WO2008156702A2 - Bacteria mediated gene silencing - Google Patents
Bacteria mediated gene silencing Download PDFInfo
- Publication number
- WO2008156702A2 WO2008156702A2 PCT/US2008/007448 US2008007448W WO2008156702A2 WO 2008156702 A2 WO2008156702 A2 WO 2008156702A2 US 2008007448 W US2008007448 W US 2008007448W WO 2008156702 A2 WO2008156702 A2 WO 2008156702A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- sirnas
- bacterium
- cell
- invasive
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/32—Special delivery means, e.g. tissue-specific
Definitions
- RNAi RNA-interference
- siRNA short interfering RNA
- shRNA Short hairpin RNA transcribed from small DNA plasmids within the target cell has also been shown to mediate stable gene silencing and achieve gene knockdown at levels comparable to those obtained by transfection with chemically synthesized siRNA (T. R. Brummelkamp, R. Bernards, R. Agami, Science 296, 550 (2002), P. J. Paddison, A. A. Caudiy, G. J. Hannon, PNAS 99, 1443 (2002)).
- RNAi Possible applications of RNAi for therapeutic purposes are extensive and include silencing and knockdown of disease genes such as oncogenes or viral genes.
- One major obstacle for the therapeutic use of RNAi is the delivery of siRNA to the target cell (Zamore PD, Aronin N. Nature Medicine 9,(3):266-8 (2003)). In fact, delivery has been described as the major hurdle now for RNAi (Phillip Sharp, cited by Nature news feature, VoI 425, 2003, 10-12).
- the present invention provides at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), including one or more siRNAs or one or more DNA molecules encoding one or more siRNAs.
- BTP bacterial therapeutic particle
- the present invention also provides at least one prokaryotic vector including at least one DNA molecule encoding one or more siRNAs and at least one RNA-polymerase III compatible promoter or at least one prokaryotic promoter, wherein the expressed siRNAs interfere with at least one mRNA of a gene of interest.
- the present invention also provides methods of using the various bacterium, BTP and vectors provided in the invention.
- the present invention provides methods of delivering one or more siRNAs to mammalian cells.
- the methods include introducing at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs to the mammalian cells.
- the present invention also provides methods of regulating gene expression in mammalian cells.
- the method includes introducing at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs to the mammalian cells, where the expressed siRNAs interfere with at least one mRNA of a gene of interest thereby regulating gene expression.
- BTP bacterial therapeutic particle
- the present invention also provides methods of treating or preventing a viral disease or disorder in a mammal.
- the methods include regulating the expression of at least one gene in a cell known to cause a viral disease or disorder (e.g., known to increase proliferation, growth or dysplasia) by introducing to the cells of the mammal at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs, where the expressed siRNAs interfere with the mRNA of the gene known to cause a viral disease or disorder.
- a viral disease or disorder e.g., known to increase proliferation, growth or dysplasia
- BTP bacterial therapeutic particle
- the viral disease or disorder can be, but is not limited to, infection, eptithelial dysplasia and cancer caused by HPV infection
- the present invention also provides a composition containing at least one invasive bacterium or BTP and a pharmacetucally acceptable carrier.
- the present invention also provides a eukaryotic host cell containing at least one invasive bacterium or BTP and a pharmacetucally acceptable carrier.
- the invasive bacterium or BTPs of the present invention can be non-pathogenic, non-virulent bacterium or therapeutic bacterium
- the mammalian cells can be ex vivo, in vivo or in vitro.
- the mammalian cells can be, but are not limited to, human, bovine, ovine, porcine, feline, buffalo, canine, goat, equine, donkey, deer, avian, bird, chicken, and primate cells.
- the mammalian cells are human cells, hi some preferred embodiments, the mammalian cells can be, but are not limited to, gastrointestinal epithelial cells, macrophages, cervical epithelial cells, rectal epithelial cells and a pharyngeal epithelial cells.
- the mammalian cells can be infected with about 10 3 to 10 n viable invasive bacterium or BTPs (or any integer within said ranges). Preferably, the mammalian cells can be infected with about 10 5 to 10 9 viable invasive bacterium or BTPs (or any integer within said ranges).
- the mammalian cells can be infected at a multiplicity of infection ranging from about 0.1 to 10 6 (or any integer within said ranges). Preferably, the mammalian cells can be infected at a multiplicity of infection ranging from about 10 2 to 10 4 (or any integer within said ranges).
- the mammal can be, but is not limited to, human, bovine, ovine, porcine, feline, buffalo, canine, goat, equine, donkey, deer, avian, bird, chicken, and primate.
- the mammal is a human.
- the one or more DNA molecules encoding the one or more siRNAs can be transcribed within the animal cell or transcribed within the bacterium.
- the one or more siRNAs are transcribed within the animal cell as shRNAs.
- the one or more DNA molecules encoding the one or more siRNAs can include one or more promoter sequences, enhancer sequences, terminator sequences, invasion factor sequences or lysis regulation sequences.
- the promoter can be a prokaryotic promoter.
- the prokaryotic promoter is a T7 promoter, a P gap A promoter, a P ara BAD promoter, a Ptac promoter, a Piacuvs promoter, or a recA promoter.
- the expressed siRNAs can direct the multienzyme complex RNA-induced silencing complex of the cell to interact with the mRNA of one or more genes of interest.
- the siRNAs interact with the mRNA of one or more HPV oncogenes.
- the complex can degrade the mRNA.
- the expression of one or more genes of interest is decreased or inhibited.
- the expression is decreased or inhibited as compared to the expression of the gene prior to administration or treatment with an invasive bacterium or BTP containing one or more siRNA or a DNA encoding for one or more siRNAs.
- the expression of one or more HPV oncogenes is decreased or inhibited.
- FIG. 1 is a schematic showing the Transkingdom RNA Interference Plasmid (TRIP) with multiple hairpin express cassettes.
- FIG. 2 is a schematic showing the TRIP system (bacteria and plasmid) modified with the Operator Repressor Titration (ORT) system.
- Figure 3 is a photograph showing cellular staining of the intestinal epithelial layer demonstrating efficient invasion and plasmid delivery by S. typhimurium.
- Figure 4 is a photograph showing that bacteria-mediated RNA interference reduces target gene expression in the gastrointestinal epithelium.
- Figure 5 is a schematic showing pNJSZ plasmid construct.
- Figure 6 is a schematic showing the use of lamba S and R genes to kill intact bacteria.
- Figure 7 is a bar graph showing a reduction in HPV oncogene expression with bacterial delivered siRNA.
- Figure 8 is a bar graph showing a reduction in HPV oncogene expression with bacterial delivered siRNA.
- Figure 9 is a bar graph showing a reduction in HPV oncogene expression with bacterial delivered siRNA.
- FIG 10 Panels A-C, are a series of bar graphs showing real time PCR results following invasion of HeIa cells with various siRNAs.
- Figure 11 is a photograph of an immunoblot showing the effects of downregulation of HPV
- E6 and E7 genes on tumor suppressor pathways and other downstream targets.
- Figure 12 is a photograph of a colony forming assay showing infection at different multiplicities of infection (MOI).
- Figure 13 is a line graph of a MTT assay showing infection at different multiplicities of infection (MOI).
- Figure 14 is a bar graph showing real time PCR results following invasion of HeIa cells with various siRNAs
- FIG 15 Panels A-C, are a series of bar graphs showing real time PCR results following invasion of HeIa cells with various siRNAs.
- Figure 16 is a photograph of an immunoblot showing the effects of downregulation of HPV
- E6 and E7 genes on tumor suppressor pathways and other downstream targets.
- Figure 17 is a bar graph showing real time PCR results following invasion assay of HeIa cells with a frozen aliquot of negative sHRNA control and HPV sHRNA in BL21.
- Figure 18 is a photograph showing the plating efficiency of frozen aliquots of negative sHRNA control and HPV sHRNA in BL21.
- Figure 19 is a photograph of an immunoblot showing the knockdown of HPV E6 gene assessed by western blotting with HPV 18 E7 antibody.
- Figure 20 is a bar graph showing the knockdown of CCL20 expression with the various siRNA sequences in CMT93 cells.
- Figure 21 is a bar graph showing the knockdown of Claudin-2 expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
- Figure 22 is a bar graph showing the knockdown of IL6-RA expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
- Figure 23 is a bar graph showing the knockdown of IL 13 -RAl expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
- Figure 24 is a bar graph showing the knockdown of ILl 8 expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
- Figure 25 is a bar graph showing the knockdown of IL-7 expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
- Figure 26 is a bar graph showing the knockdown of CH13L1 expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
- Figure 27 is a schematic of the pMBV40 or pMBV43 or pMBV44 plasmids.
- Figure 28 is a schematic of the pNJSZ ⁇ BamHl plasmid.
- Figure 29 is a schematic of the pNJSZ pNJSZc plasmid.
- Figure 30 is a schematic showing a lysis regulation system in combination with strain-specific nutritional attenuation.
- Figure 31 is a schematic showing three cassettes in the combination lysis regulation system/nutritional attenuation system.
- Figure 32 is a schematic showing a lysis regulation systemin combination with a Tet-on expression system.
- the invention pertains to compositions and methods of delivering small interfering RNAs (siRNAs) to eukaryotic cells using non-pathogenic or therapeutic strains of bacteria or bacterial therapeutic particles (BTPs).
- the bacteria or BTPs deliver DNA encoding siRNA, or siRNA itself, to effect RNA interference (RNAi) ) by invading into the eukaryotic host cells.
- RNAi RNA interference
- to trigger RNA interference in a target cell it is required to introduce siRNA into the cell.
