WO2009017692A2 - Vectors and methods for cloning gene clusters or portions thereof - Google Patents
Vectors and methods for cloning gene clusters or portions thereof Download PDFInfo
- Publication number
- WO2009017692A2 WO2009017692A2 PCT/US2008/009083 US2008009083W WO2009017692A2 WO 2009017692 A2 WO2009017692 A2 WO 2009017692A2 US 2008009083 W US2008009083 W US 2008009083W WO 2009017692 A2 WO2009017692 A2 WO 2009017692A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- vector
- dna
- cell
- gene cluster
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/76—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Actinomyces; for Streptomyces
Definitions
- the present invention relates to vectors and methods for cloning or transferring large nucleic acid fragments containing whole or portions of a gene cluster from one prokaryotic organism to another.
- the invention also relates to a plasmid rescue method for isolating chromosomal DNA adjacent to an inserted piece of DNA in various organisms.
- PKSs Polyketide synthases
- NRPSs nonribosomal peptide synthestases
- the genes that encode the multienzyme systems are usually grouped together on the chromosome and form distinct biosynthetic gene clusters. Depending on the final product, the gene clusters can be as large as 100kb in size (March, P. R., Tang, L., Yoon, Y.J., Ning, S., M ⁇ ller, R., Yu, T.W., Taylor, M., Hoffmann, D., Kim, C.G., Zhang, X., Hutchinso, C.R., and Floss, H. G. 1998. S699. Chem. Biol. 5:69-79.).
- a plasmid rescue method has been used to isolate the chromosomal DNA adjacent to an inserted piece of DNA in various organisms (Hamilton, B.A., Zinn, K. 1994. Methods Cell Biol. 44:81-94; Kiessling, U., Platzer, M., and Strauss, M. 1984. MoI Gen Genet. 193:512-519; Weinrauch, Y., and Dubnau, D. 1983. J Bact. 154:1077-1087; McMahon T.L, Wilczynska, Z., Barth, C, Fraser, B.D., Pontes, L., and Fisher P.R. 1996. Nucleic Acids,
- the invention provides a shuttle BAC vector for direct cloning of gene clusters ranging in size from about 20 kb to about 100 kb.
- the vector is used for the transfer and integration of cloned DNA from a prokaryotic organism into a strain of Actinomycetes. Integration of the cloned DNA occurs at the ⁇ BT1 attB site of the recipient chromosome.
- the invention also provides a plasmid (BAC) rescue method that can be used for cloning large DNA fragments directly from the designated Actinomycetes strain without the need for generation and screening of cosmid or BAC libraries. These large DNA fragments may contain intact gene clusters or a major portion of a gene cluster.
- the invention provides a vector for cloning or transfer of a large DNA fragment comprising a whole, or a portion of a gene cluster, from one prokaryotic organism to a species of Actinomycetes, comprising at least two origins of replication, a prokaryotic F factor partitioning system, an origin of transfer, a site-specific recombination system that allows for the integration of the vector into the recipient cell and a selection marker.
- the invention provides a vector for cloning or transfer of a large DNA fragment comprising a whole, or a portion of a gene cluster, from one prokaryotic organism to a species of Actinomycetes, comprising at least two origins of replication, a prokaryotic F factor partitioning system, an origin of transfer, a ⁇ BT1 attP-int recombination system and a selection marker.
- the invention provides a vector as described herein that further comprises a whole or a portion of a gene cluster.
- the prokaryotic organism from which the vectors of the present invention are transferred is E.coli.
- the prokaryotic organism may be the same or a different strain of actinomycetes, or any other prokaryotic organism known to those skilled in the art for transfer of genetic material from one organism to another.
- the donor of the genetic material may be a prokaryotic or eukaryotic organism.
- the vector of the present invention is a Bacterial Artificial Chromosome (BAC) vector.
- the BAC vector is a shuttle BAC vector.
- the shuttle BAC vector is an E. coli-Actinomycetes conjugative vector, pSBAC (SEQ ID NO: 1).
- At least two origins of replication of a vector of the invention are E coli origins of replication.
- the two E. coli origins of replication are ori 2 and ori V.
- at least one of the origins of replication is selected from ori 2 and ori V.
- at least one of the origins of replication comprises the nucleotide sequence as set forth in SEQ ID NO: 2 or SEQ ID NO: 3.
- the ori 2 nucleic acid sequence is set forth in SEQ ID NO: 2.
- the ori V nucleic acid sequence is set forth in SEQ ID NO: 3.
- the prokaryotic F factor partitioning system of the vectors of the present invention is an E. coli F factor partitioning system.
- the E. coli F factor partitioning system nucleic acid sequence comprises the nucleotide sequence as set forth in SEQ ID NO: 4.
- the origin of transfer of the vectors of the present invention is oriT. In one embodiment, the origin of transfer comprises the nucleotide sequence as set forth in SEQ ID NO: 5.
- the shuttle BAC vector comprises the nucleotide sequence of SEQ ID NO: 1.
- a vector of the present invention provides for cloning or transfer of a large DNA fragment comprising a whole, or a portion of a gene cluster that encodes one or more gene product(s) that are part of a specific biosynthetic pathway for secondary metabolites.
- the gene product(s) is selected from a polyketide and a non-ribosomal polypeptide (NRP).
- the polyketide is selected from the group consisting of an antibiotic, an immunosuppressant, an anti-cancer agent, an antifungal agent and a cholesterol lowering agent.
- the polyketide of the invention is a macrolide antibiotic or a tetracycline antibiotic.
- the macrolide antibiotic is selected from the group consisting of azithromycin, clarithromycin, dirithromycin, erythromycin and troleandomycin.
- the tetracycline is selected from the group consisting of chlortetracycline, oxytetracycline, and demeclocycline.
- the polyketide of the invention is an immunosuppressant selected from the group consisting of rapamycin, ascomycin (FK520) and tacrolimus (FK-506).
- the polyketide of the invention is the anti-cancer agent doxorubicin.
- the polyketide of the invention is the anti-fungal agent amphotericin B.
- the polyketide of the invention is the cholesterol lowering agent lovastatin.
- the non-ribosomal polypeptide (NRP) of the invention is an immunosuppressant or an antibiotic.
- the non-ribosomal polypeptide (NRP) of the invention is the immunosuppressant cyclosporine A.
- the non-ribosomal polypeptide (NRP) of the invention is the antibiotic penicillin.
- a vector of the present invention provides for cloning or transfer of a large DNA fragment comprising a whole, or a portion of a gene cluster that encodes the proteins that are involved in the biosynthesis of actinorhodin or meridamycin.
- a vector of the present invention provides for cloning or transfer of a large DNA fragment comprising a whole, or a portion of a gene cluster that encodes the proteins that are involved in the biosynthesis of meridamycin, wherein the gene cluster is the mer gene cluster, which comprises the nucleic acid sequence of SEQ ID NO: 31.
- a third aspect of the invention provides a plasmid rescue method for isolating or cloning a large DNA fragment, wherein the large DNA fragment ranges in size from about 20 kb to about 100 kb, the method comprising transferring any of the vectors of the present invention to a recipient Actinomycetes cell, which contains a nucleic acid having a site specific integration sequence that allows for the integration of the vector, selecting for the recipient Actinomycetes cell that contains the vector incorporated into the Actinomycetes chromosome, isolating the DNA from the chromosome of the recipient Actinomycetes cell, transferring the DNA into an E. coli cell, screening for an E. coli cell that contains any of the vectors and isolating the large DNA fragment from the E. coli cell.
- a fourth aspect of the invention provides a plasmid rescue method for isolating or cloning a large DNA fragment, wherein the large DNA fragment ranges in size from about 20 kb to about 100 kb, the method comprising transferring any of the vectors of the present invention to a recipient Actinomycetes cell, which contains a homologous sequence that allows for the integration of the vector, selecting for the recipient Actinomycetes cell that contains the vector incorporated into the Actinomycetes chromosome, isolating the DNA from the chromosome of the recipient Actinomycetes cell, transferring the isolated DNA from the previous step into an E. coli cell, screening for an E. coli cell that contains any of the vectors of the invention and isolating the large DNA fragment from the E. coli cell.
- the plasmid rescue method(s) of the invention provide for isolating or cloning a large DNA fragment, wherein the large DNA fragment is a whole or a portion of a gene cluster.
- the gene cluster encodes the proteins that are involved in the biosynthesis of actinorhodin or meridamycin.
- the plasmid rescue method of the invention provides a site specific integration sequence in the recipient cell, which is an att site.
- the att site in the recipient cell is an attB site comprising the nucleotide sequence of SEQ ID NO: 6.
- the plasmid rescue method of the invention provides a selecting step, which comprises selecting for a biological or enzymatic activity that is transferred to the recipient cell by the vector. In one embodiment, the plasmid rescue method of the invention provides that the transferring of the vector comprises conjugating the donor cell containing the vector with a recipient Actinomycetes cell.
- a fifth aspect of the invention provides a method of producing meridamycin comprising expressing the amino acids encoded by the mer gene cluster of SEQ ID NO: 31.
- the mer gene cluster is incorporated into the pSBAC vector of SEQ ID NO: 1.
- FIG. 5 (A) Cloning of the whole mer gene cluster into pSBAC vector. Schematic representation of the mer gene cluster is shown. The arrow represents the translational start codon site for MerP gene. The solid line represents the probe used for library screening, and the hatched line represents the probe used for Southern hybridization (B) Southern analysis confirmed the introduction of the mer gene cluster into the heterologous hosts.
- Figure 6. Semi-quantitative RT-PCR analysis of the transcription of mer gene cluster in various strains.
- Figure. 7 LC/MS analysis of fermentation extracts of S. lividans K4-114, HL30-K3, E7, original meridamycin producer NRRL 30748 and the meridamycin and 3- Normerdiamycin standard.
- the term “about” means within 20%, preferably within 10%, and more preferably within 5%. In one embodiment of the present invention, the term “about” refers to the size of the gene clusters as described in the present invention, which range from 20 kb to 100 kb. In one embodiment, the term “about” refers to the actual sizes or ranges as described herein.
- Actinomycetes are non-motile, filamentous, gram positive bacteria. As Actinomycetes grow, they form branching filaments of cells which become a network of strands called a mycelium, similar in appearance to the mycelium of some fungi. Actinomycetes are also unique in the way they form spores and in the production of numerous antibiotics. By far the most successful genus in this group is Streptomyces with over 500 species. The Streptomycetes are members of the bacterial order Actinomycetales, bacteria that resemble fungi in their branching filamentous structure. However, they are true bacteria - prokaryotic cells - unlike eukaryotic fungal cells. Streptomyces species refers to a terrestrial actinomycete, which produces macrolide antibiotic complexes.
- Actinorhodin refers to a blue-pigmented aromatic polyketide antibiotic from Streptomyces coelicolor, whose basic carbon skeleton is derived from type Il polyketide synthase (PKS). (A. Zeeck and P. Christiansen. Liebigs Ann. Chem. 724 (1969), pp. 172- 182).
- An "antibiotic biosynthetic pathway” includes the entire set of antibiotic biosynthetic genes necessary for the process of converting primary metabolites into antibiotics. These genes can be isolated by methods well known to the art, e.g., see U.S. Pat. No. 4,935,340.
- An "att" site refers to a site having nucleic acid identity or similarity that facilitates site-specific recombination between two nucleic acid molecules. For example, one att site described in the present invention is the integration site for ⁇ BT1 bacteriophage (Gregory, MA, et al., 2003, J. Bacteriol. 185, No. 17: 5320-5323).
- the "attB” site refers to the attachment site on the bacterial cell chromosome
- the "attP” site refers to the attachment site on the bacteriophage.
