WO2009001095A2 - Novel schizophrenia associated genes - Google Patents
Novel schizophrenia associated genes Download PDFInfo
- Publication number
- WO2009001095A2 WO2009001095A2 PCT/GB2008/002204 GB2008002204W WO2009001095A2 WO 2009001095 A2 WO2009001095 A2 WO 2009001095A2 GB 2008002204 W GB2008002204 W GB 2008002204W WO 2009001095 A2 WO2009001095 A2 WO 2009001095A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- schizophrenia
- genes
- expression
- activity
- proteins
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present invention relates to the identification of genes involved and/or associated with schizophrenia and related diseases, as well as particular identified genes and their potential use in therapy/diagnosis of schizophrenia and related diseases.
- Schizophrenia is a devastating mental illness which affects 1% of the world population, the aetiology of which remains elusive. There is known to be a strong genetic component to the disease, with incidence rising to between 10% and 49% in those with close relatives suffering from the disease. However, to date, there is a poor understanding of the genes involved.
- Schizophrenia is characterised by positive symptoms (such as hallucinations and delusions), negative symptoms, (such as social withdrawal, anhedonia and self- neglect) and cognitive deficits (including impairments in executive function and attention).
- positive symptoms such as hallucinations and delusions
- negative symptoms such as social withdrawal, anhedonia and self- neglect
- cognitive deficits including impairments in executive function and attention.
- PCP psychotogenic drug phencyclidine
- the present invention is based on experiments which were designed to identify genes potentially contributing to the aetiology of schizophrenia, using prefrontal cortex tissue from rats treated according to the model of Cochran et al (2003), and post-mortem prefrontal cortex tissue from patients with schizophrenia, and controls.
- the present invention relates to the differential expression of certain genes, notably certain kinases, and how proteins expressed from these genes, or the differential expression of these genes, may be used to screen for compounds which may modulate the activity or the expression of the differentially expressed genes, or measure an effect a compound may have on the expression of such differentially expressed genes in an animal model of schizophrenia. It may also be possible to use the information as a prognostic or diagnostic marker for schizophrenia.
- a method of screening a compound for treating schizophrenia which comprises:
- a method for measuring an anti-schizophrenia effect of a compound using an animal model of schizophrenia which comprises:
- schizophrenia as used herein, relates to schizophrenia and other related disorders such as bipolar affective disorder, brief psychotic disorder, schizophrenia form disorder, schizopaffective disorder and the like.
- expression means allowing or causing the information in a gene or DNA sequence to become manifest, for example, by producing mRNA or a protein.
- the level of "expression” can easily be detected by methods known to the skilled addressing including hybridisation studies, quantitative PCR, northern and western blotting, techniques and immunoassays. See for example Sambrook et al, 2000.
- Allelic variants are usually observed by comparing their nucleotide or (in the case of variant polypeptides) amino acid sequences to a common "wild-type” or “reference” sequence.
- a wild-type or “reference” allele of a gene refers to that allele of a gene having a genomic sequence designated as the wild-type sequence and/or encoding a polypeptide having an amino acid sequence that is also designated as a wild-type sequence.
- the wild-type allele may be arbitrarily selected from any of the different alleles that may exist for a particular gene. However, the allele is most typically selected to be the allele which is most prevalent in a population of individuals.
- the level of activity of the protein may be the ability of the protein to interact with a different protein or ligand and this can be detected by enzyme assays and ligand/protein binding assays, known in the art.
- JNK activity is typically measured by directly monitoring the amount of phosphorylated JNK in a tissue or cell extract using phosphorylation-state- specific antisera (e.g. Mizuno et al., 2002; Machida et al., 2004).
- a tissue or cell extract is incubated with c-jun or ATF3 protein, or with synthetic peptides corresponding to the sites of phosphorylation of these proteins, either in the presence of 32 P-ATP, so that the incorporation of 32 P into the c-jun or ATF3 protein can be monitored, or in the presence of unlabelled ATP, in which case the levels of phosphorylated c-jun or ATF3 are monitored via phosphor-specific antisera for these proteins (e.g.
- MAP2K7 activity is typically measured by directly monitoring the amount of phosphorylated MAP2K7 in a tissue or cell extract using phosphorylation-state-specif ⁇ c antisera.
- a tissue or cell extract is incubated with JNKl or JNK2, along with c-jun or ATF3 protein, or with synthetic peptides corresponding to the sites of phosphorylation of these proteins, either in the presence of 32 P-ATP, so that the incorporation of 32 P into the c-jun or ATF3 protein can be monitored, or in the presence of unlabelled ATP, in which case the levels of phosphorylated c-jun or ATF3 are monitored via phosphor-specific antisera for these proteins (e.g.
- MAP3K7 activity can be measured by directly monitoring the amount of phosphorylated MAP3K7 in a tissue or cell extract using phosphorylation-state-specif ⁇ c antisera.
- a tissue or cell extract is incubated with MKK7, or with synthetic peptides corresponding to the sites of phosphorylation of this protein, either in the presence of 32 P-ATP, so that the incorporation of P into the MKK7 protein can be monitored, or in the presence of unlabelled ATP, in which case the levels of phosphorylated MKK7 are monitored via phosphor-specific antisera.
- Activity of MAP4K4 or TNIK can be measured by directly monitoring the amount of phosphorylated MAP3K7 in a tissue or cell extract using phosphorylation-state-specif ⁇ c antisera.
- Activity of MAP4K4 or TNIK can also be assessed by incubating a tissue or cell extract with MAP3K7, and monitoring the activity of MAP3K7 as above (eg Yao et al., 1999; Fu et al., 1999).
- PAKl activity can be measured by directly monitoring the amount of phosphorylated PAKl in a tissue or cell extract using phosphorylation-state-specif ⁇ c antisera (e.g. Koh et al., 2002).
- a tissue or cell extract is incubated with tyrosine hydroxylase or myelin basic protein, or with synthetic peptides corresponding to the sites of phosphorylation of these proteins, either in the presence of 32 P-ATP, so that the incorporation of 32 P into the tyrosine hydroxylase or myelin basic protein can be monitored, or in the presence of unlabelled ATP, in which case the levels of phosphorylated tyrosine hydroxylase or myelin basic protein are monitored via phosphor-specific antisera (e.g. Poitras et al., 2003).
- CamKIV activity can be measured by directly monitoring the amount of phosphorylated CamKIV in a tissue or cell extract using phosphorylation-state-specific antisera.
- tissue or cell extract is incubated with CREB or CamKII-gamma, or with synthetic peptides corresponding to the sites of phosphorylation of CREB or CamKII-gamma, either in the presence of P-ATP, so that the incorporation of P into the CREB or CamKII- gamma can be monitored, or in the presence of unlabelled ATP, in which case the levels of phosphorylated CREB or CamKII-gamma are monitored via phosphor- specific antisera (e.g. Enslen et al., 1996).
- PPMlE and PPMlF activity can be measured by directly monitoring the amount of phosphorylated PPMlE or PPMlF in a tissue or cell extract using phosphorylation-state-specific antisera.
- a tissue or cell extract is incubated with PAKl, CamKIV or CamKII, which have been previously phosphorylated with 32 P derived from 32 P-ATP via the action of CaMK kinase, or with synthetic phosphor-peptides corresponding to the sites of phosphorylation of PAKl, CamKIV or CamKII.
- the release of 32 P can then be monitored, or alternatively the reduction in the levels of phosphorylated PAKl, CamKIV or CamKII are monitored via phospho-specific antisera (e.g. Koh et al., 2002; Tan et al., 2001).
- Detection of protein may typically be carried out using labelling of the protein with an appropriate marker molecule.
- an appropriate marker molecule For example a labelled or unlabelled antibody or other binding agent specific for the particular protein may be used, to bind the protein and allow its detection. If an unlabelled antibody or other binding agent is used, it will be necessary to employ a labelling agent designed to bind to the antibody or binding agent, in order to allow detection. It may also be necessary to first permeabilise or lyse the cells in order to allow the proteins to be detected and many techniques for achieving this are known to the skilled man.
- proteins identified herein are kinases
- antibodies or specific binding agents which are able to bind to the phosphorylated or non-phosphorylated forms of the kinases substrate may be used, in order to detect a level of kinase activity.
- the more genes/proteins which are included in any test may lead to an improved test.
- the method may preferably include at least 2, 3, 4, 5, 10, 15 or all of the aforementioned genes identified herein.
- Preferred sets of genes, the differential expression of which, whether up or down with respect to a control, are identified in Tables 1 and 2 and a particularly preferred sub-set of genes comprise one or more of the MAP kinases identified (e.g. MAP2K7, MAPK9, MAP3K7 and/or MAP4K4).
- the present invention also provides methods for identifying, evaluating, and/or monitoring drug candidates for the treatment of schizophrenia.
- a candidate drug may be assayed for its ability to modulate the expression or activity of one or more of the genes/proteins identified herein.
- a specific drug may increase or decrease the expression or activity of one or more of the genes/proteins identified herein.
- drugs or chemical entities such as small molecules or peptides etc. which are already known to have an effect on the expression on one or more of the genes/proteins identified hereinabove, but not in the context of being associated with Schizophrenia. As such, it would not be appropriate to use such drugs/chemical entities as potential anti-Schizophrenia agents.
- the present invention provides use of a agent which is capable of modulating activity or expression of one or more of the genes/proteins identified herein, for the manufacture of a medicament for treating Schizophrenia and/or Schizophrenia associated disorders.
- Schizophrenia and/or Schizophrenia associated disorders comprising the step of administering an agent, to a subject in need thereof, which is capable of modulating the activity or expression of one or more of the genes/proteins identified herein so as to treat Schizophrenia and/or a Schizophrenia associated disorder.
- In vivo systems can include, but are not limited to, animal systems which naturally exhibit the symptoms of schizophrenia, or ones which have been developed to exhibit such symptoms, as for example the model described in WOO 1/75440. Further, such systems can include, but are not limited to transgenic animals systems.
- In vitro systems can include, but are not limited to, cell-based systems comprising the identified gene/polypeptide expressing cell types. The cells can be wild type cells, or can be non-wild type cells containing modifications known or suspected of contributing to schizophrenia.
- the expression of said identified gene(s) can be modulated within the in vivo and/or in vitro systems, i.e. either overexpressed or underexpressed in, for example, transgenic animals and/or cell lines, and the subsequent effect on the system can then be assayed.
- the activity of the product of the identified gene can be modulated by either increasing or decreasing the level of activity in the in vivo and/or in vitro system of interest, and its subsequent effect then assayed.
- relevant treatment can include a modulation of gene expression and/or gene product activity. Characterisation procedures such as those described herein can indicate whether such modulation should be positive or negative.
- positive modulation refers to an increase in gene expression or activity of the gene or gene product of interest.
- Negative modulation refers to a decrease in gene expression or activity.
- the identified genes/proteins are differentially expressed (see Table 2), that is, increased or decreased in expression in tissue from schizophrenic patients, as compared to non- schizophrenic patients. It may therefore be appropriate to seek to correct such differential expression by either up-regulating or down-regulating, in some manner, the expression of one or more of said identified genes. For genes/proteins which are expressed to a lesser degree in schizophrenic patients as compared to non-schizophrenic patients, it may be possible to redress this imbalance using gene therapy techniques, or simply by administering the relevant proteins to the subject.
- adeno associated virus vector constructs which may be administered to a subject to cause expression of a chosen gene.
- Appropriate promoters may also be used to control expression of the cloned gene in specific cell types and/or at certain times.
- RNAi techniques known in the art.
- In vitro systems can be designed to identify compounds capable of binding said identified gene(s) products of the invention.
- Compounds identified can be useful, for example, in modulating the activity of wild type and/or mutant gene(s) products, can be useful in elaborating the biological function of said identified gene(s) products, or can disrupt normal identified gene(s) product interactions.
- a candidate drug may be added to cells or sample tissue prior to analysis.
- Preferred cells are cell lines grown from tissue, particular brain tissue, e.g. prefrontal cortex tissue from schizophrenic subjects.
- cells isolated from the brain of the PCP rat model described in WOO 1/75440 may be employed.
- the invention provides screens for a candidate drug which modulates gene expression and/or protein activity of said one or more disclosed genes/proteins in brain tissue, or interferes or enhances the binding of said one or more proteins to its substrate.
- candidate drug or equivalent as used herein describes any molecule, e.g. an antibody or antibody fragment, aptamer protein, oligopeptide, fatty acid, steroid, small organic molecule, polysaccharide, polynucleotide, RNAi molecule, antisense molecule, ligand, bioactive partner and structural analogs or combinations or conjugates thereof, to be tested for candidate drugs that are capable of directly or indirectly altering the activity or the expression of said one or more genes/proteins.
- candidate drugs may also be administered in combination with an agent designed to facilitate entry into a cell and many such agents are known in the art.
- a method of prognosis or diagnosis of schizophrenia comprising the steps of: a) providing a tissue or body fluid sample from a test subject; b) detecting a level of expression or level of activity of one or more of the following genes/proteins PPMlE; PPMlF; MAP2K7; MAPK9; RICS/GRIT; PTK2B/PYK2; Gabl; Gab2; Nckl; NcIcAPI; CrkL; PAKl; CamKK; CAMK4; MAP4K4; TNIK; MAP3K7; and MAPK ⁇ ipl in a cell or cells from said sample; and c) comparing the level of expression or level of activity of said one or more genes/proteins with a level of expression or level of activity of said one or more genes/proteins in a control sample from a subject not suffering or predisposed to suffering from schizophrenia.
