WO2009017444A2 - Diagnosis, staging and monitoring of inflammatory bowel disease - Google Patents

Diagnosis, staging and monitoring of inflammatory bowel disease Download PDF

Info

Publication number
WO2009017444A2
WO2009017444A2 PCT/SE2008/000464 SE2008000464W WO2009017444A2 WO 2009017444 A2 WO2009017444 A2 WO 2009017444A2 SE 2008000464 W SE2008000464 W SE 2008000464W WO 2009017444 A2 WO2009017444 A2 WO 2009017444A2
Authority
WO
WIPO (PCT)
Prior art keywords
ibd
patient
sample
mrna
disease
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/SE2008/000464
Other languages
French (fr)
Other versions
WO2009017444A3 (en
Inventor
Magnus Thörn
Ola Winqvist
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
ISS Immune System Stimulation AB
Original Assignee
ISS Immune System Stimulation AB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to JP2010519171A priority Critical patent/JP2010535336A/en
Priority to EP08794093A priority patent/EP2185936A4/en
Priority to CN200880109384A priority patent/CN101815945A/en
Priority to US12/671,318 priority patent/US20110081649A1/en
Priority to EA201000131A priority patent/EA201000131A1/en
Priority to CA2695360A priority patent/CA2695360A1/en
Application filed by ISS Immune System Stimulation AB filed Critical ISS Immune System Stimulation AB
Priority to AU2008283077A priority patent/AU2008283077A1/en
Publication of WO2009017444A2 publication Critical patent/WO2009017444A2/en
Publication of WO2009017444A3 publication Critical patent/WO2009017444A3/en
Anticipated expiration legal-status Critical
Priority to ZA2010/01486A priority patent/ZA201001486B/en
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5047Cells of the immune system
    • G01N33/505Cells of the immune system involving T-cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/06Gastro-intestinal diseases
    • G01N2800/065Bowel diseases, e.g. Crohn, ulcerative colitis, IBS
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/56Staging of a disease; Further complications associated with the disease