- the nucleic acid sequence for the attP site in the bacteriophage for the ⁇ BT1 system is shown in SEQ ID NO: 7
- the nucleic acid sequence for the attB site in the bacterial cell (Actinomycetes) for the ⁇ BT1 system is shown in SEQ ID NO: 6.
- Another example of an "att” site is the ⁇ C31 att site described by Bierman et al. (Bierman, M., R. Logan, K. O'Brien, E. T. Seno, R. N. Rao, and B. E.
- BAC Bacterial Artificial Chromosome
- the large DNA fragment may range in size from about 20 kb to about 400 kb. In one embodiment, the large DNA fragment may range in size from about 20 kb to about 300 kb. In one embodiment, the large DNA fragment comprises a whole or a portion of a gene cluster ranging in size from about 20 kb to about 100 kb.
- the large DNA fragment BACs are based on the single-copy F-plasmid of E.
- BAC Bacterial Artificial Chromosome
- the term "Recombinant Bacterial Artificial Chromosome” refers to a BAC vector containing a large DNA insert, ranging in size from about 20 kb up to about 400 kb in size.
- the large DNA insert comprises a whole or a portion of a gene cluster of about 20 kb to about 100 kb, encoding one or more gene product(s) that are part of a specific biosynthetic metabolic pathway.
- biosynthetic pathway for secondary metabolites refers to a biosynthetic network composed of genes from bacteria, humans, and various plants for synthesizing secondary metabolites for pharmaceutical use.
- the pathway generally involves a series of naturally occurring enzyme controlled reactions whereby one substance is converted to another, resulting in the release of secondary metabolites or by-products.
- a "coding sequence” or a sequence “encoding” an expression product, such as a RNA, polypeptide, protein, or enzyme is a nucleotide sequence that, when expressed, results in the production of that RNA, polypeptide, protein, or enzyme, i.e., the nucleotide sequence encodes an amino acid sequence for that polypeptide, protein or enzyme.
- a coding sequence for a protein may include a start codon (usually ATG) and a stop codon.
- conjugation refers to the direct transfer of nucleic acid from one prokaryotic cell to another via direct contact of cells.
- a “conjugative vector”, for example, pSBAC
- pSBAC is a vector that contains a nucleic acid of interest, whereby such nucleic acid is directly transferred (ie. the passing of a nucleic acid sequence from one cell to another without isolation of the sequence) from one cell to another via direct contact between the cell containing the vector and a recipient cell to which the nucleic acid is transferred following direct contact of the two cells.
- conjuggative transfer refers to the temporary union of two bacterial cells during which one cell transfers part or all of its genetic material to the other.
- derivative refers to a chemically synthesized organic molecule that is functionally equivalent to the active parent compound, but may be structurally different. It may also refer to chemically similar compounds, which have been chemically altered to increase bioavailability, absorption, or to decrease toxicity.
- a derivative is a compound that is formed from a similar compound or a compound that can be expected to arise from another compound, if one atom is replaced with another atom or group of atoms, or a compound that may be formed from a precursor compound.
- express and expression mean allowing or causing the information in a gene or DNA sequence to become manifest, for example producing a protein by activating the cellular functions involved in transcription and translation of a corresponding gene or DNA sequence.
- a DNA sequence is expressed in or by a cell to form an "expression product” such as a protein.
- the expression product itself e.g. the resulting protein, may also be said to be “expressed” by the cell.
- An expression product can be characterized as intracellular, extracellular or secreted.
- intracellular means something that is inside a cell.
- extracellular means something that is outside a cell.
- a substance is "secreted” by a cell if it appears in significant measure outside the cell, from somewhere on or inside the cell.
- expression control sequence refers to a promoter and any enhancer or suppression elements that combine to regulate the transcription of a coding sequence.
- the element is an origin of replication.
- F factor or "prokaryotic F factor” refers to a fertility factor found in prokaryotes. It is a small piece of episomal DNA that enables bacteria to mediate conjugation with other bacteria. In its extrachromosomal state the factor has a molecular weight of approximately 62 kb and encodes at least 20 transfer genes, an origin of replication as well as other genes for incompatibility and replication.
- the F factor can exist in three different states: "F + " refers to a factor in an autonomous, extrachromosomal state containing only the genetic information described above.
- the "Hfr" (which refers to "high frequency recombination”) state describes the situation when the factor has integrated itself into the chromosome presumably due to its various insertion sequences.
- the "F” 1 or (F prime) state refers to the factor when it exists as an extrachromosomal element, but with the additional requirement that it contain some section of chromosomal DNA covalently attached to it.
- a strain containing no F factor is said to be “F ".
- the F factor “partitioning system” refers to the system that ensures both daughter cells inherit a copy of the parental plasmid.
- “Fragment” refers to either a protein or polypeptide comprising an amino acid sequence of at least 4 amino acid residues (preferably, at least 10 amino acid residues, at least 15 amino acid residues, at least 20 amino acid residues, at least 25 amino acid residues, at least 40 amino acid residues, at least 50 amino acid residues, at least 60 amino residues, at least 70 amino acid residues, at least 80 amino acid residues, at least 90 amino acid residues, at least 100 amino acid residues, at least 125 amino acid residues, or at least 150 amino acid residues) of the amino acid sequence of a parent protein or polypeptide, or a nucleic acid comprising a nucleotide sequence of at least 10 base pairs (preferably at least 20 base pairs, at least 30 base pairs, at least 40 base pairs, at least 50 base pairs, at least 50 base pairs, at least 100 base pairs, at least 200 base pairs) of the nucleotide sequence of the parent nucleic acid. Any given fragment may or may not possess a functional activity of the parent nucleic
- gene means a DNA sequence that codes for or corresponds to a particular sequence of amino acids which comprise all or part of one or more proteins or enzymes, and may or may not include regulatory DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed. Some genes, which are not structural genes, may be transcribed from DNA to RNA, but are not translated into an amino acid sequence. Other genes may function as regulators of structural genes or as regulators of DNA transcription.
- gene cluster refers to any group of two or more closely linked genes that encode for the same or similar products.
- the gene clusters encode the multimodular meganzymes (multienzyme systems) responsible for the synthesis of secondary metabolites, as defined herein.
- the polyketide synthases (PKSs) and the non-ribosomal peptide synthetases (NRPSs) are both multimodular meganzymes responsible for synthesis of the corresponding chemicals (See Staunton J. et al. Nat Prod Rep.(2001) Aug;18(4):380-416; Finking, R. et al. Annu Rev Microbiol. 2004;58:453-88).
- the genes that encode these multienzyme systems are usually grouped together on the chromosome and form distinct biosynthetic gene clusters.
- Gene Product refers to a product produced by a gene when that gene is expressed.
- the phrase refers to a nucleic acid, a protein or a polypeptide.
- the phrase refers to an enzyme such as a polyketide synthase, or any enzyme that plays a role in the synthesis of a non-ribosomal polypeptide, or it may refer to the actual polyketide or non-ribosomal polypeptide as well. Examples of this may be found in U.S. patent publications 20050272133, or 20030134398 and 20030124689. Further examples may be found in U.S. patent number 6,495,348.
- heterologous refers to a combination of elements not naturally occurring.
- heterologous DNA refers to DNA not naturally located in the cell, or in a chromosomal site of the cell.
- the heterologous DNA may include a gene foreign to the cell.
- a heterologous expression regulatory element is an element operatively associated with a different gene than the one it is operatively associated within nature.
- Homologous recombination is a type of genetic recombination , a process of physical rearrangement occurring between two different strands of DNA molecules. Homologous recombination involves the alignment of identical or similar sequences, a crossover between the aligned homologous DNA strands of the two molecules, and breaking and repair of the DNA to produce an exchange of material between the strands. Homologous recombination is distinguished from other types of recombination. For example, "site specific recombination", as exemplified by invertible elements, resolvases, and some phage integration events are examples of non-homologous recombination.
- a nucleic acid molecule is "hybridizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see Sambrook et a/., supra). The conditions of temperature and ionic strength determine the "stringency" of the hybridization.
- low stringency hybridization conditions corresponding to a T m (melting temperature) of 55 0 C
- T m melting temperature
- Moderate stringency hybridization conditions correspond to a higher T m , e.g., 40% formamide, with 5x or 6x SCC, 5X Denhardt's.
- High stringency hybridization conditions correspond to the highest T n , , e.g., 50% formamide, 5x or 6x SCC, 5X Denhardt's.
- SCC is a 0.15M NaC1 , 0.015M Na-citrate buffer.
- 5X Denhardt's is 0.1% ficoll, 0.1% polyvinylpyrrolidone, 0.1 %g BSA (w/v).
- Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible.
- the appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of T m for hybrids of nucleic acids having those sequences.
- RNA RNA, DNA:RNA, DNA:DNA The relative stability (corresponding to higher T m ) of nucleic acid hybridizations decreases in the following order: RNA RNA, DNA:RNA, DNA:DNA.
- equations for calculating T m have been derived (see Sambrook et al., supra, 9.50- 9.51).
- the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., supra, 11.7-11.8).
- a minimum length for a hybridizable nucleic acid is at least about 10 nucleotides; preferably at least about 15 nucleotides; and more preferably the length is at least about 20 nucleotides.
- integration site refers to the site of insertion of a nucleic acid into the genome of a recipient cell.
- the site of integration may be random, or it may occur via a site- directed mechanism, known to those skilled in the art.
- conservative site-specific recombination for example, a mobile DNA element is inserted into a strand of DNA by means similar to that seen in crossover. A segment of DNA on the mobile element matches exactly with a segment of DNA on the target, allowing enzymes called integrases to insert the rest of the mobile element into the target. Integrases are a special type of recombinase enzyme.
- Recombinases are enzymes which cleave the double stranded DNA at specific sites resulting in a loss of the phosphodiester bonds. This reaction is stabilized by the formation of a covalent bond between the recombinase and the DNA through a phospho tyrosine bond.
- Another form of site-specific recombination, transpositional recombination does not require an identical strand of DNA in the mobile element to match with the target DNA. Instead, the integrases involved introduce nicks in both the mobile element and the target DNA, allowing the mobile DNA to enter the sequence. The nicks are then removed by a ligase. Recombination between DNA sequences that contain no sequence homology, is also referred to as non-homologous end joining.
- the word “isolating” refers to the removal of a material of interest from its original environment (e.g., a natural environment if it is naturally occurring, or from an environment into which it has been placed).
- an "isolated" peptide or protein is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized.
- the plasmid rescue method provides for a means of "isolating” or recovering a gene cluster that lies adjacent to the integration site, such that it is free of any other contaminating genetic or cellular material.
- the term "large DNA fragment” refers to a piece of DNA that has an approximate size ranging from about 20 kilobases to about 400 kilobases. In one embodiment, the "large DNA fragment” may range from about 20 kb to about 300kb. In one embodiment, the “large DNA fragment” may range from about 20 kb to about 200 kb. In one embodiment, the “large DNA fragment” may range from about 20 kb to about 100 kb. In one embodiment, the "large DNA fragment” may comprise a whole or a portion of a gene cluster.
- Meridamycin is a macrolide polyketide that has been shown to have strong FKBP12 binding activity and significant neuroprotective activity in vitro, having the structure (I):
- Meridamycin functions as an immunophilin ligand which binds to FK-binding proteins.
- a "natural product” is a chemical compound or substance produced by a living organism, which is found in nature and which usually has a pharmacological or biological activity for use in pharmaceutical drug discovery and design.
