WO2009003489A1 - CaOU-1 EPITOPE BINDING POLYPEPTIDES - Google Patents

CaOU-1 EPITOPE BINDING POLYPEPTIDES Download PDF

Info

Publication number
WO2009003489A1
WO2009003489A1 PCT/DK2008/050164 DK2008050164W WO2009003489A1 WO 2009003489 A1 WO2009003489 A1 WO 2009003489A1 DK 2008050164 W DK2008050164 W DK 2008050164W WO 2009003489 A1 WO2009003489 A1 WO 2009003489A1
Authority
WO
WIPO (PCT)
Prior art keywords
caou
binding polypeptide
epitope
antibody
isolated
Prior art date
Application number
PCT/DK2008/050164
Other languages
French (fr)
Inventor
Marianne Brorson
Teit Agger
Original Assignee
Natimmune A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to DKPA200700969 priority Critical
Priority to DKPA200700969 priority
Application filed by Natimmune A/S filed Critical Natimmune A/S
Publication of WO2009003489A1 publication Critical patent/WO2009003489A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)

Abstract

Adenocarcinoma tissue and healty tissue can be discriminated based on the expression pattern of the CaOU-1 epitope. The present invention provides new CaOU-1 epitope binding polypeptides, such as antibodies of various types including re-combinantly produced antibodies and antibody fragments. The antibodies or binding polypeptides according to the invention are useful for treatment and diagnosis of adenocarcinoma as well as in methods for detecting or measuring the amounts of the CaOU-1 epitope. CaOU-1 epitope binding polypeptides may be provided in pharmaceutical compositions and/or optionally in a kit of part comprising further medicaments.

Description

CaOU-1 epitope binding polypeptides

Field of invention

The present invention relates to a polypeptide capable of binding the CaOU-1 epitope. The CaOU-1 epitope is characterised by its binding to the COU-1 antibody, which react selectively with epithelial cells in solid adenocarcinomas such as colon-, breast-, ovarian and pancreatic adenocarcinomas. CaOU-1 epitope binding polypeptides are suitable for use in diagnosis and treatment of adenocarcinomas.

Background of invention

In specific types of malignant tissue the COU-1 antibody exhibits a membrane associated staining of proliferating cells, while resting cells has a filamentous staining pattern. This antibody reacts with a molecule associated with intermediate filaments in the cytoplasm of adenocarcinoma cells, whereas no interaction with intermediate filaments is observed in normal epithelium. The COU-1 antibody thus discriminates between healthy tissue and adenocarcinoma tissue. No specific binding to cancerous cell in, such as malignant melanoma, glioblastomas, sarcomas or squamous carcinoma is observed. (Dizel, HJ 1999). The specific binding of the COU-1 antibody to this cancer associated epitope lead to the characterisation of the "CaOU-1 epitope", which is formed by two separate polypeptides. The CaOU-1 epitope is exposed in a modified heterotypic complex comprising cytokeratins K8 and K18.

The sequence of the variable regions of the COU-1 IgM isotype antibody was published in WO 03/057168 and Ditzel, HJ et al 1997.

Based on the cancer specific binding the COU-1 antibody has a plurality of application with in the field of adenocarcinoma treatment and diagnosis.

Summary of invention

The present invention relates to new CaOU-1 epitope binding polypeptides. The binding polypeptide may be any polypeptide capable of binding the CaOU-1 epitope such as whole antibodies, antibody fragments or an antigen binding portion of an antibody. In an embodiment the CaOU-1 epitope binding polypeptide comprising at least one binding domain comprising at least one amino acid sequence selected from the group of: amino acid sequences identified by SEQ ID NO 6, 8, 10 and 16. Preferably the binding polypeptide comprises an amino acid sequence identified by SEQ ID NO 10 or 16. More preferably the binding polypeptide comprises the amino acid sequences set identified by SEQ ID NO 6, 8 and 10 or/and the amino acid sequences set identified by SEQ ID NO 12, 14 and 16.

In further embodiments the binding polypeptide is selected from antibodies or immunologically active fragments of antibodies or single chain of antibodies, wherein the binding domain is arranged as complementarity determining regions (CDRs) in the binding polypeptide. The amino acid sequences identified by SEQ ID NO 6, 8 and 10 may be arranged in one or more heavy chain complementarity determining regions (CDRs) and the amino acid sequences identified by SEQ ID NO 12, 14 and 16 in one or more light chain complementarity determining regions (CDRs).

In a prefered embodiment the CaOU-1 epitope binding polypeptide according to claim 7 is an antibody or an immunologically active fragment of an antibody selected from Fab, Fab', F(ab)2, Fv and single chain antibody (ScFv). The binding domain is preferably carried by a humanised antibody framework or human antibody framework.

The binding domain may be comprised by a VH domain and a VL domain identified by the sequences identified by SEQ ID NO 2 and SEQ ID NO 4, respectivly.

Preferred binding polypeptide have a dissociation constant which is less than 5 x 10" 9 M, such as less than 1 x 10"9 M. Binding polypeptide may further be labelled with a label selected from the group of: radioisotype labels, fluorescent labels and enzy- matic labels.

It is highly preferred that the binding polypeptides via the binding domain bind the CaOU-1 epitope specifically. It is thus preferred that the binding polypeptides are capable of discriminating between malignant tissue and normal tissue, enabling dis- crimination of adenocarcinoma cells and healthy cells. In further embodiment the binding polypeptide is coupled to a therapeutic agent, such as a chemotherapeutic agent or an angiogenesis inhibitor.

A further aspect of the invention relates to nucleic acid sequences encoding CaOU- 1 epitope binding polypeptides, comprising at least one nucleic acid sequence as defined by SEQ ID NO 5, 7, 9, 1 1 , 13 and 15. More preferred are nucleic acid sequences comprising a nucleic acid sequence as defined by SEQ ID NO 1 or/and SEQ ID NO 3. These nucleic acid sequences may be comprised by a vector accord- ing to the invention and said vector comprised by a suitable host cell for expression of said binding polypeptide by a recombinant method. Such host cell may be named a cell line.

Based on the abililty of the CaOU-1 epitope binding polypeptides to recognise ade- nocarcinoma cells the binding polypeptides have potential application in the medical industri, such as in pharmaceutical compsitions as well as in method of treatment and diagnosis. The binding polypeptide may alone or in combination with any suitable pharmaceutically accepted carrier and/or excipients form a pharmaceutical composition. Said composition may in further embodiments comprise a second therapeutic agent, such as a chemotherapeutic agent or an angiogenesis inhibitory agent.

The binding polypeptide may accordingly be used for the manufacture of a medicament, such as for treatment of adenocarcinomas, such as adenocarcinomas se- lected from colon, ovarian, renal, mammary gland, lung and pancreatic adenocarcinoma. A furthe application may be for treatment of non-seminomal testis carcinoma.

The medicament may be for parenteral administration as well as inhalation

In an aspect the invention relates to a kit of parts comprising: i. a pharmaceutical composition according to the invention or a medicament according to the invention and ii. a secondary pharmaceutical composition or medicament as separate entities. Besides the above mentioned application of the CaOU-1 epitope binding polypeptide in treatment and diagnosis the binding polypeptide may according to the invention be used in detection of the CaOU-1 epitope in a test sample, such as for measuring the amount of the CaOU-1 epitope in a test sample.

The invention thus encompas a method of detecting the CaOU-1 epitope in a test sample comprising the steps of: contacting a CaOU-1 epitope binding polypeptide according according to the invention with a test sample, - detecting bound CaOU-1 epitope binding polypeptide in the test sample.

Futher included is a method of measuring the amount of CaOU-1 epitope in a test sample comprising the steps of: contacting a CaOU-1 epitope binding polypeptide according to the invention - measuring the amount of bound CaOU-1 epitope binding polypeptide in the test sample, and thereby obtaining information about the amount of CaOU-1 epitope in the test sample.

Methods of detecting or diagnosing a disease or disorder associated with the CaOU- 1 epitope in an individual comprising the steps, contacting a CaOU-1 epitope binding polypeptide according to the invention with a biological sample from said individual, detecting binding polypeptides bound to said biological sample, and thereby - detecting or diagnosing the disease or disorder.

The methods may be used for detection or diagnosing of adenocarcinoma.

The application in treatment according to the invention may be performed according to a method of treatment involving administering to a subject in need a binding polypeptide, said treatment being applied as a treatment of an adenocarcinoma, such as an adenocarcinoma selected from the group of: colon, ovarian, renal, mammary gland, lung and pancreatic adenocarcinoma. Subsequent applications according to the invention relates to the use of binding polypeptides and corresponding nucleotide sequences in maturations procedures and methods as described herein, for the development of binding polypeptides with an increase affinity for the CaOU-1 epitope.

Description of Drawings Figure 1. Alignment of VH and VL sequences Figure 2. The pHOG21 expression vector Figure 3. Western blot of scFV Figure 4. Western blot of GST-cytokeratin fusion proteins Figure 5. Spectogram of recombinant scFV Nisc204

Detailed description of the invention

Definitions

The term "antibody" as referred to herein includes whole antibodies and any antigen binding fragment (Ae., "antigen-binding portion") or single chain thereof.

"A whole antibody" refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds, or an antigen binding portion thereof. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region (abbreviated herein as CH). Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region (abbreviated herein as CL). The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1 , CDR1 , FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1 q) of the classical complement sys- tern. The term "antigen-binding portion" of an antibody, as used herein, refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen. It has been shown that the antigen-binding function of an antibody can be per- formed by fragments of a full-length antibody. Examples of binding fragments encompassed within the term "antigen-binding portion" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and Cm domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and Cm domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., (1989) Nature 341 :544-546), which consists of a VH domain; (vi) an isolated complementarity determining region (CDR), and (vii) a combination of two or more isolated CDRs which may optionally be joined by a synthetic linker. Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). Such single chain antibod- ies are also intended to be encompassed within the term "antigen-binding portion" of an antibody.

A further example of an antigen binding-domain is immunoglobulin fusion proteins comprising (i) a binding domain polypeptide that is fused to an immunoglobulin hinge region polypeptide, (ii) an immunoglobulin heavy chain CH2 constant region fused to the hinge region, and (iii) an immunoglobulin heavy chain CH3 constant region fused to the CH2 constant region. The binding domain polypeptide can be a heavy chain variable region or a light chain variable region. Such binding-domain immunoglobulin fusion proteins are further disclosed in US 2003/01 18592 and US 2003/0133939.

These antibody fragments are obtained using conventional techniques known to those with skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies. The term "epitope" means a protein determinant capable of specific binding to an antibody. Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. Con- formational and nonconformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.

The term "discontinuous epitope", as used herein, means a conformational epitope on a protein antigen which is formed from at least two separate regions in the pri- mary sequence of the protein. A discontinuous epitope may also be formed by at least two regions of one or more proteins, in such a case the antigen may be formed by one or more proteins.

The term "bispecific molecule" is intended to include any agent, e.g., a protein, pep- tide, or protein or peptide complex, which has two different binding specificities. For example, the molecule may bind to, or interact with, (a) a cell surface antigen and (b) an Fc receptor on the surface of an effector cell. The term "multispecific molecule" or "heterospecific molecule" is intended to include any agent, e.g., a protein, peptide, or protein or peptide complex, which has more than two different binding specificities. For example, the molecule may bind to, or interact with, (a) a cell surface antigen, (b) an Fc receptor on the surface of an effector cell, and (c) at least one other component. Accordingly, the invention includes, but is not limited to, bispecific, trispecific, tetraspecific, and other multispecific molecules which are directed to the CaOU-1 epitope, and to other cell surface antigens or targets, such as Fc receptors on effector cells.

As used herein, a human antibody is "derived from" a particular germline sequence if the antibody is obtained from a system using human immunoglobulin sequences, e.g., by immunizing a transgenic mouse carrying human immunoglobulin genes or by screening a human immunoglobulin gene library, and wherein the selected human antibody is at least 90%, more preferably at least 95%, even more preferably at least 96%, 97%, 98%, or 99% identical in amino acid sequence to the amino acid sequence encoded by the germline immunoglobulin gene. Typically, a human antibody derived from a particular human germline sequence will display no more than 10 amino acid differences, more preferably, no more than 5, or even more prefera- bly, no more than 4, 3, 2, or 1 amino acid difference from the amino acid sequence encoded by the germline immunoglobulin gene.

The term "human antibody", as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The human antibodies of the invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo). However, the term "human antibody", as used herein, is not intended to in- elude antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.

The term "recombinant human antibody", as used herein, includes all human anti- bodies that are prepared, expressed, created or isolated by recombinant means, such as (a) antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom, (b) antibodies isolated from a host cell transformed to express the antibody, e.g., from a transfectoma, (c) antibodies isolated from a recombinant, combi- natorial human antibody library, and (d) antibodies prepared, expressed, created or isolated by any other means that involve splicing of human immunoglobulin gene sequences to other DNA sequences. Such recombinant human antibodies have variable and constant regions derived from human germline immunoglobulin sequences.

In certain embodiments, however, such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) also called affinity maturation and thus the amino acid sequences of the VH and VL regions of the recombinant antibod- ies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.

As used herein, a "heterologous antibody" is defined in relation to the transgenic non-human organism producing such an antibody. This term refers to an antibody having an amino acid sequence or an encoding nucleic acid sequence corresponding to that found in an organism not consisting of the transgenic non-human animal, and generally from a species other than that of the transgenic non-human animal.

An "isolated antibody", as used herein, is intended to refer to an antibody which is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds to the CaOU-1 epitope is substantially free of antibodies that specifically bind antigens other than the CaOU-1 epitope). An isolated antibody that specifically binds to an epitope, isoform or variant of the human CaOU-1 epitope may, however, have cross-reactivity to other related antigens, e.g., from other species (e.g., CaOU-1 epitope species homologs). Moreover, an isolated antibody may be substantially free of other cellular material and/or chemicals.

As used herein, "specific binding"' refers to antibody binding to a predetermined an- tigen. Typically, the antibody binds with an affinity corresponding to a K0 of about 10" 7 M or less, such as about 10"8 M or less, such as about 10"9 M or less, about 10"10 M or less, or about 10"11 M or even less, when measured as apparent affinities based on IC50 values in FACS, and binds to the predetermined antigen with an affinity corresponding to a K0 that is at least ten-fold lower, such as at least 100-fold lower than its affinity for binding to a non-specific antigen (e.g., BSA, casein) other than the predetermined antigen or a closely-related antigen. Specific binding according to the present application further means that binding polypeptides according to invention to can discriminate between the heterotypic complex of K8 and K18 in the wild type conformation present in normal epithelia cells and the modified heterotypic complex of K8 and K18 present in adenocarcinoma cells.

Affinity: the strength of binding between receptors and their ligands, for example between an antibody and its antigen.

Avidity: The functional combining strength of an antibody with its antigen which is related to both the affinity of the reaction between the epitopes and paratopes, and the valencies of the antibody and antigen

Antibody Classes: Depending on the amino acid sequences of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes. There are at least five (5) major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, and several of these may be further divided into subclasses (isotypes), e.g. lgG-1 , lgG-2, lgG-3 and lgG-4; lgA-1 and lgA-2. The heavy chains constant domains that correspond to the different classes of immunoglobulins are called alpha (α), delta (δ), epsilon (ε), gamma (γ) and mu (μ), respectively. The light chains of antibodies can be assigned to one of two clearly distinct types, called kappa (K) and lambda (λ), based on the amino sequences of their constant domain. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.

Antibody Combining Site: An antibody combining site is that structural portion of an antibody molecule comprised of a heavy and light chain variable and hypervariable regions that specifically binds (immunoreacts with) an antigen. The term immunore- act in its various forms means specific binding between an antigenic determinant- containing molecule and a molecule containing an antibody combining site such as a whole antibody molecule or a portion thereof. Alternatively, an antibody combining site is known as an antigen binding site.

Chimeric antibody: An antibody in which the variable regions are from one species of animal and the constant regions are from another species of animal. For example, a chimeric antibody can be an antibody having variable regions which derive from a mouse monoclonal antibody and constant regions which are human.

Complementarity determining region or CDR: Regions in the V-domains of an anti- body that together form the antibody recognizing and binding domain.

Constant Region or constant domain or C-domain: Constant regions are those structural portions of an antibody molecule comprising amino acid residue sequences within a given isotype which may contain conservative substitutions therein. Exem- plary heavy chain immunoglobulin constant regions are those portions of an immunoglobulin molecule known in the art as CH1 , CH2, CH3, CH4 and CH5. An exemplary light chain immunoglobulin constant region is that portion of an immunoglobulin molecule known in the art as CL. Diabodies: This term refers to a small antibody fragments with two antigen-binding sites, which fragments comprise a heavy chain variable domain (VH) connected to a light chain variable domain (VL) in the same polypeptide chain (VH-VL). By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites. Diabodies are described more fully in, for example, EP 404,097; WO 93/1 1161 ; and Hollinger et al., Proc. Natl. Acad Sci. USA 90: 6444-6448 (1993).

Fv: dual chain antibody fragment containing both a VH and a VL.

Human antibody framework: A molecule having an antigen binding site and essentially all remaining immunoglobulin-derived parts of the molecule derived from a human immunoglobulin.

Humanised antibody framework: A molecule having an antigen binding site derived from an immunoglobulin from a non-human species, whereas some or all of the remaining immunoglobulin-derived parts of the molecule is derived from a human immunoglobulin. The antigen binding site may comprise: either a complete variable domain from the non-human immunoglobulin fused onto one or more human constant domains; or one or more of the complementarity determining regions (CDRs) grafted onto appropriate human framework regions in the variable domain. In a humanized antibody, the CDRs can be from a mouse monoclonal antibody and the other regions of the antibody are human.

Immunoglobulin: The serum antibodies, including IgG, IgM, IgA, IgE and IgD.

Immunoglobulin isotypes: The names given to the Ig which have different H chains, the names are IgG (lgGi,2,3,4), IgM, IgA (IgA1 2), slgA, IgE, IgD.

Immunologically distinct: The phrase immunologically distinct refers to the ability to distinguish between two polypeptides on the ability of an antibody to specifically bind one of the polypeptides and not specifically bind the other polypeptide. Monoclonal Antibody: The phrase monoclonal antibody in its various grammatical forms refers to a population of antibody molecules that contains only one species of antibody combining site capable of immunoreacting with a particular antigen. A monoclonal antibody thus typically displays a single binding affinity for any antigen with which it immunoreacts. A monoclonal antibody may contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different antigen, e.g., a bispecific monoclonal antibody.

Polyclonal antibody: Polyclonal antibodies are a mixture of antibody molecules rec- ognising a specific given antigen, hence polyclonal antibodies may recognise different epitopes within said antigen.

Single Chain Antibody or scFv: The phrase single chain antibody refers to a single polypeptide comprising one or more antigen binding sites, most commonly one anti- gen binding site. Furthermore, although the H and L chains of an Fv fragment are encoded by separate genes, they may be linked either directly or via a peptide, for example a synthetic linker can be made that enables them to be made as a single protein chain (known as single chain antibody, sAb; Bird et al. 1988 Science 242:423-426; and Huston et al. 1988 PNAS 85:5879-5883) by recombinant meth- ods. Such single chain antibodies are also encompassed within the term "antibody", and may be utilized as binding determinants in the design and engineering of a mul- tispecific binding molecule.

Valency: The term valency refers to the number of potential antigen binding sites, i.e. binding domains, in a polypeptide. A polypeptide may be monovalent and contain one antigen binding site or a polypeptide may be bivalent and contain two antigen binding sites. Additionally, a polypeptide may be tetravalent and contain four antigen binding sites. Each antigen binding site specifically binds one antigen. When a polypeptide comprises more than one antigen binding site, each antigen binding site may specifically bind the same or different antigens. Thus, a polypeptide may contain a plurality of antigen binding sites and therefore be multivalent and a polypeptide may specifically bind the same or different antigens.

V-domain: Variable domain are those structural portions of an antibody molecule comprising amino acid residue sequences forming the antigen binding sites. An ex- emplary light chain immunoglobulin variable region is that portion of an immunoglobulin molecule known in the art as VL.

V|_: Variable domain of the light chain.

VH: Variable domain of the heavy chain.

The CaOU-1 epitope

Mapping of the CaOU-1 epitope has been described in WO 03 057168 and Ditzel et al (2002). The CaOU-1 epitope is a discontinuous epitope formed by truncated heterotypic complex of cytokeratin 8 (K8) and cytokeratin 18 (K18). The CaOU-1 epitope is available in K8/K18 complexes where the head domain has been altered such as by truncation of the N-terminal regions (cleavage of the head domain) of K8 and/or K18 or in complexes where the majority of the rod domain e.g. the C-terminal of K8 has been removed. The CaOU-1 epitope may thus be revealed by the removal of amino acid 1-49 and 1-65 of the K18 and K8 respectively. The epitope may also be revealed by the removal of the C-terminal region of either of K8 and K18. The CaOU-1 epitope is thus exposed when the first domain, A1 of the alpha helical rod is not in its normal coil-coil structure.

The initial finding that the COU-1 antibody recognises a cancer associated epitope was confirmed by the identification of truncated K8/K18 complexes in cancerous epithelia.

Based on the specificity of the COU-1 antibodies towards adenocarcinoma cells the antibody has a plurality of applications, such as in diagnosis and treatment of adenocarcinomas.

Binding Polypeptides An object of the present invention is to provide new CaOU-1 epitope binding polypeptides, such binding polypeptides are preferably, antibodies as described here below or other binding polypeptides as described herein. All characterised by comprising a binding domain capable of interacting with the CaOU-1 epitope through specific amino acid sequences comprised by the binding domain. The binding polypetides of the invention specifically bind the CaOU-1 epitope e.g. the binding polypeptides are capable of discriminating between the cancer associated epitope defined by the binding of the original COU-1 antibody, e.g. the modified heterocyclic complex of K8 and K18 identified in adenocarcinomas and the wild type complex located in healthy cells. The discrimination may be observed by suitable methods know in the art such as a different pattern of staining in tissue samples (as described in Ditzel et al, 1997) or by selective binding in in vitro binding experiments as described in example 5 herein (and as described in WO 03 57168 and Ditzel et al 2002).

An aspect of the invention relates to an isolated CaOU-1 epitope binding polypeptide comprising one or more, preferably at least 2, even more preferably at least 3, yet more preferably at least 4, even more preferably at least 5, yet more preferably all 6 amino acid sequences selected from the group consisting of: SEQ ID NO 6, 8, 10, 12, 14 and 16.

