WO2009019293A1 - Modified bacteriophage including an alpha/beta small acid-soluble spore protein (sasp) gene - Google Patents

Modified bacteriophage including an alpha/beta small acid-soluble spore protein (sasp) gene Download PDF

Info

Publication number
WO2009019293A1
WO2009019293A1 PCT/EP2008/060360 EP2008060360W WO2009019293A1 WO 2009019293 A1 WO2009019293 A1 WO 2009019293A1 EP 2008060360 W EP2008060360 W EP 2008060360W WO 2009019293 A1 WO2009019293 A1 WO 2009019293A1
Authority
WO
WIPO (PCT)
Prior art keywords
bacteriophage
sasp
gene
modified
modified bacteriophage
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2008/060360
Other languages
French (fr)
Inventor
Heather Fairhead
Adam Wilkinson
Sarah Holme
Katy Pitts
Alison Jackson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Phico Therapeutics Ltd
Original Assignee
Phico Therapeutics Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP08786965A priority Critical patent/EP2179035B8/en
Priority to DK08786965.7T priority patent/DK2179035T3/en
Priority to JP2010519462A priority patent/JP5582354B2/en
Priority to SI200830934T priority patent/SI2179035T1/en
Priority to PL08786965T priority patent/PL2179035T3/en
Priority to HRP20130250AT priority patent/HRP20130250T1/en
Priority to US12/672,311 priority patent/US8697049B2/en
Priority to ES08786965T priority patent/ES2402176T3/en
Priority to AU2008285659A priority patent/AU2008285659B2/en
Priority to CA2695939A priority patent/CA2695939C/en
Application filed by Phico Therapeutics Ltd filed Critical Phico Therapeutics Ltd
Publication of WO2009019293A1 publication Critical patent/WO2009019293A1/en
Anticipated expiration legal-status Critical
Priority to US14/190,727 priority patent/US9359596B2/en
Priority to US15/147,483 priority patent/US10106784B2/en
Priority to US16/128,558 priority patent/US11559560B2/en
Ceased legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/164—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0014—Skin, i.e. galenical aspects of topical compositions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/02—Local antiseptics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/00032—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/00041—Use of virus, viral particle or viral elements as a vector
    • C12N2795/00043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present invention relates to modified bacteriophage and a process for the production of modified bacteriophage.
  • Staphylococcus aureus is the most common cause of infections contracted whilst in hospital (nosocomial infections) (Nosk ⁇ i et ah, 2005). It frequently causes infections in the lungs, wounds, skin and the blood and, because of the number of toxins the bacterium can produce, these infections may be life threatening.
  • CA-MRSA new Community Acquired MRSA
  • infection control measures include, variously, the use of hand sanitisers by healthcare workers; screening, isolation and barrier nursing of infected and carrier patients; and decontamination of patients and healthcare workers who carry MRSA.
  • the carriage of bacteria is defined as the presence of bacteria, usually at a low level, without any associated pathology such as inflammation.
  • MRSA carriers do constitute a significant risk for the spread of MRSA to the wider hospital community, and the elimination of MRSA from carriers, particularly on or prior to admission, is a very important part of the infection control process.
  • SASP small acid-soluble spore proteins
  • SspC motifs interact with adjacent DNA-SspC filaments packing the filaments into a tight assembly of nucleo-protein helices. In this way DNA replication is halted and, where bound, SASP prevent DNA transcription. SASP bind to DNA in a non-sequence specific manner (Nicholson et al, 1990) so that mutations in the bacterial DNA do not affect the binding of S ASP.
  • WO02/40678 describes the use as an antimicrobial agent of bacteriophage modified to incorporate a SASP gene.
  • WO02/40678 aims to avoid expression of the SASP gene during proliferation of the production host.
  • the SASP gene was preferably inserted into the lysis genes of the bacteriophage so as to put the SASP gene under the control of a lysis gene promoter which is active only at the end of the bacteriophage life cycle. It was thought that proliferation of the bacterial production host would otherwise be prevented owing to the presence of the SASP gene product, particularly if the SASP gene was under the control of a constitutive promoter.
  • the SASP gene could be located elsewhere on the bacteriophage chromosome and placed under the control of a bacteriophage or bacterial promoter whereby the lytic cycle could be left to run its course.
  • the bacterial promoter would be non-constitutive and could be up- regulated by environmental cues.
  • bacteriophage has been modified to carry a gene encoding a SASP under the control of a promoter which is controlled independently of the bacteriophage, and which is constitutive with no exogenous or in trans regulation necessary or provided, When present in multiple copies, for example following infection of target cells, the promoter.drives toxic levels of SASP expression.
  • the present invention provides a modified bacteriophage capable of infecting a target bacterium, which bacteriophage includes an ⁇ / ⁇ small acid-soluble spore protein (SASP) gene encoding a SASP which is toxic to the target bacterium, wherein the SASP gene is under the control of a constitutive promoter which is foreign to the bacteriophage and the SASP gene.
  • SASP small acid-soluble spore protein
  • a process for the production of a modified bacteriophage capable of infecting a target bacterium comprises growing a bacterial host comprising genetic material encoding the bacteriophage in a growth medium; causing the bacteriophage to replicate in the bacterial host; and harvesting the bacteriophage.
  • Use of a modified bacteriophage in which the SASP gene is under the control of a constitutive promoter has a number of advantages. Control of expression of the SASP gene is removed from the bacteriophage whereby production of SASP becomes independent of phage gene expression.
  • bacteriophage Whilst bacteriophage generally tend to have narrow host ranges, putting a SASP gene under the control of a constitutive promoter can broaden the host range of the modified bacteriophage. This is because one of the key ways in which bacteria limit their host range is by degrading bacteriophage DNA on entry into a bacterial cell. Use of bacteriophage to deliver aSASP gene, whose production is independent of the bacteriophage, means that the fate of the bacteriophage DNA may not impact on the efficacy of the SASP. In this way, the bacteriophage acts as a delivery vector by delivering the gene encoding the SASP to a target bacterial cell.
  • Production of a modified bacteriophage according to the invention requires a bacterial host which can be lysogenised by the bacteriophage. This Iy so gen should allow proliferation of the bacteriophage upon induction, so that an adequate bacteriophage titre may be obtained for harvesting. According to the invention, the SASP do not prevent the production of adequate phage titres within the timescale required by a manufacturing process, i.e. prior to host cell death.
  • a preferred approach according to the present invention is to use a constitutive promoter to control the SASP gene, such that the promoter does not promote the expression of sufficient SASP to kill the host production strain from which the modified bacteriophage is to be harvested.
  • the promoter may be a bacterial promoter, such as from S. aureus.
  • Preferred promoters include the S. aureus promoters pdhA for pyruvate dehydrogenase El component alpha subunit, rpsB for the 3OS ribosomal protein S2, pgi for glucose-6-phosphate isomerase. Sequences having >90% identity to these sequences may also be used on promoters according to the invention.
  • a particularly preferred promoter is the promoter for the fructose bisphosphate aldolase gene, fiaA, from S. aureus N315 (accession no. BAB43211), or a sequence showing >90% homology to this sequence.
  • An advantage of using the flaA promoter to express the SASP gene is that this promoter expresses constitutively in bacterial cells and does not appear to be regulated by any mechanism within S. aureus cells.
  • a single copy of ihefl>aA::SASP-C element does not produce enough SASP- C to be lethal to a host cell, enabling maintenance and production of the PTSA 1.2/A bacteriophage, as described in further detail below.
  • multiple copies of the fbaA promoter drives sufficient expression of SASP-C so as to cause loss of viability of the target.
  • promoters which are suitable to be used upstream of SASP in bacteriophage constructs have two defining properties; they are not strong enough to kill the bacteriophage's host during growth of the host bacterium; they do not prevent the production of adequate phage titres within the timescale required by a manufacturing process, i.e. prior to host cell death. However, they are sufficiently strong so as to drive the production of toxic levels of SASP when present in multiple copies, i.e. following delivery of multiple copies of the SASP gene to a targeted cell or due to phage replication in a targeted cell. Selection of promoters with such activities may be made by analysing bacteriophage constructs for these characteristics.
  • the promoter controlling transcription and therefore expression of the SASP gene is foreign to both the bacteriophage and the SASP gene in the sense that it does not originate from the bacteriophage and is not the native promoter of the SASP gene. In this way, control of expression of the SASP gene is divested from the phage.
  • the bacterial host can be any host suitable for a given bacteriophage.
  • the host must support the bacteriophage through the proliferation of mature bacteriophage particles within the host, when induced to do so.
  • WO02/40678 sets out in appendix 4 a list of common pathogens and some of their phages. This appendix is reproduced in the present application as appendix 1.
  • Staphylococcus and Clostridium hosts preferably Staphylococcus aureus and Clostridium difficile, are particularly useful hosts.
  • Bacteriophage ⁇ l l is capable of infecting Staphylococcus aureus and is described in further detail below. This bacteriophage may be modified in accordance with the present invention.
  • Sequences of ⁇ / ⁇ -type SASP may be found in appendix 1 of WO 02/40678, including SASP-C from Bacillus megaterium which is the preferred ⁇ / ⁇ -type SASP.
  • SASPject vectors Bacteriophage vectors modified to contain a SASP gene have generally been named SASPject vectors.
  • SASPject vector PTSAl.2/A is described in further detail below for delivery of the SASP gene to S. aureus, including MRSA.
  • the SASP gene and its promoter may be placed anywhere within the bacteriophage genome.
  • the modified bacteriophage is non-lytic and this may be achieved by the removal or inactivation of one or more genes required by the phage for lysing infected bacteria, most preferably by inactivating at least one of the lysis genes.
  • the SASP gene is inserted into one of the lysis genes or the lysis gene is replaced with the toxin gene.
  • the genes for lysing infected bacteria include the bacteriophage holin gene and/or an amidase gene. One or more of these genes may be interrupted or replaced by the SASP gene.
  • the present invention provides a composition for inhibiting or preventing bacterial cell growth, which comprises a modified bacteriophage as defined herein and a carrier therefor.
  • a composition may have a wide range of uses and is therefore to be formulated according to the intended use.
  • the composition may be formulated as a medicament, especially for human treatment and may treat various conditions, including bacterial infections.