- Typical body fluid samples include blood, serum, urine, cerebrospinal fluid (CSF), saliva,
- a gene sequence may comprise a mutation or polymorphism, with respect to the wild-type sequence and the level of expression of such a mutant or polymorphic sequence may also be detected, by for example, hybridisation, quantitative PCR, electrophoretic mobility, or nucleic acid sequence studies, known in the art.
- polymorphism refers, generally, to the coexistence of more than one form of a gene (e.g., more than one allele) within a population of individuals.
- the different alleles may differ at one or more positions of their nucleic acid sequences, which are referred to herein as "polymorphic locuses".
- polymorphic locus When used herein to describe polypeptides that are encoded by different alleles of a gene, the term “polymorphic locus” also refers to the positions in an amino acid sequence that differ among variant polypeptides encoded by different alleles.
- the polymorphisms of the present invention include "single nucleotide polymorphisms" (SNPs) and microsatellite repeats.
- SNP refers to a polymorphic site occupied by a single nucleotide, which is the site of variation between allelic sequences.
- the polymorphic site of an SNP is flanked by highly conserved sequences (e.g., sequences that vary in less than 1/100 and, more preferably, in less than 1/1000 individuals in a population).
- the polymorphic locus of an SNP may be a single base deletion, a single base insertion, or a single base substitution. Single base substitutes are most typical.
- Prediction of whether or not a test subject is likely to have or be predisposed to developing schizophrenia may be based on a profile of expression and this may be carried out using appropriate computer software.
- the present invention therefore also provides arrays of gene expression detection agents for use in the method of the present invention.
- a DNA array for use in a method according to the present invention the array comprising or consisting essentially of one or more of the following genes or sequence specific fragments thereof: PPMlE; PPMlF; MAP2K7; MAPK9; RICS/GRIT; PTK2B/PYK2; Gabl; Gab2; Nckl; NckAPI; CrkL; PAKl ; CamKK; CAMK4; MAP4K4; TNIK; MAP3K7; and MAPKSipl, the array being immobilised on a support.
- the array is a microarray.
- the array or microarray is prepared on any suitable, preferably non-porous substrate.
- the suitable substrate may include glass or a plastic material.
- Information regarding suitable substrates and the protocols used to generate arrays or microarrays may be obtained from the National Human Genome Research Institute, Bethesda USA.
- the surface of the suitable microarray substrate is treated in someway so that nucleic acid specific to said genes, that is nucleic acid corresponding to said gene or specific fragment thereof may be coupled to it.
- the surface of the suitable substrate may be made hydrophobic so as to prevent spread of individual nucleic acid samples applied to the microarray substrate and positively charged so as to facilitate the coupling of the nucleic acid to the microarray substrates.
- Such a hydrophobic/positively charged surface may be obtained by use of a substance such as poly-L-lysine.
- the nucleic acid fragments may be spotted on to the surface as an array.
- Preferably automated printing procedures known in the art may be utilised to apply the nucleic acid fragments as an array.
- Preferred gene expression detection agents hybridise specifically to the genes identified herein whose expression is correlated with having or being disposed to developing schizophrenia. Such agents may be RNA, DNA or PNA molecules. Preferred agents are fragments of the above-identified genes, e.g. oligonucleotides specific therefore. Alternative agents may bind specifically to the protein expression products of the marker genes disclosed herein. Preferred agents include antibodies and aptamers.
- Agents such as oligonucleotides, are preferably attached to a solid support in the form of an array.
- Olignucleotide arrays in the form of DNA microarrays and useful hybridisation assays are known in the art and disclosed for example in US Patent Nos. 5,631,734; 5,874,219; 5,861,242; 5,585,659; 5,856,174; 5,843,655; 5,837,832; 5,834,758; 5,770,722; 5,770,456; 5,733,729; 5,556,752; 6,045,996 and 6,261,776.
- an array includes oligonucleotides for measuring the expression level of the genes identified herein.
- cDNAs or PCR products for probes.
- the present invention further provides a database of said identified genes and information about the said genes, including the expression levels that are characteristic of schizophrenic and non-schizophrenic subjects.
- said gene information is preferably stored in a memory in a computer system.
- the information is stored in a removable data medium such as a magnetic disk, a CDROM, a tape, or an optical disk.
- the input/output of the computer system can be attached to a network and the information about the identified genes can be transmitted across the network.
- Preferred information includes the identify of the genes identified herein, the differential expression of which correlates with an expected diagnosis or prognosis to developing schizophrenia.
- reference expression levels of said genes may be stored in a memory or on a removable data medium.
- a reference expression level is a level of expression of the marker gene that is indicative normal, that is, a non-schizophrenia subject and as such can be used as a reference to determine whether or not a test subject's level of expression is significantly increased or decreased with respect to the reference level.
- a computer system or removable data medium includes the identity and expression information.
- information about expression levels of said genes for non-schizophrenia tissue may be included.
- Figure 1 shows the relationship between Pyk-Nck-Jnk pathway gene products
- Figure 2 shows the results of RT-qPCR for human post mortem tissue RNAs (two-tailed t-test; *p ⁇ 0.05; ** ⁇ 0.01; *** ⁇ ,0.001);
- Figure 3 shows the ability of increased Nek 1 gene expression to alter Pyk- Nck-Jnk pathway activity in neuronal cells: Nckl was over-expressed in NG 108- 15 cells, and total JNK activity measured by phosphor- JNK ELISA. (one-tailed t-test; *p ⁇ 0.05);
- Figure 4a shows the levels of NMDA receptor NRl subunit protein, Parvalbumin mRNA, and phospho-JNK activity in prefrontal cortex tissue from mice with a deleted Nckl gene to render the Pyk-Nck-Jnk2 pathway dysfunctional: (two- tailed t-test; *p ⁇ 0.05; **p,0,01, ***p,0.001);
- Figure 4b shows reduced metabolic activity in prefrontal cortex (hypofrontality) from mice with a deleted Nckl gene (Nckl knockout mice - KO) to render the Pyk-Nck-Jnk2 pathway dysfunctional, as compared to control (wild-type - WT) mice: (two-tailed t-test; ***p ⁇ 0.001 relative to control);
- Figure 4c shows increased metabolic activity in the auditory processing circuit (Auditory Cortex, AuCx; Parasubiculum, PaS; and Inferior Colliculi, IC) from mice with a deleted Nckl gene to render the Pyk-Nck-Jnk2 pathway dysfunctional, as compared to control (wild-type - WT) mice: (two-tailed t-test; *p ⁇ 0.05 relative to control);
- Figure 5 shows the results of SNP analysis for MAP2K7 in human blood samples from schizophrenic patients and controls. Results are analysed using two complementary statistical tests - Fisher's exact test and the trend test. The genotype is shown on the abscissa, and frequency of detection on the ordinate;
- Figure 6 shows the results of SNP analysis for MAP2K7, in pooled data from Glasgow and London blood samples, from schizophrenia patients and controls. Results are analysed using two complementary statistic tests — Fisher's exact test and the trend test. The genotype is shown on the abscissa, and frequency of detection on the ordinate;
- FIG. 7 shows the interaction of CamKIV with PPMlE and PPMlF in neuronal cells.
- NGl 08-15 neuronal cells were transfected with combinations of vectors expressing FLAG-tagged-PPMIE, FLAG-tagged-PPMlF or a constitutively active truncated mutant of CamKIV (caCamKIV). Following immunoprecipitation of the FLAG tag.
- CamKIV was detected by western blotting. The presence of a band representing either endogenous CamKIV or transfected caCamKIV indicates a physical interaction with PPM1E/PPM1F.
- endogenous CamKIV interacts with PPMlF
- active CamKIV interacts with both PPMlE and PPMlF;
- Figure 8a and b shows recombinant human PPMlE and PPMlF purified from E. coli. Purification of the arrowed His-tagged protein was confirmed by western blotting with peroxidase-conjugated anti-His antibody (data not shown).
- M, El and E2 stand for Molecular weight marker, eluted fraction with 150 mM imidazole and eluted fraction with 200 mM imidazole, respectively;
- Figure 9 shows measurement of phosphatase activity of recombinant human PPMlE by BIOMOL GREEN
- Figure 10 shows measurement of phosphatase activity of recombinant human PPMlE by AlphaScreen Phosphosensor kit
- Figure 11 shows measurement of phosphatase activity of recombinant human PPMlE by the principle of HTRF.
- Chronic PCP Treatment- Male hooded Long Evans rats (approximately 30Og at the start of the study) were randomly assigned into two treatment groups: chronic PCP (2.58mg/kg PCP.HC1) and chronic vehicle (saline 1 ml/kg).
- the rats were treated according to the YRING chronic PCP model (Cochran et al., 2003) (i.p. injections once daily for five days, then once every 72 hours for a further 3 weeks) and killed by cervical dislocation 72 hours after the last injection.
- the brains were removed and the prefrontal cortex dissected.
- Microarray analysis - Sample information and Preparation of total RNA
- RG-U34A-C Affymetrix GeneChips were used for the rat chronic PCP microarray study.
- HG-Ul 33 A Affymetrix GeneChips were used for the human post mortem microaray study. Affymetrix protocols were followed for sample labelling. GeneChip hybridisation and scanning. Microarray data analysis
- RMA Robot Multi-Array Average Expression Measure
- Probe-specific background was corrected to compensate for nonspecific binding using PM (Perfect Matching signal) distribution rather than PM-MM (Mismatching signal) values;
- SAM Signal Analysis of Microarrays
- First strand cDNAs were generated by reverse transcription using 2 ⁇ g of human or rat prefrontal cortex total RNA used for the microarray study, Superscript II RNaseH- Reverse Transcriptase (Invitrogen) and a Hexanucleotide Mix (Roche) in a reaction volume of 20 ⁇ l.
- This 1st strand cDNA synthesis was diluted 1/20 to a final volume of 400 ⁇ l and then 2.5 ⁇ l was amplified using Universal Master Mix (ABI), gene-specific Assays-on-Demand (ABI) and the SDS7000 (ABI).
- ABSI Universal Master Mix
- ANCPVA gene-specific Assays-on-Demand
- SDS7000 SDS7000
- NCKl over-expression in NG 108- 15 cells -
- NG108-15 cells were plated at a cell density of 2 x 10 5 cells in 1 ml DMEM (Gibco) and 10 % FBS (Gibco) without antibiotic into two 12 well plates and allowed to grow overnight at 37°C, 5 % CO 2 .
- DNA was diluted in 100 ⁇ l of serum free DMEM and mixed gently.
- Lipofectamine 2000 reagent (Invitrogen) was mixed before use and diluted in 100 ⁇ l of serum free DMEM and mixed gently. The reagent was incubated at room temperature for 5 minutes. The diluted DNA was then added to the diluted lipofectamine, mixed gently and incubated at room temperature for 20 minutes.
- the cortex was dissected from 6 NcM -I- KO and 6 ICR +/+ wild-type control mice.
- Western blots of Nckl KO -/- mice:
- PCR -based assays were designed for NCBI SNP rs4804833.
- the primers were Fr4 (GTCGGTTCCTAGCCATCTCTGCAG) with Rr4
- Fr4/Rr4 could amplify PCR fragments that could/could not be cleaved with BsiEI at the site of the SNP, depending on the alleles present. Therefore, the second assay for MAP2K7 was by RFLP using Fr4/Rr4 in conjunction with BsiEI.
- Human PPMlE cDNA (GenBank Accession number NM_014906) was inserted into pET30a to generate His-PPMIE, which encodes full-length PPMlE with an N-terminal His-tag.
- This construct was transformed into E. coli strain BL21(DE3).
- the transformed bacteria were grown in LB medium, and then isopropyl- ⁇ -D- thiogalactopyranoside was added to a final concentration of 0.5 mM.
- the bacteria were harvested by centrifugation and the harvested cell pellets were suspended in 10 mM Tris-HCl (pH 7.4) containing 150 mM NaCl (TBS), and then disrupted by sonication. The extract was cleared by centrifugation, and the supernatants were used for the purification of recombinant proteins using Talon Co2+ column chromatography according to the manufacturer's instruction (Clontech).
- BIOMOL GREEN Four kinds of assay development, BIOMOL GREEN, a Screen and HTRF for the measurement of purified human recombinant PPMlE phosphatase activity were conducted.
- BIOMOL GREEN reagent was purchased from BIOMOL International. Phosphatase assay was carried out at RT for lhr using purified PPMlE and biotinylated pThr-CaMKIV peptide. The reaction was stopped by adding BIOMOL GREEN reagent to capture the released Pi from the peptide. The mixture was allowed to stand at RT for 20 min, then the absorbance at 620 nm was measured. Increase of the value at 620 nm means increase of Pi released from biotinylated pThr-CaMKIV peptide by phosphatase activity of PPMlE ( Figure 9).