In an embodiment the isolated CaOU-1 epitope binding polypeptide comprising at least one binding domain comprising at least one amino acid sequence selected from the group of: amino acid sequences identified by SEQ ID NO: 6, 8, 10 and 16.

In more preferred embodiments comprise the amino sequence identified by SEQ ID NO: 10 or 16 and more preferred both of the amino acid sequences identified by SEQ ID NO: 10 and 16.

In particular preferred embodiments the binding domain comprise the amino acid sequence set indentified by SEQ ID NO 6, 8 and 10 or/and the amino acid sequence set indentified by SEQ ID NO 12, 14 and 16.

Preferred binding polypeptide have a dissociation constant which is less than 1 x 10" 7 M, sucha s less than 1 x 10"8 M, or less than 5 x 10"9 M, or more preferably such as less than 1 x 10"9 M.

Binding polypeptide may further be labelled with a label selected from the group of: radioisotype labels, fluorescent labels and enzymatic labels enabeling easy detec- tion of the the binding polypeptide to the antigen. Antibodies

It is one aspect of the present invention to provide antibodies or functional equivalents thereof specifically recognising and binding the CaOU-1 epitope.

The antibody or functional equivalent thereof may be any antibody known in the art, for example a polyclonal or a monoclonal antibody derived from a mammal or a synthetic antibody, such as a single chain antibody or hybrids comprising antibody fragments. Furthermore, the antibody may be mixtures of monoclonal antibodies or artificial polyclonal antibodies. In addition functional equivalents of antibodies may be antibody fragments, in particular epitope binding fragments. Furthermore, antibodies or functional equivalent thereof may be a small molecule mimicking? an antibody. Naturally occurring antibodies are immunoglobulin molecules consisting of heavy and light chains. In preferred embodiments of the invention, the antibody is a monoclonal antibody.

Monoclonal antibodies (Mab's) are antibodies, wherein every antibody molecule are similar and thus recognises the same epitope. Monoclonal antibodies are in general produced by a hybridoma cell line. Methods of making monoclonal antibodies and antibody-synthesizing hybridoma cells are well known to those skilled in the art. An- tibody producing hybridomas may for example be prepared by fusion of an antibody producing B lymphocyte with an immortalized B-lymphocyte cell line. Monoclonal antibodies according to the present invention may for example be prepared as described in Antibodies: A Laboratory Manual, By Ed Harlow and David Lane, Cold Spring Harbor Laboratory Press, 1988. Said monoclonal antibodies may be derived from any suitable mammalian species, however frequently the monoclonal antibodies will be rodent antibodies for example murine or rat monoclonal antibodies. It is preferred that the antibodies according to the present invention are monoclonal antibodies or derived from monoclonal antibodies.

In an embodiment the antibodies are preferably immunuglobulins selected from the group of IgG, IgD, IgE, IgA and IgM and of any of the subtypes available for each group eg. lgG-1 ,-2, -3 or 4 and lgA-1 or 2.

Polyclonal antibodies is a mixture of antibody molecules recognising a specific given antigen, hence polyclonal antibodies may recognise different epitopes within said antigen. In general polyclonal antibodies are purified from serum of a mammal, which previously has been immunized with the antigen. Polyclonal antibodies may for example be prepared by any of the methods described in Antibodies: A Laboratory Manual, By Ed Harlow and David Lane, Cold Spring Harbor Laboratory Press, 1988. Polyclonal antibodies may be derived from any suitable mammalian species, for example from mice, rats, rabbits, donkeys, goats, sheeps, cows or camels. The antibody is preferably not derived from a non-mammalian species, i.e. the antibody is for example preferably not a chicken antibody. The antibody may also for example be an artificial polyclonal antibody as for example described in US 5,789,208 or US 6,335,163, both patent specifications are hereby incorporated by reference into the application in their entirety.

The antibodies according to the present invention may also be recombinant antibodies. Recombinant antibodies are antibodies or fragments thereof or functional equivalents thereof produced using recombinant technology. For example recombinant antibodies may be produced using a synthetic library or by phage display. Recombinant antibodies may be produced according to any conventional method for example the methods outlined in "Recombinant Antibodies", Frank Breitling, Stefan Dϋbel, Jossey-Bass, September 1999. Cloning of such recombinant antibodies or antibody fragments are described in Example 4 and 5 herein.

The antibodies according to the present invention may also be bispecific antibodies, i.e. antibodies specifically recognising two different epitopes. Bispecific antibodies may in general be prepared starting from monoclonal antibodies, or from recombinant antibodies, for example by fusing two hybridoma's in order to combine their specificity, by Chemical crosslinking or using recombinant technologies. Antibodies according to the present invention may also be tri-specific antibodies.

Functional equivalents of antibodies may in one preferred embodiment be a frag- ment of an antibody, preferably an antigen binding fragment or a variable region.

Examples of antibody fragments useful with the present invention include Fab, Fab', F(ab') 2 and Fv fragments. Papain digestion of antibodies produces two identical antigen binding fragments, called the Fab fragment, each with a single antigen binding site, and a residual "Fc" fragment, so-called for its ability to crystallize readily. Pepsin treatment yields an F(ab') 2 fragment that has two antigen binding fragments which are capable of cross-linking antigen, and a residual other fragment (which is termed pFc'). Additional fragments can include diabodies, linear antibodies, single- chain antibody molecules, and multispecific antibodies formed from antibody fragments. As used herein, "functional fragment" with respect to antibodies, refers to Fv, F(ab) and F(ab')2 fragments.

Preferred antibody fragments retain some or essential all the ability of an antibody to selectively binding with its antigen or receptor. Some preferred fragments are defined as follows:

(1 ) Fab is the fragment that contains a monovalent antigen-binding fragment of an antibody molecule. A Fab fragment can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain.

(2) Fab' is the fragment of an antibody molecule and can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain. Two Fab' fragments are obtained per antibody molecule. Fab' fragments differ from Fab fragments by the addition of a few resi- dues at the carboxyl terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region.

(3) (Fab')2 is the fragment of an antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction. F(ab')2 is a dimer of two Fab' fragments held together by two disulfide bonds.

(4) Fv is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy and one light chain variable domain in a tight, non-covalent association (VH -V L dimer). It is in this configuration that the three CDRs of each variable domain interact to define an antigen binding site on the surface of the VH -V L dimer. Collectively, the six CDRs confer antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site. In one embodiment of the present invention the antibody is a single chain antibody ("SCA"), defined as a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable poly- peptide linker as a genetically fused single chain molecule. Such single chain antibodies are also refered to as "single-chain Fv" or "scFv" antibody fragments. Generally, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains that enables the scFv to form the desired structure for antigen binding.

The antibody may also be selected for useful properties, for example it may be desirable to control serum half life of the antibody. In general, complete antibody molecules have a very long serum persistence, whereas fragments (<60-80 kDa) are filtered very rapidly through the kidney. Glycosylation on complete antibodies in general, prolongs serum persistence. Hence, if long term action of the CaOU-1 epi- tope antibody is desirable, the CaOU-1 epitope antibody is preferably a complete antibody, whereas if shorter action of the antibody is desirable, an antibody fragment might be preferred.

In another embodiment of the present invention the functional equivalent of an anti- body is a small molecule mimicking an antibody. Such molecules may be a non- immunoglobulin binding members. Thus the CaOU-1 epitope binding polypeptide may be derived from a naturally occurring protein or polypeptide; said protein or polypeptide may for example be designed de novo, or may be selected from a library. The binding member may be a single moiety, e.g., a polypeptide or protein domain, or it may include two or more moieties, e.g., a pair of polypeptides such as a pair polypeptides. The binding polypeptide may for example, but not exclusively, be a lipocalin, a single chain MHC molecule, an Anticalin™ (Pieris), an Affibody™, or a Trinectin™ (Phylos), Nanobodies (Ablynx). The binding member may be selected or designed by recombinant methods known by people well known in the art.

In one embodiment of the present invention the antibody or functional equivalent thereof comprises specific hypervariable regions, designated CDR. Preferably, the CDRs are CDRs according to the Kabat CDR definition. CDRs or hypervariable regions may for example be identified by sequence alignment to other antibodies. Preferably, the antibody or funtional equivalent thereof comprises at least one, more preferably at least two even more preferably all three of the following heavy chain CDRs:

1 ) CDR1 of the heavy chain identified by SEQ ID NO: 6, 2) CDR2 of the heavy chain identified by SEQ ID NO: 8 and

3) CDR3 of the heavy chain identified by SEQ ID NO: 10.

More preferably the CaOU-1 epitope binding polypeptide comprises at least CDR 3 of the heavy chain.

Even more preferably the isolated CaOU-1 epitope binding polypeptide comprises the amino acid sequence set identified by SEQ ID NO 6, 8 and 10 in one or more heavy chain complementarity determining regions (CDRs).

In a further preferred embodiment the CaOU-1 epitope binding polypeptide comprises the variable heavy chain with the amino acid sequence set identified by SEQ ID NO 2.

In another embodiment of the present invention the antibody or functional equivalent thereof comprises specific hypervariable regions, designated CDR. Preferably, the CDRs are CDRs according to the Kabat CDR definition. Preferably, the antibody or funtional equivalent thereof comprises at least one, more preferably at least 2, even more preferably all three of the following light chain CDRs:

4) CDR1 of the light chain identified by SEQ ID NO: 12,

5) CDR1 of the light chain identified by SEQ ID NO: 14 and

6) CDR1 of the light chain identified by SEQ ID NO: 16.

More preferably the CaOU-1 epitope binding polypeptide comprises at least CDR 3 of the light chain.

Even more preferably the isolated CaOU-1 epitope binding polypeptide comprises the amino acid sequence set identified by SEQ ID NO 12, 14 and 16 in one or more light chain complementarity determining regions (CDRs). In a further preferred embodiment the CaOU-1 epitope binding polypeptide comprises the variable light chain with the amino acid sequence identified by SEQ ID NO 4.

In a preferred embodiment the antibody or functional equivalent thereof comprises the CDRs of the heavy chain and the CDRs of the light chain described herein above. More preferably, the antibody or functional equivalent thereof comprises the variable region of the heavy chain described above and the variable region of the light chain described above. Even more preferably, the antibody or functional equivalent thereof comprises the heavy chain described herein above and the light chain described herein above. Thus, in a very preferred embodiment the invention relates to an antibody comprising one or more, preferably at least 2, even more preferably at least 3, yet more preferably at least 4, even more preferably at least 5, yet more preferably all 6 CDRs selected from the group consisting of

7) CDR1 of the heavy chain identified by SEQ ID NO: 6,

8) CDR2 of the heavy chain identified by SEQ ID NO: 8,

9) CDR3 of the heavy chain identified by SEQ ID NO: 10,

10) CDR1 of the light chain identified by SEQ ID NO: 12, 11 ) CDR1 of the light chain identified by SEQ ID NO: 14 and

12) CDR1 of the light chain identified by SEQ ID NO: 16.

In a most prefere embodiment the antibody or functional equivalent thereof comprises the variable light chain identified by SEQ ID NO: 2 and the variable heavy chain identified by SEQ ID NO: 4.

Human Antibodies

Human monoclonal antibodies of the invention can be produced by a variety of techniques, including conventional monoclonal antibody methodology, e.g., the standard somatic cell hybridization technique of Kohler and Milstein, Nature 256:495 (1975). Although somatic cell hybridization procedures are preferred, in principle, other techniques for producing monoclonal antibody can be employed, e.g., viral or oncogenic transformation of B-lymphocytes or phage display techniques using libraries of human antibody genes. In a preferred embodiment, human monoclonal antibodies directed against the CaOU-1 epitope can be generated using transgenic or transchromosomal mice carrying parts of the human immune system rather than the mouse system. These transgenic and transchromosomic mice include mice referred to herein as HuMAb mice and KM mice, respectively, and are collectively referred to herein as "transgenic mice."

The HuMAb mouse contains a human immunoglobulin gene miniloci that encodes unrearranged human heavy (μ and Y) and K light chain immunoglobulin sequences, together with targeted mutations that inactivate the endogenous μ and K chain loci (Lonberg, N. et al. (1994) Nature 368 (6474):856-859). Accordingly, the mice exhibit reduced expression of mouse IgM or K and in response to immunization, the introduced human heavy and light chain transgenes, undergo class switching and somatic mutation to generate high affinity human IgG1K monoclonal antibodies (Lon- berg, N. et al. (1994), supra; reviewed in Lonberg, N. (1994) Handbook of Experimental Pharmacology 1 13:49-101 ; Lonberg, N. and Huszar, D. (1995) Intern. Rev. Immunol. Vol. 13:65-93, and Harding, F. and Lonberg, N. (1995) Ann. N.Y. Acad. Sci 764:536-546). The preparation of HuMAb mice is described in detail in Taylor, L. et al. (1992) Nucleic Acids Research 20:6287-6295; Chen, J. et al. (1993) Interna- tional Immunology 5:647-656; Tuaillon et al. (1994) J. Immunol. 152:2912-2920;

Lonberg et al., (1994) Nature 368(6474):856-859; Lonberg, N. (1994) Handbook of Experimental Pharmacology 113:49-101 ; Taylor, L. et al. (1994) International Immunology 6:579-591 ; Lonberg, N. and Huszar, D. (1995) Intern. Rev. Immunol. Vol. 13:65-93; Harding, F. and Lonberg, N. (1995) Ann. N.Y. Acad. Sci 764:536-546; Fishwild, D. et al. (1996) Nature Biotechnology 14:845-851. See further, US Nos. 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,789,650; 5,877,397; 5,661 ,016; 5,814,318; 5,874,299; and 5,770,429; all to Lonberg and Kay, as well as US 5,545,807 to Surani et al.; WO 98/24884, WO 94/25585, WO 93/1227, WO 92/22645, WO 92/03918 and WO 01/09187.

The KM mouse contains a human heavy chain transchromosome and a human kappa light chain transgene. The endogenous mouse heavy and light chain genes also have been disrupted in the KM mice such that immunization of the mice leads to production of human immunoglobulins rather than mouse immunoglobulins. Con- struction of KM mice and their use to raise human immunoglobulins is described in detail in WO 02/43478.

Immunizations To generate fully human monoclonal antibodies to the CaOU-1 epitope, transgenic or transchromosomal mice containing human immunoglobulin genes (e.g., HCo12, HCo7 or KM mice) can be immunized with an enriched preparation of the antigen and/or cells expressing the CaOU-1 epitope, as described, for example, by Lonberg et al. (1994), supra; Fishwild et al. (1996), supra, and WO 98/24884. Alternatively, mice can be immunized with DNA encoding the CaOU-1 epitope. Preferably, the mice will be 6-16 weeks of age upon the first infusion. For example, an enriched preparation (5-50 μg) of the CaOU-1 epitope can be used to immunize the HuMAb mice intraperitoneally. In the event that immunizations using a purified or enriched preparation of the CaOU-1 epitope do not result in antibodies, mice can also be im- munized with cells expressing the CaOU-1 epitope, e.g., a cell line, to promote immune responses.

Cumulative experience with various antigens has shown that the HuMAb transgenic mice respond best when initially immunized intraperitoneally (i.p.) or subcutaneously (s.c.) with antigen expressing cells in complete Freund's adjuvant, followed by every other week i.p. immunizations (up to a total of 10) with the antigen expressing cells in PBS. The immune response can be monitored over the course of the immunization protocol with plasma samples being obtained by retroorbital bleeds. The plasma can be screened by FACS analysis, and mice with sufficient titers of anti-antigen human immunoglobulin can be used for fusions. Mice can be boosted intravenously with antigen expressing cells for example 4 and 3 days before sacrifice and removal of the spleen.

Generation of Hybridomas Producing Human Monoclonal Antibodies to the CaOU-1 epitope

To generate hybridomas producing human monoclonal antibodies to the CaOU-1 epitope, splenocytes and lymph node cells from immunized mice can be isolated and fused to an appropriate immortalized cell line, such as a mouse myeloma cell line. The resulting hybridomas can then be screened for the production of antigen- specific antibodies. For example, single cell suspensions of splenic lymphocytes from immunized mice can be fused to SP2/0 nonsecreting mouse myeloma cells (ATCC, CRL 1581 ) with 50% PEG (w/v). Cells can be plated at approximately 1 x 105 per well in flat bottom microtiter plate, followed by a two week incubation in selective medium containing besides usual reagents 10% fetal Clone Serum, 5-10% origen hybridoma cloning factor (IGEN) and 1X HAT (Sigma). After approximately two weeks, cells can be cultured in medium in which the HAT is replaced with HT. Individual wells can then be screened by ELISA for human kappa-light chain containing antibodies and by FACS analysis using CaOU-1 epitope expressing cells for CaOU-1 epitope specificity. Once extensive hybridoma growth occurs, medium can be observed usually after 10-14 days. The antibody secreting hybridomas can be replated, screened again, and if still positive for human IgG, anti- CaOU-1 epitope monoclonal antibodies can be subcloned at least twice by limiting dilution. The stable subclones can then be cultured in vitro to generate antibody in tissue culture medium for characterization.

The original COU-1 antibody was obtained by fusion of a human B lymphoblatoid cell line with lymphocytes from a mesenteric lymphnode of patient with colon cancer (Borup-Christensen P et al 1986) and similar procedures may be applied.

Generation of Transfectomas Producing Human Monoclonal Antibodies to the CaOU-1 epitope

Human antibodies of the invention also can be produced in a host cell transfectoma using, for example, a combination of recombinant DNA techniques and gene trans- fection methods as is well known in the art, see e.g. Morrison, S. (1985) Science 229:1202.

For example, to express the antibodies, or antibody fragments thereof, DNAs encoding partial or full-length light and heavy chains, can be obtained by standard molecular biology techniques (e.g., PCR amplification, site directed mutagenesis) and can be inserted into expression vectors such that the genes are operatively linked to transcriptional and translational control sequences. In this context, the term "operatively linked" is intended to mean that an antibody gene is ligated into a vector such that transcriptional and translational control sequences within the vector serve their intended function of regulating the transcription and translation of the antibody gene. The expression vector and expression control sequences are chosen to be compati- ble with the expression host cell used. The antibody light chain gene and the antibody heavy chain gene can be inserted into separate vectors or, more typically, both genes are inserted into the same expression vector. The antibody genes are inserted into the expression vector by standard methods (e.g., ligation of complemen- tary restriction sites on the antibody gene fragment and vector, or blunt end ligation if no restriction sites are present). The light and heavy chain variable regions of the antibodies described herein can be used to create full-length antibody genes of any antibody isotype by inserting them into expression vectors already encoding heavy chain constant and light chain constant regions of the desired isotype such that the VH segment is operatively linked to the CH segment(s) within the vector and the VL segment is operatively linked to the CL segment within the vector. Additionally or alternatively, the recombinant expression vector can encode a signal peptide that facilitates secretion of the antibody chain from a host cell. The antibody chain gene can be cloned into the vector such that the signal peptide is linked in-frame to the amino terminus of the antibody chain gene. The signal peptide can be an immunoglobulin signal peptide or a heterologous signal peptide (Ae., a signal peptide from a non-immunoglobulin protein).

In addition to the antibody chain genes, the recombinant expression vectors of the invention carry regulatory sequences that control the expression of the antibody chain genes in a host cell. The term "regulatory sequence" is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation of the antibody chain genes. Such regulatory sequences are described, for example, in Goeddel; Gene Expres- sion Technology. Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). It will be appreciated by those skilled in the art that the design of the expression vector, including the selection of regulatory sequences may depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. Preferred regulatory sequences for mammalian host cell ex- pression include viral elements that direct high levels of protein expression in mammalian cells, such as promoters and/or enhancers derived from cytomegalovirus (CMV), Simian Virus 40 (SV40), adenovirus, (e.g., the adenovirus major late promoter (AdMLP)) and polyoma. Alternatively, nonviral regulatory sequences may be used, such as the ubiquitin promoter or β-globin promoter. In addition to the antibody chain genes and regulatory sequences, the recombinant expression vectors of the invention may carry additional sequences, such as sequences that regulate replication of the vector in host cells (e.g., origins of replication) and selectable marker genes. The selectable marker gene facilitates selection of host cells into which the vector has been introduced (see e.g., US 4,399,216, US 4,634,665 and US 5,179,017, all by Axel et al.). For example, typically the selectable marker gene confers resistance to drugs, such as G418, hygromycin or methotrexate, on a host cell into which the vector has been introduced. Preferred selectable marker genes include the dihydrofolate reductase (DHFR) gene (for use in dhfr- host cells with methotrexate selection/amplification) and the neo gene (for G418 selection).

For expression of the light and heavy chains, the expression vector(s) encoding the heavy and light chains is transfected into a host cell by standard techniques. The various forms of the term "transfection" are intended to encompass a wide variety of techniques commonly used for the introduction of exogenous DNA into a prokaryotic or eukaryotic host cell, e.g., electroporation, calcium-phosphate precipitation, DEAE- dextran transfection, lipofectin transfection and the like.

In one embodiment the antibodies are expressed in eukaryotic cells, such as mammalian host cells. Preferred mammalian host cells for expressing the recombinant antibodies of the invention include CHO cells (including dhfr-CHO cells, described in Urlaub and Chasin, (1980) Proc. Natl. Acad. Sci. USA 77:4216-4220, used with a DHFR selectable marker, e.g., as described in R. J. Kaufman and P. A. Sharp (1982) MoI. Biol. 159:601-621 ), NS/0 myeloma cells, COS cells, HEK293 cells and SP2.0 cells. In particular for use with NS/0 myeloma cells and CHO cells, another preferred expression system is the GS (glutamine synthetase) gene expression system disclosed in WO 87/04462, WO 89/01036 and EP 338 841. When recombinant expression vectors encoding antibody genes are introduced into mammalian host cells, the antibodies are produced by culturing the host cells for a period of time sufficient to allow for expression of the antibody in the host cells or, more preferably, secretion of the antibody into the culture medium in which the host cells are grown. Antibodies can be recovered from the culture medium using standard protein purification methods. Further Recombinant Means for Producing Human Monoclonal Antibodies to the CaOU-1 epitope

Alternatively the cloned antibody genes can be expressed in other expression systems, including prokaryotic cells, such as microorganisms, e.g. Escherichia coli (E. coli) for the production of scFv antibodies, algi, as well as insect cells. Furthermore, the antibodies can be produced in transgenic non-human animals, such as in milk from sheep and rabbits or eggs from hens, or in transgenic plants. See e.g. Verma, R., et al. (1998) "Antibody engineering: Comparison of bacterial, yeast, insect and mammalian expression systems", J. Immunol. Meth. 216:165-181 ; Pollock, et al. (1999) "Transgenic milk as a method for the production of recombinant antibodies", J. Immunol. Meth. 231 :147-157; and Fischer, R., et al. (1999) "Molecular farming of recombinant antibodies in plants", Biol.Chem. 380:825-839.

