WO2009016108A2 - Microbial bioreaction process - Google Patents

Abstract

A cis- or trans- stilbenoid of the general formla (1): in which each of R1, R2, R3, R4 and R5 is hydrogen or hydroxy, or a glycosylated or oligomeric form thereof, is produced by cultivating a micro-organism producing said stilbenoid, in a multi-phase system comprising at least an aqueous first phase containing said micro-organism and a second phase immiscible with said aqueous phase in which (e.g. as which) said stilbenoid accumulates. The second phase may be said stilbenoid or a free or encapsulated solvent compatible with the growth of the micro-organism, for instance an ester.

Description

Microbial Bioreaction Process

FIELD OF THE INVENTION

This invention relates generally to a bioreactor process in which a stilbenoid (i.e a hydroxystilbene) is produced using a two phase cultivation medium.

BACKGROUND OF THE INVENTION

There have recently been proposed recombinant microorganisms that have the capacity to produce certain stilbenoids of the general formula 1:

wherein each of R¹, R², R³, R⁴ and R⁵ independently is hydrogen or hydroxy. Examples of such compounds include resveratrol (only R³ being hydroxy) and pinosylvin (all of the R groups being hydrogen) , see for instance WO2006/089898.

EP1181383 describes the in-situ extraction of a micro- organism fermentation product into an encapsulated organic solvent, the purpose being to prevent inhibition of production of the fermentation product caused by the product itself by sequestering it into the encapsulated solvent. This is therefore an approach to address the problem of a poor yield of the desired product. US4865973 also tackles the problem of low metabolite yields due to product inhibition, this time by extraction of ethanol during cultivation of Saccaromyces cerevisiae yeast into a non-encapsulated solvent such as dodecylacetate . US2004/0229326 again tackles the problem of product inhibition, this time in relation to aromatic compounds such as cinnamic acid, using a two phase extractive fermentation based on one or more of several defined solvents which include methyl decanoate.

Similarly, EP1715032 discloses a two phase fermentation using yeast to produce aroma compounds such as 2- phenylethanol with propylene glycol as extracting solvent to avoid product inhibition.

In fermentations to produce the stilbenoids with which the invention is concerned there is no problem relating to product inhibition however, as the existing strains of micro-organisms produce these compounds only in very small yields and it is not disclosed that they are secreted into the culture medium. Also, we have found that the solubility limit of the compounds is too low for product inhibition to become a problem.

Teachings such as WO2004/092344 describe biphasic reaction media for carrying out cell free enzymatic or other conversions, but this is of little relevance since there is no exposure of micro-organisms to the biphasic system.

SUMMARY OF THE INVENTION Previously described micro-organisms have not been disclosed to release stilbenoids into the culture medium, as opposed to accumulating it within the micro-organism cells, although we have found that strains that we have described can do so. Also, a higher yield of stilbenoid compounds is desirable compared to that released into the culture medium by previously described micro-organisms. Strains of yeast and of other fungi or of bacteria which we have developed are such that the concentration of hydroxystilbene secreted into the medium by the micro-organisms is so high as to reach saturation, leading to precipitation of the product.

Accordingly, the invention provides in a first aspect a method for the production of a cis- or trans- stilbenoid of the general formla 1 :

Formula 1

in which each of R¹, R², R³, R⁴ and R⁵ independently is hydrogen or hydroxy, or a glycosylated or oligomeric form thereof, comprising cultivating a micro-organism producing said stilbenoid, wherein said cultivation is performed in a multi-phase system comprising at least an aqueous first phase containing said micro-organism and a second phase immiscible with said aqueous phase in which (e.g. as which) said stilbenoid accumulates.

The second phase in which the stilbenoid accumulates may be composed of the stilbenoid itself. The stilbenoid may then be recovered at least in part simply by separating the accumulated solids from the fermentation, normally followed by further purification steps.

However, the stilbenoid may also deposit onto vessel walls, stirrer shafts, sensor, baffles and other apparatus constituents. If it is desired to prevent this, the second phase may be a solvent for the stilbenoid which is compatible with the fermentation requirements of the microorganism. This will prevent accumulating solids disturbing fermentation process control and down-stream processing, desirably preventing precipitation without reduction of the hydroxystilbene yield.

Preferably, one of said first and second phases is dispersed within the other and preferably the first (aqueous) phase is continuous and the second phase is dispersed.

Said stilbenoid may be resveratrol (only R³ = OH) , pinosylvin (all R groups are hydrogen) or piceatannol (only R³ and either R² or R⁴ is OH) . Preferably, not more than 3 of the R groups are hydroxy. Preferably, the stilbenoid is trans .

Said second phase is preferably a liquid. Optionally, said second phase is a micro-encapsulated liquid. Preferably, said liquid or micro-encapsulated liquid comprises or consists of an ester. Said ester is suitably of the general formula R⁶-COO-R⁷, and R⁶ is H or an aliphatic straight or branched chain hydrocarbon moiety of from 1-6 carbon atoms and R⁷ is an aliphatic straight or branched chain hydrocarbon moiety of from 2-16 carbon atoms, or a heteroatom containing hydrocarbon moiety of from 2 to 16 carbon atoms or an aromatic or heteroaromatic moiety of from

5 to 16 carbon atoms. R⁷ may have from 3 to 9 carbon atoms. R⁶ may have from 1 to 4 carbon atoms. Alternatively, R⁶ may have from 6 to 12 carbon atoms and R⁷ may have from 1 to 6 carbon atoms. For instance, the solvent may be methyl decanoate, propyl decanoate or butyl decanoate or the corresponding undecanoate or dodecanoate esters. Preferably, said ester is an octyl acetate, especially n-octyl acetate.

Optionally, said liquid comprises or further comprises an alkane. It may consist of a said alkane and a said ester . Said alkane may be a Ce to Ciε straight or branched chain alkane, e.g. a C9-14 alkane, e.g. a C12 alkane.

Preferably, said alkane is n-dodecane.

Preferably, said micro-organism, when cultivated in said aqueous phase without said immiscible phase, is capable of producing said stilbenoid in an amount sufficient to reach a saturated concentration thereof in said aqueous phase and to precipitate therefrom.

Methods according to the invention may further comprise separating said second phase and extracting said stilbenoid therefrom.

In a second aspect, the invention provides a method for producing an extraction solvent tolerant micro-organism strain producing a metabolite comprising:

(a) cultivating a starting micro-organism in a multi-phase system comprising at least an aqueous first phase containing said micro-organism and a second phase immiscible with said aqueous phase in which said metabolite accumulates, one of said first and second phases preferably being dispersed within the other, said second phase comprising a first solvent component to which the micro-organism is more tolerant and a first concentration of a second solvent component to which the micro-organism is less tolerant,

(b) recovering progeny micro-organism from said cultivation (a) , and

(c) culturing said progeny micro-organism in a said multiphase system in which the concentration of said second solvent component is increased above said first concentration.

In a further aspect, the invention provides A method for the production of a cis- or trans- stilbenoid of the general formla 1, comprising cultivating a micro-organism producing said stilbenoid, wherein said cultivation is conducted in a culture medium comprising or consisting of an aqueous phase and produces an amount of said stilbenoid (e.g. resveratrol) released from the micro-organisms into the culture medium which exceeds the solubility limit of said stilbenoid in said aqueous phase.

The method may be operated such that said stilbenoid precipitates from said culture medium. Alternatively, the cultivation is performed in a said culture medium which is a multi-phase system comprising at least said aqueous phase containing said micro-organism and a liquid solvent immiscible with said aqueous phase in which said stilbenoid accumulates . Then it is optional whether said liquid solvent forms a liquid-liquid interface with said aqueous phase or is separated therefrom by encapsulation. Preferably, one of said aqueous phase and said liquid solvent is dispersed within the other and preferably the aqueous phase is continuous and said liquid solvent is dispersed therein.

All preferred features of the first aspect of the invention also apply in relation to the second aspect and this further aspect also.

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

The micro-organisms used may be naturally occurring, or recombinant micro-organisms, or may be micro-organisms obtained by directed evolution from a starting naturally occurring or recombinant micro-organism. Repeated cultivation of micro-organism cells in a two phase system as described herein will generally produce evolved cells more suited to withstanding the conditions.

Micro-organisms that may be employed include fungi, including both filamentous fungi and yeasts, and bacteria. Yeasts are preferred, especially strains of 5. cerevisiae .

The micro-organism may be one having an operative metabolic pathway comprising at least one enzyme activity, said pathway producing a said stilbenoid or an oligomeric or glycosidically-bound derivative thereof from a precursor aromatic acid of the general formula 2 :

Formula 2 wherein each R group is as defined above.

For instance, the micro-organism may be one producing resveratrol from coumaric acid, producing pinosylvin from cinnamic acid, and/or producing piceatannol from caffeic acid.

The transformation of the said aromatic acid to the compound of Formula 1 may be by the action of an exogenous stilbene synthase expressed in said micro-organism, usually in conjunction with a suitable aromatic acid-CoA ligase serving to form the CoA thioester of the aromatic acid which together with malonyl-CoA acts as a substrate for the stilbene synthase.

Stilbene synthases are rather promiscuous enzymes that can accept a variety of physiological and non-physiological substrates. For instance, addition of various phenylpropanoid CoA starter esters led to formation of several products in vitro in Ikuro Abe et al._r 2004 and Morita et al . , 2001. Likewise it has been shown that resveratrol synthase from rhubarb (Rheum tartaricum) indeed synthesized a small amount of pinosylvin when cinnamoyl-CoA was used as substrate instead of coumaroyl-CoA (Samappito et al. , 2003) .

Micro-organisms producing resveratrol for use in the invention may be as described in WO2006/089898. In particular, the micro-organism may be one having an operative metabolic pathway comprising at least one enzyme activity, said pathway producing resveratrol, or an oligomeric or glycosidically-bound derivative thereof, from 4-coumaric acid. Micro-organisms producing pinosylvin for use in the invention may be as described in WO2008/009728 and therefore may be one that has an operative metabolic pathway comprising at least one enzyme activity, said pathway producing pinosylvin, or an oligomeric or glycosidically- bound derivative thereof, from cinnamic acid.

Malonyl-CoA for said stilbenoid forming reaction may be produced endogenously . The stilbene synthase may be expressed in said said micro-organism from nucleic acid coding for said enzyme which is not native to the micro-organism and may be resveratrol synthase (EC 2.3.1.95) from a plant belonging to the genus of Arachis, a plant belonging to the genus of Rheum, or a plant belonging to the genus of Vitus or any one of the genera Artocarpus, Clintonia, Morus, Vaccinium, Pinus, Picea, Lilium, Eucalyptus, Parthenocissus, Cissus , Calochortus, Polygonum, Gnetum, Artocarpus, Nothofagus, Phoenix, Festuca, Carex, Veratrum, Bauhinia or Pterolobium or may be a pinosylvin synthase (EC 2.3.1.146) from a plant belonging to the genus of Pinus, e.g. P. sylvestris, P. strobes, P. densiflora, P. taeda, a plant belonging to the genus Picea, or any one of the genus Eucalyptus .

For the preferential production of pinosylvin, the stilbene synthase may be one which exhibits a higher turnover rate with cinnamoyl-CoA as a substrate than it does with 4-coumaroyl-CoA as a substrate, e.g. by a factor of at least 1.5 or at least 2. Thus, in further preferred embodiments, said stilbene synthase is a pinosylvin synthase, suitably from a tree species such as a species of Pinus, Eucalyptus, Picea or Madura. In particular, the stilbene synthase may be a pinosylvin synthase (EC 2.3.1.146) from a plant belonging to the genus of Pinus, e.g. P. sylvestris, P. strobes, P. densiflora, P. taeda, a plant belonging to the genus of Picea, or any one of the genus Eucalyptus .

The aromatic acid precursor may be produced in the micro-organism or may be supplied externally thereto, production by the micro-organism generally being preferred. Such aromatic acid precursors are generally producible in the micro-organism from a suitable amino acid precursor by the action of an enzyme such as a phenylalanine ammonia lyase or tyrosine ammonia lyase. The genes for the production of these enzymes may be recombinantly expressed in the micro-organism.

Thus, in certain preferred embodiments, said L- phenylalanine ammonia lyase is a L-phenylalanine ammonia lyase (EC 4.3.1.5) from a plant or a micro-organism. The plant may belong to the genus of Arabidopsis, e.g. A. thaliana, a plant belonging to the genus of Brassica , e.g. B. napus, B. rapa, a plant belonging to the genus of Citrus, e.g. C. reticulata, C. clementinus, C. limon, a plant belonging to the genus of Phaseolus, e.g. P. coccineus, P. vulgaris, a plant belonging to the genus of Pinus, e.g. P. banksiana, P. monticola, P. pinaster, P. sylvestris, P. taeda, a plant belonging to the genus of Populus, e.g. P. balsamifera, P. deltoides, P. Canadensis, P. kitakamiensis, P. tremuloides, a plant belonging to the genus of Solanum, e.g. 5. tuberosum, a plant belonging to the genus of Prunus, e.g. P. avium, P. persica, a plant belonging to the genus of Vitus, e.g. Vitus vinifera, a plant belonging to the genus of Zea, e.g. Z. mays or other plant genera e.g. Agastache, Ananas, Asparagus, Bromheadia, Bambusa, Beta, Betula,

Cucumis, Camellia , Capsicum, Cassia, Catharanthus, Cicer, Citrullus, Coffea, Cucurbita, Cynodon, Daucus, Dendrobium, Dianthus, Digitalis, Dioscorea, Eucalyptus, Gallus, Ginkgo, Glycine, Hordeum, Helianthus, Ipomoea, Lactuca, Lithospermum, Lotus, Lycopersicon, Medicago, Malus, Manihot, Medicago, Mesembryanthemum, Nicotiana , Olea, Oryza, Pisum, Persea, Petroselinum, Phalaenopsis, Phyllostachys, Physcomitrella , Picea, Pyrus, Quercus, Raphanus, Rehmannia , Rubus, Sorghum, Sphenostylis, Stellaria, Stylosanthes, Triticum, Trifolium, Triticum, Vaccinium, Vigna, Zinnia. The micro-organism might be a fungus belonging to the genus Agaricus, e.g. A. bisporus, a fungus belonging to the genus Aspergillus, e.g. A. oryzae, A. nidulans, A. fumigatus, a fungus belonging to the genus Ustilago, e.g. U. maydis, a bacterium belonging to the genus Rhodobacter, e.g. R. capsulatus, a bacterium belonging to the genus Streptomyces, e.g. 5. maritimus, a bacterium belonging to the genus Photorhabdus, e.g. P. luminescens, a yeast belonging to the genus Rhodotorula, e.g. R. rubra.

A suitable tyrosine ammonia lyase (EC 4.3.1.5) may be derived from yeast or bacteria. Suitably, the tyrosine ammonia lyase is from the yeast Rhodotorula rubra or from the bacterium Rhodobacter capsulatus .

Where the immediate product of the conversion of amino acid to aromatic acid is an aromatic acid that is not suitable as the immediate precursor of the desired stilbenoid, it may be converted to a more appropriate aromatic acid enzymatically by the micro-organism. For instance, cinammic acid may be converted to coumaric acid by a cinnamate-4-hydroxylase (C4H) . Thus, said 4-coumaric acid may be produced from trans-cinnamic acid by a cinnamate 4- hydroxylase, which preferably is expressed in said micro- organism from nucleic acid coding for said enzyme which is not native to the micro-organism.