  • infections treatable according to the present invention are topical infections, dental carries, respiratory infections, eye infections and localised tissue and organ infections.
  • the carrier may be a pharmaceutically-acceptable recipient or diluent. The exact nature and quantities of the components of such compositions may be determined empirically and will depend in part upon the routes of administration of the composition.
  • Routes of administration to recipients include oral, buccal, sublingual, intranasal, by inhalation, topical (including ophthalmic), intravenous, intra-arterial, intra-muscular, subcutaneous and intra-articular.
  • topical including ophthalmic
  • intravenous, intra-arterial, intra-muscular, subcutaneous and intra-articular are examples of dosages according to the invention.
  • Respiratory infections may be treated by inhalation administration and eye infections may be treated using eye drops.
  • Oral hygiene products containing the modified bacteriophage are also provided; a mouthwash or toothpaste may be used which contains modified bacteriophage according to the invention formulated to eliminate bacteria associated with dental plaque formation.
  • a modified bacteriophage according to the invention may be used as a bacterial decontaminant, for example in the treatment of surface bacterial contamination as well as land remediation or water treatment.
  • the bacteriophage may be used in the treatment of medical personnel and/or patients as a decontaminating agent, for example in a handwash. Treatment of work surfaces and equipment is also provided, especially that used in hospital procedures or in food preparation.
  • One particular embodiment comprises a composition formulated for topical use for preventing, eliminating or reducing carriage of bacteria and contamination from one individual to another. This is important to limit the transmission of microbial infections, particularly in a hospital environment where bacteria resistant to conventional antibiotics are prevalent.
  • the modified bacteriophage may be contained in Tris buffered saline containing CaCl 2 (10 mM) and MgCl 2 (1 mM) or may be formulated within a gel or cream.
  • a preservative may be added.
  • the product may be lyophilised and excipients, for example a sugar such as sucrose may be added.
  • Figure 1 Region of S. aureus phage ⁇ l 1, showing the holin and amidase genes, and the priming sites for amplification of the genes and flanking DNA
  • Figure 2 Diagram of pSAl, showing the cloned region and the location of the priming sites for inverse PCR of pSAl.
  • FIG. 3 Diagram of pSA4, showing the cloned promoter- saspC region with the cadmium resistance (Cd R ) gene and the flanking ⁇ l 1 DNA, together with the location of relevant priming sites.
  • Cd R cadmium resistance
  • Figure 4 Arrangement of DNA within the genome of PTL1003, showing the replacement of the holin gene with foreign genes. The arrangement of genes in the wild-type ⁇ l 1 genome is shown for comparison.
  • Figure 5 An example of a kill curve showing efficacy of PTSAl .2/A against an S. aureus strain.
  • Figure 6 A kill curve comparing the killing ability of PTSAl.2/A with the same phage minus the SASP gene.
  • Figure 7 A kill curve of PTSAl .2/A infecting an S. aureus strain. Summary of construction of a genetically altered bacteriophage carrying SASP-C under control of a fructose bisphosphate aldolase homologue (fbaA) promoter
  • Genes can be removed and added to the phage genome using homologous recombination. There are several ways in which phages carrying foreign genes and promoters can be constructed and the following is an example of such methods.
  • ⁇ l 1 derivative For the construction of a ⁇ l 1 derivative it is shown how, using an E. coli I S. aureus shuttle vector, as an example only, the phage holin gene has been replaced with the gene for SASP-C, under the control of a S. aureus fructose bisphosphate promoter homologue ⁇ fbaA is used from this point on to denote the fructose bisphosphate aldolase promoter).
  • Genes for resistance to the heavy metal Cadmium (referred to henceforth as Cd R ) are used as a non- antibiotic resistance marker.
  • fbaA- SASP-C and Cd R regions were cloned between two regions of ⁇ l 1 DNA which flank the ⁇ l 1 holin gene. Subsequently, this plasmid was introduced into cells and double recombinants were selected for, where the holin was replaced with the fboA-S ASP-C and Cd R region.
  • E. colilS. aureus shuttle vector designated p SMl 98 was used to transfer to genes between E. coli and S. aureus.
  • Plasmid pSM198 was previously produced by combining E. coli cloning vector pUC18 and the tetracycline resistance and replication regions of S. aureus plasmid pT181.
  • the plasmid carries resistance markers that can be selected for in E. coli and S. aureus.
  • This plasmid retains the pUC18 multiple cloning site (MCS), although not all the sites remain as unique sites.
  • the remaining unique sites in the MCS of pSM198 are: Pstl, Sail, BamHI, Sad and EcoRL
  • Plasmid pSAl comprising pBluescript SK+ containing a 1.8 kb fragment of ⁇ l 1 spanning the lytic genes, was constructed as follows.
  • Figure 1 shows the priming sites for the oligonucleotides described below for amplification of regions from the ⁇ l 1 genome.
  • Primer BlOOl (SEQ ID NO: 1) comprises a 5' Pstl site (underlined) followed by sequence of ⁇ l l (Genbank: AF424781) from base 39779 to base 39798, (see Figure 1).
  • Primer B 1002 (SEQ ID NO: 2) comprises an Xbal site (underlined) followed by the reverse and complement of sequence of ⁇ ll from base 41537 to base 41556 (see Figure 1).
  • Primer B 1003 comprises a 5' BamHI site (underlined) followed by the reverse and complement sequence of ⁇ l 1 from base 40454 to base 40469 (see Figure 1).
  • Primer B 1004 comprises a 5' Spel site (underlined), followed by sequence of ⁇ l l from base 40891 to base 40911 (see Figure 2).
  • the cadmium resistance region from pI258 was amplified by PCR using primers B 1005 and B1006, yielding an -2.8 kb fragment.
  • the PCR product was cleaned and digested with BamHI and Xbal.
  • the digested PCR product was cleaned and cloned into pSAl (PCR amplified and digested, above), making pSA2.
  • Primer Bl 005 (SEQ ID NO: 5) is complementary to DNA 308 bp upstream from the ATG for the putative cadmium-responsive regulatory protein gene cadC from pI258 (Genbank: J04551), the 3' end being nearest the ATG (see Figure 3).
  • the 5' end of the primer carries a non-complementary tail with a BamHI site (underlined) to aid cloning.
  • Primer Bl 006 (SEQ ID NO: 6) is complementary to DNA at the 3' end of the cadA gene for the cadmium resistance protein from plasmid pI258, such that the last 3 complementary nucleotides are complementary to the stop codon TAG of the cadA gene (see Figure 3).
  • the 5' end carries a non-complementary Xbal site (underlined) to aid cloning.
  • PCR amplification of the fiaA promoter using B 1007 and B 1008 yielded an approximately 300 bp fragment which was cleaned and subsequently digested with Ncol, then re-cleaned.
  • the fiaA PCR fragment was ligated to the SASP-C coding sequence from B. megaterhtm. The amplification and preparation of the SASP-C gene is described below.
  • Primer B 1007 (SEQ ID NO: 7) comprises a 5' sequence tail which includes a BamHI site, followed by the reverse complement of bases 2189404 to 2189427 from the S. aureusNCTC 8325 genome (Genbank: CP000253) (see Figure 3).
  • Oligonucleotide Bl 008 (SEQ ID NO: 8) comprises a sequence tail which includes an Ncol site, then the sequence of bases 2189214 to 2189232 from the S. aureus NCTC 8325 genome (see Figure 3).
  • the Ncol site incorporated into the primer at the ATG of the gene results in the change of the base 2 nucleotides upstream of the ATG from T>C.
  • the SASP-C gene from B. megaterium strain KM was amplified by PCR with primers B 1009 and BlOlO and yielded an -300 bp fragment.
  • the PCR product was cleaned and digested with Ncol.
  • the digested PCR product was cleaned and used in a ligation with the fboA PCR fragment, as described below.
  • Oligonucleotide B1009 (SEQ ID NO: 9) comprises a 5' tail containing an Ncol site and is complementary to the first 20 nucleotides of SASP-C (accession no. KOl 833), starting at the ATG, from B. megaterium strain KM (see Figure 3).
  • the Ncol site at the beginning of the oligonucleotide incorporates the ATG of the SASP-C gene.
  • Oligonucleotide BlOlO (SEQ ID NO: 10) comprises a BgIII site (underlined), and an EcoRI site (double underlined), followed by the reverse complement of DNA starting 59 bases downstream of the stop codon to 74 bases downstream of the stop codon of the SASP-C gene (see Figure 3).
  • the fbaA and the SASP-C PCR fragments were ligated together using T4 DNA ligase.
  • the ligated DNAs were used as a template for PCR, to amplify the joined flaA and SASP-C DNAs.
  • PCR was performed using primers B 1007 and BlOlO.
  • the main PCR product of -500 bp was gel purified.
  • the PCR product was digested with BamHI and BgIII and cleaned. This fragment was cloned into pSA3 which was prepared as follows.
  • the plasmid was cut with BamHI, and the ends were dephosphorylated using calf intestinal alkaline phosphatase (CIAP). The DNA was cleaned again.
  • Plasmids were screened so that the end of the SASP-C gene was adjacent to the "left arm" region of ⁇ l l, and so the start of the fbaA promoter was adjacent to the cadmium chloride resistance region.
  • PTL47 is a monolysogen of ⁇ l l in RN4220.
  • PCR reactions were performed to check that the holin gene was no longer present, and that the/S ⁇ -SASP-C and the CdCl 2 R gene were present and correctly placed in the ⁇ l l prophage genome. PCR fragments were sequenced to ensure that the isolate carried the expected sequence, especially in regions:/?) ⁇ and SASP-C.
  • Verified prophage constructs were thus identified and a representative was picked and named PTLlOOl.
  • Phage was induced from a culture of strain PTLlOOl by heat shock, and the cells were lysed with lysostaphin (0.25 ⁇ g/ml), and then filtered through a 0.2 ⁇ m filter, yielding a crude cell-free phage Iy sate. 5. This lysate was used to infect S. aureus strain 8325-4. The infection mixture was plated onto ⁇ VPB (vegetable peptone brothcontaining 10 g/1 sodium chloride) + CdCl 2 (0.1 mM) agar plates to select for lysogens after overnight growth at 37 0 C.
  • ⁇ VPB vegetable peptone brothcontaining 10 g/1 sodium chloride
  • CdCl 2 0.1 mM
  • Lysogens were checked by colony PCR as described above. A verified lysogen was identified and named PTL 1002.
  • PTL1002 was passaged 5 times on ⁇ VPB agar, picking a single colony and re- streaking to single colonies at each passage.
  • SASPject vector PTSAl.2/A has been tested against a panel of S. aureus strains and clinical isolates, including methicillin sensitive S. aureus (MSSA) and MRSA strains belonging to each of the 5 recognised scc-mec types.
  • MSSA methicillin sensitive S. aureus
  • An example of a kill curve showing efficacy of PTS Al.2/A against an 5. aureus strain is given in Figure 5.
  • a kill curve comparing the killing ability of PTSAl.2/A versus the same phage minus the SASP gene (phage SAO/ A) is given in Figure 6, and confirms that the kill rate is due to presence of the SASP.
  • a kill curve of PTSAl .2/A infecting an S. aureus strain which is a monolysogen of PTSAl.2/A is given in Figure 7, and shows that superinfection immunity to the phage does not prevent SASP from inhibiting infected cells.
  • Bacteriophage VT2-Sa (E. coii 0157 :H7)
  • Bacteriophages of Pseudomonas aeruginosa Bacteriophages of Pseudomonas aeruginosa.
  • Bacteriophage 60 Bacteriophage 92
  • Bacteriophages of Yersinia pestis Bacteriophages of Yersinia pestis

