vector of the present invention, i.e., a promoter region containing a vertebrate promoter, particularly a mammalian promoter, and a baculovirus promoter, and a gene region encoding the amino acid sequence of a protein capable of being a component of viral particles, may be used, and the required components can be inserted by optionally cleaving such a commercially available expression vector with restriction enzymes and incorporating other promoter to insert a fused DNA sequence of a foreign gene having the desired immunogenicity and a gene encoding the amino acid sequence of a protein capable of being a component of viral particles into the cloning region of the vector, or by inserting a foreign gene having the desired immunogenicity into the N terminus side of the DNA region of a gene encoding the amino acid sequence of a protein capable of being a component of viral particles, already incorporated in a plasmid.
In the present invention, the plasmid vector having a structure capable of expressing a foreign protein having the desired immunogenicity. as an antigenic protein in both insect cells and vertebrate cells, particularly mammalians cells, may be produced by using a commercially available plasmid already having a partial structure thereof. The amino acid sequence of a peptide for cleaving the fusion protein with enzymes in vertebrate cells may intervene. In the transfer vector of the present invention, an enhancer for increasing the transcription activity in vertebrate cells, particularly mammalian cells, may be disposed upstream of the two promoters, or a DNA sequence encoding the amino acid sequence of a signal peptide for facilitating extracellular secretion of the expressed protein from host cells may be bound to the gene to be fused and expressed. To terminate the transcription, a vertebrate terminator region, such as a rabbit β globin terminator, which is effective in vertebrate cells, may be disposed downstream of the gene to be fused and expressed. A transfer vector capable of expressing a fusion gene of an immunogenic foreign gene capable of expressing the desired immunogenicity in baculovirus particles and a gene encoding the amino acid sequence of a protein capable of being a component of viral particles can be thereby produced. Specific examples of the transfer vector and the method for production thereof according to the present invention are as shown in the Examples described later. More specifically, transfer vectors having a structure in which a CAG promoter modified from a cytomegalovirus (CMV) promoter as a vertebrate promoter, particularly a mammalian promoter, and a polyhedrin
(polh) promoter, vp39 promoter, or gp64 promoter as a baculovirus promoter, are linked to each other, and a fused DNA sequence of an influenza virus antigen gene or malaria antigen gene as a foreign gene and a gp64 antigen gene as a gene encoding the amino acid sequence of a protein capable of being a component of the viral particle is inserted can be mentioned as examples of pCAP- PfCSP, pCAP-PfCSP/272, pCAP-PfCSP/467, pCAP-PfCSP (A361E) , pCAP- PfCSP (A361E) /272, pCAP-PfCSP(A361E) /467, pCAP-PfCSP-76, pCAP- PfCSP-76/467, pCAP-PfCSP+209, pCAP-PfCSP+209/467, pCAP- PfCSP+76/209, pCAP-PfCSP+76/209/467, pCAP-HAl/Anhui, pCAP- HAl/Anhui/272, pCAP-HAl/Anhui/467, pCAP-HAl/Vietnam, pCAP- HAl/Vietnam/51, pCAP-HAl/Vietnam/101, pCAP-HAl/Vietnam/154, pCAP- HAl/Vietnam/201, pCAP-HAl/Vietnam/272, pCAP-HAl/Vietnam/467, pCAP-AH/345, pCAP-AH/345/467, pCAP-AH/410, pCAP-AH/410/467, pCAP- AH/473, pCAP-AH/473/467, pCAP-AH/520, pCAP-AH/520/467, pCAP- VN/346, pCAP-VN/346/467, pCAP-VN/410, pCAP-VN/410/467, pCAP- VN/473, pCAP-VN/473/467, pCAP-VN/520, pCAP-VN/520/467, pCAP- CO/full, pCAP-CO/full/467, pCAP-CO/19, pCAP-CO/19/467, pCAP-CO/76, pCAP-CO/76/467, pCAP-CO/205, pCAP-CO/205/467, pCA39-HAl/Anhui, pCA64-HAl/Anhui, pCA39-PfCSP(A361E) , pCA64-PfCSP (A361E) , pCAP- CO/full/VSV, pCAP-CO/19/VSV, pCAP-CO/76/VSV, pCAP-CO/205/VSV, pDual-Pfs25-PfCSP-gp64, and pDual-PfMSPl-PfCSP-gp64. (2) Production of Recombinant Baculovirus
The present invention provides a method of producing a recombinant baculovirus comprising the step of producing a transfer vector having a structure in which a fusion gene containing at least one gene encoding a protein capable of being a component of the viral particle and at least one immunogenic foreign gene is incorporated downstream of a dual promoter consisting of two linked promoters, i.e., one vertebrate promoter and one baculovirus promoter, and the step of co-transfecting the transfer vector and a baculovirus DNA into a host cell and isolating the recombinant baculovirus.
In the above process of producing the recombinant baculovirus, the method of introducing the desired recombinant DNA (transfer vector) into the host cell and the method of transformation thereby are not particularly limited. Various methods that are well known and commonly used in this field can be used. For example, general genetic recombination techniques (e.g., Science, 224, 1431 (1984); Biochem. Biophys. Res. Coirim. , 130, 692 (1985); Proc. Natl. Acad. Sci. USA, 80, 5990 (1983) can be used to prepare the recombinant baculovirus. The recombinant DNA (transfer vector) can be expressed and produced with reference to Ohno et al., "Tanpaku Jikken Protocol 1 Functional Analysis, Saibo Kogaku Bessatsu, Jikken Protocol Series, 1997, Shujun-sha". The general methods used for the handling of insect cells, gene recombination, and co-transfection may be the same as well-known methods of producing a recombinant virus in insect cells (BACULOVIRUS EXPRESSION VECTORS: A LABORATORY MANUAL, Oxford University Press, 1994) .
The resulting recombinant baculovirus can be cultured in accordance with standard methods. A fusion product (expressed product) of the DNA of a foreign gene having the desired immunogenicity with the DNA encoding the amino acid sequence of a protein capable of being a component of viral particles of the present invention is expressed and produced (accumulated and secreted) inside, outside, or on the cell membrane of insect cells by the culturing of the baculovirus.
As a medium used for the culturing, various commonly used media can be selectively used according to the host cell used. The culture can be performed under conditions suitable for the growth of the host cell.
More specifically, the method of producing the recombinant baculovirus comprises the step of preparing a baculovirus DNA to be subjected to homologous recombination with a transfer vector produced above, and the step of co-transfecting the transfer vector and the baculovirus DNA into insect cells, such as Sf9 cells and Sf21 cells derived from Spodoptera frugiperda, and Tn5 cells (High Five cells) derived from Trichoplusia ni, as host cells.
The baculovirus DNA thus produced to be subjected to homologous recombination with the transfer vector may be a wild type, mutant, or recombinant baculovirus DNA. The baculovirus DNA can enhance the probability of its homologous recombination with the transfer vector of the present invention as long as it has a DNA structure homologous to the baculovirus-derived DNA containing DNA of the dual promoter region, and DNA of a fusion gene obtained by fusion of an immunogenic foreign gene and a gene encoding a protein capable of being a component of viral particles.
To induce homologous recombination, the mixing ratio of the transfer vector to the baculovirus DNA by weight is preferably about 1:1 to about 10:1.
After the co-transfection step of simultaneous introduction into insect cells, the cells are cultured, and viral plaques are obtained from the culture supernatant and then suspended in a medium. The virus is eluted from agar by vortex and centrifuged to yield a solution containing the recombinant virus. In the above process, commercially available products may be used as the baculovirus DNA. For example, BacVector-1000 DNA and BacVector-2000 DNA (supplied from Novagen) in which the polyhedrin gene has been removed from AcNPV can be used.
The co-transfection for the homologous recombination of the obtained transfer vector and baculovirus DNA into insect cells can be performed using a commercially available vector transfection kit (BacVector Transfection Kits, supplied from Novagen) as described above in accordance with the instructions packaged with the vector transfection kit. Thus, the obtained transfer vector can be co-transfected together with the baculovirus DNA into insect cells such as Sf9 cell to yield a recombinant baculovirus .
In the present invention, in accordance with the above method of producing a recombinant baculovirus, a transfer vector that is any one of pCAP-PfCSP, pCAP-PfCSP/272, pCAP-PfCSP/467, pCAP-PfCSP(A361E) , pCAP-PfCSP (A361E) /272, pCAP-PfCSP (A361E) /467, pCAP-PfCSP-76, pCAP-PfCSP-76/467, pCAP-PfCSP+209, pCAP- PfCSP+209/467, pCAP-PfCSP+76/209, pCAP-PfCSP+76/209/467, pCAP- HAl/Anhui, pCAP-HAl/Anhui/272, pCAP-HAl/Anhui/467, pCAP- HAl/Vietnam, pCAP-HAl/Vietnam/51, pCAP-HAl/Vietnam/101, pCAP- HAl/Vietnam/154, pCAP-HAl/Vietnam/201, pCAP-HAl/Vietnam/272, pCAP-HAl/Vietnam/467, pCAP-AH/345, pCAP-AH/345/467, pCAP-AH/410, pCAP-AH/410/467, pCAP-AH/473, pCAP-AH/473/467, pCAP-AH/520, pCAP- AH/520/467, pCAP-VN/346, pCAP-VN/346/467, pCAP-VN/410, pCAP- VN/410/467, pCAP-VN/473, pCAP-VN/473/467, pCAP-VN/520, pCAP- VN/520/467, pCAP-CO/full, pCAP-CO/full/467, pCAP-CO/19, pCAP- CO/19/467, pCAP-CO/76, pCAP-CO/76/467, pCAP-CO/205, pCAP- CO/205/467, pCA39-HAl/Anhui, pCA64-HAl/Anhui, pCA39-PfCSP(A36lE) , pCA64-PfCSP(A361E), pCAP-CO/full/VSV, pCAP-CO/19/VSV, pCAP- CO/76/VSV, pCAP-CO/205/VSV, pDual-Pfs25-PfCSP-gp64, and pDual- ■ PfMSPl-PfCSP-gp64, and a baculovirus DNA can be co-transfected into Sf9 insect cells to yield a recombinant baculovirus of any one of AcNPV-CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP-PfCSP (A361E), AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP-AH/473/467, AcNPV-CAP-AH/520, AcNPV- CAP-AH/520/467, AcNPV-CAP-VN/346, AcNPV-CAP-VN/346/467, AcNPV- CAP-VN/410, AcNPV-CAP-VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP- VN/473/467, AcNPV-CAP-VN/520, AcNPV-CAP-VN/520/467, AcNPV-CAP- CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP- CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-CAP-CO/205/467, AcNPV-CA39-HAl/Anhui, AcNPV-CA64-HAl/Anhui, AcNPV-CA39-PfCSP(A361E), AcNPV-CA64-PfCSP (A361E) , AcNPV-CAP-
CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP- CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl- PfCSP-gp64.
In addition to the above method of producing a recombinant baculovirus, other methods of producing a recombinant baculovirus include, for example, a method of using a transposon as a phagemid (bacmid) having the entire baculovirus genome incorporated therein to efficiently insert a foreign gene into Escherichia coli. According to this method, a bacmid bearing a viral gene is extracted from bacterial cells and transfected into insect cells to thereby easily produce and collect a recombinant baculovirus .
The purification of the recombinant baculovirus of the present invention obtained by the above method of producing a recombinant baculovirus can be performed by using known virus purification methods.
For the purification of the recombinant baculovirus, for example, 0.5 to 1.0 mL of a stock virus obtained by the above method of producing a recombinant baculovirus is inoculated into insect cells (1 x 107 cells/10 cm dish) , such as Sf9 cells, the culture supernatant is collected several days after the infection, and a virus pellet obtained by centrifugation is suspended in a buffer, such as PBS. The resulting suspension is subjected to a sucrose gradient of 10 to 60%, and then centrifuged (25,000 rpm,
60 minutes, 4°C) to collect a virus band. The collected virus is further suspended in PBS, subsequently centrifuged (under the same conditions as above) , and the resulting purified recombinant virus pellet is stored at 4°C in a buffer, such as PBS. The infectivity titer of the above resulting purified recombinant virus can be measured by plaque assay (BACULOVIRUS EXPRESSION VECTORS: A LABORATORY MANUAL, Oxford University Press, 1994) using insect cells such as Sf9 cells.
In the recombinant viruses described in the Examples, the N terminus of the baculovirus protein gp64 is exposed outside the particle, whereas the C terminus thereof is inside the particle. Therefore, if the protein encoded by a foreign gene having the desired immunogenicity is fused to the N terminus of gp64, the entity thereof is exposed as a component of the viral particle outside the viral protein particle in insect cells, and thus the antigen is more easily presented, which is suitable for use as the vaccine formulation of the present invention. (3) Pharmaceutical Composition of the Present Invention (Pharmaceutical Containing the Recombinant Baculovirus of the Present Invention as an Active Ingredient)