Definitions

  • the present invention relates to diagnosis, staging, and monitoring of inflammatory bowel disease.
  • IBD Inflammatory bowel disease
  • CD Crohn's disease
  • UC ulcerative colitis
  • IBD ulcerative colitis
  • IBD IBD
  • microscopic colitis, collagenous colitis and lymphocytic colitis have been included in IBD.
  • the combination of external antigens, impaired immune reactions and hereditary factors seem to contribute to the etiology of IBD, but the mechanisms initiating the intestinal inflammation remain unclear (1). So far, many potential antigens have been proposed, for example antigens derived through intestinal CMV infection (2) and persistent measles virus infection (3).
  • mesenteric lymph nodes draining the intestinal content
  • Antigens triggering inflammation are actively transported from the intestinal wall to the lymph nodes for presentation to the immune system (1, 4).
  • Techniques have been developed to identify the first lymph nodes, which are draining pathological areas of the intestine and to harvest these nodes during surgery (5).
  • the invention discloses assays constructed to delineate the different IBD diagnoses and stages based on cell surface marker expression and mRNA expression array profiling. These patterns are related to the type and activity of intestinal inflammation, and therefore are useful for diagnosis, staging and monitoring of disease activity, including response to therapy.
  • CD and UC are the two major forms of IBD.
  • any part of the bowel can be affected, but most common is affection of the ileocaecal region (50%) and colon (30%).
  • About one third of the patients also have concomitant perianal disease.
  • Several short segments of the small bowel may be affected, often known as skip lesions.
  • Histopathologically the inflammation is transmural; dense infiltrations of lymphocytes and macrophages with granulomas are seen in up to 60 % of the patients.
  • UC usually involves the rectum, and extends in a proximal direction, the extension varying between individual patients; the disease however always remains restricted to the colon.
  • the term total colitis is used when the inflammation is also involving the right colonic flexure.
  • mucosal inflammation is superficial and rich of lymphocytes and granulocytes. Ulcerations and crypt abscesses are common (1). Along with the symptoms from the prolonged inflammation such as diarrhoea (often containing blood), malnutrition, fever and pain, the patient is also at long- term risk of developing epithelial dysplasia and finally cancer in the intestine (9). About 15% of the IBD patients have indeterminate colitis and therefore a definite diagnosis of CD or UC cannot be set. Even more important, among patients with fulminant colitis, there is often uncertainty regarding diagnosis. A correct diagnosis is important when deciding about immediate medical treatment and, in a longer time perspective, about the best surgical treatment.
  • Surgical treatments in CD include resection of inflamed segments, treatment of stenosis by strictureplasties, colonic resection of affected segments or total colectomy and ileostomy in cases with severe colitis.
  • Reconstructive surgery in CD is often an ileorectal anastomosis to restore intestinal continuity.
  • a pelvic pouch is seldom chosen due to high risk of complications related to fistula formation in the ileoanal anastomotic area.
  • Some patients end up with a permanent ileostomy. Patients with severe colitis due to UC are often treated by colectomy and ileostomy as an emergency procedure.
  • the role of the microenvironment is less clear, and the inflammation seems to be based on an autoimmune-like pathogenesis considering the dependency on immunoglobulins (IgG), the association with autoimmune disorders such as sclerosing cholangitis, the frequency of autoantibodies and the colon mucosal specificity
  • IgG immunoglobulins
  • an immune response towards the bowel may be an effect of insufficient inhibitory action of regulatory T cells (1, 4, 10).
  • Active UC is characterized by infiltration of activated granulocytes and monocytes/macrophages within the colonic mucosa. These infiltrating cells are major sources of inflammation-promoting cytokines. IBD patients may develop resistance towards medical treatment. Possible causes are changes in distribution of granulocytes, cytokines or functional characteristics of immune cells including the expression of steroid-receptors.
  • IBD Intestinal Bowel Disease
  • CD Crohn's disease
  • UC ulcerative colitis
  • the invention is based on the insight that intestinal antigens are continuously transported to the locoregional mesenteric lymph nodes by mucosal dendritic cells.
  • regulatory T cells can play a pivotal role in modulating T effector cells, thus preventing response to normal antigens.
  • T helper cells type 1 which are characterized by the production of cytokines such as IL- 12, IFN-gamma and TNF-alpha.
  • the inflammatory site is dominated by cell-mediated infiltration of macrophages and cytotoxic T effector cells (CD8+). This type of inflammation resembles the lesions in CD.
  • Th 2 T helper cells type 2
  • the humoral immune defense system immunoglobulins
  • cytotoxic T cells and cytokines such as IL-4 and IL- 5 as well as IgGl that are seen in the inflammatory sites.
  • Th 2 type inflammation shares features with human UC.
  • the present invention is disclosed a method of differentiating between Crohn's disease and ulcerative colitis in an IBD patient by submitting single cells isolated from biopsy samples of inflamed tissue to multicoloured flow cytometry.
  • the determination of activation markers and cytokine production allows the status of the local immune response to be determined with high precision.
  • the method of the invention is also useful for staging and for the evaluation of therapy in IBD-patients.
  • a method of determining the presence of IBD in a person comprising providing a biopsy sample from distal ileal or colonic mucosa suspected to be diseased or from a sentinel lymph node draining said distal ileal or colonic mucosa, determining the number of CD4 T cells expressing the CD 69 activation marker, and comparing said number of CD4 T cells with the number of corresponding T cells obtained from healthy persons and from persons having IBD in an active or inactive state.
  • a method of differentiating between ulcerative colitis and Crohn's disease in an IBD patient comprises providing a biopsy sample from diseased intestinal mucosa or a sentinel lymph node draining such mucosa, determining one or more of cytokines produced in immune activation driven by activated T helper cells type 1 (ThI) indicative of CD and one or more of cytokines produced in immune activation driven by activated T helper cells type 2 (Th2) indicative of UC, and comparing the amount of ThI and Th2 cytokines with the amounts usually found in patients having manifest CD and/or UC.
  • ThI activated T helper cells type 1
  • Th2 activated T helper cells type 2
  • Preferred ThI cytokines comprise IL- 12, IFN- ⁇ and TNF- ⁇ , in particular IFN- ⁇ .
  • Preferred Th2 cytokines comprise IL-4 and IL- 5, in particular IL-4. In this method it is also preferred to independently or additionally determine IgGl as a marker for Crohn's disease.
  • mRNA expression profiling (13) of immune cells from IBD biopsies is used for diagnosis, staging, therapy and monitoring of therapy in IBD.
  • a method of determining the susceptibility of an IBD patient to steroid treatment comprising determination of glucocorticoid receptor expression in CD4+ T helper cells obtained from said patient.
  • Staging relates to the determination of the activation stage, severity of inflammation, type of inflammation, etc., in IBD
  • monitoring relates to monitoring the development of IBD in a patient.
  • Fig. 1 is a graph showing the investigation of single cell suspensions of biopsies from patients with active or inactive UC and from healthy controls using flow cytometry and antibodies against CD4 and the activation marker CD69, the mean fluorescent intensity on CD4+ cells being set off on the y-axis;
  • Fig. 2 is a graph correlating the percentage of activated CD69+CD4+ T cells seen in flow cytometry (FACS) investigated biopsies from healthy controls, patients with active and inactive UC and patients with inactive CD;
  • Fig. 3 is a graph correlating the IBD score of patients with different stages of disease with the percentage of activated CD69+CD4+ T cells in FACS investigated biopsies;
  • Fig. 4 is a graph showing the production of IFN- ⁇ in cultured supernatants from non-sentinel node, sentinel node 1 and sentinel node 2 draining the inflammatory area of a CD patient;
  • Fig. 5 is a graph showing the production of IL-4 in cultured supernatants from non-sentinel nodes (NSLN) and sentinel nodes (SLN) draining the inflammatory area of a UC patient;
  • Fig. 6 is a graph showing decreased expression of intracellular levels of glucocorticoid receptors in CD4+ T helper cells from patients with IBD not responding to glucocorticoid treatment;
  • Fig. 7 is a graph showing increased Tbet expression in CD4+ T helper cells from the intestinal tract of a patient with active CD, whereas Tbet expression in an inactive phase is low;
  • Fig. 8 is a graph showing increased Tbet expression in CD4+ T helper cells from the intestinal tract from a patient with active CD, whereas Tbet expression in an inactive phase is low. Furthermore, Tbet expression in CD4+ T helper cells from a patient with UC is low compared to the Tbet expression seen in active CD;
  • Fig. 9 is a graph showing increased GATA-3 expression in CD4+ T helper cells from the intestinal tract from a patient with active UC, whereas GATA-3 expression in an inactive phase is low.
  • Analyses of expression of glucocorticoid receptor were performed using a mouse anti human glucocorticoid receptor antibody followed by an anti-mouse IgG FITC conjugated detection antibody of saponin permeabilized single cells.
  • RNA isolation from single cell suspensions was performed using TRIZOL reagent
  • RNA was subjected to cDNA synthesis, FAM labelling and thereafter to analysed using an Affymetrix human array chip.
  • the patient's IBD score comprising S-albumin, CRP and the number of stools containing blood/day with the flow cytometry profile is shown in Fig 3.
  • the number of CD4+ T cells expressing the CD69 activation marker correlated well with the IBD score (SEO index).
  • SEO-index was utilized to correlate the results with disease activity. This index uses clinical (stool frequency and hematochezia) and laboratory parameters (Hb, albumin and erythrocyte sedimentation rate). In our material erythrocyte sedimentation rate was replaced by CRP (C- reactive protein).
  • the determination of the immune response and cytokine patterns in the sentinel nodes draining lesional areas of the intestine and in nodes draining unaffected segments in both CD and UC according to the invention suggests that the release of cytokines can be used in CD and UC diagnosis.
  • markers allow to differentiate between CD and UC also in fulminant colitis where a correct diagnosis often is difficult.
  • Information obtained from intestinal biopsies may be used to provide a correct diagnosis early, in order to tailor medical treatment more precisely and to prevent surgical intervention with total colectomy and ileostomy in some patients.
  • multicoloured flow cytometry analysis of activation markers of other immune cells such as neutrophils, eosinophils, NK cells, NKT cells, T regulatory cells, and B cells can be useful in the diagnosis, staging and monitoring of IBD.
  • steroid receptor expression profile It is a well-known problem that some patients with IBD may become resistant to steroid treatment. According to the present invention is disclosed an investigation of steroid receptor-expression profile in IBD-patients using Western blot or intracellular flow cytometry of single cells from biopsies to determine whether these cells are sensitive to steroid treatment. Intestinal biopsies or single cell suspensions from patients with steroid sensitive responses or patients not sensitive to steroid treatment were investigated by intracellular flow cytometry for the degree of steroid receptor expression. All patients with steroid refractory IBD expressed lower levels of glucocorticoid receptor, whereas patients who responded with intestinal healing and lower SEO index upon steroid treatment expressed higher levels (Fig. 6). Thus, expression levels of steroid receptors in intestinal lymphocytes correlate with susceptibility to treatment.
  • Cytokine expression array profiling According to the invention a more detailed picture of the cytokine expression pattern of immune cells in biopsies from IBD patients is obtained by expression array profiling. This kind of profiling was performed using a 20 k Affymetrix chip. The ThI activation pattern found in CD patients seems to be caused by up-regulation of the mRNAs for CD69 and Tbet, IFN- ⁇ and TIM-3. On the contrary, a Th2 expression pattern is seen in UC patients where, in addition to CD69, the up-regulation of GATA-3 and IL-4, IL-5 was noted. The array findings were verified by real time quantitative PCR (QT-PCR). Accordingly, cells from CD patients displayed a higher expression level of the Tbet transcript (Fig.
  • ThI dominance in CD can be predicted by increased expression of Tbet, IFN- ⁇ and TIM-3. Consequently, Th2 dominance and UC can be predicted by the increased expression of the GATA-3 and IL-4, IL-5 transcripts.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)