- the siRNA is either introduced into the target cell directly or by transfection or can be transcribed within the target cell as hairpin-structured dsRNA (shRNA) from specific plasmids with RNA-polymerase III compatible promoters (e.g., U6, Hl) (P. J. Paddison, A. A. Caudiy, G. J. Hannon, PNAS 99, 1443 (2002), T. R. Brummelkamp, R. Bernards, R. Agami, Science 296, 550 (2002)).
- the interfering RNA of the invention regulates gene expression in eukaryotic cells. It silences or knocks down genes of interest inside target cells (e.g., decreases gene activity).
- the interfering RNA directs the cell-owned multienzyme-complex RISC (RNA-induced silencing complex) to the mRNA of the gene to be silenced. Interaction of RISC and mRNA results in degradation or sequestration of the mRNA. This leads to effective post-transcriptional silencing of the gene of interest.
- This method is referred to as Bacteria Mediated Gene Silencing (BMGS).
- BMGS Bacteria Mediated Gene Silencing
- shRNA or siRNA are produced within the target cell after liberation of the eukaryotic transcription plasmid and trigger the highly specific process of mRNA degradation, which results in silencing of the targeted gene.
- one or more cell-specific eukaryotic promoters may be used that limit the expression of siRNA or shRNA to specific target cells or tissues that are in particular metabolic states.
- the cell-specific promoter is albumin and the target cell or tissue is the liver.
- the cell-specific promoter is keratin and the specific target cell or tissue is the skin.
- the non-virulent bacteria and BTPs of the invention have invasive properties (or are modified to have invasive properties) and may enter a mammalian host cell through various mechanisms.
- invasive bacteria or BTP strains In contrast to uptake of bacteria or BTPs by professional phagocytes, which normally results in the destruction of the bacterium or BTP within a specialized lysosome, invasive bacteria or BTP strains have the ability to invade non-phagocytic host cells.
- Naturally occurring examples of such bacteria or BTPs are intracellular pathogens such as Yersinia, Rickettsia, Legionella, Brucella, Mycobacterium, Helicobacter, Coxiella, Chlamydia, Neisseria, Burkolderia, Bordetella, Borrelia, Listeria, Shigella, Salmonella, Staphylococcus, Streptococcus, Porphyromonas, Treponema, and Vibrio, but this property can also be transferred to other bacteria or BTPs such as E. coli, Lactobacillus or
- bacteria or BTPs used to deliver interfering RNAs to host cells include Shigella flexneri (D. R. Sizemore, A. A. Branstrom, J. C. Sadoff, Science 270, 299 (1995)), invasive E. coli (P. Courvalin, S. Goussard, C. Grillot-Courvalin, C.R.Acad.Sci.Paris 318,1207 (1995), C.
- Any invasive bacterium or BTP is useful for DNA transfer into eukaryotic cells (S. Weiss, T. Chakraborty, Curr Opinion Biotechnol 12, 467 (2001)).
- BMGS is performed using the naturally invasive pathogen Salmonella typhimurium.
- the strains of Salmonella typhimurium include SL 7207 and VNP20009 (S. K. Hoiseth, B. A. D. Stacker, Nature 291, 238 (1981); Pawelek JM, Low KB, Bermudes D. Cancer Res. 57(20): 4537-44 (Oct. 15 1997)).
- BMGS is performed using attenuated E. coli.
- the CEQ201 strain is engineered to possess cell-invading properties through an invasion plasmid.
- this plasmid is a TRIP (Transkingdom RNA interference plasmid) plasmid or pNJSZ.
- TRIP Transkingdom RNA interference plasmid
- pNJSZ plasmid
- a double "trojan horse” technique is also used with an invasive and auxotrophic bacterium or
- the BTP carrying a eukaryotic transcription plasmid.
- This plasmid is, in turn, transcribed by the target cell to form one or more hairpin RNA structures that triggers the intracellular process of RNAi.
- This method of the invention induces significant gene silencing of a variety of genes.
- the genes include a transgene (GFP), a mutated oncogene (k-Ras) and a cancer related gene ( ⁇ -catenin) in vitro.
- RNAi Transkingdom RNAi
- siRNA is directly produced by the invasive bacteria, or accumulated in the BTPs after production in the bacteria, as opposed to the target cell.
- a transcription plasmid controlled by a prokaryotic promoter e.g., T7
- a prokaryotic promoter e.g., T7
- siRNA is produced within the bacteria and is liberated within the mammalian target cell after bacterial lysis triggered either by auxotrophy or by timed addition of antibiotics.
- the RNAi methods of the invention, including BMGS and tkRNAi are used to create transient "knockdown" genetic animal models as opposed to genetically engineered knockout models to discover gene functions.
- the methods are also used as in vitro transfection tool for research and drug development These methods use bacteria with desirable properties (invasiveness, attenuation, steerability) to perform BMGS and tkRNAi. Invasiveness as well as eukaryotic or prokaryotic transcription of one or several shRNA is conferred to a bacterium or BTP using plasmids (e.g., TRIP) and vectors as described in greater detail herein.
- plasmids e.g., TRIP
- BTPs Bacterium and/or Bacterial Therapeutic Particles
- the present invention provides at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), including one or more siRNAs or one or more DNA molecules encoding one or more siRNAs.
- BTP bacterial therapeutic particle
- any microorganism that is capable of delivering a molecule, e.g., an RNA molecule or an RNA-encoding DNA molecule, into the cytoplasm of a target cell, such as by traversing the membrane and entering the cytoplasm of a cell can be used to deliver RNA to such cells.
- the microorganism is a prokaryote.
- the prokaryote is a bacterium or BTP.
- microorganisms other than bacteria that can be used for delivering RNA to a cell.
- the microorganism can be a fungus, e.g., Cryptococcus neoformans, protozoan, e.g., Trypanosoma cruzi, Toxoplasma gondii, Leishmania donovani, and plasmodia.
- fungus e.g., Cryptococcus neoformans
- protozoan e.g., Trypanosoma cruzi, Toxoplasma gondii, Leishmania donovani, and plasmodia.
- the microorganism is a bacterium or BTP.
- a preferred invasive bacterium or BTP is capable of delivering at least one molecule, e.g., an RNA or RNA-encoding DNA molecule, to a target cells, such as by entering the cytoplasm of a eukaryotic cell.
- the RNA is siRNA or shRNA and the RNA-encoding DNA molecule encodes for siRNA or shRNA.
- BTPs are fragments of bacteria used for therapeutic or preventive purposes.
- BTPs may include particles known in the art as minicells.
- Minicells are small cells produced by cell division that is faulty near the pole. They are devoid of nucleoid and, therefore, unable to grow and form colonies (Alder et al., (1967) Proc. Nat. Acad. Sci. U.S.A. 57, 321-326; for reviews see Sullivan and Maddock, (2000) Curr. Biol. 10:R249-R252; Margolin, (2001) Curr. Biol. 11, R395-R398; Howard and Kruse, (2005) J. Cell Biol. 168, 533-536).
- Minicell formation results due to mutations causing a defect in selection of the site for the septum formation for cell division.
- Such mutations include null alleles of minC, minD (Davie et al, (1984) J. Bacterid. 158, 1202-1203; de Boer et al., 1988) J. Bacteriol. 170, 2106-2112) and certain alleles of ftsZ (Bi and Lutkenhaus, (1992) J. Bacteriol. 174, 5414-5423).
- Overexpression fo FtsZ or MinC-MinD proteins has also been reported to cause the formation of minicells (Ward and Lutkenhaus, 1985; de Boer et al., 1988).
- minicells are devoid of nucleoid, they are capable of transcription and translation (Roozen et al., (1971) J. Bacteriol. 107, 21- 33; Shepherd et al., (2001) J. Bacteriol. 183, 2527-34).
- BTPs are distinct from bacteria in that they lack the bacterial genome and, therefore, provide a decreased risk of bacterial proliferation in patients. This is of particular value for immune- compromised patients. Furthermore, the inability of BTPs to proliferate allows for their use in sensitive tissues, e.g., the brain, and other areas of the body traditionally considered inaccessible to traditional siRNA. For example, the intraperitoneal delivery of bacteria can include the risk of adhesions and peritonitis, which is eliminated by utilizing BTPs.
- BTPs contain the bacterial cell wall, some bacterial plasma contents and subcellular particles, one or more therapeutic components, e.g., one or more siRNAs, one or more invasion factors, one or more phagosome degradation factors, and one or more factors for targeting specific tissues.
- the BTPs are produced from bacteria that have produced and accumulated siRNAs inside the bacteria, and then segregate the bacterial fragment (BTP) during cell division.
- BTPs are obtained by fermenting the bacteria, during which the BTPs form abundantly, followed by isolation of the BTPs from live bacteria using differential size filtration, which will retain the bacteria but allow passage and collection of BTPs.
- BTPs are separated from bacteria by centrifugation.
- live bacterial cells are lysed through activation of a death signal.
- the BTPs can be lyophilized and formulated for use.
- BTP refers to a microorganism that is capable of delivering at least one molecule, e.g., an RNA or RNA-encoding DNA molecule, to a target cell.
- An invasive microorganism can be a microorganism that is capable of traversing a cell membrane, thereby entering the cytoplasm of said cell, and delivering at least some of its content, e.g., RNA or RNA-encoding DNA, into the target cell.
- the process of delivery of the at least one molecule into the target cell preferably does not significantly modify the invasion apparatus.
- Invasive microorganisms include microorganisms that are naturally capable of delivering at least one molecule to a target cell, such as by traversing the cell membrane, e.g., a eukaryotic cell membrane, and entering the cytoplasm, as well as microorganisms which are not naturally invasive and which have been modified, e.g., genetically modified, to be invasive.