The recombinant baculovirus of the present invention, which is an active ingredient of the pharmaceutical composition of the present invention, can be obtained by the genetic engineering techniques shown in the above (2) . The pharmaceutical composition of the present invention essentially contains as the active ingredient a recombinant baculovirus obtained by homologous recombination of a baculovirus DNA and a transfer vector constructed so that a fusion gene obtained by the fusion of an immunogenic foreign gene of the present invention to a gene encoding the amino acid sequence of a protein capable of being a component of the viral particle can be expressed in insect cells and vertebrate cells, particularly cells of mammalians, including humans.
The present invention particularly provides a pharmaceutical composition comprising as an active ingredient a specific recombinant baculovirus that is any one of AcNPV-CAP- PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E) , AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP-
PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP-AH/473/467, AcNPV-CAP-AH/520, AcNPV- CAP-AH/520/467, AcNPV-CAP-VN/346, AcNPV-CAP-VN/346/467, AcNPV- CAP-VN/410, AcNPV-CAP-VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP- VN/473/467, AcNPV-CAP-VN/520, AcNPV-CAP-VN/520/467, AcNPV-CAP- CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP- CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-CAP-CO/205/467, AcNPV-CA39-HAl/Anhui, AcNPV-CA64-HAl/Anhui, AcNPV-CA39-PfCSP(A361E), AcNPV-CA64-PfCSP (A361E) , AcNPV-CAP- CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP- CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl- PfCSP-gp64.
The recombinant baculovirus of the present invention that is any one of AcNPV-CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV- CAP-PfCSP/467, AcNPV-CAP-PfCSP (A361E) , AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP-PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP- 76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP-AH/473/467, AcNPV-CAP-AH/520, AcNPV- CAP-AH/520/467, AcNPV-CAP-VN/346, AcNPV-CAP-VN/346/467, AcNPV- CAP-VN/410, AcNPV-CAP-VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP- VN/473/467, AcNPV-CAP-VN/520, AcNPV-CAP-VN/520/467, AcNPV-CAP- CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP- CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-CAP-CO/205/467, AcNPV-CA39-HAl/Anhui, AcNPV-CA64-HAl/Anhui, AcNPV-CA39-PfCSP(A361E) , AcNPV-CA64-PfCSP(A361E) , AcNPV-CAP- CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP- CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl- PfCSP-gp64, used as an active ingredient of the pharmaceutical composition of the present invention, has the action of enhancing infection-preventing effects against an infectious antigen and reducing the infectivity titer. Utilizing this action and activity, the recombinant baculovirus can be used for the treatment of diseases associated with infection of target cells and tissues. Examples of target cells affected by such infection include blood cells, hepatic cells, renal cells, brain cells, lung cells, epithelial cells, and muscular cells. Examples of tissues comprising such cells include the lung, liver, kidney, brain, arteries and veins, the stomach, intestines, urethra, skin, and muscle.
The pharmaceutical composition enhances infection- preventing effects against infectious antigens, for example, malaria antigens such as sporozoite surface antigens (CSP and TRAP) of malaria parasites, merozoite surface membrane protein MSPl, malaria S antigen secreted from erythrocytes infected with malaria, PfEMPl protein present in the knobs of erythrocytes infected with malaria, SERA protein, TRAMP protein, AMAl protein, and Pfs25 known as a transmission-blocking antigen; and influenza antigens such as HA antigen, NA antigen, M2 antigen, and NP antigen, and reduces the infectivity titer (e.g., viral infectivity titer) , thereby increasing the survival period and survival rate of mammals including humans, compared to the group not administered the pharmaceutical composition of the present invention. Therefore, the pharmaceutical composition is particularly useful as a preventive or therapeutic agent for malaria and influenza virus infections.
The pharmaceutical composition of the invention has the action of enhancing infection-preventing effects against infectious antigens and reducing the infectivity titers, and is therefore useful as a preventive or therapeutic agent for infectious diseases caused by pathogens such as influenza viruses and malaria, and complications thereof.
By using a gene immunogenic to non-human vertebrates as an immunogenic foreign gene of the transfer vector to obtain a recombinant baculovirus used as an active ingredient of the pharmaceutical composition of the present invention, for example, a chicken influenza vaccine can be prepared, which has the action of enhancing infection-preventing effects against the infectious antigen and reducing the infectivity titer. By utilizing this action and activity, the pharmaceutical composition can be used for the treatment of diseases associated with the infection of target cells and tissues.
The pharmaceutical composition of the present invention can be prepared as a composition containing a pharmaceutically effective amount of the recombinant baculovirus of the invention and a pharmaceutically acceptable carrier.
The infection-preventing effect of the recombinant baculovirus of the present invention in vertebrates, particularly mammals, including humans, or mammalian cells can be provided, for example, by administering the pharmaceutical composition containing the recombinant baculovirus of the present invention and additives for pharmaceutical administration to vertebrates, particularly mammals, including humans, by the intramuscular, subcutaneous, intracutaneous, intraperitoneal, nasal, or respiratory route, and then immunizing the vertebrates with the pharmaceutical composition containing the recombinant baculovirus of the present invention as an active ingredient several times. Respiratory administration of the pharmaceutical composition of the invention is particularly preferable. The infection-preventing effect can be evaluated by comparing the survival rate of vertebrates, particularly mammals, including humans, that have been immunized with the pharmaceutical composition of the invention several times and then infected with a target pathogen with the survival rate of those not administered with the pharmaceutical composition. (4) Vaccine of the present invention
The recombinant baculovirus that is any one of AcNPV- CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E), AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP-AH/473/467, AcNPV-CAP-AH/520, AcNPV- CAP-AH/520/467, AcNPV-CAP-VN/346, AcNPV-CAP-VN/346/467, AcNPV- CAP-VN/410, AcNPV-CAP-VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP- VN/473/467, AcNPV-CAP-VN/520, AcNPV-CAP-VN/520/467, AcNPV-CAP- CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP- CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-CAP-CO/205/467, AcNPV-CA39-HAl/Anhui, AcNPV-CA64-HAl/Anhui, AcNPV-CA39-PfCSP(A361E), AcNPV-CA64-PfCSP(A361E) , AcNPV-CAP-
CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP- CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl- PfCSP-gp64 used as the active ingredient of the pharmaceutical composition of the present invention can enhance pathogen infection-preventing effects as described in the Examples below, and an expressed fusion product of the DNA sequence obtained by fusion of a gene encoding the amino acid sequence of a protein capable of being a component of viral particles and a foreign gene with the desired immunogenicity of the present invention capable of reducing the infectivity titer is produced as viral particles budded from insect cells. When the pharmaceutical composition of the invention is administered in the form of viral particles to vertebrates, particularly mammals, including humans, a foreign antigen protein contained as a component of viral particles promotes acquired immunity (humoral immunity and cellular immunity) , and further, the antigenic protein as an expressed product of the fusion DNA sequence seems to promote acquired immunity (humoral immunity and cellular immunity) in vertebrate cells, particularly cells of mammals, including humans. Thus, the recombinant baculovirus of the present invention is useful as a vaccine.
The present invention particularly provides a vaccine containing as an active ingredient a specific recombinant baculovirus that is any one of AcNPV-CAP-PfCSP, AcNPV-CAP- PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP-PfCSP (A361E) , AcNPV- CAP-PfCSP (A361E) /272, AcNPV-CAP-PfCSP (A361E) /467, AcNPV-CAP- PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP- PfCSP+209/467, AcNPV-CAP-PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP- HAl/Anhui/467, AcNPV-CAP-HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP- HAl/Vietnam/201, AcNPV-CAP-HAl/Vietnam/272, AcNPV-CAP- HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV- CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP- AH/473/467, AcNPV-CAP-AH/520, AcNPV-CAP-AH/520/467, AcNPV-CAP- VN/346, AcNPV-CAP-VN/346/467, AcNPV-CAP-VN/410, AcNPV-CAP- VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP-VN/473/467, AcNPV-CAP- VN/520, AcNPV-CAP-VN/520/467, AcNPV-CAP-CO/full, AcNPV-CAP- CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP-CO/19/467, AcNPV-CAP- CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-CAP-
CO/205/467, AcNPV-CA39-HAl/Anhui, AcNPV-CA64-HAl/Anhui, AcNPV- CA39-PfCSP(A361E) , AcNPV-CA64-PfCSP (A361E) , AcNPV-CAP-CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP-CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl-PfCSP-gp64. As in the pharmaceutical composition of the above (3) , the vaccine enhances infection-preventing effects against infectious antigens such as malaria antigens such as sporozoite surface antigens (CSP and TRAP) of the malaria parasite, merozoite surface membrane protein MSPl, malaria S antigen secreted from erythrocytes infected with malaria, PfEMPl protein present in the knobs of erythrocytes infected with malaria, SERA protein, TRAMP protein, and AMAl protein; and influenza antigens such as influenza virus HA antigen, influenza virus NA antigen, influenza virus M2 antigen, and influenza virus NP antigen; the vaccine also reduces the infectivity titer (e.g., the viral infectivity titer) , thereby increasing the survival period and survival rate of mammals, including humans, compared with the group not administered with the pharmaceutical composition of the present invention. Thus, the vaccine is particularly useful as a preventive or therapeutic agent for malaria and influenza virus infection.
The vaccine of the invention enhances infection- preventing effects against infectious antigens and reduces the infectivity titer, and is therefore useful as a preventive or therapeutic agent for infectious diseases caused by pathogens such as influenza viruses and malaria, and complications thereof.
By using a gene immunogenic to non-human vertebrates as an immunogenic foreign gene of the transfer vector to obtain a recombinant baculovirus used as an active ingredient of the pharmaceutical composition of the present invention, for example, a chicken influenza vaccine, that can enhance infection- prevention effects against the infectious antigen and reduce the infectivity titer, can be prepared. By utilizing this activity, the vaccine can be used for the treatment of diseases associated with the infection of target cells and tissues.
The recombinant baculovirus that is any one of AcNPV- CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E) , AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP-
PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP-AH/473/467, AcNPV-CAP-AH/520, AcNPV- CAP-AH/520/467, AcNPV-CAP-VN/346, AcNPV-CAP-VN/346/467, AcNPV- CAP-VN/410, AcNPV-CAP-VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP- VN/473/467, AcNPV-CAP-VN/520, AcNPV-CAP-VN/520/467, AcNPV-CAP- CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP- CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-CAP-CO/205/467, AcNPV-CA39-HAl/Anhui, AcNPV-CA64-HAl/Anhui, AcNPV-CA39-PfCSP(A361E), AcNPV-CA64-PfCSP (A361E), AcNPV-CAP- CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP- CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl- PfCSP-gp64, used as an active ingredient of the vaccine of the present invention, can enhance infection-preventing effects against an infectious antigen and reduce the infectivity titer. By utilizing this activity, the recombinant baculovirus can be used for the treatment of diseases associated with the infection of target cells and tissues.
Examples of target cells affected by such infection include blood cells, hepatic cells, renal cells, brain cells, lung cells, epithelial cells, and muscular cells. Examples of tissues containing such cells include lung, liver, kidney, brain, arterial and venous veins, stomach, intestine, urethra, skin, and muscle tissues.