Abstract

A method of differentiating between active and inactive IBD in a gastrointestinal mucosa sample or a sample from a sentinel lymph node draining gastrointestinal mucosa comprises preparing a suspension of single cells from the sample, analyzing the suspension for expression of the inflammation activation marker CD69 on CD4+ T helper cells using directly labelled fluorescent DC69 antibody; comparing the number of T helper cells expressing DC69 in the sample with that obtained from a corresponding sample of a healthy person, a significantly increased level of T helper cells expressingCDD69 signifying the presence of active IBD and a less than significantly increased level of T helper cells signifying the presence of inactive IBD. Also disclosed are methods of differentiating between ulcerative colitis (UC) and Crohn's disease (CD), of detecting UC and CD, and of determining the susceptibility of an IBD patient to steroid treatment.

Description

DIAGNOSIS, STAGING AND MONITORING OF INFLAMMATORY BOWEL DISEASE
FIELD OF THE INVENTION
The present invention relates to diagnosis, staging, and monitoring of inflammatory bowel disease.
BACKGROUND OF THE INVENTION
Inflammatory bowel disease (IBD) comprises Crohn's disease (CD) and ulcerative colitis (UC), both cause long-term damage to the intestine. Recently, microscopic colitis, collagenous colitis and lymphocytic colitis have been included in IBD. The combination of external antigens, impaired immune reactions and hereditary factors seem to contribute to the etiology of IBD, but the mechanisms initiating the intestinal inflammation remain unclear (1). So far, many potential antigens have been proposed, for example antigens derived through intestinal CMV infection (2) and persistent measles virus infection (3).
Most likely, mesenteric lymph nodes, draining the intestinal content, are crucial loci for the initiation and maintenance of inflammation in IBD. Antigens triggering inflammation are actively transported from the intestinal wall to the lymph nodes for presentation to the immune system (1, 4). Techniques have been developed to identify the first lymph nodes, which are draining pathological areas of the intestine and to harvest these nodes during surgery (5). The invention discloses assays constructed to delineate the different IBD diagnoses and stages based on cell surface marker expression and mRNA expression array profiling. These patterns are related to the type and activity of intestinal inflammation, and therefore are useful for diagnosis, staging and monitoring of disease activity, including response to therapy.
In Sweden, 1400 new persons are diagnosed with IBD every year. The number of newly diagnosed persons has been increasing in recent years. The IBD peak incidence occurs at 20 years of age (6,7). The intestine is an intricate microenvironment where immunocompetent cells meet with a broad variety of endogenous and exogenous factors. These interactions nurture a continuous, low grade inflammation reflected by the abundance of T cells in the lamina propria (8). T cells are constantly ready to act against harmful pathogens but they ignore innocuous dietary antigens or members of the normal resident bacterial flora. When the balance between tolerance and response in the intestinal immune system is abrogated, the consequence may be IBD.
CD and UC are the two major forms of IBD. In CD, any part of the bowel can be affected, but most common is affection of the ileocaecal region (50%) and colon (30%). About one third of the patients also have concomitant perianal disease. Several short segments of the small bowel may be affected, often known as skip lesions. Histopathologically, the inflammation is transmural; dense infiltrations of lymphocytes and macrophages with granulomas are seen in up to 60 % of the patients. UC usually involves the rectum, and extends in a proximal direction, the extension varying between individual patients; the disease however always remains restricted to the colon. The term total colitis is used when the inflammation is also involving the right colonic flexure. Microscopically, mucosal inflammation is superficial and rich of lymphocytes and granulocytes. Ulcerations and crypt abscesses are common (1). Along with the symptoms from the prolonged inflammation such as diarrhoea (often containing blood), malnutrition, fever and pain, the patient is also at long- term risk of developing epithelial dysplasia and finally cancer in the intestine (9). About 15% of the IBD patients have indeterminate colitis and therefore a definite diagnosis of CD or UC cannot be set. Even more important, among patients with fulminant colitis, there is often uncertainty regarding diagnosis. A correct diagnosis is important when deciding about immediate medical treatment and, in a longer time perspective, about the best surgical treatment. Surgical treatments in CD include resection of inflamed segments, treatment of stenosis by strictureplasties, colonic resection of affected segments or total colectomy and ileostomy in cases with severe colitis. Reconstructive surgery in CD is often an ileorectal anastomosis to restore intestinal continuity. A pelvic pouch is seldom chosen due to high risk of complications related to fistula formation in the ileoanal anastomotic area. Some patients end up with a permanent ileostomy. Patients with severe colitis due to UC are often treated by colectomy and ileostomy as an emergency procedure. About six months later either an ileorectal anastomosis or pelvic pouch can be chosen as definite surgical treatment but in some cases a permanent ileostomy may be the only possible solution. Several lines of evidence imply that CD is a consequence of a disruption of tolerance towards the normal enteric flora. In humans, it has been shown that mononuclear cells in the lamina propria of patients respond to autologous faecal extracts, which is not the case in normal controls (10). The dependency on antigen for the T cell stimulation is apparent from observations of in vitro proliferation of lymphocytes from CD patients against sonicates of autologous intestinal bacteria, where the proliferation was inhibited by anti-MHC class II antibodies (11). Regarding UC, the role of the microenvironment is less clear, and the inflammation seems to be based on an autoimmune-like pathogenesis considering the dependency on immunoglobulins (IgG), the association with autoimmune disorders such as sclerosing cholangitis, the frequency of autoantibodies and the colon mucosal specificity
(12). Hypothetically, an immune response towards the bowel may be an effect of insufficient inhibitory action of regulatory T cells (1, 4, 10).
Active UC is characterized by infiltration of activated granulocytes and monocytes/macrophages within the colonic mucosa. These infiltrating cells are major sources of inflammation-promoting cytokines. IBD patients may develop resistance towards medical treatment. Possible causes are changes in distribution of granulocytes, cytokines or functional characteristics of immune cells including the expression of steroid-receptors.
Today, the diagnosis and staging of IBD are based on a combination of clinical parameters, (albumin, SR, CRP, fever, number of stools) together with endoscopic criteria and histopathology. The inflammatory activity is evaluated by microscopy but only the general types and numbers of cells present in the biopsy are taken under consideration. Activation characteristics are not determined.
OBJECTS OF THE INVENTION
It is an object of the invention to provide a method capable of differentiating between active and inactive Intestinal Bowel Disease (IBD).
It is another object of the invention to provide a method of diagnosis capable of differentiating between Crohn's disease (CD) and ulcerative colitis (UC) in an IBD patient. It is further object of the invention to provide a method capable of differentiating between Crohn's disease and ulcerative colitis in a patient with indeterminate colitis.
Additional objects of the invention will become evident from the study of a summary of the invention, of preferred embodiments thereof illustrated in a drawing and the appended claims.