- a natural product can be considered as such even if it can be prepared by total synthesis. Not all natural products can be fully synthesized and many natural products have very complex structures, some of which are too difficult and expensive to synthesize on an industrial scale. Such compounds can only be harvested from their natural source. Furthermore, the number of structural analogues that can be obtained from harvesting is severely limited. Semisynthetic procedures are sometimes used to get around these problems. This often involves harvesting a biosynthetic intermediate from the natural source, rather than the final (lead) compound itself.
- the intermediate could then be converted to the final product by conventional synthesis.
- This approach can have two advantages. First, the intermediate may be more easily extracted in higher yield than the final product itself. Second, it may allow the possibility of synthesizing analogues of the final product.
- the semisynthetic penicillins are an illustration of this approach. Another example is that of paclitaxel. It is manufactured by extracting 10-deacetylbaccatin III from the needles of the yew tree, then carrying out a four- stage synthesis.
- non-ribosomal polypeptides refers to polypeptides that are synthesized using a modular enzyme complex, which functions much like a conveyor belt. Nonribosomal peptides are confined primarily to unicellular organisms, plants and fungi. All of these complexes are laid out in a similar fashion, and they can contain many different modules to perform a diverse set of chemical manipulations on the developing product. In general, these peptides are cyclic (often with highly-complex cyclic structures), although linear nonribosomal peptides are common. Since the system is modular and closely related to the machinery for building fatty acids and polyketides, hybrid compounds are often found.
- Oxazoles, thiazoles and their reduced counterparts often indicate that the compound was synthesized in this fashion.
- Other examples of non-ribosomal polypeptides include: vancomycin, thiostrepton, ramoplanin, teicoplanin, gramicidin, and bacitracin.
- Polyketides are secondary metabolites from bacteria, fungi, plants and animals. Secondary metabolites seem to be unnecessary for an organism's ontogeny, but appear to have applications such as defense and intercellular communication. Polyketides represent a large group of natural products that are derived from successive condensations of simple carboxylates, such as acetate, propionate or butyrate. They also serve as building blocks for a broad range of natural products or are derivatized. Polyketides are structurally a very diverse family of natural products with an extremely broad range of biological activities and pharmacological properties.
- Polyketide antibiotics antifungals, cytostatics, anticholesterolemics, antiparasitics, coccidiostatics, animal growth promotants and natural insecticides are in commercial use. Examples include: Macrolides, such as picromycin, erythromycin A, clarithromycin, and azithromycin. Also included are the immunosuppressants tacrolimus (FK506) and rapamycin, and the polyene antibiotics, e.g. amphotericin. Also included are the tetracycline family of antibiotics. The anti-cancer compounds, daunomycin, bryostatin and discodermolide, are also polyketides. The veterinary compounds monensin and avermectin are also polyketides. Also Included are actinorhodin and meridamycin. Polyketides are synthesized by one or more specialized polyketide synthase (PKS) enzymes (See U.S. Patent Publication 20070148717).
- PES polyketide syntha
- nucleic acid molecule refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA- DNA, DNA-RNA and RNA-RNA helices are possible.
- nucleic acid molecule refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms.
- this term includes double-stranded DNA found, inter alia, in linear (e.g., restriction fragments) or circular DNA molecules, plasmids, and chromosomes.
- sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).
- a "recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
- nucleotide refers to a subunit of DNA or RNA consisting of nitrogenous bases (adenine, guanine, cytosine and thymine), a phosphate molecule, and a sugar molecule (deoxyribose in DNA and ribose in RNA).
- a vector in a host cell may contain one or more "origins of replication” sites (often termed “ori"), which is a specific nucleic acid sequence at which replication is initiated.
- ori is a specific nucleic acid sequence at which replication is initiated.
- the term "origin of replication” or "ori”, as used herein refers to a nucleic acid sequence that initiates nucleic acid replication.
- the two strands of DNA are pulled apart to form a replication bubble. This creates a region of single stranded DNA on each side of the bubble.
- the DNA polymerase machinery can then move in and begin to synthesize the new strands of DNA, using the old strands as templates.
- a replication "fork” moves along the DNA in either direction from the origin, synthesizing new DNA.
- Ori 2 refers to an "origin of replication" from an E. coli plasmid that allows for single- copy replication. (Shizuya, H., Birren, B., Kim, U.-J., Mancino, v., Slepak, Tl, Tachiiri, Y., and Simon, M. 1992. Proc. Natl. Aca. Sci. 890:8794-8797).
- Ori V refers to an "origin of replication” from an E. coli plasmid that allows for high- copy replication. (Perri, S. and Helinski, D. R. 1993. DNA sequence requirements for interaction of the RK2 replication initiation protein with plasmid origin repeats. J. Biol. Chem. 268:3662-2669).
- Ori T refers to an "origin of transfer” that permits the transfer of the vector from one bacterial cell to another.
- the "origin of transfer” represents the site on the vector where the transfer process is initiated. It is also defined genetically as the region required in cis to the DNA that is to be transferred. Conjugation-specific DNA replication is initiated within the oriT region which also encodes plasmid transfer factors.
- ⁇ BT1 attP-int recombination system refers to a site-specific recombination system that permits site-specific integration of the vector into the attB site of the recipient cell's chromosome. (Gregory, M.A., Till, R., and Smith, M. CM. 2003. J Bacteriol. 185:5320-5323; GenBank Accession Number AJ550940)
- a "polynucleotide” or “nucleotide sequence” is a series of nucleotide bases in a nucleic acid, such as DNA and RNA, and means any chain of two or more nucleotides.
- a nucleotide sequence typically carries genetic information, including the information used by cellular machinery to make proteins and enzymes. These terms include double or single stranded genomic and cDNA, RNA, any synthetic and genetically manipulated polynucleotide, and both sense and anti-sense polynucleotide (although only sense stands are being represented herein).
- PNA protein nucleic acids
- the nucleic acids herein may be flanked by natural regulatory (expression control) sequences, or may be associated with heterologous sequences, including promoters, internal ribosome entry sites (IRES) and other ribosome binding site sequences, enhancers, response elements, suppressors, signal sequences, polyadenylation sequences, introns, 5'- and 3'- non-coding regions, and the like.
- the nucleic acids may also be modified by many means known in the art.
- Non-limiting examples of such modifications include methylation, "caps”, substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).
- uncharged linkages e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.
- charged linkages e.g., phosphorothioates, phosphorodithioates, etc.
- Polynucleotides may contain one or more additional covalently linked moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators (e.g., acridine, psoralen, etc.), chelators (e.g., metals, radioactive metals, iron, oxidative metals, etc.), and alkylators.
- the polynucleotides may be derivatized by formation of a methyl or ethyl phosphotriester or an alkyl phosphoramidate linkage.
- the polynucleotides herein may also be modified with a label capable of providing a detectable signal, either directly or indirectly. Exemplary labels include radioisotopes, fluorescent molecules, biotin, and the like.
- a “promoter” or “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3 1 direction) coding sequence.
- the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
- a transcription initiation site (conveniently defined for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
- the promoter may be operatively associated with other expression control sequences, including enhancer and repressor sequences.
- Prokaryotic F factor partitioning system refers to an active positioning process that ensures proper segregation and faithful distribuition of daughter F factors at cell division.
- This partitioning system contains three functionally distinct regions: two of them (sopA and sopB) encode gene products that act in trans, whereas the third region (sopC) functions in cis. All regions are essential in plasmid partitioning during cell division. (Ogura T., Hiraga S. 1983. Cell.32:351 -60).
- the term "recipient cell” refers to a cell that is selected for receipt of the vector of interest, as described herein.
- the "recipient cell” may also be referred to as a "host cell".
- a recipient cell provides for Actinomycetes as being a recipient cell.
- the invention provides for a genus of Actinomycetes, in particular, a species of Streptomycetes, as being the recipient cell.
- E. coli may be the recipient cell.
- a recipient cell may be one that is manipulated to express a particular gene, a DNA or RNA sequence, or a protein. Recipient cells can further be used for screening.
- Recipient cells may be cultured in vitro or one or more cells may be transferred to a non-human animal (e.g., a transgenic animal or a transiently transfected animal).
- the recipient cell may be selected from any biological organism, including prokaryotic (e.g., bacterial) cells, plant cells, and eukaryotic cells, including, insect cells, yeast cells and mammalian cells.
- prokaryotic e.g., bacterial
- plant cells eukaryotic cells
- eukaryotic cells including, insect cells, yeast cells and mammalian cells.
- Other representative examples of appropriate recipient cells include any other bacterial cell; fungal cells, such as yeast cells and Aspergillus cells; and insect cells such as Drosophila S2 and Spodoptera Sf9 cells.
- Secondary metabolites are organic compounds that are not directly involved in the normal growth, development, or reproduction of organisms. Unlike primary metabolites, absence of secondary metabolites only results in mild impairment for the organisms such as: lowered survivability/fecundity, aesthetic differences, or else no change in phenotype at all. Secondary metabolites are often restricted to a narrow set of species within a phylogenetic group. The function or importance of these compounds to the organism is usually of an ecological nature as they are used as defenses against predators, parasites and diseases, for interspecies competition, and to facilitate the reproductive processes (coloring agents, attractive smells, etc).
- Alkaloids such as hyoscyamine, atropine, cocaine, codeine, morphine, tetrodotoxin
- Terpenoids such as azadirachtin, artemisin, tetrahydrocannabinol
- Steroids such as terpenes, Saponins
- Glycosides such as Nojirimycin and glucosinolates
- Phenols such as Resveratrol
- Phenazines such as pyocyanin and phenazine-1-carboxylic acid (and derivatives).
- the term "selecting” refers to the identification and isolation of a recipient cell that contains the vector of interest.
- Transformed microorganisms that is, those containing recombinant molecules, may be selected with a variety of positive and/or negative selection methods or markers.
- the positive selection marker is a gene that allows growth in the absence of an essential nutrient, such as an amino acid. For example, in the absence of thymine and thymidine, cells expressing the thyA gene survive, while cells not expressing this gene do not.
- an essential nutrient such as an amino acid
- detectable markers are also suitable for use in the present invention, and may be positively and negatively selected and/or screened using technologies such as fluorescence activated cell sorting (FACS) or microfluidics.
- FACS fluorescence activated cell sorting
- detectable markers include various enzymes, prosthetic groups, fluorescent markers, luminescent markers, bioluminescent markers, and the like.
- fluorescent proteins include, but are not limited to, yellow fluorescent protein (YFP), green fluorescence protein (GFP), cyan fluorescence protein (CFP), umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichiorotriazinylamine fluorescein, dansyl chloride, phycoerythrin and the like.
- suitable bioluminescent markers include, but are not limited to, luciferase (e.g., bacterial, firefly, click beetle and the like), luciferin, aequorin and the like.
- the positive selection marker is a gene that confers resistance to a compound, which would be lethal to the cell in the absence of the gene.
- a cell expressing an antibiotic resistance gene would survive in the presence of an antibiotic, while a cell lacking the gene would not.
- the presence of a tetracycline resistance gene could be positively selected for in the presence of tetracycline, and negatively selected against in the presence of fusaric acid.
- Suitable antibiotic resistance genes include, but are not limited to, genes such as ampicillin-resistance gene, neomycin-resistance gene, blasticidin-resistance gene, hygromycin-resistance gene, puromycin-resistance gene, chloramphenicol-resistance gene, apramycin-resistance gene and the like.
- the negative selection marker is a gene that is lethal to the target cell in the presence of a particular substrate.
- the thyA gene is lethal in the presence of trimethoprim. Accordingly, cells that grow in the presence trimethoprim do not express the thyA gene.
- Negative selection markers include, but are not limited to, genes such as thyA, sacB, gnd, gapC, zwJ, talA, taiB, ppc, gdhA, pgi, Jbp, pykA, cit, acs, edd, icdA, groEL, secA and the like.