In certain preferred embodiments, said cinnamate-4- hydroxylase is a cinnamate-4-hydroxylase (EC 1.14.13.11) from a plant or a micro-organism. The plant may belong to the genus of Arabidopsis, e.g. A. thaliana, a plant belonging to the genus of Citrus, e.g. C. sinensis, C. x paradisi , a plant belonging to the genus of Phaseolus, e.g. P. vulgaris, a plant belonging to the genus of Pinus, e.g. P. taeda , a plant belonging to the genus of Populus, e.g. P. deltoides, P. tremuloides, P. trichocarpa, a plant belonging to the genus of Solanum, e.g. 5. tuberosum, a plant belonging to the genus of Vitus, e.g. Vitus vinifera, a plant belonging to the genus of Zea, e.g. Z. mays, or other plant genera e.g. Ammi , Avicennia , Camellia, Camptotheca , Catharanthus, Glycine, Helianthus, Lotus, Mesembryanthemum, Physcomitrella , Ruta, Saccharum, Vigna . The micro-organism might be a fungus belonging to the genus Aspergillus, e.g. A. oryzae.

The conversion of the aromatic acid precursor into its CoA derivative may be performed by a suitable endogenous or recombinantly expressed enzyme. Both cinnamoyl-CoA and coumaroyl-CoA may be formed in a reaction catalysed by an enzyme in which ATP and CoA are substrates and ADP is a product by a 4-coumarate-CoA ligase (also referred to as 4- coumaroyl-CoA ligase) . Known 4-coumarate-CoA ligase enzymes accept either 4-coumaric acid or cinnamic acid as substrates and produce the corresponding CoA derivatives. Generally, such enzymes are known as M-coumarate-CoA ligase' whether they show higher activity with 4-coumaric acid as substrate or with cinnamic acid as substrate. However, we refer here to enzymes having that substrate preference as ^λcinnamate- CoA ligase' enzymes (or cinnamoyl-CoA-ligase) . One such enzyme is described for instance in Aneko et al . , 2003.

Said 4-coumarate-CoA ligase or cinnamate-CoA ligase may be a 4-coumarate-CoA ligase / cinnamate-CoA ligase (EC 6.2.1.12) from a plant, a micro-organism or a nematode. The plant may belong to the genus of Abies, e.g. A. beshanzuensis, B. firma, B. holophylla, a plant belonging to the genus of Arabidopsis, e.g. A. thaliana, a plant belonging to the genus of Brassica, e.g. B. napus, B. rapa, B . oleracea, a plant belonging to the genus of Citrus, e.g. C. sinensis, a plant belonging to the genus of Larix, e.g. L. decidua , L. gmelinii , L. griffithiana , L. himalaica , L. kaempferi , L. laricina , L. mastersiana , L. occidentalis, L. potaninii , L. sibirica, L. speciosa, a plant belonging to the genus of Phaseolus, e.g. P. acutifolius, P. coccineus, a plant belonging to the genus of Pinus, e.g. P. armandii P. banksiana , P. pinaster, a plant belonging to the genus of Populus, e.g. P. balsamifera, P. tomentosa, P. tremuloides, a plant belonging to the genus of Solanum, e.g. 5. tuberosum, a plant belonging to the genus of Vitus, e.g.

Vitus vinifera, a plant belonging to the genus of Zea, e.g. Z. mays, or other plant genera e.g. Agastache, Amorpha, Cathaya, Cedrus, Crocus, Festuca, Glycine, Juglans, Keteleeria, Lithospermum, Lolium, Lotus, Lycopersicon, Malus, Medicago, Mesembryanthemum, Nicotiana , Nothotsuga , Oryza, Pelargonium, Petroselinum, Physcomitrella, Picea, Prunus, Pseudolarix, Pseudotsuga, Rosa, Rubus, Ryza, Saccharum, Suaeda, Thellungiella, Triticum, Tsuga. The micro-organism might be a filamentous fungi belonging to the genus Aspergillus, e.g. A. flavus, A. nidulans, A. oryzae, A. fumigatus, a filamentous fungus belonging to the genus Neurospora, e.g. N. crassa, a fungus belonging to the genus Yarrowia, e.g. Y. lipolytics, a fungus belonging to the genus of Mycosphaerella, e.g. M. graminicola, a bacterium belonging to the genus of Mycobacterium, e.g. M. bovis, M. leprae, M. tuberculosis, a bacterium belonging to the genus of Neisseria, e.g. N. meningitidis, a bacterium belonging to the genus of Streptomyces, e.g. 5. coelicolor, a bacterium belonging to the genus of Rhodobacter, e.g. R. capsulatus, a nematode belonging to the genus Ancylostoma, e.g. A. ceylanicum, a nematode belonging to the genus Caenorhabditis, e.g. C. elegans, a nematode belonging to the genus Haemonchus, e.g. H. contortus, a nematode belonging to the genus Lumbricus, e.g. L. rubellus, a nematode belonging to the genus Meilodogyne, e.g. M. hapla, a nematode belonging to the genus Strongyloidus, e.g. 5. rattii, S. stercoralis, a nematode belonging to the genus Pristionchus, e.g. P. pacificus .

Optionally, one may express, over express, or recombinantly express in said organism an NADPH: cytochrome P450 reductase (CPR) . This may be a plant CPR. Alternatively, a native NADPH: cytochrome P450 reductase (CPR) may be overexpressed in said micro-organism.

Optionally, said NADPH: cytochrome P450 reductase is a NADPH: cytochrome P450 reductase (EC 1.6.2.4) from a plant belonging to the genus of Arabidopsis, e.g. A. thaliana, a plant belonging to the genus of Citrus, e.g. C. sinensis, C. x paradisi , a plant belonging to the genus of Phaseolus, e.g. P. vulgaris, a plant belonging to the genus of Pinus, e.g. P. taeda, a plant belonging to the genus of Populus, e.g. P. deltoides, P. tremuloides, P. trichocarpa , a plant belonging to the genus of Solanum, e.g. 5. tuberosum, a plant belonging to the genus of Vitus, e.g. Vitus vinifera, a plant belonging to the genus of Zea, e.g. Z. mays, or other plant genera e.g. Ammi , Avicennia , Camellia , Camptotheca, Catharanthus, Glycine, Helianthus, Lotus, Mesembryanthemum, Physcomitrella, Ruta, Saccharum, Vigna. Because, as described above, for the production of pinosylvin, production of cinnamic acid by a PAL enzyme and also its conversion on to pinosylvin is preferred to either the production of coumaric acid from tyrosine by a substrate promiscuous PAL or by conversion of cinnamic acid by a C4H enzyme, micro-organisms for use in the invention to produce pinosylvin preferably have a PAL which favours phenylalanine as a substrate (thus producing cinnamic acid) over tyrosine (from which it would produce coumaric acid) . Preferably, therefore, the ratio K_m (phenylalanine) /K_m (tyrosine) for the PAL is less than 1:1, preferably less 1:5, e.g. less than 1:10. As usual, K_m is the molar concentration of the substrate (phenylalanine or tyrosine respectively) that produces half the maximal rate of product formation (V_max) .

Except where micro-encapsulation is used, in choosing a solvent to act as the water immiscible phase in the cultivation, there generally will be some tension between opposing requirements for a solvent that does not hamper the growth of the micro-organism and one that successfully extracts the hydroxystilbene product. Generally, the less miscible with water is the solvent, the less it will interfere with the micro-organism growth, but the less effective it will be in extracting the hydroxystilbene. The rate at which the system is agitated will also have an effect, greater agitation tending to increase the interference of the solvent with the growth of the microorganism. The toxicity of the water immiscible material for the micro-organism may therefore be regarded as being divided into a direct toxic effect due to the concentration of the immiscible solvent in the aqueous medium and a phase toxicity due to the physical presence of the immiscible phase which can exert effects by nutrient extraction, limited access to nutrients due to emulsion formation, cell coating, attraction to the interface and, the most detrimental effect, disruption of cell membranes.

The rate of agitation employed should therefore be balanced against the nature of the immiscible solvent material . However, optionally, the solvent is physically separated from the aqueous phase by micro-encapsulation, as described in Stark et al, 2003 and EP1181383 using for instance solvent filled alginate micro-spheres of for instance 1-4 mm diameter. The encapsulating material is chosen to be permeable to the stilbenoid. This can prevent phase toxicity, although the aqueous phase may remain saturated with the solvent. This allows a more free choice of solvent on the basis of its extractive power for the stilbenoid having regard to the stilbenoid solubility therein and its partition coefficient for the stilbenoid.

The solvent is preferably one in which the microorganism of interest, if necessary after adaptation as described in Example 12, is able to grow in an aqueous phase culture medium in liquid-liquid interface contact with the said solvent at a growth rate of at least 50% of the growth rate obtainable in the aqueous phase culture medium without the solvent being present. Such a solvent may be referred to as a biocompatible solvent.

Preferred solvents have a partition coefficient logP between water and octanol of not more than 4.4, preferably not more than 4.0. Such solvents are generally suitable for all of the stilbenoids. However, for the most hydrophobic stilbenoids, especially pinosylvin, a logP value of up to 7.5 may be used, e.g. up to 6.5.

Having regard particularly for their extraction affinity for more polar hydroxy stilbenes, preferred solvents are esters, especially esters of the general formula R⁶-COO-R⁷, where R⁶ is H or an optionally substituted aliphatic straight or branched chain hydrocarbon moiety of from 1-6 carbon atoms, or an optionally substituted aromatic or heteroaromatic moiety of from 5 to 6 carbon atoms, and R⁷ is an optionally substituted aliphatic straight or branched chain hydrocarbon moiety of from 2-16 carbon atoms, or an optionally substituted heteroatom containing hydrocarbon moiety of from 2 to 16 carbon atoms or an optionally substituted aromatic or heteroaromatic moiety of from 5 to 16 carbon atoms. Suitably, R⁷ has from 3 to 9 carbon atoms. Suitably the ester is formed between a short chain acid and a long chain alcohol, e.g. where R⁶ has from 1 to 4 carbon atoms and R⁷ has from 6 to 12 carbon atoms. Said ester is preferably an octyl acetate, e.g. n-octyl acetate (logP=3.7). Alternatives include hexyl, heptyl, nonyl (logP=4.2) and decyl acetates, and the corresponding formates and propionates.

Alternatively, esters formed between long chain acids and short chain alcohols may be used, e.g. where R⁶ may have from 6 to 12 carbon atoms and R⁷ may have from 1 to 6 carbon atoms. For instance, the solvent may be methyl decanoate (logP=4.3), propyl decanoate or butyl decanoate or the corresponding undecanoate or dodecanoate esters. Also, long chain ketones such as a Cs to C12 ketones, e.g. undecanone may be used. These may be of the formula R⁸COR⁹ where R⁸ and R⁹ independently may be an optionally substituted aliphatic straight or branched chain hydrocarbon moiety, e.g. where R⁸ is C1-5, more preferably C1-3, and R⁹ is C₇-I₂.

Other suitable solvents may be as described in US4865973. Except where these overlap with those described above however they are in general less preferred. They include double bond unsaturated aliphatic alcohols having 12 or more carbon atoms, saturated branched chain aliphatic alcohols having 14 or more carbon atoms or mixtures thereof (e.g. guerbet alcohols), double bond unsaturated aliphatic acids having 12 or more carbon atoms, aliphatic and aromatic mono- di- or tri-esters having 12 or more carbon atoms, aliphatic noncyclic ketones and aliphatic aldehydes having 12 or more carbon atoms.

Examples include: oleyl alcohol, (cis-9-octadecen-l-ol) , phytol (3,7,11,15- tetramethyl-2-hexadecen-l-ol) , isophytol (3,7,11,15- tetramethyl-l-hexadecen-3-ol) , isostearyl alcohol e.g. the commercial product sold under the trademark ADOL 66, isocetyl alcohol e.g. the commercial product sold under the trademark Eutanol G-16, octyl dodecanol e.g. the commercial product sold under the trademark Eutanol G, oleic acid (cis-9-octadecenoic acid), linoleic acid, (9,11- octadecadienoic acid), ricinoleic acid, (12-hydroxy-9- octadecenoic acid), dodecyl acetate (CH₃ COO (CH₂) n), butyl dodecanoate, (CH₃ (CH₂) io COOC₄H₉), dibutyl sebacate (C₄H₉ 0OC (CH₂) ₈H₁₇ COOC₄H₉, di (2-ethylhexyl) sebacate, (C₈ H₁₇ 0OC (CH₂) ₈ COOC₈H₁₇), dibutyl adipate (C₄ H₉ 0OC (CH₂) ₄ COOC₄H₉), di (2- ethylhexyl) adipate, (C₈ H₁₇ 0OC (CH₂) ₄ COOC₈H₁₇) , di (2- ethylhexyl)phthalate, (C₈H₁₇OOCC₆H₄COOC₈H₁₇), di (3,5,5- trimethyhexyl) , phthalate (C₈H₁₇OOCC₆H₄COOC₈H₁₇), glyceroltrideca- ( [CH₃ (CH₂) ₈COOCH₂ ]₂ CHOCO (CH₂) ₈CH₃) noate, 2- dodecanone (CH₃ CO (CH₂) ₉ CH₃), dodecanal (CH3 (CH2)10 CHO), the commercial product sold under the trademark ADOL 85 NF (69 percent oleyl alcohol), the commercial product sold under the trademark ADOL 330 (62 percent oleyl alcohol), and the commercial product sold under the trademark HD oleyl alcohol (commercial oleyl alcohol) .

Generally, all the solvents described above may be used in any admixture with one or more others.

For the production of pinosylvin, which is the least polar of the hydroxystilbenes of formula 1, an alkane may be used. This may be a C₆ to C₁₆ (e.g. C₉ to C₁₄) straight or branched chain alkane such as a nonane, decane, undecane, dodecane or higher, e.g. n-dodecane. However, used by itself, n-dodecane does not have sufficient polarity to be a good extractant for resveratrol and more hydroxylated compounds . On the other hand, the esters are less well tolerated by certain micro-organisms as regards toxicity and in some cases can steer hydroxystilbene production towards resveratrol and away from pinosylvin. For the mixed production of resveratrol and pinosylvin for instance, it is therefore preferred to use a mixture of a said ester and a said alkane, e.g. octyl acetate and n- dodecane .

Micro-organisms that do not fully tolerate a particular solvent such as octyl acetate may be evolved to do so by methods described briefly above.

In the present context the term "micro-organism" relates to microscopic organisms, including bacteria, microscopic fungi, including yeast. More specifically, the micro-organism may be a fungus, and more specifically a filamentous fungus belonging to the genus of Aspergillus, e.g. A. niger, A. awamori, A. oryzae, A. nidulans, a yeast belonging to the genus of Saccharomyces, e.g. 5. cerevisiae, S. kluyveri , S. bayanus, S. exiguus, S. sevazzi, S. uvarum, a yeast belonging to the genus Kluyveromyces, e.g. K. lactis K. marxianus var. marxianus, K. thermotolerans, a yeast belonging to the genus Candida, e.g. C. utilis C. tropicalis, C. albicans, C. lipolytics, C. versatilis, a yeast belonging to the genus Pichia, e.g. P. stipidis, P. pastoris, P. sorbitophila, or other yeast genera, e.g. Cryptococcus, Debaromyces, Hansenula, Pichia, Yarrowia , Zygosaccharomyces or Schizosaccharomyces . Concerning other micro-organisms a non-exhaustive list of suitable filamentous fungi is: a species belonging to the genus Penicillium, Rhizopus, Fusarium, Fusidium, Gibberella , Mucor, Mortierella , and Trichoderma .