SUMMARY OF THE INVENTION
The invention is based on the insight that intestinal antigens are continuously transported to the locoregional mesenteric lymph nodes by mucosal dendritic cells. In this process regulatory T cells can play a pivotal role in modulating T effector cells, thus preventing response to normal antigens.
In animal models two distinct pathways for T effector cell response can be distinguished. The first type of immune initiation is driven by activated T helper cells type 1 (ThI), which are characterized by the production of cytokines such as IL- 12, IFN-gamma and TNF-alpha. The inflammatory site is dominated by cell-mediated infiltration of macrophages and cytotoxic T effector cells (CD8+). This type of inflammation resembles the lesions in CD. In the T helper cells type 2 (Th 2) immune activation, the humoral immune defense system (immunoglobulins) plays an important role in conjunction with cytotoxic T cells and cytokines such as IL-4 and IL- 5 as well as IgGl that are seen in the inflammatory sites. In animal models, Th 2 type inflammation shares features with human UC.
According to the present invention is disclosed a method of differentiating between Crohn's disease and ulcerative colitis in an IBD patient by submitting single cells isolated from biopsy samples of inflamed tissue to multicoloured flow cytometry. The determination of activation markers and cytokine production allows the status of the local immune response to be determined with high precision. The method of the invention is also useful for staging and for the evaluation of therapy in IBD-patients.
According to a first preferred aspect of the invention is provided a method of determining the presence of IBD in a person, the method comprising providing a biopsy sample from distal ileal or colonic mucosa suspected to be diseased or from a sentinel lymph node draining said distal ileal or colonic mucosa, determining the number of CD4 T cells expressing the CD 69 activation marker, and comparing said number of CD4 T cells with the number of corresponding T cells obtained from healthy persons and from persons having IBD in an active or inactive state.
According to a second preferred aspect of the invention is provided a method of differentiating between ulcerative colitis and Crohn's disease in an IBD patient. The method comprises providing a biopsy sample from diseased intestinal mucosa or a sentinel lymph node draining such mucosa, determining one or more of cytokines produced in immune activation driven by activated T helper cells type 1 (ThI) indicative of CD and one or more of cytokines produced in immune activation driven by activated T helper cells type 2 (Th2) indicative of UC, and comparing the amount of ThI and Th2 cytokines with the amounts usually found in patients having manifest CD and/or UC. Preferred ThI cytokines comprise IL- 12, IFN-γ and TNF-α, in particular IFN-γ. Preferred Th2 cytokines comprise IL-4 and IL- 5, in particular IL-4. In this method it is also preferred to independently or additionally determine IgGl as a marker for Crohn's disease.
According to a preferred aspect of the invention mRNA expression profiling (13) of immune cells from IBD biopsies is used for diagnosis, staging, therapy and monitoring of therapy in IBD.
According to a further preferred aspect of the invention is disclosed a method of determining the susceptibility of an IBD patient to steroid treatment, comprising determination of glucocorticoid receptor expression in CD4+ T helper cells obtained from said patient.
In this application "staging" relates to the determination of the activation stage, severity of inflammation, type of inflammation, etc., in IBD, whereas "monitoring" relates to monitoring the development of IBD in a patient.
Further preferred aspects of the invention are disclosed in the following description of preferred embodiments thereof illustrated in a drawing comprising a number of figures, and in the appended claims. SHORT DESCRIPTION OF THE FIGURES
The invention will now be explained in more detail by reference to a number of preferred embodiments illustrated in a drawing, in which
Fig. 1 is a graph showing the investigation of single cell suspensions of biopsies from patients with active or inactive UC and from healthy controls using flow cytometry and antibodies against CD4 and the activation marker CD69, the mean fluorescent intensity on CD4+ cells being set off on the y-axis;
Fig. 2 is a graph correlating the percentage of activated CD69+CD4+ T cells seen in flow cytometry (FACS) investigated biopsies from healthy controls, patients with active and inactive UC and patients with inactive CD;
Fig. 3 is a graph correlating the IBD score of patients with different stages of disease with the percentage of activated CD69+CD4+ T cells in FACS investigated biopsies;
Fig. 4 is a graph showing the production of IFN-γ in cultured supernatants from non-sentinel node, sentinel node 1 and sentinel node 2 draining the inflammatory area of a CD patient;
Fig. 5 is a graph showing the production of IL-4 in cultured supernatants from non-sentinel nodes (NSLN) and sentinel nodes (SLN) draining the inflammatory area of a UC patient;
Fig. 6 is a graph showing decreased expression of intracellular levels of glucocorticoid receptors in CD4+ T helper cells from patients with IBD not responding to glucocorticoid treatment;
Fig. 7 is a graph showing increased Tbet expression in CD4+ T helper cells from the intestinal tract of a patient with active CD, whereas Tbet expression in an inactive phase is low; Fig. 8 is a graph showing increased Tbet expression in CD4+ T helper cells from the intestinal tract from a patient with active CD, whereas Tbet expression in an inactive phase is low. Furthermore, Tbet expression in CD4+ T helper cells from a patient with UC is low compared to the Tbet expression seen in active CD;
Fig. 9 is a graph showing increased GATA-3 expression in CD4+ T helper cells from the intestinal tract from a patient with active UC, whereas GATA-3 expression in an inactive phase is low.
DETAILED DESCRIPTION OF THE INVENTION
Materials and Methods
Single cell suspensions were made from fresh biopsies. Flow cytometry (FACS) was performed using directly labelled fluorescent antibodies CD4, CD8, CD69, CD25, CD14, CD9, CD66b, CD 19 using FITC, PE, PerCp, APC conjugates in combinations of four. Isotype antibodies where used as controls. In CD and UC sentinel nodes draining inflamed bowel and unaffected normal bowel were identified using a tracer substance, Patent Blue, injected around the area of inflammation for comparative analyses. A venous blood sample was also collected from each patient.
Analyses of cytokines IL-4 and IFN-γ were performed on single cell cultured supernatants from biopsies or sentinel nodes using sandwich ELISA (R&D systems).
Analyses of expression of glucocorticoid receptor were performed using a mouse anti human glucocorticoid receptor antibody followed by an anti-mouse IgG FITC conjugated detection antibody of saponin permeabilized single cells.
RNA isolation from single cell suspensions was performed using TRIZOL reagent
(Invitrogen, Cat. No. 15596-026). 100 ng RNA per sample was included in a reverse transcriptase reaction using iScript™cDNA Synthesis Kit according to manufacturer's protocol. Quantitative PCR was performed on an iCyclerlQ using 2X IQ™ SYBR® Green Supermix. Cycle thresholds were obtained using iCycler IQ™ Optical System Software Version 3.1 from BIO-RAD. Expression levels were normalized to RPII using the 2"ΔΔCt method. Alternatively isolated RNA was subjected to cDNA synthesis, FAM labelling and thereafter to analysed using an Affymetrix human array chip.
Primer sequences QT-PCR:
IFNγ QT Fwrd GCAGGTCATTCAGATGTAGCGG
IFNγ QT Rev TGTCTTCCTTGATGGTCTCCACAC IL-4 QT Fwrd CACAACTGAGAAGGGAAACCTTCTG
IL-4 QT Rev CTCTCTCATGATCGTCTTTAGCCTTTC
T-bet QT Fwrd CACTACAGGATGTTTGTGGACGTG
T-bet QT Rev CCCCTTGTTGTTTGTGAGCTTTAG
GATA3 QT Fwrd AACTGTCAGACCACCACAACCACAC GATA3 QT Rev GGATGCCTTCCTTCTTCATAGTCAGG
EXAMPLE 1