- selecting for a biological or enzymatic activity refers to identifying and selecting the recipient cell, for example, the actinomycetes cell that contains the transferred vector by measuring for either the biological activity associated with the gene product that is transferred to the recipient cell by the vector, for example, an enzyme encoded by a gene cluster, such as, but not limited to, a polyketide synthase, or alternatively, measuring the activity of the enzyme itself. It may also refer to the biological activity of the final product, which may be a polyketide or a non-ribosomal polypeptide.
- selection marker refers to the use of, or the inclusion of, a drug as a marker to aid in the cloning and identification of transformants, for example, genes that confer resistance to Apramycin, neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers. Accordingly, cells containing a nucleic acid construct of the present invention may be identified in vitro or in vivo by including a marker in the vector. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the vector. Generally, a selectable marker is one that confers a property that allows for selection.
- a positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection.
- An example of a positive selectable marker is a drug resistance marker.
- other types of markers including screenable markers such as GFP, whose basis is colorimetric analysis, are also contemplated.
- screenable enzymes such as herpes simplex virus thymidine kinase ("tk”) or chloramphenicol acetyltransferase (“CAT”) may be utilized.
- tk herpes simplex virus thymidine kinase
- CAT chloramphenicol acetyltransferase
- One of skill in the art would also know how to employ immunologic markers, possibly in conjunction with FACS analysis. The marker used is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable and screenable markers are well known to one of skill in the
- sequence similarity refers to the degree of identity or correspondence between nucleic acid or amino acid sequences of proteins that may or may not share a common evolutionary origin.
- a “shuttle vector” refers generally to a plasmid that is capable of replicating in two different organisms, such as, for example, yeast and E. coli.
- the shuttle vector allows for transfer of large DNA fragments, including whole or portions of gene clusters, between E. coli and Actinomycetes.
- the shuttle vector of the present invention is a "shuttle Bacterial Artificial Chromosome (BAC) vector", which is a vector that allows for transfer of large fragments of DNA, from about 20 kb to about 400 kb, and which is capable of replicating in two different organisms.
- BAC Bacterial Artificial Chromosome
- a "site specific integration sequence” refers to a nucleic acid sequence in a donor or recipient nucleic acid molecule that facilitates recombination between the two nucleic acid molecules and integration of the donor nucleic acid molecule into the recipient nucleic acid molecule.
- Site-specific recombination or “site-specific recombination system” refers to a recombination process between two DNA molecules that occurs at unique sites of each molecule which are generally 20-30 bases long, called attachment (att) sites.
- a specialyzed enzyme, the "integrase” recognizes the two att sites, joins the two DNA molecules and catalyzes a DNA double-strand breakage and rejoining event that results in the integration of one of the DNA molecules into the other DNA of the recipient cell.
- standard hybridization conditions refers to a T m of 55°C, and utilizes conditions as set forth above.
- substantially free of cellular material includes preparations of a polypeptide/protein in which the polypeptide/protein is separated from cellular components of the cells from which it is isolated or recombinantly produced.
- a polypeptide/protein that is substantially free of cellular material includes preparations of the polypeptide/protein having less than about 30%, 20%, 10%, 5%, 2.5%, or 1%, (by dry weight) of contaminating protein.
- the polypeptide/protein is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation.
- polypeptide/protein When polypeptide/protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly, such preparations of the polypeptide/protein have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than polypeptide/protein fragment of interest.
- An "isolated" or “purified” nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule.
- an "isolated" nucleic acid molecule such as a cDNA molecule or an RNA molecule, or a gene cluster can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
- two DNA sequences are "substantially homologous" or “substantially similar” when at least about 80%, and most preferably at least about 90 or 95% of the nucleotides match over the defined length of the DNA sequences, as determined by sequence comparison algorithms, such as BLAST, FASTA, DNA Strider, etc.
- sequence comparison algorithms such as BLAST, FASTA, DNA Strider, etc.
- An example of such a sequence is an allelic or species variant of the specific genes of the invention.
- Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system.
- two amino acid sequences are "substantially homologous" or “substantially similar” when greater than 80% of the amino acids are identical, or greater than about 90% are similar.
- the amino acids are functionally identical.
- the similar or homologous sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin) pileup program, or any of the programs described above (BLAST, FASTA, etc.).
- transferring refers to the introduction of a nucleic acid into a cell by any means including electroporation (making transient holes in cell membranes using electric shock), conjugation (refers to the direct transfer of nucleic acid from one prokaryotic cell to another via direct contact of cells), transduction (the process by which bacterial DNA is moved from one bacterium to another by a virus) or transfection (the introduction of foreign material into cells, which typically involves opening transient pores or 'holes' in the cell membrane, to allow the uptake of material. Transfection is frequently carried out by mixing a cationic lipid with the material to produce liposomes, which fuse with the cell membrane and deposit their contents inside.) Transformation is the genetic alteration of a cell resulting from the uptake and expression of foreign genetic material.
- a “vector” is a replicon, such as plasmid, phage, bacterial artificial chromosome (BAC) or cosmid, to which another DNA segment (e.g. a foreign gene) may be incorporated so as to bring about the replication of the attached segment, resulting in expression of the introduced sequence.
- Vectors may comprise a promoter and one or more control elements (e.g., enhancer elements) that are heterologous to the introduced DNA but are recognized and used by the host cell.
- the sequence that is introduced into the vector retains its natural promoter that may be recognized and expressed by the host cell (Bormann et al., J. Bacteriol 1996;178:1216-1218).
- a “replicon” is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication within a cell, i.e., capable of replication under its own control.
- a vector of the present invention is a Bacterial Artificial Chromosome (BAC) shuttle vector that permits conjugation between e.g., Streptomyces and E. coli.
- BAC Bacterial Artificial Chromosome
- a “cassette” refers to a DNA coding sequence or segment of DNA that codes for an expression product that can be inserted into a vector at defined restriction sites.
- the cassette restriction sites are designed to ensure insertion of the cassette in the proper reading frame.
- foreign DNA is inserted at one or more restriction sites of the vector DNA, and then is carried by the vector into a host cell along with the transmissible vector DNA.
- a segment or sequence of DNA having inserted or added DNA, such as an expression vector can also be called a "DNA construct".
- a common type of vector is a "plasmid", which generally is a self-contained molecule of double-stranded DNA, usually of bacterial origin, that can readily accept additional (foreign) DNA and which can be readily introduced into a suitable host cell.
- a plasmid vector often contains coding DNA and promoter DNA and has one or more restriction sites suitable for inserting foreign DNA.
- Coding DNA is a DNA sequence that encodes a particular amino acid sequence for a particular protein or enzyme.
- Promoter DNA is a DNA sequence, which initiates, regulates, or otherwise mediates or controls the expression of the coding DNA.
- Promoter DNA and coding DNA may be from the same gene or from different genes, and may be from the same or different organisms.
- Recombinant cloning vectors will often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g. antibiotic resistance, and one or more expression cassettes.
- Vector constructs may be produced using conventional molecular biology and recombinant DNA techniques within the skill of the art.
- the present invention provides a vector (pSBAC) that contains the following components: first, it contains the backbone of pCCI BAC, a Bacterial Artificial Chromosomal (BAC) vector, which has two replication origins (ori2 for initiation of single-copy replication and oriV for initiation of high-copy replication) and E.
- pSBAC Bacterial Artificial Chromosomal
- coli F factor-based partitioning system ParA, ParB and ParC
- parA, ParB and ParC contains an origin of transfer (oriT) which permits the transfer of the vector from one bacterial cell to another, and this function is critical for conjugation which results in the transfer of nucleic acid from one prokaryotic cell to another through direct cell-to-cell contact
- adjut origin of transfer
- ⁇ BT1 attP-int DNA fragment which encodes a site-specfic recombination system that permit site-specific integration of the vector into the attB site of the recipient chromosome.
- this vector represents an integration system that is different than the heavily exploited ⁇ C31 attP-int system.
- This vector system expands the repertoire of available integration conjugation vectors and avoids the potential detrimental effects caused by the ⁇ C31 attP-int system.
- the use of the ⁇ C31 attP-int system results in the reduced production of A47934, a glycopeptide antibiotic, in Streptomyces toyocaensis to 59% of the control strain.
- this vector provides an important vehicle to clone those gene clusters as well as shuffle those large genetic segments between E. coli, in which the vector replicates autonomously, and various Actinomycetes hosts, in which it site- specifically integrates into the ⁇ BT1 attB loci in the chromosomes.
- the plasmid rescue method has been used to isolate the chromosomal DNA adjacent to an inserted piece of DNA in various organisms. However, because of the limited cloning capacity of the vectors used for this purpose, this method was mainly used for cloning and identification of the adjacent region of the loci that the exogenous DNA inserted. Taking advantage of the ability of BAC vector to clone targe DNA fragments, the present invention also provides a plasmid (BAC) rescue method using the pSBAC vector to clone biosynthetic gene clusters on large DNA fragments from streptomycetes.
- BAC plasmid
- BAC DNA was isolated from several transformants and analyzed with restriction enzyme digestion and pulse field electrophoresis. The result demonstrated that 40 to 50 kb DNA fragment adjacent to the ⁇ BT1 attB site can be routinely cloned using this method. To prove that this method has a general application potential, 2 kb DNA fragment at the end of the actinorhodin gene cluster of S. coelicolor was amplified and cloned into the pSBAC vector that does not have the attP- int locus. Then, this construct was transformed into S.
- One aspect of the invention provides for a vector for cloning or transfer of a large fragment of nucleic acid, e.g. a large DNA fragment comprising a whole or portion of a gene cluster from one prokaryotic organism to Actinomycetes.
- the prokaryotic organism is a strain of £. coli.
- the prokaryotic organism is the same or a different strain of actinomycetes, or any other organism known to those skilled in the art for use in transfer of nucleic acids from one organism to another, for example, from one prokaryotic organism to actinomycetes.
- the donor of the genetic material may be a prokaryotic or eukaryotic organism, known to those skilled in the art, for use in transfer of genetic material from one organism to another.
- the vector is a Bacterial Artificial Chromosome (BAC) vector.
- the BAC vector is a shuttle BAC vector.
- the shuttle BAC vector is an E.coli-Actinomycetes conjugative vector, designated pSBAC.
- the vector further comprises a whole or portion of a gene cluster. While it is envisioned that the vector is a BAC vector, other vectors capable of transfer of large nucleic acid fragments are also envisioned for use. These include bacteriophage derived artificial chromosomes (PACs), as well as yeast artificial chromosomes (YACs).
- PACs bacteriophage derived artificial chromosomes
- YACs yeast artificial chromosomes
- BACs Bacterial Artificial Chromosomes
- PACs bacteriophage derived artificial chromosomes
- BACs and PACs may have certain advantages over the traditional large DNA cloning system, the yeast artificial chromosomes (YACs). These include large carrying capacity ( ⁇ 100-300 kb), high clonal stability, low rate of chimerism, and the ease with which they can be handled (Shizuya, H., Birren, B., Kim, UJ. , Mancino, V., Slepak, T., Tachiiri, Y., and Simon, M. 1992.
- PNAS 89: 8794-8797 loannou, P.A., Amemiya, C.T., Games, J., Kroisel, P.M., Shizuya, H., Chen, C, Batzer, M.A., and de Jong, PJ. 1994. Nat. Genet. 6: 84-89;; Marra, M.A., Kucaba, T.A., Dietrich, N. L., Green, E.D., Brownstein, B., Wilson, R.K., McDonald, K.M., Hillier, L.W., McPherson, J. D., and Waterston, R.H. 1997. Genome Res.