Use of Partial Antibody Sequences to Express Intact Antibodies Antibodies interact with target antigens predominantly through amino acid residues that are located in the six heavy and light chain complementarity determining regions (CDRs). For this reason, the amino acid sequences within CDRs are more diverse between individual antibodies than sequences outside of CDRs. Because CDR sequences are responsible for most antibody-antigen interactions, it is possible to express recombinant antibodies that mimic the properties of specific naturally occurring antibodies by constructing expression vectors that include CDR sequences from the specific naturally occurring antibody grafted onto framework sequences from a different antibody with different properties (see, e.g., Riechmann, L. et al. (1998) Nature 332:323-327; Jones, P. et al. (1986) Nature 321 :522-525; and Queen, C. et al. (1989) Proc. Natl. Acad. Sci. USA 86:10029-10033). Such framework sequences can be obtained from public DNA databases that include germline antibody gene sequences. These germline sequences will differ from mature antibody gene sequences because they will not include completely assembled variable genes, which are formed by V(D)J joining during B cell maturation. Germline gene sequences will also differ from the sequences of a high affinity secondary repertoire antibody which contains mutations throughout the variable gene but typically clustered in the CDRs. For example, somatic mutations are relatively infrequent in the amino terminal portion of framework region 1 and in the carboxy-terminal portion of framework region 4. For this reason, it is not necessary to obtain the entire DNA sequence of a particular antibody in order to recreate an intact recombinant antibody having binding properties similar to those of the original antibody (see WO 99/45962). Partial heavy and light chain sequence spanning the CDR regions is typically sufficient for this purpose. The partial sequence is used to determine which germline variable and joining gene segments contributed to the recombined anti- body variable genes. The germline sequence is then used to fill in missing portions of the variable regions. Heavy and light chain leader sequences are cleaved during protein maturation and do not contribute to the properties of the final antibody. To add missing sequences, cloned cDNA sequences can be combined with synthetic oligonucleotides by ligation or PCR amplification. Alternatively, the entire variable region can be synthesized as a set of short, overlapping, oligonucleotides and combined by PCR amplification to create an entirely synthetic variable region clone. This process has certain advantages such as elimination or inclusion or particular restriction sites, or optimization of particular codons.

The nucleotide sequences of heavy and light chain transcripts from hybridomas are used to design an overlapping set of synthetic oligonucleotides to create synthetic V sequences with identical amino acid coding capacities as the natural sequences. The synthetic heavy and kappa chain sequences can differ from the natural sequences in three ways: strings of repeated nucleotide bases are interrupted to facili- tate oligonucleotide synthesis and PCR amplification; optimal translation initiation sites are incorporated according to Kozak's rules (Kozak, 1991 , J. Biol. Chem. 266:19867-19870); and Hindlll sites are engineered upstream of the translation initiation sites.

For both the heavy and light chain variable regions, the optimized coding and corresponding non-coding, strand sequences are broken down into 30 - 50 nucleotides approximately at the midpoint of the corresponding non-coding oligonucleotide. Thus, for each chain, the oligonucleotides can be assembled into overlapping double stranded sets that span segments of 150 - 400 nucleotides. The pools are then used as templates to produce PCR amplification products of 150 - 400 nucleotides. Typically, a single variable region oligonucleotide set will be broken down into two pools which are separately amplified to generate two overlapping PCR products. These overlapping products are then combined by PCR amplification to form the complete variable region. It may also be desirable to include an overlapping frag- ment of the heavy or light chain constant region (including the Bbsl site of the kappa light chain, or the Agel site of the gamma heavy chain) in the PCR amplification to generate fragments that can easily be cloned into the expression vector constructs.

The reconstructed heavy and light chain variable regions are then combined with cloned promoter, leader, translation initiation, constant region, 3' untranslated, polyadenylation, and transcription termination, sequences to form expression vector constructs. The heavy and light chain expression constructs can be combined into a single vector, co-transfected, serially transfected, or separately transfected into host cells which are then fused to form a host cell expressing both chains.

In another aspect of the invention, the structural features of the anti-CaOU-1 epitope binding polypetide of the invention are used to create structurally related human anti-CaOU-1 antibodies that retain at least one functional property of the antibodies of the invention, such as binding to the CaOU-1 epitope. More specifically, one or more CDR regions can be combined recombinantly with known human framework regions and CDRs to create additional, recombinantly-engineered, human anti- CaOU-1 epitope antibodies of the invention.

Accordingly, in another embodiment, the invention provides a method for preparing an anti-CaOU-1 antibody comprising: preparing an antibody comprising (1 ) human heavy chain framework regions and human heavy chain CDRs, wherein at least one of the human heavy chain CDRs comprises an amino acid sequence selected from the amino acid sequences of CDRs shown in SEQ ID NOs:6, 8 and 10; and (2) human light chain framework regions and human light chain CDRs, wherein at least one of the human light chain CDRs comprises an amino acid sequence selected from the amino acid sequences of CDRs shown in SEQ ID NOs:12, 14 and 16); wherein the antibody retains the ability to bind to the CaOU-1 epitope.

Since it is well known in the art that antibody heavy and light chain CDR3 domains play a particularly important role in the binding specificity/affinity of an antibody for an antigen, the recombinant antibodies of the invention prepared as set forth above preferably comprise the VH CDR3 identified by SEQ ID NO: 10 and/or the VL CDR3 identified by SEQ ID NO: 16 Monovalent antibodies

The monospecific binding polypeptide may be monovalent, i.e. having only one binding domain.

For a monovalent antibody, the immunoglobulin constant domain amino acid residue sequences comprise the structural portions of an antibody molecule known in the art as CH1 , CH2, CH3 and CH4. Preferred are those binding polypeptides which are known in the art as CL. Preferrred CL polypeptides are selected from the group consisting Of Ckappa and Ciambda-

Furthermore, insofar as the constant domain can be either a heavy or light chain constant domain (CH or CL, respectively), a variety of monovalent binding polypeptide compositions are contemplated by the present invention. For example, light chain constant domains are capable of disulfide bridging to either another light chain constant domain, or to a heavy chain constant domain. In contrast, a heavy chain constant domain can form two independent disulfide bridges, allowing for the possibility of bridging to both another heavy chain and to a light chain, or to form polymers of heavy chains.

Thus, in another embodiment, the invention contemplates an isolated monovalent binding polypeptide wherein the constant chain domain C has a cysteine residue capable of forming at least one disulfide bridge, and where at least two monovalent polypeptides are covalently linked by said disulfide bridge.

In preferred embodiments, the constant chain domain C can be either CL or CH.

Where C is CL, the CL polypeptide is preferably selected from the group consisting of

Ckappa and Ciambda-

In another embodiment, the invention contemplates a binding polypeptide composi- tion comprising a monovalent polypeptide as above except where C is CL having a cysteine residue capable of forming a disulfide bridge, such that the composition contains two monovalent polypeptides covalently linked by said disulfide bridge. Multispecificity, including bispecificity

In a preferred embodiment the present invention relates to multispecific binding polypeptides, which have affinity for and are capable of binding at least two different entities. Multispecific binding polypeptides can include bispecific binding polypep- tides.

In one embodiment the multispecific molecule is a bispecific antibody (BsAb), which carries at least two different binding domains, where preferably at least one of which is of antibody origin.

A bispecific molecule of the invention can also be a single chain bispecific molecule, such as a single chain bispecific antibody, a single chain bispecific molecule comprising one single chain antibody and a binding domain, or a single chain bispecific molecule comprising two binding domains. Multispecific molecules can also be sin- gle chain molecules or may comprise at least two single chain molecules.

The multispecific, including bispecific, antibodies may be produced by any suitable manner known to the person skilled in the art.

The traditional approach to generate bispecific whole antibodies was to fuse two hybridoma cell lines each producing an antibody having the desired specificity. Because of the random association of immunoglobulin heavy and light chains, these hybrid hybridomas produce a mixture of up to 10 different heavy and light chain combinations, only one of which is the bispecific antibody. Therefore, these bispeci- fie antibodies have to be purified with cumbersome procedures, which considerably decrease the yield of the desired product.

Alternative approaches include in vitro linking of two antigen specificities by chemical cross-linking of cysteine residues either in the hinge or via a genetically intro- duced C-terminal Cys as described above. An improvement of such in vitro assembly was achieved by using recombinant fusions of Fab's with peptides that promote formation of heterodimers. However, the yield of bispecific product in these methods is far less than 100%. A more efficient approach to produce bivalent or bispecific antibody fragments, not involving in vitro chemical assembly steps, was described by Holliger et al. (1993). This approach takes advantage of the observation that scFv's secreted from bacteria are often present as both monomers and dimers. This observation suggested that the VH and VL of different chains could pair, thus forming dimers and larger complexes. The dimeric antibody fragments, also named "diabodies" by Hollinger et al., are in fact small bivalent antibody fragments that assembled in vivo. By linking the VH and VL of two different antibodies 1 and 2, to form "cross-over" chains VH 1 VL 2 and VH 2-VL 1 , the dimerisation process was shown to reassemble both antigen- binding sites. The affinity of the two binding sites was shown to be equal to the starting scFv's, or even to be 10-fold increased when the polypeptide linker covalently linking VH and VL was removed, thus generating two proteins each consisting of a VH directly and covalently linked to a VL not pairing with the VH. This strategy of producing bispecific antibody fragments was also described in several patent appli- cations. Patent application WO 94/09131 (SCOTGEN LTD; priority date Oct. 15, 1992) relates to a bispecific binding protein in which the binding domains are derived from both a VH and a VL region either present at two chains or linked in an scFv, whereas other fused antibody domains, e.g. C-terminal constant domains, are used to stabilise the dimeric constructs. Patent application WO 94/13804 (CAM- BRIDGE ANTIBODY TECHNOLOGY/MEDICAL RESEARCH COUNCIL; first priority date Dec. 4, 1992) relates to a polypeptide containing a VH and a VL which are incapable of associating with each other, whereby the V-domains can be connected with or without a linker.

Mallender and Voss, 1994 (also described in patent application WO 94/13806; DOW CHEMICAL CO; priority date Dec. 11 , 1992) reported the in vivo production of a single-chain bispecific antibody fragment in E. coli. The bispecificity of the bivalent protein was based on two previously produced monovalent scFv molecules possessing distinct specificities, being linked together at the genetic level by a flexible polypeptide linker. Traditionally, whenever single-chain antibody fragments are referred to, a single molecule consisting of one heavy chain linked to one (corresponding) light chain in the presence or absence of a polypeptide linker is implicated. When making bivalent or bispecific antibody fragments through the "diabody" approach (Holliger et al., (1993) and patent application WO 94/09131 ) or by the "dou- ble scFv" approach (Mallender and Voss, 1994 and patent application WO 94/13806), again the VH is linked to a (the corresponding) VL.

The multispecific molecules described above can be made by a number of methods. For example, all specificities can be encoded in the same vector and expressed and assembled in the same host cell. This method is particularly useful where the multi- specific molecule is a mAb X mAb, mAb X Fab, Fab X F(ab')2 or ligand X Fab fusion protein. Various other methods for preparing bi- or multivalent antibodies are described for example described in U.S. Pat. Nos. 5,260,203; 5,455,030; 4,881 ,175; 5,132,405; 5,091 ,513; 5,476,786; 5,013,653; 5,258,498; and 5,482,858.

By using a bispecific or multispecific binding polypeptide according to the invention the invention offers several advantages as compared to monospecific/monovalent binding polypeptides.

A bispecific/multispecific binding polypeptide has a first binding domain capable of specifically recognising and binding the CaOU-1 epitope, whereas the other binding domain(s) may be used for other purposes.

In an embodiment of the present invention at least one other binding domain are further used for specifically binding an adenocarcinoma cell.

It may be preferred that the at least one other binding domain is capable of binding an immunoactive cell, such as a leucocyte, a macrophage, a lymphocyte, a baso- philic cell, and/or an eosinophilic cell, in order to increase the effect of the binding polypeptide in a therapeutic method. This may be accomplished by establishing that the at least one other binding domain is capable of specifically binding a mammalian protein, such as a human protein, such as a protein selected from any of the cluster differentiation proteins (CD), in particular CD64 and/or CD89. A method for produc- ing bispecific antibodies having CD64 specificity is described in US 6,071 ,517 to Medarex, Inc.

Accordingly, the present invention includes bispecific and multispecific molecules comprising at least one first binding domain withspecificity for the CaOU-1 epitope and a second binding specificity for a second target epitope. In a particular embodi- merit of the invention, the second target epitope is an Fc receptor, e.g., human FcγRI (CD64) or a human Fcα receptor (CD89), or a T cell receptor, e.g., CD3. Therefore, the invention includes bispecific and multispecific molecules capable of binding both to FcyR, FcαR or FcεR expressing effector cells (e.g., monocytes, macrophages or polymorphonuclear cells (PMNs)), and target cells expressing the CaOU-1 epitope. These bispecific and multispecific molecules target cells expressing the CaOU-1 epitope to effector cell and can like antibodies of the invention, trigger Fc receptor-mediated effector cell activities, such as phagocytosis of cells expressing the CaOU-1 epitope, antibody dependent cellular cytotoxicity (ADCC), cy- tokine release, or generation of superoxide anion.

Bispecific and multispecific molecules of the invention can further include a third binding specificity, in addition to an anti-Fc binding specificity and the anti-CaOU-1 epitope binding specificity. In one embodiment, the third binding specificity is an anti-enhancement factor (EF) portion, e.g., a molecule which binds to a surface protein involved in cytotoxic activity and thereby increases the immune response against the target cell. The "anti-enhancement factor portion" can be an antibody, functional antibody fragment or a ligand that binds to a given molecule, e.g., an antigen or a receptor, and thereby results in an enhancement of the effect of the binding determinants for the Fc receptor or target cell antigen. The "anti-enhancement factor portion" can bind an Fc receptor or a target cell antigen. Alternatively, the anti- enhancement factor portion can bind to an entity that is different from the entity to which the first and second binding specificities bind. For example, the anti- enhancement factor portion can bind a cytotoxic T cell (e.g., via CD2, CD3, CD8, CD28, CD4, CD40, ICAM-1 or other immune cell that results in an increased immune response against the target cell).

In one embodiment, the bispecific and multispecific molecules of the invention comprise as a binding specificity at least one further antibody, including, e.g., an Fab, Fab', F(ab')2, Fv, or a single chain Fv. The antibody may also be a light chain or heavy chain dimer, or any minimal fragment thereof such as a Fv or a single chain construct as described in Ladner et al. in US 4,946,778. The antibody may also be a binding-domain immunoglobulin fusion protein as disclosed in US 2003/0118592 and US 2003/0133939. In one embodiment, the binding specificity for an Fc receptor is provided by a human monoclonal antibody, the binding of which is not blocked by human immunoglobulin G (IgG). As used herein, the term "IgG receptor" refers to any of the eight γ-chain genes located on chromosome 1. These genes encode a total of twelve transmembrane or soluble receptor isoforms which are grouped into three Fcγ receptor classes: FcγRI (CD64), FcγRII (CD32), and FcγRIII (CD16). In one preferred embodiment, the FCY receptor is a human high affinity FcγRI.

The production and characterization of these preferred monoclonal antibodies are described by Fanger et al. in WO 88/00052 and in US 4,954,617. These antibodies bind to an epitope of FcγRI, FcγRII or FcγRIII at a site which is distinct from the FCY binding site of the receptor and, thus, their binding is not blocked substantially by physiological levels of IgG. Specific anti-FcγRI antibodies useful in this invention are imAb 22, mAb 32, mAb 44, mAb 62 and mAb 197. In other embodiments, the anti- FCY receptor antibody is a humanized form of mAb 22 (H22). The production and characterization of the H22 antibody is described in Graziano, R. F. et al. (1995) J. Immunol. 155 (10):4996-5002 and WO 94/10332. The H22 antibody producing cell line was deposited at the American Type Culture Collection on November 4, 1992 under the designation HA022CL1 and has the accession No. CRL 1 1177.

In still other preferred embodiments, the binding specificity for an Fc receptor is provided by an antibody that binds to a human IgA receptor, e.g., an Fcα receptor (Fcαl (CD89)), the binding of which is preferably not blocked by human immunoglobulin A (IgA). The term "IgA receptor" is intended to include the gene product of one α-gene (FcαRI) located on chromosome 19. This gene is known to encode several alternatively spliced transmembrane isoforms of 55 to 110 kDa. FcαRI (CD89) is constitu- tively expressed on monocytes/macrophages, eosinophilic and neutrophilic granulocytes, but not on non-effector cell populations. FcαRI has medium affinity for both IgAI and lgA2, which is increased upon exposure to cytokines such as G-CSF or GM-CSF (Morton, H. C. et al. (1996) Critical Reviews in Immunology 16:423-440). Four FcαRI-specific monoclonal antibodies, identified as A3, A59, A62 and A77, which bind FcαRI outside the IgA ligand binding domain, have been described (Monteiro, R.C. et al. (1992) J. Immunol. 148:1764). FcαRI, FcγRI, FcγRII and FcγRIII, especially FcγRII and FcγRIII, are preferred trigger receptors for use in the invention because they (1 ) are expressed primarily on immune effector cells, e.g., monocytes, PMNs, macrophages and dendritic cells; (2) are expressed at high levels (e.g., 5,000-100,000 per cell); (3) are mediators of cyto- toxic activities (e.g., ADCC, phagocytosis); and (4) mediate enhanced antigen presentation of antigens, including self-antigens, targeted to them.

While human monoclonal antibodies are preferred, other antibodies which can be employed in the bispecific or multispecific molecules of the invention are murine, chimeric and humanized monoclonal antibodies. Such murine, chimeric and humanized monoclonal antibodies can be prepared by methods known in the art.

Bispecific and multispecific molecules of the present invention can be made using chemical techniques (see e.g., D. M. Kranz et al. (1981 ) Proc. Natl. Acad. Sci. USA 78:5807), "polydoma" techniques (see US 4,474,893), or recombinant DNA techniques.

In particular, bispecific and multispecific molecules of the present invention can be prepared by conjugating the constituent binding specificities, e.g., the anti-FcR and anti-CaOU-1 epitope binding specificities, using methods known in the art. For example, each binding specificity of the bispecific and multispecific molecule can be generated separately and then conjugated to one another. When the binding specificities are proteins or peptides, a variety of coupling or cross-linking agents can be used for covalent conjugation. Examples of cross-linking agents include protein A, carbodiimide, N-succinimidyl-S-acetyl-thioacetate (SATA), 5,5'-dithiobis(2- nitrobenzoic acid) (DTNB), o-phenylenedimaleimide (oPDM), N-succinimidyl-3-(2- pyridyldithio)propionate (SPDP), and sulfosuccinimidyl 4-(N-maleimidomethyl)cyclo- hexane-1-carboxylate (sulfo-SMCC) see e.g., Karpovsky et al. (1984) J. Exp. Med. 160:1686; Liu, M. A., et al. (1985) Proc. Natl. Acad. Sci. USA 82:8648. Other meth- ods include those described by Paulus (Behring Ins. Mitt. (1985) No. 78, 1 18-132); Brennan et al. (1985) Science 229:81-83, and Glennie et al. (1987) J. Immunol. 139:2367-2375. Preferred conjugating agents are SATA and sulfo-SMCC, both available from Pierce Chemical Co. (Rockford, IL). When the binding specificities are antibodies, they can be conjugated via sulfhydryl bonding of the C-terminus hinge regions of the two heavy chains. In a particularly preferred embodiment, the hinge region is modified to contain an odd number of sulfhydryl residues, preferably one, prior to conjugation.

Alternatively, both binding specificities can be encoded in the same vector and expressed and assembled in the same host cell. This method is particularly useful where the bispecific and multispecific molecule is a mAb x mAb, mAb x Fab, Fab x F(ab')2 or ligand x Fab fusion protein. A bispecific and multispecific molecule of the invention, e.g., a bispecific molecule can be a single chain molecule, such as a single chain bispecific antibody, a single chain bispecific molecule comprising one single chain antibody and a binding determinant, or a single chain bispecific molecule comprising two binding determinants. Bispecific and multispecific molecules can also be single chain molecules or may comprise at least two single chain molecules. Methods for preparing bi- and multispecific molecules are described for example in US 5,260,203; US 5,455,030; US 4,881 ,175; US 5,132,405; US 5,091 ,513; US 5,476,786; US 5,013,653; US 5,258,498; and US 5,482,858.

Binding of the bispecific and multispecific molecules to their specific targets can be confirmed by enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), FACS analysis, a bioassay (e.g., growth inhibition), or a Western Blot Assay. Each of these assays generally detects the presence of protein-antibody complexes of particular interest by employing a labeled reagent (e.g., an antibody) specific for the complex of interest. For example, the FcR-antibody complexes can be detected using e.g., an enzyme-linked antibody or antibody fragment which recognizes and specifically binds to the antibody-FcR complexes. Alternatively, the complexes can be detected using any of a variety of other immunoassays. For example, the antibody can be radioactively labeled and used in a radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986).

The radioactive isotope can be detected by such means as the use of a Y counter or a scintillation counter or by autoradiography. Humanised antibody framework

It is not always desirable to use non-human antibodies for human therapy, since the non-human "foreign" epitopes may elicit immune response in the individual to be treated. To eliminate or minimize the problems associated with non-human antibod- ies, it is desirable to engineer chimeric antibody derivatives, i.e., "humanized" antibody molecules that combine the non-human Fab variable region binding determinants with a human constant region (Fc). Such antibodies are characterized by equivalent antigen specificity and affinity of the monoclonal and polyclonal antibodies described above, and are less immunogenic when administered to humans, and therefore more likely to be tolerated by the individual to be treated.

Accordingly, in one embodiment the binding polypeptide has a binding domain carried on a humanised antibody framework, also called a humanised antibody.