- a microorganism that is not naturally invasive can be modified to become invasive by linking the bacterium or BTP to an "invasion factor", also termed "entry factor” or "cytoplasm- targeting factor".
- an "invasion factor” is a factor, e.g., a protein or a group of proteins which, when expressed by a non-invasive bacterium or BTP, render the bacterium or BTP invasive.
- an “invasion factor” is encoded by a "cytoplasm-targeting gene”.
- the microorganism is a naturally invasive bacterium or BTP selected from the group that includes, but is not limited to, Yersinia, Rickettsia, Legionella, Brucella, Mycobacterium, Helicobacter, Coxiella, Chlamydia, Neisseria, Burkolderia, Bordetella, Borrelia, Listeria, Shigella, Salmonella, Staphylococcus, Streptococcus, Porphyromonas, Treponema, Vibrio, E. coli, and Bifidobacteriae.
- BTP naturally invasive bacterium or BTP selected from the group that includes, but is not limited to, Yersinia, Rickettsia, Legionella, Brucella, Mycobacterium, Helicobacter, Coxiella, Chlamydia, Neisseria, Burkolderia, Bordetella, Borrelia, Listeria, Shigella, Salmonella, Staphylococcus, Strept
- the naturally invasive bacterium or BTP is Yersinia expressing an invasion factor selected from the group including, but not limited to, invasin and YadA ⁇ Yersinia enterocolitica plasmid adhesion factor).
- the naturally invasive bacterium or BTP is Yersinia expressing an invasion factor selected from the group including, but not limited to, invasin and YadA ⁇ Yersinia enterocolitica plasmid adhesion factor).
- the naturally invasive bacterium or BTP is Yersinia expressing an invasion factor selected from the group including, but not limited to, invasin and YadA ⁇ Yersinia enterocolitica plasmid adhesion factor).
- the naturally invasive bacterium or BTP is Yersinia expressing an invasion factor selected from the group including, but not limited to, invasin and YadA ⁇ Yersinia enterocolitica plasmid adhesion factor).
- BTP is Rickettsia expressing the invasion factor RickA (actin polymerization protein).
- the naturally invasive bacterium or BTP is Legionella expressing the invasion factor RaIF (guanine exchange factor).
- the naturally invasive bacterium or BTP is Neisseria expressing an invasion factor selected from the group including, but not limited to, NadA ⁇ Neisseria adhesion/invasion factor), OpA and OpC (opacity-associated adhesions).
- the naturally invasive bacterium or BTP is Listeria expressing an invasion factor selected from the group including, but not limited to, InIA (intemalin factor), InIB (intemalin factor), Hpt (hexose phosphate transporter), and ActA (actin polymerization protein).
- the naturally invasive bacterium or BTP is Shigella expressing an invasion factor selected from the group including, but not limited to, the Shigella secreting factors IpaA (invasion plasmid antigen), IpaB, IpaC, IpgD, IpaB-IpaC complex, VirA, and IcsA.
- the naturally invasive bacterium or BTP is Salmonella expressing an invasion factor selected from the group including, but not limited to, Salmonella secreting/exchange factors SipA, SipC, SpiC, SigD, SopB, SopE, SopE2, and SptP.
- the naturally invasive bacterium or BTP is Staphylococcus expressing an invasion factor selected from the group including, but not limited to, the f ⁇ bronectin binding proteins FnBPA and FnBPB.
- the naturally invasive bacterium or BTP is Streptococcus expressing an invasion factor selected from the group including, but not limited to, the f ⁇ bronectin binding proteins ACP, Fba, F2, Sfbl , Sfb2, SOF, and PFBP.
- the naturally invasive bacterium or BTP is Porphyromonas gingivalis expressing the invasion factor FimB (integrin binding protein f ⁇ briae).
- the microorganism is a bacterium or BTP that is not naturally invasive but has been modified, e.g, genetically modified, to be invasive.
- the bacterium or BTP that is not naturally invasive has been genetically modified to be invasive by expressing an invasion factor selected from the group including, but not limited to, invasin, YadA, RickA, RaIF, NadA, OpA, OpC, InIA, InIB, Hpt, ActA, IpaA, IpaB, IpaC, IpgD, IpaB-IpaC complex, VirA, IcsA, SipA, SipC, SpiC, SigD, SopB, SopE, SopE2, SptP, FnBPA, FnBPB, ACP, Fba, F2, Sfbl, Sfb2, SOF, PFBP, and FimB.
- an invasion factor selected from the group including, but not limited to, invasin, YadA, RickA, RaIF, NadA, OpA, OpC, InIA, InIB, Hpt, ActA, IpaA, IpaB
- the microorganism is a bacterium or BTP that may be naturally invasive but has been modified, e.g., genetically modified, to express one or more additional invasion factors.
- the invasion factor is selected from the group that includes, but is not limited to, invasin, YadA, RickA, RaIF, NadA, OpA, OpC, InIA, InIB, Hpt, ActA, IpaA, IpaB, IpaC, IpgD, IpaB-IpaC complex, VirA, IcsA, SipA, SipC, SpiC, SigD, SopB, SopE, SopE2, SptP, FnBPA, FnBPB, ACP, Fba, F2, Sfbl, Sfb2, SOF, PFBP, and FimB.
- Naturally invasive microorganisms e.g., bacteria or BTPs
- a certain tropism i.e., preferred target cells.
- microorganisms e.g., bacteria or BTPs
- the bacterium or BTP is Streptococcus and the preferred target cells are selected from the group including, but not limited to, pharyngeal epithelial cells, buccal epithelial cells of the tongue, and mucosal epithelial cells.
- the bacterium or BTP is Porphyromonas and the preferred target cells are selected from the group including, but not limited to, oral epithelial cells.
- the bacterium or BTP is Staphylococcus and the preferred target cells are mucosal epithelial cells.
- the bacterium or BTP is Neisseria and the preferred target cells are selected from the group including, but not limited to, urethral epithelial cells and cervical epithelial cells.
- the bacterium or BTP is E. coli and the preferred target cells are selected from the group, including but not limited to, intestinal epithelial cells, urethral epithelial cells, and the cells of the upper urinary tract.
- the bacterium or BTP is Bordetella and the preferred target cells are respiratory epithelial cells.
- the bacterium or BTP is Vibrio and the preferred target cells are intestinal epithelial cells.
- the bacterium or BTP is Treponema and the preferred target cells are mucosal epithelial cells.
- the bacterium or BTP is Mycoplasma and the preferred target cells are respiratory epithelial cells.
- the bacterium or BTP is Helicobacter and the preferred target cells are the endothelial cells of the stomach.
- the bacterium or BTP is Chlamydia and the preferred target cells are selected from the group including, but not limited to, conjunctival cells and urethral epithelial cells.
- the microorganism is a bacterium or BTP that has been modified, e.g., genetically modified, to have a certain tropism.
- the preferred target cells are selected from the group including, but not limited to, pharyngeal epithelial cells, buccal epithelial cells of the tongue, mucosal epithelial cells, oral epithelial cells, epithelial cells of the urethra, cervical epithelial cells, intestinal epithelial cells, respiratory epithelial cells, cells of the upper urinary tract, epithelial cells of the stomach, and conjunctival cells.
- the preferred target cells are dysplastic or cancerous epithelial cells.
- the preferred target cells are activated or resting immune cells.
- Delivery of at least one molecule into a target cell can be determined according to methods known in the art.
- the presence of the molecule, by the decrease in expression of an RNA or protein silenced thereby can be detected by hybridization or PCR methods, or by immunological methods that may include the use of an antibody.
- Determining whether a microorganism is sufficiently invasive for use in the invention may include determining whether sufficient siRNA was delivered to host cells, relative to the number of microorganisms contacted with the host cells. If the amount of siRNA is low relative to the number of microorganisms used, it may be desirable to further modify the microorganism to increase its invasive potential.
- Bacterial or BTP entry into cells can be measured by various methods. Intracellular bacteria or BTPs survive treatment by aminoglycoside antibiotics, whereas extracellular bacteria are rapidly killed.
- a quantitative estimate of bacterial or BTP uptake can be achieved by treating cell monolayers with the antibiotic gentamicin to inactivate extracellular bacteria or BTPs, then by removing said antibiotic before liberating the surviving intracellular organisms with gentle detergent and determining viable counts on standard bacteriological medium. Furthermore, bacterial or BTP entry into cells can be directly observed, e.g., by thin-section-transmission electron microscopy of cell layers or by immunofluorescent techniques (Falkow et al. (1992) Annual Rev. Cell Biol. 8:333).
- Bacteria or BTPs that can be used for delivering RNA according to the method of the invention are preferably non-pathogenic. However, pathogenic bacteria or BTP s can also be used, so long as their pathogenicity has been attenuated, to thereby render the bacteria non-harmful to a subject to which it is administered.
- the term "attenuated bacterium or BTP" refers to a bacterium or BTP that has been modified to significantly reduce or eliminate its harmfulness to a subject.
- a pathogenic bacterium or BTP can be attenuated by various methods, set forth below.
- the bacterium or BTP delivering the RNA into the eukaryotic cell can enter various compartments of the cell, depending on the type of bacterium or BTP.
- the bacterium or BTP can be in a vesicle, e.g., a phagocytic vesicle.
- the bacterium or BTP can be destroyed or lysed and its contents delivered to the eukaryotic cell.
- a bacterium or BTP can also be engineered to express a phagosome degrading protein to allow leakage of RNA from the phagosome, hi one embodiment of this invention, the bacterium or BTP expresses, either naturally or through modification, e.g., genetic modification, a protein that contributes to pore-formation, breakage or degradation of the phagosome.