- AlphaScreen Phosphosensor kit was purchased from PerkinElmer. Phosphatase assay was carried out at RT for lhr using purified PPMlE and biotinylated pThr-CaMKIV peptide. According to manufacturer' instruction (PerkinElmer), the mixture in which streptavidin donor beads and phosphosensor acceptor beads were added to capture biotinylated pThr-CaMKIV peptide allowed to stand at RT for lhr in the dark room. After incubation a signal was measured by
- Streptavidin-XL ent! and Anti-phospho Threonine Polyclonal antibody cryptate were purchased from CIS bio International. Phosphatase assay was carried out at RT for lhr using purified PPMlE and biotinylated pThr-CaMKIV peptide. According to manufacturer' instruction (CIS bio International), the mixture in which Streptavidin- XL e ⁇ ti and Anti-phospho Threonine Polyclonal antibody cryptate were added to capture biotinylated pThr-CaMKIV peptide allowed to stand at 4°C overnight. After incubation FRET was measured by Analyst GT (Molecular Devices). Decrease of the FRET value means decrease of pThr-CaMKIV peptide by phosphatase activity of PPMlE ( Figure 11). Semi-quantitative 2-deoxyglucose autoradiography:-
- mice Adult NcM -I- KO and ICR +/+ wild-type control mice were used for this study. At 5 minute intervals, a mouse was placed in a cylindrical restrainer and its tail immersed in warm water (to aid visualization of the tail veins) for 5 mins. A bolus dose of [14-C] -2-deoxyglucose ([14-C]-2-DG; 120 ⁇ Ci/Kg) was then administered via the lateral tail vein. The mouse was then placed in a normal home cage. 45mins later the mouse was replaced in the cylindrical restrainer and killed by an overdose of pentobarbitone (Saggital, 42mg/kg) via the lateral tail vein.
- pentobarbitone Saggital, 42mg/kg
- the brain was removed and frozen at -42C in isopentane cooled by dry ice and then stored at -70C.
- the brain was sectioned at -20C on a cryostat (Leica), with 3 adjacent 20 ⁇ m sections being collected onto coverslips simultaneously every 200 ⁇ m throughout the brain.
- the sections were immediately dried on a hotplate at 6OC for 5mins to prevent diffusion of the isotope.
- the sections were then glued to cardboard and exposed to x-ray film (Biomax MRl, Kodak) with [14-C]-methylmethacrylate tissue standards for 2 days. Films were analysed using the MCID 5 computer based densitometry system. Tissue concentrations of [14-CJ-2-DG were measured in discrete brain regions and 2-DG uptake calculated as follows:
- a microarray screen was conducted, monitoring the expression of around 20,000 transcripts — theoretically the majority of the transcriptome - in prefrontal cortex of rats treated chronically with PCP according to our model (Cochran et al., 2003), as compared to rats treated chronically with vehicle.
- 327 transcripts were detected as significantly differentially-expressed in the prefrontal cortex after PCP treatment, as compared to vehicle treatment.
- a parallel comprehensive microarray screen was then conducted, monitoring the expression of around 20,000 transcripts in post-mortem prefrontal cortex tissue (Brodmann area 10) from schizophrenia patients, as compared to equivalent tissue from control subjects.
- the subjects were matched for age, gender and post-mortem delay.
- 961 transcripts were detected as significantly differentially- expressed in the prefrontal cortex in schizophrenic patients, as compared to control subjects.
- MAP kinase mitogen-activated protein kinase
- a triggering signal phosphorylates and activates a MAP4K, which then leads to sequential phosphorylation of a MAP3K, a MAP2K, and a MAPK.
- genes identified in their screens the investigators noted the presence of a set of genes that are likely to be functionally linked to each other. These genes, with their synonyms, are listed in Table 3.
- MAPK9 also known as JNK2
- MAP2K7 also known as MKK7
- the activation of MAPK9 by MAP2K7 is relatively selective (Fleming et ah, 2000; Machida et ah, 2004).
- MAP2K7 in turn is phosphorylated and activated by MAP3K7 (also known as TAKl), which itself is phosphorylated and activated by MAP4K4 (also known as HPK/GCK-like kinase - HGK, or Nck-interacting kinase - NIK) (Yao et al., 1999).
- MAP4K4 interacts with the scaffolding protein Nckl, leading specifically to the activation of MAPK9 (Machida et al., 2004).
- Nckl scaffolding protein
- Another MAP4K - Traf2 and Nck-interacting kinase (TNIK, or KIAA0551) also reportedly interacts with Nek and activates JNKs such as MAPK9 (Fu et al., 1999).
- Nckl In addition to MAP4K4 and TNIK, Nckl also binds other scaffolding molecules such as GRB-associated proteins 1 & 2 (Gabl & Gab2) and Crk-like protein (CrkL). CrkL over-expression can induce activation of JNKs such as MAPK9 (Ling et al., 1999). Nckl over-expression in non-neuronal cells increases the activity of MAPK9 (JNK2) but not MAPK8 (JNKl) (Mizuno et al., 2002) suggesting that Nckl function, like that of MAP2K7, is specifically linked to MAPK9 activation.
- JNK2 MAPK9
- Nckl over-expression also alters the activity of another kinase PAKl (Poitras et al., 2003), and PAKl has been implicated in the regulation of JNK activity (Brown et al., 1996). Thus Nckl can mediate parallel activation of PAKl and JNKs (Schmitz et al., 2001).
- PTK2B protein tyrosine kinase 2B, also known as PYK2
- PYK2B protein tyrosine kinase 2B, also known as PYK2
- JNKs c-jun N-terminal kinases
- MAPK9 c-jun N-terminal kinases
- the small GTPase regulatory protein RICS also known as GRIT or GC-GAP
- CrkL Nonmura et al., 2002
- Gabl and Gab2 Zhao et al., 2003
- NMDA receptor - dependent signalling can be predicted to propagate to Gabl and Gab2.
- CamKIV is activated by NMDA receptor stimulation via CamKK, and potentiates activation of JNKs such as MAPK9 (Enslen et al., 1996).
- PPMlE and PPMlF have recently been identified as phosphatases that suppress the activity of both PAKl (Koh et al, 2002) and CamK4 (Tan et al., 2001), and hence are intimately linked to the other proteins in this pathway. Indeed the direct interaction of CamKIV with PPMlE and PPMlF is neuronal cells was confirmed (see Figure 7).
- RT-qPCR real-time quantitative reverse-transcriptase PCR
- MAPK9 has also been functionally linked to NMDA signalling, and in particular to the long-term effects of NMDA receptor stimulation on network activity in the hippocampus and cortex (Chen et al., 2005). Hence one of the predicted consequences of Pyk-Nck-Jnk hypofunction in schizophrenia (as indicated by the present) is reduced NMDA receptor-dependent network activity.
- Nckl potentially has a central role in co-ordinating the various proteins of the Pky-Nck- Jnk pathway
- the investigators tested the hypothesis that manipulating the level of Nckl expression in cultured neuronal cells would alter the level of JNK activity. It was found that over-expression of exogenous Nckl in the neurones elevated JNK activity, as assessed by a phosphor- JNK specific ELISA ( Figure 3).
- mice with altered Pyk-Nck-Jnk activity should show some of the neurochemical and metabolic changes characteristic of the disease.
- Mice were obtained with a targeted deletion of the Nckl gene (Nckl knockout mice) from the laboratory of Prof. T. Pawson, Samuel Lunenfield Research Institute, Mt. Sinai Hospital, Toronto (Bladt et al., 2003). Relative to control mice, these mice seemed overtly normal.
- Schizophrenia patients show a highly characteristic pattern of altered metabolic activity in the CNS, as assessed by de-oxyglucose imaging or functional MRI. This pattern involves decreased activity in the prefrontal cortex relative to normal subjects (hypofrontality) and increased activity in parts of the auditory system during hallucinations (Tamminga et al., 1992; Wolkin et al., 1992; Shergill et al, 2000).
- As a final test of the potential of Pyk-Nck-Jnk pathway dysfunction to cause the symptoms of schizophrenia we assessed metabolic activity in the CNS of mice with a deleted Nckl gene, relative to controls, by de-oxyglucose imaging. We found a pattern of altered metabolic activity that matched that observed in patients with schizophrenia, encompassing hypofrontality (Figure 4b) and increased auditory system activity (Figure 4c).
- MAP2K7 as a gene with a central role in Pyk-Nck-Jnk pathway function, and assessed the prevalence of single nucleotide polymorphisms (SNPs) in DNA from schizophrenia patients and control subjects.
- SNPs single nucleotide polymorphisms
- Table 1 Relative changes in expression of Pyk-Nck-Jnk pathway genes, in prefrontal cortex, in rats treated chronically with PCP, relative to corresponding controls, as assessed by rmcroarray analysis.
- Table 2 Relative changes in expression of Pyk-Nck-Jnk pathway genes, in prefrontal cortex, in schizophrenic patients, relative to corresponding controls, as assessed by microarray analysis.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to the identification of genes involved and/or associated with schizophrenia and related diseases, as well as particular identified genes and their potential use in therapy/diagnosis of schizophrenia and related diseases. The genes are all linked to a MAP-kinase signalling chain and are PPMlE; PPMlF,- MAP2K7; MAPK9; RICS/GRIT; PTK2B/PYK2; Gab1; Gab2; Nckl; NckAPI; CrkL; PAKI; CatnKK; CAMK4; MAP4K4; TNIK; MAP3K7; and MAPK8ip1.
Description
NOVEL SCHIZOPHRENIA ASSOCIATED GENES
Field of the Invention
The present invention relates to the identification of genes involved and/or associated with schizophrenia and related diseases, as well as particular identified genes and their potential use in therapy/diagnosis of schizophrenia and related diseases.
Background to the Invention
Schizophrenia is a devastating mental illness which affects 1% of the world population, the aetiology of which remains elusive. There is known to be a strong genetic component to the disease, with incidence rising to between 10% and 49% in those with close relatives suffering from the disease. However, to date, there is a poor understanding of the genes involved.
Schizophrenia is characterised by positive symptoms (such as hallucinations and delusions), negative symptoms, (such as social withdrawal, anhedonia and self- neglect) and cognitive deficits (including impairments in executive function and attention). The majority of patients exhibit the first psychotic episode at around 16 — 26 years of age, and thereafter are unlikely ever to make a full recovery. Most patients remain considerably impaired for the rest of their lives, and a high proportion commit suicide, despite treatment with current antipsychotic medication.
A few specific neurobiological features have been identified in the CNS of patients with schizophrenia. As compared to control subjects, schizophrenic patients exhibit a lower metabolic activity in the prefrontal cortex when performing a cognitive task (Tamminga et al., 1992). This metabolic "hypofrontality", generally
accompanied by parallel alterations in metabolic activity in the temporal cortex and hippocampus, is highly characteristic of schizophrenia. In addition, post-mortem studies have revealed a selective loss of a particular population of inhibitory interneurones - parvalbumin-containing GABAergic interneurones (axo-axonic or "chandelier" cells) - in the prefrontal cortex and hippocampus from patients with schizophrenia (Beasley & Reynolds, 1997; Lewis et al., 1999). This regionally specific pathology focuses attention on the prefrontal cortex as a major site of dysfunction in schizophrenia, and is consistent with evidence that many of the cognitive tasks where patients show deficits are dependent on prefrontal cortex function. In addition, the severity of negative symptoms and cognitive deficits has been shown to correlate with the degree of metabolic hypofrontality in the prefrontal cortex (Hill et al., 2994; Wolkin et al., 1985; Wolkin et al., 1992).
Existing antipsychotic drugs show considerable efficacy against the positive symptoms, but are relatively ineffective against the negative symptoms and cognitive deficits, which arguably represent the major long-term barrier to the patients resuming something that approaches a normal lifestyle (Goldberg et al., 1993). In addition, all current anti-psychotic drugs display a variety of unpleasant side-effects, including parkinsonism, dysphoria, weight-gain, hypotension or sedation. One of the major goals of modern drug development is to produce a novel antipsychotic drug which is more effective in ameliorating the negative symptoms and cognitive deficits characteristic of schizophrenia than existing therapies. The development of improved antipsychotic drugs which will have superior action against the negative symptoms and cognitive dysfunction has been severely hampered by the lack of knowledge of which genes are involved and/or associated with schizophrenia. The hope is that an understanding of the causes of schizophrenia will ultimately lead to markedly
improved drug therapies aimed at curing the disease rather than treating some of the symptoms.
The discovery of novel therapeutic strategies for treating schizophrenia has received a dramatic boost from the recent discovery of a viable animal model of the disease (Cochran et al., 2003; Morris et al., 2005). The model exploits the clinical properties of the psychotogenic drug phencyclidine (PCP). When PCP is chronically abused by humans, it induces a range of symptoms virtually indistinguishable from schizophrenia, including positive and negative symptoms, and also cognitive deficits (Allen & Young, 1978). Since PCP is an antagonist of the NMDA class of glutamate receptor (Morris et al., 2005), this has led to intense interest in the possibility that glutamatergic hypoactivity might contribute to the aetiology of schizophrenia (Tamminga, 1998). Indeed, evidence that the levels of NMDA receptors are increased in the cortex of patients with schizophrenia tends to support this view (Dracheva et al., 2001; Ishimaru et al., 1994). In the animal model of schizophrenia, rats are treated chronically with a specific dose of PCP. The treatment induces metabolic hypofrontality, altered hippocampal metabolic activity, chandelier cell dysfunction, including reduced parvalbumin expression, and deficits in prefrontal cortex-dependent cognitive tasks which have been designed to mirror those where schizophrenic patients show deficits (Morris et al., 2005). Thus this animal model accurately reproduces in rats the clinical profile of the disease in humans.