The vaccine of the present invention can be prepared as a pharmaceutical composition of the above (3) containing a pharmaceutically effective amount of the recombinant baculovirus of the invention (any one of AcNPV-CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP-PfCSP (A361E), AcNPV-CAP- PfCSP (A361E) /272, AcNPV-CAP-PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-
PfCSP+209/467, AcNPV-CAP-PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP- HAl/Anhui/467, AcNPV-CAP-HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP- HAl/Vietnam/201, AcNPV-CAP-HAl/Vietnam/272, AcNPV-CAP- HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV- CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP- AH/473/467, AcNPV-CAP-AH/520,AcNPV-CAP-AH/520/467, AcNPV-CAP- VN/346, AcNPV-CAP-VN/346/467, AcNPV-CAP-VN/410, AcNPV-CAP- VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP-VN/473/467, AcNPV-CAP- VN/520, AcNPV-CAP-VN/520/467, AcNPV-CAP-CO/full, AcNPV-CAP- CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP-CO/19/467, AcNPV-CAP- CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-CAP- CO/205/467, AcNPV-CA39-HAl/Anhui, AcNPV-CA64-HAl/Anhui, AcNPV- CA39-PfCSP(A361E), AcNPV-CA64-PfCSP(A361E) , AcNPV-CAP-CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP-CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl-PfCSP-gp64) , and a pharmaceutically acceptable carrier.
The vaccine can be prepared in the form of a pharmaceutical composition by using a pharmaceutically acceptable carrier as used in the pharmaceutical composition of the above (3) , according to a standard method. Examples of carriers include physiologically acceptable solutions, such as sterile saline and sterile buffered saline. The vaccine (the formulation is hereinafter the same as in the pharmaceutical composition) can be prepared as a liposomal formulation containing as an active ingredient the recombinant baculovirus of the invention (any one of AcNPV-CAP- PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E), AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP-
PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP-AH/473/467, AcNPV-CAP-AH/520, AcNPV- CAP-AH/520/467, AcNPV-CAP-VN/346, AcNPV-CAP-VN/346/467, AcNPV- CAP-VN/410, AcNPV-CAP-VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP- VN/473/467, AcNPV-CAP-VN/520, AcNPV-CAP-VN/520/467, AcNPV-CAP- CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP- CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-CAP-CO/205/467, AcNPV-CA39-HAl/Anhui, AcNPV-CA64-HAl/Anhui, AcNPV-CA39-PfCSP(A361E) , AcNPV-CA64-PfCSP (A361E) , AcNPV-CAP- CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP- CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl- PfCSP-gp64), and can be used in combination with an adjuvant. Specific examples of the vaccine (the pharmaceutical composition) of the present invention include liposomal formulations. The liposomal formulation may be one in which the recombinant baculovirus of the present invention is retained in a liposome containing an acidic phospholipid as a membrane component, or containing a neutral phospholipid and an acidic phospholipid as membrane components.
The acidic phospholipid and neutral phospholipid used as membrane components are not particularly limited, and various lipids commonly used for liposomal formulations can be used alone or in a combination of two or more.
The liposome membrane is produced in accordance with a standard method by using an acidic phospholipid alone or together with a neutral phospholipid. When an acidic phospholipid is used together with a neutral phospholipid, the proportion of the acidic phospholipids in the liposome membrane components is preferably about 0.1 to about 100 mol%, more preferably 1 to 90 mol%, and even more preferably about 10 to about 50 mol%.
To prepare the liposome, for example, cholesterol or the like can be added. This can control the fluidity of phospholipids and facilitates the liposome preparation. In general, the cholesterol is preferably added in an equivalent amount or less, and preferably in a 0.5-fold amount to an equivalent amount by weight, to the phospholipid.
The mixing ratio of the acidic phospholipid to the active ingredient in the liposomal formulation is about 0.5 to about 100 equivalents, preferably about 1 to about 60 equivalents, and more preferably about 1.5 to about 20 equivalents.
The recombinant baculovirus of the present invention as an active ingredient is used in an amount of several mol% to several tens mol%, preferably about 5 to about 10 mol%, and usually around 5 mol%, based on the total amount of the lipids. The production, concentration, and particle diameter control of the liposomal formulation can be performed in accordance with standard methods. If desired, the various additives as described above can also be incorporated into the liposomal formulation.
To produce the liposomal formulation, the recombinant baculovirus of the invention as an active ingredient can be used in the form of being bound to a fatty acid (e.g., behenic acid, stearic acid, palmitic acid, myristic acid, and oleic acid) , an alkyl group, a cholesteryl group, or the like. The liposomal formulation containing such bound components can also be produced in accordance with a standard method (see, for example, Long Circulating Liposomes: Old Drugs, New Therapeutics., M. C. Woodle, G. Storm, Eds: Springer-Verlag Berlin (1998)).
The vaccine (pharmaceutical composition) of the present invention can preferably be used as a vaccine composition. The vaccine is preferably used in combination with a pharmaceutically effective amount of an adjuvant to enhance the anti-infection (anti-malaria or anti-influenza) effects.
Any adjuvant commonly used for this type of vaccine can be used as the adjuvant. Examples of such adjuvants include Freund's complete adjuvant, muramyl dipeptide, aluminium hydroxide, BCG, IL-12, N-acetylmuramine-L-alanyl-D-isoglutamine (MDP), thymosin αl, and QS-21. The amount of adjuvant used can be suitably selected according to the degree of symptoms, such as softening of the skin, pain, erythema, fever, headache, and muscular pain, which might be expressed as part of the immune response in humans or animals after the administration of this type of vaccine.
The vaccine (pharmaceutical composition) of the present invention may be used in combination with other publicly known pharmaceutical products, such as immune response-promoting peptides and antibacterial agents (synthetic antibacterial agents) .
The vaccine (pharmaceutical composition) may further contain other drugs and additives. Examples thereof include drugs that aid intracellular uptake of the recombinant baculovirus of the present invention, such as calcium ions. The liposome, and other drugs and additives that facilitate the transfection, such as fluorocarbon emulsifiers, cochleates, tubules, golden particles, biodegradable microspheres, and cationic polymers, can also be used.
The amount of the active ingredient contained in the vaccine (pharmaceutical composition) (drug) of the present invention is not particularly limited and can be selected from a wide range as long as it is a pharmaceutically effective amount. The dosage of the vaccine (pharmaceutical composition) is not particularly limited, and can be appropriately selected from a wide range according to the desired therapeutic effect, the administration method (administration route) , the therapeutic period, the patient's age, gender, and other conditions, etc.
When the recombinant baculovirus as an active ingredient of the vaccine (pharmaceutical composition) of the present invention is administered to a human, the recombinant baculovirus is administered in an amount corresponding to 102 to 1014 PFU, preferably 105 to 1012 PFU, and more preferably 106 to 1010 PFU per patient, calculated as the PFU of the recombinant virus . The dosage of the recombinant baculovirus (any one of
AcNPV-CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV- CAP-PfCSP (A361E) , AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467,
AcNPV-CAP-AH/473, AcNPV-CAP-AH/473/467, AcNPV-CAP-AH/520, AcNPV- CAP-AH/520/467, AcNPV-CAP-VN/346, AcNPV-CAP-VN/346/467, AcNPV- CAP-VN/410, AcNPV-CAP-VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP- VN/473/467, AcNPV-CAP-VN/520, AcNPV-CAP-VN/520/467, AcNPV-CAP- CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP- CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-CAP-CO/205/467, AcNPV-CA39-HAl/Anhui, AcNPV-CA64-HAl/Anhui, AcNPV-CA39-PfCSP(A361E), AcNPV-CA64-PfCSP (A361E) , AcNPV-CAP- CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP- CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl- PfCSP-gp64) , used as an active ingredient of the vaccine (pharmaceutical composition) of the present invention, can be selected from a very wide range, in terms of the amount of expressible DNA introduced into the vaccine host or the amount of transcribed RNA. These amounts also depend on the strength of the transcription and translation promoters used in the transfer vector of the invention.
The vaccine (pharmaceutical composition) of the present invention is administered by directly injecting a recombinant baculovirus suspension prepared by suspending the recombinant baculovirus in PBS (phosphate buffered saline) or saline into a local site (e.g., into the lung tissue, liver, muscle or brain) , or by nasal or respiratory inhalation, or by intravascular (e.g., intra-arterial, intravenous, and portal venous) , subcutaneous, intracutaneous, or intraperitoneal administration. The vaccine of the invention is preferably administered by respiratory inhalation.
The vaccine (pharmaceutical composition) of the present invention is preferably administered more than once. More specifically, after the initial administration, additional vaccinations are preferably performed once to several times while . the condition is observed. This can enhance the desired effect. After the administration of the vaccine (pharmaceutical composition) , booster immunization with a pharmaceutical composition containing the recombinant baculovirus of the present invention (any one of AcNPV-CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP-PfCSP (A361E) , AcNPV-CAP- PfCSP (A361E) /272, AcNPV-CAP-PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP- PfCSP+209/467, AcNPV-CAP-PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP- HAl/Anhui/467, AcNPV-CAP-HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP- HAl/Vietnam/201, AcNPV-CAP-HAl/Vietnam/272, AcNPV-CAP- HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV- CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP- AH/473/467, AcNPV-CAP-AH/520, AcNPV-CAP-AH/520/467, AcNPV-CAP- VN/346, AcNPV-CAP-VN/346/467, AcNPV-CAP-VN/410, AcNPV-CAP- VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP-VN/473/467, AcNPV-CAP- VN/520, AcNPV-CAP-VN/520/467, AcNPV-CAP-CO/full, AcNPV-CAP-
CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP-CO/19/467, AcNPV-CAP- CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-CAP- CO/205/467, AcNPV-CA39-HAl/Anhui, AcNPV-CA64-HAl/Anhui, AcNPV- CA39-PfCSP(A361E) , AcNPV-CA64-PfCSP (A361E) , AcNPV-CAP-CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP-CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl-PfCSP-gpβ4) can be performed. Further, use of various other drugs with the vaccine of the invention, as mentioned above, may enhance the therapeutic effect achieved by the administration of the vaccine (pharmaceutical composition) .
In one embodiment of the vaccine (pharmaceutical composition) of the present invention, the recombinant baculovirus, used as one of the active ingredients of the vaccine (pharmaceutical composition) of the invention, is generally prepared by homologous recombination of a baculovirus DNA and a transfer vector into which a fusion gene obtained by fusion of a foreign gene having the desired immunogenicity and a gene encoding a protein capable of being a component of viral particles has been introduced. The recombinant baculovirus is mixed, in an injectable dosage form (a solution, suspension or emulsion), with a pharmaceutically acceptable carrier (i.e., nontoxic to humans and other vertebrates in the dosage and concentration used, and compatible with other ingredients in the formulation) to produce a formulation. Preferably, the formulation thus obtained does not contain oxidizing agents or any other compound that is publicly known to be harmful to recombinant baculovirus .
The carrier may contain a trace amount of additives, such as substances that enhance the isotonicity and chemical stability. Such additives are non-toxic to mammals, including humans, in the dosage and concentration used, and examples thereof include buffers such as phosphoric acid, citric acid, succinic acid, acetic acid, and other organic acids, and salts thereof; antioxidants such as ascorbic acid; low molecular weight (e.g., less than about 10 residues) polypeptides (e.g., polyarginine and tripeptide) proteins (e.g., serum albumin, gelatin, and immunoglobulin); amino acids (e.g., glycine, glutamic acid, aspartic acid, and arginine) ; monosaccharides, disaccharides, and other carbohydrates (e.g., cellulose and derivatives thereof, glucose, mannose, and dextrin) , chelating agents (e.g., EDTA); sugar alcohols (e.g., mannitol and sorbitol); counterions (e.g., sodium); nonionic surfactants (e.g., polysorbate and poloxamer) ; and PEG.