- the protein is a cholesterol-dependent cytolysin.
- the protein is selected from the group consisting of listeriolysin, ivanolysin, streptolysin, sphingomyelinase, perfringolysin, botulinolysin, leukocidin, anthrax toxin, phospholipase, IpaB (invasion plasmid antigen), IpaH, IcsB (intercellular spread), DOT/Icm (defect in organelle trafficking/intracellular multiplication defective), DOTU (stabilization factor for the DOT/Icm complex), IcmF, and PmrA (multidrug resistance efflux pump).
- the bacterium can stay alive for various times in the eukaryotic cell and may continue to produce RNA.
- the RNA or RNA-encoding DNA can then be released from the bacterium into the cell by, e.g., leakage, hi certain embodiments of the invention, the bacterium can also replicate in the eukaryotic cell, hi a preferred embodiment, bacterial replication does not kill the host cell.
- the invention is not limited to delivery of RNA or RNA-encoding DNA by a specific mechanism and is intended to encompass methods and compositions permitting delivery of RNA or RNA-encoding DNA by a bacterium independently of the mechanism of delivery.
- the bacterium or BTP for use in the present invention is non-pathogenic or non- virulent. In another aspect of this embodiment, the bacterium or BTP is therapeutic. In another aspect of this embodiment, the bacterium or BTP is an attenuated strain or derivative thereof selected from, but not limited to, Yersinia, Rickettsia, Legionella, Brucella, Mycobacterium, Helicobacter, Haemophilus, Coxiella, Chlamydia, Neisseria, Burkolderia, Bordetella, Borrelia, Listeria, Shigella, Salmonella, Staphylococcus, Streptococcus, Porphyromonas, Treponema, Vibrio, E.
- the Yersinia strain is an attenuated strain of the Yersinia pseudotuberculosis species.
- the Yersinia strain is an attenuated strain of the Yersinia enterocolitica species.
- the Rickettsia strain is an attenuated strain of the Rickettsia coronii species.
- the Legionella strain is an attenuated strain of the Legionella pneumophilia species.
- the Mycobacterium strain is an attenuated strain of the Mycobacterium tuberculosis species.
- the Mycobacterium strain is an attenuated strain of the Mycobacterium bovis BCG species.
- the Helicobacter strain is an attenuated strain of the Helicobacter pylori species.
- the Coxiella strain is an attenuated strain of Coxiella burnetti.
- the Haemophilus strain is an attenuated strain of the Haemophilus influenza species.
- the Chlamydia strain is an attenuated strain of the Chlamydia trachomatis species.
- the Chlamydia strain is an attenuated strain of the Chlamydia pneumoniae species.
- the Neisseria strain is an attenuated strain of the Neisseria gonorrheae species.
- the Neisseria strain is an attenuated strain of the Neisseria meningitides species.
- the Burkolderia strain is an attenuated strain of the Burkolderia cepacia species.
- the Bordetella strain is an attenuated strain of the Bordetella pertussis species.
- the Borrelia strain is an attenuated strain of the Borrelia hermisii species.
- the Listeria strain is an attenuated strain of the Listeria monocytogenes species.
- the Listeria strain is an attenuated strain of the Listeria ivanovii species.
- the Salmonella strain is an attenuated strain of the Salmonella enterica species.
- the Salmonella strain is an attenuated strain of the Salmonella typhimurium species.
- the Salmonella typhimurium strain is SL 7207 or VNP20009.
- the Staphylococcus strain is an attenuated strain of the Staphylococcus aureus species.
- the Streptococcus strain is an attenuated strain of the Streptococcus pyogenes species.
- the Streptococcus strain is an attenuated strain of the Streptococcus mutans species.
- the Streptococcus strain is an attenuated strain of the Streptococcus salivarius species.
- the Streptococcus strain is an attenuated strain of the Streptococcus pneumonia species.
- the Porphyromonas strain is an attenuated strain of the Porphyromonas gingivalis species.
- the Pseudomonas strain is an attenuated strain of the Pseudomonas aeruginosa species.
- the Treponema strain is an attenuated strain of the Treponema pallidum species.
- the Vibrio strain is an attenuated strain of the Vibrio cholerae species.
- the E. coli strain is MM294.
- any bacterial strain can be modified to modulate, in particular to increase, its invasive characteristics ⁇ e.g., as described in section 1.3).
- Naturally invasive bacteria employed in the present invention are not critical thereto.
- examples of such naturally occurring invasive bacteria include, but are not limited to, Shigella spp., Salmonella spp., Listeria spp., Rickettsia spp., and enteroinvasive Escherichia coli.
- Shigella strain employed is not critical to the present invention.
- Shigella strains that can be employed in the present invention include Shigella flexneri 2a (ATCC No. 29903), Shigella sonnei (ATCC No. 29930), and Shigella disenteriae (ATCC No. 13313).
- An attenuated Shigella strain such as Shigella flexneri 2a 2457T aroA virG mutant CVD 1203 (Noriega et al. supra), Shigella flexneri M90T icsA mutant (Goldberg et al. Infect.
- Shigella flexneri Y SFLl 14 aroD mutant (Karnell et al. Vacc, 10:167-174 (1992)), and Shigella flexneri aroA aroD mutant (Verma et al. Vacc, 9:6-9 (1991)) are preferably employed in the present invention.
- new attenuated Shigella spp. strains can be constructed by introducing an attenuating mutation either singularly or in conjunction with one or more additional attenuating mutations.
- At least one advantage to Shigella bacteria as delivery vectors is their tropism for lymphoid tissue in the colonic mucosal surface.
- the primary site of Shigella replication is believed to be within dendritic cells and macrophages, which are commonly found at the basal lateral surface of M cells in mucosal lymphoid tissues (reviewed by McGhee, J. R. et al. (1994) Reproduction, Fertility, & Development 6:369; Pascual, D. W. et al. (1994) Immunomethods 5 :56).
- Shigella vectors may provide a means to target RNA interference or deliver therapeutic molecules to these professional antigen-presenting cells. Another advantage of Shigella vectors is that attenuated Shigella strains deliver nucleic acid reporter genes in vitro and in vivo (Sizemore, D. R. et al. (1995) Science 270:299; Courvalin, P. et al. (1995) Comptes Rendus de 1 Academy des Sciences Serie III- Sciences de Ia Vie-Life Sciences 318:1207; Powell, R. J. et al. (1996) In: Molecular approaches to the control of infectious diseases. F. Brown, E. Norrby, D. Burton and J. Mekalanos, eds. Cold Spring Harbor Laboratory Press, New York.
- Attenuating mutations can be introduced into bacterial pathogens using non-specific mutagenesis either chemically, using agents such as N-methyl-N'-nitro-N-nitrosoguanidine, or using recombinant DNA techniques; classic genetic techniques, such as TnIO mutagenesis, P22 -mediated transduction, ⁇ phage mediated crossover, and conjugational transfer; or site-directed mutagenesis using recombinant DNA techniques.
- Recombinant DNA techniques are preferable since strains constructed by recombinant DNA techniques are far more defined. Examples of such attenuating mutations include, but are not limited to:
- auxotrophic mutations such as aro (Hoiseth et al. Nature, 291 :238-239 (1981)), gua (McFarland et al. Microbiol. Path., 3:129-141 (1987)), nad (Park et al. J. Bact., 170:3725-3730
- the attenuating mutations can be either constitutively expressed or under the control of inducible promoters, such as the temperature sensitive heat shock family of promoters (Neidhardt et al. supra), or the anaerobically induced nirB promoter (Harborne et al. MoI. Micro., 6:2805-2813 (1992)) or repressible promoters, such as uapA (Gorf ⁇ nkiel et al. J. Biol. Chem., 268:23376-23381 (1993)) or gcv (Stauffer et al. J. Bact., 176:6159-6164 (1994)).
- inducible promoters such as the temperature sensitive heat shock family of promoters (Neidhardt et al. supra), or the anaerobically induced nirB promoter (Harborne et al. MoI. Micro., 6:2805-2813 (1992)) or repressible promote
- Salmonella strains that can be employed in the present invention include Salmonella typhi (ATCC No. 7251) and S. typhimurium (ATCC No. 13311). Attenuated Salmonella strains are preferably used in the present invention and include S. typhi-aioC-aroD (Hone et al. Vacc. 9:810 (1991) and S. typhimurium-aroA mutant (Mastroeni et al. Micro. Pathol. 13:477 (1992)). Alternatively, new attenuated Salmonella strains can be constructed by introducing one or more attenuating mutations as described for Shigella spp. above.
- Rickettsia strain employed is not critical to the present invention.
- Rickettsia strains which can be employed in the present invention include Rickettsia Rickettsiae (ATCC Nos. VR149 and VR891), Ricketsia prowaseckii (ATCC No. VR233), Rickettsia tsutsugamuchi (ATCC Nos. VR312, VR150 and VR609), Rickettsia mooseri (ATCC No. VR144), Rickettsia sibirica (ATCC No. VRl 51), and Rochalimaea quitana (ATCC No. VR358).
- Attenuated Rickettsia strains are preferably used in the present invention and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- enteroinvasive Escherichia strain employed is not critical to the present invention.
- enteroinvasive Escherichia strains which can be employed in the present invention include Escherichia coli strains 4608-58, 1184-68, 53638-C-17, 13-80, and 6-81 (Sansonetti et al. Ann. Microbiol. (Inst. Pasteur), 132A:351-355 (1982)).
- Attenuated enteroinvasive Escherichia strains are preferably used in the present invention and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- integrin molecules which are receptors for certain invasion factors
- integrin molecules which are receptors for certain invasion factors
- integrin molecules which are receptors for certain invasion factors
- RNA e.g., RNA into target cells.