Little is known about the genes that cause schizophrenia, or more specifically any alteration of expression/mutation of genes in a patient suffering from schizophrenia.
It is amongst the objects of the present invention to identify one or more genes, the altered expression of which are associated with schizophrenia.
Summary of the Invention
The present invention is based on experiments which were designed to identify genes potentially contributing to the aetiology of schizophrenia, using prefrontal cortex tissue from rats treated according to the model of Cochran et al (2003), and post-mortem prefrontal cortex tissue from patients with schizophrenia, and controls.
In certain embodiments, the present invention relates to the differential expression of certain genes, notably certain kinases, and how proteins expressed from these genes, or the differential expression of these genes, may be used to screen for compounds which may modulate the activity or the expression of the differentially expressed genes, or measure an effect a compound may have on the expression of such differentially expressed genes in an animal model of schizophrenia. It may also be possible to use the information as a prognostic or diagnostic marker for schizophrenia.
In a first aspect there is provided a method of screening a compound for treating schizophrenia, which comprises:
(a) bringing a test compound into contact with a wild type cell or transformed cell which is capable of expressing one or more schizophrenia-associated genes selected from the group consisting of PPMlE; PPMlF; MAP2K7; MAPK9; RICS/GRIT; PTK2B/PYK2; Gabl; Gab2; Nckl; NckAPI; CrkL; PAKl; CamKK; CAMK4; MAP4K4; TNIK; MAP3K7; and MAPOipl;
(b) detecting a level of expression or activity of said one or more schizophrenia-associated gene(s)/protein(s) in said cell; and
(c) selecting a compound which promotes or suppresses expression or activity of the schizophrenia-associated gene/protein in comparison with a control (vehicle).
There is also provided a method for measuring an anti-schizophrenia effect of a compound using an animal model of schizophrenia, which comprises:
(a) administering the compound to an animal model displaying characteristics of schizophrenia;
(b) detecting a level of expression or activity of one or more genes/proteins selected from the group consisting of PPMlE; PPMlF; MAP2K7; MAPK9; RICS/GRIT; PTK2B/PYK2; Gabl; Gab2; Nckl; NcIcAPI; CrkL; PAKl ; CamKK; CAMK4; MAP4K4; TNIK; MAP3K7; and MAPKδipl;
(c) comparing the level of expression or activity of said one or more genes/proteins with a level of expression or activity of said one or more genes/proteins in a further control animal displaying characteristics of schizophrenia, but which has not been administered the compound; and
(d) selecting compounds for further evaluation as potential anti- schizophrenia agents, which modulate expression or activity of said one or more genes/proteins, in comparison to the control animal.
It is to be understood that the term schizophrenia as used herein, relates to schizophrenia and other related disorders such as bipolar affective disorder, brief psychotic disorder, schizophrenia form disorder, schizopaffective disorder and the like.
The term "expression" means allowing or causing the information in a gene or DNA sequence to become manifest, for example, by producing mRNA or a protein. The level of "expression" can easily be detected by methods known to the skilled
addressing including hybridisation studies, quantitative PCR, northern and western blotting, techniques and immunoassays. See for example Sambrook et al, 2000.
It may also be appropriate to detect a level of expression of variant of the gene, which may lead to an alteration in the level of activity of the resulting protein.
Allelic variants are usually observed by comparing their nucleotide or (in the case of variant polypeptides) amino acid sequences to a common "wild-type" or "reference" sequence. Thus, a "wild-type" or "reference" allele of a gene refers to that allele of a gene having a genomic sequence designated as the wild-type sequence and/or encoding a polypeptide having an amino acid sequence that is also designated as a wild-type sequence. The wild-type allele may be arbitrarily selected from any of the different alleles that may exist for a particular gene. However, the allele is most typically selected to be the allele which is most prevalent in a population of individuals.
The level of activity of the protein may be the ability of the protein to interact with a different protein or ligand and this can be detected by enzyme assays and ligand/protein binding assays, known in the art.
For example, JNK activity is typically measured by directly monitoring the amount of phosphorylated JNK in a tissue or cell extract using phosphorylation-state- specific antisera (e.g. Mizuno et al., 2002; Machida et al., 2004). Alternatively a tissue or cell extract is incubated with c-jun or ATF3 protein, or with synthetic peptides corresponding to the sites of phosphorylation of these proteins, either in the presence of 32P-ATP, so that the incorporation of 32P into the c-jun or ATF3 protein can be monitored, or in the presence of unlabelled ATP, in which case the levels of phosphorylated c-jun or ATF3 are monitored via phosphor-specific antisera for these proteins (e.g. Poitras et al., 2003). Similarly, MAP2K7 activity is typically measured
by directly monitoring the amount of phosphorylated MAP2K7 in a tissue or cell extract using phosphorylation-state-specifϊc antisera. Alternatively a tissue or cell extract is incubated with JNKl or JNK2, along with c-jun or ATF3 protein, or with synthetic peptides corresponding to the sites of phosphorylation of these proteins, either in the presence of 32P-ATP, so that the incorporation of 32P into the c-jun or ATF3 protein can be monitored, or in the presence of unlabelled ATP, in which case the levels of phosphorylated c-jun or ATF3 are monitored via phosphor-specific antisera for these proteins (e.g. Fleming et al., 2000). MAP3K7 activity can be measured by directly monitoring the amount of phosphorylated MAP3K7 in a tissue or cell extract using phosphorylation-state-specifϊc antisera. Alternatively a tissue or cell extract is incubated with MKK7, or with synthetic peptides corresponding to the sites of phosphorylation of this protein, either in the presence of 32P-ATP, so that the incorporation of P into the MKK7 protein can be monitored, or in the presence of unlabelled ATP, in which case the levels of phosphorylated MKK7 are monitored via phosphor-specific antisera. Activity of MAP4K4 or TNIK can be measured by directly monitoring the amount of phosphorylated MAP3K7 in a tissue or cell extract using phosphorylation-state-specifϊc antisera. Activity of MAP4K4 or TNIK can also be assessed by incubating a tissue or cell extract with MAP3K7, and monitoring the activity of MAP3K7 as above (eg Yao et al., 1999; Fu et al., 1999). PAKl activity can be measured by directly monitoring the amount of phosphorylated PAKl in a tissue or cell extract using phosphorylation-state-specifϊc antisera (e.g. Koh et al., 2002). Alternatively a tissue or cell extract is incubated with tyrosine hydroxylase or myelin basic protein, or with synthetic peptides corresponding to the sites of phosphorylation of these proteins, either in the presence of 32P-ATP, so that the incorporation of 32P into the tyrosine hydroxylase or myelin basic protein can be
monitored, or in the presence of unlabelled ATP, in which case the levels of phosphorylated tyrosine hydroxylase or myelin basic protein are monitored via phosphor-specific antisera (e.g. Poitras et al., 2003). CamKIV activity can be measured by directly monitoring the amount of phosphorylated CamKIV in a tissue or cell extract using phosphorylation-state-specific antisera. Alternatively a tissue or cell extract is incubated with CREB or CamKII-gamma, or with synthetic peptides corresponding to the sites of phosphorylation of CREB or CamKII-gamma, either in the presence of P-ATP, so that the incorporation of P into the CREB or CamKII- gamma can be monitored, or in the presence of unlabelled ATP, in which case the levels of phosphorylated CREB or CamKII-gamma are monitored via phosphor- specific antisera (e.g. Enslen et al., 1996). PPMlE and PPMlF activity can be measured by directly monitoring the amount of phosphorylated PPMlE or PPMlF in a tissue or cell extract using phosphorylation-state-specific antisera. Alternatively a tissue or cell extract is incubated with PAKl, CamKIV or CamKII, which have been previously phosphorylated with 32P derived from 32P-ATP via the action of CaMK kinase, or with synthetic phosphor-peptides corresponding to the sites of phosphorylation of PAKl, CamKIV or CamKII. The release of 32P can then be monitored, or alternatively the reduction in the levels of phosphorylated PAKl, CamKIV or CamKII are monitored via phospho-specific antisera (e.g. Koh et al., 2002; Tan et al., 2001).
Detection of protein may typically be carried out using labelling of the protein with an appropriate marker molecule. For example a labelled or unlabelled antibody or other binding agent specific for the particular protein may be used, to bind the protein and allow its detection. If an unlabelled antibody or other binding agent is used, it will be necessary to employ a labelling agent designed to bind to the antibody
or binding agent, in order to allow detection. It may also be necessary to first permeabilise or lyse the cells in order to allow the proteins to be detected and many techniques for achieving this are known to the skilled man. Moreover, as some of the proteins identified herein are kinases, antibodies or specific binding agents which are able to bind to the phosphorylated or non-phosphorylated forms of the kinases substrate, may be used, in order to detect a level of kinase activity.
As described in more detail hereinafter, the inventors have identified a number of associated genes/proteins (PPMlE; PPMlF; MAP2K7; MAPK9; RICS/GRIT; PTK2B/PYK2; Gabl; Gab2; Nckl; NckAPI; CrkL; PAKl; CamKK; CAMK4; MAP4K4; TNIK; MAP3K7; and MAPOipl) which may be differentially expressed in a schizophrenic subject. Thus, detection of the level of expression or activity of one or more of these genes/proteins in a cell or animal, in comparison to a control sample, may be used to screen compounds for potential use as anti-schizophrenia drugs.
Generally speaking, the more genes/proteins which are included in any test may lead to an improved test. Thus, the method may preferably include at least 2, 3, 4, 5, 10, 15 or all of the aforementioned genes identified herein. Preferred sets of genes, the differential expression of which, whether up or down with respect to a control, are identified in Tables 1 and 2 and a particularly preferred sub-set of genes comprise one or more of the MAP kinases identified (e.g. MAP2K7, MAPK9, MAP3K7 and/or MAP4K4).
The present invention also provides methods for identifying, evaluating, and/or monitoring drug candidates for the treatment of schizophrenia. According to the invention, a candidate drug may be assayed for its ability to modulate the expression or activity of one or more of the genes/proteins identified herein. For
example, a specific drug may increase or decrease the expression or activity of one or more of the genes/proteins identified herein.
Moreover, there may be existing drugs or chemical entities, such as small molecules or peptides etc. which are already known to have an effect on the expression on one or more of the genes/proteins identified hereinabove, but not in the context of being associated with Schizophrenia. As such, it would not be appropriate to use such drugs/chemical entities as potential anti-Schizophrenia agents.
Thus, in a further aspect the present invention provides use of a agent which is capable of modulating activity or expression of one or more of the genes/proteins identified herein, for the manufacture of a medicament for treating Schizophrenia and/or Schizophrenia associated disorders.
There is also provided a method of treating Schizophrenia and/or Schizophrenia associated disorders comprising the step of administering an agent, to a subject in need thereof, which is capable of modulating the activity or expression of one or more of the genes/proteins identified herein so as to treat Schizophrenia and/or a Schizophrenia associated disorder.
Of course an existing/known chemical entity active on one or more of said genes/proteins could be administered to the described animal model in order to observe and effect on the behaviour of the animal.
It is also possible to evaluate, or study the biological function of the genes identified herein and this can be assessed by utilizing relevant in vivo and in vitro systems. In vivo systems can include, but are not limited to, animal systems which naturally exhibit the symptoms of schizophrenia, or ones which have been developed to exhibit such symptoms, as for example the model described in WOO 1/75440. Further, such systems can include, but are not limited to transgenic animals systems.
In vitro systems can include, but are not limited to, cell-based systems comprising the identified gene/polypeptide expressing cell types. The cells can be wild type cells, or can be non-wild type cells containing modifications known or suspected of contributing to schizophrenia.
In further characterising the biological function of said identified gene(s), the expression of said identified gene(s) can be modulated within the in vivo and/or in vitro systems, i.e. either overexpressed or underexpressed in, for example, transgenic animals and/or cell lines, and the subsequent effect on the system can then be assayed.
Alternatively, the activity of the product of the identified gene can be modulated by either increasing or decreasing the level of activity in the in vivo and/or in vitro system of interest, and its subsequent effect then assayed.
The information obtained through such characterisations can suggest relevant methods for the treatment or control of schizophrenia. For example, relevant treatment can include a modulation of gene expression and/or gene product activity. Characterisation procedures such as those described herein can indicate whether such modulation should be positive or negative. As used herein, "positive modulation" refers to an increase in gene expression or activity of the gene or gene product of interest. "Negative modulation", as used herein, refers to a decrease in gene expression or activity.
For example, it can be seen from the results presented herein, that the identified genes/proteins are differentially expressed (see Table 2), that is, increased or decreased in expression in tissue from schizophrenic patients, as compared to non- schizophrenic patients. It may therefore be appropriate to seek to correct such differential expression by either up-regulating or down-regulating, in some manner, the expression of one or more of said identified genes.
For genes/proteins which are expressed to a lesser degree in schizophrenic patients as compared to non-schizophrenic patients, it may be possible to redress this imbalance using gene therapy techniques, or simply by administering the relevant proteins to the subject. With regards to gene therapy, the skilled addressee is well aware of suitable vector constructs, such as adeno associated virus vector constructs which may be administered to a subject to cause expression of a chosen gene. Appropriate promoters may also be used to control expression of the cloned gene in specific cell types and/or at certain times.