The pharmaceutical vaccine (composition) containing the recombinant baculovirus can typically be stored as an aqueous solution or a lyophilized product in a unit or multiple dose container such as a sealed ampoule or a vial.
The present invention further provides a method of preventing malaria or influenza infection, or a method of treating malaria or influenza, comprising administering an effective amount of the recombinant baculovirus, vaccine, formulation, and pharmaceutical composition of the invention to a subject. The present invention further provides a method of immunostimulation comprising administering an effective amount of the recombinant baculovirus, vaccine, formulation, and pharmaceutical composition of the invention to a subject. Examples of the subjects used include those that may be infected with malaria parasites or influenza viruses, such as humans and other animals (such as mammals, birds, reptiles, fish, and amphibians) , and those infected with malaria parasites or influenza viruses. The influenza virus with which the subject is infected is preferably an influenza A virus, and more preferably an influenza A subtype Hl virus, or an influenza A subtype H3 virus. Examples of malaria parasites include Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale.
The recombinant baculovirus of the present invention is formed alone or together with a pharmaceutically acceptable carrier into a vaccine, formulation, or pharmaceutical composition, and administered to the subject.
The administration route may be, for example, any administration route mentioned above. The pharmaceutically acceptable carrier for use in the present invention can be suitably selected from carriers commonly used in this technical field, according to the form of the pharmaceutical composition to be produced.
For example, when the pharmacological composition is formed into an aqueous solution, purified water (sterile water) or a physiological buffer solution can be used as the carrier. When the pharmaceutical composition is formed into other appropriate solutions, organic esters capable of being injected, such as glycol, glycerol and olive oil, can be used as the carrier. The composition may contain stabilizers, excipients and the like commonly used in this technical field, and particularly in the field of vaccine formulations.
The amount of recombinant baculovirus in the vaccine, formulation, or pharmaceutical composition of the present invention is not particularly limited, and can be suitably selected from a wide range. In general, the amount of recombinant baculovirus in the composition is preferably about 0.0002 to about 0.2 (w/v %) , and more preferably 0.001 to 0.1 (w/v %) . The administration method of the recombinant baculovirus, vaccine, formulation, or pharmaceutical composition of the invention is not particularly limited, and can be suitably selected according to the dosage form, the patient's age, gender and other conditions, the severity of the disease, etc. A preferable dosage form thereof is a form for parenteral administration, such as injections, drops, nasal drops, and inhalants. When the composition is formed into an injection or drops, the injection can be intravenously administered as mixed with a replacement fluid such as a glucose solution or an amino acid solution as required, or can be administered intramuscularly, intracutaneously, subcutaneously or intraperitoneally.
The daily dosage of the recombinant baculovirus, vaccine, formulation, or pharmaceutical composition of the present invention may vary depending on the subject's condition, body weight, age, gender, etc., and therefore cannot be completely specified. However, the dosage is usually such that the recombinant baculovirus is administered in an amount of 0.001 to 100 mg per kg of body weight per day. The vaccine, formulation, or composition of the invention can be administered in one or more administrations per day.
When the recombinant baculovirus as an active ingredient of the vaccine (formulation or pharmaceutical composition) of the present invention is administered, the recombinant baculovirus is administered in an amount corresponding to 102 to 1014 PFU, preferably 105 to 1012 PFU, and more preferably 106 to 1010 PFU per patient, calculated as the PFU of the recombinant virus. The vaccine (composition) of the present invention is administered according to Good Medical Practice, considering the clinical condition (for example, the condition to be prevented or treated) of each patient, the delivery site of the vaccine (composition) containing the recombinant baculovirus, the target tissue, the administration method, the dosage regimen, and other factors publicly known to those skilled in the art. Therefore, the proper dosage of the vaccine (composition) herein is determined in consideration of the above.
EXAMPLES The present invention will be described below in more detail with reference to Examples. These Examples are merely examples of the present invention, and do not limit the present invention. Example 1: Transfer Vector Plasmid and Method for Production thereof of the Present Invention
(1) Construction of Transfer Vector Plasmids pCAP-PfCSP, pCAP- PfCSP/272, and pCAP-PfCSP/467 of the Present Invention (1.1) Construction of Plasmid pBACsurf-Hsp65 An Hsp65 gene was obtained by extracting genomic DNA from M. tuberculosis H37Rv strain using a QIAamp DNA Midi Kit (Qiagen) , and cloning by PCR. More specifically, the genomic DNA extracted from the M. tuberculosis H37Rv strain was amplified by PCR using primers phsp65-Fl (5' - AATAATAGATCTAATGGCCAAGACAATTGCGTACGACGAAGA -3' (SEQ ID NO: 1) ; the BgIII site is underlined) and phsp65-Rl (5' -
AATCCAATGCGGCCGCGGGAATTCGATTCCTGCAGGTCAGAAATCCATGCCACCCATGTCGCC - 3' (SEQ ID NO: 2); the Notl site is underlined). The PCR product was purified, cleaved with restriction enzymes BgIII and Notl, ligated to pcDNA3.1(+) (from Invitrogen) digested with BamHI and Notl. The resulting plasmid was designated pcDNA-hsp65. PCR was performed with pcDNA-hsp65 as a template using primers phsp65-F2
(5' - CACCCCTGCAGGACΓACAAGGACGACGAΓGACAAGGAATTCATGGCCAΆGAC
AATTGCGTACGACGAAGAGGCC - 3' (SEQ ID NO: 3); the Sse8387I and EcoRI sites are underlined, and the FLAG sequence is italicized) , and phsp65-R2 (5' - CCCGGGCGAAATCCATGCCACCCATGTCGCCGCCACC - 3' (SEQ
ID NO: 4); the Cfr9I site is underlined). The resulting Hsp65 gene DNA fragment was cloned into pENTR/D-TOPO (from Invitrogen), then cleaved with Sse8387I/Cfr9l and inserted into the PstI/Cfr9I site of pBACsurf-CSP (Yoshida et al., Virology 316: 161-70, 2003).
The plasmid thus constructed was designed pBACsurf-Hsp65. (1.2) Construction of Plasmid pENTR-gp64
PCR was performed with pBACsurf-1 (from Novagen) as a template using primers pPolh-F2 (5' - CACCCGGACCGGATAATTAAAATGATAACCATCTCGCAAATAAATAAG - 3' (SEQ ID NO: 5); the RsrII site is underlined), and pgp64-R2 (5' - GGTACCATATTGTCTATTACGGTTTCTAATCATAC - 3' (SEQ ID NO: 6) ; the Kpnl site is underlined) . The resulting gp64 gene DNA fragment was inserted into pENTR/D-TOPO to construct a plasmid pENTR-gp64. The plasmid thus constructed was designated pENTR-gp64.
(1.3) Construction of Transfer Vector pDual-Hsp65-gp64 of the Present Invention pBACsurf-Hsp65 was cleaved with PstI/Cfr9I, and the hsp65 gene DNA fragment was inserted into the PstI/Cfr9I site of pENTR-gp64 to construct a plasmid pENTR-Hsp65-gp64. The pENTR- Hsp65-gp64 was cleaved with RsrII/Kpnl, and a DNA fragment consisting of a polyhedrin promoter and hsp65-gp64 gene was inserted into pTriEx-3.1 (Novagen) cleaved with RsrII and Kpnl to construct a transfer vector plasmid pDual-Hsp65-gp64 enabling the expression of a fusion protein of Hsp65 antigen and gp64 protein in mammalian and insect cells under the control of the desired dual promoter consisting of CMA promoter and polyhedrin promoter.
(1.4) Construction of Transfer Vector pDual-HlNl/HAl-gp64 of the Present Invention
RNA was extracted from a culture supernatant of MDCK cells infected with influenza virus PR/8/34 strain using a QIAamp MinElute Virus Spin Kit (from Qiagen) , and amplified by RT-PCR using primers HA-f (5f - CCTGCAGGTATGAAGGCAAACCTACTGGTC - 3' (SEQ ID NO: 7); the Sbfl site is underlined) and HA-r (5' -
GCCCGGGCGATGCATATTCTGCA - 3 (SEQ ID NO: 8); the Sbfl site is underlined) . The resulting influenza virus HA gene fragment was cloned into pCR-Blunt II-TOPO (from Invitrogen) . The resulting plasmid was designated as pCR-Blunt-HA. PCR was performed with the pCR-Blunt-HA as a template using primers pHA-Fl (5' -
CACCGAATTCGACACAATATGTATAGGCTACCATGCG-S' (SEQ ID NO: 9) ; the EcoRI site is underlined) and pHA-Rl (5' -
CCCGGGCACCTCTGGATTGGATGGACGGAATG - 3' (SEQ ID NO: 10); the Cfr9I site is underlined) . The resulting H1N1/HA1 gene DNA fragment was cloned into pENTR/D-TOPO, then cleaved with EcoRI/Cfr9I and inserted into the EcoRI/Cfr9I site of pDual-Hsp65-gp64 to construct a plasmid pDual-HlNl/HAl-gp64.
(1.5) Construction of Plasmid pBACsurf-HAl pDual-HlNl/HAl-gp64 was cleaved with EcoRI/Cfrl, and the DNA fragment of HlNl/HAl gene was inserted into pBACsurf- Hsp65 digested with EcoRI and Cfrl to construct a plasmid pBACsurf-HAl .
(1.6) Construction of Plasmid pCP-HlNl/HAl-gp64
PCR was performed with pBACsurf-HAl as a template using Polh-f RsrII (5' - GGGCGGACCGGATAATTAAAATGATAACCATCTCG - 3' (SEQ ID NO: 11) ; the RsrII site is underlined) and GP64-r DraIII (5' - GGGCACTTAGTGATATTGTCTATTACGGTTTCTAATC - 3' (SEQ ID NO: 12); the DraIII site is underlined) . The resulting DNA fragment was inserted into pDual-HlNl/HAl-gp64 digested with RsrII and DraIII to yield pCP-HlNl/HAl-gp64.
(1.7) Construction of Plasmid pCAP-HlNl/HAl-gp64 pCP-HlNl/HAl-gp64 was cleaved with restriction enzymes RsrII and DraIII to prepare HAl and gp64 gene fragments. The fragments were inserted into a vector prepared by digesting pTriEx-1.1 (from Novagen) with restriction enzymes RsrII and DraIII to yield a transfer vector plasmid pCAP-HlNl/HAl-gp64 enabling the expression of a fusion protein of HAl antigen and gp64 protein in mammalian and insect cells under the control of the desired dual promoter consisting of CAG promoter and polyhedrin promoter.
(1.8) Construction of Plasmid pCAP-HlNl/NP-gp64
RT-PCR was performed with genomic RNA of influenza virus PR/8/34 strain as a template using NP-f EcoRI (5' - ACGGAATTCCATTCAATTCAAACTGGA - 3' (SEQ ID NO: 13); the EcoRI site is underlined) and NP-r Cfr9I (5' -
GATCCCGGGCCTTGTCAATGCTGAATGGCAA - 3' (SEQ ID NO: 14); the Cfr9I site is underlined) . The obtained fragments were digested with restriction enzymes EcoRI and Cfr9I, and inserted into pCAP- HlNl/HAl-gp64 digested with restriction enzymes EcoRI and Cfr9I to yield pCAP-HlNl/NP-gp64. (1.9) Construction of Plasmids pCAP-HlNl/NP/272 and pCAP- H1N1/NP/467
PCR was performed using gp64(272)-f (5' -
GACTCCCCGGGTCGAGCACCGAGTCAAGAAG - 3' (SEQ ID NO: 15); the Xmal site is underlined), gp64(467)-f (5' -
GACTCCCCGGGACATCACTTCCATGGCTGAA -3' (SEQ ID NO: 16) ; the Xmal site is underlined), and GP64-r DraIII (5'-
GGGCACTTAGTGATATTGTCTATTACGGTTTCTAATC-3' (SEQ ID NO: 12); the DraIII site is underlined) of pCAP-HlNl/HAl-gp64. The obtained fragments were digested with restriction enzymes Xmal and DraIII, and inserted into pCAP-HlNl/NP-gp64 digested with Xmal and DraIII to yield pCAP-HlNl/NP/272 and pCAP-HlNl/NP/467.
(1.10) Construct of Transfer Vectors pCAP-PfCSP, cCAP-PfCSP/272 and pCAP-PfCSP/467 of the Present Invention P. falciparum genomic DNA was extracted from human erythrocytes infected with Plasmodium falciparum 3D7 strain using a QIAamp DNA Midi Kit (from Qiagen) . A PfCSP gene was cloned by PCR with this genomic DNA as a template according to the following method. The PCR was performed using primers PfCSP- f (19) (5' - GACTCTGCAGTTATTCCAGGAATACCAGTGCTATGGAAG - 3' (SEQ ID NO: 17); the Pstl site is underlined) and PfCSP-r (373) (5' - CGATCCCGGGCTTTTTCCATTTTACAAATTTTTTTTTCAATATC - 3' (SEQ ID NO: 18) ; the Xmal site is underlined) . The resulting DNA fragment was inserted into pCAP-HlNl/NP-gp64, pCAP-HlNl/NP/272, and pCAP- H1N1/NP/467, each digested with Pstl and Xmal. The constructed plasmids were designated pCAP-PfCSP, pCAP-PfCSP/272, and pCAP- PfCSP/467.
The GenBank accession number of the amino acid sequence of the Plasmodium falciparum 3D7 circumporozoite (CS) protein is XP_001351122.
(2) Construction of Transfer Vector pDual-Pfs25-PfCSP-gp64 of the Present Invention (2.1) Construction of Plasmid pDual-PbAMAlD123-gp64
A blood sample was collected from a BALB/c mouse infected with malaria parasite P. berghei ANKA strain, and P. berghei genomic DNA was extracted using a QIAamp DNA Midi Kit (Qiagen) . A PbAMAl gene domain 123 (D123) was cloned by PCR with this genomic DNA as a template according to the following method.
PCR was performed using primers pAMA-Fl (5' - CACCGAATTCAATCCATGGGAAAAGTATACGGAAAAATAT - 3' (SEQ ID NO: 19); the EcoRI site is underlined) and pAMAl-Rl (5' -