Concerning bacteria a non-exhaustive list of suitable bacteria is follows: a species belonging to the genus Bacillus, a species belonging to the genus Escherichia, a species belonging to the genus Lactobacillus, a species belonging to the genus Lactococcus, a species belonging to the genus Corynebacterium, a species belonging to the genus Acetobacter, a species belonging to the genus Acinetobacter, a species belonging to the genus Pseudomonas, etc.

The preferred micro-organisms of the invention may be 5. cerevisiae, A. niger, A. nidulans, A. oryzae, E. coli, L. lactis or B. subtilis . The constructed and engineered micro-organism can be cultivated using commonly known processes, including chemostat, batch, fed-batch cultivations, etc.

Stilbenoids produced as described herein may optionally be isolated or purified and suitable methods include solvent extraction with n-hexane, followed by sequential extraction with 100% ether, acetone, methanol and water, and chromatographic purification on a silicagel column using a n-hexane/ethyl acetate (2/1) system.

The micro-organism may be fed with a carbon substrate which is optionally selected from the group of fermentable carbon substrates consisting of monosaccharides, oligosaccharides and polysaccharides, e.g. glucose, fructose, galactose, xylose, arabinose, mannose, sucrose, lactose, erythrose, threose, and/or ribose. Said carbon substrate may additionally or alternatively be selected from the group of non-fermentable carbon substrates including ethanol, acetate, glycerol, and/or lactate. Said non- fermentable carbon substrate may additionally or alternatively be selected from the group of amino acids and may be phenylalanine and/or tyrosine. BRIEF DESCRIPTION OF THE DRAWINGS

To assist in the ready understanding of the above decription of the invention reference has been made to the accompanying drawings in which are shown:

Figure IA: Fermentation profile for PALCPR-control (see Example 3) : Cθ2-evolution (C02 Vol%) , O2 consumption (O2 Vol%) and dissolved oxygen (PO2 %Sat) are shown.

Figure IB: Fermentation profile for PALCPR-solvent (see Example 3) : Cθ2-evolution (CO2 Vol%) , O2 consumption (O2 Vol%) and dissolved oxygen (PO2 %Sat) are shown.

Figure 2: Fermentation profile for PALCPR-evolved-I (Example 4): C0₂-evolution (CO2 Vol%) , O₂ consumption (O₂ Vol%) and dissolved oxygen (PO₂ %Sat) are shown.

Figure 3: Fermentation profile for PALCPR-evolved-I I (Example 5) : C0₂-evolution (C02 Vol%) , O₂ consumption (O₂ Vol%) and dissolved oxygen (PO₂ %Sat) are shown.

Figure 4: Fermentation profile for PALCPR-evolved-III (Example 6) : C0₂-evolution (C02 Vol%) , O₂ consumption (O₂ Vol%) and dissolved oxygen (PO₂ %Sat) are shown.

Figure 5: Principle of two-phase fermentation. A: extraction of stilbenoids into solvent phase with low stirring and hence physical separate phases; B: extraction of stilbenoids into solvent phase with high stirring stirring and hence with mixed phases.

Figure 6: Structure of the fused divergent TEF1-TDH3 promoters referred to in Example 9. Figure 7: Structure of a plasmid vector pESC-HIS-4CL-VSTl containing galactose inducible promotors Gall/GallO referred to in Example 9 (VII) .

Figure 8: Structure of a plasmid vector pESC-HIS-TDH3-4CL- TEF-VSTl referred to in Example 9(VII).

Figure 9: History plot of parameters of cultivation measured in Example 10.

Figure 10: History plot of parameters of cultivation measured in Example 11.

Examples

Example 1

Expression of the PAL-pathway to resveratrol in S. cerevisiae strain overexpressing native S. cerevisiae NADP- cytochrome P450 reductase (CPR)

A yeast strain FSSC-PAL2C4H4CL2VSTl-pADHlCPRl was used.

This is a strain of 5. cerevisiae having introduced therein genes expressing PAL2 from A. thaliana, C4H from A. thaliana, 4CL2 from A. thaliana, and VSTl from Vitis vinifera with overexpressed CPR from A. thaliana (see

WO2006/089898 and WO2008/009728 for details) . In summary consruction of the strain is described further below and is divided in parts A, B, C, D and E.

A: Construction of a strain overexpressing native 5. cerevisiae NADP-cytochrome P450 reductase (CPR) . The native promoter of 5. cerevisae NADP-cytochrome P450 reductase CPRl gene (encoded by YHR042W) was replaced with the constitutive 5. cerevisiae alcohol dehydrogenase ADHl promoter via chromosomal promoter exchange using the "bi-partite" PCR-based allele replacement method. Primers A and B were used to generate fragment CPRl-UP (Table 1) via PCR at a melting temperature of 56°C using 5. cereveisiae genomic DNA as template. Primers C and D were then used to generate fragment CPRl-S via PCR at a melting temperature of 56°C using 5. cerevisiae genomic DNA as template. Fragments ADl (klURA 3' end fused to promoter ADHl) and AD2 (promoter ADHl fused to KlURA 5' end) were generated via PCR using primers AD-fw and Int3' and Int5' and AD-rv at a melting temperature of 56°C and 56°C, respectively. Plasmid pWADl was used as template for generation of fragment ADl and plasmid pWAD2 was used for generating fragment AD2.

Fragments CPR UP were then fused to fragment AD2 using fusion PCR with primers A and Int3' at a melting temperature of 56 ⁰C resulting in fusion fragment 1 (bi-partite substrate 1) . A second fusion PCR was used to fuse fragments ADl and CPR-S with Int5' and primer D at a melting temperature of 56°C resulting in fusion fragment 2 (bipartite substrate 2).

Fusion fragments 1 and 2 (bi-partite substrates 1 and 2) were purified on agarose gel and used for co- transformation of S. cerevisiae strain FS01528 (Mata, ura3 his3) and the transformants were plated on SC-URA plates and incubated for 2-4 days at 30⁰C. Transformants were streak purified on SC-ura plates and incubated another 2 days at 30⁰C and then plated onto 5-FOA (5-fluoroorotic acid) plates. After incubation for 2 days at 30⁰C "pop-out" colonies appeared, which were streak purified on a new 5- FOA-plate and incubated another 2 days at 30⁰C and then finally transferred to a rich medium plate YPD. The resulting colonies were analyzed for the presence of fragment of size 1700-1800 base pairs using yeast colony PCR with primers A and AD-rev and a melting temperature at 55°C and an elongation time of 1 minute and 45 seconds. One of the positive colonies from the colony PCR containing the new replaced ADHl promoter in front of the CPRl gene was named FSpADHl-CPR (Mata ura3 his3 pADHl-CPRl) strain.

Table 1 Primers and fragments used in the "bi-partite" PCR- based allele replacement method to exchange native 5. cerevisie CPRl promoter with 5. cerevisiae ADHl promoter

towards the 5' end generated from primers AD-fw and Int3' )

AD2(Two thirds of K.lactis URA3 towards the 3' end coupled to the ADHl promoter. Generated from primers Int5' and AD- rv)

Fusion fragment 1 (CPR-UP fragment fused to AD2 fragment)

Fusion fragment 2 (ADl fragment fused to CPR-S fragment)

B: Isolation of genes encoding PAL, C4H, 4CL, and VSTl

Phenylalanine ammonia lyase (PAL2), cinnamate 4- hydroxylase (C4H) , 4-coumarate : CoenzymeA ligase (4CL1) were isolated as described previously (WO2006/089898) via PCR from A. thaliana cDNA (BioCat, Heidelberg, Germany) .

4-coumarate: CoenzymeA ligase (4CL2) (see WO2006/089898 and PCT/EP2007/057484 for details) was isolated via PCR from A. thaliana cDNA (BioCat, Heidelberg, Germany) using the forward primer 5'-GCGAATTCTTATGACGACACAAGATGTGATAGTCAATGAT- 3' SEQ ID NO: 9 containing an EcoRl restriction site and reverse primer 5'-GCACTAGTATCCTAGTTCATTAATCCATTTGCTAGT- CTTGCT-3' SEQ ID NO: 10 containing a Spel restriction site.

The VSTl gene encoding Vitis vinifera (grapevine) resveratrol synthase (Hain et al, 1993) was synthesized by GenScript Corporation (Piscataway, NJ) . The amino acid sequence (see WO2006/089898 and WO2008/009728 for details) was used as template to generate a synthetic gene optimized for expression in 5. cerevisiae . The synthetic VSTl gene was delivered inserted in E. coli pUC57 vector flanked by BamHl and Xhol restriction sites. The synthetic gene was purified from the pUC57 vector by BamHl/Xhol restriction and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen) . C: Construction of a yeast vector for expression of PAL and C4H

Plasmid, pESC-URA-PAL-C4H, containing the genes encoding PAL and C4H under the control of the divergent GAL1/GAL10 promoter was constructed as described in Example 3 of WO2006/089898. D: Construction of a yeast vector for expression of 4CL

The gene encoding 4CLl and 4CL2 were isolated as described in previously. The amplified 4CLl PCR-product was digested with Xbal/BamHl and ligated into Spel/Bglll digested pESC-TRP vector (Stratagene) , resulting in vector pESC-TRP-4CL. The amplified 4CL2 PCR-product was digested with EcoRl/Spel and ligated into EcoRl/Spel digested pESC- HIS vector (Stratagene), resulting in vector pESC-HIS-4CL2. Two different clones of pESC-TRP-4CLl and pESC-HIS-4CL2 were sequenced to verify the sequence of the cloned gene.

E: Construction of yeast vectors for expression of 4CL and VST

The gene encoding VST from Vitis vinifera (grape) was isolated as described previously. The purified BamHl/Xhol digested VST gene fragment was ligated into BamHl/Xhol digested pESC-HIS-4CL2 plasmid or pESC-trp-4CLl plasmid

(example 15) . The resulting plasmids, pESC-HIS-4CL2-VST and pESC-TRP-4CLl-VST contained the genes encoding 4CLl, 4CL2 and VST under the control of the divergent GAL1/GAL10 promoter. The sequence of the gene encoding VST was verified by sequencing of two different clones of pESC-HIS-4CL2-VST and pESC-TRP-4CLl-VST. FSpADHl-CPR (Mata ura3 his3 pADHl-CPRl) as described previously was co-transformed with the vectors pESC-URA-PAL- C4H and pESC-HIS-4CL2-VST, resulting in the strain FSSC- PALC4H4CL2VST-pADHlCPRl (Mata ura3 his3 pADHl-CPRl, pESC- URA-PAL-C4H, pESC-HIS-4CL2-VST) .

Example 2

Adaptation of strain PALCPR to the presence of solvents

Yeast strain FSSC-PAL2C4H4CL2VSTl-pADHlCPRl as described in the previous example was subjected to a train of batch fermentations in a fermentor from Applikon containing defined medium according to Verduyn et al. (1992), containing: 10.0 g/L (NH₄) ₂SO₄; 3.0 g/L KH₂PO₄; 0.5 g/L MgSO₄-7H2O; trace metals and vitamins with the aim of adapting it to the presence of solvents. The working volume was 1 L and the gas flowrate was set at 1.5 1/m, temperature was uncontrolled and pH was set at 5.5. The first fermentation contained 10 g/1 glucose and 50 g/1 galactose, and stirring rate was kept low to prevent mixing of the medium- and solvent phase, as illustrated in Figure 5A in which is seen a fermentor vessel 10 containing the two separated phases 12 (aqueous) and 14 (solvent) agitated by a stirrer 16 at below 200 rpm. After consumption of the glucose and at the onset of galactose consumption, a mixture of 10 ml octylacetate and 40 ml dodecane was added. Consumption of galactose continued and the strain was harvested and used for a next fermentation. The next fermentation was performed with said harvested strain using similar fermentation conditions as to the previous one, but now with addition of a mixture of 50 ml octylacetate and 100 ml dodecane. Indeed the cells were able to grow in the presence of said solvent mixture, and the strain was harvested and used for a next fermentation. The next fermentation was performed with said harvested strain, using similar conditions as to the previous one, but now the stirring rate was increased to 1000 rpm halfway through the consumption of galactose, causing mixing of the solvent phase with the medium phase as illustrated in Figure 5B. Indeed the cells remained able to grow when the phases were mixed and the strain was harvested and used for a next fermentation. The next fermentation was performed with said harvested strain using similar conditions as to the previous one, but now with addition of a mixture of 100 ml octylacetate and 100 ml dodecane. The increase of the octylacetate to 100 ml caused the arrest of cell growth, indicated by a halt in galactose consumption, and therefore the amount of dodecane was increased to 200 ml, in order to further obscure the toxic effect of octylacetate. Indeed the cells were now able to grow in the presence of said solvent mixture at high stirring rate. The strain was harvested and stored in 15% glycerol at -80⁰C.

Example 3

Determination of intracellular and extracellular levels of stilbenoids in a batch culture of strain PALCPR

The last harvested strain as described in previous example was grown in two independent batch cultures with a working volume of 1 liter, containing defined medium according to Verduyn et al. (1992), containing: 10.0 g/L (NH₄) ₂SO₄; 3.0 g/L KH₂PO₄; 0.5 g/L MgSO₄-7H2O; trace metals and vitamins and 10 g/1 glucose and 100 g/1 galactose as the carbon sources. Antifoam (300 μl/L, Sigma A-8436) was added to avoid foaming. The carbon source was autoclaved separately from the mineral medium and afterwards added to the fermentor. In addition, the vitamin and trace metal solutions were added to the fermentor by sterile filtration following autoclaving and cooling of the medium. The fermentor system was from Sartorius BBI systems and consisted of a baffled 3-liter reactor vessel with 1 liter working volume equipped with Biostat B Plus controller. The reactor vessel was equipped with one lower-fitted Rushton turbine which was rotating eventually at 1000 rpm, the temperature was kept at 30 ± 1°C, and the pH was kept at 5.5 ± 0.2 by automatic addition of 2M KOH. The gasflow was controlled by a mass flow controller and was set to 1.5 vvm (1.5 1/min) . The off-gas was led through a cooled condenser, and was analyzed for O2 and CO2 (Model 1308, Innova, Denmark) . The initial batch cultures were started by inoculation of the medium with a pre-grown strain that was harvested in the exponential phase and stored at -8O⁰C in 15% glycerol. The cells were allowed to fully consume the glucose at a stirring speed of 1000 rpm, and the average dissolved oxygen content was kept above 70% of saturated air. After approximately 20 hrs, at the onset of galactose consumption, the stirring rate was turned down to 300 rpm, and to one culture a mixture of 200 ml dodecane and 100 ml of octylacetate was slowly added. This cultivation will further be referred to as PALCPR-solvent, whereas the cultivation without addition of solvent will be referred to as PALCPR-control.