- viruses e.g., foot-and-mouth disease virus, echovirus, and adenovirus
- eukaryotic pathogens e.g., Histoplasma capsulatum and Leishmania major interact with integrin molecules.
- bacteria which can be used in the invention and which have been described in the literature as being non-invasive or at least less invasive than the bacteria listed in the previous section (1.1) include, but are not limited to, Yersinia spp., Escherichia spp., Klebsiella spp., Bordetella spp., Neisseria spp., Aeromonas spp., Franciesella spp., Corynebacterium spp., Citrobacter spp., Chlamydia spp., Hemophilus spp., Brucella spp., Mycobacterium spp., Legionella spp., Rhodococcus spp., Pseudomonas spp., Helicobacter spp., Vibrio spp., Bacillus spp., and Erysipelothrix spp.
- Yersinia strains that can be employed in the present invention include Y. enterocolitica (ATCC No. 9610) or Y. pestis (ATCC No. 19428). Attenuated Yersinia strains, such as Y. enterocolitica Ye03-R2 (al-Hendy et al. Infect. Immun., 60:870-875 (1992)) or Y. enterocolitica aroA (O'Gaora et al. Micro. Path., 9:105-116 (1990)) are preferably used in the present invention.
- new attenuated Yersinia strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- the particular Escherichia strain employed is not critical to the present invention. Examples of Escherichia strains that can be employed in the present invention include E. coli Nissle 1917, MM294, H10407 (Elinghorst et al. Infect. Immun., 60:2409-2417 (1992)), and E. coli EFC4, CFT325 and CPZ005 (Donnenberg et al. J. Infect. Dis., 169:831-838 (1994)).
- Attenuated Escherichia strains such as the attenuated turkey pathogen E. coli 02 carAB mutant (Kwaga et al. Infect. Immun., 62:3766-3772 (1994)) or CEQ201 are preferably used in the present invention.
- new attenuated Escherichia strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- the particular Klebsiella strain employed is not critical to the present invention. Examples of Klebsiella strains that can be employed in the present invention include K. pneumoniae (ATCC No. 13884).
- Attenuated Klebsiella strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Bordetella strain employed is not critical to the present invention.
- Bordetella strains that can be employed in the present invention include B. bronchiseptica (ATCC No. 19395).
- Attenuated Bordetella strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Neisseria strain employed is not critical to the present invention.
- Neisseria strains that can be employed in the present invention include N. meningitidis (ATCC No. 13077) and N. gonorrhoeae (ATCC No. 19424).
- Attenuated Neisseria strains such as N. gonorrhoeae MSIl aro mutant (Chamberlain et al. Micro. Path., 15:51-63 (1993)) are preferably used in the present invention.
- new attenuated Neisseria strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Aeromonas strain employed is not critical to the present invention.
- Aeromonas strains that can be employed in the present invention include A. eucrenophila (ATCC No. 23309).
- new attenuated Aeromonas strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Franciesella strains that can be employed in the present invention include F. tularensis (ATCC No. 15482). Attenuated Franciesella strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Corynebacterium strain employed is not critical to the present invention.
- Examples of Corynebacterium strains that can be employed in the present invention include C. pseudotuberculosis (ATCC No. 19410).
- Attenuated Corynebacterium strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Citrobacter strain employed is not critical to the present invention.
- Citrobacter strains that can be employed in the present invention include C.freundii (ATCC No. 8090).
- Attenuated Citrobacter strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Chlamydia strain employed is not critical to the present invention.
- Chlamydia strains that can be employed in the present invention include C. pneumoniae (ATCC No. VRl 310).
- Attenuated Chlamydia strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Hemophilus strain employed is not critical to the present invention.
- Hemophilus strains that can be employed in the present invention include H. sornnus (ATCC No. 43625).
- Attenuated Hemophilus strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Brucella strain employed is not critical to the present invention.
- Brucella strains that can be employed in the present invention include B. abortus (ATCC No. 23448).
- Attenuated Brucella strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Mycobacterium strain employed is not critical to the present invention.
- Mycobacterium strains that can be employed in the present invention include M. intracellular (ATCC No. 13950) and M. tuberculosis (ATCC No. 27294).
- Attenuated Mycobacterium strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- the particular Legionella strain employed is not critical to the present invention. Examples of
- Legionella strains that can be employed in the present invention include L. pneumophila (ATCC No. 33156). Attenuated Legionella strains, such as a L. pneumophila mip mutant (Ott, FEMS Micro. Rev., 14:161-176 (1994)) are preferably used in the present invention. Alternatively, new attenuated Legionella strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- L. pneumophila ATCC No. 33156
- Attenuated Legionella strains such as a L. pneumophila mip mutant (Ott, FEMS Micro. Rev., 14:161-176 (1994)
- new attenuated Legionella strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Rhodococcus strains are not critical to the present invention.
- Rhodococcus strains that can be employed in the present invention include R. equi (ATCC No. 6939).
- Attenuated Rhodococcus strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Pseudomonas strain employed is not critical to the present invention.
- Pseudomonas strains that can be employed in the present invention include P. aeruginosa (ATCC No. 23267).
- Attenuated Pseudomonas strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Helicobacter strains that can be employed in the present invention include H. mustelae (ATCC No. 43772).
- Attenuated Helicobacter strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Salmonella strains that can be employed in the present invention include Salmonella typhi (ATCC No. 7251) and S. typhimurium (ATCC No. 13311). Attenuated Salmonella strains are preferably used in the present invention and include S. typhi aroC aroD (Hone et al. Vacc, 9:810-816 (1991)) and S. typhimurium aroA mutant (Mastroeni etal. Micro. Pathol, 13:477-491 (1992))). Alternatively, new attenuated Salmonella strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Vibrio strains that can be employed in the present invention include Vibrio cholerae (ATCC No. 14035) and Vibrio multiplinnatiensis (ATCC No. 35912).
- Attenuated Vibrio strains are preferably used in the present invention and include V. cholerae RSI virulence mutant (Taylor et al. J. Infect. Dis., 170:1518-1523 (1994)) and V. cholerae ctxA, ace, zot, cep mutant (Waldor etal. J. Infect. Dis.,
- new attenuated Vibrio strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- Erysipelothrix strains that can be employed in the present invention include Erysipelothrix rhusiopathiae (ATCC No. 19414) and Erysipelothrix tonsill ⁇ rum (ATCC No. 43339).
- Attenuated Erysipelothrix strains are preferably used in the present invention and include E. rhusiopathiae Kg-Ia and Kg-2 (Watarai et al. J. Vet. Med. Sci., 55:595-600 (1993)) and E. rhusiopathiae ORVAC mutant (Markowska-Daniel et al. hit. J. Med. Microb. Virol. Parisit. Infect.
- new attenuated Erysipelothrix strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
- organisms have been traditionally described as invasive or non-invasive, these organisms can be engineered to increase their invasive properties, e.g., by mimicking the invasive properties of Shigella spp., Listeria spp., Rickettsia spp., or enteroinvasive E. coli spp.
- one or more genes that enable the microorganism to access the cytoplasm of a cell e.g., a cell in the natural host of said non-invasive bacteria, can be introduced into the microorganism.
- cytoplasm-targeting genes include genes encoding the proteins that enable invasion by Shigella or the analogous invasion genes of enteroinvasive Escherichia, or listeriolysin O of Listeria, as such techniques are known to result in rendering a wide array of invasive bacteria capable of invading and entering the cytoplasm of animal cells (Formal etal. Infect. Immun., 46:465 (1984); Bielecke etal. Nature, 345:175-176 (1990); Small et al. In: Microbiology- 1986, pages 121-124, Levine et al. Eds., American Society for Microbiology, Washington, D.C. (1986); Zychlinsky et al. Molec.
- Invasin can also be introduced in combination with listeriolysin, thereby further increasing the invasive character of the bacteria relative to the introduction of either of these genes.
- the above genes have been described for illustrative purposes; however, it will be obvious to those skilled in the art that any gene or combination of genes, from one or more sources, that participates in the delivery of a molecule, in particular an RNA or RNA-encoding DNA moleecule, from a microorganism into the cytoplasm of a cell, e.g. , an animal cell, will suffice.
- such genes are not limited to bacterial genes, and include viral genes, such as influenza virus hemagglutinin HA-2 that promotes endosmolysis (Plank et al. J. Biol. Chem., 269:12918-12924 (1994)).
- the above cytoplasm-targeting genes can be obtained by, e.g., PCR amplification from DNA isolated from an invasive bacterium carrying the desired cytoplasm-targeting gene.
- Primers for PCR can be designed from the nucleotide sequences available in the art, e.g., in the above-listed references and/or in GenBank, which is publicly available on the internet (www.ncbi.nlm.nih.gov/).
- the PCR primers can be designed to amplify a cytoplasm-targeting gene, a cytoplasm-targeting operon, a cluster of cytoplasm-targeting genes, or a regulon of cytoplasm-targeting genes.
- the PCR strategy employed will depend on the genetic organization of the cytoplasm-targeting gene or genes in the target invasive bacteria.
- the PCR primers are designed to contain a sequence that is homologous to DNA sequences at the beginning and end of the target DNA sequence.
- the cytoplasm-targeting genes can then be introduced into the target bacterial strain, e.g., by using Hfr transfer or plasmid mobilization (Miller, A Short Course in Bacterial Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1992); Bothwell et al. supra; and Ausubel et al. supra), bacteriophage- mediated transduction (de Boer, supra; Miller, supra; and Ausubel et al.