CCCGGGCTTCTCTGGTTTGATGGGCTTTCATATGCAC - 3' (SEQ ID NO: 20); the
Cfr9l site is underlined) . The resulting PbAMAlD123 DNA fragment was cloned into pENTR/D-TOPO, then cleaved with EcoRI/Cfr91 and inserted into pBACsurf-Hsp65 digested with EcoRI and Cfr9I. The constructed plasmid was designated pBACsurf-PbAMAlD123.
Subsequently, the pBACsurf-PbAMAlD123 was cleaved with
EcoRI/Cfr9l, and the PbAMAlD123 gene DNA fragment was inserted into pDual-Hspβ5-gp64 digested with EcoRI and Cfr9I to yield a plasmid pDual-PbAMAlD123-gp64.
(2.2) Construction of Plasmid pDual-PfCSP-gp64
A PfCSP gene was cloned by PCR with P. falciparum genomic DNA as a template according to the following method. The
PCR was performed using primers pPfCSP-Fl (5' - CACCGAATTCTTATTCCAGGAATACCAGTGCTATGGAAGT-3' (SEQ ID NO: 21); the
EcoRI site is underlined) and pPfCSP-Rl (5'-
CCCGGGCTTTTTCCATTTTACAAATTTTTTTTTC-3' (SEQ ID NO: 22); the Cfr9I site is underlined) . The resulting PfCSP DNA fragment was cloned into pENTR/D-TOPO, then cleaved with EcoRI/Cfr9I and inserted into pDual-PbAMAlD123-gp64 digested with EcoRI and Cfr9I. The constructed plasmid was designated pDual-PfCSP-gp64. (2.3) Construction of Transfer Vector pDual-Pfs25-PfCSP-gp64 of the Present Invention
A Pfs25 gene was cloned by PCR with P. falciparum genomic DNA as a template according to the following method. The
PCR was performed using primers pPfs25-Fl (5' -
CACCGAATTCAAAGTTACCGTGGATACTGTATGCAAAAGAGGA - 3' (SEQ ID NO: 23) ; the EcoRI site is underlined) and pPfs25-R2 (5' -
CAATTGAGATCCGCCGCCACCGCCACCAGTACATATAGAGCTTTCATTATCTATTATAAATCCAT C - 3' (SEQ ID NO: 24); the Muni site is underlined). The resulting Pfs25 DNA fragment was cloned into pENTR/D-TOPO, then cleaved with EcoRI/Munl, and inserted into pDual-PfCSP-gp64 digested with EcoRI. The constructed plasmid was designated pDual-Pfs25-PfCSP-gp64. (3) Construction of Transfer Plasmid pDual-PfMSPl-PfCSP-gp64 of the Present Invention
A PfMSPl gene was cloned by PCR with P. falciparum genomic DNA as a template according to the following method. The PCR was performed using primers pPfMSP119-Fl (5' - CACCGAATTCAACATTTCACAACACCAATGCGTAAAAAAAC - 3': (SEQ ID NO: 25); the EcoRI site is underlined) and pPfMSP119-R2 (5' - CAATTGAGATCCGCCGCCACCGCCACCGTTAGAGGAACTGCAGAAAATACCATCGAAAAGTGGA - 3' (SEQ ID NO: 26) ; the Muni site is underlined) . The resulting PfMSPH9 DNA fragment was cloned into pENTR/D-TOPO, then cleaved with EcoRI and Muni, and inserted into pDual-PbCSP-gp64 digested with EcoRI. The constructed plasmid was designated pDual-PfMSPl- PfCSP-gp64.
(4) Construction of the Transfer Vector Plasmids pCAP- PfCSP(A361E) , pCAP-PfCSP(A361E)/272, and pCAP-PfCSP(A361E) /467 of the Present Invention
PCR was performed with pCAP-PfCSP using PfCSP- f(19) (5' -GACTCTGCAGTTATTCCAGGAATACCAGTGCTATGGAAG-S' : (SEQ ID NO: 17); the Pstl site is underlined) and PfCSP-r(373 A361E) (5'- CGATCCCGGGCTTTTTCCATTTTACAAATTTTTTTTTCAATATCATTTTC-S' : (SEQ ID NO: 27); the Xmal site is underlined). The obtained DNA fragment was cleaved with Pstl and Xmal, and inserted into pCAP-HlNl/NP- gp64, pCAP-HlNl/NP/272, and pCAP-HlNl/NP/467, each digested with Pstl and Xmal. The constructed plasmids were designated pCAP- PfCSP(A36lE), pCAP-PfCSP(A361E)/272, and pCAP-PfCSP(A361E)/467. (5) Construction of Transfer Plasmids pCAP-PfCSP-76 and pCAP- PfCSP-76/467 of the Present Invention
PCR was performed with pCAP-PfCSP(A361E) using PfCSP- f(76) (5' -GACTCTGCAGGATGATGGAAATAACGAAGACAACG - 3': (SEQ ID NO: 28); the Pstl site is underlined) and PfCSP-r(373 A361E) (5' - CGATCCCGGGCTTTTTCCATTTTACAAATTTTTTTTTCAATATCATTTTC - 3' : (SEQ ID NO: 27) ; the Xmal site is underlined) . The resulting DNA fragment was cleaved with Pstl and Xmal, and then inserted into pCAP- HlNl/NP-gp64 and pCAP-HlNl/NP/467, each cleaved with Pstl and Xmal. The constructed plasmids were designated pCAP-PfCSP-76 and pCAP-PfCSP-76/467.
(6) Construction of Transfer Plasmids pCAP-PfCSP+209 and pCAP- PfCSP+209/467
An artificial gene sequence (PfCSP+: SEQ ID NO: 29) was prepared from the amino acid sequence of PfCSP of P. falciparum 3D7 strain (in which, however, the A at the 361- position was replaced by E) using codons frequently used in Sf9 and human cells. Using the obtained artificial gene sequence as a template, PCR was performed using PfCSP-f (+209) (5'- GACTCTGCAGAACGCTAATCCAAACGCTAATCCCAACGCTAATCCCAATGCC -3' (SEQ ID NO: 30); the Pstl site is underlined) and PfCSP-r (+A361E) (5'-
CGATCCCGGGCTTTTTCCATTTTGCAAATTTTTTT -3' (SEQ ID NO: 31) ; the Xmal site is underlined) . The resulting DNA fragments were cleaved with Pstl and XmalI, and then inserted into pCAP-HlNl/NP-gp64 and pCAP-HlNl/NP/467 digested with Pstl and Xmall. The constructed plasmids were designated pCAP-PfCSP+209 and pCAP-PfCSP+209/467.
(7) Construction of Transfer Plasmids pCAP-PfCSP+76/209 and pCAP-PfCSP+76/209/467 of the Present Invention
Using the artificial gene sequence (PfCSP+: SEQ ID NO: 29) as a template, PCR was performed using PfCSP-f (+76) (5'- GACTCTGCAGGACGACGGCAACAACGAAGACAACG -3' (SEQ ID NO: 32); the Pstl site is underlined), PfCSP-r (+128) (5'-
CGTTAGGATCCACATTTGGGTTGGCATTTGGG -3' (SEQ ID NO: 33); the BamH I site is underlined), PfCSP-f (+209) BamHl (5'- GACTGGATCCTAACGCTAATCCAAACGCTAATCCC- 3' : (SEQ ID NO: 34); the BamH I site is underlined), and PfCSP-r (+A361E) (5'-
CGATCCCGGGCTTTTTCCATTTTGCAAATTTTTTT -3' (SEQ ID NO: 31) ; the Xmal site is underlined) from the obtained artificial gene sequence. The resulting DNA fragments were cleaved with Pstl/BamHl and BamHl/Xmal, respectively, and then inserted into pCAP-HlNl/NP- gp64 and pCAP-HlNl/NP/467, each digested with Pstl and Xmal. The constructed plasmids were designated pCAP-PfCSP+76/209 and pCAP- PfCSP+76/209/467.
(8) Construction of Transfer Plasmids pCAP-HAl/Anhui, pCAP- HAl/Anhui/272, and pCAP-HAl/Anhui/467 An artificial gene sequence (SEQ ID NO: 35) was prepared from the amino acid sequence of the hemagglutinin HAl region of influenza virus H5N1/Anhui/1/O5 using codons frequently used in Sf9 and human cells. Using the obtained artificial gene sequence as a template, PCR was performed using AH-Fl (5'- CAGTCTGCAGGACCAGATTTGCATC-3' : (SEQ ID NO: 36) ; the Pstl site is underlined) and AH-R4 (5'-CAGTCCCGGGCTCTCTTGCGCCTGC-S' : (SEQ ID NO: 37) ; the Xmal site is underlined) . The obtained DNA fragment was cleaved with Pstl and Xmal, and then inserted into pCAP- HlNl/NP-gp64, pCAP-HlNl/NP/272 and pCAP-HlNl/NP/467, each digested with Pstl and Xmal. The constructed plasmids were designated pCAP-HAl/Anhui, pCAP-HAl/Anhui/272, and pCAP- HAl/Anhui/467.
The GenBank accession number of the amino acid sequence of the hemagglutinin of influenza virus A/H5N1/Anhui/1/O5 is ABD28180.
(9) Construction of Transfer Vector Plasmids pCAP-HAl/Vietnam, pCAP-HAl/Vietnam/51, pCAP-HAl/Vietnam/101, pCAP-HAl/Vietnam/154, pCAP-HAl/Vietnam/201, pCAP-HAl/Vietnam/272, and pCAP-HAl/Vietnam /467 of the Present Invention An artificial gene sequence (SEQ ID NO: 38) was prepared from the amino acid sequence of the HAl region of the hemagglutinin of influenza virus H5N1/Vietnam/1203/4 using codons frequently used in Sf9 and human cells. Using the obtained artificial gene sequence as a template, PCR was performed using VN-Fl (5'-CAGTCTGCAGGACCAGATCTGTATC-S' : (SEQ ID NO: 39); the Pstl site is underlined), and VN-R4 (5' -CAGTCCCGGGCTCTCTTCTTCCTGC-3' : (SEQ ID NO: 40); the Xmal site is underlined). The obtained DNA fragment was cleaved with Pstl and Xmal, and inserted into pCAP- HlNl/NP-gp64, pCAP-HlNl/NP/272 and pCAP-HlNl/NP/467, each digested with Pstl and Xmal. The constructed plasmids were designated pCAP-HAl/Vietnam, pCAP-HAl/Vietnam/272, and pCAP-
HAl/Vietnam/467.
Further, using pCAP-HAl/Vietnam as a template, PCR was performed using gp64(51)-f (5'- GACTCCCCGGGTGGAAATCACCATCGTGGAGACG-3' : (SEQ ID NO: 41); the Xmal site is underlined), or gp64(101)-f (5'-
GACTCCCCGGGATTTGCTTATGTGGAGCATCAGG-3' : (SEQ ID NO: 42); the Xmal site is underlined), or gp64(154)-f (5'-
GACTCCCCGGGCGCACCACACGTGCAACAAATCG-3' : (SEQ ID NO: 43) ; the Xmal site is' underlined) , or gp64(201)-f (5'-
GACTCCCCGGGACACTGTGCTTCATCGAGACGGC-3' : (SEQ ID NO: 44); the Xmal site is underlined), and GP64-r DraIII (5'-
GGGCACTTAGTGATATTGTCTATTACGGTTTCTAATC-3' (SEQ ID NO: 12); the
Dralll site is underlined) . The obtained DNA fragments were cleaved with Xmal and DraIII, and inserted into pCAP-HAl/Vietnam digested with Xmal and DraIII. The constructed plasmids were designated pCAP-HAl/Vietnam/51, pCAP-HAl/Vietnam/101, pCAP-
HAl/Vietnam/154, and pCAP-HAl/Vietnam/201.
The GenBank accession number of the amino acid sequence of the hemagglutinin of influenza virus
A/H5Nl/Vietnam/1203/2004 is AAW80717.
(10) Construction of Transfer Vector Plasmids pCAP-AH/345, pCAP-
AH/345/467, pCAP-AH/410, pCAP-AH/410/467, pCAP-AH/473, pCAP-
AH/473/467, pCAP-AH/520, pCAP-AH/520/467 of the Present Invention An artificial gene sequence (SEQ ID NO: 45) was prepared from the amino acid sequence of the HA region of the hemagglutinin of influenza virus A/H5N1/Anhui/1/O5 by codon optimization using Gene Designer available from DNA2.0, Inc.
Using this artificial sequence as a template, PCR was perfomed using AH17-F (5'-GACTCTGCAGGATCAGATCTGTATTGGGTACC-S' : (SEQ ID NO:
46); the Pstl site is underlined, and AH345-R (5'-
CGATCCCGGGCTCTCTTTCTCCTCCGCTCGC-3' : (SEQ ID NO: 47); the Xmal site is underlined), or AH410-R (5'-
CGATCCCGGGCGGCCTCGAACTGGGTGTTCATT-3' : (SEQ ID NO: 48); the Xmal site is underlined), or AH473-R (5'- CGATCCCGGGCGTCTCTGAGTTGAAGGCGCAC-3' : (SEQ ID NO: 49); the Xmal site is underlined, or AH520-R (5'-
CGATCCCGGGCACCACTAATTTCCTCTCGCTTC-3' : (SEQ ID NO: 50); the Xmal site is underlined) . The obtained DNA fragment was cleaved with Pstl and Xmal, and inserted into pCAP-HAl/Anhui or pCAP- HAl/Anhui/467 digested with Pstl and Xitial. The constructed plasmids were designated pCAP-AH/345, pCAP-AH/345/467, pCAP- AH/410, pCAP-AH/410/467, pCAP-AH/473, pCAP-AH/473/467, pCAP- AH/520, and pCAP-AH/520/467. (11) Construction of Transfer Vector Plasmids pCAP-VN/346, pCAP- VN/346/467, pCAP-VN/410, pCAP-VN/410/467, pCAP-VN/473, pCAP- VN/473/467, pCAP-VN/520, and pCAP-VN/520/467 of the Present Invention
An artificial gene sequence (SEQ ID NO: 51) was prepared from the amino acid sequence of the HA region of the hemagglutinin of influenza virus A/H5Nl/Vietnam/1203/2004 by codon optimization using Gene Designer available from DNA2.0, Inc. Using this artificial sequence as a template, PCR was performed using VN17-F (5'-GACTCTGCAGGATCAGATCTGTATCGGATATC-S' : (SEQ ID NO: 52); the Pstl site is underlined), and VN346-R (5'-
CGATCCCGGGCCCGCTTTTTCCTCCTCCGTTCG-3' : (SEQ ID NO: 53); the Xmal site is underlined), or VN410-R (5'-
CGATCCCGGGCCTCAAACTGCGTATTCATTTTG-3' : (SEQ ID NO: 54); the Xmal site is underlined), or VN473-R (5'- CGATCCCGGGCTCTAAGCTGGAGCCTGACTTTGTC-S' : (SEQ ID NO: 55) ; the Xmal site is underlined), or VN520-R (5'-
CGATCCCGGGCACTAATCTCCTCTCTTTTAAGTC-3' : (SEQ ID NO: 56) ; the Xmal site is underlined) . The obtained DNA fragment was cleaved with Pstl and Xmal, and inserted into pCAP-HAl/Anhui or pCAP- HAl/Anhui/467 digested with Pstl and Xmal. The constructed plasmids were designated pCAP-VN/346, pCAP-VN/346/467, pCAP- VN/410, pCAP-VN/410/467, pCAP-VN/473, pCAP-VN/473/467, pCAP- VN/520, and pCAP-VN/520/467. (12) Construction of Transfer Vector Plasmids pCAP-CO/full, pCAP- CO/full/467, pCAP-CO/19, pCAP-CO/19/467, pCAP-CO/76, pCAP- CO/76/467, pCAP-CO/205, and pCAP-CO/205/467 of the Present Invention
An artificial gene sequence (SEQ ID NO: 57) was prepared from the amino acid sequence of the CSP of Plasmodium falciparum 3D7 strain by codon optimization using Gene Designer available from DNA2.0, Inc. Using this artificial sequence as a template, PCR was performed using a pair of primers consisting of PfCSP_opt-f (5' -GACTCTGCAGATGATGCGAAAATTGGCCATACTG-B' : (SEQ ID NO: 58); the Pstl site is underlined) and PfCSP_opt-r (397) (5'- CGATCCCGGGCATTGAGGAACAGAAAGGAAAGAACCATG-3' : (SEQ ID NO: 59) ; the Xmal site is underlined); PfCSP_opt-f (19) (5'- GACTCTGCAGCTGTTTCAGGAATACCAGTGCTATGG-3' : (SEQ ID NO: 60); (the Pstl site is underlined) and PfCSP_opt-r (373) (5'- CGATCCCGGGCCTTCTCCATCTTACAAATTTTCTTTTCAATATCATTAGC-S' : (SEQ ID NO: 61); the Xmal site is underlined); PfCSP_opt-f (76) (5'-
GACTCTGCAGGACGACGGAAATAATGAGGACAACG-3' : (SEQ ID NO: 62); the Pstl site is underlined) and PfCSP_opt-r (373) (5'-
CGATCCCGGGCCTTCTCCATCTTACAAATTTTCTTTTCAATATCATTAGC-S' : (SEQ ID NO: 61); the Xmal site is underlined); and PfCSP_opt-f (205) (5'- GACTCTGCAGAATGCAAACCCAAATGCCAATCCAAACGC-S' : (SEQ ID NO: 63) ; the Pstl site is underlined) and PfCSP_opt-r (373) (5'- CGATCCCGGGCCTTCTCCATCTTACAAATTTTCTTTTCAATATCATTAGC-S' : (SEQ ID NO: 61) ; the Xmal site is underlined) . The obtained DNA fragments were cleaved with Pstl and Xmal, and inserted into pCAP-HAl/Anhui or pCAP-HAl/Anhui/467 digested with Pstl and Xmal. The constructed plasmids were designated pCAP-CO/full, pCAP- CO/full/467, pCAP-CO/19, pCAP-CO/19/467, pCAP-CO/76, pCAP- CO/76/467, pCAP-CO/205, and pCAP-CO/205/467. (13) Construction of Transfer Vector Plasmids pCA64-HAl/Anhui and pCA64-PfCSP(A361E) of the Present Invention