- BACs bacterial artificial chromosomes
- PACs P1 -artificial chromosomes
- BACs and PACs have many advantages over yeast artificial chromosomes (YACs) for cloning large DNA inserts (Monaco, A. P., and Larin, Z., Trends Biotech. 12:280 286 (1994)), including the ease of preparation of microgram quantities of vector.
- the vector was used for complementation of a cell culture phenotype by a genomic DNA transgene retained in human cells as an EBV-based episome (Wade-Martins, R., et al., Nature Biotech 18:1311-1314 (December 2000)). Extrachromosomal maintenance of the construct prevented DNA rearrangement often seen on construct integration.
- the vector described by Wade-Martins, supra, is based solely on EBV features.
- U.S. Pat. No. 6,143,566 to Heintz et al. relates to targeted BAC modification.
- This patent teaches a method for directly modifying an independent origin based cloning vector (such as a BAC, in one specific embodiment) in recombination deficient host cells, including generating deletions, substitutions, and/or point mutations in a specific gene contained in the cloning vector.
- the modified cloning vector may be used to introduce a modified heterologous gene into a host cell.
- a modified BAC was inserted into a murine subject animal, and in vivo heterologous gene expression demonstrated.
- the methodology of this invention involves homologous recombination of the cloning vector with a conditional replication shuttle vector in a RecA host cell, wherein the conditional replication shuttle vector encodes a RecA-like protein.
- the vector is a BAC that has undergone homologous recombination with the temperature sensitive shuttle vector pSVLRecA.
- Sosio et al describe a BAC that can be shuttled between E.coli and a streptomycetes host where it integrates into the chromosome. They propose to construct a derivative of a BAC that can be stably maintained in the host by incorporating a gene cassette for site specific integration into the host chromosome. In particular, they used the ⁇ C31-atfS-int system and terto confer resistance to thiostrepton. (Sosio et al. (2000), Nature Biotechnology, 18: 343-345). However, it has been reported that the integration of vectors into the ⁇ C31-attS site can cause detrimental effects on antibiotic production. (Baltz, et al. (1998), Trends Microbiol. 6:76-83). These reported reductions in antibiotic synthesis may be due to insertional mutagenesis or by integration into a pseudo-att ⁇ site or to some other factor.
- the present invention provides for site-specific integration of the vector described herein into the recipient cell chromosome through use of a ⁇ BT1 -attB integration system, thereby eliminating any of the detrimental effects associated with the ⁇ C31-atfS-int system.
- This integration site is described by Gregory et al (Gregory et al. (2003), J. Bacteriol. 17:5320-5323).
- BAC vectors for cloning and transfer of very large fragments of DNA, and for the stability of the clones, the amount of DNA recovery is very low.
- the present invention incorporates two origins of replication, the ori2 and the oriV into the vector, thus improving the overall yield of the cloned DNA of the present invention.
- the shuttle vector, pSBAC was first introduced into the ⁇ BT1 attachment site of S. coelicolor by site-specific recombination. Regions of varied sizes flanking the attB site could be easily cloned into E. coli by the plasmid rescue strategy. Furthermore, the whole actinorhodin gene cluster was cloned using this method and subsequently expressed in a heterologous host.
- a versatile E. coli-Streptomyces Shuttle Bacterial Artificial Chromosomal vector, pSBAC, was constructed to facilitate the cloning, transferring and heterologous expression of streptomycete secondary metabolites biosynthetic gene clusters.
- This vector is capable of harboring large DNA fragments, transferring of cloned DNA from E. coli to streptomycetes, as well as integrating the cloned DNA into streptomycete genome at the phage ⁇ BT1 attB locus.
- a plasmid rescue method using this vector has been developed to speed the process of cloning biosynthetic gene clusters for secondary metabolites from streptomycetes without sophisticated generation and screening of cosmids or BAC libraries.
- the cloned DNA can then be used for sequencing or heterologous expression of putative secondary metabolic gene clusters.
- the actinorhodin gene cluster (act) from S. coelicolor was successfully rescued by this vector into a single E. coli clone and subsequently transferred into a mutated S. lividians strain in which the act gene cluster had been deleted.
- Successful expression of the cloned act gene cluster was demonstrated by the restoration of the production of actinorhodin.
- BAC rescue method was developed using the new BAC vector to clone large DNA fragments from Stretptomycetes.
- the BAC vector with a piece of homologous sequence to the gene of interest was conjugated into the strain of interest. Homologous recombination will result in the insertion of the vector into the targeted locus.
- the genomic DNA of the exconjugants was then isolated and digested with restriction enzyme, then circularized and transformed into E. coli. The rescued plasmid was replicated in E.
- this method can recover significant length of sequences flanking the site-specific insertion site from a disruptant strain. Successful implementation of this method will greatly facilitate the cloning of large DNA fragments, particularly, microbial secondary metabolic biosynthetic pathway, without sophisticated generating and screening of cosmid or BAC libraries.
- the present method utilizes a large capacity cloning vector, such as a BAC or a PAC.
- BAC or PAC is a particularly preferred large capacity cloning vector
- other large capacity cloning vectors known to those skilled in the art can also be used in the present invention. These include, e.g., cosmids (Evans et al., Gene 79:9 20 (1989)), yeast artificial chromosomes (YACS) (Sambrook, J., et al., A Molecular Cloning: A Laboratory Manual, 2.sup.nd Edition, Cold Spring Harbor Press, Cold Spring Harbor, N. Y.
- mammalian artificial chromosomes Vos et al., Nature Biotechnology 15:1257 1259 (1997), human artificial chromosomes (Harrington et al., Nature Genetics 15: 345 354 (1997)), or viral-based vectors, such as, e.g., CMV, EBV, or baculovirus.
- BAC Baculovirus Artificial Chromosome
- BACs Baculovirus and murine cytomegalovirus (Shizuya, H., et al., Proc. Natl. Acad. Sci. USA 89:8794 8797 (1992); Luckow, V. A., et al., J. Virol. 67:4566 4579 (1993); Messerle, M., et al., Proc. Natl. Acad. Sci. USA 94:14759 14763 (1997).
- PAC is intended to mean a cloning and sequencing vector derived from a P1 bacteriophage into which a large genomic DNA fragment, typically up to 300 kb can be inserted.
- PACs are described in loannou, P. A., et al., Nature Genetics 6:84- 89 (1994) and Sternberg et al., Proc. Natl Acad Sci USA 87:103 107 (1990).
- BAC or PAC libraries and especially those containing human genomic DNA as a result of the Human Genome Project, are readily available to those skilled in the art (See, e.g., Simon, M. I., Nature Biotechnol. 15:839 (1997)
- transforming host microorganisms with vectors carrying component polynucleotides is carried out with conventional techniques.
- the vector is transferred to the host or recipient cell via conjugation between two organisms.
- the vector may be transferred to a host cell or recipient cell via transfection methods.
- transformation and transfection are intended to refer to a variety of art-recognized techniques for introducing an exogenous nucleic acid sequence (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAB-dextran-mediated transfection, lipofection, electroporation, optoporation, mechanical injection, biolistic injection, and the like.
- Suitable methods for transforming or transfecting host cells are found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989), and like laboratory manuals.
- the shuttle vector includes a "selection marker” or “selectable marker” that is functional in the cell that contains the nucleic acid of interest.
- This "selection marker”, upon expression, can allow the host cell to be distinguished from a cell that does not contain the nucleic acid of interest.
- selection marker or “selectable marker” refers to the use of, or the inclusion of, a drug as a marker to aid in the cloning and identification of transformants, for example, genes that confer resistance to apramycin, neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable or selection markers.
- cells containing a nucleic acid construct of the present invention may be identified by including a marker in the vector.
- markers would confer an identifiable change to the cell permitting easy identification of cells containing the vector.
- a selectable marker is one that confers a property that allows for selection.
- a positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection.
- An example of a positive selection marker is a drug resistance marker.
- the positive selection marker is a gene that confers resistance to a compound, which would be lethal to the cell in the absence of the gene. For example, a cell expressing an antibiotic resistance gene would survive in the presence of an antibiotic, while a cell lacking the gene would not.
- the presence of a tetracycline resistance gene could be positively selected for in the presence of tetracycline, and negatively selected against in the presence of fusaric acid.
- Suitable antibiotic resistance genes include, but are not limited to, genes such as ampicillin-resistance gene, neomycin-resistance gene, blasticidin-resistance gene, hygromycin-resistance gene, puromycin-resistance gene, chloramphenicol-resistance gene, apramycin resistance gene and the like.
- the negative selection marker is a gene that is lethal to the target cell in the presence of a particular substrate.
- the thyA gene is lethal in the presence of trimethoprim.
- Negative selection markers include, but are not limited to, genes such as thyA, sacB, gnd, gapC, zwJ, talA, taiB, ppc, gdhA, pgi, Jbp, pykA, cit, acs, edd, icdA, groEL, secA and the like.
- the selectable marker gene is a gene that provides for apramycin resistance. (See GenBank accession number AJ414670)
- the selection marker gene may be a detection gene.
- Detection genes encode a protein that can be used as a direct or indirect label, i.e., for sorting the cells, i.e. for cell enrichment by FACS.
- the protein product of the selectable marker gene itself can serve to distinguish cells that are expressing the selectable gene.
- suitable selectable genes include those encoding green fluorescent protein (GFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), luciferase, ⁇ -galactosidase, all commercially available, i.e., Clontech, Inc.
- the selectable marker gene encodes a protein that will bind a label that can be used as the basis of selection; i.e. the selectable marker gene serves as an indirect label or detection gene.
- visually detectable markers are also suitable for use in the present invention, and may be positively and negatively selected and/or screened using technologies such as fluorescence activated cell sorting (FACS) or microfluidics.
- detectable markers include various enzymes, prosthetic groups, fluorescent markers, luminescent markers, bioluminescent markers, and the like.
- fluorescent proteins include, but are not limited to, yellow fluorescent protein (YFP), green fluorescence protein (GFP), cyan fluorescence protein (CFP), umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichiorotriazinylamine fluorescein, dansyl chloride, phycoerythrin and the like.
- suitable bioluminescent markers include, but are not limited to, luciferase (e.g., bacterial, firefly, click beetle and the like), luciferin, aequorin and the like.
- suitable enzyme systems having visually detectable signals include, but are not limited to, galactosidases, glucorinidases, phosphatases, peroxidases, cholinesterases and the like.
- Another aspect of the invention provides a plasmid (BAC) rescue method using the pSBAC vector described above to clone large DNA fragments from streptomycetes.
- This method will greatly facilitate the cloning of large DNA fragments, particularly, microbial secondary metabolic biosynthetic pathway, without sophisticated generation and screening of cosmid or BAC libraries.
- the pSBAC vector was first transferred into S. coelicolor by conjugation from E. co// S17-1 (pSBAC).
- pSBAC E. co// S17-1
- Several apramycin-resistant transconjugants were selected and the genomic DNA from one of them were isolated and partially digested with Seal.
- the digested DNA was subjected to pulse field electrophoresis and DNA fraction that corresponds to 40 to 50 kb was recovered, self-ligated, and then transformed into E. coli EPI300TM.
- BAC DNA was isolated from several transformants and analyzed with restriction enzyme digestion and pulse field electrophoresis. The result demonstrated that 40 to 50 kb DNA fragment adjacent to the ⁇ BT1 attB site can be routinely cloned using this method.
- EXAMPLE 1 Construction of the pSBAC vector and development of the Plasmid Rescue Procedure
- Streptomyces coelicolor strain M 145 and S. lividans TK24 were used in this work.
- S. lividans K4-441 (Ziermann and Betlach, 1999. BioTechniques 26:106-110) was used as a heterologous host for the expression of the Actinorhodin gene cluster.