Humanised antibodies are in general chimeric antibodies comprising regions derived from a human antibody and regions derived from a non-human antibody, such as a rodent antibody. Humanisation (also called Reshaping or CDR-grafting) is a well- established technique for reducing the immunogenicity of monoclonal antibodies (mAbs) from xenogeneic sources (commonly rodent), increasing the homology to a human immunoglobulin, and for improving their activation of the human immune system. Thus, humanized antibodies are typically human antibodies in which some CDR residues and possibly some framework residues are substituted by residues from analogous sites in rodent antibodies.

It is further important that humanized antibodies retain high affinity for the antigen and other favourable biological properties. To achieve this goal, according to a preferred method, humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three- dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of certain residues in the functioning of the candidate immunoglobulin sequence, i.e., the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the recipient and import sequences so that the desired antibody characteristic, such as increased affinity for the target antigen(s), is maximized, although it is the CDR residues that directly and most substantially influence antigen binding.

One method for humanising MAbs related to production of chimeric antibodies in which an antigen binding site comprising the complete variable domains of one antibody are fused to constant domains derived from a second antibody, preferably a human antibody. Methods for carrying out such chimerisation procedures are for example described in EP-A-O 120 694 (Celltech Limited), EP-A-O 125 023 (Genen- tech Inc.), EP-A-O 171 496 (Res. Dev. Corp. Japan), EP-A-0173494 (Stanford University) and EP-A-O 194 276 (Celltech Limited). A more complex form of humanisa- tion of an antibody involves the re-design of the variable region domain so that the amino acids constituting the non-human antibody binding site are integrated into the framework of a human antibody variable region (Jones et al., 1986).

The humanized antibody of the present invention may be made by any method capable of replacing at least a portion of a CDR of a human antibody with a CDR derived from a non-human antibody. Winter describes a method which may be used to prepare the humanized antibodies of the present invention (UK Patent Application GB 2188638A, filed on Mar. 26, 1987), the contents of which is expressly incorporated by reference. The human CDRs may be replaced with non-human CDRs using oligonucleotide site-directed mutagenesis as described in the examples below.

As an example the humanized antibody of the present invention may be made as described in the brief explanation below. The humanized antibodies of the present invention may be produced by the following process:

(a) constructing, by conventional techniques, an expression vector containing an operon with a DNA sequence encoding an antibody heavy chain in which the

CDRs and such minimal portions of the variable domain framework region that are required to retain antibody binding specificity are derived from a non-human immunoglobulin, and the remaining parts of the antibody chain are derived from a human immunoglobulin, thereby producing the vector of the invention; (b) constructing, by conventional techniques, an expression vector containing an operon with a DNA sequence encoding a complementary antibody light chain in which the CDRs and such minimal portions of the variable domain framework region that are required to retain donor antibody binding specificity are derived from a non-human immunoglobulin, and the remaining parts of the antibody chain are derived from a human immunoglobulin, thereby producing the vector of the invention;

(c) transfecting the expression vectors into a host cell by conventional techniques to produce the transfected host cell of the invention; and

(d) culturing the transfected cell by conventional techniques to produce the humanised antibody of the invention.

The host cell may be cotransfected with the two vectors of the invention, the first vector containing an operon encoding a light chain derived polypeptide and the second vector containing an operon encoding a heavy chain derived polypeptide. The two vectors contain different selectable markers, but otherwise, apart from the antibody heavy and light chain coding sequences, are preferably identical, to ensure, as far as possible, equal expression of the heavy and light chain polypeptides. Alternatively, a single vector may be used, the vector including the sequences encoding both the light and the heavy chain polypeptides. The coding sequences for the light and heavy chains may comprise cDNA or genomic DNA or both.

The host cell used to express the altered antibody of the invention may be either a bacterial cell such as E. coli, or a eukaryotic cell. In particular a mammalian cell of a well defined type for this purpose, such as a myeloma cell or a Chinese hamster ovary cell may be used.

The general methods by which the vectors of the invention may be constructed, transfection methods required to produce the host cell of the invention and culture methods required to produce the antibody of the invention from such host cells are all conventional techniques. Likewise, once produced, the humanized antibodies of the invention may be purified according to standard procedures as described below. Human antibody framework

In a more preferred embodiment the invention relates to a binding polypeptide, wherein the binding domain is carried by a human antibody framework, i.e. wherein the antibodies have a greater degree of human peptide sequences than do human- ised antibodies.

Human mAb antibodies directed against human proteins can be generated using transgenic mice carrying the complete human immune system rather than the mouse system. Splenocytes from these transgenic mice immunized with the antigen of interest are used to produce hybridomas that secrete human mAbs with specific affinities for epitopes from a human protein (see, e.g., Wood et al. International Application WO 91/00906, Kucherlapati et al. PCT publication WO 91/10741 ; Lonberg et al. International Application WO 92/03918; Kay et al. International Application 92/03917; Lonberg, N. et al. 1994 Nature 368:856-859; Green, L. L. et al. 1994 Nature Genet. 7:13-21 ; Morrison, S. L. et al. 1994 Proc. Natl. Acad. Sci. USA 81 :6851-6855; Bruggeman et al. 1993 Year Immunol 7:33-40; Tuaillon et al. 1993 PNAS 90:3720-3724; Bruggeman et al. 1991 Eur J Immunol 21 : 1323-1326).

Such transgenic mice are available from Abgenix, Inc., Fremont, Calif., and Meda- rex, Inc., Annandale, N.J. It has been described that the homozygous deletion of the antibody heavy-chain joining region (IH) gene in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. Transfer of the human germ-line immunoglobulin gene array in such germ-line mutant mice will result in the production of human antibodies upon antigen challenge. See, e.g., Jako- bovits et al., Proc. Natl. Acad. Sci. USA 90:2551 (1993); Jakobovits et al., Nature 362:255-258 (1993); Bruggermann et al., Year in Immunol. 7:33 (1993); and Duchosal et al. Nature 355:258 (1992). Human antibodies can also be derived from phage-display libraries (Hoogenboom et al., J. MoI. Biol. 227: 381 (1991 ); Marks et al., J. MoI. Biol. 222:581-597 (1991 ); Vaughan, et al., Nature Biotech 14:309 (1996)).

In an embodiment the binding domain of the isolated CaOU-1 epitope binding polypeptide according to the invention is carried by an immunoglogbuling selected from the group of IgA, IgD, IgE, IgG and IgM. It may further be preferred tha the immunoglobulin is a recombinant immunoglobulin and/or an IgM immunoglobulin.

Pharmaceutical composition Pharmaceutical compositions containing a compound of the present invention may be prepared by conventional techniques, e.g. as described in Remington: The Science and Practice of Pharmacy 1995, edited by E. W. Martin, Mack Publishing Company, 19th edition, Easton, Pa. The compositions may appear in conventional forms, for example capsules, tablets, aerosols, solutions, suspensions or topical applications.

For the purpose of the present application the term pharmaceutical composition and medicament are used interchangeably.

Administration forms

The main routes of drug delivery, in the treatment method are intravenous, oral, and topical, as will be described below. Other drug-administration methods, such as subcutaneous injection or via inhalation, which are effective to deliver the drug to a target site or to introduce the drug into the bloodstream, are also contemplated.

Compounds of the invention may be administered parenterally, that is by intravenous, intramuscular, subcutaneous intranasal, intrarectal, intravaginal or intraperitoneal administration. The CaOU-1 epitope binding polypeptides according to the invention are preferably administered parenterally such as intravenously, intra- arterially, subcutaneously, intramuscularly or and intraperitoneal^. The subcutaneous and intramuscular forms of parenteral administration are generally preferred. Further preferred is intravenous administration. Appropriate dosage forms for such administration may be prepared by conventional techniques. The compounds may also be administered by inhalation that is by intranasal and oral inhalation admini- stration. Appropriate dosage forms for such administration, such as an aerosol formulation or a metered dose inhaler, may be prepared by conventional techniques.

The compounds according to the invention may be administered with at least one other compound. The compounds may be administered simultaneously, either as separate formulations or combined in a unit dosage form, or administered sequentially.

Formulations Whilst it is possible for the compounds or salts of the present invention to be administered as the raw chemical, it is preferred to present them in the form of a pharmaceutical formulation. Accordingly, the present invention further provides a pharmaceutical formulation, for medicinal application, which comprises a compound of the present invention or a pharmaceutically acceptable salt thereof, as herein defined, and a pharmaceutically acceptable carrier therefor.

Parenteral administration

The compounds of the present invention may be formulated for parenteral administration (e.g., by injection, for example bolus injection or continuous infusion) and may be presented in unit dose form in ampoules, pre-filled syringes, small volume infusion or in multi-dose containers with an added preservative. The compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, for example solutions in aqueous polyethylene glycol. Examples of oily or nonaqueous carriers, diluents, solvents or vehicles include propylene glycol, poly- ethylene glycol, vegetable oils (e.g., olive oil), and injectable organic esters (e.g., ethyl oleate), and may contain formulatory agents such as preserving, wetting, emulsifying or suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilisation from solution for constitution before use with a suitable vehicle, e.g., sterile, pyrogen-free water.

Oils useful in parenteral formulations include petroleum, animal, vegetable, or synthetic oils. Specific examples of oils useful in such formulations include peanut, soybean, sesame, cottonseed, corn, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.

Suitable soaps for use in parenteral formulations include fatty alkali metal, ammonium, and triethanolamine salts, and suitable detergents include (a) cationic deter- gents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides; (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanola- mides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl-. beta. -aminopropionates, and 2-alkyl-imidazoline quaternary ammonium salts, and (e) mixtures thereof.

The parenteral formulations typically will contain from about 0.5 to about 25% by weight of the active ingredient in solution. Preservatives and buffers may be used. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants having a hydrophile-lipophile balance (HLB) of from about 12 to about 17. The quantity of surfactant in such formulations will typically range from about 5 to about 15% by weight. Suitable surfactants include polyethylene sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol. The parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, im- mediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.

In a preferred embodiment the medicament is formulated for parenteral administra- tion.

Suppositories

The compounds of the present invention may be formulated for administration as suppositories. A low melting wax, such as a mixture of fatty acid glycerides or cocoa butter is first melted and the active component is dispersed homogeneously, for example, by stirring. The molten homogeneous mixture is then poured into convenient sized molds, allowed to cool, and to solidify. The active compound may be formulated into a suppository comprising, for example, about 0.5% to about 50% of a compound of the invention, disposed in a polyethylene glycol (PEG) carrier (e.g., PEG 1000 [96%] and PEG 4000 [4%].

The compounds of the present invention may be formulated for vaginal administration. Pessaries, tampons, creams, gels, pastes, foams or sprays containing in addition to the active ingredient such carriers as are known in the art to be appropriate.

In a preferred embodiment the medicament is formulated of administration as a suppository.

Inhalation

The compounds of the present invention may be formulated for nasal administration.

The solutions or suspensions are applied directly to the nasal cavity by conventional means, for example with a dropper, pipette or spray. The formulations may be provided in a single or multidose form. In the latter case of a dropper or pipette this may be achieved by the patient administering an appropriate, predetermined volume of the solution or suspension. In the case of a spray this may be achieved for example by means of a metering atomizing spray pump.

The compounds of the present invention may be formulated for aerosol administration, particularly to the respiratory tract and including intranasal administration. The compound will generally have a small particle size for example of the order of 5 microns or less. Such a particle size may be obtained by means known in the art, for example by micronization. The active ingredient is provided in a pressurized pack with a suitable propellant such as a chlorofluorocarbon (CFC) for example dichloro- difluoromethane, trichlorofluoromethane, or dichlorotetrafluoroethane, carbon dioxide or other suitable gas. The aerosol may conveniently also contain a surfactant such as lecithin. The dose of drug may be controlled by a metered valve. Alterna- tively the active ingredients may be provided in a form of a dry powder, for example a powder mix of the compound in a suitable powder base such as lactose, starch, starch derivatives such as hydroxypropylmethyl cellulose and polyvinylpyrrolidine (PVP). The powder carrier will form a gel in the nasal cavity. The powder composition may be presented in unit dose form for example in capsules or cartridges of e.g., gelatin or blister packs from which the powder may be administered by means of an inhaler.

In a preferred embodiment the medicament is formulated of administration by inha- lation.

Unit dosage

The pharmaceutical preparations are preferably in unit dosage forms. In such form, the preparation is subdivided into unit doses containing appropriate quantities of the active component. The unit dosage form can be a packaged preparation, the package containing discrete quantities of preparation, such as packeted tablets, capsules, and powders in vials or ampoules. Also, the unit dosage form can be a capsule, tablet, cachet, or lozenge itself, or it can be the appropriate number of any of these in packaged form.

Pharmaceutically acceptable salts

Pharmaceutically acceptable salts of the instant compounds, where they can be prepared, are also intended to be covered by this invention. These salts will be ones which are acceptable in their application to a pharmaceutical use. By that it is meant that the salt will retain the biological activity of the parent compound and the salt will not have untoward or deleterious effects in its application and use in treating diseases.

Pharmaceutically acceptable salts are prepared in a standard manner. If the parent compound is a base it is treated with an excess of an organic or inorganic acid in a suitable solvent. If the parent compound is an acid, it is treated with an inorganic or organic base in a suitable solvent.

The compounds of the invention may be administered in the form of an alkali metal or earth alkali metal salt thereof, concurrently, simultaneously, or together with a pharmaceutically acceptable carrier or diluent, especially and preferably in the form of a pharmaceutical composition thereof, whether by oral, rectal, or parenteral (including subcutaneous) route, in an effective amount. Examples of pharmaceutically acceptable acid addition salts for use in the present inventive pharmaceutical composition include those derived from mineral acids, such as hydrochloric, hydrobromic, phosphoric, metaphosphoric, nitric and sulfuric acids, and organic acids, such as tartaric, acetic, citric, malic, lactic, fumaric, ben- zoic, glycolic, gluconic, succinic, p-toluenesulphonic acids, and arylsulphonic, for example.

Dosing regimes

The dosage requirements will vary with the particular drug composition employed, the route of administration and the particular subject being treated. Ideally, a patient to be treated by the present method will receive a pharmaceutically effective amount of the compound in the maximum tolerated dose, generally no higher than that required before drug resistance develops.

For all methods of use disclosed herein for the compounds, the daily dosage regimen will preferably be from about 1 to about 1500 μg/kg of total body weight. The daily parenteral dosage regimen about 10 to about 80 μg/kg of total body weight. The daily dosage regimen will preferably be from 0.1 mg to 150 mg, administered one to four, preferably two or three times daily. The daily dosage regimen will pref- erably be from about 0.01 mg/kg to about 1 mg/kg per day. It will also be recognized by one of skill in the art that the optimal quantity and spacing of individual dosages of a compound or a pharmaceutically acceptable salt thereof will be determined by the nature and extent of the condition being treated, the form, route and site of administration, and the particular patient being treated, and that such optimums can be determined by conventional techniques. It will also be appreciated by one of skill in the art that the optimal course of treatment, i.e., the number of doses of a compound or a pharmaceutically acceptable salt thereof given per day for a defined number of days, can be ascertained by those skilled in the art using conventional course of treatment determination tests.

The term "unit dosage form" as used herein refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of a compound, alone or in combination with other agents, calculated in an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier, or vehicle. The specifications for the unit dosage forms of the present invention depend on the particular compound or compounds employed and the effect to be achieved, as well as the pharmacodynamics associated with each compound in the host. The dose administered should be an "effective amount" or an amount necessary to achieve an "effective level" in the individual patient.

Since the "effective level" is used as the preferred endpoint for dosing, the actual dose and schedule can vary, depending on interindividual differences in pharmacokinetics, drug distribution, and metabolism. The "effective level" can be defined, for example, as the blood or tissue level desired in the patient that corresponds to a concentration of one or more compounds according to the invention.

Medicaments/ pharmaceutical composition

An aspect of the present relates to the use of the CaOU-1 epitope binding polypep- tide as described herein as a medicament.

The application thus further relates to a pharmaceutical composition comprising the CaOU-1 epitope binding polypeptide as described herein and optionally pharmaceutically accepted carriers or excipient.

The CaOU-1 epitope binding polypeptide of the present invention may be used alone or coupled to a therapeutic agent. For the purpose of treatment or prevention of adenocarsinomas characterised by expression of the CaOU-1 epitope it may be advantages to use a CaOU-1 epitope binding polypeptide coupled to a therapeutic agent.

A therapeutic agent may according to the present application be any agent which, when couple to the binding polypeptide of the invention have a desirable effect on adenocarsinomas, e.g. enhances the effect of the binding polypeptide in terms of treatment and/or prevention of adenocarcinomas.

For the purpose of the present application the therapeutic agent is preferably selected from the group of anti-neoplastic agents, radioiodinated compounds, toxins, chemotherapeutic agents, cytostatic and cytolytic drugs. The therapeutic agent may be coupled to the CaOU-1 epitope binding polypeptide by any suitable method. Such methods are well known to the person skilled in the art.

Types of chemotherapeutic agents includes; alkylating agents, anti-metabolites, plant alkaloids and terpenoids(such as vinca alkaloids, podophyllotoxi and taxanes) topoisomerase inhibitors, antitumour antibiotics and monoclonal antibodies.

The chemotherapeutic agent can be e.g. methotrexate, vincristine, adriamycin, cis- platin, non-sugar containing chloroethylnitrosoureas, 5-fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine GLA, valrubicin, carmustaine and poliferposan, MM1270, BAY 12-9566, RAS famesyl transferase inhibitor, famesyl transferase inhibitor, MMP, MTA/LY231514, LY264618/I_ometexol, Glamolec, CI-994, TNP-470, Hycamtin/Topotecan, PKC412, Valspodar/PSC833, Novantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH-4556, CS- 682, 9-AC, AG3340, AG3433, lncel/VX-710, VX-853, ZD0101 , ISI641 , ODN 698, TA

2516/Marmistat, BB2516/Marmistat, CDP 845, D2163, PD183805, DX8951f, Lem- onal DP 2202, FK 317, Picibanil/OK-432, AD 32/Valrubicin, Metastron/strontium derivative, Temodal/Temozolomide, Evacet/liposomal doxorubicin, Yew- taxan/Placlitaxel, Taxol/Paclitaxel, Xeload/Capecitabine, Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, Oral Taxoid, SPU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-609 (754)/RAS oncogene inhibitor, BMS-182751 /oral platinum, UFT(Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/776C85/5FU enhancer, Campto/Levamisole, Camptosar/lrinotecan, Tumodex/Ralitrexed, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Cae- lyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, ZD1839, LU 79553/Bis-Naphtalimide, LU 103793/Dolastain, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, Iodine seeds, CDK4 and CDK2 inhibitors, PARP inhibitors, D4809/Dexifosamide, Ifes/Mesnex/lfosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, ZD 9331 , Taxotere/Docetaxel, prodrug of guanine arabinoside, Taxane Analog, nitrosoureas, alkylating agents such as melphelan and cyclophosphamide, Aminoglu- tethimide, Asparaginase, Busulfan, Carboplatin, Chlorambucil, Cytarabine HCI, Dactinomycin, Daunorubicin HCI, Estramustine phosphate sodium, Etoposide (VP16-213), Floxuridine, Fluorouracil (5-FU), Flutamide, Hydroxyurea (hydroxycar- bamide), Ifosfamide, Interferon Alfa-2a, Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue), Lomustine (CCNU), Mechlorethamine HCI (nitrogen mustard), Mercaptopurine, Mesna, Mitotane (o.p'-DDD), Mitoxantrone HCI, Octreotide, Plica- mycin, Procarbazine HCI, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine (m-AMSA), Azacitidine, Erthropoietin, Hexamethyl- melamine (HMM), lnterleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal bis- guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), Semustine (methyl- CCNU), Teniposide (VM-26) and Vindesine sulfate. Furthermore, the chemo- theraputic agent may be any of the chemotherapeutic agents mentioned in table 3 of US 6,482,843 columns 13 to 18.

The pharmaceutical composition according to the invention may further comprise a secondary therapeutic agent, preferably a chemotherapeutic agent described above or an angiogenesis inhibiting agent as described here below.

The inhibitor of angiogenesis may be, but are not limited to, e.g. BMS-275291 , DaI- teparin (Fragmin®), Suramin, 2-methoxyestradiol (2-ME), Thalidomide, CC-5013 (Thalidomide Analog), Combretastatin A4 Phosphate, LY317615 (Protein Kinase C Beta Inhibitor), Soy Isoflavone (Genistein; Soy Protein Isolate), AE-941 (Neovas- tat™ ; GW786034), Anti-VEGF Antibody (Bevacizumab; Avastin™), Interferon- alpha, PTK787/ZK 222584, VEGF-Trap, ZD6474, EMD 121974, Carboxyamidotria- zole (CAI), Celecoxib (Celebrex®), Halofuginone Hydrobromide (Tempostatin™), AdPEDF, Macugen, tryptophanyl-tRNA synthetase (TrpRS), rhufab V2 (aka Iu- centis), squalamine, Retaane 15 mg (anecortave acetate with depot suspension) and lnterleukin-12.

Adenocarcinoma

A carcinoma is any cancer that originates from epithelial cells which is malignant by definition as carcinomas invade surrounding tissues and organs, and may spread to lymph nodes and distal sites (metastasis).

An adeno-carcinoma is a carcinoma that stems from glandular tissue, but the cells do not necessarily need to be part of a gland, as long as they have secretory properties. This form of carcinoma can occur in higher mammals, including humans. Initially the cancer can be benign e.g. an adenoma. Carcinoma in situ (CIS) is a pre-malignant condition, in which cytological signs of malignancy are present, but there is no histological evidence of invasion through the epithelial basement membrane.

Adenocarcinoma develops in cells lining glandular types of internal organs. Adenocarcinomas may be cancers of various organs such as: breast cancer (mammary gland), stomach cancer, gastric cancer including advanced gastric adenocarcinoma and adenocarcinoma of the gastroesophageal junction, colon cancer, lung cancer such as lung adenocarcinoma including bronchioalveolar adenocarcinoma and pul- monary adenocarcinoma, liver cancer such as cholangio adenocarcinomas (bile duct cancer), non-seminomal testis carcinoma, prostate cancer, pancreatic cancer such as pancreatic ductal adenocarcinoma, kidney (renal) cancers such as renal cystic adenocarcinoma, cervical cancer which may be cervical adenocarcinoma associated with HPV Types 16 and 18 and vaginal cancers including endometrial ade- nocarcinoma. Mucinous adenocarcinoma is a particular aggressive type of carcinomas that are comprised of at least sixty percent mucus.