Upon addition of the solvent mixture to the PALCPR- solvent culture the CO2 production halted temporarily, but recovered again after 5 minutes. Moreover, the CO2- production in the PALCPR-control culture also ceased temporarily and recovered soon, indicating that this was more the result of the hampered oxygen transfer imposed by the lowered stirrer speed. The stirrer speed was increased in steps of 100 rpm to 1000 rpm over a period of 5 hours. In order to enable comparison of production of stilbenoids in both cultures, the PALCPR-control culture was subjected to the same conditioning regime. In both cultures the cells kept growing exponentially with concomitant production of CO₂.

The cells in the PALCPR-control culture consumed the galactose in 17 hours, whereas the galactose in the PALCPR- solvent culture was depleted after a little less than 25 hours. Based upon the CO₂ production the specific growth rate was estimated to be 0.23 1/h for the cells in the PALCPR-control culture, and 0.13 1/h for the cells in the PALCPR-solvent culture (Figure IA and IB) . The final biomass content was 27.5 g/1 in the PALCPR-control culture and 19.6 g/1 in the PALCPR-solvent culture.

For the determination of stilbenoids, samples were taken at the point of galactose depletion. For the PALCPR- solvent culture, an aliquot of 25 ml of cell broth was collected, and phase separation was initiated by centrifugation at 3500 g for 5 minutes. Both the upper octylacetate phase and the lower aquous medium phase were collected separately with a pipet and directly analyzed for their content of stilbenoids and intermediates by HPLC as follows : For quantitative analysis of cinnamic acid, coumaric acid, resveratrol and pinosylvin, samples were subjected to separation by high-performance liquid chromatography (HPLC) prior to uv-diode-array detection at λ = 306 nm. A Phenomenex (Torrance, CA, USA) Luna 3 micrometer C18 (100 X 2.00 mm) column was used at 60 °C . As mobile phase a gradient of acetonitrile and milliq water (both containing 50 ppm trifluoroacetic acid) was used at a flow of 0.4 ml/min. The gradient profile was linear from 15 % acetonitrile to 100 % acetonitrile over 20 min. The elution time was approximately and 5.0-5.2 minutes for resveratrol and 8.8- 8.9 minutes for trans-pinosylvin .

The total concentration of stilbenoid intermediates that was produced was then calculated by multiplying the concentrations in the upper phase with a factor of 0.3 and then adding them to the concentrations that were observed in the lower phase. For the PALCPR-control culture, two aliquots of 10 ml of cell broth were collected, and one aliquot was vigorously mixed with 10 ml of 100% of ethanol. The solubility of stilbenoids in ethanol is far higher than in water and thus ensures the determination of levels of stilbenoids that would normally exceed the aquous solubility. Furthermore, stilbenoids that possibly would be bound to the cell-membranes would be recovered as well.

Thus this ethanol-washed aliquot would represent the total amount of stilbenoids produced in PALCPR-control and can be compared to the total amount of stilbenoids produced in the PALCPR-solvent culture. Indeed, a similar ethanol wash performed on the solvent phase did not result in an increase in the titers of stilbenoid- and stilbenoid intermediates, indicating that the solvent phase truly captured all the polar intermediates present in the medium broth or attached to cell membranes. Both aliquots were directly subjected to centrifugation at 3500 g, and the supernatant was analyzed for their content of stilbenoids and their intermediates. The results are shown in the following table:

Coumaric acid Resveratrol Cinnamic acid Pinosylvin

(mg/l/θ total) (mg/l/θ total) (mg/l;θ total) (mg/l/θ total]

PALCPR-solvent Upper phase (0.3 L) 24 .23 ; 36 .2 20 .72 ;56 .5 55 .84 ;55.2 Lower phase (1 L) 12 .79 ; 63 .8 4. 72; 43. ,1 0 .85 ; 4.8 Total produced in 1 L 20 .09 ; 1 00 10 .93 / 1 00 17 .6, ; 100 PALCPR-control Supernatant, ethanol 20. 01 9. 70 22, .63 Supernatant, no ethanol 11. 43 3. 59 1. 74

The results demonstrated that the PALCPR strain was able to grow in the presence of a solvent mixture containing 200 ml dodecane, and 100 ml octylacetate, growth rate and biomass yield were slighty impaired compared to the control fermentation without solvents, however, production of stilbenoids and intermediates was not substantially affected and total titers were similar to the control culture. The solvent mixture was able to capture 95 % of the stilbenoid pinosylvin and 36 % of the more polar stilbenoid resveratrol. Obviously, the non-polar dodecane fraction in the solvent mixture sufficiently obscured the toxic effects on cells of the more polar and hence more toxic octylaceate fraction. The polarity of the mixture was indeed sufficiently high to capture almost all of the stilbenoid pinosylvin, but did not fully capture the more polar stilbenoid resveratrol.

The PALCPR control culture produced a persitent brown precipitate that settled on the inner vessel wall and baffles, and moreover fouled vital fermentor parts such as the stirrer shaft, gas-outlet, pH-and dO probe that would endanger a proper control of the fermentation process parts sstirrer shaf precipitates on said fermentor components. The PALCPR-solvent culture, however, did not show fouling of said fermentor components. Instead, a creamy/gelly substance was formed that remained in the fermentation broth, but manifested as an interface between the medium and the solvent phase after centrifugation . This "third" phase did not contain substantial amounts of stilbenoids or intermediates and could be discarded relatively easily.

Example 4 Determination of intracellular and extracellular levels of stilbenoids in a batch culture of an evolved strain of PALCPR

The solvent mixture described in the previous example was not capable to capture all resveratrol produced, therefore a fermentation was initiated to adapt the cells to grow in the presence of a solvent mixture that contained solely the more polar and thus more toxic solvent octylacetate. The cells of the PALCPR-solvent culture described in the previous example were taken as starting point because the presence of the solvent mixture would possibly have already evoked adaptation of cells to solvents. For that, cells of the culture described in the previous example were harvested during mid-exponential-phase and stored at -80 ⁰C in 15% glycerol and subsequently a fermentor, containing the same medium as described in the previous example with 10 g/1 glucose and 100 g/1 galactose, was then inoculated with cells of said PALCPR-solvent culture. The cells were allowed to fully consume the glucose at a stirring speed of 1000 rpm with an average dissolved oxygen content of above 70% of saturated air. At the onset of galactose consumption, the stirring rate was turned down to 300 rpm, after which slowly 100 ml of octylacetate was added.

Upon addition of octylacetate consumption of galactose was immediately arrested, the dissolved oxygen content increased to almost 99% of saturated air, O2- consumption and CO2 production halted, all indicating that proliferation of cells arrested. However after approximately 170 hours, the CO2 signal slowly increased, Dissolved oxygen slowly decreased, indicating that cells started to grow. Galactose consumption indeed commenced again. A small arrest in CO2 production again occurred after 20 hours which, however, recovered after 5 hours, after which the cells grew exponentially with concomitant production of CO2, consumption of galactose within less than 40 hours. Based upon the CO2 production the specific growth rate was estimated to be

0.062 1/h (Figure 2) . The final biomass concentration was 21.6 g/1.

For the determination of stilbenoids, an aliquot of 25 ml of cell broth was collected, and phase separation was initiated by centrifugation at 3500 g for 5 minutes. Both the upper octylacetate phase and the lower aquous medium phase were collected separately with a pipet and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table:

Evolved PALCPR in Coumaric acid Resveratrol Cinnamic acid Pinosylvin

2-phase fermentation (mg/l/θ total) (mg/l/θ total) (mg/l;% total) (mg/l/θ total]

Upper phase (0.1 L) 233.4;18.0 163.0;92.6 408.0/52.5 32.0;100

Lower phase (1 L) 106.3;82.0 1.3;7.4 36.9;47.5 0 ; 0

Total produced in 1 L 129.64/ 100 17.6/ 100 11.1; 100 3.2/ 100

The results demonstrated clearly that strain PALCPR was able to adapt after 170 hours to the presence of 100 ml octylacetate . Though the growth rate was indeed lower than the PALCPR-control- and PALCPR-solvent culture in the previous example, the final biomass concentration was similar to said cultures.

The solvent mixture was now able to capture 100 % of the stilbenoid pinosylvin and 92 % of the more polar stilbenoid resveratrol. That result demonstrated that the polarity of the mixture was indeed sufficiently high to capture both the stilbenoids pinosylvin and resveratrol almost fully to completion. The total amount of resveratrol produced was comparable with the PALCPR-control and PALCPR- solvent cultures in the previous example, however, the culture now produced relatively high amounts of the intermediate coumaric acid, substantial amounts of cinnamic acid and very minor amounts of the stilbenoid pinosylvin. Possibly the observed change in product profile could be the result of the solvent that drained the intermediates away from the cells, thereby changing the intracellular concentrations in the cells and with that influence the product pattern through the kinetic properties of the enzymes. In case that a resveratrol producing strain is preferred, the addition of a solvent clearly could simplify down-stream processing by capturing the reveratrol, and at the same time impairing production of other similar stilbenoids .

Moreover, similar to the PALCPR-solvent culture in previous example, no persitent brown precipitate was produced that would otherwise have fouled vital fermentor parts, but a creamy/gelly substance was formed that manifested as a "third" phase and which could easily be discarded. Example 5

Determination of intracellular and extracellular levels of stilbenoids in a batch culture of a further evolved strain of PALCPR

The evolved PALCPR-evolved-I strain described in the previous example still displayed a long lag-phase to adapt to the solvent phase. In order to further improve said strain in terms of length of lag-phase and growth rate, a 25 ml aliquot of the exponentional growing PALCPR-evolved-I strain was used to inoculate a fermentor, containing a similar medium as described in the previous example. However, the medium now only contained 100 g/1 galactose and did contain 100 ml of octylacetate from the beginning of the fermentation. In addition, the stirrer speed was instantly set at 800 rpm. Upon inoculation of the fermentor, consumption of galactose only commenced after approximately 40 hours, indicated by a slow increase in CO2 signal, a decrease in dissolved oxygen and addition of base. Indeed the cells continued to grow exponentially with concomitant production of CO2, and consumed the galactose within less than 90 hours. Based upon the CO2 production the specific growth rate was estimated to be 0.041 1/h (figure 3) . The final biomass concentration was 21.5 g/1. The strain is referred to as PALCPR-evolved-II .

For the determination of stilbenoids, an aliquot of 25 ml of cell broth was collected, and phase separation was initiated by centrifugation at 3500 g for 5 minutes. Both the upper octylacetate phase and the lower aquous medium phase were collected separately with a pipet and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by multiplying the concentrations in the upper phase with a factor of 0.3 and then adding them up to the concentrations that were observed in the lower phase. The results are shown in the following table:

Evolved PALCPR in Coumaric acid Resveratrol Clnnamlc acid Pinosylvin 2-phase fermentation (mg/l/θ total) (mg/l/θ total] (mg/l;% total) (mg/l/θ total)

Upper phase (0.1 L) 383.9;59.3 210.4;31.3 163.4/88.6 30.1 ; 100 Lower phase (1 L) 26.3 ; 40.7 2.0; 8.7 2.1; 11.4 0 ; 0 Total produced in 1 L 64.1/ 100 23.0/ 100 18.4/ 100 3.1/ 100

The results demonstrated clearly that strain PALCPR- evolved-II was able to grow on a medium that contained 100 ml of octyl acetate from the beginning with a stirring speed immediately set at 800 rpm. The lag-phase of 40 hours was already considerably shorter than the 170 hrs described in the previous example, though at the expense of the growth rate that decreased to 0.041 1/h and with that galactose was depleted only after approximately 90 hours. Though the growth rate was indeed lower than the PALCPR-evolved-I culture in the previous example, the final biomass concentration was similar to said culture.

The solvent mixture was able to capture 100 % of the stilbenoid pinosylvin and 91 % of the more polar stilbenoid resveratrol. The total amount of resveratrol produced was higher than the PALCPR-evolved-I culture and the PALCPR- control and PALCPR-solvent cultures in the previous examples. However, the culture now produced lower amounts of the intermediates coumaric acid and cinnamic acid, which could be a result of the adaptation of the cells to the solvent .

Moreover, no persitent brown precipitate was produced that would otherwise have fouled vital fermentor parts, but a creamy/gelly substance was formed that manifested as a "third" phase and which could easily be discarded.

Example 6

Determination of intracellular and extracellular levels of stilbenoids in a batch culture of an even further evolved strain of PALCPR. The evolved PALCPR-evolved-II strain described in the previous example still displayed a shorter lag-phase than PALCPR-evolved-I but the growth rate was rather low with 0.041 1/h. Therefore, to further improve said strain in terms of both length of lag-phase and growth rate, a 50 ml aliquot of the exponentional growing PALCPR-evolved-II strain was used to inoculate a fermentor, containing a similar medium as described in the previous example (thus containing 100 g/1 galactose 100 ml of octylacetate from the beginning of the fermentation) . The stirrer speed was instantly set at 800 rpm. Upon inoculation of the fermentor, consumption of galactose already commenced after less then 20 hours, indicated by a slow increase in CO2 signal, a decrease in dissolved oxygen and addition of base. Indeed the cells further grew exponentially with concomitant production of CO2, and now consumed the galactose within approximately 50 hours. Based upon the CO2 production the specific growth rate was estimated to be 0.091 1/h (figure 4) . The final biomass concentration was 18.9 g/1. The strain is referred to as PALCPR-evolved-III .

For the determination of stilbenoids, an aliquot of 25 ml of cell broth was collected, and phase separation was initiated by centrifugation at 3500 g for 5 minutes. Both the upper octylacetate phase and the lower aquous medium phase were collected separately with a pipet and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table: Evolved PALCPR in Coumaric acid Resveratrol Clnnamlc acid Pinosylvin

2-phase fermentation (mg/l/θ total) (mg/l/θ total] (mg/l;% total) (mg/l/θ total)

Upper phase (0.1 L) 105.8; 40.0 223.6; 90.3 298.7/71.3 167.9;30.3

Lower phase (1 L) 15.9; 60.0 2.4; 9.7 12.0; 28.7 1.8; 9.7

Total produced in 1 L 26.5/ 100 24.8/ 100 41.9/ 100 18.6/ 100

The results demonstrated clearly that strain PALCPR- evolved-III was able to grow on a medium that contained 100 ml of octyl acetate from the beginning with the stirring speed immediately set at 800 rpm. The lag-phase of 20 hours was shortened further compared to the 40 hours lag-phase described in the previous example, and this time the growth rate increased from 0.041 1/h to 0.091 1/h. Concommitantly the galactose was depleted only after approximately 90 hours. Though the growth rate was indeed lower than the PALCPR-evolved-I culture in the previous example, the final biomass concentration was similar to said culture.

The solvent mixture was able to capture 100 % of the stilbenoid pinosylvin and 91 % of the more polar stilbenoid resveratrol. The total amount of resveratrol produced was similar to the PALCPR-evolved-II culture but higher than the PALCPR-control and PALCPR-solvent cultures in the previous examples. However, compared to the PALCPR-evolved-III culture, the PALCPR-evolved-III culture produced lower amounts of coumaric acid, higher amounts of cinnamic acid, and considerably higher amounts of pinosylvin. The change in the overall product profile of the phenylpropanoid imtermediates could be the result of a further adaptation of the cells to the solvent.

Moreover, no persitent brown precipitate was produced that would otherwise have fouled vital fermentor parts, but a creamy/gelly substance was formed that manifested as a "third" phase and which could easily be discarded.