Using the Triple Cut DNA of BacVector-2000 DNA (from Novagen) , PCR was performed using gp64-p-f (5'-
GACTCGGACCGGCCAGATAAAAATAATCTTATCAATTAAG-S' : (SEQ ID NO: 64); the RsrII site is underlined) and gp64-p-r (5'- CGATACTAGTAGCACTGAGGCTTCTTATATACCCG-3' : (SEQ ID NO: 65); the Spel site is underlined) . The obtained DNA fragment was cleaved with RsrII and Spel, and inserted into pCAP-HAl/Anhui or pCAP- PfCSP (A361E) digested with RsrII and Spel to construct transfer vector plasmids pCA64-HAl/Anhui and pCA64-PfCSP (A361E) enabling the expression of a fusion protein of HAl antigen or PfCSP antigen and gp64 protein in mammalian and insect cells under the control of the desired dual promoter consisting of CAG promoter and gp64 promoter.
(14) Construction of Transfer Vector Plasmids pCA39-HAl/Anhui and pCA39-PfCSP(A361E) of the Present Invention
Using the Triple Cut DNA of BacVector-2000 DNA (from Novagen) , PCR was performed using vp39-p-f (5'- GACTCGGACCGCGTCGTACAAATCGAAATATTGTTGTG-3' : (SEQ ID NO: 66); the RsrII site is underlined) and vp39-p-r (5'- CGATACTAGTGTGATTGAGAAAGAAATCTCTTATTC-S': (SEQ ID NO: 67); the
Spel site is underlined) . The obtained DNA fragment was cleaved with RsrII and Spel, and inserted into pCAP-HAl/Anhui or pCAP- PfCSP (A361E) digested with RsrII and Spel to construct transfer vector plasmids pCA39-HAl/Anhui and pCA39-PfCSP (A361E) enabling the expression of a fusion protein of HAl antigen or PfCSP antigen and gp64 protein in mammalian and insect cells under the control of the desired dual promoter consisting of CAG promoter and vp39 promoter.
(15) pCAP-CO/full/VSV, pCAP-CO/19/VSV, pCAP-CO/76/VSV, and pCAP- CO/205/VSV of the Present Invention
Using pVSV-G (from Clonetech) as a template, PCR was performed using VSV-G-f (5'-GACTCCCCGGGCGTTCGAACATCCTCACATTCAAG - 3' (SEQ ID NO: 68); the Xmal site is underlined), VSV-G-r (5'- GACTCACTTAGTGCTTTCCAAGTCGGTTCATCTC-3' : (SEQ ID NO: 69); the' DraIII site is underlined) . The obtained DNA fragment was inserted into pCAP-CO/full, pCAP-CO/19, pCAP-CO/76, and pCAP- CO/205, each digested with Xmal and DraIII. The constructed plasmids were designated pCAP-CO/full/VSV, pCAP-CO/19/VSV, pCAP- CO/76/VSV, and pCAP-CO/205/VSV. Example 2: Recombinant Baculoviruses of the Present Invention and Method for Production thereof
(1) Recombinant baculoviruses were produced using a kit for producing recombinant baculoviruses (BacVector-2000 Transfection Kit from Novagen) by co-transfecting BacVector-2000 DNA with each of the following transfer vectors constructed in Example 1: pCAP-PfCSP, pCAP-PfCSP/272, pCAP-PfCSP/467, pCAP- PfCSP(A36lE) , pCAP-PfCSP(A36lE)/272, pCAP-PfCSP (A361E) /467, pCAP- PfCSP-76, pCAP-PfCSP-76/467, pCAP-PfCSP+209, pCAP-PfCSP+209/467, pCAP-PfCSP+76/209, pCAP-PfCSP+76/209/467, pCAP-HAl/Anhui, pCAP- HAl/Anhui/272, pCAP-HAl/Anhui/467, pCAP-HAl/Vietnam, pCAP-
HAl/Vietnam/51, pCAP-HAl/Vietnam/101, pCAP-HAl/Vietnam/154, pCAP- - HAl/Vietnam/201, pCAP-HAl/Vietnam/272, pCAP-HAl/Vietnam/467, pCAP-AH/345, pCAP-AH/345/467, pCAP-AH/410, pCAP-AH/410/467, pCAP- AH/473, pCAP-AH/473/467, pCAP-AH/520, pCAP-AH/520/467, pCAP- VN/346, pCAP-VN/346/467, pCAP-VN/410, pCAP-VN/410/467, pCAP- VN/473, pCAP-VN/473/467, pCAP-VN/520, pCAP-VN/520/467, pCAP- CO/full, pCAP-CO/full/467, pCAP-CO/19, pCAP-CO/19/467, pCAP-CO/76, pCAP-CO/76/467, pCAP-CO/205, pCAP-CO/205/467, pCA39-HAl/Anhui, pCA64-HAl/Anhui, pCA39-PfCSP(A361E) , pCA64-PfCSP(A361E) , pCAP- CO/full/VSV, pCAP-CO/19/VSV, pCAP-CO/76/VSV, pCAP-CO/205/VSV, pDual-Pfs25-PfCSP-gp64, pDual-PfMSPl-PfCSP-gp64 into Sf9 cells. The resulting recombinant baculoviruses were designated AcNPV- CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E) , AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP- HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP-AH/473/467, AcNPV-CAP-AH/520, AcNPV- CAP-AH/520/467, AcNPV-CAP-VN/346, AcNPV-CAP-VN/346/467, AcNPV- CAP-VN/410, AcNPV-CAP-VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP- VN/473/467, AcNPV-CAP-VN/520, AcNPV-CAP-VN/520/467, AcNPV-CAP- CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP- CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-CAP-CO/205/467, AcNPV-CA39-HAl/Anhui, AcNPV-CA64-HAl/Anhui, AcNPV-CA39-PfCSP(A361E), AcNPV-CA64-PfCSP (A361E) , AcNPV-CAP-
CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP-
CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl-
PfCSP-gp64.
Example 3: Test of Expression of Vaccine Antigen from Recombinant Baculovirus of the Present Invention in Insect Cells
Sf9 cells were cultured at a concentration of 1 x 105 cells per well in a 48-well plate (from Corning), and infected with baculoviruses AcNPV-CAP-PfCSP, AcNPV-CAP-HAl/Anhui, and AcNPV-CAP-HAl/Vietnam obtained in Example 2, or a wild-type baculovirus AcNPV-WT as a control at an infection multiplicity of about 0.1. After 5 days, the culture supernatant was removed from each well, and then Sample Buffer Solution (+2ME, x2) (from Wako) was added in an amount of 0.05 mL per well to completely lyse the cells. The cell lysate was heated at 1000C for 5 minutes, and electrophoresed on 7.5% SDS-PAGE. After electrophoresis, the protein was transferred to a PVDF membrane (Immobilon-P from
Millipore) , and blocking was performed at 4°C overnight by immersing the membrane in 2.5% Skim Milk/SuperBlock (from Pierce). The membrane to which the protein of Sf9 cells infected with each baculovirus had been transferred was incubated with an anti-gp64 antibody (AcV5 from eBioScience) as the primary antibody, and then incubated with a HRP-labeled goat anti-mouse IgG (H+L) antibody (from BioRad) as the second antibody. Color was developed with an ECLplus Western Blotting Detection kit (from GE Healthcare) to detect the protein band. FIG. 1 shows the results.
FIG. 1 shows Western blotting analysis showing the expression of fusion antigens in insect cells from recombinant baculoviruses containing PfCSP gene of human malaria, HAl gene of influenza virus H5N1/Anhui/1/O5 strain, and HAl gene of H5Nl/Vietnam/1203/04 strain. In FIG. 1, Lane 1 shows the band of a wild-type baculovirus (AcNPV-WT) ; Lane 2 shows the band of a recombinant baculovirus (AcNPV-CAP-PfCSP) containing PfCSP gene and full-length gp64 gene inserted downstream of the dual promoter of the present invention; Lane 3 shows the band of a recombinant baculovirus (AcNPV-CAP-HAl/Anhui) containing HAl gene of influenza virus H5N1/Anhui/1/O5 strain and full-length gp64 gene inserted downstream of the dual promoter of the present invention; and Lane 4 shows the band of a recombinant baculovirus ( (AcNPV-CAP-HAl/Vietnam) containing HAl gene of influenza virus H5Nl/Vietnam/1203/04 strain and full-length gp64 gene inserted downstream of the dual promoter of the present invention. As shown in Lanes 2, 3 and 4 of FIG. 1, a band corresponding to the expressed fusion product of an immunogenic foreign antigen gene and gp64 gene was observed in the recombinant baculoviruses having an antigen gene and gp64 gene - fused and expressed downstream of the dual promoter of the present invention.
The above results confirmed that when using the recombinant virus of the present invention, an immunogenic foreign antigen gene and gp64 gene can be fused and expressed as an expressed fusion product in insect cells.
Example 4: Test of Identification of Fusion Antigen in Vaccine Antigen Presented on Viral Particle (Virion) of Recombinant Baculovirus of the Present Invention Sf9 cells were cultured to a concentration of 1 x 107 cells per 150 mm cell culture plate (from Sumilon) , and infected with each of the above-mentioned baculoviruses at an infection multiplicity of about 0.1. After 7 days, the medium was centrifuged at 3,000 xg at 4°C for 15 minutes twice, and the virus solution was layered over a 25% sucrose solution, and centrifuged using an ultracentrifuge at 25,000 rpm at 4°C for 90 minutes to yield viral particles. 0.05 mL of Sample Buffer Solution (+2ME, x2) (from Wako) was added to 0.05 mL each of the virus concentrates (1 x 108 PFU/mL) of AcNPV-CAP-PfCSP, AcNPV-CAP- PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP-HAl/Vietnam, and AcNPV- WT collected by ultracentrifugation. The resulting mixtures were heated at 1000C for 5 minutes, and electrophoresed on 7.5% SDS- PAGE. After the electrophoresis, the obtained proteins were transferred to PVDF membranes (Immobilon-P from Millipore), and immersed in 2.5% Skim Milk/SuperBlock (from Pierce) to perform blocking at 4°C overnight. The membranes to which the virus solutions of AcNPV-CAP-PfCSP, AcNPV-CAP-PfCSP/272, and AcNPV-CAP- PfCSP/467 had been transferred were incubated with an anti-PfCSP antibody (2A10, MR-4) as the primary antibody, and then incubated with a HRP-labeled goat anti-mouse IgG (H+L) antibody (from
BioRad) as the second antibody. The membrane to which the virus solution of AcNPV-CAP-HAl/Vietnam had been transferred was incubated with an anti-H5Nl antibody (IT-003-005 from Immune Technology) as the primary antibody, and then incubated with a HRP-labeled goat anti-rabbit IgG antibody (from GE Healthcare) as the second antibody. Color was developed with an ECLplus Western Blotting Detection kit (from GE Healthcare) to detect the bands of the proteins. FIG. 2 shows the results.
FIG. 2 (A) shows Western blotting analysis showing the expression of the CSP gene (PfCSP) of human malaria in viral particles of recombinant baculoviruses prepared using recombinant transfer vectors. Lane 1, the left side lane of FIG. 2 (A), shows the band of a recombinant baculovirus (AcNPV-CAP-PfCSP) containing PfCSP gene and full-length gp64 gene inserted downstream of the dual promoter of the invention; Lane 2 shows the band of a recombinant baculovirus (AcNPV-CAP-PfCSP/272) containing PfCSP gene and partial-length gp64 gene (241 amino acid residues from the C terminus) inserted downstream of the dual promoter of the invention; Lane 3 shows the band of a recombinant baculovirus (AcNPV-CAP-PfCSP/467) containing PfCSP gene and partial-length gp64 gene (46 amino acid residues from the C terminus) inserted downstream of the dual promoter of the invention. The baculoviruses were electrophoresed, and the presence of an expressed fusion product of the PfCSP gene and gp64 gene was checked. A strong band, indicating the presence of a fusion antigen of PfCSP gene and gp64 gene in the recombinant viral particles, was detected in all the lanes of FIG. 2 (A) .
FIG. 2 (B) shows Western blotting analysis showing the expression of H5N1/HA1 gene in viral particles of recombinant baculoviruses prepared using recombinant transfer vectors. Lane 1, left side lane of FIG. 2 (B), shows the results obtained using the infected AcNPV-WT cell lysate prepared in Example 3; Lane 2 shows the results obtained using the AcNPV-CAP-HAl/Anhui-infected cell lysate prepared in Example 3; Lane 3 shows the results obtained using the AcNPV-CAP-HAl/Vietnam-infected cell lysate prepared in Example 3; and Lane 4 shows the results of viral particles of a wild-type baculovirus (AcNPV-WT) ; Lane 5 shows the results of viral particles of a recombinant baculovirus (AcNPV- CAP-HAl/Vietnam) containing the HAl gene of influenza virus H5N1/Vietnam/1203/04 strain and full-length gp64 gene inserted downstream of the dual promoter of the present invention; and Lane 6 shows the results of purified HA antigen of H5N1 (IT-003- 0053p from Immune Technology) . The baculoviruses were electrophoresed, and the presence of an expressed fusion product of the PfCSP gene and gp64 gene was checked. A strong band, indicating the presence of a fusion antigen of HAl gene of H5Nl/Vietnam/1203/04 and gp64 gene in the recombinant viral particles, was detected in Lane 5 of FIG. 2(B).
The above results of Example 4 show that a foreign gene having the desired immunogenicity and gp64 gene can be fused and expressed in recombinant viral particles of the recombinant baculovirus of the present invention produced by using the recombinant transfer vector of the present invention. Example 5: Test of Expression of Vaccine Antigen from Recombinant Baculovirus of the Present Invention in Mammals
HepG2 cells were infected with AcNPV-Dual-PfMSPl-PfCSP at an infection multiplicity of 1. After 48 hours, the culture supernatant was removed, and the plate was rinsed with PBS three times. An acetone/ethanol solution (a mixed ratio of 7:3) cooled to -2O0C was added to immobilize the cells at -20°C for 5 minutes. A 5% normal goat serum (from Sigma) was added to perform blocking at room temperature for 1 hour. To detect the expression of PfCSP, an anti-PfCSP antibody (2A10, MR-4) labeled with Alexa Flour 594 was added; and to detect the expression of PfMSP-lig, an anti- PfMSP-lig antibody (5.2, MR-4) and then an anti-mouse antibody labeled with FITC were added. After incubation, the reacted cells were detected under a fluorescence microscope. FIG. 3 shows the results. FIG. 3 shows HepG2 cells stained with a fluorescence- labeled antibody, which indicates that an antigen has been expressed from a recombinant baculovirus containing a fusion gene of the PfMSPl gene and PfCSP gene in the HepG2 cells. The results of FIG. 3 (A) confirmed that a PfCSP antigen has been expressed. The results of FIG. 3 (B) confirmed that a PfMSP-Ii9 antigen has been expressed. It was thus confirmed that fusion antigens can be expressed in mammalian cells. The results of FIG. 3 (A) and (B) clearly show that the recombinant baculovirus produced by using the transfer vector containing the dual promoter of the present invention can express the desired antigen in mammalian cells. This suggests that when the recombinant baculovirus produced using the recombinant transfer vector of the present invention is administered to humans and other mammals, the virus particles enter the mammalian cells, and a mammalian promoter operates to produce a fusion product of the desired foreign antigen gene and gp64 gene in the mammalian cells, thus inducing the acquired immunity.