Investigation of immune cells in the mucosa or in the sentinel lymph nodes draining an area affected by IBD. Investigation by flow cytometry of immune cells in the mucosa or in the sentinel lymph nodes draining an area affected by IBD demonstrates that, in comparison with healthy controls, there is a significantly increased (p<0.009) expression of the activation marker CD69 on CD4+ T helper cells (Fig. 1) and of CD8+ cytotoxic T cells in patients with active IBD. Patients with inactive IBD (in the judgment of a competent pathologist) nevertheless display a significantly increased activation (p<0.03) of CD4+ T cells (Fig. 1) in addition to the increased expression of the activation marker CD69. The number of CD4+ CD69+ T cells is also increased in patients with active IBD (Fig. 2) both in ulcerative colitis and Crohn's disease in comparison with healthy controls and patients with reported inactive IBD. EXAMPLE 2
Correlation of the patients ' IBD score with the flow cytometry profile. The patient's IBD score comprising S-albumin, CRP and the number of stools containing blood/day with the flow cytometry profile is shown in Fig 3. The number of CD4+ T cells expressing the CD69 activation marker correlated well with the IBD score (SEO index).
SEO-index was utilized to correlate the results with disease activity. This index uses clinical (stool frequency and hematochezia) and laboratory parameters (Hb, albumin and erythrocyte sedimentation rate). In our material erythrocyte sedimentation rate was replaced by CRP (C- reactive protein).
EXAMPLE 3
Immune response in the sentinel nodes draining lesional areas of the intestine and in nodes draining unaffected segments in both CD and UC. Currently, the immune reaction in CD is regarded as a ThI response, while UC may resemble an atypical Th2 activation. This view seems to be mainly based on animal models simulating colitis by artificial means. In humans, the characterization of the inflammatory pathways in IBD is limited; perfusion studies from the colon as well as the analysis of peripheral blood cells support some of the observations from animal models, but the general picture of the pathophysiology is incomplete. The determination of the immune response and cytokine patterns in the sentinel nodes draining lesional areas of the intestine and in nodes draining unaffected segments in both CD and UC according to the invention suggests that the release of cytokines can be used in CD and UC diagnosis.
By prevailing standards 15 % of IBD patients are considered to have indeterminate colitis, i.e. a definite diagnosis cannot be set. A correct diagnosis is however nevertheless important in deciding upon further treatment. Also, it is often impossible to differ between CD and UC in fulminant colitis, which may delay adequate medical treatment, and necessitate early surgical intervention with colectomy. High amounts of IFN-γ have now been identified in gastrointestinal inflammatory sites of patients with CD (Fig. 4). In contrast, gastrointestinal inflammatory sites of patients with UC have been found to contain high amounts of the Th2 cytokine IL-4 (Fig. 5). These findings allow to correlate a high IFN-γ content in a gastrointestinal biopsy sample with CD, and the production of high amounts of IL-4 with UC. These markers allow to differentiate between CD and UC also in fulminant colitis where a correct diagnosis often is difficult. Information obtained from intestinal biopsies may be used to provide a correct diagnosis early, in order to tailor medical treatment more precisely and to prevent surgical intervention with total colectomy and ileostomy in some patients.
In a similar manner multicoloured flow cytometry analysis of activation markers of other immune cells such as neutrophils, eosinophils, NK cells, NKT cells, T regulatory cells, and B cells can be useful in the diagnosis, staging and monitoring of IBD.
EXAMPLE 4
Determination of steroid receptor expression profile. It is a well-known problem that some patients with IBD may become resistant to steroid treatment. According to the present invention is disclosed an investigation of steroid receptor-expression profile in IBD-patients using Western blot or intracellular flow cytometry of single cells from biopsies to determine whether these cells are sensitive to steroid treatment. Intestinal biopsies or single cell suspensions from patients with steroid sensitive responses or patients not sensitive to steroid treatment were investigated by intracellular flow cytometry for the degree of steroid receptor expression. All patients with steroid refractory IBD expressed lower levels of glucocorticoid receptor, whereas patients who responded with intestinal healing and lower SEO index upon steroid treatment expressed higher levels (Fig. 6). Thus, expression levels of steroid receptors in intestinal lymphocytes correlate with susceptibility to treatment.
EXAMPLE 5
Cytokine expression array profiling. According to the invention a more detailed picture of the cytokine expression pattern of immune cells in biopsies from IBD patients is obtained by expression array profiling. This kind of profiling was performed using a 20 k Affymetrix chip. The ThI activation pattern found in CD patients seems to be caused by up-regulation of the mRNAs for CD69 and Tbet, IFN-γ and TIM-3. On the contrary, a Th2 expression pattern is seen in UC patients where, in addition to CD69, the up-regulation of GATA-3 and IL-4, IL-5 was noted. The array findings were verified by real time quantitative PCR (QT-PCR). Accordingly, cells from CD patients displayed a higher expression level of the Tbet transcript (Fig. 8), whereas the GATA-3 transcript was elevated in cells from patients with UC (Fig. 9). The expression of Tbet was furthermore found to be substantially increased in patients with CD in an active phase (Fig. 7). Therefore, based on a panel of expression profiles, ThI dominance in CD can be predicted by increased expression of Tbet, IFN-γ and TIM-3. Consequently, Th2 dominance and UC can be predicted by the increased expression of the GATA-3 and IL-4, IL-5 transcripts.
References
1. Bouma G, Strober W. The immunological and genetic basis of inflammatory bowel disease. Nature Reviews Immunology 2003; 3: 521-533. 2. Rahbar A, Bostrδm L, Lagerstedt U, Magnusson I, Sδderberg-Naucler C,
Sundqvist VA. Evidence of active cytomegalovirus infection and increased production of IL- 6 in tissue specimens obtained from patients with inflammatory bowel diseases. Inflamm Bowel Dis 2003; 3:154-61.
3. Wakefield E, AJ, Ekblom A, Dhillon AP, Pittilo RM, Pounder RE. Crohn 's disease: pathogenesis and persistent measles virus infection. Gastroenterology 108:911-916,
1995.
4. Toms C, Powrie F. Control of intestinal inflammation by regulatory T cells. Microbes and infection. 2001 ; 3: 929-935.
5. Thorn M. Lymphatic mapping and sentinel node biopsy: is the method applicable to patients with colorectal and gastric cancer? Eur J Surg. 2000; 166: 755-758.
6. Lapidus A, Bernell O, Hellers G, Persson PG, Lδfberg R. Incidence of Crohn's disease in Stockholm County 1955-1989. Gut. 1997; 41 : 480-486.
7. Tysk C, Jarnerot G. Ulcerative proctocolitis in Orebro, Sweden. A retrospective epidemiologic study, 1963-1987. Scand J Gastroenterol. 1992; 27: 945-50. 8. Wittig BM, Zeitz M. The gut as an organ of immunology. International Journal of Colorectal Disease. 2002: e-journal.
9. Ekbom A, Helmick C, Zack M, Adami HO. Ulcerative colitis and colorectal cancer. A population-based study. N Engl J Med 1990; 323: 1228-33. 10. Strober W, Kelsall, B. To be responsive or not to be responsive, that is the mucosal question. Gastroenterology 1998; 114: 214-217.
1 1. Duchmann R, Kaiser I, Hermann E, Mayet W, Ewe K, Meyer-zum- Buschenfelde KH. Tolerance exists towards resident intestinal flora but is broken in active inflammatory bowel disease. Clin Exp Immunol 1995; 102: 448-455.
12. Macdonald TT, Monteleone G, Pender SLF. Recent developments in the immunology of inflammatory bowel disease. Scan J Immunol. 2000; 51 : 2-9.
13. DeRisi J, Penland L, Brown PO, Bittner ML, Meltzer PS, Ray M, Chen Y, Su YA, Trent JM. Use of a cDNA microarray to analyse gene expression patterns in human cancer. Nat Genet. 1996 14(4):457-60.