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Communicable Diseases (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Nutrition Science (AREA)
  • Dermatology (AREA)
  • Physiology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Agronomy & Crop Science (AREA)
  • Pest Control & Pesticides (AREA)
  • Plant Pathology (AREA)

Abstract

Provided is a modified bacteriophage capable of infecting a target bacterium, which bacteriophage includes an α/β small acid-soluble spore protein (SASP) gene encoding a SASP which is toxic to the target bacterium, wherein the SASP gene is under the control of a constitutive promoter which is foreign to the bacteriophage and the SASP gene.

Description

Modified Bacteriophage
The present invention relates to modified bacteriophage and a process for the production of modified bacteriophage.
Background to the Invention
Staphylococcus aureus is the most common cause of infections contracted whilst in hospital (nosocomial infections) (Noskύi et ah, 2005). It frequently causes infections in the lungs, wounds, skin and the blood and, because of the number of toxins the bacterium can produce, these infections may be life threatening.
Almost all strains of S. aureus are now resistant to penicillin owing to their ability to produce an enzyme (penicillinase) which breaks down the drug; and 45 years after the introduction of methicillin in 1959, a penicillinase-resistant penicillin, methicillin resistant S. aureus (MRSA) strains are endemic in many hospitals. More recently MRSA strains have also become a problem in the community. Many MRSA strains are now resistant to multiple antibiotics.
MRSA levels have risen dramatically in hospitals in both the US and the UK and, in addition, new Community Acquired MRSA (CA-MRSA) strains have spread rapidly across the globe since they were first reported in the late 1990's. These CA-MRSA strains have proven to be highly transmissible and often carry a set of genes encoding Panton Valentine Leukocidin which is a toxin that can make these strains highly virulent. There are concerns that these CA-MRSA strains may further add to the difficulties of controlling MRSA infections in hospitals (Donegan, 2006).
In fact, MRSA is now such a serious (and lethal) problem in hospitals that significant effort is being put into implementing infection control measures as a way of minimising the spread of MRSA in hospitals and thus reducing the number of infections. In relation to MRSA in particular, infection control measures include, variously, the use of hand sanitisers by healthcare workers; screening, isolation and barrier nursing of infected and carrier patients; and decontamination of patients and healthcare workers who carry MRSA. The carriage of bacteria is defined as the presence of bacteria, usually at a low level, without any associated pathology such as inflammation. However, MRSA carriers do constitute a significant risk for the spread of MRSA to the wider hospital community, and the elimination of MRSA from carriers, particularly on or prior to admission, is a very important part of the infection control process.
Carriage of S. aureus (and therefore MRSA) occurs in and around the nose, armpits, groin, and perineum as well as in superficial skin lesions. A number of studies report that S. aureus is carried in the nose by 25 to 30% of the general population with MRSA being carried by around 1%. Amongst hospital patients the carriage rate is significantly higher. In the US it has been estimated that 89 million people carry S. aureus in their nose, and 2.3 million of those carry MRSA (Mainous et ah, 2006). The intra-nasal elimination of MRSA is therefore fundamental to controlling the spread of this potentially lethal organism in hospitals.
As an alternative to conventional antibiotics, one family of proteins which demonstrate broad spectrum antibacterial activity inside bacteria comprises the α/β- type small acid-soluble spore proteins (known henceforth as SASP). Inside bacteria, SASP bind to the bacterial DNA: visualisation of this process, using cryoelectron microscopy, has shown that SspC, the most studied SASP, coats the DNA and forms protruding domains and modifies the DNA structure (Francesconi et ah, 1988; Frenkiel-Krispin et ah, 2004) from B-like (pitch 3.4 run) towards A-like (3.18 nm; A- like DNA has a pitch of 2.8 nm). The protruding SspC motifs interact with adjacent DNA-SspC filaments packing the filaments into a tight assembly of nucleo-protein helices. In this way DNA replication is halted and, where bound, SASP prevent DNA transcription. SASP bind to DNA in a non-sequence specific manner (Nicholson et al, 1990) so that mutations in the bacterial DNA do not affect the binding of S ASP.
WO02/40678 describes the use as an antimicrobial agent of bacteriophage modified to incorporate a SASP gene. In order to provide effective production of the modified bacteriophage in a bacterial host, WO02/40678 aims to avoid expression of the SASP gene during proliferation of the production host. To this end, the SASP gene was preferably inserted into the lysis genes of the bacteriophage so as to put the SASP gene under the control of a lysis gene promoter which is active only at the end of the bacteriophage life cycle. It was thought that proliferation of the bacterial production host would otherwise be prevented owing to the presence of the SASP gene product, particularly if the SASP gene was under the control of a constitutive promoter. In a less preferred arrangement, the SASP gene could be located elsewhere on the bacteriophage chromosome and placed under the control of a bacteriophage or bacterial promoter whereby the lytic cycle could be left to run its course. In this arrangement, the bacterial promoter would be non-constitutive and could be up- regulated by environmental cues.
Summary of the Invention
It has now surprisingly been found that effective production of bacteriophage may be achieved where the bacteriophage has been modified to carry a gene encoding a SASP under the control of a promoter which is controlled independently of the bacteriophage, and which is constitutive with no exogenous or in trans regulation necessary or provided, When present in multiple copies, for example following infection of target cells, the promoter.drives toxic levels of SASP expression.
Accordingly, in a first aspect, the present invention provides a modified bacteriophage capable of infecting a target bacterium, which bacteriophage includes an α/β small acid-soluble spore protein (SASP) gene encoding a SASP which is toxic to the target bacterium, wherein the SASP gene is under the control of a constitutive promoter which is foreign to the bacteriophage and the SASP gene.
In a second aspect, there is provided a process for the production of a modified bacteriophage capable of infecting a target bacterium, which process comprises growing a bacterial host comprising genetic material encoding the bacteriophage in a growth medium; causing the bacteriophage to replicate in the bacterial host; and harvesting the bacteriophage. Use of a modified bacteriophage in which the SASP gene is under the control of a constitutive promoter has a number of advantages. Control of expression of the SASP gene is removed from the bacteriophage whereby production of SASP becomes independent of phage gene expression. This enables the SASP to be produced even when the bacteriophage cannot carry out its full life cycle; which may happen in the case of super-infection (where the bacteriophage infects a bacterial host already carrying a prophage) and host restriction of the bacteriophage DNA. As described below this strategy thus allows one phage type to inhibit many different strains of one bacterial species.
Whilst bacteriophage generally tend to have narrow host ranges, putting a SASP gene under the control of a constitutive promoter can broaden the host range of the modified bacteriophage. This is because one of the key ways in which bacteria limit their host range is by degrading bacteriophage DNA on entry into a bacterial cell. Use of bacteriophage to deliver aSASP gene, whose production is independent of the bacteriophage, means that the fate of the bacteriophage DNA may not impact on the efficacy of the SASP. In this way, the bacteriophage acts as a delivery vector by delivering the gene encoding the SASP to a target bacterial cell.