The COU-1 antibody display a specific staining patter in tissue from different adenocarcinomas, such as breast, ovarian, colon (colorectal), rectal and pancreatic, cholangio adenocarcinomas and non-seminomal testis carcinoma. (Ditzel et al 1999 and Ditzel et al 1993). Thus CaOU-1 epitope binding polypeptides are considered to react with an adenocarcinoma antigen expressed in a plurality of adenocarcinomas such as the adenocarcinomas described above.

Treatment

The invention in an aspect relates to the use of the CaOU-1 epitope binding polypeptide for treatment of a disease or disorder associated with the CaOU-1 epitope.

For the purpose of the present application treatment is meant to include curative treatment and non-curative treatment.

The present application in an aspect relates to a method of treatment of adenocarsi- noma comprising administering a CaOU-1 epitope binding polypeptide according to the invention to an individual in need, wherein an individual in need may be an indi- vidual suffering from an adenocarcinoma. Said individual in an embodiment suffers from an adenocardinoma selected from the group of as breast, ovarian, cervical, stomac, gastric, colon (colorectal), rectal, lung, kidney, liver and pancreatic adenocarcinomas.

Curative treatment equalize as defined below a complete response e.g. disaperence of the adenocarcinoma.

Non-curative treatment encompasses treatment which prolongs the life of a patient or ameliorates the physical condition of a patient. A non-curative treatment may in- hibit progression of the disease, prevent spread of the disease or stimulate regression of the disease, which may in turn facilitate treatment of the disease by other means such as by surgical or chemotherapeutic treatment or any other means of treatment usually applied for the specific disease. Responses obtained by noncurative treatment may be catogorised as defined below as partial response, stable disease and progressive disease.

In an embodiment the treatment is for preventing spread of the disease (partial response and/or stable disease). In a further embodiment the treatment is for inhibiting progression of the disease (partial response and/or stable disease). In a further pre- ferred embodiment the treatment is for stimulating regression of the disease (partial response).

The pharmaceutical compositions of the invention can thus also be used in combination with other anti-cancer strategies, and such combination therapies are effec- tive in inhibiting and/or eliminating tumor growth and metastasis. The methods of the present invention can advantageously be used with other treatment modalities, including, without limitation, radiation, surgery, gene therapy and chemotherapy.

When such combinations are applied the CaOU-1 epitope binding polypeptide and the second treatment may be administered/applied in any order, e.g. separate, sequential or/and simultaneously.

Treatment using a CaOU-1 epitope binding polypeptide according to the invention is in an embodiment combined with treatment using a chemotherapeutic agent as mentioned previously, thus the chemotherapeutic agent need not be linked to the CaOU-1 epitope binding polypeptide, but may be administered separately, sequentially or/and simultaneously with the CaOU-1 epitope binding polypeptide.

The CaOU-1 epitope binding polypeptide may like wise be combined with inhibitors of angiogenesis as described above.

The CaOU-1 epitope binding polypeptide may according to the invention in an embodiment combined with treatment using a angiogenesis inhibtior as mentioned previously. The angiogenesis inhibitor need not be linked to the CaOU-1 epitope bind- ing polypeptide, but may be administered separately, sequentially or/and simultaneously with the CaOU-1 epitope binding polypeptide.

Evaluation of target lesions

Response of treatment may be measured using RECIST (Response Evaluation Cri- teria in Solid Tumors) criteria describe in the original WHO Handbook for reporting results of cancer treatment (World Health Organization Offset Publication No 48; 1979) taking into account the measurement of the longest diameter of target lesions (Therasse P et al. J. Natl. Cancer Inst. 2000 Feb 2;92(3): 205-16). The response is divided in; complete response, partial response, progressive disease and stable disease. A complete response is the disappearance of all target lesions, whereas a partial response refers to at least 30 % decrease in the sum of the longest diameter of target lesions. Progressive disease represents an at least 20 % increase in the sum of the longest diameter of target lesions. Stable disease refers to situation where none of the above applies. The duration of the complete response or partial response should be measured from the time where the measurement criteria are first met until the first date that recurrent or progressive disease is documented.

Prevention

The application further relates to a method of preventing the development of aden- tocarcinomas comprising administering a CaOU-1 epitope binding polypeptide according to the invention to an individual in need. For the purpose of prevention an individual in need may be any individual in risk of acquiring an adenocarcinoma. The risk of acquiring an adenocarcinoma may be based on inherited features, e.g. a predisposition for the development of adenocarcinomas in general or a particular ade- nocarcinoma. A further risk parameter may be exposure to an environment known to increase the risk of acquiring an adenocarcinoma.

Preventive treatment may for the purpose of this application be understood as com- plete prevention or alternatively a treatment postponing the onset of the disease. Prevention may also relate to the prevention or postponing the development of a pre-malignant condition, such as carcinoma in situ (CIS) to an adenocarcinoma.

An aspect of the present invention relates to a method of preventing the develop- ment of adenocarsinomas comprising administering a CaOU-1 epitope binding polypeptide according to the invention to an individual in need e.g. an individual at risk of acquiring an adenocarcinoma. In a particular embodiment said individual suffers from at pre-malignant condition.

With parallel to the method of treatment administration of the CaOU-1 epitope binding polypeptide may be combined with any suitable second therapeutic agent (or further therapeutic agents), such as the chemotherapeutic agents and angiogenesis inhibitors mentioned previously.

In further embodiment the method of prevention is combined with the administration of a secondary therapeutic agent, such as a chemotherapeutic agent or an angiogenesis inhibitor.

Detection of the CaOU-1 epitope As described above the CaOU-1 epitope is detected in a series of adenocarsinomas, and is as such characterised as a cancer associated epitope.

The present application in an aspect relates to the use of a CaOU-1 epitope binding polypeptide according to the invention for detecting the CaOU-1 epitope in a test sample, such as for measuring the amount of the CaOU-1 epitope in a test sample.

An aspect of the invention relates to a method of detecting the CaOU-1 epitope in a test sample, the method comprising the steps of: i contacting a CaOU-1 epitope binding polypeptide according to the invention with a test sample, ii detecting bound CaOU-1 epitope binding polypeptide in the test sample.

A further aspect of the invention relates to a method of measuring the amount of CaOU-1 epitope in a given test sample, the method comprising the steps of: i contacting a CaOU-1 epitope binding polypeptide according to the invention with a test sample, ii measuring the amount of bound CaOU-1 epitope binding polypeptide in the test sample, and thereby iii obtaining information about the amount of CaOU-1 epitope in the test sam- pie.

Information obtained may also be in the form of a staining pattern significant of the presence of adenocarcinoma cells.

The invention further relates to the use of the CaOU-1 epitope binding polypeptide for diagnosing a disease or disorder associated with the CaOU-1 epitope.

An aspect of the invention relates to a method of detecting or diagnosing a disease or disorder associated with the CaOU-1 epitope in an individual comprising the steps of, i. contacting a CaOU-1 epitope binding polypeptide according to the invention with a biological sample from said individual, ii. detecting binding polypeptides bound to said biological sample, and thereby iii. detecting or diagnosing the disease or disorder.

In a preferred embodiment the method relates to the detection or diagnosing of adenocarcinomas, such as an adenocarcinoma selected from the group of: breast, colon, lung, prosteta, stomac, ovarian, renal, cervical, pancreatic and cholangio (a primary liver cancer) adeno-carcinomas and non-seminomal testis carcinoma.

In a more preferred embodiment the method relates to the detection or diagnosisng of adenocarcinomas selected from the group of: breast, colon, lung, stomac, pancreatic renal, ovarian, cervical and prosteta adenocarcinoma. The method in an embodiment relates to a method of determining the spread of an adenocarcinoma.

Evaluation of treatment The CaOU-1 epitope binding polypeptide according to the invention is in a further embodiment use for measuring killing of adenocarcinoma cells, such as for measuring the efficacy of given treatment, such as chemotherapeutic treatment of adenocarcinomas.

Treatment of adenocarcinomas expressing the CaOU-1 epitope are contemplated to result in the release if CaOU-1 epitopes due to the killing of adenocarcinoma cells.

The method of detecting the CaOU-1 epitope may be applied to a plurality of test samples derived from the same individual during a treatment period. Changes in the amount of the CaOU-1 epitopes in the test sample may be indicative for the efficacy of the treatment.

Labbeling of the CaOU-1 epitope binding polypeptide

In order to detect binding of the CaOU-1 epitope binding polypeptide said peptide is preferably labelled. The label may be any label known in the art facilitating detection of binding. Suitable labels are known by the skilled person and include radioisotype labels, fluorescent labels and enzymatic labels. In example 5 biotinolated binding polypeptides is employed.

The labels are preferably linked to the binding polypeptide by a direct covalent binding. The linkage of the labels to the binding polypeptide may be accomplished using standard techniques known to a person skilled in the art.

Detection of binding may alternatively be obtained by indirect labelling using a Ia- belled secondary antibody or equivalent binding partner capable of binding the

CaOU-1 epitope binding polypeptide, whereby the bound CaOU-1 epitope binding polypeptide is detected. Description of the Sequence listing

SEQ ID NO 1 : Variable heavy chain 2 (DNA)

SEQ ID NO 2: Variable domain heavy chain 2 (protein))

SEQ ID NO 3: Variable light chain 2 (DNA) SEQ ID NO 4 Variable domain light chain 2 (protein

SEQ ID NO 5 Variable heavy chain 2 CDR 1 (DNA)

SEQ ID NO 6 Variable heavy chain 2 CDR 1 (protein)

SEQ ID NO 7: Variable heavy chain 2 CDR 2 (DNA)

SEQ ID NO 8: Variable heavy chain 2 CDR 2 (protein) SEQ ID NO 9: Variable heavy chain 2 CDR 3 (DNA)

SEQ ID NO 10: Variable heavy chain 2 CDR 3 (protein)

SEQ ID NO 1 1 : Variable light chain 2 CDR 1 (DNA)

SEQ ID NO 12: Variable light chain 2 CDR 1 (protein)

SEQ ID NO 13: Variable light chain 2 CDR 2 (DNA) SEQ ID NO 14: Variable light chain 2 CDR 2 (protein)

SEQ ID NO 15: Variable light chain 2 CDR 3 (DNA)

SEQ ID NO 16: Variable light chain 2 CDR 3 (protein)

SEQ ID NO 17: Variable heavy chain CDR 1 Seq. ID No. 36 (protein)

SEQ ID NO 18: Variable heavy chain CDR 2 Seq. ID No. 36 (protein) SEQ ID NO 19: Variable heavy chain CDR 3 Seq. ID No. 36 (protein)

SEQ ID NO 20: Variable light chain CDR 2 Seq. ID No. 37 (protein)

SEQ ID NO 21 : Variable light chain CDR 3 Seq. ID No. 37 (protein)

SEQ ID NO 22: Variable light chain CDR 3 Seq. ID No. 38 (protein)

SEQ ID NO 23: Variable heavy chain 1 (DNA) SEQ ID NO 24: Variable domain heavy chain 1 (protein))

SEQ ID NO 25: Variable light chain 1 (DNA)

SEQ ID NO 26: Variable domain light chain 1 (protein

SEQ ID NO 27: Variable heavy chain 1 CDR 1 (DNA)

SEQ ID NO 28: Variable heavy chain 1 CDR 1 (protein) SEQ ID NO 29: Variable heavy chain 1 CDR 2 (DNA)

SEQ ID NO 30: Variable heavy chain 1 CDR 2 (protein)

SEQ ID NO 31 : Variable heavy chain 1 CDR 3 (DNA)

SEQ ID NO 32: Variable heavy chain 1 CDR 3 (protein)

SEQ ID NO 33: Variable light chain 1 CDR 1 (DNA) SEQ ID NO 34: Variable light chain 1 CDR 1 (protein) SEQ ID NO 35: Variable light chain 1 CDR 2 (DNA)

SEQ ID NO 36: Variable light chain 1 CDR 2 (protein)

SEQ ID NO 37: Variable light chain 1 CDR 3 (DNA)

SEQ ID NO 38: Variable light chain 1 CDR 3 (protein) SEQ ID NO 39: Ncol-VHNisc201s3 (DNA)

SEQ ID NO 40: Ncol-VHNisc201 s3 (protein)

SEQ ID NO 41 : Link-VHNisc201 as (DNA)

SEQ ID NO 42: Link-VHNisc201as rev.comp. (DNA)

SEQ ID NO 43: Link-VHNisc201 (protein) SEQ ID NO 44: Link-VLNisc201 s2 (DNA)

SEQ ID NO 45: Link-VLNisc201 s2 (protein)

SEQ ID NO 46: Notl-VLNisc201 as (DNA)

SEQ ID NO 47: Notl-VLNisc201 as rev. comp. (DNA)

SEQ ID NO 48: Notl-VLNisc201 as (protein) SEQ ID NO 49: Ncol-VHNisc202s (DNA)

SEQ ID NO 50: Ncol-VHNisc202s (protein)

SEQ ID NO 51 : Link-VHNisc202as (DNA)

SEQ ID NO 52: Link-VHNisc202as rev.comp. (DNA)

SEQ ID NO 53: Link-VHNisc202 (protein) SEQ ID NO 54: Link-VLNisc202s (DNA)

SEQ ID NO 55: Link-VLNisc202s (protein)

SEQ ID NO 56: Notl-VLNisc202as (DNA)

SEQ ID NO 57: Notl-VLNisc202as rev. comp. (DNA)

SEQ ID NO 58: Notl-VLNisc202as (protein) SEQ ID NO 59: CK8forward66/ID186

SEQ ID NO 60: CK8revers482/ID185

SEQ ID NO 61 : CK18forward50/ID184

SEQ ID NO 62: CK18revers429/ID183

SEQ ID NO 63: CK18forward140/ID182 SEQ ID NO 64: Kappa1-Hindlll-s

SEQ ID NO 65: Kappa2-Hindlll-s

SEQ ID NO 66: Kappa2-Xhol-as

SEQ ID NO 67: Kappa-SOE-s

SEQ ID NO 68: Kappa-SOE-as SEQ ID NO 69: VH1-Xbal-s SEQ ID NO 70: VH2-Xbal-s

SEQ ID NO 71 : Mu-Notl-as

SEQ ID NO 72: Mu-SOE-s

SEQ ID NO 73: Mu-SOE-as

Examples

Abreviation and definitions used in this section FR = framework region; FR1 , FR2 and FR3 = the three framework regions on either

VH or VL, numbered from the amino terminus

Nisc = Natlmmune Single Chain

5'RACE = rapid amplification of cDNA 5'end scFv = single-chain Fv fragment;; SMART RACE = Switching Mechanism At 5' end of RNA Transcript 5'-and 3'- Rapid

Amplification of cDNA Ends

VH = the variable region of the heavy chain of Ig

VL = the variable region of the light chain of Ig

VH1 Natlmmune = VH1 NI = the VH fragment first identified in this study VH2 Natlmmune = VH2 NI = the second VH fragment to be identified in this study

VL1 Natlmmune = VL1 NI = the VL fragment first identified in this study

VL2 Natlmmune = VL2 NI = the second VL fragment to be identified in this study

Example 1 Sequencing of new CaOU-1 epitope binding polypeptide

The DNA sequences of the variably heavy and variable light chains of the new CaOU-1 epitope binding polypeptide was obtained by SMART RACE and cloned in pCR2.1-TOPO (Invitrogen). The following sequences were obtained.

Variable domain heavy chain 1 (VH1 )

DNA seguence of VH 1 :

The sequence of the variable domain is indicated by bold letters

I TTATACANTT ATTAGGCGAA TTGGGCCCTC TANNGCATGC TCGAGCGGCC bϊ GCCAGTGTGA TGGATATCTG CAGAATTCGC CCTTCTAATA CGACTCACTA _U1 TAGGGCAAGC AGTGGTATCA ACGCAGAGTA CGCGGGGGAG CATCACCCAG

_51 CAACCACATC TGTCCTCTAG AGAATCCCCT GAGAGCTCCG TTCCTCACCA

201 TGGACTGGAC CTGGAGGATC CTCTTCTTGG TGGCAGCAGC CACAGGAGCC

251 CACTCCCAGG TGCAGCTGGT GCAATCTGGG GCTGAGGTGA AGAAGCCTGG :m GGCCTCAGTG AAGGTCTCCT GCGAGGCTTC TGGATACACC TTCACCGGCC

31-)] ACTATATGCA CTGGGTGCGA CAGGCCCCTG GACAAGGGCT TGAGTGGATG iUl GGGTGGATCA ACCCTAACAG TGGTGGCACA AACTATGCAC AGAAGTTTCA

4b 1 GGGCAGGGTC ACCATCACCA GGGACACGTC CATCAACACA GCCTACATGG

50 I AGCTGAGCAG GCTGAGATCT GACGACACGG CCGTGTATTA CTGTGCGAGA 551 GCCTCATATT GTGGTTATGA CTGCTATTAC TTCTTTGACT ACTGGGGCCA

£01 GGGAACCCTG GTCACCGTCT CCTCGGGGAG TGCATCCGCC CCAACCCTTT

€51 TCCCCCTCGT CTCCTGTGAG AATTCCCCGT CGGATACGAG CAGCGTGGCC

Oi GTTGGCTGAA GGGCGAATTC CAGCACACTG GCGGCCGTTA CTAGTGGATC

/IJI CGAGCTCGGT ACCAAGCTTG GCGTAATCAT GGTCATAGCT GTTTCCTGTG δUl TGAAATTGTT ATCCGCTCAC AATTCCACAC AACATACGAG CCGGAAGCAT

351 AAAGTGTAAA GCCTGGGGTG CCTAATGAGT GAGCTAACTC ACATTAATTG

^ OL CGTTGCGCTC ACTGCCCGCT TTCCAGTCGG GAAACCTGTC GTGCCAGCTG

351 CATTAATGAA TCGGCCNANC GCGCGGGGAG AGGCCGGTTT GCGTATTGGG

1001 CGCTNTTCCG NTTCCTNGNT NACTGACTCG CTGCNCTCGG TCGTTTCGGN 101-)] TGCGGCNAGC GNTNTCAGCT NACTNAAAAG GCGGTAATAC NGNTNTTCCN

1_U1 CANAATCAGG GGATAACCCA GGAAAAAACA TGTGANCAAA AGCCNNCCAA

1_51 AAGGCCNGGA ACCCTNAAAA GGNCCCGTTN NNTGGGGTTT TTTTCATAGG

]20l NTNCCCCCCC TGNANAANNT TNAAAAAATT GNNCNTTAAN TNNAAGNGGG

1251 GNAANCCCCN NGGNTTNAAA AAANCNGGNN TTNCCCNGGA AACC

Amino acid sequence of the variable domain VH1 :

The CDR sequences are indicated by underlining

1 QVQLVQSGAE VKKPGASVKV SCEASGYTFT GHYMHWVRQA PGQGLEWMGW

51 INPNSGGTNY AQKFQGRVTI TRDTSINTAY MELSRLRSDD TAVYYCARAS

101 YCGYDCYYFF DYWGQGTLVT VSS Variable domain heavy chain 2 (VH2)

DNA sequence VH2: The sequence of the variable domain is indicated by bold letters

1 TNNANACCAT ACTATAGGGC GAATTGGGCC CTCTAGATGC ATGCTCGAGC

51 GGCCGCCAGT GTGATGGATA TCTGCAGAAT TCGCCCTTCT AATACGACTC

IUl ACTATAGGGC AAGCAGTGGT ATCAACGCAG AGTACGCGGG GGGGAGACGA IM GCCCAGCACT GGAAGTCGCC GGTGTTTCCA TTCGGTGATC AGCACTGAAC

201 ACAGAGGACT CACCATGGAG TTTGGGCTGA GCTGGGTTTT CCTCGTTGCT

2K1 CTTTTAAGAG GTGTCCAGTG TCAGGTGCAG CTGGTGGAAT CTGGGGGAGG

3Ul CGTGGTCCAG CCTGGGAGGT CCCTGAGACT CTCCTGTGCA GCCTCTGGAT

351 TCACCTTCAG TAACTATGCT TTGCACTGGG TCCGCCAGGC TCCAGGCAAG 4Ul GGGCTGGAGT GGGTGGCACT TATATCATAT GATGGAAGTA ATAAATACTA

451 CGCAGACTCC GTGAAGGGCC GATTCACCAT CTCCAGAGAC AATTCCAAGA

5-01 ACACGCTGTT TCTGCAAATG AATAGCCTGA GAGCTGAGGA CACGGCTGTG

551 TATTACTGTG CGAGAGATAA AGGCTATAGT GGGAGCTACA ACTACTTTGA

601 CTACTGGGGC CAGGGAACCC TGGTCACCGT CTCCTCAGGG AGTGCATCCG 651 CCCCAACCCT TTTCCCCCTC GTCTCCTGTG AGAATTCCCC GTCGGATACG

/Ul AGCAGCGTGG CCGTTGGCTG CCTCGCACAG GACTTCCTTC CCGACTCCAT

751 CACTTTCTCC TGGAAATACA AGAACAACTC TGACATCAGC AGCACCCGGG

301 GCTTCCCATC AGTCCTGAGA GGGGGCAAGT ACGCAGCCAC CTCACAGGTG

851 CTGCTGCCTT CCAAGGACGT CATGCAGGGC ACGGACGAAC ACGTGGTGTG 301 CAAAGTCCCA GCAACCCCCA ACGGCAACAA AGAAAAGAAC GTGCCTCTTC

951 CAAAGGGCGA ATTTCCAGCA CACTGGCGGC CCGTTACTAG TGGATCCNAN

1001 GCNCGGTACC CAAGCTTGGC GTAAATCATG GGTCATAGCT TGTTTCCTNN

1051 NGTGAAATTG TTATCCNGCT CNCATTTCCC CCANAAANAN AACGAGCCGN

1101 AAGCCTNAAG NGNAAANCCC TGGGGGTGCC TTATGAGTGA NCCTAACTTC 1151 CATTTATTGG CTTTGNCCTT CNCTGNCCCG CTTTTCCANT NCGGAAAACC

1201 TGTCGGGCCN NTTTGCTTTA TGAAATCGCC CAACCCCCGG GGAAANGCGG

1251 NTTGNNTNNT NGGGGCTTTT TCCNTTTTCN NNTTAAATGA AATNNNTGGC

1301 CTCTGGGTG Amino acid sequence of the variable domain (VH2) : The CDR sequences are indicated by underlining

I QVQLVESGGG WQPGRSLRL SCAASGFTFS NYALHWVRQA PGKGLEWVAL ) 51 ISYDGSNKYY ADSVKGRFTI SRDNSKNTLF LQMNSLRAED TAVYYCARDK

^ni GYSGSYNYFD YWGQGTLVTV SS

Variable domain light chain 1 (VL1 )