Claims

C l a i m s
1. A method of differentiating between active and inactive IBD in a patient, comprising providing a biopsy sample of gastrointestinal mucosa, in particular distal ileal or colonic mucosa, suspected to be diseased or from a sentinel lymph node draining said gastrointestinal mucosa; preparing a suspension of single cells from the sample; analyzing the suspension of single cells for expression of the inflammation activation marker CD69 on CD4+ T helper cells using directly labelled fluorescent CD69 antibody; comparing the number of T helper cells expressing CD69 so determined with the number of T helper cells expressing CD69 determined in a corresponding suspension of single cells obtained from intestinal tissue of a healthy person; wherein a significantly increased level of T helper cells expressing CD69 signifies the presence of active IBD, whereas a less significantly increased level of T signifies the presence of inactive IBD.
2. The method of claim 1 , wherein analysis is by flow cytometry.
3. The method of claim 1 or 2, wherein the antibody is a directly labelled antibody.
4. The method of any of claims 1 to 3, wherein the antibody is a fluorescent antibody.
5. The method of any of claims 1 to 4, wherein said significantly increased level is characterized by p<0.009.
6. The method of any of claims 1 to 5, wherein said less significantly increased level is characterized by 0.03<p>0.009.
7. A method of differentiating between ulcerative colitis and Crohn's disease in an IBD patient, comprising providing a patient biopsy sample obtained from diseased intestinal mucosa or a sentinel lymph node draining such mucosa, preparing a suspension of single cells from the sample; determining in the suspension or a supernatant thereof one or more of cytokines produced in immune activation driven by activated T helper cells type 1 (ThI) indicative of Crohn's disease and one or more of cytokines produced in immune activation driven by activated T helper cells type 2 (Th2) indicative of ulcerative colitis, comparing the determined amounts of ThI and Th2 cytokines with corresponding amounts found in patients having manifest Crohn's disease and/or ulcerative colitis.
8. The method of claim 7, wherein a cytokine produced in immune activation driven by activated T helper cells type 1 is selected from IL- 12, IFN-γ and TNF-α.
9. The method of claim 7 or 8, wherein a cytokine produced in immune activation driven by activated T helper cells type 2 is selected from IL-4 and IL-5.
10. The method of any of claims 7 to 9, additionally comprising determining IgGl in the sample as a marker for Crohn's disease.
11. The method of claim 8, wherein any of IL- 12, IFN-γ and TNF-α is determined in said supernatant.
12. The method of claim 9, wherein any of IL-4 and IL-5 is determined in said supernatant.
13. A method of determining the presence of Crohn's disease in a patient, comprising providing a biopsy sample of gastrointestinal mucosa, in particular distal ileal or colonic mucosa, suspected to be diseased or from a sentinel lymph node draining said gastrointestinal mucosa; preparing a suspension of single cells from the sample; isolating mRNA from the cell suspension; analyzing the isolated mRNA for mRNA of two or more of CD69, Tbet, IFN-γ, TIM-3; comparing the result with that of the analysis of mRNA of corresponding two or more of CD69, Tbet, IFN-γ, TIM-3 in correspondingly obtained mRNA from a healthy person, up-regulation of two or more of mRNA of CD69, Tbet, IFN-γ, TIM-3 in the patient mRNA sample being indicative of Crohn's disease.
14. Use of the method of claim 13 in staging of Crohn's disease or in monitoring therapy in Crohn's disease.
15. A method of determining the presence of ulcerative colitis in a patient, comprising providing a biopsy sample of gastrointestinal mucosa, in particular distal ileal or colonic mucosa, suspected to be diseased or from a sentinel lymph node draining said gastrointestinal mucosa; preparing a suspension of single cells from the sample; isolating mRNA from the cell suspension; analyzing the isolated mRNA for mRNA of two or more of CD69, GATA-3, IL-4, IL-5; comparing the result with that of the analysis of mRNA of corresponding two or more of CD69, GATA-3, IL-4, IL-5 in correspondingly obtained mRNA from a healthy person, up-regulation of two or more of mRNA of CD69, GATA-3, IL-4, IL-5 in the patient mRNA sample being indicative of ulcerative colitis.
16. Use of the method of claim 15 in staging of ulcerative colitis or monitoring therapy in ulcerative colitis.
17. Use of Tbet expression in a biopsy sample as a marker for staging of Crohn's disease in a patient from whom the sample has been taken.
18. Use of Tbet expression in a biopsy sample as a marker for differentiating between an active and an inactive phase of Crohn's disease in a patient from whom the sample has been taken.
19. Use of GATA-3 expression in a biopsy sample as a marker for differentiating between an active and an inactive phase of ulcerative colitis in a patient from whom the sample has been taken.
20. A method of determining the susceptibility of an IBD patient to steroid treatment, comprising determination of glucocorticoid receptor expression in CD4+ T helper cells obtained from said patient.
21. The method of claim 20, wherein said determined expression is compared with a corresponding expression in an IBD patient or a group of IBD patients responding to steroid treatment and/or in an IBD patient or a group of IBD patients not responding to steroid treatment.
22. The method of claim 21, wherein a 50 percent increase of said determined expression in said IBD patient in respect of the average expression in a group of non- responding IBD patients is indicative by 80 percent or more of said patient being susceptible to steroid treatment.
23. The method of claim 22, wherein the only criteria for selecting said group of non- responding IBD patients is their unresponsiveness to steroid treatment.
PCT/SE2008/000464 2007-08-02 2008-07-29 Diagnosis, staging and monitoring of inflammatory bowel disease Ceased WO2009017444A2 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP08794093A EP2185936A4 (en) 2007-08-02 2008-07-29 Diagnosis, staging and monitoring of inflammatory bowel disease
CN200880109384A CN101815945A (en) 2007-08-02 2008-07-29 Diagnosis, staging and monitoring of inflammatory bowel disease
US12/671,318 US20110081649A1 (en) 2007-08-02 2008-07-29 Diagnosis, staging and monitoring of inflammatory bowel disease
EA201000131A EA201000131A1 (en) 2007-08-02 2008-07-29 DIAGNOSTIC, DETERMINATION OF THE STAGE AND MONITORING OF THE INFLAMMATORY DISEASE OF THE INTESTINE
CA2695360A CA2695360A1 (en) 2007-08-02 2008-07-29 Diagnosis, staging and monitoring of inflammatory bowel disease
JP2010519171A JP2010535336A (en) 2007-08-02 2008-07-29 Diagnosis, staging, and monitoring of inflammatory bowel disease
AU2008283077A AU2008283077A1 (en) 2007-08-02 2008-07-29 Diagnosis, staging and monitoring of inflammatory bowel disease
ZA2010/01486A ZA201001486B (en) 2007-08-02 2010-03-01 Diagnosis,staging and monitoring of inflammatory bowel disease