Production of a modified bacteriophage according to the invention requires a bacterial host which can be lysogenised by the bacteriophage. This Iy so gen should allow proliferation of the bacteriophage upon induction, so that an adequate bacteriophage titre may be obtained for harvesting. According to the invention, the SASP do not prevent the production of adequate phage titres within the timescale required by a manufacturing process, i.e. prior to host cell death.
A preferred approach according to the present invention is to use a constitutive promoter to control the SASP gene, such that the promoter does not promote the expression of sufficient SASP to kill the host production strain from which the modified bacteriophage is to be harvested. The promoter may be a bacterial promoter, such as from S. aureus. Preferred promoters include the S. aureus promoters pdhA for pyruvate dehydrogenase El component alpha subunit, rpsB for the 3OS ribosomal protein S2, pgi for glucose-6-phosphate isomerase. Sequences having >90% identity to these sequences may also be used on promoters according to the invention. A particularly preferred promoter is the promoter for the fructose bisphosphate aldolase gene, fiaA, from S. aureus N315 (accession no. BAB43211), or a sequence showing >90% homology to this sequence. An advantage of using the flaA promoter to express the SASP gene is that this promoter expresses constitutively in bacterial cells and does not appear to be regulated by any mechanism within S. aureus cells. In addition, a single copy of ihefl>aA::SASP-C element does not produce enough SASP- C to be lethal to a host cell, enabling maintenance and production of the PTSA 1.2/A bacteriophage, as described in further detail below. Upon infection of target bacteria, however, multiple copies of the fbaA promoter (from multiple infection events or phage replication within the target cell) drives sufficient expression of SASP-C so as to cause loss of viability of the target.
Thus promoters which are suitable to be used upstream of SASP in bacteriophage constructs, such as the flaA promoter, have two defining properties; they are not strong enough to kill the bacteriophage's host during growth of the host bacterium; they do not prevent the production of adequate phage titres within the timescale required by a manufacturing process, i.e. prior to host cell death. However, they are sufficiently strong so as to drive the production of toxic levels of SASP when present in multiple copies, i.e. following delivery of multiple copies of the SASP gene to a targeted cell or due to phage replication in a targeted cell. Selection of promoters with such activities may be made by analysing bacteriophage constructs for these characteristics.
The promoter controlling transcription and therefore expression of the SASP gene is foreign to both the bacteriophage and the SASP gene in the sense that it does not originate from the bacteriophage and is not the native promoter of the SASP gene. In this way, control of expression of the SASP gene is divested from the phage.
The bacterial host can be any host suitable for a given bacteriophage. The host must support the bacteriophage through the proliferation of mature bacteriophage particles within the host, when induced to do so. WO02/40678 sets out in appendix 4 a list of common pathogens and some of their phages. This appendix is reproduced in the present application as appendix 1. Staphylococcus and Clostridium hosts, preferably Staphylococcus aureus and Clostridium difficile, are particularly useful hosts. Bacteriophage øl l is capable of infecting Staphylococcus aureus and is described in further detail below. This bacteriophage may be modified in accordance with the present invention.
Sequences of α/β-type SASP may be found in appendix 1 of WO 02/40678, including SASP-C from Bacillus megaterium which is the preferred α/β-type SASP.
Bacteriophage vectors modified to contain a SASP gene have generally been named SASPject vectors. SASPject vector PTSAl.2/A is described in further detail below for delivery of the SASP gene to S. aureus, including MRSA. Once the SASP gene has been delivered to a target bacterium, SASP is produced inside those bacteria where it binds to bacterial DNA and changes the conformation of the DNA from B- like towards A-like. Production of sufficient SASP inside target bacterial cells causes a drop in viability of affected cells; thus toxicity caused by SASP is dose dependent, which in turn is dependent upon promoter activity and number of promoter:: SASP copies present.
In general, the SASP gene and its promoter may be placed anywhere within the bacteriophage genome. However, it is preferred for targeting pathogenic bacteria that the modified bacteriophage is non-lytic and this may be achieved by the removal or inactivation of one or more genes required by the phage for lysing infected bacteria, most preferably by inactivating at least one of the lysis genes. In a preferred embodiment, the SASP gene is inserted into one of the lysis genes or the lysis gene is replaced with the toxin gene. The genes for lysing infected bacteria include the bacteriophage holin gene and/or an amidase gene. One or more of these genes may be interrupted or replaced by the SASP gene. Preventing the modified bacteriophage from lysing its target bacterial host allows continued expression and accumulation of the SASP, possibly beyond the time at which the bacteriophage would normally cause the bacterial host to lyse. In a further aspect, the present invention provides a composition for inhibiting or preventing bacterial cell growth, which comprises a modified bacteriophage as defined herein and a carrier therefor. Such a composition may have a wide range of uses and is therefore to be formulated according to the intended use. The composition may be formulated as a medicament, especially for human treatment and may treat various conditions, including bacterial infections. Among those infections treatable according to the present invention are topical infections, dental carries, respiratory infections, eye infections and localised tissue and organ infections. The carrier may be a pharmaceutically-acceptable recipient or diluent. The exact nature and quantities of the components of such compositions may be determined empirically and will depend in part upon the routes of administration of the composition.
Routes of administration to recipients include oral, buccal, sublingual, intranasal, by inhalation, topical (including ophthalmic), intravenous, intra-arterial, intra-muscular, subcutaneous and intra-articular. For convenience of use, dosages according to the invention will depend on the site and type of infection to be treated or prevented. Respiratory infections may be treated by inhalation administration and eye infections may be treated using eye drops. Oral hygiene products containing the modified bacteriophage are also provided; a mouthwash or toothpaste may be used which contains modified bacteriophage according to the invention formulated to eliminate bacteria associated with dental plaque formation.
A modified bacteriophage according to the invention may be used as a bacterial decontaminant, for example in the treatment of surface bacterial contamination as well as land remediation or water treatment. The bacteriophage may be used in the treatment of medical personnel and/or patients as a decontaminating agent, for example in a handwash. Treatment of work surfaces and equipment is also provided, especially that used in hospital procedures or in food preparation. One particular embodiment comprises a composition formulated for topical use for preventing, eliminating or reducing carriage of bacteria and contamination from one individual to another. This is important to limit the transmission of microbial infections, particularly in a hospital environment where bacteria resistant to conventional antibiotics are prevalent. For such a use the modified bacteriophage may be contained in Tris buffered saline containing CaCl2 (10 mM) and MgCl2 (1 mM) or may be formulated within a gel or cream. For multiple use a preservative may be added. Alternatively the product may be lyophilised and excipients, for example a sugar such as sucrose may be added.
Detailed Description of the Invention
The present invention will now be described in further detail, by way of example only, with reference to the accompanying drawings and the following example.
Brief description of the drawings:
Figure 1. Region of S. aureus phage φl 1, showing the holin and amidase genes, and the priming sites for amplification of the genes and flanking DNA
Figure 2. Diagram of pSAl, showing the cloned region and the location of the priming sites for inverse PCR of pSAl.
Figure 3. Diagram of pSA4, showing the cloned promoter- saspC region with the cadmium resistance (CdR) gene and the flanking φl 1 DNA, together with the location of relevant priming sites.
Figure 4. Arrangement of DNA within the genome of PTL1003, showing the replacement of the holin gene with foreign genes. The arrangement of genes in the wild-type φl 1 genome is shown for comparison.
Figure 5. An example of a kill curve showing efficacy of PTSAl .2/A against an S. aureus strain.
Figure 6. A kill curve comparing the killing ability of PTSAl.2/A with the same phage minus the SASP gene.
Figure 7. A kill curve of PTSAl .2/A infecting an S. aureus strain. Summary of construction of a genetically altered bacteriophage carrying SASP-C under control of a fructose bisphosphate aldolase homologue (fbaA) promoter
Genes can be removed and added to the phage genome using homologous recombination. There are several ways in which phages carrying foreign genes and promoters can be constructed and the following is an example of such methods.
For the construction of a φl 1 derivative it is shown how, using an E. coli I S. aureus shuttle vector, as an example only, the phage holin gene has been replaced with the gene for SASP-C, under the control of a S. aureus fructose bisphosphate promoter homologue {fbaA is used from this point on to denote the fructose bisphosphate aldolase promoter). Genes for resistance to the heavy metal Cadmium (referred to henceforth as CdR) are used as a non- antibiotic resistance marker.
The fbaA- SASP-C and CdR regions were cloned between two regions of φl 1 DNA which flank the φl 1 holin gene. Subsequently, this plasmid was introduced into cells and double recombinants were selected for, where the holin was replaced with the fboA-S ASP-C and CdR region.
Experimental procedures
All PCR reactions were performed using Expand High Fidelity PCR system and stringent conditions, depending upon the melting temperatures (Tm) of the primers, according to the manufacturers instructions. Unless otherwise stated, general molecular biology techniques, such as restriction enzyme digestion, agarose gel electrophoresis, T4 DNA ligase-dependent ligations, competent cell preparation and transformation were based upon methods described in Sambrook et al. (1989). DNA was purified from enzyme reactions and prepared from cells using Qiagen DNA purification kits. S. aureus cells were transformed with plasmid DNA by electroporation, using methods such as those described by Schenck and Ladagga (1992). Primers were obtained from Sigma Genosys. Where primers include recognition sequences for restriction enzymes, an extra 2-6 nucleotides was added at the 5' end to ensure digestion of amplified PCR DNA.
All clonings, unless otherwise stated, are achieved by ligating DNAs overnight with T4 DNA ligase and then transforming them into E. coli cloning strains, such as DH5α or XLl -Blue, with isolation on selective medium, as described elsewhere (Sambrook ef α/., 1989)
An E. colilS. aureus shuttle vector, designated p SMl 98 was used to transfer to genes between E. coli and S. aureus. Plasmid pSM198 was previously produced by combining E. coli cloning vector pUC18 and the tetracycline resistance and replication regions of S. aureus plasmid pT181. The plasmid carries resistance markers that can be selected for in E. coli and S. aureus. This plasmid retains the pUC18 multiple cloning site (MCS), although not all the sites remain as unique sites. The remaining unique sites in the MCS of pSM198 are: Pstl, Sail, BamHI, Sad and EcoRL
Construction of a plasmid for targeted replacement of the φl 1 holin gene with fbaA- SASP-C/CdR
1. Plasmid pSAl, comprising pBluescript SK+ containing a 1.8 kb fragment of φl 1 spanning the lytic genes, was constructed as follows. Figure 1 shows the priming sites for the oligonucleotides described below for amplification of regions from the φl 1 genome.
PCR amplification of φl 1 DNA using primers BlOOl and B 1002, was carried out and yielded a 1.8 kb fragment which was cleaned and digested with Xbal and Pstl. After digestion, the DNA was cleaned and cloned into Xbal and Pstl digested pBluescript SK+, yielding pSAl. Primer BlOOl (SEQ ID NO: 1) comprises a 5' Pstl site (underlined) followed by sequence of φl l (Genbank: AF424781) from base 39779 to base 39798, (see Figure 1). Primer B 1002 (SEQ ID NO: 2) comprises an Xbal site (underlined) followed by the reverse and complement of sequence of φll from base 41537 to base 41556 (see Figure 1).
BlOOl (SEQ ID NO:1)
5' - AACTGCAGGTGTATTGCAACAGATTGGCTC - 3'
B1002 (SEQ ID NO:2)
5' - GCTCTAGACTTTGCTCCCTGCGTCGTTG - 3'
2. Inverse PCR was carried out on pSAl as the template, using primers Bl 003 (SEQ ID NO: 3) and B 1004 (SEQ ID NO: 4) (see Figure 2).
Primer B 1003 comprises a 5' BamHI site (underlined) followed by the reverse and complement sequence of φl 1 from base 40454 to base 40469 (see Figure 1). Primer B 1004 comprises a 5' Spel site (underlined), followed by sequence of φl l from base 40891 to base 40911 (see Figure 2).
B1003 (SEQ ID NO. 3)
5' - CGGGATCCGACTAAAAATTAGTCG - 3'
B1004 (SEQ ID NO. 4)
5' - GGACTAGTGAATGAGTATCATCATGGAGG - 3' This PCR reaction yielded an -4.2 kb fragment which constituted: φl 1 left arm, the entire pBluescript SK+ plasmid, and the φl l right arm. This fragment was digested with BamHI and Spel, cleaned, and subsequently used as a vector to clone in the following fragment.
3. The cadmium resistance region from pI258 was amplified by PCR using primers B 1005 and B1006, yielding an -2.8 kb fragment. The PCR product was cleaned and digested with BamHI and Xbal. The digested PCR product was cleaned and cloned into pSAl (PCR amplified and digested, above), making pSA2.
Primer Bl 005 (SEQ ID NO: 5) is complementary to DNA 308 bp upstream from the ATG for the putative cadmium-responsive regulatory protein gene cadC from pI258 (Genbank: J04551), the 3' end being nearest the ATG (see Figure 3). The 5' end of the primer carries a non-complementary tail with a BamHI site (underlined) to aid cloning.
Primer Bl 006 (SEQ ID NO: 6) is complementary to DNA at the 3' end of the cadA gene for the cadmium resistance protein from plasmid pI258, such that the last 3 complementary nucleotides are complementary to the stop codon TAG of the cadA gene (see Figure 3). The 5' end carries a non-complementary Xbal site (underlined) to aid cloning.
B1005 (SEQ ID NO: 5)
5' - CGATGGATCCTCTCATTTATAAGGTTAAATAATTC - 3'
B1006 (SEQ ID NO: 6)
5' - GCAGACCGCGGCTATTTATCCTTCACTCTCATC - 3'
4. The DNA containing the φ 11 left and right arms and CdR were cut out of pS A2 using Pstl and Sad, and gel purified away from the vector. This fragment was cloned into shuttle vector pSM198 which was also cut Pstl and Sad. Clones were screened for the restriction fragment and candidates were sent for sequencing. A correct plasmid construct was identified and named pSA3. This plasmid was used to clone in the following fragments.
5. PCR amplification of the fiaA promoter using B 1007 and B 1008 yielded an approximately 300 bp fragment which was cleaned and subsequently digested with Ncol, then re-cleaned.
The fiaA PCR fragment was ligated to the SASP-C coding sequence from B. megaterhtm. The amplification and preparation of the SASP-C gene is described below.
Primer B 1007 (SEQ ID NO: 7) comprises a 5' sequence tail which includes a BamHI site, followed by the reverse complement of bases 2189404 to 2189427 from the S. aureusNCTC 8325 genome (Genbank: CP000253) (see Figure 3).
Oligonucleotide Bl 008 (SEQ ID NO: 8) comprises a sequence tail which includes an Ncol site, then the sequence of bases 2189214 to 2189232 from the S. aureus NCTC 8325 genome (see Figure 3). When a PCR product is made using this primer, the Ncol site incorporated into the primer at the ATG of the gene results in the change of the base 2 nucleotides upstream of the ATG from T>C.
B1007 (SEQ ID NO: 7)
5' - CTACGGATCCTTTATCCTCCAATCTACTTATAAA - 3'
B1008 (SEQ ID NO: 8)
5' - CATGCCATGGAAGTTCCTCCTTGAGTGCT - S' 6. The SASP-C gene from B. megaterium strain KM (ATCC 13632) was amplified by PCR with primers B 1009 and BlOlO and yielded an -300 bp fragment. The PCR product was cleaned and digested with Ncol. The digested PCR product was cleaned and used in a ligation with the fboA PCR fragment, as described below.