- cytoplasm-targeting genes can be incorporated into lysogenic bacteriophage (de Boer et al. Cell, 56:641-649 (1989)), plasmids vectors (Curtiss et al. supra) or spliced into the chromosome (Hone et al. supra) of the target strain.
- bacteria and BTPs can also be modified by linking an invasion factor to the bacteria.
- a bacterium is rendered more invasive by coating the bacterium, either covalently or non-covalently, with an invasion factor, e.g., the protein invasin, invasin derivatives, or a fragment thereof sufficient for invasiveness.
- an invasion factor e.g., the protein invasin, invasin derivatives, or a fragment thereof sufficient for invasiveness.
- latex beads coated with the carboxyl terminal region of invasin are efficiently internalized by mammalian cells, as are strains of Staphylococcus aureus coated with antibody- immobilized invasin (reviewed in Isberg and Tran van Nhieu (1994) Ann. Rev. Genet. 27:395).
- a bacterium can also be coated with an antibody, variant thereof, or fragment thereof, which binds specifically to a surface molecule recognized by a bacterial entry factor.
- an antibody variant thereof, or fragment thereof, which binds specifically to a surface molecule recognized by a bacterial entry factor.
- bacteria are internalized if they are coated with a monoclonal antibody directed against an integrin molecule, e.g., ⁇ 5Bl, known to be the surface molecule with which the bacterial invasin protein interacts (Isberg and Tran van Nhieu, supra).
- integrin molecule e.g., ⁇ 5Bl
- Such antibodies can be prepared according to methods known in the art.
- the antibodies can be tested for efficacy in mediating bacterial invasiveness by, e.g., coating bacteria with the antibody, contacting the bacteria with eukaryotic cells having a surface receptor recognized by the antibody, and monitoring the presence of intracellular bacteria, according to the methods described above.
- Methods for linking an invasion factor to the surface of a bacterium are known in the art and include cross-linking.
- the present invention also provides at least one vector or plasmid including at least one DNA molecule encoding one or more siRNAs and at least one promoter, wherein the expressed siRNAs interfere with at least one mRNA of a gene of interest.
- the present invention provides at least one prokaryotic vector including at least one DNA molecule encoding one or more siRNAs and at least one RNA-polymerase III compatible promoter or at least one prokaryotic promoter, wherein the expressed siRNAs interfere with at least one mRNA of a gene of interest.
- the TRIP (transkingdom RNA interference plasmid) vectors and plasmids of the present invention include a multiple cloning site, a promoter sequence and a terminator sequence.
- the TRIP vectors and plasmids also include one or more sequences encoding for an invasion factor to permit the non-invasive bacterium or BTP to enter mammalian cells (e.g., the Inv locus that encodes invasion that permits the bacterium or BTP to enter ⁇ 1 -integrin-positive mammalian cells) (Young et al., J. Cell Biol. 116, 197-207 (1992)) and one or more sequences to permit the genetic material to escape from the entry vesicles (e.g., HIy A gene that encodes listeriolysin O) (Mathew et al., Gene Ther.
- an invasion factor to permit the non-invasive bacterium or BTP to enter mammalian cells
- mammalian cells e.g., the Inv locus that encodes invasion that permits the bacterium or BTP to enter ⁇ 1 -integrin-positive mammalian cells
- TRIP is further described (including a vector/plasmid schematic) in PCT Publication No. WO 06/066048.
- the TRIP vectors and plasmids will incorporate a hairpin RNA expression cassette encoding short hairpin RNA under the control of an appropriate promoter sequence and terminator sequence.
- the one or more DNA molecules encoding the one or more siRNAs are transcribed within the eukaryotic target cell or transcribed within the bacterium or BTP.
- the one or more siRNAs are transcribed within the eukaryotic cells as shRNAs .
- the eukaryotic cell can be in vivo, in vitro or ex vivo.
- the one or more DNA molecules encoding the one or more siRNAs contain a eukaryotic promoter.
- the eukaryotic promoter is a RNA- polymerase III promoter.
- the RNA polymerase III promoter is a U6 promoter or an Hl promoter.
- the one or more DNA molecules contain a prokaryotic promoter.
- the prokaryotic promoter is an E. coli promoter.
- the E. coli promoter can be a T7 promoter, lacUV5 promoter, RNA polymerase promoter, gapA promoter, pAl promoter, lac regulated promoter, araC+ P amBAD promoter, T5 promoter, P 120 promoter (Estrem et al, 1998, Proc. Natl. Acad. Sci. USA 95, 9761-9766; Meng et al., 2001, Nucleic Acids Res. 29, 4166-417; De Boer et al., 1983, Proc. NatL Acad. Sci. USA 80, 21-25) or recA promoter.
- promoter sequences are recited in Table 1.
- Table 1 Preferable, promoter sequences are recited in Table 1.
- RNA polymerase promoter TAATTGATACTTTATGCTTTTT TCTGTATAAT gapA promoter AAGCTTTCAGTCGCGTAATGCT TAGGCACAGGATTGATTTGTCG CAATGATTGACACGATTCCGCT TGACACTGCGTAAGTTTTGTGT TATAATGGATCC pAl promoter AAGCTTAAGGAGAGACAACTTA AAGAGACTTAAAAGATTAATTT AAAATTTATCAAAAAGAGTATT GACTTAAAGTCTAACCTATAGG ATACTTGGATCC lac regulated promoter AAGCTTTGTGTGGAATTGTGAG CGGATAACAATTCCACACATTG ACACTTTATGCTTCCGGCTCGT ATAATGGATCC lac regulated promoter AAGCTTGGAAAATTTTTTTTAA AAAAGTCATGTGTGGAATTGTG AGCGGATAACAATTCCACATAT AATGGATCC araC+ P 3n BAD promoter GACTTCATATACCCAAGCTTTA 10 AAAAAAAAATCCTTAGCTTTCG
- the E. coli promoter is associated with a terminator.
- the E. coli terminator can be a T7 terminator, lacUV5 terminator, Rho-independent terminator, Rho-dependent terminator, or RNA polymerase terminator.
- terminator sequences are recited in Table 2.
- the vectors and plasmids of the present invention further include one or more enhancer sequences, selection markers, or lysis regulation system sequences.
- the one or more DNA molecules contain a prokaryotic enhancer.
- the prokaryotic enhancer is a T7 enhancer.
- the T7 enhancer has the sequence GAGACAGG (SEQ ID NO: 42).
- the one or more DNA molecules contain a prokaryotic terminator.
- the one or more DNA molecules are associated with one or more selection markers.
- the selection marker is an amber suppressor containing one or more mutations or an diamino pimelic acid (DAP) containing one or more mutations.
- DAP diamino pimelic acid
- the dap gene is selected from, but not limited to, dapA and dapE.
- selection marker sequences are recited in Table 3.
- the terminator is an rrnC terminator.
- terminator sequences are recited in Table 5.
- Bacterial and BTP delivery is more attractive than viral delivery because they are more accessible to genetic manipulation, which allows the production of vector strains specifically tailored to certain applications.
- the methods of the invention are used to create bacteria and BTPs that cause RNAi in a tissue specific manner.
- Liberation of the siRNA encoding plasmid or the one or more siRNAs from the intracellular bacteria or BTPs occurs through active mechanisms.
- One mechanism involves the type III export system in S. typhimuriumm, a specialized multiprotein complex spanning the bacterial or BTP cell membrane whose functions include secretion of virulence factors to the outside of the cell to allow signaling towards the target cell, but which can also be used to deliver antigens into target cells (R ⁇ ssmann H. Int J Med Microbiol, 293:107-12 (2003)), or through bacterial lysis and liberation of bacterial or BTP contents into the cytoplasm.
- the lysis of intracellular bacteria or BTPs is triggered through various mechanisms, including addition of an intracellularly active antibiotic (tetracycline), naturally through bacterial metabolic attenuation (auxotrophy), or through a lysis regulation system or bacterial suicide system comprising a bacterial regulator, promoter and sensor that is sensitive to the environment, e.g., the pH, magnesium concentration, phosphate concentration, ferric ion concentration, osmolarity, anaerobic conditions, nutritional deficiency and general stress of the target cell or the host phagosome.
- an intracellularly active antibiotic tetracycline
- auxotrophy bacterial metabolic attenuation
- a lysis regulation system or bacterial suicide system comprising a bacterial regulator, promoter and sensor that is sensitive to the environment, e.g., the pH, magnesium concentration, phosphate concentration, ferric ion concentration, osmolarity, anaerobic conditions, nutritional deficiency and general stress of the target cell or the host phagosome.
- bacteria or BTP lysis regulation system senses one or more of the above environmental conditions
- bacterial or BTP lysis is triggered by one or more mechanisms including but not limited to antimicrobial proteins, bacteriophage lysins and autolysins expressed by the bacteria or BTP, either naturally or through modification, or through pore-forming proteins expressed by the bacteria or BTPs, either naturally or through modification, e.g., genetic modification, which break the phagosomes containing the bacteria or BTPs and liberate the siRNA-encoding plasmid or the one or more siRNAs.
- antimicrobial proteins bacteriophage lysins and autolysins expressed by the bacteria or BTP
- pore-forming proteins expressed by the bacteria or BTPs either naturally or through modification, e.g., genetic modification, which break the phagosomes containing the bacteria or BTPs and liberate the siRNA-encoding plasmid or the one or more siRNAs.
- the regulator of the lysis regulation system may be selected from the group that includes but is not limited to OmpR, ArcA, PhoP, PhoB, Fur, RstA, EvgA and RpoS.
- Preferable, lysis regulator sequences are recited in Table 6.