- Escherichia coli strain EPI300TM (Epicentre, Madison Wl) was used for cloning and amplification of the pSBAC vector and constructs derived from it.
- E. coli strain NovaBlue Novagen, Madison, Wl
- E. coli strain S17-1 was used for conjugation to introduce plasmids from E. coli to S. lividans.
- the plasmid pHLW3 was a BAC (Bacterial
- the pSBAC was derived from pHLW3 with the introduction of the attP-lnt cassette of ⁇ BT1. Plasmids pHLW21 , 22, 23, and 24 were rescued BAC clones from the strains derived from the conjugation of pSBAC into the ⁇ BT1 attachment site of S. coelicolor genome. Plasmids pHLW35 were derived from pHLW3 with the insertion of a 2-kb PCR product amplified from the S. coelicolor using the primer sets that corresponding to the 3 ' -end of the Actinorhodin gene cluster.
- Plasmids pHLW38, 39, 40, 41 , and 42 were rescued BAC clones from the strains derived from the conjugation of pHLW35 into the Actinorhodin gene cluster of S. coelicolor. Finally, plasmid pHLW76 and 78 were derived by adding the attB-lnt cassette of ⁇ BT1 into plasmids pHLW41 and 42, respectively.
- E. coli strains were grown in Luria-Bertani (LB) medium supplemented with either Apramycin (50 ⁇ g/ml) or Ampicillin (100 ⁇ g/ml).
- S. coelicolor and S. lividans strains were grown at 28 0 C in MYM, R2YE or R4 media (Kieser, T.M.J., Bibb, M. J., Buttner, K.F., Chater, and D.A. Hopwood. (2000), Practical Streptomyces Genetics, University of Nottingham, Nottingham, UK).
- R6 medium used for conjugation was supplemented with Apramycin (50 ⁇ g/ml) and nalidixic acid (25 ⁇ g/ml).
- KOD Hot start DNA polymerase (Novgen) was used for PCR amplification following the manufacturer's instruction. Genomic DNA of Streptomycetes was isolated using the procedure described previously (Magarvey, N.A., HaItIi, B., He, M., Greenstein, M., and Hucul J.A. 2006. Antimicrob Agents Chemosther. 50:2167-2177). Plasmid DNA was isolated using the Zappy plasmid miniprep kit (Zymo Research). BAC clones with large inserts were isolated using the BACMAX DNA purification kit (Epicentre). Transformation of plasmid into E. coli was performed using either NovaBlue competent cell or EPI300TM electrocompetent cells. Conjugation vectors were introduced into S.
- Pulsed field electrophoresis was carried out using CHEF-DR III Pulse field electrophoresis system (Bio-Rad) following the manufacture's instruction. Briefly, the digested DNA was separated in 1% pulse filed agarose (Bio-Rad) in O. ⁇ xTBE running buffer. Run the gel using the following parameters: 1 sec of initial switch time, 6 sec of final switch time, 120° included angle and 16 hr of run time at 14 0 C under 6 volts/cm condition. Construction of the pSBAC vector.
- the backbone of the pSBAC vector was amplified from plasmid pCCI BAC (see SEQ ID NO: 8) (Epicentre, Madison, Wl) using primer set pCCI BACFor: 5'- AGGGCTTCCCGGTATCAACAG-3' (SEQ ID NO: 9) and pCCI BACRev: 5 ' - GGTTACTCCGTTCTACAGGTTAC -3'(SEQ ID NO: 10).
- the origin of transfer region (oriT) and Apramycin resistance gene, together with the multiple cloning site were amplified from plasmid pBWA2 (Magarvey, N.A., HaItIi, B., He, M., Greenstein, M., and Hucul J.A. 2006. Antimicrob Agents Chemosther. 50:2167-2177) using the primer set: pB1 : 5 - TCAGGCCTTCGCCACCTCTGACTTGAGC-3' (SEQ ID NO: 11) and pB2: 5 - ATAGGCCTCAGTGAGGCACCTATCTCAG -3 ' (SEQ ID NO: 12) .
- the 6.5-kb PCR amplified from the first primer set and the 4-kbPCR product amplified from the second primer set were ligated together to produce plasmid pHLW3. Then, the 2-kb DNA fragment containing the attP-int of ⁇ BT1 was synthesized (Celtek-genes, Arlington, TN) and introduced into the unique Seal site of pHLW3 to give the final construct pSBAC.
- the exconjugants obtained from the conjugation of S17-1 (pSBAC) into S. coelicolor were grown in MYM liquid medium supplemented with Apramycin (50 ⁇ g/ml).
- the genomic DNA was partially digested with Seal, the digested DNA then was separated using pulsed field electrophoresis.
- the DNA fraction corresponding to 40-60 kb was excised and electroeluted from the gel by electrophoresis.
- the electroeluted DNA was self-ligated using Fast-link DNA ligation kit (Epicentre Bio).
- the ligation mixture was then desalted in 1% agarose with 1.8% glucose, and 1 ⁇ l of the final ligation mixture was used to electroporate E. coli EC100 competent cell.
- This 2-kb PCR product was digested with EcoRI and Hindlll, and then ligated to the corresponding site of pHLW3.
- the resulting plasmid pHLW35 was then introduced into S. coelicolor by conjugation.
- the specific integration of the plasmid into the ACT gene cluster was first confirmed in several excojugants by PCR analyses. Then the act gene cluster was rescued using the above described procedure.
- E. coli- streptomycetes conjugative BAC vector pSBAC (Fig. 1)
- This vector contains the backbone of pCCIBAC, a Bacterial Artificial Chromosomal (BAC) vector, which has two replication origins (ori2 for initiation of single-copy replication and oriV for initiation of high-copy replication) and E. coli F factor- based partitioning system (ParA, ParB and ParC) (Wild, J., Hradecna, Z., and Szybalski W. 2002. Genome Res. 12:1434-1444).
- BAC Bacterial Artificial Chromosomal
- the pSBAC vector also contains an origin of transfer (oriT) which permits the transfer of the vector from one bacterial to another, and this function is critical for conjugation which results in the transfer of nucleic acid from one prokaryotic cell to another through direct cell-to-cell contacts; third, it also contains a ⁇ BT1 attP-int DNA fragment which encodes a site-specfic recombination system that permit site-specific integration of the vector into the attB site of the recipient chromosome. With all these components, this vector is capable of harboring large DNA fragments, and transferring of cloned DNA from E.
- oriT origin of transfer
- this vector represents an integration system that is different, yet compatible with the heavily exploited ⁇ C31 attP-int system. Construction of this vector system expands our repertoire of available integration conjugation vectors and avoids the potential detrimental effects caused by the ⁇ C31 attP-int system.
- this vector provides an important vehicle to clone those gene clusters as well as shuffle those large genetic segments between E. coli, in which the vector replicates autonomously, and various streptomycetes hosts, in which it site- specifically integrates into the ⁇ BT1 attB loci in the chromosomes.
- the plasmid rescue method has been used to isolate the chromosomal DNA adjacent to an inserted piece of DNA in various organisms (Weinrauch, Y., and Dubnau, D. 1983. J Bact. 154:1077-1087; Kiessling, U., Platzer, M., and Strauss, M. 1984. MoI Gen Genet. 193:512-519.; McMahon T.L, Wilczynska, Z., Barth, C, Fraser, B.D., Pontes, L, and Fisher P. R. 1996. Nucleic Acids, Res. 24:4096-4097).
- this method was mainly used for cloning and identification of the adjacent region of the loci that the exogenous DNA inserted.
- BAC plasmid rescue method
- Successful implementation of this method will greatly facilitate the cloning of large DNA fragments, particularly, microbial secondary metabolic biosynthetic pathway, without sophisticated generation and screening of cosmid or BAC libraries.
- the pSBAC vector was first transferred into S. coelicolor by conjugation from E.
- coli S17-1 pSBAC
- pSBAC coli S17-1
- Several apramycin-resistant transconjugants were selected and the genomic DNA from one of them were isolated and partially digested with Seal.
- the digested DNA was subjected to pulse field electrophoresis and DNA fraction that corresponds to 40 to 50 kb was recovered, self-ligated, and then transformed into E. coli EPI300TM.
- BAC DNA was isolated from several transformants and analyzed with restriction enzyme digestion and pulse field electrophoresis (Fig. 2).
- Figure 2a outlines the strategy used for plasmid rescue using the pSBAC vector.
- Figure 2b shows the results of the pulse- field gel electrophoresis analysis of four of the rescued clones digested with Hindlll.
- Figure 3a shows the schematic representation of the strategy used for rescue of the act gene cluster from S. coelicolor and 3b the analysis of the rescued clones.
- coelicolor was amplified using primer set Scresiand Scres2, then cloned into the vector pHLW3, which is different from pSBAC in that it does not have the attP-int locus.
- the resulting construct was then transformed into S. coelicolor and homologous recombination resulted in the single cross-over and site-specifically inserted the construct into the homologous region (Fig. 3a).
- the genomic DNA from one of these strains was isolated and the genomic DNA was mechanically sheared to smaller pieces. The resulting DNA was then separated by pulsed-field electrophoresis and 40 to 50 kb DNA fraction was recovered.
- Figure 3b shows the results of the pulsed-field gel electrophoresis analysis of five of the rescued clones that potentially contain the whole act gene cluster (lane 1 : pulse marker; lanes 2-7: clone pHLW38, 39, 40 , 41 and 42 digested with EcoR1 ; lanes 8-13, the above clones digested with Hindlll; lane 14: 1 kb DNA ladder).
- the recovered DNA was blunt-ended using End-itTM DNA end repair kit (Epicentre), then self-ligated and transformed into E. coli EPI300TM electrocompetent cells. Numerous transformants were subject to PCR analyses to select the clones that contain both the beginning and the ending of the Actinorhodin gene cluster.
- the confirmed clones were the clones that potentially contain the whole Actinorhodin gene cluster because of the presence of both ends of the gene cluster.
- the ⁇ BT1 attP-int fragment was then introduced into the Avrll site of the rescued clone to facilitate the subsequent integration of the gene cluster into the specific attB attachment locus.
- the clone with the whole Actinorhodin gene cluster was transferred into S. lividans strain K4-114 in which the Actinorhodin gene cluster had been deleted previously.
- Exconjugants were selected from R6 plate supplemented with apramycin and Nalidixic acid and re-streaked onto MYM agar plate supplemented with aparamycin and Nalidixic acid.
- actinorhodin was further characterized by examining the production of the blue pigment by the representative clone grown on either R2YE agar plate or liquid medium.
- a novel E. coli-Streptomycetes shuttle vector, pSBAC, was constructed and this vector can be used for direct cloning of small, medium or large gene clusters, transferring of the cloned DNA from E. coli into different soil bacteria streptomycetes strains, and integrating the cloned DNA into the ⁇ BT1 attB site of the recipient chromosome.
- This vector represents an integration system that is different, yet compatible with the widely-used ⁇ C31 attP-int system and expands the repertoire of available integration conjugation vectors.
- the plasmid (BAC) rescue method developed here can be used for cloning large DNA fragments directly from gene disruption transformants of streptomycetes without generation and screening of cosmid or BAC libraries.
- Meridamycin and its naturally occurred analog 3-normeridamycin are non- immunosuppressive, FKBP12-binding macrocyclic polyketides with potent neuroprotective activity in dopaminergic neurons.
- the biosynthetic gene cluster of meridamycin has been cloned from Streptomyces sp. NRRL 30748 and was located on several overlapping cosmids (He et al., Gene, (2006) Aug 1 ;377:109-18). The entire gene cluster is ⁇ 90kb, containing large transcriptional units encoding a total of 15 type I polyketide synthase modules, 1 NRPS module, 1 cytochrome P450 monooxygenase and several regulatory and transportation proteins.