Example 7

Stilbenoid production in Aspergillus nidulans ARl Aspergillus nidulans ARl has deleted the following genes genes argB2, pyrG89, veA.

a) Construction of a filamentous fungal expression vector, with argB (ornithine carbamoyltransferase) marker.

The gene encoding argB including the homologous promoter and terminator sequence was amplified from Aspergillus nidulans ARl genomic DNA using forward primer 5-CG GAATTC ATA CGC GGT TTT TTG GGG TAG TCA-3 (SEQ ID NO: 11) and the reverse primer 5-CG CCCGGG TAT GCC ACC TAC AGC CAT TGC GAA-3 (SEQ ID NO: 12) with the 5' overhang containing the restriction sites EcoRI and Xmal respectively. The incorporated restriction sites in the PCR product allowed insertion into pUC19 (New England biolabs, Ipswich, MA.) digested with EcoRI and Xmal giving pUC19-argB. The trpC (Indole-3-glycerol phosphate synthase) terminator was amplified from A. nidulans genomic DNA using forward primer 5-GC GGATCC ATA GGG CGC TTA CAC AGT ACA CGA-3 (SEQ ID NO: 13) and the reverse primer 5-

CGGAGAGGGCGCGCCCGTGGCGGCCGC GGA TCC ACT TAA CGT TAC TGA-3 SEQ ID NO: 14 with the 5' overhang containing the restriction site BamHI and a 27 base pair adaptamer respectively.

The gpdA (glyceraldehyde-3-phosphate dehydrogenase) promoter was amplified from A. nidulans ARl genomic DNA using forward primer 5-GCGGCCGCCACGGGCGCGCCCTCTCCG GCG GTA GTG ATG TCT GCT CAA-3 (SEQ ID NO: 15) and the reverse primer 5-CG AAGCTT TAT AAT TCC CTT GTA TCT CTA CAC-3 SEQ ID NO : 16 with the 5' overhang containing a 27 base pair adaptamer and the restriction site HindIII respectively. The fusion PCR product of fragment trpC and gpdA with the incorporated restriction sites allow insertion into pUC19- argB digested with BamHI and HindIII yielding pAT3.

b) Construction of a filamentous fungal expression vector with pyrG (orotidine-5 ' -monophosphate decarboxylase) marker for expression of C4H (Cinnamate-4-hydroxylase) in A. nidulans ARl .

The gene encoding C4H was reamplified from the yeast plasmid pESC-URA-PAL2-C4H (WO2006089898 ) using the forward primer 5-CG G CGCG C ATA ATG GAC CTC CTC TTG CTG GAG-3 SEQ ID NO: 17 and the reverse primer 5-GG GC GGCC GC TTA TTA ACA GTT CCT TGG TTT CAT AAC G-3 SEQ ID NO: 18 with the 5' overhang containing the restriction sites BssHII and Notl respectively. The incorporated restriction sites in the PCR product allowed insertion into pAT3 digested with BssHII and Notl giving pAT3-C4H. The construct was verified by restriction enzyme cut and sequencing. The argB marker was removed by using the two following restriction enzymes BsiWI and Pcil .

The gene encoding pyrG including the homologous promoter and terminator sequence was reamplified from Aspergillus fumigatus genomic DNA using the forward primer 5-CGT GTAC AATA TTA AT TAA CGAGA GCG AT CGC AAT AAC CGT ATT ACC GCC TTT GAG-3 SEQ ID NO: 19 and reverse primer 5-CGA CATG TAT TCC CGG GAA GAT CTC ATG GTC A-3 SEQ ID NO: 20 with the 5' overhang containing the restriction sites BsrGI, Pad, AsiSI in the forward primer and Pcil in the reverse primer. The incorporated restriction sites in the PCR product allowed insertion into pAT3 digested with BsiWI and Pcil giving pAT3-C4H-pyrG. The construct was verified by restriction enzyme cut and sequencing. c) Construction of a filamentous fungal expression vector with argB marker for expression of 4CLl (4-coumarate-CoA ligase) in A. nidulans ARl

The gene encoding 4CLl was reamplified from the yeast plasmid pESC-TRP-4CLl-VSTl using the forward primer 5- GCGGAGAGGGCGCG ATG GCG CCA CAA GAA CAA GCA-3 SEQ ID NO: 21 and the reverse primer 5-TGGATCCGCGGCCGC TCA CAA TCC ATT TGC TAG TTT TGC-3 SEQ ID NO: 22. The 4CLl gene was inserted into a pAT3 vector digested with BssHII and Notl using the Infusion™ PCR cloning Technology (Clontech, Mountain View, Calif.) to yield pAT3-4CLl. The construct was verified by restriction enzyme cut and sequencing.

d) Construction of a filamentous fungal expression vector with argB marker for expression of VSTl (resveratrol synthase) in A. nidulans ARl

The gene encoding VSTl was reamplified from the yeast plasmid pESC-TRP-4CLl-VSTl using the forward primer 5-CG G CGCG C ATA ATG GCA TCC GTA GAG GAG TTC-3 SEQ ID NO: 23 and the reverse primer 5-GG GC GGCC GC TTA TCA TTA GTT AGT GAC AGT TGG AA-3 SEQ ID NO: 24 with the 5' overhang containing the restriction sites BssHII and Notl respectively. The incorporated restriction sites in the PCR product allowed insertion into pAT3 digested with BssHII and Notl giving pAT3-VSTl. The construct was verified by restriction enzyme cut and sequencing.

e) Expression of the pathway leading to pinosylvin in A. nidulans ARl (The strain has deletions (argB2, pyrG89, veAl) ) using C4H, 4CLl and VSTl. The transformation of the A. nidulans ARl fungal cell was conducted in accordance with methods known in the art by protoplastation using cell wall lysing enzymes (glucanex, novozymes) Tilburn et al.,1983. Random integration of C4H, 4CLl and VSTl was conducted in two steps. Plasmid pAT3-4CLl and pAT3-VSTl were linearized using restriction enzyme Bmrl and integrated in the genome by co-transformation according to Guerra et al . , 2006 utilizing the auxotrophic marker argB. A transformant containing a 4CLl and VSTl expression cassette was isolated and a successive transformation with pAT3-C4H-pyrG, which was linearized with Bmrl, gave a recombinant A. nidulans strain containing C4H, 4CLl and VSTl.

Example 8

Stilbenoid production in Escherichia coli

a) Construction of a bacterial vector for expression of PAL2 in Escherichia coli.

The plasmids that were used in the following examples contained one or more marker genes to allow the microorganism that harbour them to be selected from those which do not. The selection system is based upon dominant markers, e.g. resistance against ampicilin and kanamycin. In addition, the plasmids contained promoter- and terminator sequences that allowed the expression of the recombinant genes. Furthermore, the plasmids contained suitable unique restriction sites to facilitate the cloning of DNA fragments and subsequent identification of recombinants. In this example the plasmids contained either the ampicilin resistance gene, designated as pETlβb (Novagen) , or the kanamycin resistance gene, designated as pET26b (Novagen).

The gene encoding PAL2, isolated as described previously, was reamplified by PCR from the plasmid pESC- URA-PAL2 using forward- and reverse primers, with 5' overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5' and 3' ends of the gene allowed ligation of the restricted PCR product into a digested pET16B vector that contained the T7 promoter. The resulting plasmid, pET16B-PAL2, contained the gene encoding PAL2 under the control of the T7 promoter.

b) Construction of a bacterial vector for expression of 4CLl and VSTl in Escherichia coli.

The gene encoding 4CLl, isolated as described previously, was reamplified by PCR from the plasmid pESC- URA-4CL1-VST1 , using forward- and reverse primers, with 5' overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5' and 3' ends of the gene allowed ligation of the restricted PCR product into a digested pET26B vector. The resulting plasmid, pET26B-4CLl, contained the gene encoding for 4CLl under the control of the T7 promoter from Lactobacillus lactis . The gene encoding VSTl, isolated as described in previosly, was reamplified by PCR from the plasmid pESC-URA- 4CL1-VST1 using forward- and reverse primers, with 5' overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5' and 3' ends of the gene allowed ligation of the restricted PCR product into a digested pET16B vector. The resulting plasmid, pET16B-VSTl, contained the gene encoding VSTl under the control of the T7 promoter. The T7 promoter and the gene encoding VSTl were reamplified as one fragment by PCR from the plasmid pET16B-VSTl using forward and reverse primers, with 5' overhangs containing suitable restriction sites.

The introduction of said restriction sites at the 5' and 3' ends of the DNA fragment allowed ligation of the restricted PCR product into the digested plasmid pET26B- 4CLl. The resulting plasmid, pET26B-4CLl-VSTl, contained the genes encoding 4CLl and VSTl, each under the control of their individual T7 promoter. The sequence of the genes encoding 4CLl and VSTl was verified by sequencing of two different clones of pET26B-4CLl-VSTl .

c) Expression of the pathway to pinosylvin in Escherichia coli

Escherichia coli strains were transformed with the vectors described in (a) and (b) , separately or in combination. The transformation of the bacterial cell was conducted in accordance with methods known in the art, for instance, by using competent cells or by electroporation (see, e.g., Sambrook et al . , 1989). Transformants were selected on medium containing the antibiotics ampicilin and kanamycin and streak purified on the same medium.

Escherichia coli strain BL21 (DE3) was transformed separately with the vector pET16B-PAL2 (a), yielding the strain FSEC-PAL2; and with pET26B-4CLl-VSTl (b) , yielding strain FSEC-4CL1VST1. In addition, Escherichia coli strain BL21 (DE3) was co-transformed with pET16B-PAL2 (a) and pET26B-4CLl-VSTl (n) , and the transformed strain was named FSEC-PAL24CL1VST1. Example 9

Cons tructi on of s train FS09229 , con taining the phenylpropanoid pa thway wi th gl ucose-cons ti tu ti ve promoters

I) Isolation of genes encoding PAL C4H, 4CL2 and VSTl

4-coumarate : CoenzymeA ligase (4CL2) SEQ ID NO: 25

(Hamberger and Hahlbrock 2004; Ehlting et al . , 1999;) was isolated via PCR from A. thaliana cDNA (BioCat, Heidelberg, Germany) using suitable primers.

The PAL2 gene encoding Arabidopsis thaliana resveratrol phenylalanine ammonia lyase (Cochrane et al . , 2004) was synthesized by GenScript Corporation (Piscataway, NJ) . The amino acid sequence was used as template to generate a synthetic gene codon (SEQ ID NO: 26) optimized for expression in 5. cerevisiae . The synthetic PAL2 gene was delivered inserted in E. coli pUC57 vector. The synthetic gene was purified from the pUC57 vector by amplifying it by forward primer 5-CAC TAA AGG GCG GCC GCA TGG ACC AAA TTG AAG

CA-3 SEQ ID NO: 27 and reverse primer 5-AAT TAA GAG CTC AGA

TCT TTA GCA GAT TGG AAT AGG TG-3 SEQ ID NO: 28 and purified from agarose gel using the QiaQuick Gel Extraction Kit

(Qiagen) .

The C4H gene encoding Arabidopsis thaliana cinnamate-4- hydroxylase (Hamberger and Hahlbrock 2004; Ehlting et al . , 1999) was synthesized by GenScript Corporation (Piscataway, NJ) . The amino acid sequence was used as template to generate a synthetic gene (SEQ ID NO: 29) (S codon optimized for expression in 5. cerevisiae . The synthetic C4H gene was delivered inserted in E. coli pUC57 vector. The synthetic gene was purified from the pUC57 vector by amplifying it by forward primer 5-ATT TCC GAA GAA GAC CTC GAG ATG GAT TTG TTA TTG CTG G-3 SEQ ID NO: 30 and reverse primer 5-AGT AGA TGG AGT AGA TGG AGT AGA TGG AGT AGA TGG ACA ATT TCT GGG TTT CAT G-3 SEQ ID NO: 31 and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen) .

The ATR2 gene encoding Arabidopsis thaliana P450 reductase was synthesized by GenScript Corporation (Piscataway, NJ) . The amino acid sequence was used as template to generate a synthetic gene (SEQ ID NO: 32) codon optimized for expression in 5. cerevisiae . The synthetic C4H gene was delivered inserted in E. coli pUC57 vector. The synthetic gene was purified from the pUC57 vector by amplifying it by forward primer 5-CCA TCT ACT CCA TCT ACT CCA TCT ACT CCA TCT ACT AGG AGG AGC GGT TCG G-3 SEQ ID NO: 33 and reverse primer 5-ATC TTA GCT AGC CGC GGT ACC TTA CCA TAC ATC TCT CAG ATA TC-3 SEQ ID NO: 34 and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen) .

The VSTl gene encoding Vitis vinifera (grapevine) resveratrol synthase (Hain et al . , 1993) was synthesized by GenScript Corporation (Piscataway, NJ) . The amino acid sequence was used as template to generate a synthetic gene codon optimized for expression in 5. cerevisiae. The synthetic VSTl gene (SEQ ID NO: 35) was delivered inserted in E. coli pUC57 vector flanked by BamHl and Xhol restriction sites. The synthetic gene was amplified using forward primer 5-CCG GAT CCT CAT GGC ATC CGT CGA AGA GTT CAG G-3 SEQ ID NO: 36 and reverse primer 5-CGC TCG AGT TTT AGT TAG TAA CTG TGG GAA CGC TAT GC-3 SEQ ID NO: 37 and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen) .

II) Construction of a yeast vector for galactose induced expression of 4CL2 and VSTl The gene encoding 4CL2 was isolated as described in section I. The amplified 4CL2 PCR-product using forward primer 5-GCG AAT TCT TAT GAC GAC ACA AGA TGT GAT AGT CAA TGA T-3 SEQ ID NO: 38 and reverse primer 5-GCA CTA GTA TCC TAG TTC ATT AAT CCA TTT GCT AGT CTT GC-3 SEQ ID NO: 39 was digested with EcoRl/Spel and ligated into EcoRl/Spel digested pESC-HIS vector (Stratagene) , resulting in vector pESC-HIS-4CL2.

Two different clones of pESC-HIS-4CL2 were sequenced to verify the sequence of the cloned gene.

The gene encoding VSTl was isolated as described in section I. The amplified synthetic VSTl gene was digested with BamHl/Xhol and ligated into BamHl/Xhol digested pESC-

HIS-4CL2. The resulting plasmid, pESC-HIS-4CL2-VSTl, contained the genes encoding 4CL2 and VSTl under the control of the divergent galactose induced <=GAL1/GAL1O=> promoters.

The sequence of the gene encoding VSTl was verified by sequencing of two different clones of pESC-HIS-4CL2-VSTl

(SEQ ID NO: 40) .

III) Construction of a yeast vector for galactose induced expression of PAL2 and C4H:ATR2 fusion gene

The gene encoding PAL2 was isolated as described in section I. The amplified PAL2 PCR-product was inserted into Notl/Bglll digested pESC-URA vector Stratagene) , resulting in vector pESC-URA-PAL2. Two different clones of pESC-URA- PAL2 were sequenced to verify the sequence of the cloned gene .