Oligonucleotide B1009 (SEQ ID NO: 9) comprises a 5' tail containing an Ncol site and is complementary to the first 20 nucleotides of SASP-C (accession no. KOl 833), starting at the ATG, from B. megaterium strain KM (see Figure 3). The Ncol site at the beginning of the oligonucleotide incorporates the ATG of the SASP-C gene.
B1009 (SEQ ID NO: 9)
5' - CGATCCATGGCAAATTATCAAAACGC - 3'
Oligonucleotide BlOlO (SEQ ID NO: 10) comprises a BgIII site (underlined), and an EcoRI site (double underlined), followed by the reverse complement of DNA starting 59 bases downstream of the stop codon to 74 bases downstream of the stop codon of the SASP-C gene (see Figure 3).
B1010 (SEQ ID NO: 10)
5 ' - AGTGAGATCTGAATTCGCTGATTAAAAGAAAC - 3 '
7. The fbaA and the SASP-C PCR fragments (both cut Ncol) were ligated together using T4 DNA ligase. The ligated DNAs were used as a template for PCR, to amplify the joined flaA and SASP-C DNAs. PCR was performed using primers B 1007 and BlOlO. The main PCR product of -500 bp was gel purified. The PCR product was digested with BamHI and BgIII and cleaned. This fragment was cloned into pSA3 which was prepared as follows. The plasmid was cut with BamHI, and the ends were dephosphorylated using calf intestinal alkaline phosphatase (CIAP). The DNA was cleaned again. Plasmids were screened so that the end of the SASP-C gene was adjacent to the "left arm" region of φl l, and so the start of the fbaA promoter was adjacent to the cadmium chloride resistance region. The resulting plasmid, carrying ftaA-SASP-C, was named pSA4.
Replacment of the holin gene from S. aureus phage φl l with fbaA-SASV-C and the CdR marker
1. pSA4 was transformed into S. aureus strain PTL47. PTL47 is a monolysogen of φl l in RN4220.
2. Cells which had undergone a double crossover, where the DNA contained between the φl 1 left and right arms of pSA4 have replaced the DNA between the φl 1 left and right arms in the phage genome (ie the holin gene) gave rise to colonies with the following phenotype: CdCl2 (0.1 mM) resistant, tetracycline (5 μg/ml) sensitive. Tetracycline resistance is carried by the shuttle vector pSM198. Loss of tetracycline resistance is indicative of loss of pSM198. Colonies which had the phentoype: CdCl2 R, tetracycline5 were screened further by colony PCR.
3. PCR reactions were performed to check that the holin gene was no longer present, and that the/Sα^-SASP-C and the CdCl2 R gene were present and correctly placed in the φl l prophage genome. PCR fragments were sequenced to ensure that the isolate carried the expected sequence, especially in regions:/?)^ and SASP-C.
Verified prophage constructs were thus identified and a representative was picked and named PTLlOOl.
4. Phage was induced from a culture of strain PTLlOOl by heat shock, and the cells were lysed with lysostaphin (0.25 μg/ml), and then filtered through a 0.2 μm filter, yielding a crude cell-free phage Iy sate. 5. This lysate was used to infect S. aureus strain 8325-4. The infection mixture was plated onto φVPB (vegetable peptone brothcontaining 10 g/1 sodium chloride) + CdCl2 (0.1 mM) agar plates to select for lysogens after overnight growth at 37 0C.
6. Lysogens were checked by colony PCR as described above. A verified lysogen was identified and named PTL 1002.
7. PTL1002 was passaged 5 times on φVPB agar, picking a single colony and re- streaking to single colonies at each passage.
8. A single colony was picked and analysed again by PCR and sequencing. The verified isolate was named PTL 1003. The phage carried by this lysogen strain is called PTSAl.2/A (see Figure 4).
SASPject vector PTSAl.2/A has been tested against a panel of S. aureus strains and clinical isolates, including methicillin sensitive S. aureus (MSSA) and MRSA strains belonging to each of the 5 recognised scc-mec types. An example of a kill curve showing efficacy of PTS Al.2/A against an 5. aureus strain is given in Figure 5.
A kill curve comparing the killing ability of PTSAl.2/A versus the same phage minus the SASP gene (phage SAO/ A) is given in Figure 6, and confirms that the kill rate is due to presence of the SASP.
A kill curve of PTSAl .2/A infecting an S. aureus strain which is a monolysogen of PTSAl.2/A is given in Figure 7, and shows that superinfection immunity to the phage does not prevent SASP from inhibiting infected cells. REFERENCES
Donegan, N. 2006. Annual Meeting of the Soc. for Healthcare Epidemiology of America.
Francesconi, S.C., MacAlister, T.J., Setlow, B., and Setlow, P. 1988. Immunoelectron microscopic localization of small, acid-soluble spore proteins in sporulating cells of Bacillus subtilis. J. Bacteriol. 170: 5963-5967.
Frenkiel-Krispin, D., Sack R., Englander, J., E. Shimoni, Eisenstein, M., Bullitt, Horowitz-Scherer, E. R., Hayes, C. S., Setlow, P., Minsky, A., and Wolf, S.G. 2004. Structure of the DNA-SspC Complex: Implications for DNA Packaging, Protection, and Repair in Bacterial Spores. J. Bacteriol. 186: 3525 - 3530. Mainous, A.G. Ill, Hueston, W.J., Everett, C.J., and Diaz V.A.. 2006. Nasal Carriage of Staphylococcus aureus and Methicillin Resistant S. aureus in the US 2001-2002. Annals of Family Medicine 4:132-137.
Nicholson, W. L., Setlow, B., and Setlow, P. 1990. Binding of DNA in vitro by a small, acid-soluble spore protein from Bacillus subtilis and the effect of this binding on DNA topology. J. Bacteriol. 172: 6900-6906.
Noskin, G.A., Rubin, R. J., Schentag, J. J., Kluytmans, J., Hedblom, E. C, Smulders, M., Lapetina, E., and Gemmen, E. 2005. The Burden of Staphylococcus aureus Infections on Hospitals in the United States: An Analysis of the 2000 and 2001 Nationwide Inpatient Sample Database. Arch Intern Med 165: 1756-1761
Sambrook, J., Fritsch, E. F. and Maniatis, T. in Molecular Cloning, A Laboratory Manual 2nd edn (Cold Spring Harbor Press, New York, 1989).
Schenk, S., and R. A. Laddaga. 1992. Improved method for electroporation of Staphylococcus aureus. FEMS Microbiol. Lett. 73:133-138. APPENDIX 1
A list of common pathogens and some of their phages (This list is representative but not exhaustive) .
Coliphages :
Bacteriophage lambda
Bacteriophage 933W {Escherichia coli 0157 :H7)
Bacteriophage VT2-Sa (E. coii 0157 :H7)
Coliphage 186
Coliphage Pl
Coliphage P2
Coliphage N15
Bacteriophage T3
Bacteriophage T4
Bacteriophage T7
Bacteriophage KUl
Bacteriophages of Salmonella spp
Bacteriophage Felix
Bacteriophage P22
Bacteriophage L
Bacteriophage 102
Bacteriophage 31
Bacteriophage FO
Bacteriophage 14
Bacteriophage 163
Bacteriophage 175
Bacteriophage Vir
Bacteriophage ViVI
Bacteriophage 8
Bacteriophage 23
Bacteriophage 25
Bacteriophage 46
Bacteriophage E15
Bacteriophage E34
Bacteriophage 9B
Bacteriophages of Shigella dysenteriae
Bacteriophage φ80 Bacteriophage P2 Bacteriophage 2 Bacteriophage 37
Bacteriophages of Vibrio choleras
Bacteriophage fs-2 Bacteriophage 138 Bacteriophage 145 Bacteriophage 149 Bacteriophage 163
Bacteriophages of Mycoplasma arthr±t±dls
Bacteriophage MAVl Bacteriophages of Streptococci
Bacteriophage CP-I
Bacteriophage φXz40
Bacteriophage IA
Bacteriophage IB
Bacteriophage 12/12
Bacteriophage 113
Bacteriophage 120
Bacteriophage 124
Bacteriophages of Pseudomonas aeruginosa.
Bacteriophage D3 Bacteriophage φCTX Bacteriophage PP7
Bacteriophages of Haemophilus influenzae
Bacteriophage S2 Bacteriophage HPl Bacteriophage flu Bacteriophage Mu
Bacteriophages of Staphylococcus aureus
Bacteriophage Twort Bacteriophage tIII-29Ξ Bacteriophage φPVL Bacteriophage φPV83 Bacteriophage φll Bacteriophage φl2 Bacteriophage φl3 Bacteriophage φ42 Bacteriophage φ812 Bacteriophage K Bacteriophage P3 Bacteriophage P14 Bacteriophage UC18 Bacteriophage 15 Bacteriophage 17 Bacteriophage 29 Bacteriophage 42d Bacteriophage 47 Bacteriophage 52 Bacteriophage 53 Bacteriophage 79 Bacteriophage 80 Bacteriophage 81 Bacteriophage 83 Bacteriophage 85 Bacteriophage 93 Bacteriophage 95 Bacteriophage 187
Bacteriophages of Chlamydia
Bacteriophage φCPAR39 Mycobacter±ophage
Bacteriophage L5 Bacteriophage LG Bacteriophage D29 Bacteriophage RvI Bacteriophage Rv2 Bacteriophage DSGA
Bacteriophages of Listeria monocytogenes
Bacteriophage A118 Bacteriophage 243 Bacteriophage A500 Bacteriophage A511 Bacteriophage 10 Bacteriophage 2685 Bacteriophage 12029 Bacteriophage 52 Bacteriophage 3274
Bacteriophages of Klebsiella pneumoniae
Bacteriophage 60 Bacteriophage 92
Bacteriophages of Yersinia pestis
Bacteriophage R Bacteriophage Y Bacteriophage Pl