- PhoP regulator ATGCGCGTACTGGTTGTTGAAG 30 ACAATGCGTTGTTACGTCACCA CCTTAAAGTTCAGATTCAGGAT GCTGGTCATCAGGTCGATGACG CAGAAGATGCCAAAGAAGCCGA TTATTATCTCAATGAACATATA CCGGATATTGCGATTGTCGATC TCGGATTGCCAGACGAGGACGG TCTGTCACTGATTCGCCGCTGG CGTAGCAACGATGTTTCACTGC CGATTCTGGTATTAACCGCCCG TGAAAGCTGGCAGGACAAAGTC
- the promoter of the lysis regulation system may be selected from the group that includes but is not limited to ompF, ompC, fadB, phoPQ, mgtA, mgrB, psiB, phnD, Ptrp, sodA, sodB, sltA, sltB, asr, csgD, emrKY, yhiUV, acrAB, mdfA and tolC.
- lysis regulation system promoter sequences are recited in Table 7. Table 7
- the sensor of the lysis regulation system may be selected from the group that includes but is not limited to EnvZ, ArcB, PhoQ, PhoR, RstB and EvgS.
- Preferable, lysis regulation system sensor sequences are recited in Table 8. Table 8
- PhoQ sensor ATGAAAAAATTACTGCGTCTTT 38 TTTTCCCGCTCTCGCTGCGGGT ACGTTTTCTGTTGGCAACGGCA GCGGTAGTACTGGTGCTTTCGC TTGCCTACGGAATGGTCGCGCT GATCGGTTATAGCGTCAGTTTC GATAAAACTACGTTTCGGCTGT TACGTGGCGAGAGCAATCTGTT CTATACCCTTGCGAAGTGGGAA AACAATAAGTTGCATGTCGAGT TACCCGAAAATATCGACAAGCA AAGCCCCACCATGACGCTAATT TATGATGAGAACGGGCAGCTTT TATGGGCGCAACGTGACGTGCC CTGGCTGATGAAGATGATCCAG CCTGACTGGCTGAAATCGAATG GTTTTCATGAAATTGAAGCGGA TGTTAACGATACCAGCCTCTTG CTGAGTGGAGATCATTCGATAC AGCAACAGTTGCAGGAAGTGCGGGAAGATGATCCAGCCTCTTG CTGAGTGGATCATTCGATAC AG
- the lysis regulation system may comprise any combination of one or more of the above regulators, promoters and sensors.
- the lysis regulation system comprises OmpR as the regulator, ompF as the promoter and EnvZ as the sensor and the stimulus is reduced osmolality.
- the lysis regulation system comprises OmpR as the regulator, ompC as the promoter and EnvZ as the sensor and the stimulus is reduced osmolality.
- the lysis regulation system comprises the ArcA as the regulator, fad as the promoter and Arc B as the sensor and the stimulus is anaerobic conditions.
- the lysis regulation system comprises PhoP as the regulator, phoPQ as the promoter and PhoQ as the sensor and the stimulus is reduced magnesium concentration.
- the lysis regulation system comprises PhoP as the regulator, mgtA as the promoter and PhoQ as the sensor and the stimulus is reduced magnesium concentration.
- the lysis regulation system comprises PhoP as the regulator, mgrB as the promoter and PhoQ as the sensor and the stimulus is reduced magnesium concentration.
- the lysis regulation system comprises PhoB as the regulator, psiB as the promoter and PhoR as the sensor and the stimulus is reduced phosphate concentration.
- the lysis regulation system comprises PhoB as the regulator, phnD as the promoter and PhoR as the sensor and the stimulus is reduced phosphate concentration.
- the lysis regulation system comprises RstA as the regulator, asr as the promoter and RstB as the sensor.
- the lysis regulation system comprises RstA ast the regulator, csgD as the promoter and RstB as the sensor.
- the lysis regulation system comprises EvgA as the regulator, emrKY as the promoter and EvgS as the sensor. In another example of this embodiment, the lysis regulation system comprises EvgA as the regulator, yhiUV as the promoter and EvgS as the sensor. In another example of this embodiment, the lysis regulation system comprises EvgA as the regulator, acrAB as the promoter and EvgS as the sensor. In another example of this embodiment, the lysis regulation system comprises EvgA as the regulator, mdfA as the promoter and EvgS as the sensor. In another example of this embodiment, the lysis regulation system comprises EvgA as the regulator, tolC as the promoter and EvgS as the sensor.
- the lysis regulation system comprises Fur as the regulator in combination with a promoter selected from the group comprising sodA, sodB, sltA or sltB.
- the antimicrobial protein may be selected from the group that includes but is not limited to ⁇ - and ⁇ -defensins, protegrins, cathelicidins (e.g., indolicidin and bactenecins), granulysin, lysozyme, lactoferrin, azurocidin, elastase, bactericidal permeability inducing peptide (BPI), adrenomedullin, brevinin, histatins and hepcidin. Additional antimicrobial proteins are disclosed in the following, each of which is incorporated herein by reference in its entirety: Devine, D.A. et al., Current Pharmaceutical Design, 8, 703-714 (2002); Jack R. W., et al., Microbiological Reviews, 59 (2), 171- 200 (June 1995).
- cathelicidins e.g., indolicidin and bactenecins
- granulysin e
- the antimicrobial protein is an ⁇ -defensin, ⁇ -defensin, or protegrin.
- antimicrobial protein sequences are recited in Table 9.
- Table 9 GGTCGCCTGTGCTATTGTAGGC GTAGGTTCTGCGTCTGTGTCGG ACGAGGATGACGGTTGCGACGG CAGGCTTTCCCTCCCCCAATTT TCCCGGGGCCAGGTTTCCGTCC CCCAATTTTTCCGCCTCCACCT TTCCGGCCCGCACCATTCGGTC CACCAAGGTTCCCTGGTAGACG GTGAAGGATTTGCAGGCAACTC ACCCAGAAGGCCTTTCGGTACA TTAAAATCCCAGCAAGGAGACC TAAGCATCTGCTTTGCCCAGGC CCGCATCTGTCAAATAAATTCT TGTGAAACC protegrin-3 protein ATGGAGACCCAGAGAGCCAGCC 48 TGTGCCTGGGGCGCTGGTCACT GTGGCTTCTGCTGCTGGCACTC GTGGTGCCCTCGGCCAGCCC AGGCCCTC
- the bacteriophase lysin may be selected from the group that includes but is not limited to holins and endolysins or lysins (e.g., lysozyme, amidase and transglycoslate). Additional lysins are disclosed in the following, each of which is incorporated herein by reference in its entirety: Kloos D.- U., et al., Journal of Bacteriology, 176 (23), 7352-7361 (December 1994); Jain V., et al., Infection and Immunity, 68 (2), 986-989 (February 2000); Srividhya K.V., et al., J. Biosci., 32, 979-990 (2007); Young R.V., Microbiological Reviews, 56 (3), 430-481 (September 1992).
- the autolysin may be selected from the group that includes but is not limited to peptidoglycan hydrolases, amidases (e.g., N-acetylmuramyl-L-alanine amidases), transglycosylases, endopeptidases and glucosaminidases.
- amidases e.g., N-acetylmuramyl-L-alanine amidases
- transglycosylases e.g., endopeptidases and glucosaminidases.
- the control exerted by the lysis regulation system may further be enhanced by bacterial or BTP strain-specific regulation.
- the strain-specific regulation is attenuation caused by deletion of a nutritional gene.
- the nutritional gene may be selected from the group that includes but is not limited to dapA, aroA and guaBA.
- dapA attenuation results in deficiency in the biosynthesis of lysine and peptidoglycan.
- transcription of genes including but not limited to lysC may be activated by mechanisms such as transcriptional induction, antitermination and riboswitch.
- aroA attenuation results in deficiency in aromatic amino acids and derepression of one or more genes including but not limited to aroF, aroG and aroH by regulators such as TrpR and TyrR.
- guaBA attenuation results in derepression of one or more genes that are repressed by PurR.
- the bacteria or BTP may further contain an inducible system that includes but is not limited to a Tet-on expression system to facilitate bacterial or BTP lysis at a time desired by the clinician.
- the bacteria or BTP Upon administration of tetracycline, which activates the Tet-on promoter, the bacteria or BTP express a protein that triggers lysis of the bacteria or BTP.
- the protein expressed under the Tet- on expression system is selected from the group that includes but is not limited to defensins and protegrins.
- the present invention also provides a lysis regulation system in combination with strain- specific attenuation (e.g., nutritional attenuation).
- strain- specific attenuation e.g., nutritional attenuation
- a global regulator can sense an extraceullar condition and regulate transcription, starvation for specific nutrient such as an amino acid in vivo, in contrast to laboratory growth in the presence of excess of the nutrient and a positive or negative regulator in response to starvation.
- a global regulator can sense an extraceullar condition and regulate transcription, starvation for specific nutrient such as an amino acid in vivo, in contrast to laboratory growth in the presence of excess of the nutrient and a positive or negative regulator in response to starvation.
- the present invention provides a plasmid containing a lysis regulation system comprising OmpR as the regulator, ompF or ompC as the promoter and protegrin or ⁇ -defensin as the antimicrobial protein, in combination with a Tet-on expression system, which provides two levels of control of bacterial lysis.
- a lysis regulation system comprising OmpR as the regulator, ompF or ompC as the promoter and protegrin or ⁇ -defensin as the antimicrobial protein, in combination with a Tet-on expression system, which provides two levels of control of bacterial lysis.
- the DNA insert comprises one or more of the following constructs, each of which contains an HPV target sequence, a hairpin sequence and BamHl and Sail restriction sites to facilitate incorporation into the hairpin RNA expression cassette of the TRIP plasmid as shown in Table 10.