The genes encoding C4H and ATR2 were isolated as described in section I. C4H was amplified using forward primer 5-ATT TCC GAA GAA GAC CTC GAG ATG GAT TTG TTA TTG CTG

G-3 SEQ ID NO: 41 and reverse primer 5-AGT AGA TGG AGT AGA TGG AGT AGA TGG AGT AGA TGG ACA ATT TCT GGG TTT CAT G-3 SEQ ID NO: 42. ATR2 was amplified using forward primer 5-CCA TCT ACT CCA TCT ACT CCA TCT ACT CCA TCT ACT AGG AGG AGC GGT TCG G-3 SEQ ID NO: 43 and reverse primer 5-ATC TTA GCT AGC CGC GGT ACC TTA CCA TAC ATC TCT CAG ATA TC-3 SEQ ID NO: 44.

The amplified PCR products C4H and ATR2 were used as templates for the creation of the fusion gene C4H:ATR2 using the forward primer 5-ATT TCC GAA GAA GAC CTC GAG ATG GAT TTG TTA TTG CTG G-3 SEQ ID NO: 41 and the reverse primer 5-ATC TTA GCT AGC CGC GGT ACC TTA CCA TAC ATC TCT CAG ATA TC-3 SEQ ID NO:44.

The Fusion gene C4H:ATR2 gene was inserted into

Xhol/Kpnl digested pESC-URA-PAL2 by Infusion™ technology

(stratagene, La jolla, USA). The resulting plasmid, pESC- URA-PAL2-C4H:ATR2, contained the genes encoding PAL2 and

C4H:ATR2 under the control of the divergent galactose induced <=GAL1/GAL1O=> promoters. The sequence of the gene encoding C4H:ATR2 was verified by sequencing of two different clones of pESC-URA-PAL2-C4H: ATR2 (SEQ ID NO: 45).

IV) Construction of strong constitutive promoter fragment TDH3

The 600 base pair TDH3 (GPD) promoter was amplified from 5. cerevisiae genomic DNA using the forward primer 5' GC GAGCTC AGT TTA TCA TTA TCA ATA CTC GCC ATT TCA AAG SEQ ID NO: 46 containing a Sacl restriction site and the reverse primer 5'- CG TCTAGA ATC CGT CGA AAC TAA GTT CTG GTG TTT TAA AAC TAA AA SEQ ID NO: 47 containing a Xbal restriction site. The amplified TDH3 fragment was digested with Sacl/Xbal and ligated into Sacl/Xbal digested plasmid pRS416 (Sikorski and Hieter, 1989) as described previously (Mumberg et al, 1995) resulting in plasmid pRS416-TDH3.

V) Construction of constitutive strong promoter fragment TEFl

The 400 base pair TEFl promoter was amplified from 5. cerevisiae genomic DNA using the forward primer 5'- GC GAGCTC ATA GCT TCA AAA TGT TTC TAC TCC TTT TTT ACT CTT SEQ ID NO: 48 containing a Sacl restriction site and the reverse primer 5'- CG TCTAGA AAA CTT AGA TTA GAT TGC TAT GCT TTC TTT CTA ATG A SEQ ID NO : 49 containing a Xbal restriction site. The amplified TEFl fragment was digested with Sacl/Xbal and ligated into Sacl/Xbal digested plasmid pRS416 (Sikorski and Hieter, 1989) as described previously (Mumberg et al, 1995) resulting in plasmid pRS416-TEFl.

VI) Construction of fused divergent constitutive TEFl and TDH3 promoter fragment

A divergent fusion fragment (Figure 1) between TEFl promoter and TDH3 promoter was constructed starting from PRS416-TEF1 and PRS416-TDH3.

The 600 base pair TDH3 fragment was reamplified from PRS416-TDH3 using the forward primer 5' TTGCGTATTGGGCGCTCTTCC GAG CTC AGT TTA TCA TTA TCA ATA CTC GC SEQ ID NO: 50 containing the underlined overhang for fusion PCR to TEFl fragment and the reverse primer 5' AT GGATCC TCT AGA ATC CGT CGA AAC TAA GTT CTG SEQ ID NO: 51 containing the underlined BamHl restriction site. This resulted in a fragment ready for fusion to the below TEFl fragment .

The 400 base pair TEFl fragment including a 277 base pair spacer upstream of the Sacl restriction site was reamplified from PRS416-TEF1 using the forward primer 5' AT GAATTC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC SEQ ID NO: 52 containing the underlined EcoRl restriction site and the reverse primer 5' TGA TAA TGA TAA ACT GAG CTC GGA AGA GCG CCC AAT ACG CAA AC SEQ ID NO: 53 containing the underlined overhang for fusion to the TDH3 fragment. This resulted in a 680 base pair fragment ready for fusion to the TDH3 fragment.

The 600 base pair TEFl fragment and the 600 base pair TDH3 fragments were joined together (fused) using fusion PCR with the forward primer 5' AT GAATTC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC SEQ ID NO: 54 and the reverse primer 5' AT GGATCC TCT AGA ATC CGT CGA AAC TAA GTT CTG SEQ ID NO: 55, resulting in the divergent fragment <=TEF1/TDH3=> (SEQ ID NO: 56) .

VII) Construction of a yeast vector for constitutive expression induced of 4CL2 and VSTl pesc-HIS-TDH3-4CL2-TEF- VSTl

The vector pESC-HIS-4CL2-VSTl (figure 2) with divergent galactose inducible promoters GAL1/GAL10 was sequentially digested with EcoRl and BamHl to remove the GAL1/GAL10 promoters .

The divergent constitutive <=TEF1/TDH3=> promoter fragment (Sequence ID 56) was reamplified with forward primers 5' ATGAATTC TCT AGA ATC CGT CGA AAC TAA GTT CTG SEQ ID NO: 57 and reverse primers AT GGA TCC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC TTT CTA A SEQ ID NO: 58 to reverse the orientation of TEF and TDH3 promoters in the final construct, that is to revert construct pESC-HIS-TEFl-4CL2- TDH3-VST1 into pESC-HIS-TDH3-4CL2-TEFl-VSTl . The reamplified fragment was sequentially digested with EcoRl and BamHl and ligated into the above vector without the GALl/GallO fragment. This resulted in a vector pesc-HIS- TDH3-4CL2-TEF1-VST1 (Figure 3) with replaced promoters, from GALl/GallO to TDH3/TEF1 (SEQ ID NO: 59) .

VIII) Marker exchange of the expression vector pesc-HIS- TDH3-4CL2-TEF-VSTl

The vector pesc-HIS-TDH3-4CL2-TEF-VSTl with divergent constitutive TDH3/TEF1 promoters was used as template for amplification by PCR with forward primer 5- TCG ACG GAT CTA TGC GGT GTG AAA TAC C -3 (SEQ ID NO: 60) and reverse primer 5- ACT CTC AGT ACA ATC TGC TCT GAT GCC G-3 (SEQ ID NO: 61) removing the His3 expression cassette.

The Ura3 expression cassette was amplified by PCR using forward primer 5- AGA GCAGATTGTA CTGAGAGT CAT CAG AGC AGA TTG TAC TGA GAG TGC-3 (SEQ ID NO: 62) and reverse primer 5- CAC ACC GCA TAG ATC CGT CGA GGA TTT TGC CGA TTT CGG CCT ATT GG-3 (SEQ ID NO: 63) and template pESC-URA-PAL2-C4H: ATR2. The two PCR fragments were fused by Infusion™ technology (stratagene, La Jolla, USA) . This resulted in vector pesc- URA-TDH3-4CL2-TEF-VST1 with replaced auxotrophic marker, from his3 to ura3 (SEQ ID NO: 64) .

IX) Construction of a yeast vector for constitutive expression of PAL2 and C4H:ATR2 fusion gene

The vector pESC-URA-PAL2-C4H: ATR2 with divergent galactose inducible promoters GAL1/GAL10 was sequentially digested with Notl and Xhol to remove the GAL1/GAL10 promoters .

The divergent constitutive <=TEF1/TDH3=> promoter fragment was re-amplified with forward primer 5-TTC CAG CAA TAA CAA ATC CAT TTT GTA TCT AGA AAA CTT AGA TTA GAT TG-3 SEQ

ID NO: 65 and reverse primer 5-CAT TGC TTC AAT TTG GTC CAT TTT GTA TCT AGA ATC CGT CGA AAC TAA GT-3 SEQ ID NO: 66. The PCR product was sequentially inserted into the above vector without the GALl/GallO fragment using Infusion™ technology (stratagene, La Jolla, USA) . This resulted in a vector pESC- URA-TDH3-PAL2-TEF1-C4H:ATR2 with replaced promoters, from GALl/GallO to TEF1/TDH3 (SEQ ID NO: 67) .

X) Marker exchange of the expression vector pESC-URA-TDH3- PAL2-TEF1-C4H:ATR2 The vector pESC-URA-TDH3-PAL2-TEFl-C4H: ATR2 with divergent constitutive TDH3/TEF1 promoters was used as template for amplification by PCR with forward primer 5-TGA AAT ACC GCA CAG ATG-3 (SEQ ID NO: 68) and reverse primer 5-CTC TCA GTA CAA TCT GCT-3 (SEQ ID NO: 69) removing the Ura3 expression cassette.

The His3 expression cassette was amplified by PCR using forward primer 5-AGC AGA TTG TAC TGA GAG GAG CTT GGT GAG

CGC TAG GA-3 (SEQ ID NO: 70) and reverse primer 5-C ATC TGT

GCG GTA TTT CAC GGT ATT TTC TCC TTA CGC ATC-3 (SEQ ID NO: 71) and template pESC-HIS-4CL2-VSTl . The two PCR fragments were fused by Infusion™ technology (stratagene, La Jolla,

USA) . This resulted in vector pESC-HIS-TDH3-PAL2-TEFl-

C4H:ATR2 with replaced auxotrophic marker, from his3 to ura3

(SEQ ID NO: 72) .

XI) Expression of the pathway to resveratrol in the yeast S. cerevisiae using PAL2, C4H:ATR2, 4CL2 and VSTl

Yeast strains FS01529 containing the appropriate genetic markers were transformed with the vectors described in sections VIII and X giving FS09229. The transformation of the yeast cell was conducted in accordance with methods known in the art by using competent cells, an alternative being for instance, electroporation (see, e.g., Sambrook et al . , 1989). Transformants were selected on medium lacking uracil and histidine and streak purified on the same medium.

Example 10

Determination of intracellular and extracellular levels of stilbenoids in a batch culture of a further evolved strain of PALCPR

The evolved PALCPR-evolved-III strain described in the previous example was grown in the presence of nonyl-acetate, a similar solvent as octylacetate with one additional carbon atom. A 1 ml aliquot of a glycerol stock that was made from an exponentional growing PALCPR-evolved-III strain was used to inoculate a fermentor, containing a similar medium as described in the previous example, containing only 100 g/1 galactose and 100 ml of nonyl-acetate from the beginning of the fermentation. The stirrer speed was instantly set at 800 rpm. Upon inoculation of the fermentor, consumption of galactose only commenced after approximately 70 hours, indicated by a slow increase in CO2 signal, a decrease in dissolved oxygen and addition of base. Indeed the cells continued to grow exponentially with concomitant production of CO2, and consumed the galactose within less than 40 hours. Based upon the CO2 production the specific growth rate was estimated to be 0.098 1/h (figure 9) . The final biomass concentration was 36.7 g/1. The cultivation will be referred to as PALCPR-solvent . As a control-experiment said strain was grown in the similar medium without the addition of nonylacetate . Upon inoculation of the fermentor, consumption of galactose commenced already after approximately 40 hours, indicated by an increase in CO2 signal, a decrease in dissolved oxygen and addition of base. Indeed the cells continued to grow exponentially with concomitant production of CO2, and consumed the galactose within less than 30 hours. Based upon the CO2 production the specific growth rate was estimated to be 0.17 1/h. The final biomass concentration was 25.4 g/1. The cultivation will be referred to as PALCPR- control.

For the determination of stilbenoids, an aliquot of 25 ml of cell broth was collected, and phase separation was initiated by centrifugation at 3500 g for 5 minutes. Both the upper nonylacetate phase and the lower aqueous medium phase were collected separately with a pipette and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table:

Coumaric acid Resveratrol Cinnamic acid Pinosylvin (mg/l/θ total) (mg/l/θ total] (mg/l;θ total) (mg/l/θ total)

PALCPR-solvent Upper phase (0.1 L) 8.27;100 252.82;29.6 Lower phase (1 L) 0.0; 0.0 60.05; 70.4 Total produced in 1 L 0.83/ 100 85.33/ 100 PALCPR-control Supernatant 0.48 76.36

The results demonstrated that strain PALCPR-evolved-III was able to grow on a medium that contained 100 ml of nonyl acetate from the beginning with a stirring speed immediately set at 800 rpm. The lag-phase of 70 hours was already considerably longer than the lag-phase of the PALCPR-control fermentation and also a bit longer then a similar fermentation in the presence of octylacetate described in a previous example. The growth rate of 0.098 1/h was similar to the cultivation in the presence of octylacetate and considerably lower than the PALCPR-control fermentation.

Surprisingly the biomass concentration was higher than both PALCPR-control and the octylacetate fermentation.

In both the PALCPR-solvent and PALCPR-control fermentation, only cinnamic acid and resveratrol was produced. The stilbenoid profiles differ therewith with previous described control-and solvent fermentations, which could be due to the difference between inocculating with either a fresh culture (previous examples) or with a glycerol stock (this example) . Nevertheless, the solvent mixture was able to capture 100 % of the stilbenoid resveratrol whereas only 25% of cinnamic acid was captured. The total amount of resveratrol produced was slightly higher than the PALCPR-control in this example Moreover, the culture produced none of the intermediates coumaric acid and pinosylvin, which could be a result of a further adaptation of the cells to the solvent.

Example 11

Determination of intracellular and extracellular levels of stilbenoids in a batch culture of a non-evolved strain containing the phenylpropanoid pathway The non-evolved FS09229 strain described in previous examples was grown in the presence of nonyl-acetate . A 1 ml aliquot of a glycerol stock that was made frOm an exponentional growing FS09229 strain was used to inoculate a fermentor, containing a similar medium as described in the previous example, but now containing 100 g/1 glucose and 100 ml of nonyl-acetate from the beginning of the fermentation. The stirrer speed was instantly set at 800 rpm. Upon inoculation of the fermentor, a long lag-phase of approximately 70 hrs set-in, during which an apparent adaptation to the solvent took place. Consumption of glucose only then commenced, indicated by a slow increase in CO2 signal, a decrease in dissolved oxygen and addition of base. Indeed the cells continued to grow exponentially with concomitant production of CO2, and consumed the glucose within less than 25 hours. Based upon the CO2 production the specific growth rate was estimated to be 0.176 1/h (figure 10). The final biomass concentration was 15.5 g/1. The cultivation will be referred to as FS09229-solvent . As a control-experiment said strain was grown in the similar medium without the addition of nonyl-acetate. Upon inoculation of the fermentor, consumption of glucose commenced already after approximately 10 hours, indicated by an increase in CO2 signal, a decrease in dissolved oxygen and addition of base. Indeed the cells continued to grow exponentially with concomitant production of CO2, and consumed the glucose within less than 20 hours. Based upon the CO2 production the specific growth rate was estimated to be 0.22 1/h (figure 3) . The final biomass concentration was 12.8 g/1. The cultivation will be referred to as FS09229- control . For the determination of stilbenoids, an aliquot of 25 ml of cell broth was collected, and phase separation was initiated by centrifugation at 3500 g for 5 minutes. Both the upper nonylacetate phase and the lower aqueous medium phase were collected separately with a pipette and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table:

8

65

Coumaric acid Resveratrol Cinnamic acid Pinosylvin (mg/l/θ total) (mg/l/θ total) (mg/l;θ total) (mg/l/θ total]

FS09229-solvent Upper phase (0.1 L) 160 .39; 95.1 39 .29; 42.2 373.24;100 Lower phase (1 L) 0 .83,- 1.9 53 .83; 57.8 0.0; 0.0 Total produced in 1 L 16 .87/ 100 9. 31/ 100 37. 32 FS09229-control Supernatant 43.8 9 57. ϊ 31 8. 5

The results demonstrated that also the non-evolved strain FS09229 was able to grow on a medium that contained 100 ml of nonyl acetate from the beginning with a stirring speed immediately set at 800 rpm. The lag-phase of 70 hours was already considerably longer than the lag-phase of the

FSO 9229-control fermentation, but rather similar to the fermentation with PALCPR-evolved-III strain described in previous examples. The growth rate of 0.176 1/h was only slightly lower then the FS09229-control cultivation, whereas the biomass concentrations were similar.