Example 6: Induction of Antibody by PfCSP Antigen Recombinant Virus and H5N1/HA1 Antigen Recombinant Virus 1. Inoculation of Virus Solution Virus solutions of AcNPV-WT, AcNPV-CAP-PfCSP, AcNPV-
CAP-PfCSP/467, AcNPV-CAP-HAl/Anhui, and AcNPV-CAP-HAl/Vietnam concentrated by ultracentrifugation were inoculated into the thigh muscles of BALB/c female mice in an amount of 1 x 108 PUF twice at two week-intervals. 2. Measurement of Antibody Titers The mice were euthanized two weeks after the final immunization, and sera were collected from the mice and used for measuring antigen-specific antibody titers. Induction of PfCSP antigen-specific antibody titers by AcNPV-CAP-PfCSP and AcNPV- CAP-PfCSP/467 was measured by ELISA using a plate on which
(NANP)4NVDPC peptide (from Sigma), i.e., B-cell epitope of PfCSP, had been immobilized. Induction of H5N1/HA antigen-specific antibody titers by AcNPV-CAP-HAl/Anhui and AcNPV-CAP-HAl/Vietnam was measured by ELISA using a plate on which purified HA antigen of H5N1 virus (IT-003-005p from Immune Technology) had been immobilized. The absorbance at OD450 ran was measured using MaxiSorp (from NUNC) as the ELISA plate, HRP-labeled goat anti- mouse IgG (H&L) antibody (from American Qualex) as the secondary antibody, and TMB (from Calbiochem) for the color reaction. FIG. 4 shows the results.
FIG. 4 (A) is a graph plotting the average absorbance of each group at OD450 nm obtained when the mouse sera were subjected to two-fold serial dilution from 800-fold to 102, 400- fold dilutions. In the groups inoculated with PBS and AcNPV-WT, whose sera contained no antibody- to the antigen, absorbance of even the 800-fold dilutions was 0.1 or less, indicating low reactivity. In contrast, in the groups inoculated with AcNPV-CAP- PfCSP and AcNPV-CAP-PfCSP/467, absorbance of the 800-fold dilutions was 1.138 and 1.878, respectively, indicating strong reactivity and clearly showing that antigen-specific antibodies were induced. FIG. 4 (B) is a graph plotting the average absorbance of each group at OD450 nm obtained when the mouse sera were subjected to two-fold serial dilution from 400-fold to 25, 600-fold dilutions. In the groups inoculated with PBS and AcNPV-WT, whose sera contained no antibody to the antigen, absorbance of the 800-fold dilutions was 0.1 or less, indicating low reactivity. In contrast, in the group inoculated with AcNPV- CAP-HAl/Anhui and AcNPV-CAP-HAl/Vietnam, absorbance of the 3, 200- fold dilution was 1.551 and 2.503, respectively, indicating strong reactivity and clearly showing that antigen-specific antibodies were induced. FIG. 4 clearly shows that the recombinant baculovirus produced using a transfer vector containing the dual promoter of the present invention can induce an antibody to the desired antigen in mammals. 3. Measurement of Neutralization Value
A hemagglutination inhibition (HI) test was performed using a mouse serum inoculated with AcNPV-CAP-PiAl/Anhui. More specifically, the test was performed according to the method described in the instructions packaged with an influenza HI reagent "Seiken" (from Denka Seiken Co., Ltd.), using purified HA antigen of H5N1 virus (IT-003-0053p from Immune Technology) . Absorption of non-specific agglutinins was performed using erythrocyte, and removal of non-specific agglutination inhibitors was performed using RDE (II) of "Seiken" (from Denka Seiken Co., Ltd.). The HI test was performed in the following manner. 0.025 mL of 10-fold diluted antiserum in a 96-well plate was subjected to 2-fold serial dilution using a diluent. To each well of the 96-well plate containing the diluted antiserum, 0.025 mL of HA antigen of H5N1 virus diluted to obtain an HA titer of 4 per 0.025 mL thereof was added. The plate was allowed to stand at room temperature for 30 minutes. 0.05 mL of an erythrocyte suspension for the reaction was added and stirred well. The mixture was allowed to stand at room temperature for 60 minutes. The final dilution of the test sample at which hemagglutination was completely inhibited was defined as the HI antibody titer.
The results show that the sera inoculated with PBS and AcNPV-WT had HI antibody titers of 10 or less, whereas the serum inoculated with AcNPV-CAP-HAl/Anhui had an HI antibody titer of 40. The results seem to indicate that when administered to humans and other mammals, the recombinant baculovirus produced from the recombinant transfer vector of the present invention can induce an antibody effective to the desired foreign antigen gene, thus providing vaccine effects. Sequence Listing Free Text SEQ ID NOS: 1 and 2 are the sequences of primers phsp65-Fl and phsp65-Rl for PCR of genomic DNA of M. tuberculosis H37Rv.
SEQ ID NOS: 3 and 4 are the sequences of primers phsp65-F2 and phsp65-R2 for PCR with pcDNA-hps65 as a template.
SEQ ID NOS: 5 and 6 are the sequences of primers pPolh-F2 and pgp64-R2 for PCR with pBACsurf-1 as a template to produce a gp64 gene DNA fragment.
SEQ ID NOS: 7 and 8 are the sequences of primers HA-f and HA-r for PCR to produce an influenza virus HA gene fragment.
SEQ ID NOS: 9 and 10 are the sequences of primers pHA- Fl and pHA-Rl for PCR with pCR-Blunt-HA as a template.
SEQ ID NOS: 11 and 12 are the sequences of primers Polh-f RsrII and GP64-r DraIII for PCR with pBACsurf-HAl as a template.
SEQ ID NOS: 13 and 14 are the sequences of primers NP- f EcoRI and NP-r Cfr9I for RT-PCR of genomic RNA of influenza virus PR/8/34 strain.
SEQ ID NOS: 15, 16, and 12 are the sequences of primers gp64(272)-f, gp64(467)-f, and GP64-r DraIII for PCR of pCAP-HlNl/HAl-gp64.
SEQ ID NOS: 17 and 18 are the sequences of primers PfCSP-f (19) and PfCSP-r(373) for PCR with P. falciparum genomic DNA as a template. SEQ ID NOS: 19 and 20 are the sequences of primers pAMA-Fl and pAMAl-Rl for PCR with P. berghei genomic DNA as a template .
SEQ ID NOS: 21 and 22 are the sequences of primers pPfCSP-Fl and pPfCSP-Rl for PCR with P. falciparum genomic DNA as a template.
SEQ ID NOS: 23 and 24 are the sequences of primers pPfs25-Fl and pPfs25-R2 for PCR with P. falciparum genomic DNA as a template.
SEQ ID NOS: 25 and 26 are the sequences of primers pPfMSP119-Fl and pPfMSP119-R2 for PCR with P. falciparum genomic DNA as a template.
SEQ ID NOS: 17 and 27 are the sequences of primers PfCSP-f (19) and PfCSP-r(373 A361E) for PCR with pCAP-PfCSP as a template . SEQ ID NOS: 28 and 27 are the sequences of primers
PfCSP-f (76) and PfCSP-r(373 A361E) for PCR with pCAP-PfCSP as a template .
SEQ ID NO: 29 is the sequence of an artificial gene (PfCSP+) produced from the amino acid sequence of the PfCSP of P. falciparum 3D7 strain (in which, however, the A at the 361- position was replaced by E) using codons frequently used in Sf9 and human cells.
SEQ ID NOS: 30 and 31 are the sequences of primers PfCSP-f (+209) and PfCSP-r (+A361E) for PCR with PfCSP+ as a template.
SEQ ID NOS: 32, 33, 34 and 31 are the sequences of primers PfCSP-f (+76) , PfCSP-r (+128) , PfCSP-f (+209) BamHI, and PfCSP-r(+A361E) for PCR with PfCSP+ as a template.
SEQ ID NO: 35 is the sequence of an artificial gene produced from the amino acid sequence of the HAl region of the hemagglutinin of influenza virus H5N1/Anhui/1/O5 using codons frequently used in Sf9 and human cells.
SEQ ID NOS: 36 and 37 are the sequences of primers AH- Fl (5' -CAGTCTGCAGGACCAGATTTGCATC-S' : (SEQ ID NO: 36); the Pstl site is underlined) and AH-R4 (5' -CAGTCCCGGGCTCTCTTGCGCCTGC-3' : (SEQ ID NO: 37); the Xmal site is underlined) for PCR with the artificial gene sequence of SEQ ID NO: 35 as a template.
SEQ ID NO: 38 is the sequence of an artificial gene produced from the amino acid sequence of the HAl region of the hemagglutinin of influenza virus H5Nl/Vietnam/1203/04 using codons frequently used in Sf9 and human cells.
SEQ ID NOS: 39 and 40 are the sequences of primers VN- Fl (5'-CAGTCTGCAGGACCAGATCTGTATC-S' : (SEQ ID NO: 39); the Pstl site is underlined), and VN-R4 (5' -CAGTCCCGGGCTCTCTTCTTCCTGC-3' : (SEQ ID NO: 40); the Xmal site is underlined) for PCR with the artificial gene sequence of SEQ ID NO: 38 as a template.
SEQ ID NOS: 41, 42, 43, 44, and 12 are the sequences of primers gp64(51)-f (5'-GACTCCCCGGGTGGAAATCACCATCGTGGAGACG-S' :
(SEQ ID NO: 41); the Xmal site is underlined), gp64(101)-f (5'- GACTCCCCGGGATTTGCTTATGTGGAGCATCAGG-3' : (SEQ ID NO: 42); the Xmal site is underlined), gp64(154)-f (5'-
GACTCCCCGGGCGCACCACACGTGCAACAAATCG-3' : (SEQ ID NO: 43); the Xmal site is underlined), gp64(201)-f (5'-
GACTCCCCGGGACACTGTGCTTCATCGAGACGGC-3' : (SEQ ID NO: 44); the Xmal site is underlined), and GP64-r DraIII (5'-
GGGCACTTAGTGATATTGTCTATTACGGTTTCTAATC-3' (SEQ ID NO: 12); the
Dralll site is underlined) .
SEQ ID NO: 45 is the sequence of an artificial gene produced from the amino acid sequence of the HAl region of the hemagglutinin of influenza virus H5N1/Anhui/1/O5 by codon optimization using Gene Designer available from DNA2.0, Inc.
SEQ ID NOS: 46, 47, 48, 49, and 50 are the sequences of AH17-F (5'-GACTCTGCAGGATCAGATCTGTATTGGGTACC-S' : (SEQ ID NO:
46); the Pstl site is underlined, and AH345-R (5'- CGATCCCGGGCTCTCTTTCTCCTCCGCTCGC-3' : (SEQ ID NO: 47); the Xmal site is underlined), AH410-R (5'-
CGATCCCGGGCGGCCTCGAACTGGGTGTTCATT-3' : (SEQ ID NO: 48); the Xmal site is underlined), AH473-R (5'-
CGATCCCGGGCGTCTCTGAGTTGAAGGCGCAC-3' : (SEQ ID NO: 49); the Xmal site is underlined, and AH520-R (5'-
CGATCCCGGGCACCACTAATTTCCTCTCGCTTC-3' : (SEQ ID NO: 50); the Xmal site is underlined) for PCR with the artificial gene sequence of
SEQ ID NO: 45 as a template.
SEQ ID NO: 51 is the sequence of an artificial gene produced from the amino acid sequence of the HAl region of the hemagglutinin of influenza virus H5Nl/Vietnam/1203/04 by codon optimization using Gene Designer available from DNA2.0, Inc.
SEQ ID NOS: 52, 53, 54, 55, and 56 are the sequences of primers VN17-F (5'-GACTCTGCAGGATCAGATCTGTATCGGATATC-S' : (SEQ ID NO: 52); the Pstl site is underlined), and VN346-R (5'- CGATCCCGGGCCCGCTTTTTCCTCCTCCGTTCG-3' : (SEQ ID NO: 53); the Xmal site is underlined), VN410-R (5'-
CGATCCCGGGCCTCAAACTGCGTATTCATTTTG-3' : (SEQ ID NO: 54); the Xmal site is underlined), VN473-R (5'- CGATCCCGGGCTCTAAGCTGGAGCCTGACTTTGTC-3' : (SEQ ID NO: 55); the Xmal site is underlined), and VN520-R (5'-
CGATCCCGGGCACTAATCTCCTCTCTTTTAAGTC-3' : (SEQ ID NO: 56) ; the Xmal site is underlined) for PCR with the artificial gene sequence of
SEQ ID NO: 51 as a template. SEQ ID NO: 57 is the sequence of an artificial gene produced from the amino acid sequence of the CSP of Plasmodium falciparum 3D7 strain by codon optimization using Gene Designer available from DNA2.0, Inc.
SEQ ID NOS: 58, 59, 60, 61, and 62 are the sequences of primers PfCSP_opt-f (5'-GACTCTGCAGATGATGCGAAAATTGGCCATACTG-
3' : (SEQ ID NO: 58); the Pstl site is underlined), PfCSP_opt-r
(397) (5' -CGATCCCGGGCATTGAGGAACAGAAAGGAAAGAACCATG-3' : (SEQ ID NO:
59); the Xmal site is underlined), PfCSP_opt-f (19) (5'-
GACTCTGCAGCTGTTTCAGGAATACCAGTGCTATGG-3' : (SEQ ID NO: 60); (the Pstl site is underlined), PfCSP_opt-r (373) (5'-
CGATCCCGGGCCTTCTCCATCTTACAAATTTTCTTTTCAATATCATTAGC -3' : (SEQ ID
NO: 61); (the Xmal site is underlined), PfCSP_opt-f (76) (5'-
GACTCTGCAGGACGACGGAAATAATGAGGACAACG-3' : (SEQ ID NO: 62); the Pstl site is underlined), and PfCSP_opt-f (205) (5'- GACTCTGCAGAATGCAAACCCAAATGCCAATCCAAACGC-3' : (SEQ ID NO: 63) ; the
Pstl site is underlined) for PCR with the artificial gene sequence of SEQ ID NO: 57 as a template.
SEQ ID NOS: 64, 65, 66, and 67 are the sequences of primers gp64-p-f (5'-GACTCGGACCGGCCAGATAAAAATAATCTTATCAATTAAG-S' : (SEQ ID NO: 64); the RsrII site is underlined), gp64-p-r (5'-
CGATACTAGTAGCACTGAGGCTTCTTATATACCCG-3' : (SEQ ID NO: 65); the Spel site is underlined), and vp39-p-f (5'-
GACTCGGACCGCGTCGTACAAATCGAAATATTGTTGTG-3' : (SEQ ID NO: 66) ; the
RsrII site is underlined), and vp39-p-r (5'- CGATACTAGTGTGATTGAGAAAGAAATCTCTTATTC-S': (SEQ ID NO: 67); the Spel site is underlined) for PCR with Baculovirus genomic DNA as a template.
SEQ ID NOS: 68 and 69 are the sequences of primers VSV-G-f (5'-GACTCCCCGGGCGTTCGAACATCCTCACATTCAAG -3' (SEQ ID NO: 68); the Xmal site is underlined), and VSV-G-r (5'-
GACTCACTTAGTGCTTTCCAAGTCGGTTCATCTC-3' : (SEQ ID NO: 69); the DraIII site is underlined) for PCR with pVSV-G as a template.