- the giant polyketide synthetase complex comprises three large subunits designated as MerA, MerB and MerC.
- the mer gene cluster was cloned in a pSBAC vector to facilitate the transfer and expression in a heterologous host. More particularly, by using pSBAC, the whole meridamycin biosynthetic gene cluster ( ⁇ 97kb) was cloned into a single E. coli clone and then transferred into Streptomyces lividans for heterologous expression. Although the original mer promoter was able to drive the transcription of the whole gene cluster in the heterologous hosts, the production of meridamycin was only detectable by mass spectrometry when the original promoter was replaced with ermE * promoter.
- E coli strains were grown in Luria-Bertani (LB) medium supplemented with either apramycin (50 ⁇ g/ml) or ampicillin (100 ⁇ g/ml).
- S. coelicolor and S. lividans strains were grown at 28 0 C in IvIYM, R2YE (Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F., and Hopwood, D.A. (Eds.), 2000. Practical Streptomycetes genetics.
- KOD Hot start DNA polymerase (Novgen, San Diego, CA) was used for PCR amplification following the manufacturer's instruction. Genomic DNA of Streptomycetes was isolated using the procedure described previously (Magarvey, N.A., HaItIi, B., He, M., Greenstein, M., and Hucul J.A. 2006. Antimicrob. Agents Chemother. 50:2167-2177). Plasmid DNA was isolated using the Zappy plasmid miniprep kit (Zymo Research, Orange, CA). BAC clones with large inserts were isolated using the BACMAX DNA purification kit (Epicentre, Madison, Wl). Transformation of plasmid into E.
- coli was performed using either NovaBlue competent cell or EPI300TM electrocompetent cells. Conjugation vectors were introduced into S. lividans TK24 or K4-114 using E. coli S17-1 or ET12567(pUZ8002) harboring the intended plasmid as donor strain. Pulsed field electrophoresis was carried out using CHEF-DR III Pulse field electrophoresis system (Bio-Rad, Hercules, CA) following the manufacture's instruction. Briefly, the digested DNA was separated in 1% pulse filed agarose (Bio-Rad) in O. ⁇ xTBE running buffer. Gel was run using the following parameters: 1 second of initial switch time, 6 seconds of final switch time, 120° included angle and 16 hr of run time at 14 0 C under 6 volts/cm condition.
- Streptomyces sp. NRRL 30748 was grown in TSBC liguid medium for 72 h at 28 0 C. The mycelia was collected and washed with de-ionized water. Preparation of the genomic DNA plug was carried out following the instruction manual for CHEF Genomic DNA Plug Kits (Bio-Rad). Briefly, the mycelium pellet was re-suspended in Cell Suspension buffer and then embedded into CleanCut agarose using the plug mold. The solidified agarose plugs were then treated with lysozyme and subsequently with proteinase K. The plugs were washed twice with 1x Wash Buffer before treated with 1 mM PMSF to inactivate residual Proteinase K.
- the DNA fraction corresponding to 90 to 110 kb was excised, eluted from the gel by electro-elution. The eluted DNA was precipitated and concentrated before ligate to EcoRI digested pSBAC vector using using Fast-link DNA ligation kit (Epicentre Bio).
- the ligation mixture was then desalted in 1% agarose containing 1.8% glucose, and 1 ⁇ l of the final ligation mixture was used to electroporate E. coli EPI300 competent cell. About 300 recombinant colonies have been screened using DNA probes derived from the sequences flanking the mer gene cluster, resulting the idenification of pHLW30, which contains the whole meridamycin biosynthetic gene cluster.
- RNA from different Streptomycete strains was isolated using the method described by Van Dessel, W.V (2004) (Van Dessel, W., Van Mellaert, L., Geukens, N., Lammertyn, E and Anne, J. 2004. J. Microbiol. Methods 58:135-137) with modification. Briefly, 3 ml culture from 72 hr growth was collected and 2 vol of RNA protect Reagent (Qiagen) was added immediately and stand at room temperature for 5 min, then centrifuge to get the mycelium pellets.
- RNA protect Reagent Qiagen
- the pellets were treated with 1 ml of 5 mg/ml lysozyme for 1 hr at 37 0 C, then extracted with phenol:chloroform (5:1 ; pH4.5) and precipitated with 2ml of ethanol, 250 ⁇ l of 1M Tris (pH ⁇ .O) and 100 ⁇ l 5M NaCI.
- the precipitated RNA was washed with 80% ethanol once, dry down and resolved in 100ul RNA storage buffer (Ambion, Austin, TX). The DNA contamination was eliminated with DNase 1 digestion (Ambion) and re- purified repeating the above procedure.
- the primer sets used for RT-PCR were: RT1 : 5 ' - GCGCGGACCGAGCCCTACGAC-3' (SEQ ID NO: 19), RT2: 5 ' - CCCCCGGCCCTCCAGCAGATG-3 ' (SEQ ID NO: 20) for amplification of the 5'-end of the mer gene cluster; Primers 16sFor: 5 ' -GGTTACCTTGTTACGACTT-3' (SEQ ID NO: 21) and 16sRev: 5'-AGAGTTTGATCCTGGC TCAG-3 ' (SEQ ID NO: 22), were used as an internal control to ensure the equal amount of total RNA was present in each sample.
- RT-PCR Semiquantitative RT-PCR was similar to the method described previously (Noonan, K. E., Beck, C, Holzmayer, T. A., Chin, J. E., Wunder, J. S., Audrulis, I. L., Gazdar, A.F., William, C.L., Griffith, B., Hoff, D.D.V and Roninson, I. B. 1990. Proc. Natl. Acad .ScL USA 87:7160-7164.), except one-step RT-PCR kit (Qiagen) was used following the instruction manual. Cycle numbers and template amount were carefully calibrated to ensure that the RT-PCR was carried out within the exponential phase of amplification.
- the 1.2 kb PCR product was purified and its 5 ' - end was phosphated by T4 PNK.
- the final product was cloned into the blunted BstBI site of pHLW70 and produced plasmid pHLW71.
- the plasmid was conjugated into heterologous hosts HL30-2 and HL30-K3.
- the PCR product was cloned and sequenced to confirm the site-specific integration.
- the final strains E3 and E7 contain the mer gene cluster under the control of ermE * promoter were derived from HL30-2 and HL30-K3, respectively.
- High resolution mass spectra were obtained using a Bruker Daltonics (Billerica, MA) APEX Il FTICR mass spectrometer equipped with an actively shielded 9.4 Tesla superconducting magnet (Magnex Scientific Ltd., UK), an external Bruker Apollo ESI source, and a Synrad 5OW CO2 CW laser.
- a detailed description of this instrument and its performance has been published previously (Palmblad, M., Hakansson, K., Hakansson, P., Feng, X., Cooper, H.J., Giannakopulos, A.E., and Derrick, P.J. 2000, Eur. J. Mass. Spectrom. 6:267-275).
- Nanoelectrospray was employed due to the very limited quantities of samples. About 5 ⁇ l sample was loaded into nanoelectrospray tip with conductive coating (New Objective, Woburn, MA) and mixed with the pre-loaded same amount of methanol containing 1% formic acid. A high voltage about -800 V was applied between the nanoelectrospray tip and the capillary. Mass spectra were calibrated externally using Agilent ES tuning mix. Bruker Xmass software (Versions 7) was used for data acquisition and analysis, including the calculations for predicted masses. The errors are the differences between the experimental and predicted values expressed in mDa.
- meridamycin (mer) biosynthetic gene cluster from Streptomyces sp. NRRL 30748 was cloned into several cosmid clones and sequence results revealed that the genes that are responsible for the construction of the core structure of meridamycin were located in an approximately 90 kb of DNA fragment (He, M., Haiti, B., Summers, M., Feng, X. and Hucul, J. (2006). Gene 377:109-118.).
- two restriction enzyme sites (Mfel) were found to be located at 378 bp upstream and ⁇ 16kb down stream of the mer gene cluster, respectively.
- This Mfel DNA fragment contains the DNA that covers the whole mer gene cluster with its original promoter and many downstream modification enzyme encoding regions (Fig. 5A). Southern analysis demonstrated the existence of the 97 kb band when the genomic DNA digested with Mfel and hybridized with mer gene cluster specific probe (data not shown).
- an Mfel-digested genomic BAC library was constructed using a E.coli- streptomycetes shuttle BAC vector, pSBAC which not only has the essential components of a BAC vector to accommodate large DNA inserts, but also contains an origin of transfer (oriT) which permits the transfer of the vector from E.coli to streptomycetes by conjugation and a ⁇ BT1 attP-int DNA fragment which encodes a site-specific recombination system that permit site-specific integration of the vector into the attB site of the recipient chromosome (Liu and He., Manuscript in preparation).
- pSBAC which not only has the essential components of a BAC vector to accommodate large DNA inserts, but also contains an origin of transfer (oriT) which permits the transfer of the vector from E.coli to streptomycetes by conjugation and a ⁇ BT1 attP-int DNA fragment which encodes a site-specific recombination system that permit site-specific integration of the vector into the attB site
- the top panel of Figure 6 represents the results of RT-PCR amplification from RNAs of various strains using primer set RT1 and RT2, which amplifies part of the MerP gene.
- the bottom panel of Figure 6 represents the results of RT-PCR amplification from RNAs of corresponding strains using primer set 16sFor and 16sRev, which amplifies part of the 16sr rRNA.
- TK24 S. lividans TK24, K4-114: S. lividans K4-114, HL30-2: mer gene cluster in S. lividans TK24, HL30-K3: Mer gene cluster in S. lividans K4-114
- E3 Mer gene cluster with ermE* promoter in S.
- LC-MS detection demonstrated the production of meridamycin from the strain E7 (Fig. 7), which has the original mer promoter changed with ermE* promoter in the S. lividans K4-114 background.
- the left panel of Figure 7 shows the detection of the production of meridamycin from strains grown in FKA medium supplemented with 2mM pipecolate and 1OmM diethymalonate.
- the right panel of Figure 7 shows the detection of the production of 3-Normeridamycin from strains grown in FKA medium supplemented with 0.4% proline and 1OmM diethymalonate.
- the arrows indicate the peaks with expected molecular weight and retention time of either meridamycin or 3-Normeridamycin.
- the failure of the corresponding strain derived from S. lividans TK24 (strain HL30-2) to produce detectable amount of meridamycin may be due to precursor supply or to interference from the host metabolites (Fig. 7).
- the identity of the interested products was further confirmed by FTMS high-resolution accurate mass spectra using a nanoelectrospray source with long accumulation times.
- the sodium adduct molecular ion of meridamycin and normeridamycin with low abundance were detected in the positive ion mode at m/z 844.51928 and m/z 830.50298, respectively, and they agree very well with the predicted values ([M+Na] 1+ , meridamycin: pred.
- the acyltransferase (AT) in module 4 is responsible for the incorporation of ethylmalonyl-CoA into the polyketide backbone of meridamycin (He et al., 2006), but the gene cluster lacks the genes for biosynthesis of the eythlmalonate extender unit and it has been suggested that other functional gene clusters may be able to synthesize ethymalonate and provide if for the production of meridamycin.
- S. lividans produces ethylmalonyl- CoA (Hu, Z., Reid, R., and Gramajo, H. 2005, J. Antibiot.
- this precursor has been demonstrated to be a critical factor that limits the synthesis of some polyketides by heterologous hosts (Jung, W.S., Lee, S.K., Hong, J.S.J., Park., S. R., Jeong, S.J., Han, A.R., Sohng, J. K., Kim B.G., Choi, C.Y., Sherman, D.H., and Yoon, Y.J. 2006, App. Microbiol. Biotech. 72:763-769.).