In both the FS09229-solvent and FS09229-control fermentation, only cinnamic acid, pinosylvin and resveratrol was produced. The solvent mixture was able to capture 95 % of the stilbenoid resveratrol, 100% of the stilbenoid pinosylvin and 42% of cinnamic acid. The total amount of resveratrol produced was, however lower than the FS09229- control culture, whereas the cinnamic acid- and pinosylvin concentrations were higher. Said difference in the profile of phenylpropanoid pathway intermediates could be a result of a-non optimal adaptation of the cells to the solvent.

This experiment demonstrates clearly, however, the biocompatibility of nonyl acetate solvent, because non- adapted cells of 5. cerevisiae are already able to grow on a fermentation medium in the presence of said solvent. For an optimal production of stilbenoids, however, the strain likely needs to be further evolved on said solvent.

Example 12 Adaptation of microorganisms to the presence of solvents

The present example describes a procedure to rapidly improve the resistance of microorganisms towards non- biocompatible toxic solvents a.

Cells of a microorganism are subjected to a train of batch fermentations in a fermentor containing a suitable defined medium. The working volume is 1 L and the gas flow rate is set at 1.5 1/m, the temperature and pH is controlled at a desired setting suitable to the organism. The first fermentation contains a suitable carbon source, preferably in the range of 50 g/1 to 100 g/1, and stirring rate is kept low to prevent mixing of the medium- and solvent phase, as illustrated in Figure 5A in which a fermentor vessel is shown containing the two separated phases (aqueous) and (solvent) agitated by a stirrer below 200 rpm. At the onset of carbon-source consumption, a mixture of solvents is added. The mixture contains 10 ml of solvent (now referred to as "extractant") that is a good extractant for the desired product, but non-biocompatible with the cells, and 40 ml of a biocompatible solvent (now referred to as "biocompatible solvent") that is a poor extractant for the desired product. After depletion of the carbon source the strain is harvested and used for a next fermentation. The next fermentation is performed with said harvested strain using similar fermentation conditions as to the previous one, but now with addition of a mixture of 50 ml extractant and 100 ml biocompatible solvent. In case the cells are able to grow in the presence of said solvent mixture, the strain is harvested after carbon source depletion and used for a next fermentation. The next fermentation is performed with said harvested strain, using similar conditions as to the previous one, but now the stirring rate is increased to 1000 rpm halfway through the consumption of the carbon source, causing mixing of the solvent phase with the medium phase as illustrated in Figure 5B. In case the cells remain able to grow when the phases are mixed, the strain is harvested and used for a next fermentation. The next fermentation is then performed with said harvested strain using similar conditions as to the previous one, but now with addition of a mixture of 100 ml extractant and 100 ml biocompatible solvent. In case the increase of the extractant to 100 ml causes the arrest of cell growth, indicated by a halt in carbon source consumption, the amount of biocompatible solvent can be increased to, for instance to 200 ml, in order to further obscure the toxic effect of extractant. If necessary the amount of biocompatible solvent can even be increased further up to the point that cells can grow in the presence of the solvent mixture. In case cells are indeed able to grow in the presence of said solvent mixture at high stirring rate, the strain is harvested and stored in a solution of 15% glycerol at -80⁰C.

In case that the polarity of said solvent mixture is too low to capture sufficient amounts of desired polar products, a further train of fermentations can be initiated to adapt the cells to grow in the presence of solely the more polar and thus more toxic solvent extractant. The cells obtained from the previously described adaptation rounds are taken as starting point because the presence of the solvent mixture should possibly have already evoked adaptation of cells to solvents. For that, the glycerol stocks cells of the cultures described in the previous example is used to inoculate a fermentor, containing the same medium as described in the previous example with a suitable carbon source in the range of 50- to 100 g/1. The cells are allowed to fully consume the carbon source at a stirring speed of 1000 rpm with average dissolved oxygen content of above 70% of saturated air. At the onset of carbon source consumption, the stirring rate is turned down to 300 rpm, after which slowly 100 ml of extractant is added.

Upon addition of extractant, consumption of carbon source is arrested, the dissolved oxygen content increases to almost 99% of saturated air, O2- consumption and CO2 production halts, all indicating that the proliferation of cells arrested. However after a long lag-phase, the CO2 signal slowly increases, dissolved oxygen slowly decreases, indicating that cells start to grow, and consumption of carbon source commences again.

To further improve said strain in terms of reducing the length of the lag-phase and growth rate, a 25 ml aliquot of the exponentional growing strain as described above is used to inoculate a fermentor, containing a similar medium as described previously. However, the medium now contains 100 ml of extractant from the very beginning of the fermentation. In addition, the stirrer speed is instantly set at 800 rpm. Upon inoculation of the fermentor, consumption of the carbon source commences after a shorter lag-phase than before. To further improve said strain in terms of both length of lag-phase and growth rate, another adaption round follows with a 50 ml aliquot of the exponentional growing adapted- strain, in the presence of 100 ml of extractant and with the stirring rate instantly set at 800 rpm. The number of adaptation rounds is repeated until a satisfactory reduction of lag-phase, and sufficiently high growth-rates are reached. Example 13

Determination of intracellular and extracellular levels of stilbenoids in shakeflask cultures of FS06112, in the presence of the solvent octyl acetate

A glycerol stock of strain FS06112 was used to inoculate 500 ml baffled shake flasks that contained 100 ml modified M9 medium consisting of 4.5 g/1 glycerol, 1.5 g/1 yeast extract, 3 g/1 K₂HPO₄, 6.8 g/1 Na₂HPO₄, 0.5 g/1 NaCl, 1 g/1 NH₄C, 50 μg/ml ampicilin and 50 μg/ml kanamycin; the initial pH was set at 7.0. The shakeflasks were incubated at ambient temperature, and were mixed with a magnetic stirring bar at approximately 150 rpm. After 5 hours, isopropyl β- thiogalactopyranoside (IPTG) was added at a final concentration of 4 mM, as an inducer of the T7 promoter that was in front of each of the three genes TAL, 4CL and VST. After one hour an aliquot of 10 ml of the solvent octyl acetate was added to one shakeflask that is now referred to as FS06112-solvent ; the shakeflask culture without solvent will be referred to as FS06112-control . After an incubation period of approximately 24 hours, 2.5 g/1 glycerol was consumed in both the FS06112-solvent and -control culture and both the medium and solvent phases were analyzed for the presence of resveratrol.

For the determination of stilbenoids, an aliquot of 50 ml of cell broth was collected, and phase separation was initiated by centrifugation at 4500 g for 10 minutes. Both the upper methyl decanoate phase and the lower aqueous medium phase were collected separately with a pipette and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table:

Solvent : Coumaric acid Resveratrol Cinnamic acid Pinosylvin octyl acetate (mg/l/θ total) (mg/l/θ total] (mg/l;θ total) (mg/l/θ total)

FS06112-solvent Upper phase (0.1 L) 3.03;100 Lower phase (1 L) 0.0; 0.0 Total produced in 1 L 0.30/ 100 FS06112-control Supernatant 0.85

The results demonstrated that strain FS06112 was able to grow in a shakeflask on a medium to which 10 ml of octyl acetate was added at the onset of induction of resveratrol production. Both FS06112-solvent- and FS06112-control cultivation consumed 2.5 g/1 of glycerol within 24 hrs .

In both the FS06112-control and FS06112-solvent cultivation, resveratrol was produced without co-production of any of the other pathway intermediates coumaric acid and pinosylvin. The solvent was able to capture 100% of the stilbenoid resveratrol, but the total amount of resveratrol produced was lower than the FS06112-control cultivation.

Example 14

Construction E. coli strain FS06112, containing the "TAL"- phenylpropanoid pathway with inducible promoters .

I) Construction of a bacterial vector for expression of TAL in Escherichia coli.

An ammonia lyase from Rhodobacter capsulatus, which was codon-optimized for use in 5. cerevisiae, was used as the basis for the construction of a bacterial vector for expression of TAL in Escherichia coli. The coding sequence of tyrosine ammonia lyase (TAL) from Rhodobacter capsulatus

(Kyndt et al . , 2002; SEQ ID NO: 73 (nucleotide) and 74 (amino acid) ) was codon optimized for expression in 5. cerevisiae using the online service back translation tool at www.entelechon.com, yielding sequence SEQ ID NO: 75, which again expresses SEQ ID NO: 74. Oligos for the synthetic gene assembly were constructed at MWG Biotech and the synthetic gene was assembled by PCR using a slightly modified method protocol of from Martin et al. (2003) . The amplified synthetic TAL gene was digested with EcoRl/Spel and ligated into EcoRl/Spel-digested pESC-URA vector. The resulting plasmid, pESC-URA-TAL, contained the gene encoding for TAL under the control of the divergent GAL1/GAL10 promoter. The sequence was verified by sequencing of two different clones of pESC-URA-TAL . The gene encoding tyrosine ammonia lyase

(TAL) was reamplified by PCR from the yeast plasmid pESC-

URA-TAL described in using the forward primer 5'-CCG CTCGAG

CGG ATG ACC CTG CAA TCT CAA ACA GCT AAA G-3' SEQ ID NO: 76 and the reverse primer 5'-GC GGATCC TTA AGC AGG TGG ATC GGC AGC T-3' SEQ ID NO: 77 with 5' overhangs containing the restriction sites Xhol and BamHI, respectively. The introduction of restriction sites at the 5' and 3' ends of the gene allowed ligation of the restricted PCR product into a pET-16b vector (Novagen) , digested with Xhol and BamHI to yield pET16b-TAL. The pET-16b vector contained both the gene for ampicillin resistance and the T7 promoter. Hence, above procedure resulted in a vector that contained the gene encoding TAL under the control of the T7 promoter. The sequence of the gene encoding TAL was verified by sequencing of one clone of pET16b-TAL.

II) Construction of a bacterial vector for expression of 4CL and VST in Escherichia coli.

The gene encoding 4-Coumarate-CoA ligase (4CL1) was reamplified by PCR from the yeast plasmid pESC-TRP-4CLl-

VSTl using the forward primer 5'-TG CCATGG CA ATGGCGCCAC

AAGAACAAGC AGTTT-3' SEQ ID NO: 78 and the reverse primer 5'-

GC GGATCC CCT TCA CAA TCC ATT TGC TAG TTT TGCC-3' SEQ ID NO:

79 with 5' overhangs containing the restriction sites Ncol and BamHI, respectively. The introduction of restriction sites at the 5' and 3' ends of the gene allowed ligation of the restricted PCR product into a pETlβb vector (Novagen) digested with Ncol and BamHI. The resulting plasmid, pETlβb- 4CLl, contained the gene encoding for 4CLl under the control of the T7 promoter. Both the T7 promoter and the gene encoding 4CLl were reamplified as one fragment by PCR from the plasmid pET16b-4CLl using the forward primer (A) 5'- GACAAGCTTGCGGCC AGA TCT CGA TCC CGC GAA ATT AAT ACG-3' SEQ ID NO: 80 and the reverse primer (B) 5'- TGCTCGAGTGCGGCC TCA CAA TCC ATT TGC TAG TTT TGCC-3' SEQ ID NO: 81. The 4CLl gene was inserted into a pET26b-VSTl vector (Novagen) digested with Notl using the In-fusionTM PCR cloning Technology (Clontech, Mountain View, Calif.) to yield pET26b-VSTl-4CLl . The resulting plasmid, pET26b-VSTl- 4CLl, contained the two genes 4CLl and VSTl that each are under control of an individual T7 promoter. The sequences of the genes, promoters and terminator were verified by sequencing of four clones of pET26b-VSTl-4CLl .

The gene encoding grape resveratrol synthase (VSTl) was reamplified by PCR from the yeast plasmid pESC-TRP-4CLl- VSTl, using the forward primer 5'- CGC CATATG ATG GCA TCC GTA GAG GAG TTC AGA A -3' SEQ ID NO: 82 and the reverse primer 5'-CC GGATCC TCA TTA GTT AGT GAC AGT TGG AAC AGA els' SEQ ID NO: 83. The VSTl gene was inserted into a pET26b vector (Novagen) digested with Ndel and BamHl using the In- fusionTM PCR cloning Technology (Clontech, Mountain View, Calif.) to yield pET26b-VSTl. The pET26b vector contained both the gene for kanamycin resistance and the T7 promoter. Hence, above procedure resulted in a vector that contained the gene encoding VSTl under the control of the T7 promoter. Cloning between the Ndel and Bamhl restriction sites enabled the removal of N-terminal pET26b pelB secretion signal sequence, which would otherwise enable targeting of the expressed protein to the E. coli periplasmic space. An extra VSTl copy was cloned into a third vector encoding chloramphenicol resistance by reamplifying VSTl gene by PCR from the yeast plasmid pESCTRP- 4CL1-VSTl, using the forward primer 5'- AAGGAGATATACATATG ATG GCA TCC GTA GAG GAG TTC AGA

A-3' SEQ ID NO: 84 and the reverse primer 5'- CTTTACCAGACTC

GAG TCA TTA GTT AGT GAC AGT TGG AAC AGA GT- 3' SEQ ID NO: 85. The VSTl gene was inserted into a pACYCDuet-1 vector

(Novagen) digested with Ndel and Xhol using the In-fusionTM

PCR cloning Technology (Clontech, Mountain View, Calif.) to yield pACYCDuet-VSTl .

III) Expression of the pathway to resveratrol in Escherichia coli, using TAL, 4CL and VST.