DNA sequence:

The sequence of the variable domain is indicated by bold letters

1 ATAAACANTA NTTAGGGCGA ATTGGGCCCT CTANAGCATG CTCGAGCGGC M CGCCAGTGTG ATGGATATCT GCAGAATTCG CCCTTCTAAT ACGACTCACT

_U1 ATAGGGCAAG CAGTGGTATC AACGCAGAGT ACGCGGGGGA GCTACAACAG

_51 GCAGGCAGGG GCAGCAAGAT GGTGTTGCAG ACCCAGGTCT TCATTTCTCT

201 GTTGCTCTGG ATCTCTGGTG CCTACGGGGA CATCGTGATG ACCCAGTCTC

251 CAGACTCCCT GGCTGTGTCT CTGGGCGAGA GGGCCACCAT CAACTGCAAG :ni TCCAGCCAGA GTCTTTTATA CAGCTCCAAC AATAAGAACT ACTTAGCTTG

31-)] GTACCAGCAG AAACCAGGAC AGCCTCCTAA GTTGCTCATT TACTGGGCAT iUl CTACCCGGGA ATCCGGGGTC CCTGACCGAT TCAGTGGCAG CGGGTCTGGG

-±51 ACAGATTTCA CTCTCACCAT CAGCAGCCTG CAGGCTGAAG ATGTGGCAGT

501 TTATTACTGT CAGCAATATT ATAGTACTCC TCCGATGTTC GGCCAAGGGA 551 CCAAGGTGGA \\V\V ^ ACTGTGGCTG CACCATCTGT CAAGGGCGAA eni TTCCAGCACA CTGGCGGCCG TTACTAGTGG ATCCGAGCTC GGTACCAAGC

€51 TTGGCGTAAT CATGGTCATA GCTGTTTCCT GTGTGAAATT GTTATCCGCT

<m CACAATTCCA CACAACATAC GAGCCGGAAG CATAAAGTGT AAAGCCTGGG

-Sl GTGCCTAATG AGTGAGCTAA CTCACATTAA TTGCGTTGCG CTCACTGCCC 6Ul GCTTTCCAGT CGGGAAACCT GTCGTGCCAG CTGCATTAAT GAATCGGCCA

351 ACGCGCGGGG AGAGGCGGGT TTGCGTATTG GGCGCTCTTT CCGCTTCCTC

^ OL GCTCACTGAC TCGNTGCGCT CGGTCGTTCG GCTGCGGCGA GCGGTATCAG

1JbI CTCACTCAAA AGGCGGTAAT ACNGTTATCC NCAGAATCAG GGGATAACCC lOni NAGGAAAAAA CATGTGAGCA AAAGGCCAGC NAAAANGGCC ANGNAACCGT 10^1 AAAAANGNCC GGGTTGCTGG CGTTTTTTCC ATAAGGCCTC CNCCCCCCTG

1-Ul ACGGGCATCN NAAAAATCGA CNCTTAANTN ANAAGGNNGN GAAAACCCCG

1_51 CCAGGNACTT TAAAAAANCN AGGNGTTTTC CCCCTGNAAA NCTCCCTCTG

1'ϋl NGNCCTTTCT TGTTNCCACC CTGNCCCTNA CCGGAANCNG GNCCCCCTTT 12IJI TTCCTTNGGG NANNGGGGGC TTTTTTNAAN CTNACCCNGG GNNTTTCAAN 13Ul TCGGGGNNGG NGTTCCNCAA NGGGGNTNGG NCCAAANCCC CTTNAACCCC ]^M NCCGGGCTTT TNNGNAAATT TTTTGN

Amino acid sequence of the variable domain VL1 :

] GDIVMTQSPD SLAVSLGERA TINCKSSQSL LYSSNNKNYL AWYQQKPGQP 51 PKLLIYWAST RESGVPDRFS GSGSGTDFTL TISSLQAEDV AVYYCQQYYS _ n i TPPMFGQGTK VE IKR

Variable domain light chain 2 (VL2)

The sequence of the variable domain is indicated by bold letters

DNA sequence:

] GNNATCGACT ACTATAGGGC GAATTGGGCC CTCTAGATGC ATGCTCGAGC

IJI CGGCCGCCAG TGTGATGGAT ATCTGCAGAA TTCGCCCTTA AGCAGTGGTA

_U1 TCAACGCAGA GTACGCGGGG AGAGGGAACC ATGGAAACCC CAGCGCAGCT IbI TCTCTTCCTC CTGCTACTCT GGCTCCCAGA TACCACCGGA GAAATTGTGT

201 TGACGCAGTC TCCAGGCACC CTGTCTTTGT CTCCAGGGGA AAGAGCCACC

?^1 CTCTCCTGCA GGGCCAGTCA GAGTGTTAGC AGCAGCTACT TAGCCTGGTA

301 CCAGCAGAAA CCTGGCCAGG CTCCCAGGCT CCTCATCTAT GGTGCATCCA

3 IJI GCAGGGCCAC TGGCATCCCA GACAGGTTCA GTGGCAGTGG GTCTGGGACA -iUl GACTTCACTC TCACCATCAG CAGACTGGAG CCTGAAGATT TTGCAATGTA

-5 I TTACTGTCAG CAGTATGGTA GCTCACCGTA CACTTTTGGC CAGGGGACCA

501 AGCTGGAGAT CAAACGAACT GTGGCTGCAC CATCTGTCTT CATCTTCCCG

551 CCATCTGATG AGCAGTTGAA ATCTGGAACT GCCTCTGTTG TGTGCCTGCT eni GAATAACTTC TATCCCAGAG AGGCCAAAGT ACAGTGGAAG GTGGATAACG ^I CCCTCCAATC GGGTAACTCC CAGGAGAGTG TCACAGAGCA GGACAGCAAG

/Ul GACAGCACCT ACAGCCTCAG CAGCACCCTG ACGCTGAGCA AAGCAGACTA

751 CGAGAAACAC AAAGTCTACG CCTGCGAAGT CACCCATCAG GGCCTGAGCT

3Ul CGCCCGTCAC AAAGAGCTTC AACAGGGGAG AGTGTAAGGG CGAATTCCAG

351 CACACTGGCG GCCGTTACTA GTGGATCCGA GCTCGGTACC AAGCTTGGCG GOl TAATCATGGT CATAGCTGTT TCCTGTGTGA AATTGTTATC CGCTCACANT

9 M TCCACACAAC ATACGAGCCC GGAAGCATAA AAGTGTAAAA GCCTGGGGTN IOUI GCCTAATGAG TGAGCTAACC TCANNTTAAT TTGCGTTNGC GCTCACTGNC

1051 CCGCTTTTCC ATTTCNGGAA AACCTGTNGT GCCCANCTGC ATTTAATGAA

] 101 TCCGGCCNAA CGCNCCGGGG GAGAAGGCCG GTTTTGTNTT NTTGGGCNCT libI TTTTCCNCTT TCNTTNGTTA ATNGATTCGT TGGCCTTTCG GNNNTCCGCT

1201 TNNGGGNGAG GGGTTTNANN TTACTTCAAA GGNGGTAATN CGGGTTNCCC

I2b1 NNAANNCGGG GGTNAACCNG GGAAAAANTT TGTTACNAAG GCCCCCNAAG

1301 GCCGGAACCN TAAAAGGCCG GNTNTGGGGN TTTTTCAAGG NNCCCCCCCC

1351 GNGAAGANTT TAAAANTCCC CTTNTTTNNG GGGNTAACTC CCGGNTTTTA

1401 NTNTCC

Amino acid seαuence of the variable domain (VL2):

1 EIVLTQSPGT LSLSPGERAT LSCRASQSVS SSYLAWYQQK PGQAPRLLIY bi GASSRATGIP DRFSGSGSGT DFTLTISRLE PEDFAMYYCQ QYGSSPYTFG

101 QGTKLE IKR

Conclusion

The variable heavy chain 1 (VH 1 ) and the variable light chain 1 (VL1 ) are presumed to originate from the fusion partner cell line, whereas VH2 and VL2 are the sequence of the new CaOU-1 epitope binding polypeptide. An alignment of the CDR 1-3 from VH2 and VL2 with the sequences know from WO 03 057168 are shown here below.

Figure imgf000064_0001
Table 1. Alignment of CDR's 1-3 from the variable heavy and light chain from the COU 1 -epitope binding antibodies described in the present application with the CDR's 1-3 from the variable heavy and light chain from the COU-1 antibody described in WO 03 057168. The sequence ID No's refers to the numbers used in WO 03 057168. The shaded areas of VL2 CDR3 indicates amino acid residues and AA deletions which are different from the amino acid residues in the Sequence of Seq. ID No. 38 of WO 03 057168 (here SEQ ID NO 22).

Example 2

Generation of new CaOU-1 epitope binding single-chain Fv fragment (scFv)

The cloned VH and VL fragments are assembled as scFv's, which are VH-VL fusion proteins combined by a short linker that ensures great flexibility between the variable fragments. To facilitate E. coli expression the scFv's are inserted into pHOG21 (Stacy, JE. 2003). This vector includes an upstream pelB signal sequence that mediates periplasmic secretion and a downstream Myc-His tag, which may assist in scFv protein purification.

In order to add the desired restriction enzyme sites to be used for cloning into pHOG21, each VL or VH fragment are PCR amplified by primers including either VH or VL and pHOG21 vector sequences and the respective restriction enzyme sites. An important issue of the primer design is to ascertain that the VH and VL encoding triplets are in frame with the pH0G21 vector triplets specifying the pelB signal se- quence, the linker sequence and the Myc-His tag sequence. The primers are specified below:

Λ/col-VHNisc201s3:

L A A Q P A M A Q V Q L V Q S (a.a.) δ'-TβCTGβCAGCTCAβCCGOOiCATGOOCCAGβTβCAGCTβGTGCMTCT-S', pHOG21 pelB Nco\ site VH1 Natlmmune FR1

Tm=57.5°C (ID 211; DNA Technology Oligo no : 475045)

(contains 3'-terminal CDS of pHOG21 pelB signal sequence including Λ/col + 5'- terminal CDS of FR1 in VH1 Natlmmune) Link-VHNisc201as:

5'-TGGGGCGGATGCACTCCCTGAAAGCTTCGAGGAGACGGTGACCAGGGT-S'

Tm=59.8°C (ID 204; DNA Technology Oligo no: 473359)

Reverse Complementary to: T L V T V S S K L S G S A S (a.a.) δ'-ACCCTβGTCACCGTCTCCTCGA/AβCTTTOAGGGAβTGCATCOGCCCCA-S'

VH1 Natlmmune FR4 H/ndlll site pHOG-21 linker

(contains reverse complement of: 3'-terminal CDS of FR4 in VH 1 Natlmmune +

5'terminal CDS of pHOG21 linker sequence including H/ndlM)

Link-VLNisc201s2:

E F S E A R V D I V M T Q S (a.a.) δ'-GAAGGTGAATTTTCAGAAGGA/CGCGTAGACATGGTGATGACCCAGTCT-S' pHOG21 linker Mlu\ site VL1 Natlmmune FR1 Tm=51.0°C(ID212; DNA Technology Oligo no: 475046)

(contains 3'-terminal CDS of the pHOG21 linker including Mlu\ + 5'-terminal CDS of

FR 1 in VL1 Natlmmune)

Λ/ofl-VLNisc201as: δ'GCTTTTGTTCGGATCCAGCGGCCGCACCTCGTTTGATTTCCACCTTGGT-S'

Tm = 53.50C (ID 206; DNA Technology Oligo no: 473361 )

Reverse Complementary to:

T K V E I K R G A A A G S E (a.a.)

5'-ACCAAGGTGGAAATCAAACGAGGTGCZGGCCGCTGGATCCGAACAAAAGC 3'

VL1 Natlmmune FR4 Not\ site pHOG21 Myc-His tag

(contains reverse complement of 3'-terminal CDS of FR4 in VL1 Natlmmune + 5'- terminal CDS of pHOG21 Myc-His tag including Not\)

Λ/col-VHNisc202s

L A A Q P A M A Q V Q L V E S (a.a.) β^TGCTGGCAGCTCAGCCGGC/CATGGCCCAGGTGCAGCTGGTGGAATCT-3 pHOG21 pelB Nco\ site VH2 Natlmmune FR1

Tm = 56.5°C (ID 207; DNA Technology Oligo no: 475040) (contains 3'-terminal CDS of pHOG21 pelB signal sequence including Λ/col + 5'- terminal CDS of FR1 in VH2 Natlmmune)

link-VHNisc202as 5'-TGGGGCGGATGCACTCCCTGAAAGCTTTGAGGAGACGGTGACCAGGGT-S'

Tm = 58.00C (ID 208; DNA Technology Oligo no: 475042) Reverse Complementary to:

T L V T V S S K L S G S A S (a.a.) ACCCTGGTCACCGTCTCCTCA A/AGCTTTCAGGGAGTGCATCCGCCCCA VH2 Natlmmune FR4 H/ndlll site pHOG21 linker

(contains reverse complement of: 3'-terminal CDS of FR4 in VH1 Natlmmune + 5'terminal CDS of pHOG21 linker sequence including H/ndlM)

link-VLNisc202s E F S E A R V E I V L T Q S (a.a.) δ'-GAAGGTOAATTTTCAGAAOCA/CGCOTAGAAATTGTGTTGACGCAGTCTCC-S pHOG21 linker Mlu\ site VL2 Natlmmune FR1

Tm= 55.2°C (ID 209; DNA Technology Oligo no: 475044) (contains 3'-terminal CDS of the pHOG21 linker including Mlu\ + 5'-terminal CDS of FR1 in VL2 Natlmmune)

Notl-VLNisc202as

5'-GCTTTTGTTCGGATCCAGCGGCCGCACCTCGTTTGATCTCCAGCTTGGT-S' Tm= 53.8°C (ID 210; DNA Technology Oligo no: 475043)

Reverse Complementary to:

T K L E I K R G A A A G S E

5'-ACCAAGCTGGAGATCAAACGAGGTGCZGGCCGCTGGATCCGAACAAAAGC-S

VL2 Natlmmune FR4 Notl site pHOG21 Myc-His tag (contains reverse complement of 3'-terminal CDS of FR4 in VL2 Natlmmune + 5'- terminal CDS of pHOG21 Myc-His tag including Notl) PCR amplification of cloned W and VL 1 +2 fragments

VH1 Natlmmune in pCR2.1-TOPO is amplified by the primer set: Λ/col-VHNisc201s3 + Link-VHNisc201as.

VL1 Natlmmune in pCR2.1-TOPO is amplified by the primer set: Link-VLNisc201s2 + Λ/ofl-VLNisc201as.

VH2 Natlmmune in pCR2.1-TOPO is amplified by the primer set: Λ/col-VHNisc202s + Link-VHNisc202as.

VL2 Natlmmune in pCR2.1-TOPO is amplified by the primer set: Link-VLNisc202s + Λ/ofl-VLNisc202as.

The PCR amplification is accomplished with the four different primer pairs. In each PCR reaction is included:

25.0 μL PfuUltra™ Hotstart PCR Master Mix from Stratagene

22.0 ul H2O

1.0 μL Primer 1 (20 pmol/mL)

1.0 μL Primer 2 (20 pmol/mL)

1.0 uL template plasmid DNA (50 ng/μL)

50 μL in total

The PCR reaction was run on the BioRAD i-cycler Profile:

Figure imgf000068_0001

After amplification the fragments are identified by 1 % Agarose gel electrophoresis Cloning W and VL Fragments into pHOG21

Following amplification the VH and VL fragments are cleaved by the restriction enzymes sites specified in the primers above and ligated into the pHOG21 vector.

Initially the VH1 and VH2 are inserted in the vector that had been cleaved by Λ/col and H/ndlll to eliminate the internal fragment. The cleaved vectors and internal fragments are identified by agarose gel electrophoresis, and the vector is cut out and purified by QIAquick gel extraction Kit (Qiagen). Before ligation the concentration of both vector and insert is estimated on a Bioanalyzer chip (DNA 7500 kit + DNA chip used on Agilent 2100 Bioanalyzer). The ligation is done by FASTLink ligation kit (Epicentre) in accordance to the manufacturer's protocol.

The ligated plasmids were transformed by heat chock into E. coli {DH5a from Invi- trogen). DNA from selected E. coli colonies was extracted by minipreparation and clones including VH fragments were identified by Ncol and H/ndlll cleavage.

The procedure was repeated for insertion of VL1 and VL2 into Mlu\ and Not\ sites of pHOG21 except that the plasmids were finally analyzed by sequencing at Lark Technologies.

Plasmids

The plasmids listed below was prepared in the E. coli strain "SURE" (Stratagene) to overcome problems with mutations and DNA instability observed in other strains.

pME1079-pHOG21-Nisc203 (pHOG-VH1VL1)

pME1079-pHOG21-Nisc204 {pHOG-VH2VL2)

pME1079-pHOG21-Nisc205 (pHOG-VH1VL2)

pME1079-pHOG21-Nisc206 (pHOG-VH2VL1) Example 3

Expression of new CaOU-1 epitope binding single-chain Fv fragment (scFv)

Nisc204 (VH2 and VL2) is supposed to react specifically with the CaOU-1 epitope, whereas Nisc203 (VH1 and VL1 ) should not exhibit any specific reactivity against this epitope.

Materials and methods The recombinant scFv's were expressed from the pHOG21 vector including the IPTG inducible lac-promoter and an N-terminal signal sequence PeIB that directs the proteins to the E. coli periplasma.

The scFv's were expressed in the E. coli strain "HB2151" (Amersham) and the proteins were isolated from the culture media and extracted as soluble proteins the pe- riplasmic fraction by a mild osmotic shock. Different expression conditions were attempted in order to optimize the expression and secretion level. In addition the expression level was analyzed in the E. coli strain "SURE' (Stratagene) that had been used for the scFv cloning and another E. coli strain " Rosetta-gami 2" (Novagen), which is recommended for expression of human genes. The expressed scFv was analyzed by coomassie blue staining of SDS-PAGE gels and western blotting using an Anti-myc antibody that detects a C-terminal Myc tag of the scFv's.

Transformation

ΗB2151" strain The ME1079pHOG21-Nisc203 and 204, were cloned successfully in the E. coli strain "SURE' and transformed into "HB2151" using TransformAid™ Bacterial Transformation Kit (fermentas) in accordance to the protocol described by the manufacturer

After propagation of selective clones, plasmid DNA was purified and the scFv encoding cDNA sequences were verified by restriction enzyme analysis and DNA sequencing. "Rosetta-gami 2" strain

ME1079pHOG21-Nisc203, 204, 205 and 206 were transformed by Heat-shock into competent "Rosetta-gami 2" in accordance to the protocol from the manufacturer.

Single clones were propagated in LB-medium including selective agents. After propagation the plasmid DNA was purified and the scFv encoding cDNA sequences were verified by restriction enzyme analysis.

Culturinq and induction

ΗB2151" strain

Transformed "HB2151" cells were inoculated in YT-CG medium (including 2 % glucose and the selective agent carbenicillin) and propagated at 30°C and 200 RPM overnight. The propagated cells were transferred to 10 X volume YT-CG medium the following day and incubated 1 hour at 30°C at 200 RPM. The culture was centri- fuged at 1500 x g for 20 minutes at room temperature and the pellet was resus- pended in a corresponding volume of YT-CI medium to induce protein expression (including IPTG and carbenicillin, but no glucose). The culture was then further propagated at different IPTG concentrations: 0 mM IPTG, 1 mM IPTG, 10 mM IPTG; incubation temperatures: 16°C, 22°C, 30°C and 37°C and incubation time spans between 24 and 43 hours in order to optimize the scFv expression and secretion level.

In optimization experiments 6 ml "HB2151" cultures was propagated. Induction was initiated at OD600 = 0.8. 1 ml samples was used for preparation and analysis of periplasma, cell culture and whole cell lysates For large scale cultures 250 ml. culture was induced, the periplasma was extracted from the cell pellet and the periplasma fraction and the culture supernatant were analyzed.

Culturing and propagation of the cells was also attempted in LB-media, but as the ΗB2151" E. coli grow faster and more consistent in the YT-CG media, this media was preferred. "SURE" strain

The expression level of the CaOU-1 epitope binding scFv's ME1079pHOG21- Nisc203 and 204 was also analyzed in the "SURE' cells that had been used for cloning. The cells were propagated and induced in the same media as "HB2151". The inducing IPTG concentration was varied between 0, 1 and 10 mM, the temperature between 30 and 37°C and the induction time was 20 hours. Whole cell lysates were made from all the samples and analyzed by coomassie blue staining of SDS- PAGE gels.

"Rosetta-gami 2" strain

CaOU-1 eptiope binding scFv expression was only attempted in the YT media found to be optimal to "HB2151" and at one induction set-up: 30°C; 24 hours and 1 mM IPTG. Periplasma and cell culture samples were analyzed by western blotting.

Periplasma extraction and whole cell extract

Periplasmic extracts were prepared from pelleted E. coli resuspended in ice-cold 1X TES buffer (0.2 M Tris-HCI, pH 8.0, 0.5 mM EDTA, 0.5 M sucrose) - 10 mL for large scale cultures and 40 μl_ for small scale. The periplasmic proteins were released by a mild osmotic shock induced by adding 10 mL/60 μl_ 1/5X TES buffer to the suspension, which was vortexed and incubated on ice for 30 minutes. The insoluble E. coli fraction was pelleted by centrifugation at 7000xg for 20 minutes and the supernatant containing the soluble E. coli proteins was saved for analysis or storage at -20°C.

Whole cell extract was prepared by resuspending the E. coli pellet in 0.5 mL PBS and boiling for 5 min. The cell debris was pelleted and the supernatant containing the soluble scFv's were transferred to a clean tube for analysis or storage at -20°C.