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SE0701807-0 2007-08-02
SE0701807 2007-08-02

Publications (2)

Publication Number Publication Date
WO2009017444A2 true WO2009017444A2 (en) 2009-02-05
WO2009017444A3 WO2009017444A3 (en) 2009-03-19

Family

ID=40305076

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SE2008/000464 Ceased WO2009017444A2 (en) 2007-08-02 2008-07-29 Diagnosis, staging and monitoring of inflammatory bowel disease

Country Status (10)

Country Link
US (1) US20110081649A1 (en)
EP (1) EP2185936A4 (en)
JP (1) JP2010535336A (en)
KR (1) KR20100063052A (en)
CN (1) CN101815945A (en)
AU (1) AU2008283077A1 (en)
CA (1) CA2695360A1 (en)
EA (1) EA201000131A1 (en)
WO (1) WO2009017444A2 (en)
ZA (1) ZA201001486B (en)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011127351A1 (en) * 2010-04-09 2011-10-13 Exagen Diagnostics, Inc. Biomarkers for ulcerative colitis and crohn's disease
JP2011254810A (en) * 2010-05-12 2011-12-22 En Otsuka Pharmaceutical Co Ltd Classification of crohn disease activity
WO2012012725A2 (en) 2010-07-23 2012-01-26 President And Fellows Of Harvard College Methods of detecting diseases or conditions using phagocytic cells
CN103069276A (en) * 2010-08-05 2013-04-24 D.M.G.意大利有限公司 Use of hmgb1 as' a biological marker of bowel inflammatory conditions, non-invasive method for its detection in fecal samples and kit thereof
US8852581B2 (en) 2005-08-31 2014-10-07 Ith Immune Therapy Holdings Ab Treatment of inflammatory bowel disease
US10494675B2 (en) 2013-03-09 2019-12-03 Cell Mdx, Llc Methods of detecting cancer
US10626464B2 (en) 2014-09-11 2020-04-21 Cell Mdx, Llc Methods of detecting prostate cancer
US10934589B2 (en) 2008-01-18 2021-03-02 President And Fellows Of Harvard College Methods of detecting signatures of disease or conditions in bodily fluids
US10961578B2 (en) 2010-07-23 2021-03-30 President And Fellows Of Harvard College Methods of detecting prenatal or pregnancy-related diseases or conditions
US11111537B2 (en) 2010-07-23 2021-09-07 President And Fellows Of Harvard College Methods of detecting autoimmune or immune-related diseases or conditions
US11156600B2 (en) 2014-05-16 2021-10-26 Amgen Inc. Assay for detecting TH1 and TH2 cell populations
US11585814B2 (en) 2013-03-09 2023-02-21 Immunis.Ai, Inc. Methods of detecting prostate cancer
EP4303584A2 (en) 2010-07-23 2024-01-10 President and Fellows of Harvard College Methods for detecting signatures of disease or conditions in bodily fluids

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2850414A1 (en) * 2012-05-18 2015-03-25 Institut Gustave Roussy (IGR) Characterization of biological tissues at a cellular level using red and far-red fluorescent dyes
GB201223223D0 (en) 2012-12-21 2013-02-06 Norinnova Technology Transfer As Inflammatory bowel disease