With regards to down-regulation of gene expression, this may be achieved by way of, for example, RNAi techniques known in the art.
It will be appreciated that all such techniques may first be applied to an appropriate schizophrenia animal model, in order to determine their efficacy, before turning to human schizophrenic patients.
In vitro systems can be designed to identify compounds capable of binding said identified gene(s) products of the invention. Compounds identified can be useful, for example, in modulating the activity of wild type and/or mutant gene(s) products, can be useful in elaborating the biological function of said identified gene(s) products, or can disrupt normal identified gene(s) product interactions.
In one embodiment, a candidate drug may be added to cells or sample tissue prior to analysis. Preferred cells are cell lines grown from tissue, particular brain tissue, e.g. prefrontal cortex tissue from schizophrenic subjects. Alternatively, cells isolated from the brain of the PCP rat model described in WOO 1/75440 may be employed.
In another embodiment, the invention provides screens for a candidate drug which modulates gene expression and/or protein activity of said one or more disclosed genes/proteins in brain tissue, or interferes or enhances the binding of said one or more proteins to its substrate.
The term "candidate drug" or equivalent as used herein describes any molecule, e.g. an antibody or antibody fragment, aptamer protein, oligopeptide, fatty acid, steroid, small organic molecule, polysaccharide, polynucleotide, RNAi molecule, antisense molecule, ligand, bioactive partner and structural analogs or combinations or conjugates thereof, to be tested for candidate drugs that are capable of directly or indirectly altering the activity or the expression of said one or more genes/proteins. Such candidate drugs may also be administered in combination with an agent designed to facilitate entry into a cell and many such agents are known in the art.
In a further aspect there is provided a method of prognosis or diagnosis of schizophrenia comprising the steps of: a) providing a tissue or body fluid sample from a test subject; b) detecting a level of expression or level of activity of one or more of the following genes/proteins PPMlE; PPMlF; MAP2K7; MAPK9; RICS/GRIT; PTK2B/PYK2; Gabl; Gab2; Nckl; NcIcAPI; CrkL; PAKl; CamKK; CAMK4; MAP4K4; TNIK; MAP3K7; and MAPKδipl in a cell or cells from said sample; and c) comparing the level of expression or level of activity of said one or more genes/proteins with a level of expression or level of activity of said one or more genes/proteins in a control sample from a subject not suffering or predisposed to suffering from schizophrenia.
Typical body fluid samples include blood, serum, urine, cerebrospinal fluid (CSF), saliva, etc. Suitable tissue samples include buccal cells and skin.
Moreover, a gene sequence may comprise a mutation or polymorphism, with respect to the wild-type sequence and the level of expression of such a mutant or polymorphic sequence may also be detected, by for example, hybridisation, quantitative PCR, electrophoretic mobility, or nucleic acid sequence studies, known in the art.
The term "polymorphism" refers, generally, to the coexistence of more than one form of a gene (e.g., more than one allele) within a population of individuals. The different alleles may differ at one or more positions of their nucleic acid sequences, which are referred to herein as "polymorphic locuses". When used herein to describe polypeptides that are encoded by different alleles of a gene, the term "polymorphic locus" also refers to the positions in an amino acid sequence that differ among variant polypeptides encoded by different alleles.
The polymorphisms of the present invention include "single nucleotide polymorphisms" (SNPs) and microsatellite repeats. The term SNP refers to a polymorphic site occupied by a single nucleotide, which is the site of variation between allelic sequences. Typically, the polymorphic site of an SNP is flanked by highly conserved sequences (e.g., sequences that vary in less than 1/100 and, more preferably, in less than 1/1000 individuals in a population). The polymorphic locus of an SNP may be a single base deletion, a single base insertion, or a single base substitution. Single base substitutes are most typical.
Prediction of whether or not a test subject is likely to have or be predisposed to developing schizophrenia, may be based on a profile of expression and this may be carried out using appropriate computer software.
The present invention therefore also provides arrays of gene expression detection agents for use in the method of the present invention.
Thus, in a further aspect, there is provided a DNA array for use in a method according to the present invention the array comprising or consisting essentially of one or more of the following genes or sequence specific fragments thereof: PPMlE; PPMlF; MAP2K7; MAPK9; RICS/GRIT; PTK2B/PYK2; Gabl; Gab2; Nckl; NckAPI; CrkL; PAKl ; CamKK; CAMK4; MAP4K4; TNIK; MAP3K7; and MAPKSipl, the array being immobilised on a support.
Preferably the array is a microarray. Advantageously the array or microarray is prepared on any suitable, preferably non-porous substrate. Typically the suitable substrate may include glass or a plastic material. Information regarding suitable substrates and the protocols used to generate arrays or microarrays may be obtained from the National Human Genome Research Institute, Bethesda USA.
Generally the surface of the suitable microarray substrate is treated in someway so that nucleic acid specific to said genes, that is nucleic acid corresponding to said gene or specific fragment thereof may be coupled to it. For example the surface of the suitable substrate may be made hydrophobic so as to prevent spread of individual nucleic acid samples applied to the microarray substrate and positively charged so as to facilitate the coupling of the nucleic acid to the microarray substrates. Such a hydrophobic/positively charged surface may be obtained by use of a substance such as poly-L-lysine.
After such preparation of the microarray substrate, the nucleic acid fragments may be spotted on to the surface as an array. Preferably automated printing procedures known in the art may be utilised to apply the nucleic acid fragments as an array.
Preferred gene expression detection agents hybridise specifically to the genes identified herein whose expression is correlated with having or being disposed to developing schizophrenia. Such agents may be RNA, DNA or PNA molecules. Preferred agents are fragments of the above-identified genes, e.g. oligonucleotides specific therefore. Alternative agents may bind specifically to the protein expression products of the marker genes disclosed herein. Preferred agents include antibodies and aptamers.
Agents, such as oligonucleotides, are preferably attached to a solid support in the form of an array. Olignucleotide arrays in the form of DNA microarrays and useful hybridisation assays are known in the art and disclosed for example in US Patent Nos. 5,631,734; 5,874,219; 5,861,242; 5,585,659; 5,856,174; 5,843,655; 5,837,832; 5,834,758; 5,770,722; 5,770,456; 5,733,729; 5,556,752; 6,045,996 and 6,261,776. In a preferred embodiment, an array includes oligonucleotides for measuring the expression level of the genes identified herein. However, it is also possible to use cDNAs or PCR products for probes.
The present invention further provides a database of said identified genes and information about the said genes, including the expression levels that are characteristic of schizophrenic and non-schizophrenic subjects. According to the invention, said gene information is preferably stored in a memory in a computer system. Alternatively, the information is stored in a removable data medium such as a magnetic disk, a CDROM, a tape, or an optical disk. In a further embodiment, the input/output of the computer system can be attached to a network and the information about the identified genes can be transmitted across the network.
Preferred information includes the identify of the genes identified herein, the differential expression of which correlates with an expected diagnosis or prognosis to developing schizophrenia. In addition, reference expression levels of said genes may be stored in a memory or on a removable data medium. According to the invention, a reference expression level is a level of expression of the marker gene that is indicative normal, that is, a non-schizophrenia subject and as such can be used as a reference to determine whether or not a test subject's level of expression is significantly increased or decreased with respect to the reference level.
In a highly preferred embodiment, a computer system or removable data medium includes the identity and expression information. In addition, information about expression levels of said genes for non-schizophrenia tissue may be included.
Detailed description of the Invention
The present invention will now be further described by way of example and with reference to the following Figures which show:
Figure 1 shows the relationship between Pyk-Nck-Jnk pathway gene products;
Figure 2 shows the results of RT-qPCR for human post mortem tissue RNAs (two-tailed t-test; *p<0.05; **ρ<0.01; ***ρ,0.001);
Figure 3 shows the ability of increased Nek 1 gene expression to alter Pyk- Nck-Jnk pathway activity in neuronal cells: Nckl was over-expressed in NG 108- 15 cells, and total JNK activity measured by phosphor- JNK ELISA. (one-tailed t-test; *p<0.05);
Figure 4a shows the levels of NMDA receptor NRl subunit protein, Parvalbumin mRNA, and phospho-JNK activity in prefrontal cortex tissue from mice with a deleted Nckl gene to render the Pyk-Nck-Jnk2 pathway dysfunctional: (two- tailed t-test; *p<0.05; **p,0,01, ***p,0.001);
Figure 4b shows reduced metabolic activity in prefrontal cortex (hypofrontality) from mice with a deleted Nckl gene (Nckl knockout mice - KO) to render the Pyk-Nck-Jnk2 pathway dysfunctional, as compared to control (wild-type - WT) mice: (two-tailed t-test; ***p<0.001 relative to control);
Figure 4c shows increased metabolic activity in the auditory processing circuit (Auditory Cortex, AuCx; Parasubiculum, PaS; and Inferior Colliculi, IC) from mice with a deleted Nckl gene to render the Pyk-Nck-Jnk2 pathway dysfunctional, as compared to control (wild-type - WT) mice: (two-tailed t-test; *p<0.05 relative to control);
Figure 5 shows the results of SNP analysis for MAP2K7 in human blood samples from schizophrenic patients and controls. Results are analysed using two complementary statistical tests - Fisher's exact test and the trend test. The genotype is shown on the abscissa, and frequency of detection on the ordinate;
Figure 6 shows the results of SNP analysis for MAP2K7, in pooled data from Glasgow and London blood samples, from schizophrenia patients and controls. Results are analysed using two complementary statistic tests — Fisher's exact test and the trend test. The genotype is shown on the abscissa, and frequency of detection on the ordinate;
Figure 7 shows the interaction of CamKIV with PPMlE and PPMlF in neuronal cells. NGl 08-15 neuronal cells were transfected with combinations of vectors expressing FLAG-tagged-PPMIE, FLAG-tagged-PPMlF or a constitutively
active truncated mutant of CamKIV (caCamKIV). Following immunoprecipitation of the FLAG tag. CamKIV was detected by western blotting. The presence of a band representing either endogenous CamKIV or transfected caCamKIV indicates a physical interaction with PPM1E/PPM1F. Thus endogenous CamKIV interacts with PPMlF, while active CamKIV interacts with both PPMlE and PPMlF;
Figure 8a and b shows recombinant human PPMlE and PPMlF purified from E. coli. Purification of the arrowed His-tagged protein was confirmed by western blotting with peroxidase-conjugated anti-His antibody (data not shown). M, El and E2 stand for Molecular weight marker, eluted fraction with 150 mM imidazole and eluted fraction with 200 mM imidazole, respectively;
Figure 9 shows measurement of phosphatase activity of recombinant human PPMlE by BIOMOL GREEN;
Figure 10 shows measurement of phosphatase activity of recombinant human PPMlE by AlphaScreen Phosphosensor kit; and
Figure 11 shows measurement of phosphatase activity of recombinant human PPMlE by the principle of HTRF.
Materials and Methods
Chronic PCP Treatment- Male hooded Long Evans rats (approximately 30Og at the start of the study) were randomly assigned into two treatment groups: chronic PCP (2.58mg/kg PCP.HC1) and chronic vehicle (saline 1 ml/kg). The rats were treated according to the YRING chronic PCP model (Cochran et al., 2003) (i.p. injections once daily for five days, then once every 72 hours for a further 3 weeks) and killed by cervical dislocation 72
hours after the last injection. The brains were removed and the prefrontal cortex dissected.
Microarray analysis:- Sample information and Preparation of total RNA
-rat tissue:
Qiagen RNeasy Minicolumns were used to isolate total RNA from the 12 chronic PFC tissue samples (PCP n=6, vehicle n=6). 10μg of total RNA was treated with DNaseI to remove genomic DNA and purified using the Qiagen RNeasy Minicolumns. The yield, concentration and integrity of the total RNA were determined using a GeneQuant spectrophotometer, agarose gel electrophoresis and an Agilent 2100 Bioanalyzer (Sir Henry Wellcome Functional Genomics Facility, University of Glasgow, SHWFGF).
-human tissue:
The Scottish Biomedical Foundation provided a set of PFC samples (Brodmann region 10) from controls (n = 12) and schizophrenic patients (n = 12). Total RNA was extracted from approximately 500 mg/sample of DLPFC using Qiagen Lipid Midi Kit (Qiagen). The manufacturer's protocol was modified by adding a centrifugation step after homogenisation to remove the remaining debris and to prevent blocking the purification column. To remove genomic DNA contamination, DNase treatment was performed on the purification column. The quality of the total RNA was assessed using the Agilent 2100 Bioanalyzer. Eighteen high quality RNAs were finally used for the microarray study. The samples - 9 controls (7 males and 2 females) and 9 schizophrenics (7 males and 2 females) - were matched as far as possible using the following information: average post mortem delay 20.1 ± 5.7h
(control) and 20.3 ± 8.9h (schizophrenics); average age 58 ± 14.3yr (control) and 55.2 ± 16yr (schizophrenics).