SDA-Paqe, coomassie blue staining and western blotting 10-25 μl protein samples (periplasmic extract, cell supernatant or whole cell lysates) were mixed with 4X NuPage LDS Sample Buffer (Invitrogen) and DTT, vortexed and heated for 10 minutes at 80°C. The whole cell lysates were pulled several times through a needle in order to shear the sticky DNA in the samples. Periplasmic extract from non-transformed "HB2151" was used as a negative control. The samples were centrifuged briefly and chilled on ice before loading on a 4-12 % Bis-Tris

(1 mm) gel (Invitrogen). After electrophoresis at 200 V for 35 minutes, the gel was stained with coomassie blue or used for western blotting. The coomassie blue staining was accomplished with Page Blue Staining Solution (Fermentas) and decolouring in milli-Q H2O as described by the manufacturer. For western blotting the proteins were transferred for 1 hour at 30V to a PVDF membrane in NuPage Transfer buffer + Ethanol. The membrane was blocked in blocking buffer (0.1 % Tween in TBS) for 1 hour at room temperature, washed, incubated with antibodies (HRP- labelled Anti-Myc Antibodies (Invitrogen) diluted 5000X in blocking buffer), washed and developed by West Pico Working Solution (Pierce).

"HB2151" strain

In all samples including periplasmic extracts from ME1079pHOG21 -Nisc203 and 204 transformed cells; a protein of the expected scFv molecular weight -35 kDa was detected by the anti-Myc western blotting. In several of those samples including the most protein, an additional protein of about 20 kDa was observed. This protein product most likely represents a scFv degradation product observed in the cells displaying the highest expression levels. No protein bands were observed in the negative control including periplasmic extract from non-transformed "HB2151" cells. Comparable amount seems to be present in several samples from both plasmid constructs - ME1079pHOG21-Nisc203 and 204 (Figure 3).

Neither the temperature nor the time span for induction seems to have great impact on the product yield. On the other hand the IPTG concentration seems to influence the product yield. Surprisingly, presence of IPTG seems to decrease rather than increase the product yield, which is contrary to what was expected, since the scFv cDNA expression is controlled by the lac-promoter. The reason for this is most likely leakiness of the lac-operon. The fact that the protein expression is not increased after IPTG induction, but rather reduced, might be explained by some kind of ex- pression "close down" provoked by the E. coli. The "close down" could speculatively be explained by the protein production being unfavorable to the cells for example because of toxicity. This phenomenon has previously been described for human derived scFv's produced in E. coli and it correlates with the fact that the scFv's were impossible to clone in conventional cloning E. coli due to mutations and DNA instability. Possibly, the IPTG induced cells close down the protein production or loose their plasmids in the beginning of the induction process. The un-induced cells on the other hand display a lower expression level, but continuously export the scFv's to the periplasma. If they do this during the entire induction period, this might explain the higher product concentration in the samples from these cells.

"SURE" strain

The CaOU-1 epitope binding scFv expression level in "SURE" at variable induction conditions was estimated by Coomassie staining of SDS-PAGE gel of whole cell lysates, in case these cells did not secrete the scFv's to the periplasma as effective as "HB2151". However, no protein band of the expected Mw could be observed in any of the preparations, therefore the expression level in the "SURE" cells seems to be lower, than in "HB2151".

"Rosetta-Gami 2" strain

The expression level of CaOU-1 epitope binding scFv in "Rosetta garni 2" was esti- mated by western blotting on cell culture media and periplasma fractions from one induction set up (24 hours at 30 °C, 1 mM IPTG). The protein quantity seemed to be equivalent to the "HB2151" expression level observed at the corresponding induction parameters (data not shown).

Large scale scFV expression

Based on the experiments described above the larges scale expression was performed in "HB2151".

Figure 3 shows a Western blot of periplasma and supernatant samples from large scale pME1079-pHOG21-Nisc203 and Nisc204 transformed "HB2151"E. coli cultures. The detecting antibody is anti-myc.

In both pME1079-pHOG21 -Nisc203 and Nisc204 periplasmic extract samples and culture supernatant samples, ~35 kDa proteins comparable to the products de- scribed above could be detected by the anti-Myc western blotting. No smaller protein products were observed. It was estimated that slightly more protein was expressed from the pME1079-pHOG21-Nisc203 construct than from the pME1079- pHOG21-Nisc204.

The expressed quantity of Nisc203 and Nisc204 in the periplasma samples is about 0.2 μg and 0.15 μg respectively (0.2 μg and 0.08 μg in the culture supernatant sam- pies). As 10 μL sample is added per lane and the volume of culture supernatant and the periplasma extract is about 500 ml. and 45 ml. in that order the total amount of scFv's expressed can be calculated as:

Nisc203 Periplasma extract:

0.2 μg/10 μL x 45.000 μl ~ 1 mg

Nisc203 culture supernatant:

0.2 μg/10 μL x 500.000 μl « 10 mg

Nisc203 In total * 11 mg

Nisc204 Periplasma extract:

0.15 μg/10 μL x 45.000 μl « 0.7 mg

Nisc204 culture supernatant:

0.08 μg/10 μL x 500.000 μl « 4 mg Nisc204 In total = 5 mg

Conclusion

The two scFv's Nisc203 and 204 encoding VH1-VL1 and VH2-VL2 respectively were expressed by "HB2151" E. coli. Surprisingly, the scFv expression levels were not increased by IPTG induction as supposed, as the highest expression level was observed in the cultures without IPTG addition. However, at this condition, both proteins were expressed in an abundant quantity for following purification and analysis. The expression level seemed to be lower or equivalent in "SURE" and "Rosetta garni 2".

Example 4

Cloning of the recombinant human IgM binding the CaOU-1 eptiope

The two variants of the CaOU-1 binding polypeptides are cloned into mammalian expression vectors by two parallel set ups:

A) Cloning of native cDNA's in two different constitutive (CMV) mammalian expres- sion vectors containing two different selective markers (Neomycin and hygromycin) to be used for co-transfection and/or sequential transfection B) Cloning of synthetic cDNA's optimized for expression in CHO cells in a bicistronic constitutive (CMV promoter) mammalian expression vector plRES

For both set ups a series of primers are required to enable the appropriate fursions. Such primers are designed by methods known in the art such as employed in Example 5.

A)

PCR SOEing (Horton et al., 1990) is used to fuse COU-1 variable fragment (VL1 , VL2, VH1 and VH2) together with the human constant cDNA fragments (human kappa light and IgM Mu heavy constant regions). 5'-terminal kozak sequences are inserted in the full length COU-1 kappa light and mu heavy fragments.

Primers are designed for PCR SOEing insetion of kozak sequences and to incorpo- rate suitable restriction sites for cloning into the mammalian expression vectors pcDNA3.1-Hyg(+) and pcDNA3.1-Neo(-) (Invitrogen).

The method comprises the following steps.

1. PCR SOE-ing and amplification the variable and constant fragments:

VL1 + kappa light constant = Kappal

VL2 + kappa light constant = Kappa2

VH 1 + heavy mu constant = Mu 1

VH2 + heavy mu constant = Mu2 2. Identification of PCR amplicons by agarose gel electrophoresis and ethidium bromide staining

3. Purification of PCR amplicons from agarose gel

4. Restriction enzyme (Hindlll+Xho I) digestions of purified PCR amplicons Kappal and 2 5. Restriction enzyme (Hindlll+Xho I) digestion of multiple cloning site (MCS) in pcDNA3.1-Neo(-)

6. Agarose gel electrophoresis and purification of digested vector

7. Ligation of digested plRES:

Kappal + pcDNA3.1-Neo(-) = pcDNA3.1-Neo(-) /Kappal Kappa2 + pcDNA3.1-Neo(-) = pcDNA3.1-Neo(-)/Kappa2 8. E. coli transformation and spreading on selective LB-agar plates

9. Propagation in selective LB-media

10. Verification of cloned vectors by restriction enzyme analysis and sequencing of inserted cDNA's 1 1. Restriction enzyme (Xbal+Notl)) digestions of purified PCR amplicons Mu 1 and 2

12. Restriction enzyme (Xbal+Notl) digestion of multiple cloning site (MCS) in pcDNA3.1-Hyg(+)

13. Agarose gel electrophoresis and purification of digested vectors 14. Ligation of digested pIRES/Kappal and plRES/Kappa2:

Mu1 + pcDNA3.1-Hyg(+) = pcDNA3.1-Hyg(+)/Mu1 Mu2 + pcDNA3.1-Hyg(+) = pcDNA3.1-Hyg(+)/Mu2

15. E. coli transformation and spreading on selective LB-agar plates

16. Propagation in selective LB-media 17. Verification of cloned vectors by restriction enzyme analysis and sequencing of inserted cDNA's

18. Maxipreparation of pcDNA3.1-Neo(-) /Kappa 1 , pcDNA3.1-Neo(-)/Kappa2, pcDNA3.1-Hyg(+)/Mu1 and pcDNA3.1-Hyg(+)/Mu2

19. CHO DG44 (Invitrogen) cell transfection by Free Style MAX Reagent (Invitro- gen)either as a co transfection or making a stabile pool of: pcDNA3.1-Neo(-) /Kappa1/2 transfected cells and retransfecting with pcDNA3.1-Neo(-)/Kappa1/2 : pcDNA3.1-Neo(-) /Kappa1 + pcDNA3.1-Hyg(+)/Mu1 and pcDNA3.1-Neo(-)/Kappa2 + pcDNA3.1-Hyg(+)/Mu2 20. Propagation of stabile pool in Geneticin

21. Subcloning of stable pool to monoclones in microtitreplates

Kappal and 2 to be inserted into pcDNA3.1-Hyg(+) are obtained using: Kappa1-Hindlll-s: 5'-CATTATATAZAGCTTGCCACCATGGTGTTGCAGACCCAGG-S' Kappa2-Hindlll-s: 5'-CATTATATAZAGCTTGCCACCATGGAAACCCCAGCGCAGC-S'

Kappa2-Xhol-as: 5'-GCAAGCTCGC/ICGAGTTAACACTCTCCCCTGTTGAAGC-3' Kappa-SOE-s: δ'-CGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCG-S' Kappa-SOE-as: δ'-CGGGAAGATGAAGACAGATGGTGCAGCCACAGTTCG-S' MuI and Il to be inserted into pcDNA3.1-Neo(-)are obtained using: VH 1 -Xbal-s: 5'-GAATCTATiCJAGAGCCACCATGGACTGGACCTGGAGG-S' VH2-Xbal-s: 5'-GAATCTAT/CTAGAGCCACCATGGAGTTTGGGCTGAGC-3' Mu-Notl-as: 5'-ATGAATATGAAGC/GGCCGCTCAGTAGCAGGTGCCAGC-3' Mu-SOE-s: 5'-CTGTGAGAATTCCCCGTCGGATACGAGCAGC-S'

Mu-SOE-as: 5'-GCTGCTCGTATCCGACGGGGAATTCTCACAG-S'

Restriction sites are: Hindlll/Xhol/Xbal/Notl

B)

The DNA sequence used for recobinant expresion may be optimized including one or more of codon-optimization Kozak sequence optimization tecknics. Optemeriza- tion of sequence for expression of antibodies in CHO cells has been described prvi- ously (Kalwy S et al).

1. Sequence optimization for expression in CHO cells of the sequences described above encoding:

VL1 + human kappa light constant = Kappal VL2 + human kappa light constant = Kappa2

VH1 + human heavy mu constant = Mu1 VH2 + human heavy mu constant = Mu2

2. Gene synthesis of the cDNA's including 5'-terminal kozak sequences and restriction enzymes desired for cloning into mammalian expression vector pl- RES (Clontech)

3. Restriction enzyme (Nhel+Mlul) digestions of the synthetic cDNA's Kappal and 2

4. Restriction enzyme (Nhel+Mlul) digestion of multiple cloning site 1 (MCS1 ) in mammalian expression vector plRES 5. Agarose gel electrophoresis and purification of digested vector

6. Ligation of digested plRES:

Kappal + plRES = pIRES/Kappal Kappa2 + plRES = plRES/Kappa2

7. E. coli transformation and spreading on selective LB-agar plates 8. Propagation in selective LB-media 9. Verification of cloned vectors by restriction enzyme analysis and sequencing of inserted cDNA's

10. Restriction enzyme (Xbal+Notl)) digestions of the synthetic cDNA's Mu 1 and 2

1 1. Restriction enzyme (Xbal+Notl) digestion of multiple cloning site 2 (MCS2) in pIRES/Kappal and plRES/Kappa2

12. Agarose gel electrophoresis and purification of digested vectors

13. Ligation of digested pIRES/Kappal and plRES/Kappa2:

Mu1 + pIRES/Kappal = plRES/Kappa1/IRES/Mu1 Mu2 + plRES/Kappa2 = plRES/Kappa2/IRES/Mu2 14. E. coli transformation and spreading on selective LB-agar plates

15. Propagation in selective LB-media

16. Verification of cloned vectors by restriction enzyme analysis and sequencing of inserted cDNA's

17. Maxipreparation of plRES/Kappa1/IRES/Mu1 and plRES/Kappa2/IRES/Mu2 18. CHO DG44 (Invitrogen) cell transfection by Free Style MAX Reagent (Invitro- gen)

19. Propagation of stabile pool in Geneticin

20. Subcloning of stable pool to monoclones in microtitreplates

The antibody produce is purified and binding is tested as described in Example 5 and/or 6.

Example 5

Cvtokeratin 8 and 18 - construction and purification

The fusion proteins of cytokeratin 8 (K8); GST-K8 (1-482), GST-K8 (66-482) and GST-K8 (129-482) are used.

The fusion proteins of cytokeratin 18 (K18); GST-K18 (1-429), GST-K18 (50-429), GST-K18 (139-384) and GST-K18 (140-429) are used.

Full-length human proteins, Met K8 (1-482), Progen and Met K18 (1-429), Progen are used as controls GST-K8 (1-482), GST-K8 (129-482), GST-K18 (1-429), and GST-K18 (139-384) are as described in Ditzel et al 2002 and Waseem et al 1996.

Remaining fusion proteins GST-K8 (66-482), GST-K18 (50-429) and GST-K18 (140- 429) are prepared by PCR amplification of the relevant K8 and K18 sequences using the primers listed here below.

CKSforwardβS / ID 186 GGC GAATTC ACGGTCAACCAGAGCCTG

CK8re*erse4S2 / ID 185 GATCTC GGATCC TCACTTGGGCAGGAGGTG

CK18forwaf-d50 / JD 184 GGC GAATTC TCCACCAGCTTCAGGGGC

CK18reverse429 / ID 183 GCTGCG AAGCTT TTAATGCCTCAGAACTTTGGTG

CK18førwδrdl40 / ID 182 GGC GAATTC TTCGCAAATACTGTGGAC

The PCR products included sites for the restriction enzymes EcoRI and BamH1 (K8) or EcoRI and Hindlll (K18) enabeling insertion in the GST expression vectors GST- K8 (1-482) and GST-K18 (1429) after EcoRI/BamH1 (K8) or EcoRI/Hindlll (K18) digest.

Expression of GST fusion proteins

The K8 and K18 GST fusion proteins were expressed in a total of 2 L of E. coli culture and cultured and purified as described by Dizel et al (2002) except that β- mercapto ethoanol was substituted with DTT. Thorough washing of the inclusion bodies was further observed to have a favorable effect on purity of the final product.

The purified GST fusion products were analysed by Western blotting using Anti K8 (M20), anti K18 (CY-90) and anti GST antibodies as shown in figure 4 A and 4 B.

Example 6

Binding assay for anti-CaOU-1 binding polypeptides

The specificity and potency of anti-CaOU-1 binding polypeptide can be tested in a binding assay towards the antigen CaOU-1. In the following the binding polypeptides is a His tagged scFV but the assay may be performed using any binding polypeptide with minor modification to the assay known by a person skilled in the art.

The binding assay is an indirect ELISA, whereby scFV bound to the CaOU-1 coating is determined. The detection is performed with a HRP-labelled monoclonal anti- histidine tag antibody. If the scFv antibody is biotinylated the detection is performed with streptavidin labelled with HRP. In both detection systems, the substrate TMB is added and the absorbance is measured at 450 nm.

Coating

Complementary intact cytokeratins 18 (type I, Acidic) and 8 (type II, Basic), or their truncated forms containing the CaOU-1 epitope are mixed in equimolar amount in 8M urea. Cytokeratins heterotypic complex are reconstituted by diluting the polypeptide solution to 5 μg/mL with carbonate coating buffer. This solution is used for the coating of the ELISA microplates. Alternatively colon 137 cytoskeletal extract containing the CaOU-1 antigen can be use for coating.

The coating is performed as follows:

1. Coating:

Coating with recombinant cvtokeratin:

Coat the FluoroNunc microplates with 100 μL/well of a solution containing 5 μg/mL of the cytokeratin complex dissolved in 50 mM NaCO3 buffer pH 9.6.

Coating with colon 137 cell extract:

Coat the FluoroNunc microplates with 100 μL/well of a solution containing 5x105 cells/mL of colon 137 cell extract. To 300 μL colon 137 extract, 5.7 mL of 50 mM NaCO3 buffer pH 9.6 is added. Use always one aliquot per half microplate. Never re-freeze the cell extract.

2. Cover the plate with a self adhesive plastic lid in order to avoid evaporation.

3. Incubate the plate overnight at +40C.

4. Wash the plates three times in TBS buffer (without Tween) in Plate Washer. 5. Block the plates by adding 200 μL/well of blocking solution. 6. Cover the plates with a self adhesive plastic lid in order to avoid evaporation.

7. Leave the plates for 60 minutes at room temperature.

8. Wash the plates three times in TBST-buffer in Plate Washer.

9. Use the plates immediately. If stored for short period, always cover plates with a self adhesive plastic lid.

Binding of the scFV

The scFv antibodies that recognize the antigen are bound and detected through their 6xHis tag by an anti-His(C-term) antibody conjugated with horse radish peroxi- dase. The substrate TMB-One is added. After development of the color, the reaction is stopped by adding 1 M sulphuric acid. The absorbance is read at 450 nm. If the scFv antibodies are biotinylated, the antibody for detection can be replace with streptavidin conjugated with horse radish peroxidase.

scFv Standard and Samples Application

1. Pre-dilute scFv reference and sample to a concentration of 4 μg/mL using TBS-T buffer.

2. Perform the reference and sample dilution series: Dilute the scFv reference and test samples as recommended in Table 1 using TBS-T buffer.

3. Add 100 μl_ of the reference dilution series per well according to Table 2. Apply the samples on the CaOU-1 coated plates immediately after preparation.

4. Add 100 μl_ of each scFv sample dilution series per well according to Table 2. Apply samples on the CaOU-1 coated plate immediately after preparation.

5. Add 100 μL TBS-T buffer to the blank wells according to Table 2.

6. Cover the plate with a self adhesive plastic lid in order to avoid evaporation. Incubate the plates on plate shaker (gently shaking) for 120 minutes at room temperature or overnight at +40C. If the plate is coated with colon 137 cell extract, the incubation should be performed overnight at +40C.

Initially, pre-dilute the scFv reference (R) and samples (S) to obtain 4 μg/mL

The references and samples may then be diluted as follows in table 2.

Figure imgf000083_0001

Table 2: scFv reference and sample dilutions

Plate set up

S1 - S1 1 are dilutions of the scFv reference (R) and samples (SX, SY and SZ) may be assyed using the below described set up in micro-well plates.

Figure imgf000083_0002

Table 3: scFv assay plate setup with application of the References and Samples. scFv Detection with anti-Histidine tag antibody

1. Wash the plates three times in TBST-buffer in a plate washer.

2. Add 100 μL per well of 1 :3000 dilution of Mouse anti-His(C-term) antibody conjugated with horse radish peroxidase diluted with TBST-buffer (~1 μL per 3 ml. TBST-buffer) and incubate on plate shaker (gently shaking) one hour at room temperature.

3. Wash the plates three times in TBST-buffer in Plate Washer.

4. Add 100 μL per well of TMB substrate and leave the plate in the dark for 10 min. 5. Stop the reaction with 100 μL/well of 1 M H2SO4.

6. Read plate at 450 nm using the Biotek EL808IU plate reader.

scFv Detection with streptavidin-HRP

This procedure is applied for biotinylated scFv antibodies:

1. Wash the plates three times in TBST -buffer in a plate washer.

2. Add 100 μL per well of HRP-labelled Streptavidin diluted 1 :2000 in TBST-buffer (~1 μL per 2 mL TBST-buffer) and incubate on plate shaker (gently shaking) one hour at room temperature.

3. Wash the plates three times in TBST-buffer in Plate Washer.

4. Add 100 μL per well of TMB substrate and leave the plate in the dark for 10 min.

5. Stop the reaction with 100 μL/well of 1 M H2SO4. 6. Read plate at 450 nm using the Biotek EL808IU plate reader.

Evaluation

The dilution of scFv (X-values) may be plottet versus the absorbance (Y-values), wherein the Dilution = 0.01 when dilution factor is 100

Plot the dilutions versus the absorbance in SigmaPlot ver. 10.0 for Windows

Evaluate the sigmoid standard curve using a 4 parameter logistic fit in SigmaPlot Ver.10 for Windows: Y=Y0+A/[1 +(X/X0)B] where the following 4 parameters are estimated:

A = Difference between maximum absorbance at infinite scFv concentration and minimum absorbance at background, YO = minimum absorbance at background,

XO = scFv amount in well when absorbance is YO+A/2. B = the tangential slope of the curve in [X1Y]=[XO; YO+A/2].

The binding ratio of the scFv antibodies is expressed at the increase in absorbance at XO compared to the background, according to the relation: Binding ratio at XO = [(Y0+A/2)/Y0]

Chemicals and Reagents

Mouse monoclonal anti-His(C- InVitrogen 460707 term)-HRP Antibody Mouse anti-His(C-term)-HRP Antibody

50 μl_ stored at +2-80C

Streptavidin-Horseradish GE Healthcare

Peroxidase Conjugate RPN1231-2ML

Bovine Serum Albumin (BSA) Sigma A7030

Bovine serum albumin >98% pure CAS=[9048-46-8]

Tris (hydroxymethyl) amino Sigma T6791 methane Trizma Base

CAS=[77-86-1]; (HOCH2)3CNH2; MW=121.1 g/mol

Sodium chloride Merck 106404 (EP/BP/USP)

CAS=[7647-14-5]; NaCI; MW=58.4 g/mol

Sodium carbonate Merck 106398 (EP/BP)

CAS=[497-19-8]; Na2CO3; MW=106.0 g/mol

Sodium hydrogen carbonate ICN 191435 (EP/BP/USP)

CAS=[144-55-8]; NaHCO3; MW=84.0 g/mol

Streptavidin horse radish GE Healthcare, RPN1231-2mL peroxidase conjugate

Sulphuric Acid (1 M) Bie & Bemtsen LAB 00531.100

H2SO4

Tween® 20 Calbiochem 655205

CAS=[9005-64-5]; polyoxyethylene sorbitan monolaurate; MW=1228 g/mol; p=1.11 g/mL

3, 3', 5, 5' TetraMethylBenzidi- TMB-One, Kem-En-Tec, Cat. No. 4380 ne Ready to use substrate

(TMB) Solutions: PreCoating Buffer A Na2CO3 (200 mM) Dissolve 21.2 g Na2CO3 in 1000 ml_ MiIIi-

Q H2O.