Claims

Claims:
1. A modified bacteriophage capable of infecting a target bacterium, which bacteriophage includes an α/β small acid-soluble spore protein (SASP) gene encoding a SASP which is toxic to the target bacterium, wherein the SASP gene is under the control of a constitutive promoter which is foreign to the bacteriophage and the SASP gene.
2. A modified bacteriophage according to claim 2, wherein the SASP comprises B. megaterium SASP-C.
3. A modified bacteriophage according to claim 1 or claim 2, which comprises a modified S. aureus bacteriophage.
4. A modified bacteriophage according to claim 3, wherein the S. aureus bacteriophage is a øl 1 bacteriophage.
5. A modified bacteriophage according to any preceding claim, wherein the promoter is selected from pdhA, rpsB, pgi, fbaA and sequences having more than 90% identity thereto.
6. A modified bacteriohage according to claim 5, wherein the bacterial fbaA promoter is from S. aureus.
7. A modified bacteriophage according to any preceding claim, which is non- lytic.
8. A modified bacteriophage according to claim 7, wherein the toxin gene is inserted into a lysis gene thereof.
9. A modified bacteriophage according to claim 7 or claim 8, which is holin".
10. A modified bacteriophage capable of infecting a target bacterium, which bacteriophage comprises a φ 1 1 bacteriophage having a holin gene into which is inserted a gene encoding B. megaterium SASP-C under the control of an fbaA constitutive promoter.
11. A modified bacteriophage according to any preceding claim, which further comprises a non-antibiotic resistance marker.
12. A modified bacteriophage according to claim 11, wherein the non-antibiotic resistance marker is a cadmium resistance marker.
13. A composition for inhibiting or preventing bacterial cell growth, which comprises a modified bacteriophage according to any preceding claim and a carrier therefor.
14. A composition according to claim 13, which is formulated for topical use.
15. A modified bacteriophage according to any one of claims 1 to 12, for use as a medicament.
16. Use of a modified bacteriophage according to any one of claims 1 to 12, as a bacterial decontaminant
17. Use of a modified bacteriophage according to any one of claims 1 to 12, for the preparation of a medicament for inhibiting or preventing bacterial cell growth.
18. A process for the production of a modified bacteriophage capable of infecting a target bacterium, which process comprises growing a bacterial host comprising genetic material encoding the bacteriophage of any preceding claim in a growth medium; causing the bacteriophage to replicate in the bacterial host; and harvesting the bacteriophage.
PCT/EP2008/060360 2007-08-07 2008-08-06 Modified bacteriophage including an alpha/beta small acid-soluble spore protein (sasp) gene Ceased WO2009019293A1 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
AU2008285659A AU2008285659B2 (en) 2007-08-07 2008-08-06 Modified bacteriophage including an alpha/beta small acid-soluble spore protein (SASP) gene
JP2010519462A JP5582354B2 (en) 2007-08-07 2008-08-06 Modified bacteriophage
SI200830934T SI2179035T1 (en) 2007-08-07 2008-08-06 Modified bacteriophage including an alpha/beta small acid-soluble spore protein (sasp) gene
PL08786965T PL2179035T3 (en) 2007-08-07 2008-08-06 Modified bacteriophage including an alpha/beta small acid-soluble spore protein (sasp) gene
HRP20130250AT HRP20130250T1 (en) 2007-08-07 2008-08-06 Modified bacteriophage including an alpha/beta small acid-soluble spore protein (sasp) gene
US12/672,311 US8697049B2 (en) 2007-08-07 2008-08-06 Modified bacteriophage including an alpha/beta small acid-soluble spore protein (SASP) gene
ES08786965T ES2402176T3 (en) 2007-08-07 2008-08-06 Modified bacteriophage that includes a small acid-soluble spore protein (SASP) gene alpha / beta
EP08786965A EP2179035B8 (en) 2007-08-07 2008-08-06 Modified bacteriophage including an alpha/beta small acid-soluble spore protein (sasp) gene
DK08786965.7T DK2179035T3 (en) 2007-08-07 2008-08-06 MODIFIED BACTERIOPHAGIC INCLUDING AN ALFA / BETA-SASP (SMALL ACID-SOLUBLE SPORE PROTEIN) GENE
CA2695939A CA2695939C (en) 2007-08-07 2008-08-06 Modified bacteriophage
US14/190,727 US9359596B2 (en) 2007-08-07 2014-02-26 Modified bacteriophage including an alpha/beta small acid-soluble spore protein (SASP) gene
US15/147,483 US10106784B2 (en) 2007-08-07 2016-05-05 Modified bacteriophage
US16/128,558 US11559560B2 (en) 2007-08-07 2018-09-12 Modified bacteriophage

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB0715416.4 2007-08-07
GBGB0715416.4A GB0715416D0 (en) 2007-08-07 2007-08-07 Modified bacteriophage

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US12/672,311 A-371-Of-International US8697049B2 (en) 2007-08-07 2008-08-06 Modified bacteriophage including an alpha/beta small acid-soluble spore protein (SASP) gene
US14/190,727 Division US9359596B2 (en) 2007-08-07 2014-02-26 Modified bacteriophage including an alpha/beta small acid-soluble spore protein (SASP) gene

Publications (1)

Publication Number Publication Date
WO2009019293A1 true WO2009019293A1 (en) 2009-02-12

Family

ID=38543208

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2008/060360 Ceased WO2009019293A1 (en) 2007-08-07 2008-08-06 Modified bacteriophage including an alpha/beta small acid-soluble spore protein (sasp) gene

Country Status (13)

Country Link
US (4) US8697049B2 (en)
EP (1) EP2179035B8 (en)
JP (3) JP5582354B2 (en)
AU (1) AU2008285659B2 (en)
CA (1) CA2695939C (en)
DK (1) DK2179035T3 (en)
ES (1) ES2402176T3 (en)
GB (2) GB0715416D0 (en)
HR (1) HRP20130250T1 (en)
PL (1) PL2179035T3 (en)
PT (1) PT2179035E (en)
SI (1) SI2179035T1 (en)
WO (1) WO2009019293A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016055585A1 (en) 2014-10-08 2016-04-14 Phico Therapeutics Ltd Multiple host range bacteriophage with hybrid tail fibres
WO2016055584A1 (en) 2014-10-08 2016-04-14 Phico Therapeutics Ltd Multiple host range bacteriophage with different tail fibres
WO2016055586A1 (en) 2014-10-08 2016-04-14 Phico Therapeutics Ltd Modifying bacteriophage
WO2016055587A1 (en) * 2014-10-08 2016-04-14 Phico Therapeutics Ltd Modifying bacteriophage using beta-galactosidase as a selectable marker
GB2544956A (en) * 2015-07-08 2017-06-07 Phico Therapeutics Ltd Polypeptides, polynucleotides and uses thereof
WO2017174810A1 (en) * 2016-04-08 2017-10-12 Phico Therapeutics Ltd Modified bacteriophage
WO2017174809A1 (en) * 2016-04-08 2017-10-12 Phico Therapeutics Ltd Modifying bacteriophage
US20190322988A1 (en) * 2014-12-16 2019-10-24 C3J Therapeutics, Inc. Compositions of and methods for in vitro viral genome engineering