Microarray
RG-U34A-C Affymetrix GeneChips were used for the rat chronic PCP microarray study. HG-Ul 33 A Affymetrix GeneChips were used for the human post mortem microaray study. Affymetrix protocols were followed for sample labelling. GeneChip hybridisation and scanning. Microarray data analysis
RMA (Robust Multi-Array Average Expression Measure) was carried out (MBSU, University of Glasgow) to perform a low level analysis for the HG- U133A/RG-U34 GeneChip data using BioConductor software. RMA normalises the signal intensities across the GeneChips by adjusting the fluorescent strength of each array:
1. Probe-specific background was corrected to compensate for nonspecific binding using PM (Perfect Matching signal) distribution rather than PM-MM (Mismatching signal) values;
2. Probe-level multichip quantile normalisation was performed to unify PM distributions across all GeneChips; and
3. Robust probe-set summary of the log-normalised probe-level data by median polishing.
SAM (Significance Analysis of Microarrays) (Tusher et al., 2001) is software for performing a high level analysis on the normalised RMA data to identify differentially expressed genes. It uses repeated permutations of the data to determine if the expression of any genes is significantly related to schizophrenia. The cut-off for
significance is determined by the user based on the false positive rate. Once can also choose a fold change parameter, to ensure that called genes change at least by a pre- specified amount. For comparison, a conventional t-test was used as an alternative method to assess the level of significance for differentially-expressed genes. The p- value for cut off of non-altered genes was set above 0.050. However with this value 5% of risk will be detected as nonconfidence by chance.
Real-time quantitative PCR (RT-qPCR):-
First strand cDNAs were generated by reverse transcription using 2 μg of human or rat prefrontal cortex total RNA used for the microarray study, Superscript II RNaseH- Reverse Transcriptase (Invitrogen) and a Hexanucleotide Mix (Roche) in a reaction volume of 20 μl. This 1st strand cDNA synthesis was diluted 1/20 to a final volume of 400 μl and then 2.5 μl was amplified using Universal Master Mix (ABI), gene-specific Assays-on-Demand (ABI) and the SDS7000 (ABI). Two methods of statistics were used to analyse the RT-qPCR data to identify differentially expressed genes: ANCPVA and comparative CT method, followed by a two-tailed t-test. GAPDH was used as the housekeeping gene (internal control).
NCKl over-expression in NG 108- 15 cells:-
NG108-15 cells were plated at a cell density of 2 x 105 cells in 1 ml DMEM (Gibco) and 10 % FBS (Gibco) without antibiotic into two 12 well plates and allowed to grow overnight at 37°C, 5 % CO2. DNA was diluted in 100 μl of serum free DMEM and mixed gently. Lipofectamine 2000 reagent (Invitrogen) was mixed before use and diluted in 100 μl of serum free DMEM and mixed gently. The reagent was incubated at room temperature for 5 minutes. The diluted DNA was then added
to the diluted lipofectamine, mixed gently and incubated at room temperature for 20 minutes. Fresh medium was then added to the cells and the 200 μl DNA/lipofectamine mix was placed onto the cells. The cells were incubated for 48 hours at 370C, 5 % CO2 and the protein harvested. The over-expression was assayed using western blots with antibodies to NCKl (Santa cruz) and FLAG (Sigma). 10 μg of protein was loaded in each well of an SDA-PAGE gel (10 %) when using the FLAG antibody and 30 μg of protein was loaded when using the NCKl antibody. The various conditions tested are indicated in the results.
NcId -/- KO mice and ICR +/+ mouse cortex samples:-
The cortex was dissected from 6 NcM -I- KO and 6 ICR +/+ wild-type control mice. Western blots of Nckl KO -/- mice: =
Whole cell lysates were prepared from the cortex of 6 Nckl -I- KO and 6 ICR +/+ wild-type control mice using cell lysate buffer containing proteinase and phosphotase inhibitors. The soluble protein was isolated by centrifugation and quantified using the Bradford method. 30 μg of protein was electrophoresed in a polyacrylamide gel and transferred by western blotting to PVDF membrane. A NCKl antibody (Chemicon, 1 :10,000) was used to immunodetect Nckl protein in the cell lysates. NRl levels were also detected in these samples (Sigma, 1 :2000).
JNK-P Enzyme-linked immunosorbent assay (ELISA):-
25 μg of protein isolated from the cortex of the NcM-I- KO and WT mice was used in each ELISA well (PathScan Phospho-SAPK/JNK (Thrl83/Tyrl 85) Sandwich ELISA kit, Cell Signalling). The assay will detect the levels of total phosphor- JNKs,
including p-JNKl, p-JNK2 and p-JNK3. 6 animals were used for each group. Three ELISA reactions were performed per sample, the mean of which were used in the data analysis. The JNK-P levels were statistically analysed using a two-tailed unpaired t- test.
SNP analysis
Human genomic DNA samples collected in the London area (London cohort) were derived from Prof. Hugh Gurling (UCL, UK) (approximately 300 control + 300 schizophrenic gNDAs, London cohort). These samples had been tested previously for stratification (Curtis e t al., 1994). In addition, 392 gDNAs had been derived from anonymous donor blood samples from the West of Scotland (Glasgow cohort).
PCR -based assays were designed for NCBI SNP rs4804833. The primers were Fr4 (GTCGGTTCCTAGCCATCTCTGCAG) with Rr4
(GGTGCAGATGTCCAAGCAGCGATG) for rs4804833, yielding a 230bp product. Fr4/Rr4 could amplify PCR fragments that could/could not be cleaved with BsiEI at the site of the SNP, depending on the alleles present. Therefore, the second assay for MAP2K7 was by RFLP using Fr4/Rr4 in conjunction with BsiEI.
Purification of recombinant human PPMlE and PPMlF
Human PPMlE cDNA (GenBank Accession number NM_014906) was inserted into pET30a to generate His-PPMIE, which encodes full-length PPMlE with an N-terminal His-tag.
This construct was transformed into E. coli strain BL21(DE3). The transformed bacteria were grown in LB medium, and then isopropyl-β-D- thiogalactopyranoside was added to a final concentration of 0.5 mM. After
recombinant proteins were sufficiently induced, the bacteria were harvested by centrifugation and the harvested cell pellets were suspended in 10 mM Tris-HCl (pH 7.4) containing 150 mM NaCl (TBS), and then disrupted by sonication. The extract was cleared by centrifugation, and the supernatants were used for the purification of recombinant proteins using Talon Co2+ column chromatography according to the manufacturer's instruction (Clontech). All the purification procedures were earned out at 4°C. His-PPMIE fractions eluted from the column stepwise with TBS containing 150 mM and 200 mM imidazole (Figure 8A). Similarly recombinant human PPMlF also purified from E. coli transformed with pET30a containing human PPMlF cDNA (GenBank Accession number NM_014634) (Figure 8B). Protein concentrations were determined by the method of Bradford with BSA as a standard.
CaMKIV Phosphatases Assay Development
Four kinds of assay development, BIOMOL GREEN, a Screen and HTRF for the measurement of purified human recombinant PPMlE phosphatase activity were conducted. Synthesized partial CaMKIV peptide (184-204), biotinylated- LSKIVEHQVLMKT(p)VCGTPGYC, as a substrate of PPMlE was applied for enzymatic reaction in assay development for BIOMOL GREEN, a Screen and HTRF.
BIOMOL GREEN
BIOMOL GREEN reagent was purchased from BIOMOL International. Phosphatase assay was carried out at RT for lhr using purified PPMlE and biotinylated pThr-CaMKIV peptide. The reaction was stopped by adding BIOMOL GREEN reagent to capture the released Pi from the peptide. The mixture was allowed to stand at RT for 20 min, then the absorbance at 620 nm was measured. Increase of
the value at 620 nm means increase of Pi released from biotinylated pThr-CaMKIV peptide by phosphatase activity of PPMlE (Figure 9).
AlphaScreen Phosphosensor
AlphaScreen Phosphosensor kit was purchased from PerkinElmer. Phosphatase assay was carried out at RT for lhr using purified PPMlE and biotinylated pThr-CaMKIV peptide. According to manufacturer' instruction (PerkinElmer), the mixture in which streptavidin donor beads and phosphosensor acceptor beads were added to capture biotinylated pThr-CaMKIV peptide allowed to stand at RT for lhr in the dark room. After incubation a signal was measured by
Fusion a HT (PerkinElmer). Decrease of the value of a signal means decrease of pThr-CaMKIV peptide by phosphatase activity of PPMlE (Figure 10).
HTRF: Homogenous Time Resolved Fluorescence assay
Streptavidin-XLent! and Anti-phospho Threonine Polyclonal antibody cryptate were purchased from CIS bio International. Phosphatase assay was carried out at RT for lhr using purified PPMlE and biotinylated pThr-CaMKIV peptide. According to manufacturer' instruction (CIS bio International), the mixture in which Streptavidin- XLeπti and Anti-phospho Threonine Polyclonal antibody cryptate were added to capture biotinylated pThr-CaMKIV peptide allowed to stand at 4°C overnight. After incubation FRET was measured by Analyst GT (Molecular Devices). Decrease of the FRET value means decrease of pThr-CaMKIV peptide by phosphatase activity of PPMlE (Figure 11).
Semi-quantitative 2-deoxyglucose autoradiography:-
Adult NcM -I- KO and ICR +/+ wild-type control mice were used for this study. At 5 minute intervals, a mouse was placed in a cylindrical restrainer and its tail immersed in warm water (to aid visualization of the tail veins) for 5 mins. A bolus dose of [14-C] -2-deoxyglucose ([14-C]-2-DG; 120μCi/Kg) was then administered via the lateral tail vein. The mouse was then placed in a normal home cage. 45mins later the mouse was replaced in the cylindrical restrainer and killed by an overdose of pentobarbitone (Saggital, 42mg/kg) via the lateral tail vein. The brain was removed and frozen at -42C in isopentane cooled by dry ice and then stored at -70C. The brain was sectioned at -20C on a cryostat (Leica), with 3 adjacent 20μm sections being collected onto coverslips simultaneously every 200μm throughout the brain. The sections were immediately dried on a hotplate at 6OC for 5mins to prevent diffusion of the isotope. The sections were then glued to cardboard and exposed to x-ray film (Biomax MRl, Kodak) with [14-C]-methylmethacrylate tissue standards for 2 days. Films were analysed using the MCID 5 computer based densitometry system. Tissue concentrations of [14-CJ-2-DG were measured in discrete brain regions and 2-DG uptake calculated as follows:
IT4-C1-2-DG (nCi/g) in region of interest [14-C]-2-DG (nCi/g) in whole brain
Independent t-tests were carried out using SPSS software (vl l) followed by application of the sequential Bonferroni correction method to correct for multiple comparisons. Levene's test of variance was used to confirm the homogeneity of the data.
Results and Discussion
Little is known about the genes that cause schizophrenia, or more specifically any alteration of expression/mutation of genes in a patient suffering from schizophrenia. Experiments were therefore designed to identify genes potentially contributing to the aetiology of schizophrenia, using prefrontal cortex tissue from rats treated according to the model of Cochran et al (2003), and post-mortem prefrontal cortex tissue from patients with schizophrenia, and controls.
A microarray screen was conducted, monitoring the expression of around 20,000 transcripts — theoretically the majority of the transcriptome - in prefrontal cortex of rats treated chronically with PCP according to our model (Cochran et al., 2003), as compared to rats treated chronically with vehicle. In this study, 327 transcripts were detected as significantly differentially-expressed in the prefrontal cortex after PCP treatment, as compared to vehicle treatment.
A parallel comprehensive microarray screen was then conducted, monitoring the expression of around 20,000 transcripts in post-mortem prefrontal cortex tissue (Brodmann area 10) from schizophrenia patients, as compared to equivalent tissue from control subjects. The subjects were matched for age, gender and post-mortem delay. In this study, 961 transcripts were detected as significantly differentially- expressed in the prefrontal cortex in schizophrenic patients, as compared to control subjects.
Previous microarray studies using tissue from post-mortem tissue from schizophrenic patients have identified altered expression of metabolic genes (Middleton et al., 2002), lipid-regulatory genes (Mimmack et al., 2002), presynaptic vesicle release genes (Mimics et al., 2000) or myelin-related genes (Hakak et al., 2001). The present study, which was conducted with the most rigorous experimental
and analytical approaches, failed to confirm these findings. The investigators searched for patterns of functionally-related genes in the results from microarray studies. Based on considerable knowledge of cell biology and neuroscience, built on many years of experience, it was noted that a number of the genes identified in both the rat and human studies could potentially be linked together into a single biochemical signalling pathway. The investigators assessed the list of differentially-expressed genes in the rat study, and noted the presence of 4 protein kinases that could potentially be involved in a single signalling pathway downstream of NMDA receptors, together with a binding protein known to interact with one of these kinases (Table 1). The investigators have assessed the list of differentially-expressed genes in their human study, and noted the presence of these 4 protein kinases, together with a number of other genes encoding proteins potentially interacting with these kinases (Table 2).
There are a number of distinct mitogen-activated protein kinase (MAP kinase) signalling cascades in cells, in which a number of protein kinase enzymes act sequentially "in series" to phosphorylate and activate their downstream targets. In each case, a triggering signal phosphorylates and activates a MAP4K, which then leads to sequential phosphorylation of a MAP3K, a MAP2K, and a MAPK. In the many hundreds of genes identified in their screens, the investigators noted the presence of a set of genes that are likely to be functionally linked to each other. These genes, with their synonyms, are listed in Table 3.