Expiry date: 1 month from preparation date.

PreCoating Buffer B NaHCO3 (200 mM) Dissolve 16.8 g NaHCO3 in 1000 ml_

MiIIiQ H2O.

Expiry date: 1 month from preparation date. Carbonate coating buffer Na2CO3/NaHCO3 (50 mM) Mix 80 ml_ buffer A and 170 ml buffer B pH=9.6 (200C) and fill up to 900 ml_ with MiIIi-Q H2O. Adjust pH=9.6 at room temperature using PreCoating buffers and fill up to 1000 ml_. Expiry date: 1 month from preparation date.

TBS (10X) stock solution Tris Buffered Saline (Stock Dissolve 12.1 g Tris and 87.6 g NaCI in solution): 900 ml_ MiIIi-Q H2O, adjust pH=8.0 with 5

Tris (0.1 M) M HCI and add MiIIi-Q H2O to 1.0 L. Store

NaCI (1.5 M) at 4°C. pH 8.0 (20°C) Expiry date: 6 months from preparation date.

TBS-buffer Tris Buffered Saline (withDilute TBS (10X) stock solution 1 +9 with out Tween): MiIIi-Q H2O. Store at 4°C. Tris (1 O mM) Expiry date: 1 month from preparation NaCI (15O mM) date. pH 8.0 (20°C)

Blocking solution Tris Buffered Saline with Dilute TBS (10X) stock solution 1 +9 with

0.5% BSA: MiIIi-Q H2O. Add 5 g of BSA per L TBS-

Tris (1 O mM) buffer.

NaCI (15O mM) Prepare just before use. Do not store after

BSA (0.5% w/v) use. pH 8.0 (200C)

TBST-buffer Tris Buffered Saline (with Dilute TBS (10X) stock solution 1 +9 with (Washing buffer) Tween): MiIIi-Q H2O. Add 0.5 ml_ Tween 20 per L Tris (1 O mM) TBS-buffer. Store at 4°C. NaCI (15O mM) Expiry date: 1 month from preparation Tween-20 (0.05% v/v) date. pH 8.0 (200C)

Sulphuric Acid H2SO4 (1 M) Ready to use solution

Bie & Bemtsen, Cat. No.

LAB00531.100

Example 7

Testing of CaOU binding by use of Biacore.

The binding of scFv Nisc204 is tested in a Biacore experiment using BIAcore T100 following the manufactures instructions. The test was performed using >95 % pure proteins verified by sequencing , SDS-PAGE and Mass Spectroscopy. N-terminal truncated cytokeratin 8 and cytokeratin 18 was used as ligand. The samles are run at conscentrations of: 1000 nM, 500 nM, 250 nM, 100 nM and 10 nM. A blan sample running buffer - back ground was substracted and the 250 nM sample was run in duplicate.

A hetrogenous dimer of GST-K18(50-429) and GST-K8(66-482) is used. In the depicted experiment GST-K8 (66-482) contains a spontations mutation of V193 was to A193 which is a conservative muations of low importance for the present experiment.

The affinity data for Nisc 204 show a low but concentration dependen biding to the antigen(Rmax of approcimately 10 RU). The spectrogram is shown in figure 5.

Description of figures

Figure 1. Alignment of the variable heavy and light chain sequences identified by the present study with sequence from WO 03/057168.

Figure 2. The E. coli expression vector pHOG

Figure 3. Western blot of scFv. The loading of the gel is as follows: lane 1 : Nisc204, periplasmic extract, lane 2:

Nisc204, cell media, lane 3: Nisc203, periplasmic extract, lane 4: Nisc203, cell media, lane 5: Blank, lane 6: Protein Marker (10, 15, 20, 25, 37, 50, 75, 100, 150,

250 kD).

Figure 4. Western blot of GST- K8 and GST-K18 fusion proteins. Figure 5. Affinity data from Biacore experiment

References

Borup-Christensen P, Erb K, Jensenius JC, Nielsen B, Svehag SE. Human-human hybridomas for the study of anti-tumor immune response in patients with colorectal cancer. Int. J. Cancer 1986, May 15;37(5):683-8

Ditzel HJ, Garrigues U, Andersen CB, Larsen MK, Garrigues HJ, Svejgaard A, Hellstrom I, Hellstrom KE, Jensenius JC. Modified cytokeratins expressed on the surface of carcinoma cells undergo endocytosis upon binding of human monoclonal antibody and its recombinant Fab fragment. Proc. Natl. Acad. Sci. U S A. 1997 July 22;94(15):8110-5.

Ditzel, HJ. Human monoclonal antibodies: a tool for cancer detection in vivo. APMIS Suppl. 1999; 94:5-42.

Ditzel HJ, Strik MC, Larsen MK, Willis AC, Waseem A, Kejling K, Jensenius JC.

Cancer-associated cleavage of cytokeratin 8/18 heterotypic complexes exposes a neoepitope in human adenocarcinomas. J. Biol. Chem. 2002 June 14;277(24):21712-22.

Stacy, JE. Kausmally, L. Simonsen B, Nordgard SH, Alsoe L, Michaelsen TE, Brekke OH. Direct isolation of recombinant human antibodies against group B Neisseria meningitidis from scFv expression libraries. J. Immunol. Methods. 2003 Dec;283(1-2):247-59.

Waseem A, Lane EB, Harrison D, Waseem N. A keratin antibody recognizing a heterotypic complex: epitope mapping to complementary locations on both components of the complex. Exp. Cell. Res. 1996 Mar. 15;223(2):203-14.

Horton RM, Cai ZL, Ho SN, and Pease LR. Gene Splicing by Overlap Extension: Tailor-made genes using the polymerase chain reaction. Biotechniques, 1990, May;8(5):528-35.

Kalwy S, Ranee J, Young R. Toward more efficient protein expression: keep the message simple. MoI Biotechnol. 2006 Oct;34(2):151-6.

Claims

Claims
1. An isolated CaOU-1 epitope binding polypeptide comprising at least one binding domain comprising at least one amino acid sequence selected from the group of: amino acid sequences identified by SEQ ID NO 6, 8, 10 and 16.
2. The isolated CaOU-1 epitope binding polypeptide according to claim 1 , wherein the at least one binding domain comprises an amino acid sequence identified by SEQ ID NO 10 or 16.
3. The isolated CaOU-1 epitope binding polypeptide according to claim 1 , wherein the at least one binding domain comprises the amino acid sequences identified by SEQ ID NO 10 and 16.
4. The isolated CaOU-1 epitope binding polypeptide according to any of the claims 1-3, wherein the at least one binding domain comprises the amino acid sequences set identified by SEQ ID NO 6, 8 and 10 or/and the amino acid sequences set identified by SEQ ID NO 12, 14 and 16.
5. The isolated CaOU-1 epitope binding polypeptide according to any of the claims 1-4, wherein the binding polypeptide is selected from antibodies or immunologically active fragments of antibodies or single chain of antibodies.
6. The isolated CaOU-1 epitope binding polypeptide according to any of the claims 1-5, wherein the binding polypeptide is a non-imunological binding polypeptide.
7. The isolated CaOU-1 epitope binding polypeptide according to any of the preceding claims 1-5, wherein the binding domain is arranged as complementarity determining regions (CDRs) in the binding polypeptide.
8. The isolated CaOU-1 epitope binding polypeptide according to claim 7, wherein the at least one binding domain comprises at least one amino acid sequence identified by SEQ ID NO 6, 8 and 10 in one or more heavy chain complementarity determining regions (CDRs).
9. The isolated CaOU-1 epitope binding polypeptide according to claim 7, wherein the at least one binding domain comprises at least one amino acid sequence identified by SEQ ID NO 12, 14 and 16 in one or more light chain complementarity determining regions (CDRs).
10. The isolated CaOU-1 epitope binding polypeptide according to claim 7, wherein the at least one binding domain comprises the amino acid sequences identified by SEQ ID NO 10 and 16 in a heavy and light chain CDR 3.
1 1. The isolated CaOU-1 epitope binding polypeptide according to any of the claims 5, 7-10, wherein the binding polypeptide is an antibody.
12. The isolated CaOU-1 epitope binding polypeptide according to any of the claims 5, 7-10, wherein the binding polypeptide is an immunologically active fragment of an antibody.
13. The isolated CaOU-1 epitope binding polypeptide according to claim 12, wherein the fragment of antibodies are selected from Fab, Fab', F(ab)2 and Fv.
14. The isolated CaOU-1 epitope binding polypeptide according to claims 12, wherein the binding polypeptide is a single chain antibody (ScFv).
15. The isolated CaOU-1 epitope binding polypeptide according to any of the claims 7-14, wherein the binding domain is carried by a human antibody framework.
16. The isolated CaOU-1 epitope binding polypeptide according to any of the claims 7-14, wherein the binding domain is carried by a humanised antibody framework.
17. The isolated CaOU-1 epitope binding polypeptide according to any of the claims 7-16, wherein the binding domain is carried by an immunoglogbuling selected from the group of IgA, IgD, IgE, IgG and IgM.
18. The isolated CaOU-1 epitope binding polypeptide according to claim 17, wherein the immunoglobulin is a recombinant immunoglobulin.
19. The isolated CaOU-1 epitope binding polypeptide according to claim 17 or 18, wherein the immunoglobulin is an IgM immunoglobulin.
20. The isolated CaOU-1 epitope binding polypeptide according to any of the claims 7-16, wherein the binding domain comprises a VH domain.
21. The isolated CaOU-1 epitope binding polypeptide according to claim 17, wherein the VH domain comprise the sequence identified by SEQ ID NO 2.
22. The isolated CaOU-1 epitope binding polypeptide according to any of the claims 7-16, wherein the binding domain comprises a VL domain.
23. The isolated CaOU-1 epitope binding polypeptide according to claim 19, wherein the VL domain comprise the sequence identified by SEQ ID NO 4.
24. The isolated CaOU-1 epitope binding polypeptide according to any of the previous claim, wherein the dissociation constant is less than 5 x 10"9 M, such as less than 1 x 10"9 M.
25. The isolated binding polypeptide according to any of the previous claims wherein the binding polypeptide is labelled with a label selected from the group of: radio- isotype labels, fluorescent labels and enzymatic labels.
26. The isolated CaOU-1 epitope binding polypeptide according to any of the claims 1-19, wherein the binding domain is capable of specifically binding the CaOU-1 epitope.
27. The isolated CaOU-1 epitope binding polypeptide according to claim 20, wherein the binding domain is capable of specifically binding an adenocarcinoma cell.
28. The isolated binding polypeptide according to any of the previous claims wherein the binding polypeptide is coupled to a therapeutic agent.
29. The isolated binding polypeptide according to claim 25, wherein the therapeutic agent is a chemotherapeutic agent.
30. The isolated binding polypeptide according to claim 25, wherein the therapeutic agent is an angiogenesis inhibitor
31. A nucleic acid sequence encoding a CaOU-1 epitope binding polypeptide according to any of the claims 1-27.
32. The nucleic acid sequence according to claim 28, comprising at least one nucleic acid sequence as defined by SEQ ID NO 5, 7, 9, 11 , 13 and 15.
33. The nucleic acid sequence according to claim 28, comprising at least one nucleic acid sequence as defined by SEQ ID NO 9 or 15 .
34. The nucleic acid sequence according to claim 28, comprising at least one nu- cleic acid sequence as defined by SEQ ID NO 1 or/and 3.
35. A vector comprising the nucleic acid molecule as defined in any of the claims 28- 31.
36. The vector according to claim 32, comprising a nucleotide sequence which regulates the expression of the antibody encoded by the nucleic acid molecule.
37. A host cell comprising the nucleic acid sequence as defined in claims 32 or 33.
38. A cell line engineered to express the binding polypeptide as defined in any of claims 1-27.
39. A pharmaceutical composition comprising: i. at least one CaOU-1 epitope binding polypeptide as defined in any of claims 1-27 and ii. optionally pharmaceutically accepted carrier and/or excipients.
40. The pharmaceutical composition according to claim 36, comprising at least two different binding polypeptides.
41. The pharmaceutical composition according to claim 37, comprising a second therapeutic agent, such as a chemotherapeutic agent or an angiogenesis inhibitory agent.
42. A CaOU-1 epitope binding polypeptide according to any of the claims 1-27, for use as a medicament.
43. Use of a binding polypeptide according to any of claims 1-27 for the manufacture of a medicament for treatment of an adenocarcinoma.
44. The use according to claim 40, wherein the adenocarcinoma is selected from colon, ovarian, renal, mammary gland, lung and pancreatic adenocarcinoma.
45. The use according to claim 40, wherein the medicament is for the treatment of non-seminomal testis carcinoma.
46. The use accoding to claim 39, werein the medicament is for parenteral administration.
47. The use accoding to claim 39, werein the medicament is formulated for inhalation.
48. A kit of parts comprising: i. a pharmaceutical composition according to any of the claims 36-38 or a medicament according to any of the claims 39-44 and ii. a secondary pharmaceutical composition or medicament as separate entities.
49. A CaOU-1 epitope binding polypeptide according to any one of claims 1-27 for use in detection of the CaOU-1 epitope in a test sample.
50. A CaOU-1 epitope binding polypeptide according to any one of claims 1-27 for use in measuring the amount of the CaOU-1 epitope in a test sample.
51. A CaOU-1 epitope binding polypeptide according to any one of claims 1-27 for use in diagnosis of adenocarcinomas.
52. The use according to claim 48, wherein adenocarcinma is selected from colon, ovarian, renal, mammary gland, lung and pancreatic adenocarcinoma
53. A method of detecting the CaOU-1 epitope in a test sample comprising the steps of: i. contacting a CaOU-1 epitope binding polypeptide according to any of claims 1 -27 with a test sample, ii. detecting bound CaOU-1 epitope binding polypeptide in the test sample.
54. A method of measuring the amount of CaOU-1 epitope in a test sample comprising the steps of: i. contacting a CaOU-1 epitope binding polypeptide according according to any of claims 1-27 with a test sample, ii. measuring the amount of bound CaOU-1 epitope binding polypeptide in the test sample, and thereby iii. obtaining information about the amount of CaOU-1 epitope in the test sam- pie.
55. A method of detecting or diagnosing a disease or disorder associated with the CaOU-1 epitope in an individual comprising the steps of: i. contacting a CaOU-1 epitope binding polypeptide according according to any of claims 1-27 with a biological sample from said individual, ii. detecting binding polypeptides bound to said biological sample, and thereby iii. detecting or diagnosing the disease or disorder.
56. The method according to claim 52, for detection or diagnosing of adenocarci- noma.
57. A method of treatment involving administering to a subject in need a binding polypeptide according to any of claims 1-27.
58. The method of treatment according to claim 54 for the treatment of adenocarcinoma.
59. The method of treatment according to claim 55, wherein the acenocarcinoma is selected from the group of: colon, ovarian, renal, mammary gland, lung and pancreatic adenocarcinoma
60. Use of a binding polypeptide according to any of the claims 1-27 or a nucleic acid sequence according to any of the claims 28-31 for affinity maturation.
61. A method of developing CaOU-1 epitope binding polypeptides comprising at least one step of affinity maturation of a binding polypeptide according to any of the claims 1-27 or a nucleic acid sequence according to any of the claims 28-31.
PCT/DK2008/050164 2007-07-02 2008-07-02 CaOU-1 EPITOPE BINDING POLYPEPTIDES WO2009003489A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
DKPA200700969 2007-07-02
DKPA200700969 2007-07-02

Publications (1)

Publication Number Publication Date
WO2009003489A1 true WO2009003489A1 (en) 2009-01-08

Family

ID=39811540

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2008/050164 WO2009003489A1 (en) 2007-07-02 2008-07-02 CaOU-1 EPITOPE BINDING POLYPEPTIDES

Country Status (1)

Country Link
WO (1) WO2009003489A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017124001A3 (en) * 2016-01-14 2017-08-17 Memorial Sloan-Kettering Cancer Center T cell receptor-like antibodies specific for foxp3-derived peptides
US10053507B2 (en) 2013-03-15 2018-08-21 Amgen Inc. Human PAC1 antibodies

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003057168A2 (en) * 2002-01-03 2003-07-17 The Scripps Research Institute Cancer-associated epitope

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003057168A2 (en) * 2002-01-03 2003-07-17 The Scripps Research Institute Cancer-associated epitope

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
DITZEL H ET AL: "Immunoscintigraphy of colon cancers with the human monoclonal antibody COU-1.", CANCER 1 FEB 1994, vol. 73, no. 3 Suppl, 1 February 1994 (1994-02-01), pages 858 - 863, XP002499697, ISSN: 0008-543X *
DITZEL H ET AL: "Tumor detection with 131I-labeled human monoclonal antibody COU-1 in patients with suspected colorectal carcinoma", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, BALTIMORE, USA, DE, vol. 53, no. 24, 15 December 1993 (1993-12-15), pages 5920 - 5928, XP002209730 *
DITZEL H J ET AL: "Cancer-associated cleavage of cytokeratin 8/18 heterotypic complexes exposes a neoepitope in human adenocarcinomas", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOCHEMICAL BIOLOGISTS, BIRMINGHAM,; US, vol. 277, no. 24, 14 June 2002 (2002-06-14), pages 21712 - 21722, XP002209731, ISSN: 0021-9258 *
DITZEL H J ET AL: "Modified cytokeratins expressed on the surface of carcinoma cells undergo endocytosis upon binding of human monoclonal antibody and its recombinant Fab fragment", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC.; US, vol. 94, no. 15, 22 July 1997 (1997-07-22), pages 8110 - 8115, XP002209729, ISSN: 0027-8424 *
DITZEL H J: "Human monoclonal antibodies: A tool for cancer detection in vivo", APMIS, COPENHAGEN, DK, vol. SUPPL. 94, no. 107, 1 January 1999 (1999-01-01), pages 5 - 42, XP008006619, ISSN: 0903-4641 *
ERB K ET AL: "Characterization of a Human-Human Hybridoma Antibody, C-OU1, Directed Against a Colon Tumor-Associated Antigen", HYBRIDOMA, LIEBERT, NEW YORK, NY, US, vol. 11, no. 2, 1 April 1992 (1992-04-01), pages 121 - 134, XP008006633, ISSN: 0272-457X *
GODFROID E ET AL: "Cytokeratins are exposed on the outer surface of established human mammary carcinoma cells.", JOURNAL OF CELL SCIENCE JUL 1991, vol. 99 ( Pt 3), July 1991 (1991-07-01), pages 595 - 607, XP002499696, ISSN: 0021-9533 *
HASPEL M V ET AL: "Generation of tumor cell-reactive human monoclonal antibodies using peripheral blood lymphocytes from actively immunized colorectal carcinoma patients.", CANCER RESEARCH AUG 1985, vol. 45, no. 8, August 1985 (1985-08-01), pages 3951 - 3961, XP002499698, ISSN: 0008-5472 *
PANCOOK J D ET AL: "In vitro affinity maturation of human IgM antibodies reactive with tumor-associated antigens", HYBRIDOMA AND HYBRIDOMICS, MARY ANN LIEBERT, NEW YORK, NY, US, vol. 20, no. 5-6, 1 January 2001 (2001-01-01), pages 383 - 396, XP002348142, ISSN: 1536-8599 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10053507B2 (en) 2013-03-15 2018-08-21 Amgen Inc. Human PAC1 antibodies
WO2017124001A3 (en) * 2016-01-14 2017-08-17 Memorial Sloan-Kettering Cancer Center T cell receptor-like antibodies specific for foxp3-derived peptides

Similar Documents

Publication Publication Date Title
JP4606172B2 (en) Human monoclonal antibodies against the epidermal growth factor receptor (egfr)
KR101704734B1 (en) Human monoclonal antibodies to programmed death ligand 1(pd-l1)
AU770555B2 (en) Generation of modified molecules with increased serum half-lives
EP2316856B1 (en) Human monoclonal antibodies against CD20
US7141653B2 (en) Human monoclonal antibodies to interleukin-5
JP4315982B2 (en) Antibodies to MAdCAM
AU2004299833B2 (en) Interferon alpha antibodies and their uses
RU2421466C2 (en) Recovered prostate specific membrane antigen (psma) antibody and method of inhibition of psma-expressing cell growth
US10106615B2 (en) Nucleic acids encoding human monoclonal antibodies that bind CXCR4
US9624297B2 (en) Monoclonal antibodies that specifically block biological activity of a tumor antigen
US7109003B2 (en) Methods for expressing and recovering human monoclonal antibodies to CTLA-4
JP4733635B2 (en) Anti-cd19 antibody
EP1899379B1 (en) Cd19 antibodies and their uses
US9505845B2 (en) Treating lung cancer using human monoclonal antibodies to protein tyrosine kinase 7 (PTK7)
JP2019103504A (en) Methods for treating cancer with human monoclonal and anti-PD-1 antibodies alone or in combination with other immunotherapies against Programmed Death 1 (PD-1)
JP5912090B2 (en) Modified antigen binding molecule with altered cell signaling activity
KR101527342B1 (en) Monoclonal Antibodies Against Glypican-3
EP1934261B1 (en) Human monoclonal antibodies to cd70
JP4464450B2 (en) Antibodies and uses thereof to insulin-like growth factor i receptor
RU2486199C2 (en) Recovered ip-10 antibody, immunoconjugate and biospecific molecule thereof, compositions thereof, method of treating (versions), coding molecule of nucleic acid, relative expression vector, host cell and hybridoma
AU2009243493B2 (en) Bispecific Antibodies for Inducing Apoptosis of Tumor and Diseased Cells
AU2008320823B2 (en) Molecules and methods for modulating low-density-lipoprotein receptor-related protein 6 (LRP6)
EP1740946B1 (en) Human monoclonal antibodies against cd20
JP5225069B2 (en) Antibodies against cd38 for the treatment of multiple myeloma
KR101615935B1 (en) Antibodies against human nkg2d and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08758301

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08758301

Country of ref document: EP

Kind code of ref document: A1