- strain E7 was cultured in FKA media supplemented with 1OmM diethylmalonate, which has been proven to be an effective precursor for ethylmalonyl-CoA (Jung, W.S., Lee, S. K., Hong, J.S.J., Park., S. R., Jeong, S. J., Han, A.R., Sohng, J. K., Kim B.G., Choi, C.Y., Sherman, D.H., and Yoon, YJ. 2006, App. Microbiol. Biotech. 72:763-769.).
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP08794782A EP2173880A2 (en) | 2007-07-27 | 2008-07-25 | Vectors and methods for cloning gene clusters or portions thereof |
| CA2694537A CA2694537A1 (en) | 2007-07-27 | 2008-07-25 | Vectors and methods for cloning gene clusters or portions thereof |
| MX2010000992A MX2010000992A (en) | 2007-07-27 | 2008-07-25 | Vectors and methods for cloning gene clusters or portions thereof. |
| JP2010519218A JP2010534489A (en) | 2007-07-27 | 2008-07-25 | Vectors and methods for cloning gene clusters or portions thereof |
| AU2008282876A AU2008282876A1 (en) | 2007-07-27 | 2008-07-25 | Vectors and methods for cloning gene clusters or portions thereof |
| BRPI0813971-7A2A BRPI0813971A2 (en) | 2007-07-27 | 2008-07-25 | VECTORS AND METHODS FOR CLONING GENE CLUSTERS OR PORTIONS THEREOF |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US96231107P | 2007-07-27 | 2007-07-27 | |
| US60/962,311 | 2007-07-27 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2009017692A2 true WO2009017692A2 (en) | 2009-02-05 |
| WO2009017692A3 WO2009017692A3 (en) | 2009-07-23 |
Family
ID=40257042
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2008/009083 Ceased WO2009017692A2 (en) | 2007-07-27 | 2008-07-25 | Vectors and methods for cloning gene clusters or portions thereof |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US20090075283A1 (en) |
| EP (1) | EP2173880A2 (en) |
| JP (1) | JP2010534489A (en) |
| KR (1) | KR20100034055A (en) |
| AU (1) | AU2008282876A1 (en) |
| BR (1) | BRPI0813971A2 (en) |
| CA (1) | CA2694537A1 (en) |
| MX (1) | MX2010000992A (en) |
| WO (1) | WO2009017692A2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2677034A1 (en) | 2012-06-18 | 2013-12-25 | LEK Pharmaceuticals d.d. | Genome sequence based targeted cloning of DNA fragments |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100137143A1 (en) | 2008-10-22 | 2010-06-03 | Ion Torrent Systems Incorporated | Methods and apparatus for measuring analytes |
| WO2013083566A1 (en) * | 2011-12-08 | 2013-06-13 | Bayer Intellectual Property Gmbh | New actinomycete integrative and conjugative element from actinoplanes sp. se50/110 as plasmid for genetic transformation of related actinobacteria |
| WO2020185831A1 (en) * | 2019-03-12 | 2020-09-17 | Varigen Biosciences Corporation | Expression vector |
| KR102877826B1 (en) * | 2024-07-02 | 2025-10-28 | 서울대학교산학협력단 | Recombinant vectors containing genes encoding partitioning proteins in the Clavibacter michiganensis plasmid and their applications |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4935340A (en) * | 1985-06-07 | 1990-06-19 | Eli Lilly And Company | Method of isolating antibiotic biosynthetic genes |
| US6495348B1 (en) * | 1993-10-07 | 2002-12-17 | Regents Of The University Of Minnesota | Mitomycin biosynthetic gene cluster |
| US6143566A (en) * | 1997-06-23 | 2000-11-07 | The Rockfeller University | Methods of performing homologous recombination based modification of nucleic acids in recombination deficient cells and use of the modified nucleic acid products thereof |
| US20030134398A1 (en) * | 2001-09-12 | 2003-07-17 | Sherman David H. | Mitomycin biosynthetic gene cluster |
| JP4532121B2 (en) * | 2002-04-10 | 2010-08-25 | レスポンス バイオメディカル コーポレイション | Highly sensitive immunochromatographic assay |
| US7507752B2 (en) * | 2004-06-03 | 2009-03-24 | Wyeth | Biosynthetic gene cluster for the production of a complex polyketide |
-
2008
- 2008-07-25 KR KR1020107004151A patent/KR20100034055A/en not_active Ceased
- 2008-07-25 AU AU2008282876A patent/AU2008282876A1/en not_active Abandoned
- 2008-07-25 US US12/179,782 patent/US20090075283A1/en not_active Abandoned
- 2008-07-25 CA CA2694537A patent/CA2694537A1/en not_active Abandoned
- 2008-07-25 WO PCT/US2008/009083 patent/WO2009017692A2/en not_active Ceased
- 2008-07-25 BR BRPI0813971-7A2A patent/BRPI0813971A2/en not_active Application Discontinuation
- 2008-07-25 EP EP08794782A patent/EP2173880A2/en not_active Withdrawn
- 2008-07-25 JP JP2010519218A patent/JP2010534489A/en not_active Withdrawn
- 2008-07-25 MX MX2010000992A patent/MX2010000992A/en not_active Application Discontinuation
Non-Patent Citations (7)
| Title |
|---|
| GREGORY M.A. ET AL.: "Integration site for Streptomyces phage variant phiBT1 and development of site-specific integrating vectors." JOURNAL OF BACTERIOLOGY, vol. 185, no. 17, September 2003 (2003-09), pages 5320-5323, XP002511911 ISSN: 0021-9193 cited in the application * |
| GRINDLEY NIGEL D. F. ET AL.: "Mechanisms of site-specific recombination" ANNUAL REVIEW OF BIOCHEMISTRY, vol. 75, 2006, pages 567-605, XP002527516 ISSN: 0066-4154 * |
| HE M. ET AL.: "Isolation and characterization of meridamycin biosynthetic gene cluster from Streptomyces sp. NRRL 30748" GENE, ELSEVIER, AMSTERDAM, NL, vol. 377, 1 August 2006 (2006-08-01), pages 109-118, XP024934551 ISSN: 0378-1119 [retrieved on 2006-08-01] * |
| LIU H. ET AL.: "Rapid cloning and heterologous expression of the meridamycin biosynthetic gene cluster using a versatile Eschericia coli#Streptomyces artificial chromosome vector, pSBAC." JOURNAL OF NATURALS PRODUCTS, vol. 72, no. 3, 2009, pages 389-395, XP002527517 * |
| MARTINEZ A. ET AL.: "Genetically modified bacterial strains and novel bacterial artificial chromosome shuttle vectors for constructing environmental libraries and detecting heterologous natural products in multiple expression hosts" APPLIED AND ENVIRONMENTAL MICROBIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 70, no. 4, 1 April 2004 (2004-04-01), pages 2452-2463, XP002364447 ISSN: 0099-2240 cited in the application * |
| SOSIO M. ET AL.: "ARTIFICIAL CHROMOSOMES FOR ANTIBIOTIC-PRODUCING ACTINOMYCETES" NATURE BIOTECHNOLOGY, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 18, no. 3, 1 March 2000 (2000-03-01), pages 343-345, XP001180029 ISSN: 1087-0156 cited in the application * |
| WILD J. ET AL.: "Conditionally amplifiable BACs: switching from single-copy to high-copy vectors and genomic clones" GENOME RESEARCH, COLD SPRING HARBOR LABORATORY PRESS, WOODBURY, NY, US, vol. 2512, no. 9, 1 September 2002 (2002-09-01), pages 1434-1444, XP002463965 ISSN: 1088-9051 cited in the application * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2677034A1 (en) | 2012-06-18 | 2013-12-25 | LEK Pharmaceuticals d.d. | Genome sequence based targeted cloning of DNA fragments |
Also Published As
| Publication number | Publication date |
|---|---|
| BRPI0813971A2 (en) | 2014-10-07 |
| WO2009017692A3 (en) | 2009-07-23 |
| EP2173880A2 (en) | 2010-04-14 |
| KR20100034055A (en) | 2010-03-31 |
| MX2010000992A (en) | 2010-03-01 |
| AU2008282876A1 (en) | 2009-02-05 |
| JP2010534489A (en) | 2010-11-11 |
| US20090075283A1 (en) | 2009-03-19 |
| CA2694537A1 (en) | 2009-02-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Peng et al. | Engineered Streptomyces lividans strains for optimal identification and expression of cryptic biosynthetic gene clusters | |
| Kallifidas et al. | Rational engineering of Streptomyces albus J1074 for the overexpression of secondary metabolite gene clusters | |
| WO2017151059A1 (en) | Multiplexable activation of silent biosynthetic clusters in native actinomycete hosts for natural product discovery | |
| US20090176969A1 (en) | Cloning genes from streptomyces cyaneogriseus subsp. noncyanogenus for biosynthesis of antibiotics and methods of use | |
| Lü et al. | Engineering the erythromycin-producing strain Saccharopolyspora erythraea HOE107 for the heterologous production of polyketide antibiotics | |
| US20090075283A1 (en) | Vectors and Methods for Cloning Gene Clusters or Portions Thereof | |
| KR102561694B1 (en) | Compositions and methods for producing the compound | |
| DE69736673T2 (en) | RIFAMYCIN BIOSYNTHESIS GENKLUSTER | |
| EP3442599B1 (en) | Compositions and methods for the production of compounds | |
| US20060269528A1 (en) | Production detection and use of transformant cells | |
| Javorova et al. | A new synthetic biology system for investigating the biosynthesis of antibiotics and other secondary metabolites in streptomycetes | |
| He et al. | dTSR enables efficient improvement of heterologous production of spinosad in Saccharopolyspora erythraea | |
| Zelyas et al. | Use of the native flp gene to generate in-frame unmarked mutations in Streptomyces spp. | |
| EP1448773A2 (en) | Genetically modified bacterial strains and novel vectors for use in expressing and assaying natural products | |
| EP1751286A2 (en) | Biosynthetic gene cluster for the production of a complex polyketide | |
| Yu et al. | Functional analysis of type II thioesterase of Streptomyces lydicus AS 4.2501 | |
| WO2003106638A2 (en) | Methods and cells for improved production of polyketides | |
| Pollock | Mining and Manipulation of Antibiotic Biosynthesis in Streptomyces | |
| CN101838642A (en) | Cyclothiazomycin biosynthesis function gene cluster | |
| US20040132055A1 (en) | Recombinant chalcomycin polyketide synthase and modifying genes | |
| JP2005509431A (en) | Genetically modified bacterial strains and novel vectors for use in expression and assay of natural products | |
| Bilyk | Transposon mutagenesis in streptomycetes | |
| Gomez-Escribano et al. | 3.2. Bacterial Artificial Chromosomes and P1-derived Artificial Chromosomes | |
| He | Molecular analysis of the aureothin biosynthesis gene cluster from streptomyces thioluteus HKI-227: new insights into polyketide assemply | |
| SOCKALINGAM | GENETIC STUDIES ON A SOIL STREPTOMYCES SP. THAT PRODUCES AN ANTIFUNGAL COMPOUND |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08794782 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 203364 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008282876 Country of ref document: AU Ref document number: 2008794782 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2694537 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2010/000992 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010519218 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1036/DELNP/2010 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2008282876 Country of ref document: AU Date of ref document: 20080725 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20107004151 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010102517 Country of ref document: RU |
|
| ENP | Entry into the national phase |
Ref document number: PI0813971 Country of ref document: BR Kind code of ref document: A2 Effective date: 20100126 |