MAPK9 (also known as JNK2), for example, is phosphorylated and activated by MAP2K7 (also known as MKK7). The activation of MAPK9 by MAP2K7 is relatively selective (Fleming et ah, 2000; Machida et ah, 2004). MAP2K7 in turn is phosphorylated and activated by MAP3K7 (also known as TAKl), which itself is
phosphorylated and activated by MAP4K4 (also known as HPK/GCK-like kinase - HGK, or Nck-interacting kinase - NIK) (Yao et al., 1999). The action of MAP kinase signalling cascades is co-ordinated by, and is dependent upon, specific scaffolding molecules which bring the kinases together. MAP4K4 interacts with the scaffolding protein Nckl, leading specifically to the activation of MAPK9 (Machida et al., 2004). Another MAP4K - Traf2 and Nck-interacting kinase (TNIK, or KIAA0551) also reportedly interacts with Nek and activates JNKs such as MAPK9 (Fu et al., 1999). In addition to MAP4K4 and TNIK, Nckl also binds other scaffolding molecules such as GRB-associated proteins 1 & 2 (Gabl & Gab2) and Crk-like protein (CrkL). CrkL over-expression can induce activation of JNKs such as MAPK9 (Ling et al., 1999). Nckl over-expression in non-neuronal cells increases the activity of MAPK9 (JNK2) but not MAPK8 (JNKl) (Mizuno et al., 2002) suggesting that Nckl function, like that of MAP2K7, is specifically linked to MAPK9 activation. Nckl over-expression also alters the activity of another kinase PAKl (Poitras et al., 2003), and PAKl has been implicated in the regulation of JNK activity (Brown et al., 1996). Thus Nckl can mediate parallel activation of PAKl and JNKs (Schmitz et al., 2001).
PTK2B (protein tyrosine kinase 2B, also known as PYK2) has also been reported to mediate activation of JNKs (c-jun N-terminal kinases) such as MAPK9 (Blaukat et al., 1999). The small GTPase regulatory protein RICS (also known as GRIT or GC-GAP) binds to CrkL (Nakamura et al., 2002), Gabl and Gab2 (Zhao et al., 2003) and can be activated by NMDA receptor stimulation (Nakazawa et al., 2003; Okabe et al., 2003). Hence NMDA receptor - dependent signalling can be predicted to propagate to Gabl and Gab2. Similarly, CamKIV is activated by NMDA receptor stimulation via CamKK, and potentiates activation of JNKs such as MAPK9 (Enslen et al., 1996). PPMlE and PPMlF (fem-2) have recently been identified as
phosphatases that suppress the activity of both PAKl (Koh et al, 2002) and CamK4 (Tan et al., 2001), and hence are intimately linked to the other proteins in this pathway. Indeed the direct interaction of CamKIV with PPMlE and PPMlF is neuronal cells was confirmed (see Figure 7).
These 16 genes can therefore be placed on a single biochemical signalling pathway, which the investigators have termed the Pyk-Nck-Jnk (for Pyk2-Nckl-Jnk2) pathway (Figure 1). Hence the investigators data suggested that the expression of a number of genes with potentially a very close functional interaction might by dysregulated in parallel in prefrontal cortex tissue from schizophrenic patients. The fact that there was an overlap between the changes in expression of Pyk-Nck-Jnk genes observed in the rat chronic PCP model of schizophrenia, and in the postmortem tissue from patients, is consistent with the hypothesis that these changes in gene expression are causally involved in producing the core neurobiological deficts of schizophrenia (for example the metabolic hyprofrontality or the compromised chandelier cell function) or indeed the behavioural impairments such as reduced attention and impaired executive function.
To confirm the changes in the expression of these genes identified in the microarray studies, the investigators used real-time quantitative reverse-transcriptase PCR (RT-qPCR) to determine the level of expression of these genes accurately. Many of the genes were detected as differentially expressed in prefrontal cortex tissue from rats treated chronically with PCP, or from schizophrenic patients, relative to corresponding control tissue (Figure 2). These results reveal that in schizophrenia there is a co-ordinated dysregulation of this interacting set of genes.
MAPK9 has also been functionally linked to NMDA signalling, and in particular to the long-term effects of NMDA receptor stimulation on network activity
in the hippocampus and cortex (Chen et al., 2005). Hence one of the predicted consequences of Pyk-Nck-Jnk hypofunction in schizophrenia (as indicated by the present) is reduced NMDA receptor-dependent network activity.
Since Nckl potentially has a central role in co-ordinating the various proteins of the Pky-Nck- Jnk pathway, the investigators tested the hypothesis that manipulating the level of Nckl expression in cultured neuronal cells would alter the level of JNK activity. It was found that over-expression of exogenous Nckl in the neurones elevated JNK activity, as assessed by a phosphor- JNK specific ELISA (Figure 3).
Without wishing to be bound by theory, if the Pyk-Nck-Jnk pathway plays a major role in the aetiology of schizophrenia, then mice with altered Pyk-Nck-Jnk activity should show some of the neurochemical and metabolic changes characteristic of the disease. Mice were obtained with a targeted deletion of the Nckl gene (Nckl knockout mice) from the laboratory of Prof. T. Pawson, Samuel Lunenfield Research Institute, Mt. Sinai Hospital, Toronto (Bladt et al., 2003). Relative to control mice, these mice seemed overtly normal. However, when cortex tissue was investigated from Nckl knockout mice, it was found that the levels of the NMDA receptor NRl subunit were elevated, as has been observed in the cortex of patients with schizophrenia (Dracheva et al., 2001; Ishimaru et al., 1994). Strikingly, the levels of parvalbumin mRNA were decreased in the prefrontal cortex in mice lacking Nckl (and hence lacking a functional Pyk-Nck-Jnk pathway) relative to normal mice (Figure 4a). The decrease in parvalbumin expression is highly characteristic of the changes observed in post-mortem tissue from patients with schizophrenia (Beasley and Reynolds, 1997) suggesting strongly that reduced Pyk-Nck-Jnk pathway activity may be the direct case of this pathology.
Schizophrenia patients show a highly characteristic pattern of altered metabolic activity in the CNS, as assessed by de-oxyglucose imaging or functional MRI. This pattern involves decreased activity in the prefrontal cortex relative to normal subjects (hypofrontality) and increased activity in parts of the auditory system during hallucinations (Tamminga et al., 1992; Wolkin et al., 1992; Shergill et al, 2000). As a final test of the potential of Pyk-Nck-Jnk pathway dysfunction to cause the symptoms of schizophrenia, we assessed metabolic activity in the CNS of mice with a deleted Nckl gene, relative to controls, by de-oxyglucose imaging. We found a pattern of altered metabolic activity that matched that observed in patients with schizophrenia, encompassing hypofrontality (Figure 4b) and increased auditory system activity (Figure 4c).
The existence of a close relative with schizophrenia is known to considerably increase the risk of someone suffering from schizophrenia, and hence schizophrenia is regarded as having a substantial genetic component. A number of different chromosomal loci have been linked with schizophrenia, although none of them particularly strongly. This has led to the idea that schizophrenia is a polygenic disease - with a number of different genes at different chromosomal loci all contributing to an increased risk of inheriting the disease. This raises the possibility that these different genes might all share a functional relationship, and hence a slight inherited functional impairment in a number of these genes might summate to give rise to the disease. The present data linking the Pyk-Nck-Jnk pathway genes to schizophrenia provides a rational basis for the contribution of a number of different genes to the aetiology of a single disease.
If dysfunction of the Pyk-Nck-Jnk pathway is a major factor in causing schizophrenia, it should be possible to obtain evidence of genetic linkage of a Pyk-
Nck-Jnk pathway gene to schizophrenia. The investigators selected MAP2K7, as a gene with a central role in Pyk-Nck-Jnk pathway function, and assessed the prevalence of single nucleotide polymorphisms (SNPs) in DNA from schizophrenia patients and control subjects. Two sets of blood sample DNA were analysed, one collected in the Greater London area and comprising around 300 patients and 300 controls, and the other collected in the Glasgow/West of Scotland area, comprising around 200 patients and 200 controls. Any significant effects that are reproduced in both of the two separate sets of samples are likely to be highly relevant to the causes of schizophrenia.
The results of SNP analysis for MAP2K7 in human blood samples from schizophrenic patients and controls (Figure 5) showed that for the 1st SNP, there was a significant association with schizophrenia in the London samples, that was replicated in the separate Glasgow samples (Figure 5). Furthermore, for the 2nd SNP, there was a similar significant association with schizophrenia in the London samples, that was replicated in the separate Glasgow samples (Figure 5). When the two sets of samples were analysed together, a very high level of significance for the association with schizophrenia was noted for both SNPl and SNP2 (Figure 6). Thus a highly significant association of MAP2K7 SNPs with schizophrenia is detected, using two different SNPs, and two different sets of samples.
Thus the investigators have observed:
1) altered expression, in prefrontal cortex tissue from schizophrenia patients, of a number of functionally-related genes that constitute a single signalling pathway in the brain;
2) altered parvalbumin cell function in mice with genetically-modified activity of this signalling pathway; and
3) metabolic hypofrontality and elevated auditory system metabolic activity - a pattern highly characteristic of the brains of patients with schizophrenia - in mice with genetically-modified activity of this signalling pathway; and
4) highly significant genetic linkage between a key gene in this signalling pathway and schizophrenia.
These data imply that dysfunction of this Pyk-Nck-Jnk pathway, caused by impaired function of any individual gene in the pathway, can be a cause of schizophrenia, and hence that novel drug treatments, aimed at restoring the function of this pathway, may be a highly effective strategy for curing the disease.
Table 1: Relative changes in expression of Pyk-Nck-Jnk pathway genes, in prefrontal cortex, in rats treated chronically with PCP, relative to corresponding controls, as assessed by rmcroarray analysis.
Table 2: Relative changes in expression of Pyk-Nck-Jnk pathway genes, in prefrontal cortex, in schizophrenic patients, relative to corresponding controls, as assessed by microarray analysis.
REFERENCES
Allen, R.M. & Young, SJ. (1978). American Journal of Psychiatry, 135, 1081-4.
Beasley, CL. & Reynolds, G.P. (1997). Schizophrenia Research, 24, 349-55.
Bladt, F., Aippersbach, E., Gelkop, S., Strasser, G.A., Nash, P., Tafuri, A., Gertler, F.B. & Pawson, T. (2003). MoI. Cell Biol, 23, 4586-4597.
Blaukat, A., Ivankovic-Dikic, L, Gronroos, E., Dolfi, F., Tokiwa, G., Vuori, K. & Dikic, I. (1999). J Biol. Chem., 274, 14893-14901.
Brown, J.L., Stowers, L., Baer, M., Trejo, J., Coughlin, S. & Chant, J. (1996). Current Biology, 6, 598-605.
Chen, J.-T., Lu, D.-H., Chia, C-P., Ruan, D.-Y., Sabapathy, K. & Xiao, Z.-C. (2005). Journal ofN euro chemistry, 93, 463-473.
Cochran, S.M., Steward, LJ., Kennedy, M.B., McKerchar, C.E., Pratt, J.A. & Morris, BJ. (2003). Neuropsychopharmacology, 28, 265-275.
Curtis, D., Kalsi, G. & Gurling, H.M. (1994). Br J Psychiatry., 165, 117-119.
Dracheva, S., Marras, S.A.E., Elhakem, S.L., Kramer, F.R., Davis, K.L. & Haroutunian, V. (2001). Am J Psychiatry, 158, 1400-1410.
Enslen, H., Tokumitsu, H., Stork, P.J.S., Davis, RJ. & Soderling, T.R. (1996). Proc. Natl. Acad.Sci. (USA), 93, 10803-10808.
Fleming, Y., Armstrong, C. G., Morrice, N., Paterson, A., Goedert, M. & Cohen, P. (2000). Biochemical Journal, 352, 145-154.
Fu, CA., Shen, M., Huang, B.C.B., Lasaga, J., Payan, D.G. & Luo, Y. (1999). J. Biol. Chem., 274, 30729-30737.
Goldberg, T., Greenberg, R., Griffen, S., Gold, J., Pickar, D., Kleinman, J. & Weinberger, D. (1993). Br. J. Psychiatry, 162, 43-38.
Hakak, Y., Walker, J.R., Li, C, Wong, W.H., Davis, K.L., Buxbaum, J.D., Haroutunian, V. & Fienberg, A.A. (2001). PNAS, 98, 4746-4751.
Hill, K., Mann, L., Laws, K.R., Stephenson, CM., Nimmo-Smith, I. & McKenna, PJ. (2004). Acta Psychiatr Scand, 110, 243-56.
Ishimaru, M., Kurumaji, A. & Toru, M. (1994). Biological Psychiatry, 35, 84- 95.
Koh, C-G., Tan, E.-J., Manser, E. & Lim, L. (2002). Current Biology, 12, 317-321.
Lewis, D.A., Pienϊ, J.N., VoIk, D.W., Melchitzky, D.S. & Woo, T.U. (1999). Biol Psychiatry, 46, 616-26.
Ling, P., Yao, Z., Meyer, CF., Wang, X.S., Oehrl, W., Feller, S.M. & Tan, T.- H. (1999). MoI. Cell. Biol, 19, 1359-1368.
Machida, N., Umikawa, M., Takei, K., Sakima, N., Myagmar, B. -E., Taira, K., Uezato, H., Ogawa, Y. & Kariya, K.-i. (2004). J. Biol. Chem., 279, 15711-15714
Middleton, F.A., Mimics, K., Pierri, J.N., Lewis, D.A. & Levitt, P. (2002). J. Neuroscl, 22, 2718-2729.