Claims

1. A transfer vector which is any one of pCAP-PfCSP, pCAP- PfCSP/272, pCAP-PfCSP/467, pCAP-PfCSP (A361E) , pCAP-
PfCSP (A361E) /272, pCAP-PfCSP(A361E) /467, pCAP-PfCSP-76, pCAP- PfCSP-76/467, pCAP-PfCSP+209, pCAP-PfCSP+209/467, pCAP-
PfCSP+76/209, pCAP-PfCSP+76/209/467, pCAP-HAl/Anhui, pCAP- HAl/Anhui/272, pCAP-HAl/Anhui/467, pCAP-HAl/Vietnam, pCAP- HAl/Vietnam/51, pCAP-HAl/Vietnam/101, pCAP-HAl/Vietnam/154, pCAP- HAl/Vietnam/201, pCAP-HAl/Vietnam/272, pCAP-HAl/Vietnam/467, pCAP-AH/345, pCAP-AH/345/467, pCAP-AH/410, pCAP-AH/410/467, pCAP- AH/473, pCAP-AH/473/467, pCAP-AH/520, pCAP-AH/520/467, pCAP- VN/346, pCAP-VN/346/467, pCAP-VN/410, pCAP-VN/410/467, pCAP- VN/473, pCAP-VN/473/467, pCAP-VN/520, pCAP-VN/520/467, pCAP- CO/full, pCAP-CO/full/467, pCAP-CO/19, pCAP-CO/19/467, pCAP-CO/76, pCAP-CO/76/467, pCAP-CO/205, pCAP-CO/205/467, pCA39-HAl/Anhui, pCA64-HAl/Anhui, pCA39-PfCSP(A361E) , pCA64-PfCSP(A361E) , pCAP- CO/full/VSV, pCAP-CO/19/VSV, pCAP-CO/76/VSV, pCAP-CO/205/VSV, pDual-Pfs25-PfCSP-gp64, and pDual-PfMSPl-PfCSP-gp64.
2. A recombinant baculovirus which is any one of AcNPV- CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP-
PfCSP (A361E), AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP-
HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-PiAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP-AH/473/467, AcNPV-CAP-AH/520, AcNPV- CAP-AH/520/467, AcNPV-CAP-VN/346, AcNPV-CAP-VN/346/467, AcNPV- CAP-VN/410, AcNPV-CAP-VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP- VN/473/467, AcNPV-CAP-VN/520, AcNPV-CAP-VN/520/467, AcNPV-CAP- CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP- CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV-CAP-CO/205/467, AcNPV-CA39-HAl/Anhui, AcNPV-CA64-HAl/Anhui, AcNPV-CA39-PfCSP(A361E), AcNPV-CA64-PfCSP (A361E) , AcNPV-CAP- CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP- CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV-Dual-PfMSPl- PfCSP-gp64.
3. A composition for infectious diseases comprising the recombinant baculovirus of claim 2 as an active ingredient.
4. A composition for infectious diseases comprising the recombinant baculovirus of claim 2 as an active ingredient, the composition being administered by the intramuscular, respiratory, or nasal route.
5. A vaccine comprising the recombinant baculovirus of claim 2 as an active ingredient.
6. A vaccine comprising the recombinant baculovirus of claim 3 as an active ingredient, the composition being administered by the intramuscular, respiratory, or nasal route.
7. A therapeutic or preventive agent for influenza virus infection, comprising as an active ingredient any one of AcNPV- CAP-HAl/Anhui, AcNPV-CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP-HAl/Vietnam, AcNFV-CAP-HAl/Vietnam/51, AcNPV-CAP- HAl/Vietnam/101, AcNPV-CAP-HAl/Vietnam/154, AcNPV-CAP- HAl/Vietnam/201, AcNPV-CAP-HAl/Vietnam/272, AcNPV-CAP- HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV- CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP- AH/473/467, AcNPV-CAP-AH/520, AcNPV-CAP-AH/520/467, AcNPV-CAP- VN/346, AcNPV-CAP-VN/346/467, AcNPV-CAP-VN/410, AcNPV-CAP- VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP-VN/473/467, AcNPV-CAP- VN/520, AcNPV-CAP-VN/520/467, AcNPV-CA39-HAl/Anhui, and AcNPV- CA64-HAl/Anhui.
8. A therapeutic or preventive agent for influenza virus infection according to claim 7, which is administered by the intramuscular, respiratory, or nasal route.
9. A vaccine against influenza virus infection, comprising as an active ingredient any one of AcNPV-CAP-HAl/Anhui, AcNPV- CAP-HAl/Anhui/272, AcNPV-CAP-HAl/Anhui/467, AcNPV-CAP-HAl/Vietnam, AcNPV-CAP-HAl/Vietnam/51, AcNPV-CAP-HAl/Vietnam/101, AcNPV-CAP- HAl/Vietnam/154, AcNPV-CAP-HAl/Vietnam/201, AcNPV-CAP- HAl/Vietnam/272, AcNPV-CAP-HAl/Vietnam/467, AcNPV-CAP-AH/345, AcNPV-CAP-AH/345/467, AcNPV-CAP-AH/410, AcNPV-CAP-AH/410/467, AcNPV-CAP-AH/473, AcNPV-CAP-AH/473/467, AcNPV-CAP-AH/520, AcNPV- CAP-AH/520/467, AcNPV-CAP-VN/346, AcNPV-CAP-VN/346/467, AcNPV- CAP-VN/410, AcNPV-CAP-VN/410/467, AcNPV-CAP-VN/473, AcNPV-CAP- VN/473/467, AcNPV-CAP-VN/520, AcNPV-CAP-VN/520/467, AcNPV-CA39- HAl/Anhui, and AcNPV-CA64-HAl/Anhui.
10. A vaccine against influenza virus infection according to claim 7, which is administered by the intramuscular, respiratory, or nasal route.
11. A therapeutic or preventive agent for human malaria infection, comprising as an active ingredient any one of AcNPV- CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E), AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP-CO/19/467,
AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV- CAP-CO/205/467, AcNPV-CA39-PfCSP (A361E) , AcNPV-CA64-PfCSP (A361E) , AcNPV-CAP-CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP-CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV- Dual-PfMSPl-PfCSP-gp64.
12. A therapeutic or preventive agent for human malaria infection according to claim 11, which is administered by the intramuscular, respiratory, or nasal route.
13. A therapeutic or preventive agent for human malaria infection, comprising as an active ingredient any one of AcNPV-
CAP-PfCSP, AcNPV-CAP-PfCSP/272, AcNPV-CAP-PfCSP/467, AcNPV-CAP- PfCSP (A361E), AcNPV-CAP-PfCSP (A361E) /272, AcNPV-CAP- PfCSP (A361E) /467, AcNPV-CAP-PfCSP-76, AcNPV-CAP-PfCSP-76/467, AcNPV-CAP-PfCSP+209, AcNPV-CAP-PfCSP+209/467, AcNPV-CAP- PfCSP+76/209, AcNPV-CAP-PfCSP+76/209/467, AcNPV-CAP-CO/full, AcNPV-CAP-CO/full/467, AcNPV-CAP-CO/19, AcNPV-CAP-CO/19/467, AcNPV-CAP-CO/76, AcNPV-CAP-CO/76/467, AcNPV-CAP-CO/205, AcNPV- CAP-CO/205/467, AcNPV-CA39-PfCSP (A361E) , AcNPV-CA64-PfCSP (A361E) , AcNPV-CAP-CO/full/VSV, AcNPV-CAP-CO/19/VSV, AcNPV-CAP-CO/76/VSV, AcNPV-CAP-CO/205/VSV, AcNPV-Dual-Pfs25-PfCSP-gp64, and AcNPV- Dual-PfMSPl-PfCSP-gp64.
14. A therapeutic or preventive agent for human malaria infection according to claim 13, which is administered by the intramuscular, respiratory, or nasal route.
15. A method of preventing malaria or influenza infection or of treating malaria or influenza, comprising administering to a subject an effective amount of the recombinant baculovirus of claim 2, the composition for infectious diseases of claim 3 or 4, or the vaccine of claim 5, 6, 9, 10, 13 or 14.
16. A method according to claim 15, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject as a liposomal formulation.
17. A method according to claim 15, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject by the intramuscular, respiratory, or nasal route.
18. A method according to claim 16, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject by the intramuscular, respiratory, or nasal route.
19. A method of immunostimulation comprising administering to a subject an effective amount of the recombinant baculovirus of claim 2, the composition for infectious diseases of claim 3 or 4, or the vaccine of claim 5, 6, 9, 10, 13 or 14.
20. A method according to claim 19, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject as a liposomal formulation.
21. A method according to claim 19, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject by the intramuscular, respiratory, or nasal route.
22. A method according to claim 20, wherein the recombinant baculovirus, composition, or vaccine is administered to the subject by the intramuscular, respiratory, or nasal route.
PCT/JP2008/064503 2006-02-09 2008-08-06 Baculoviral vectors with a dual vertebrate and baculovirus promoter controlling an immunogenic fusion gene WO2009020236A2 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
DK08792433.8T DK2191002T3 (en) 2007-08-07 2008-08-06 BACULOVIRUS VECTORS WITH A DOUBLE VERTEBRAT AND BACULOVIRUS PROMOTER REGULATING AN IMMUNOGENT FUSION GENE
CA2695894A CA2695894C (en) 2007-08-07 2008-08-06 Baculoviral vectors with a dual vertebrate and baculovirus promoter controlling an immunogenic fusion gene
MX2010001499A MX2010001499A (en) 2007-08-07 2008-08-06 Baculoviral vectors with a dual vertebrate and baculovirus promoter controlling an immunogenic fusion gene.
JP2010504369A JP5409605B6 (en) 2007-08-07 2008-08-06 New virus vector
EP08792433.8A EP2191002B1 (en) 2007-08-07 2008-08-06 Baculoviral vectors with a dual vertebrate and baculovirus promoter controlling an immunogenic fusion gene.
CN200880102191.5A CN101772576B (en) 2007-08-07 2008-08-06 With controlling the vertebrate of immunogenic fusion gene and the baculovirus vector of baculoviral double starting
BRPI0815034 BRPI0815034A2 (en) 2007-08-07 2008-08-06 Baculoviral vectors with a dual vertebrate and baculovirus promoter that controls an immunogenic fusion gene
RU2010108248/10A RU2491093C2 (en) 2007-08-07 2008-08-06 Baculovirus vectors with double promoter including vertebrate promotor and baculovirus promotor controlling immunogenic fused gene
AU2008284664A AU2008284664B2 (en) 2007-08-07 2008-08-06 Baculoviral vectors with a dual vertebrate and baculovirus promoter controlling an immunogenic fusion gene
AP2010005146A AP2010005146A0 (en) 2007-08-07 2008-08-06 Baculoviral vectors with a dual vertebrate and baculovirus promoter controlling an immunogenic fusion gene
US12/192,927 US9333249B2 (en) 2006-02-09 2008-08-15 Recombinant baculovirus vaccine
IL203411A IL203411A (en) 2007-08-07 2010-01-20 Baculoviral vectors with a dual vertebrate and baculovirus promoter controlling an immunogenic fusion gene
ZA2010/00422A ZA201000422B (en) 2007-08-07 2010-01-20 Baculoviral vectors with a dual vertebrate and baculovirus promoter controlling an immunogenic fusion gene
HK10109135.5A HK1142629A1 (en) 2007-08-07 2010-09-24 Baculoviral vectors with a dual vertebrate and baculovirus promoter controlling an immunogenic fusion gene

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2007205785 2007-08-07
JP2007-205785 2007-08-07

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
US12/278,916 Continuation-In-Part US9023365B2 (en) 2006-02-09 2007-02-08 Recombinant baculovirus vaccine
PCT/JP2007/052195 Continuation-In-Part WO2007091624A1 (en) 2006-02-09 2007-02-08 Novel viral vector

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/192,927 Continuation-In-Part US9333249B2 (en) 2006-02-09 2008-08-15 Recombinant baculovirus vaccine

Publications (2)

Publication Number Publication Date
WO2009020236A2 true WO2009020236A2 (en) 2009-02-12
WO2009020236A3 WO2009020236A3 (en) 2009-04-16

Family

ID=40011036

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2008/064503 WO2009020236A2 (en) 2006-02-09 2008-08-06 Baculoviral vectors with a dual vertebrate and baculovirus promoter controlling an immunogenic fusion gene

Country Status (18)

Country Link
EP (1) EP2191002B1 (en)
KR (1) KR20100040947A (en)
CN (1) CN101772576B (en)
AP (1) AP2010005146A0 (en)
AR (1) AR067833A1 (en)
AU (1) AU2008284664B2 (en)
BR (1) BRPI0815034A2 (en)
CA (1) CA2695894C (en)
DK (1) DK2191002T3 (en)
HK (1) HK1142629A1 (en)
IL (1) IL203411A (en)
MX (1) MX2010001499A (en)
MY (1) MY155412A (en)
PE (1) PE20090959A1 (en)
RU (1) RU2491093C2 (en)
TW (1) TWI435934B (en)
WO (1) WO2009020236A2 (en)
ZA (1) ZA201000422B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011099541A1 (en) * 2010-02-12 2011-08-18 大塚製薬株式会社 Method for producing recombinant virus
US8513006B2 (en) 2010-09-14 2013-08-20 University of Pittsburgh—of the Commonwealth System of Higher Education Tetravalent influenza vaccine and use thereof

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105209620A (en) * 2013-03-15 2015-12-30 诺瓦瓦克斯股份有限公司 Enhanced expression of picornavirus proteins
CN109022456B (en) * 2018-07-24 2021-03-02 江南大学 Preparation method of virus vaccine for expressing plasmodium ovale AMA1 protein

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5180581A (en) * 1989-06-29 1993-01-19 University Of Georgia Research Foundation, Inc. Biological insect control agents and methods of use
CN1147555A (en) * 1995-10-09 1997-04-16 武汉大学 Gene engineering-recombined bacillary virus insecticide
WO2002062381A1 (en) * 2001-02-05 2002-08-15 Hisamitsu Pharmaceutical Co., Inc. Baculovirus vector vaccine
WO2003020322A1 (en) * 2001-09-04 2003-03-13 DeveloGen Aktiengesellschaft für entwicklungsbiologische Forschung Vector used to induce an immune response
AU2003266628A1 (en) * 2002-09-25 2004-04-19 Osaka Industrial Promotion Organization Baculovirus vector, method of constructing baculovirus vector and gene transfer method
US7527967B2 (en) * 2003-11-25 2009-05-05 Academia Sinica Recombinant baculovirus and virus-like particle
TWI477602B (en) * 2006-02-09 2015-03-21 Educational Foundation Jichi Medical Univ Novel viral vector

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
None

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011099541A1 (en) * 2010-02-12 2011-08-18 大塚製薬株式会社 Method for producing recombinant virus
CN102822336A (en) * 2010-02-12 2012-12-12 大塚制药株式会社 Method for producing recombinant virus
US8513006B2 (en) 2010-09-14 2013-08-20 University of Pittsburgh—of the Commonwealth System of Higher Education Tetravalent influenza vaccine and use thereof

Also Published As

Publication number Publication date
IL203411A0 (en) 2011-07-31
JP2010535466A (en) 2010-11-25
AP2010005146A0 (en) 2010-02-28
CA2695894C (en) 2016-09-20
AR067833A1 (en) 2009-10-21
EP2191002B1 (en) 2016-04-13
JP5409605B2 (en) 2014-02-05
TW200911992A (en) 2009-03-16
CA2695894A1 (en) 2009-02-12
DK2191002T3 (en) 2016-06-13
AU2008284664A1 (en) 2009-02-12
WO2009020236A3 (en) 2009-04-16
ZA201000422B (en) 2011-03-30
IL203411A (en) 2017-01-31
EP2191002A2 (en) 2010-06-02
AU2008284664B2 (en) 2014-05-15
TWI435934B (en) 2014-05-01
CN101772576A (en) 2010-07-07
MX2010001499A (en) 2010-03-15
KR20100040947A (en) 2010-04-21
HK1142629A1 (en) 2010-12-10
RU2491093C2 (en) 2013-08-27
CN101772576B (en) 2016-05-04
RU2010108248A (en) 2011-09-20
PE20090959A1 (en) 2009-07-20
MY155412A (en) 2015-10-15
BRPI0815034A2 (en) 2015-03-17

Similar Documents

Publication Publication Date Title
CA2636632C (en) Novel viral vector
CA2746310A1 (en) Methods and compositions for use of a coccidiosis vaccine
US9327018B2 (en) Recombinant baculovirus vaccine
CA2695894C (en) Baculoviral vectors with a dual vertebrate and baculovirus promoter controlling an immunogenic fusion gene
JP5409605B6 (en) New virus vector
RU2588464C2 (en) Baculovirus vector and use thereof
KR20230059897A (en) Virus-like particle including all or part of SARS-CoV-2 spike protein and vaccine using same

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200880102191.5

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08792433

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2008284664

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2010010080

Country of ref document: EG

WWE Wipo information: entry into national phase

Ref document number: 12010500119

Country of ref document: PH

WWE Wipo information: entry into national phase

Ref document number: 203411

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2010504369

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2695894

Country of ref document: CA

Ref document number: MX/A/2010/001499

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2008284664

Country of ref document: AU

Date of ref document: 20080806

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20107004567

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2008792433

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 1531/DELNP/2010

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2010108248

Country of ref document: RU

WWE Wipo information: entry into national phase

Ref document number: PI 2010000551

Country of ref document: MY

ENP Entry into the national phase

Ref document number: PI0815034

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20100205