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0715416D0 (en) 2007-08-07 2007-09-19 Phico Therapeutics Ltd Modified bacteriophage
GB201600075D0 (en) 2016-01-03 2016-02-17 Glaxosmithkline Biolog Sa Immunogenci composition
US10736928B2 (en) 2016-01-20 2020-08-11 Richard Brian Murphy, JR. Pegylated recombinant bacteriophage
AU2019208460A1 (en) * 2018-01-19 2020-09-03 Cytophage Technologies Inc. Genetically engineered bacteriophage

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002040678A1 (en) * 2000-11-17 2002-05-23 Phico Therapeutics Ltd. Small acid-soluble spore protein and uses thereof
WO2004113375A2 (en) * 2003-06-20 2004-12-29 Phico Therapeutics Limited Antimicrobial compositions and uses thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102004061846A1 (en) * 2004-12-22 2006-07-13 Basf Ag Multiple promoters
EP2796544B1 (en) * 2005-09-09 2019-04-03 Duke University Tissue engineering methods and compositions
GB0715416D0 (en) * 2007-08-07 2007-09-19 Phico Therapeutics Ltd Modified bacteriophage

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002040678A1 (en) * 2000-11-17 2002-05-23 Phico Therapeutics Ltd. Small acid-soluble spore protein and uses thereof
WO2004113375A2 (en) * 2003-06-20 2004-12-29 Phico Therapeutics Limited Antimicrobial compositions and uses thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
A. BARNARD, K. PITTS, D. BROWN, A. WILKINSON, H. FAIRHEAD: "SASP: rapid bactericidal activity against USA strains of meticillin-resistant Staphylococcus aureus", CLINICAL MICROBIOLOGY AND INFECTION, vol. 14, no. s7, 7 April 2008 (2008-04-07), pages S131 - S132, XP002505321, ISSN: 1198-743X, Retrieved from the Internet <URL:http://dx.doi.org/10.1111/j.1469-0691.2008.02007.x> [retrieved on 20081124] *
HANLON ET AL: "Bacteriophages: an appraisal of their role in the treatment of bacterial infections", INTERNATIONAL JOURNAL OF ANTIMICROBIAL AGENTS, ELSEVIER SCIENCE, AMSTERDAM, NL, vol. 30, no. 2, 27 June 2007 (2007-06-27), pages 118 - 128, XP022132522, ISSN: 0924-8579 *
SETLOW J K ET AL: "MUTATION AND KILLING OF ESCHERICHIA COLI EXPRESSING A CLONED BACILLUS SUBTILIS GENE WHOSE PRODUCT ALTERS DNA CONFORMATION", JOURNAL OF BACTERIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 174, no. 9, 1 May 1992 (1992-05-01), pages 2943 - 2950, XP001002852, ISSN: 0021-9193 *

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11236306B2 (en) 2014-10-08 2022-02-01 Phico Therapeutics Ltd Multiple host range bacteriophage with different tail fibres
WO2016055584A1 (en) 2014-10-08 2016-04-14 Phico Therapeutics Ltd Multiple host range bacteriophage with different tail fibres
WO2016055586A1 (en) 2014-10-08 2016-04-14 Phico Therapeutics Ltd Modifying bacteriophage
WO2016055587A1 (en) * 2014-10-08 2016-04-14 Phico Therapeutics Ltd Modifying bacteriophage using beta-galactosidase as a selectable marker
WO2016055585A1 (en) 2014-10-08 2016-04-14 Phico Therapeutics Ltd Multiple host range bacteriophage with hybrid tail fibres
US11492601B2 (en) 2014-10-08 2022-11-08 Phico Therapeutics Ltd. Multiple host range bacteriophage with hybrid tail fibres
US10953052B2 (en) 2014-10-08 2021-03-23 Phico Therapeutics Ltd Modifying bacteriophage
US11913032B2 (en) 2014-12-16 2024-02-27 C3J Therapeutics, Inc. Compositions of and methods for in vitro viral genome engineering
US20190322988A1 (en) * 2014-12-16 2019-10-24 C3J Therapeutics, Inc. Compositions of and methods for in vitro viral genome engineering
US10711253B2 (en) 2014-12-16 2020-07-14 C3J Therapeutics, Inc. Compositions of and methods for in vitro viral genome engineering
US10837004B2 (en) 2014-12-16 2020-11-17 C3J Therapeutics, Inc. Compositions of and methods for in vitro viral genome engineering
GB2544956A (en) * 2015-07-08 2017-06-07 Phico Therapeutics Ltd Polypeptides, polynucleotides and uses thereof
WO2017174810A1 (en) * 2016-04-08 2017-10-12 Phico Therapeutics Ltd Modified bacteriophage
EP3901255A1 (en) 2016-04-08 2021-10-27 Phico Therapeutics Ltd Modified bacteriophage
US10781441B2 (en) 2016-04-08 2020-09-22 Phico Therapeutics Ltd Modifying bacteriophage
AU2017246593B2 (en) * 2016-04-08 2023-04-13 Phico Therapeutics Ltd Modified bacteriophage
AU2017246593A2 (en) * 2016-04-08 2023-04-13 Phico Therapeutics Ltd Modified bacteriophage
US11732243B2 (en) 2016-04-08 2023-08-22 Phico Therapeutics Ltd Anti-bacterial compositions comparing lytic modified bacteriophage engineered to infect and kill different target bacteria
AU2017246593C1 (en) * 2016-04-08 2023-12-21 Phico Therapeutics Ltd Modified bacteriophage
WO2017174809A1 (en) * 2016-04-08 2017-10-12 Phico Therapeutics Ltd Modifying bacteriophage

Also Published As

Publication number Publication date
EP2179035B1 (en) 2013-02-27
EP2179035B8 (en) 2013-04-03
ES2402176T3 (en) 2013-04-29
DK2179035T3 (en) 2013-04-08
PT2179035E (en) 2013-04-04
JP5582354B2 (en) 2014-09-03
GB2451750A (en) 2009-02-11
JP2016144444A (en) 2016-08-12
GB0715416D0 (en) 2007-09-19
JP2014221038A (en) 2014-11-27
HRP20130250T1 (en) 2013-04-30
US9359596B2 (en) 2016-06-07
CA2695939C (en) 2013-11-19
EP2179035A1 (en) 2010-04-28
GB2451750B (en) 2010-06-02
US20190071648A1 (en) 2019-03-07
US20160319244A1 (en) 2016-11-03
AU2008285659B2 (en) 2013-09-19
US8697049B2 (en) 2014-04-15
AU2008285659A1 (en) 2009-02-12
US11559560B2 (en) 2023-01-24
US20140242032A1 (en) 2014-08-28
CA2695939A1 (en) 2009-02-12
JP6177357B2 (en) 2017-08-09
JP2010535482A (en) 2010-11-25
SI2179035T1 (en) 2013-05-31
US10106784B2 (en) 2018-10-23
PL2179035T3 (en) 2013-08-30
GB0814385D0 (en) 2008-09-10
US20100239536A1 (en) 2010-09-23

Similar Documents

Publication Publication Date Title
US11559560B2 (en) Modified bacteriophage
JP7141756B2 (en) Multi-host range bacteriophages with different tail fibers
AU2015329957B2 (en) Multiple host range bacteriophage with different tail fibres
AU2017246593C1 (en) Modified bacteriophage
EP3201325A1 (en) Modifying bacteriophage using beta-galactosidase as a selectable marker
EP4702981A1 (en) Targeted antibacterial treatment
WO2025109112A1 (en) Engineered phagemids and methods for antibacterial peptide delivery against bacterial pathogens in particular clostridioides difficile
WO2026090372A1 (en) Development and production of a synthetic antibacterial drone
US20060270044A1 (en) Compositions and methods for altering cellular functions

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08786965

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2008786965

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2008285659

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2695939

Country of ref document: CA

Ref document number: 2010519462

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2008285659

Country of ref document: AU

Date of ref document: 20080806

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 12672311

Country of ref document: US