Mimmack, M.L., Ryan, M., Baba, H., Navarro-Ruiz, J., Iritani, S., Faull, R.L.M., McKenna, P.J., Jones, P.B., Arai, H., Starkey, M., Emson, P.C. & Bahn, S. (2002). PNAS, 99, 4680-4685.
Mimics, K., Middleton, F.A., Marquez, A., Lewis, D.A. & Levitt, P. (2000). Neuron, 28, 53-67.
Mizuno, K., Tagawa, Y., Mitomo, K., Watanabe, N., Katagiri, T., Ogimoto, M. & Yakura, H. (2002). J Immunol, 169, 778-786.
Morris, BJ., Cochran, S.M. & Pratt, J.A. (2005). Current Opinion in Pharmacology, 5, 1-6.
Nakamura, T., Komiya, M., Sone, K., Hirose, E., Gotoh, N., Morii, H., Ohta, Y. & Mori, N. (2002). MoI Cell Biol, 22, 8721-8734.
Nakazawa, T., Watabe, A.M., Tezuka, T., Yoshida, Y., Yokoyama, K., Umemori, H., Inoue, A., Okabe, S., Manabe, T. & Yamamoto, T. (2003). MoI Biol Cell, 14, 2921-2934.
Okabe, T., Nakamura, T., Nishimura, Y.N., Kohu, K., Ohwada, S., Morishita, Y. & Akiyama, T. (2003). J. Biol. Chem., 278, 9920-9927.
Poitras, L., Jean, S., Islam, N. & Moss, T. (2003). FEBS Letters, 543, 129-135. Schmitz, U., Thommes, K., Beier, I., Wagner, W., Sachinidis, A., Dusing, R. & Vetter, H. (2001). J. Biol. Chem., 276, 22003-22010.
Shergill, S.S., Brammer, M.J., Williams, S.C.R., Murray, R.M. & McGuire, P.K. (2000) Mapping Auditory Hallucinations in Schizophrenia Using Functional Magnetic Resonance Imaging Arch Gen Psychiatry, 57, 1033-1038.
Tamminga, CA. (1998). Critical Reviews in Neurobiology, 12, 21-36.
Tamminga, C.A., Thaker, G.K., Buchanan, R., Kirkpatrick, B., Alphs, L.D., Chase, T.N. & Carpenter, W.T. (1992). Arch Gen Psychiatry, 49, 522-30.
Tan, K.M.L., Chan, S.-L., Tan, K.O. & Yu, V.C. (2001). J. Biol. Chem., 276, 44193-44202.
Tusher, V.G., Tibshirani, R. & Chu, G. (2001). Proc. Natl. Acad. Sci. (USA), 98, 5116-5121.
Wolkin, A., Jaeger, J., Brodie, J., Wolf, A., Fowler, J., Rotrosen, J., Gomez- Mont, F. & Cancro, R. (1985). Am J Psychiatry, 142, 564-571.
Wolkin, A., Sanfilipo, M., Wolf, A.P., Angrist, B., Brodie, J.D. & Rotrosen, J. (1992). Arch Gen Psychiatry, 49, 959-65.
Yao, Z., Zhou, G., Wang, X.S., Brown, A., Diener, K., Gan, H. & Tan, T.-H. (1999). J. Biol. Chem., 274, 21 18-2125.
Zhao, C, Ma, H., Bossy-Wetzel, E., Lipton, S.A., Zhang, Z. & Feng, G.-S. (2003). J Biol. Chem., 278, 34641-34653.
Claims
1. A method of prognosis or diagnosis of schizophrenia comprising the steps of: a) providing a tissue or body fluid sample from a test subject; b) detecting a level of expression or level of activity of one or more of the following genes/proteins PPMlE; PPMlF; MAP2K7; MAPK9; RICS/GRIT; PTK2B/PYK2; Gabl; Gab2; Nckl; NckAPI; CrkL; PAKl; CamKK; CAMK4; MAP4K4; TNIK; MAP3K7; anάMAPOipl in a cell or cells from said sample; and c) comparing the level of expression or level of activity of said one or more genes/proteins with a level of expression or level or activity of said one or more genes/proteins in a control sample from a subject not suffering or predisposed to suffering from schizophrenia.
2. A DNA array for use in a method according to the present invention the array comprising or consisting essentially of one or more of the following genes or sequence specific fragments thereof: PPMlE; PPMlF; MAP2K7; MAPK9; RICS/GRIT; PTK2B/PYK2; Gabl; Gab2; Nckl; NckAPI; CrkL; PAKl; CamKK; CAMK4; MAP4K4; TNIK; MAP3K7; and MAPK8ipl, the array being immobilised on a support.
3. A database comprising information regarding one or more genes selected from the group consisting of PPMlE; PPMlF; MAP2K7; MAPK9; RICS/GRIT; PTK2B/PYK2; Gabl; Gab2; Nckl; NcIcAPI; CrkL; PAKl; CamKK; CAMK4; MAP4K4; TNIK; MAP3K7; and MAPK8ipl, said information comprising details of expression levels that are characteristic of schizophrenia and non- schizophrenia subjects, the database for use in the method according to any preceding claim.
4. The database according to claim 3 as stored in memory of a computer system or on a removable data medium.
5. A method of screening a compound for treating schizophrenia, which comprises:
(a) bringing a test compound into contact with a wild type cell or transformed cell which is capable of expressing one or more schizophrenia-associated genes selected from the group consisting of PPMlE; PPMlF; MAP2K7; MAPK9; RICS/GRIT; PTK2B/PYK2; Gabl; Gab2; Nckl; NckAPI; CrkL; PAKl; CamKK; CAMK4; MAP4K4; TNIK; MAP3K7; and MAPOipl;
(b) detecting a level of expression or activity of said one or more schizophrenia-associated gene(s)/protein(s) in said cell; and
(c) selecting a compound which promotes or suppresses expression or activity of the schizophrenia-associated gene/protein in comparison with a control (vehicle).
6. A method for measuring an anti-schizophrenia effect of a compound using an animal model of schizophrenia, which comprises:
(a) administering the compound to an animal model displaying of schizophrenia characteristics;
(b) detecting a level of expression or activity of one or more genes/proteins selected from the group consisting of PPMlE; PPMlF; MAP2K7; MAPK9; RICS/GRIT; PTK2B/PYK2; Gabl; Gab2; Nckl; NcIcAPI; CrkL; PAKl; CamKK; CAMK4; MAP4K4; TMK; MAP3K7; and MAPKδipl;
(c) comparing the level of expression or activity of said one or more genes/proteins with a level of expression or activity of said one or more genes/proteins in a further control animal displaying characteristics of schizophrenia, but which has not been administered the compound; and
(d) selecting compounds for further evaluation as potential anti- schizophrenia agents, which modulate expression or activity of said one or more genes/proteins, in comparison to the control animal.
7. The method according to either of claims 5 or 6 wherein the level of expression is detected by hybridisation studies, quantitative PCR, Northern blotting, Western blotting or an immunoassay.
8. The method according to either of claims 5 or 6 wherein the activity of the protein is detected by an enzyme assay or ligand/protein binding assay.
9. The method according to either of claims 5 or 6 wherein the protein is a kinase and its activity is detected by the use of antibodies or other specific binding agents which are capable of binding to a phosphorylated or non-phosphorylated form of the kinase's substrate.
10. The method according to any of claims 1 or 5 - 9 wherein at least 2, 3, 4, 5, 10 or 15 of the identified genes are included in said method.
1 1. The method according to any one of claims 1 to 5 wherein the genes/proteins to be tested are identified in Tables 1 or 2.
12. The method according to any one of claims 1 to 5 wherein the genes/proteins to be tested are one or more MAP kinases, such as MAP2K7, MAPK9, MAP3K7 and/or MAP4K4.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB0712524.8A GB0712524D0 (en) | 2007-06-28 | 2007-06-28 | Novel schizophrenia associated genes |
| GB0712524.8 | 2007-06-28 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2009001095A2 true WO2009001095A2 (en) | 2008-12-31 |
| WO2009001095A3 WO2009001095A3 (en) | 2009-03-26 |
Family
ID=38420842
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2008/002204 Ceased WO2009001095A2 (en) | 2007-06-28 | 2008-06-26 | Novel schizophrenia associated genes |
Country Status (2)
| Country | Link |
|---|---|
| GB (1) | GB0712524D0 (en) |
| WO (1) | WO2009001095A2 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009157251A1 (en) * | 2008-06-25 | 2009-12-30 | 株式会社エスアールエル | Method of diagnosing integration dysfunction syndrome |
| WO2016020573A1 (en) * | 2014-08-04 | 2016-02-11 | Fundación "Instituto De Investigaciones Marques De Valdecilla" | Method for monitoring antipsychotic treatment |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2003531587A (en) * | 2000-03-31 | 2003-10-28 | 三菱ウェルファーマ株式会社 | Schizophrenia-related genes |
| JP2003038198A (en) * | 2001-07-27 | 2003-02-12 | Univ Niigata | Method for analyzing nucleic acid defining a gene whose expression level changes due to schizophrenia |
| WO2005020784A2 (en) * | 2003-05-23 | 2005-03-10 | Mount Sinai School Of Medicine Of New York University | Surrogate cell gene expression signatures for evaluating the physical state of a subject |
| US20060019256A1 (en) * | 2003-06-09 | 2006-01-26 | The Regents Of The University Of Michigan | Compositions and methods for treating and diagnosing cancer |
| WO2005123955A2 (en) * | 2004-06-09 | 2005-12-29 | Children's Medical Center Corporation | Methods and compositions for modifying gene regulation and dna damage in ageing |
| CA2603550A1 (en) * | 2005-03-31 | 2006-10-05 | The Board Of Trustees Of The Leland Stanford Junior University | Compositions and methods for diagnosing and treating neuropsychiatric disorders |
| US20070292880A1 (en) * | 2006-05-05 | 2007-12-20 | Robert Philibert | Compositions and methods for detecting predisposition to a substance use disorder or to a mental illness or syndrome |
-
2007
- 2007-06-28 GB GBGB0712524.8A patent/GB0712524D0/en not_active Ceased
-
2008
- 2008-06-26 WO PCT/GB2008/002204 patent/WO2009001095A2/en not_active Ceased
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009157251A1 (en) * | 2008-06-25 | 2009-12-30 | 株式会社エスアールエル | Method of diagnosing integration dysfunction syndrome |
| WO2016020573A1 (en) * | 2014-08-04 | 2016-02-11 | Fundación "Instituto De Investigaciones Marques De Valdecilla" | Method for monitoring antipsychotic treatment |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2009001095A3 (en) | 2009-03-26 |
| GB0712524D0 (en) | 2007-08-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fujii et al. | Serine racemase binds to PICK1: potential relevance to schizophrenia | |
| Silberberg et al. | The involvement of ErbB4 with schizophrenia: association and expression studies | |
| McLaren et al. | Exome sequencing in HFE C282Y homozygous men with extreme phenotypes identifies a GNPAT variant associated with severe iron overload | |
| Allen et al. | Divergent brain gene expression patterns associate with distinct cell-specific tau neuropathology traits in progressive supranuclear palsy | |
| US8921042B2 (en) | Transcriptional repression leading to Parkinson's disease | |
| Satoh et al. | TMEM106B expression is reduced in Alzheimer’s disease brains | |
| AU2016269481A1 (en) | Micro-rna, autoantibody and protein markers for diagnosis of neuronal injury | |
| KR20140089384A (en) | Methods for treating, diagnosing and monitoring alzheimer's disease | |
| Yamaki et al. | Telomere shortening in alcohol dependence: Roles of alcohol and acetaldehyde | |
| CN101821407B (en) | CD44 splice variants in neurodegenerative diseases | |
| CN109996895A (en) | Methods and biomarkers for the diagnosis of mental disorders in vitro | |
| Rubino et al. | DNA methylation of the 5′‐UTR DAT 1 gene in Parkinson's disease patients | |
| Horiuchi et al. | Experimental evidence for the involvement of PDLIM5 in mood disorders in hetero knockout mice | |
| Zurawek et al. | Upregulation of FOXO3 in New‐Onset Type 1 Diabetes Mellitus | |
| JP4733390B2 (en) | CRH responsive gene in CNS | |
| US20200241005A1 (en) | Compositions and methods for the diagnosis and treatment of diseases of the liver | |
| WO2009001095A2 (en) | Novel schizophrenia associated genes | |
| WO2008039445A9 (en) | Polymorphisms in the human xbp-1 gene are associated with inflammatory bowel disease | |
| WO2020146639A2 (en) | Compositions and methods for the diagnosis and treatment of diseases of the liver | |
| JP2013514798A (en) | MITF as a marker for predisposition to cancer | |
| US20050142630A1 (en) | Interaction of NMDA receptor with the protein tyrosine phosphatase step in psychotic disorders | |
| US20100189695A1 (en) | Irak-1 as regulator of diseases and disorders | |
| Chalfant | The Genetics of Psoriasis-An Emphasis on CARD14 | |
| WO2025255493A2 (en) | Methods for the diagnosis and treatment of alzheimer's disease and chronic hydrocephalus | |
| Soto Gimeno | Uncovering novel biomarkers for Parkinson’s disease and its prodromal stages |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08762506 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 08762506 Country of ref document: EP Kind code of ref document: A2 |