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6746670B2 (en) * 2000-08-15 2004-06-08 Schering Corporation Regulatory T cells; methods
FR2824567B1 (en) * 2001-05-11 2003-08-08 Inst Nat Sante Rech Med PROCESS FOR OBTAINING TR1 LYMPHOCYTES SPECIFIC ANTIGEN REGULATORS
EP1534855B1 (en) * 2002-06-25 2010-12-08 Index Diagnostics AB (publ) Method and kit for the diagnosis of ulcerative colitis
EP1667669A2 (en) * 2003-05-30 2006-06-14 Molecular Staging, Inc. Inflammatory bowel diseases
SI2021025T1 (en) * 2006-05-12 2017-02-28 Ith Immune Therapy Holdings Ab Method and means for treating inflammatory bowel disease
WO2008010378A1 (en) * 2006-07-21 2008-01-24 Kabushiki Kaisha Kobe Seiko Sho Copper alloy sheets for electrical/electronic part
US7877602B2 (en) * 2007-07-27 2011-01-25 International Business Machines Corporation Transparent aware data transformation at file system level for efficient encryption and integrity validation of network files

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP2185936A4 *

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8852581B2 (en) 2005-08-31 2014-10-07 Ith Immune Therapy Holdings Ab Treatment of inflammatory bowel disease
US10934588B2 (en) 2008-01-18 2021-03-02 President And Fellows Of Harvard College Methods of detecting signatures of disease or conditions in bodily fluids
US10934589B2 (en) 2008-01-18 2021-03-02 President And Fellows Of Harvard College Methods of detecting signatures of disease or conditions in bodily fluids
US11001894B2 (en) 2008-01-18 2021-05-11 President And Fellows Of Harvard College Methods of detecting signatures of disease or conditions in bodily fluids
WO2011127351A1 (en) * 2010-04-09 2011-10-13 Exagen Diagnostics, Inc. Biomarkers for ulcerative colitis and crohn's disease
JP2011254810A (en) * 2010-05-12 2011-12-22 En Otsuka Pharmaceutical Co Ltd Classification of crohn disease activity
EP4303584A2 (en) 2010-07-23 2024-01-10 President and Fellows of Harvard College Methods for detecting signatures of disease or conditions in bodily fluids
WO2012012725A2 (en) 2010-07-23 2012-01-26 President And Fellows Of Harvard College Methods of detecting diseases or conditions using phagocytic cells
US10961578B2 (en) 2010-07-23 2021-03-30 President And Fellows Of Harvard College Methods of detecting prenatal or pregnancy-related diseases or conditions
US11111537B2 (en) 2010-07-23 2021-09-07 President And Fellows Of Harvard College Methods of detecting autoimmune or immune-related diseases or conditions
CN103069276A (en) * 2010-08-05 2013-04-24 D.M.G.意大利有限公司 Use of hmgb1 as' a biological marker of bowel inflammatory conditions, non-invasive method for its detection in fecal samples and kit thereof
US10494675B2 (en) 2013-03-09 2019-12-03 Cell Mdx, Llc Methods of detecting cancer
US11585814B2 (en) 2013-03-09 2023-02-21 Immunis.Ai, Inc. Methods of detecting prostate cancer
US12037645B2 (en) 2013-03-09 2024-07-16 Immunis.Ai, Inc. Methods of detecting cancer
US12181477B2 (en) 2013-03-09 2024-12-31 Immunis.Ai, Inc. Methods of detecting prostate cancer
US11156600B2 (en) 2014-05-16 2021-10-26 Amgen Inc. Assay for detecting TH1 and TH2 cell populations
US10626464B2 (en) 2014-09-11 2020-04-21 Cell Mdx, Llc Methods of detecting prostate cancer
US12529109B2 (en) 2014-09-11 2026-01-20 Immunis.Ai, Inc. Methods of detecting prostate cancer

Also Published As

Publication number Publication date
JP2010535336A (en) 2010-11-18
KR20100063052A (en) 2010-06-10
EP2185936A2 (en) 2010-05-19
EA201000131A1 (en) 2010-08-30
CA2695360A1 (en) 2009-02-05
ZA201001486B (en) 2013-05-29
CN101815945A (en) 2010-08-25
AU2008283077A1 (en) 2009-02-05
EP2185936A4 (en) 2010-08-04
US20110081649A1 (en) 2011-04-07
WO2009017444A3 (en) 2009-03-19

Similar Documents

Publication Publication Date Title
US20110081649A1 (en) Diagnosis, staging and monitoring of inflammatory bowel disease
Toubal et al. Mucosal-associated invariant T cells promote inflammation and intestinal dysbiosis leading to metabolic dysfunction during obesity
Burke et al. Microscopic colitis
Pistoia et al. Soluble HLA-G: Are they clinically relevant?
Fury et al. Transcript abundance patterns in Kawasaki disease patients with intravenous immunoglobulin resistance
Bertola et al. Hepatic expression patterns of inflammatory and immune response genes associated with obesity and NASH in morbidly obese patients
Mudter et al. The transcription factor IFN regulatory factor–4 controls experimental colitis in mice via T cell–derived IL-6
Rouxel et al. Mucosal‐associated invariant T cells in autoimmune and immune‐mediated diseases
Verschuere et al. Cigarette smoking alters epithelial apoptosis and immune composition in murine GALT
CA2521136A1 (en) Methods of determining efficacy of treatments of inflammatory diseases of the bowel
Nara et al. Involvement of innate immunity in the pathogenesis of intestinal Behçet's disease
Sherkat et al. Innate lymphoid cells and cytokines of the novel subtypes of helper T cells in asthma
Griesenauer et al. ST2/MyD88 deficiency protects mice against acute graft-versus-host disease and spares regulatory T cells
CN116997663A (en) Markers and cellular antecedents of rheumatoid arthritis attacks
Ly et al. Exploring the imbalance of circulating follicular helper CD4+ T cells in sarcoidosis patients
Arcoleo et al. The complex alteration in the network of IL-17-type cytokines in patients with hereditary angioedema
Ansari et al. Deregulated phenotype of autoreactive Th17 and Treg clone cells in pemphigus vulgaris after in-vitro treatment with desmoglein antigen (Dsg-3)
Shen et al. Enhanced CBir1-specific innate and adaptive immune responses in Crohn's disease
Yurdakök What next in necrotizing enterocolitis?
WO2024188443A1 (en) Marker to predict response to treatment of inflammatory bowel disease
Hise et al. Inflammatory mediators and immune function are altered in home parenteral nutrition patients
WO2009083653A1 (en) Method for monitoring efficiency of treatments with immunomodulators
Eldosoky et al. Cell free DNA and CD38 expression on T helper cells as biomarkers of disease activity in rheumatoid arthritis
Baer Identification of Crohn’s disease immunopathotypes
Xia et al. TNFSF9 expression in primary biliary cirrhosis and its clinical significance

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200880109384.3

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08794093

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2008283077

Country of ref document: AU

Ref document number: 2010519171

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 203610

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2695360

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 201000131

Country of ref document: EA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 725/DELNP/2010

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2008283077

Country of ref document: AU

Date of ref document: 20080729

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2008794093

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20107004671

Country of ref document: KR

Kind code of ref document: A