The transformation of the bacterial cell was conducted in accordance with methods known in the art, for instance, by using competent cells or by electroporation (see, e.g., Sambrook et al . , 1989). The E. coli strain BL21 (DE3) (Novagen) was co-transformed with the three vectors pETlβb- TAL, pET26b-VST-4CL, and pACYCDuet-VSTl . Transformants were selected on Luria-Bertani (LB) medium with 50 mg/1 ampicillin, 50 mg/1 kanamycin and 50 mg/1 chloramphenicol. This resulted in a strain harboring three plasmids pETlβb- TAL, pET26b-VST-4CL, and pACYCDuet-VSTl with the full "TAL"- resveratrol pathway and double VSTl copies (FS06111). It was originally thought, before extraction procedures had been optimized, that an extra copy of VSTl gene was needed on a third plasmid for efficient expression of the resveratrol pathway. However, after optimization of extraction procedures, it was demonstrated that a strain harbouring only the two plasmids pET16-TAL and pET26-4CLl-VSTl, performed as well as the three-plasmid strain with the extra VSTl copy (FS06111) . The strain expressing the resveratrol pathway with two plasmids (FS06112), therefore, was obtained by restreaking FS06111 on LB agar plates, containing only 50 mg/1 ampicillin and 50 mg/1 kanamycin, but lacking chloramphenicol; with no selection pressure from chloramphenicol, the third plasmid was eventually lost.

Example 15

Determination of intracellular and extracellular levels of stilbenoids in shakeflask cultures of FS06112, in the presence of the solvent methyl-decanoate

A glycerol stock of strain FS06112 was used to inoculate 500 ml baffled shake flasks that contained 100 ml modified M9 medium consisting of 4.5 g/1 glycerol, 1.5 g/1 yeast extract, 3 g/1 K₂HPO₄, 6.8 g/1 Na₂HPO₄, 0.5 g/1 NaCl, 1 g/1 NH₄C, 50 μg/ml ampicilin and 50 μg/ml kanamycin; the initial pH was set at 7.0. The shakeflasks were incubated at ambient temperature, and were mixed with a magnetic stirring bar at approximately 150 rpm. After 5 hours, isopropyl β- thiogalactopyranoside (IPTG) was added at a final concentration of 4 mM, as an inducer of the T7 promoter that was in front of each of the three genes TAL, 4CL and VST. After one hour an aliquot of 10 ml of the solvent methyl decanoate was added to one shakeflask that is now referred to as FS06112-solvent ; the shakeflask culture without solvent will be referred to as FSO 6112-control . After an incubation period of approximately 48 hours, the glycerol was depleted and the medium and solvent phases were analyzed for the presence of resveratrol. For the determination of stilbenoids, an aliquot of 50 ml of cell broth was collected, and phase separation was initiated by centrifugation at 4500 g for 10 minutes. Both the upper methyl decanoate phase and the lower aqueous medium phase were collected separately with a pipette and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table:

8

79

Solvent : Coumaric acid Resveratrol Cinnamic acid Pinosylvin methyl decanoate (mg/l/θ total) (mg/l/θ total) (mq/l;% total) (mg/l/θ total]

FS06112-solvent Upper phase (0.1 L) 8.19; 100 Lower phase (1 L) 0.0; 0.0 Total produced in 1 L 0.88/ 100 FS06112-control Supernatant 1.08

The results demonstrated that strain FS06112 was able to grow in a shakeflask on a medium that to which 10 ml of methyl-decanoate was added at the onset of induction of resveratrol production. The FS06112-solvent cultivation consumed the glycerol within 48 hrs, which was only slightly longer than the 30 hours in which the FS06112-control cultivation consumed the glycerol.

In both the FS06112-control and FS06112-solvent cultivation, resveratrol was produced without co-production of any of the other pathway intermediates coumaric acid and pinosylvin. In addition, in the chromatogram of the upper- solvent phase of the FS06112-solvent cultivation a small peak could be observed with a retention time and UV-spectrum that resembled those of cis-resveratrol . Most likely, a small fraction of the produced trans-resveratrol was converted into cis-resveratrol, which could be an effect of the presence of the solvent. The solvent was able to capture 100% of the stilbenoid resveratrol, and the total amount of resveratrol produced was slightly lower than the FS06112- control cultivation. However, the small peak that allegedly represented cis-resveratrol was approximately 25% of the area of the trans-resveratrol peak, which implied that the total resveratrol content produced in the FS06112-solvent cultivation could be equal or even slightly higher than in the FS06112-control cultivation.

Example 16

Determination of intracellular and extracellular levels of stilbenoids in shakeflask cultures of FS06112, in the presence of the solvent undecanone A glycerol stock of strain FS06112 was used to inoculate 500 ml baffled shake flasks that contained 100 ml modified M9 medium consisting of 4.5 g/1 glycerol, 1.5 g/1 yeast extract, 3 g/1 K₂HPO₄, 6.8 g/1 Na₂HPO₄, 0.5 g/1 NaCl, 1 g/1 NH₄C, 50 μg/ml ampicilin and 50 μg/ml kanamycin; the initial pH was set at 7.0. The shakeflasks were incubated at ambient temperature, and were mixed with a magnetic stirring bar at approximately 150 rpm. After 5 hours, isopropyl β- thiogalactopyranoside (IPTG) was added at a final concentration of 4 mM, as an inducer of the T7 promoter that was in front of each of the three genes TAL, 4CL and VST. After one hour an aliquot of 10 ml of the solvent undecanone was added to one shakeflask that is now referred to as FS06112-solvent ; the shakeflask culture without solvent will be referred to as FS06112-control . After an incubation period of approximately 48 hours, the glycerol was depleted and the medium and solvent phases were analyzed for the presence of resveratrol.

For the determination of stilbenoids, an aliquot of 50 ml of cell broth was collected, and phase separation was initiated by centrifugation at 4500 g for 10 minutes. Both the upper undecanone phase and the lower aqueous medium phase were collected separately with a pipette and directly analyzed for their content of stilbenoids and intermediates by HPLC. The total concentration of stilbenoid intermediates that was produced was then calculated by dividing the concentrations in the upper phase with a factor of 10 and then adding them to the concentrations that were observed in the lower phase. The results are shown in the following table: 8

Solvent : Coumaric acid Resveratrol Cinnamic acid Pinosylvin Undecanone (mg/l/θ total) (mg/l/θ total) (mq/l;% total) (mg/l/θ total]

FS06112-solvent Upper phase (0.1 L) 8.82; 100 Lower phase (1 L) 0.0; 0.0 Total produced in 1 L 0.88; 100 FS06112-control Supernatant 1.08

The results demonstrated that strain FS06112 was able to grow in a shakeflask on a medium that to which 10 ml of undecanone was added at the onset of induction of resveratrol production. The FS06112-solvent cultivation consumed the glycerol within 48 hrs, which was only slightly longer than the 30 hours in which the FS06112-control cultivation consumed the glycerol.

In both the FS06112-control and FS06112-solvent cultivation, resveratrol was produced without co-production of any of the other pathway intermediates coumaric acid and pinosylvin. In addition, the determination of the resveratrol content in the solvent phase was sometimes complicated by a considerable shift in retention time of the resveratrol peak. Most likely the high concentration of undecanone in the sample interfered with the a-polar interactions between the resveratrol molecule and the stationary phase. Apparently undecanone interfered more intensively with the analysis than all the other solvents used in the previous examples because no drastic retention times shifts have been observed with said other solvents.

Still it was possible to render a quantitative analysis and to establish that undecanone was able to capture 100% of the stilbenoid resveratrol, and that the total amount of resveratrol produced was slightly lower than the FS06112- control cultivation. However, with the uncertainty of the retention time shift and its effect on the peak shape the total resveratrol content produced in the FS06112-solvent cultivation could be considered at least equal to that of the FS06112-control cultivation. In this specification, unless expressly otherwise indicated, the word ^λor' is used in the sense of an operator that returns a true value when either or both of the stated conditions is met, as opposed to the operator 'exclusive or' which requires that only one of the conditions is met. The word Comprising' is used in the sense of ^λincluding' rather than in to mean Consisting of . All prior teachings acknowledged above are hereby incorporated by reference. No acknowledgement of any prior published document herein should be taken to be an admission or representation that the teaching thereof was common general knowledge in Australia or elsewhere at the date hereof.

REFERENCES :

Abe, I., Watanabe, T. and Noguchi, H. (2004). Enzymatic Formation of Long-chain Polyketide Pyrones by Plant Type III Polyketide Synthases. Phytochemistry, 65, 2447-2453

Cochrane FC, Davin LB, Lewis NG.

The Arabidopsis phenylalanine ammonia lyase gene family: kinetic characterization of the four PAL isoforms. Phytochemistry. 2004:65:1557-64.

Ehlting J, Bϋttner D, Wang Q, Douglas CJ, Somssich IE, Kombrink E.

Three 4-coumarate : coenzyme A ligases in Arabidopsis thaliana represent two evolutionarily divergent classes in angiosperms. Plant J. 1999:19:9-20.

Guerra OG, Rubio IG, da Silva Filho CG, Bertoni RA, Dos Santos Govea RC, Vicente EJ. (2006) . A novel system of genetic transformation allows multiple integrations of a desired gene in Saccharomyces cerevisiae chromosomes. J Microbiol Methods. 67, 437-45.

Hain, R., Reif, H.J., Krause, E., Langebartels, R., Kindl, H., Vornam, B., Wiese, W., Schmelzer, E., Schreier, P. H., Stocker, R. H. and Stenzel, K. (1993). Disease resistance results from foreign phytoalexin expression in a novel plant. Nature 361, 153-156.

Hamberger B, Hahlbrock K.

The 4-coumarate : CoA ligase gene family in Arabidopsis thaliana comprises one rare, sinapate-activating and three commonly occurring isoenzymes . Proc Natl Acad Sci U S A. 2004:101:2209-14.

Kaneko, M., Ohnishi, Y. and Horinouchi, S. Cinnamate : Coenzyme (2003). A ligase from the Filamentous Bacteria Streptomyces coelicolor A3 (2) , J. Bact . 185, 20-27.

Kyndt JA, Meyer TE, Cusanovich MA, Van Beeumen JJ. (2002) . Characterization of a bacterial tyrosine ammonia lyase, a biosynthetic enzyme for the photoactive yellow protein. FEBS Lett. 512, 240-244.

Martin, V.J.J. , Pitera, D.J., Withers, S. T., Newman, J. D. and Keasling, J. D. (2003). Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nature biotechnology 21, 796-802.

Morita, H., Noguchi, H., Schroder, J. and Abe, I. (2001). Novel polyketides synthesized with a higher plant stilbene synthase. Eur. J. Biochem. 268, 3759-3766.

Mumberg D, Muller R, Funk M.

Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds . Gene . 1995:156:119-22.

Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, N. Y. Samappito, S., Page, J. E., Schmidt, J., De-Eknamkul, W. and Kutchan, T. M. (2003) . Aromatic and pyrone polyketides synthesized by a stilbene synthase from Rheum tataricum. Phytochemistry 62, 313-323.

Sikorski RS, Hieter P.

A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.Genetics. 1989:122:19-27.

Stark D et al, 2003, Biotechnology and Bioengineering; Aug 20, 83 (4) : 376-75.

Tilburn J, Scazzocchio C, Taylor GG, Zabicky-Zissman JH, Lockington RA, Davies RW. (1983). Transformation by integration in Aspergillus nidulans . Gene. 26, 205-21.

Verduyn C, Postma E, Scheffers WA, Van Dijken JP. (1992) . Effect of benzoic acid on metabolic fluxes in yeasts: a continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast. 8, 501-517.

Claims

Claims

1. A method for the production of a cis- or trans- stilbenoid of the general formla 1:

Formula 1

in which each of R¹, R², R³, R⁴ and R⁵ independently is hydrogen or hydroxy, or a glycosylated or oligomeric form thereof, comprising cultivating a micro-organism producing said stilbenoid, wherein said cultivation is performed in a multi-phase system comprising at least an aqueous first phase containing said micro-organism and a second phase immiscible with said aqueous phase in which said stilbenoid accumulates.

2. A method as claimed in claim 1, wherein said stilbenoid constitutes said second phase.

3. A method as claimed in claim 1 or claim 2, wherein said first phase is continuous and said second phase is dispersed therein.

4. A method as claimed in any one of claims 1 to 3, wherein said second phase is a liquid.

5. A method as claimed in claim 5, wherein said second phase is a micro-encapsulated liquid.

6. A method as claimed in any preceding claim, wherein said micro-organism, when cultivated in said aqueous phase without said immiscible phase, is capable of producing said stilbenoid in an amount sufficient to reach a saturated concentration thereof in said aqueous phase and to precipitate therefrom.

7. A method for the production of a cis- or trans- stilbenoid of the general formla 1:

Formula 1 in which each of R¹, R², R³, R⁴ and R⁵ independently is hydrogen or hydroxy, or a glycosylated or oligomeric form thereof, comprising cultivating a micro-organism producing said stilbenoid, wherein said cultivation is conducted in a culture medium comprising or consisting of an aqueous phase and produces an amount of said stilbenoid released from the micro-organisms into the culture medium which exceeds the solubility limit of said stilbenoid in said aqueous phase.

8. A method as claimed in claim 7, wherein said stilbenoid precipitates from said culture medium.

9. A method as claimed in claim 7, wherein said cultivation is performed in a said culture medium which is a multi-phase system comprising at least said aqueous phase containing said micro-organism and a liquid solvent immiscible with said aqueous phase in which said stilbenoid accumulates.

10. A method as claimed in claim 9, wherein said liquid solvent forms a liquid-liquid interface with said aqueous phase.

11. A method as claimed in any preceding claim, wherein said stilbenoid is resveratrol (only R³ = OH) , pinosylvin (all R groups are hydrogen) or piceatannol (only R³ and either R² or R⁴ is OH) .

12. A method as claimed in any preceding claim, wherein said stilbenoid is trans.

13. A method as claimed in claim 1, claim 4, claim 5, claim 9, or claim 10, wherein said liquid or said solvent comprises an ester.

14. A method as claimed in claim 13, wherein said ester is of the general formula R⁶-COO-R⁷, and R⁶ is H or an aliphatic straight or branched chain hydrocarbon moiety of from 1-6 carbon atoms and R⁷ is an aliphatic straight or branched chain hydrocarbon moiety of from 2-16 carbon atoms, or a heteroatom containing hydrocarbon moiety of from 2 to 16 carbon atoms or an aromatic or heteroaromatic moiety of from 5 to 16 carbon atoms.

15. A method as claimed in claim 14, wherein R⁷ has from 3 to 9 carbon atoms .

16. A method as claimed in claim 14 or claim 15, wherein R has from 1 to 4 carbon atoms .

17. A method as claimed in claim 14, wherein said ester is an octyl acetate.

18. A method as claimed in claim 1, claim 4, claim 5, claim 9, or claim 10, or in any one of claims 13 to 17, wherein said liquid comprises or further comprises an alkane .

19. A method as claimed in claim 18, wherein said alkane is a Ce to Ci6 straight or branched chain alkane.

20. A method as claimed in claim 19, wherein said alkane is n-dodecane.

21. A method as claimed in any preceding claim, further comprising separating said second phase and extracting said stilbenoid therefrom.

22. A method as claimed in any preceding claim, further comprising an additional step of recovering said stilbenoid.

23. A method for producing an extraction solvent tolerant micro-organism strain producing a metabolite comprising:

(a) cultivating a starting micro-organism in a multiphase system comprising at least an aqueous first phase containing said micro-organism and a second phase immiscible with said aqueous phase in which said metabolite accumulates, said second phase comprising a first solvent component to which the micro-organism is more tolerant and a first concentration of a second solvent component to which the micro-organism is less tolerant,

(b) recovering progeny micro-organism from said cultivation (a) , and

(c) culturing said progeny micro-organism in a said multi-phase system in which the concentration of said second solvent component is increased above said first concentration.