- Table 10 each of which contains an HPV target sequence, a hairpin sequence and BamHl and Sail restriction sites to facilitate incorporation into the hairpin RNA expression cassette of the TRIP plasmid as shown in Table 10.
- the present invention also provides methods of using the various bacterium, BTP and vectors provided in the invention.
- the present invention provides methods of delivering one or more siRNAs to mammalian cells.
- the methods include introducing at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs to the mammalian cells.
- the present invention also provides methods of regulating gene expression in mammalian cells.
- the method includes introducing at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs to the mammalian cells, where the expressed siRNAs interfere with at least one mRNA of a gene of interest thereby regulating gene expression.
- BTP bacterial therapeutic particle
- the invention provides a method for delivering RNA to any type of target cell.
- target cell refers to a cell that can be invaded by a bacterium, i.e., a cell that has the necessary surface receptor for recognition by the bacterium.
- Preferred target cells are eukaryotic cells. Even more preferred target cells are animal cells. "Animal cells" are defined as nucleated, non-chloroplast containing cells derived from or present in multicellular organisms whose taxanomic position lies within the kingdom animalia. The cells may be present in the intact animal, a primary cell culture, explant culture or a transformed cell line. The particular tissue source of the cells is not critical to the present invention.
- the recipient animal cells employed in the present invention are not critical thereto and include cells present in or derived from all organisms within the kingdom animalia, such as those of the families mammalia, pisces, avian, reptilia.
- Preferred animal cells are mammalian cells, such as humans, bovine, ovine, porcine, feline, canine, goat, equine, and primate cells.
- the most preferred mammalian cells are human cells.
- the cells can be in vivo, in vitro or ex vivo.
- the cell is a cervical epithelial cell, a rectal epithelial cell or a pharyngeal epithelial cell, macrophage, gastrointestinal epithelial cell, skin cell, melanocyte, keratinocyte, hair follicle, colon cancer cell, an ovarian cancer cell, a bladder cancer cell, a pharyngeal cancer cell, a rectal cancer cell, a prostate cancer cell, a breast cancer cell, a lung cancer cell, a renal cancer cell, a pancreatic cancer cell, or a hematologic cancer cell such as a lymphoma or leukemia cell.
- the colon cancer cell is an SW 480 cell.
- the pancreatic cancer cell is a CAPAN-I cell.
- the target cell is in a mucosal surface.
- enteric pathogens e.g., E. coli, Shigella, Listeria, and Salmonella
- enteric pathogens e.g., E. coli, Shigella, Listeria, and Salmonella
- enteric pathogens e.g., E. coli, Shigella, Listeria, and Salmonella
- RNA or RNA-encoding DNA may have a certain tropism, i.e., preferred target cells
- delivery of RNA or RNA-encoding DNA to a certain type of cell can be achieved by choosing a bacterium which has a tropism for the desired cell type or which is modified such as to be able to invade the desired cell type.
- a bacterium could be genetically engineered to mimic mucosal tissue tropism and invasive properties, as discussed above, to thereby allow said bacteria to invade mucosal tissue, and deliver RNA or RNA-encoding DNA to cells in those sites.
- Bacteria can also be targeted to other types of cells.
- bacteria can be targeted to erythrocytes of humans and primates by modifying bacteria to express on their surface either, or both of, the Plasmodium vivax reticulocyte binding proteins- 1 and -2, which bind specifically to erythrocytes in humans and primates (Galinski et al. Cell, 69:1213-1226 (1992)).
- bacteria are modified to have on their surface asialoorosomucoid, which is a ligand for the asilogycoprotein receptor on hepatocytes (Wu etal. J. Biol. Chem., 263:14621-14624 (1988)).
- bacteria are coated with insulin-poly-L-lysine, which has been shown to target plasmid uptake to cells with an insulin receptor (Rosenkranz et al. Expt. Cell Res., 199:323-329 (1992)). Also within the scope of the invention are bacteria modified to have on their surface p60 of Listeria monocytogenes, which allows for tropism for hepatocytes (Hess et al. Infect.
- a cell can be modified to become a target cell of a bacterium for delivery of RNA.
- a cell can be modified to express a surface antigen that is recognized by a bacterium for its entry into the cell, i.e., a receptor of an invasion factor.
- the cell can be modified either by introducing into the cell a nucleic acid encoding a receptor of an invasion factor, such that the surface antigen is expressed in the desired conditions.
- the cell can be coated with a receptor of an invasion factor.
- Receptors of invasion factors include proteins belonging to the integrin receptor superfamily.
- target cells include fish, avian, and reptilian cells.
- examples of bacteria that are naturally invasive for fish, avian, and reptilian cells are set forth below.
- bacteria that can naturally access the cytoplasm of fish cells include, but are not limited to, Aeromonas salminocida (ATCC No. 33658) and Aeromonas schuberii (ATCC No. 43700). Attenuated bacteria are preferably used in the invention, and include A. salmonicidia vapA (Gustafson et al. J. MoI. Biol., 237:452-463 (1994)) o ⁇ A. salmonicidia aromatic-dependent mutant (Vaughan et al. Infect. Immun., 61:2172-2181 (1993)).
- bacteria that can naturally access the cytoplasm of avian cells include, but are not restricted to, Salmonella galinarum (ATCC No. 9184), Salmonella enteriditis (ATCC No. 4931) and Salmonella typhimurium (ATCC No. 6994).
- Attenuated bacteria are preferred to the invention and include attenuated Salmonella strains such as S. galinarum cya crp mutant (Curtiss et al. (1987) supra) or S. enteritidis aroA aromatic-dependent mutant CVL30 (Cooper et al. Infect. Immun., 62:4739-4746 (1994)).
- bacteria that can naturally access the cytoplasm of reptilian cells include, but are not restricted to, Salmonella typhimurium (ATCC No. 6994). Attenuated bacteria are preferable to the invention and include, attenuated strains such as S. typhimuirum aromatic-dependent mutant (Hormaeche et al. supra).
- the invention also provides for delivery of RNA to other eukaryotic cells, e.g., plant cells, so long as there are microorganisms that are capable of invading such cells, either naturally or after having been modified to become invasive.
- microorganisms which can invade plant cells include Agrobacterium tumerfacium, which uses a pilus-like structure which binds to the plant cell via specific receptors, and then through a process that resembles bacterial conjugation, delivers at least some of its content to the plant cell.
- Agrobacterium tumerfacium which uses a pilus-like structure which binds to the plant cell via specific receptors, and then through a process that resembles bacterial conjugation, delivers at least some of its content to the plant cell.
- human cell lines include but are not limited to ATCC Nos. CCL 62, CCL 159, HTB 151, HTB 22, CCL 2, CRL 1634, CRL 8155, HTB 61, and HTB104.
- bovine cell lines include ATCC Nos. CRL 6021, CRL 1733, CRL 6033, CRL 6023, CCL 44 and CRL 1390.
- ovine cells lines examples include ATCC Nos. CRL 6540, CRL 6538, CRL 6548 and CRL 6546.
- porcine cell lines examples include ATCC Nos. CL 184, CRL 6492, and CRL 1746.
- feline cell lines examples include CRL 6077, CRL 6113, CRL 6140, CRL 6164, CCL 94, CCL 150, CRL 6075 and CRL 6123.
- buffalo cell lines examples include CCL 40 and CRL 6072.
- canine cells examples include ATCC Nos. CRL 6213, CCL 34, CRL 6202, CRL 6225, CRL 6215, CRL 6203 and CRL 6575.
- goat derived cell lines include ATCC No. CCL 73 and ATCC No. CRL 6270.
- horse derived cell lines include ATCC Nos. CCL 57 and CRL 6583.
- deer cell lines examples include ATCC Nos. CRL 6193-6196.
- primate derived cell lines include those from chimpanzee's such as ATCC Nos. CRL 6312, CRL 6304, and CRL 1868; monkey cell lines such as ATCC Nos. CRL 1576, CCL 26, and CCL 161; orangautan cell line ATCC No. CRL 1850; and gorilla cell line ATCC No. CRL 1854.
- the invention also provides methods of regulating the expression of one or more genes.
- regulating the expression of one or more genes means decreasing or lessening the expression of the gene and/or decreasing or lessening the activity of the gene and its corresponding gene product.
- the expressed siRNAs direct the multienzyme complex RISC (RNA- induced silencing complex) of the cell to interact with the mRNAs to be regulated. This complex degrades or sequesters the mRNA. This causes the expression of the gene to be decreased or inhibited.
- RISC RNA- induced silencing complex
- the gene is an animal gene.
- Preferred animal genes are mammalian genes, such as humans, bovine, ovine, porcine, feline, canine, goat, equine, and primate genes.
- the most preferred mammalian genes are human cells.
- the gene to be regulated can be a viral gene, anti-inflammatory gene, obesity gene or automimmune disease or disorder gene. In some embodiments, more than one gene can be regulated from a single plasmid or vector.
- the gene can be, but is not limited to, ras, ⁇ -catenin, one or more HPV oncogenes, APC, HER-2, MDR-I, MRP-2, FATP4, SGLUT-I, GLUT-2, GLUT-5, apobec-1, MTP, IL-6, IL-6R, IL-7, IL-12, IL-13, IL-13 Ra-I, IL-18, p38/JNK MAP kinase, p65/NF- ⁇ B, CCL20 (MIP-3 ⁇ ), Claudin-2, Chitinase 3-like 1, apoA-IV, MHC class I and MHC class II.
- the ras is k-Ras.
- the HPV oncogene is E6 or E7.
- Preferable ⁇ -catenin target gene sequences are recited in Table 11. The sequences in Table 11.
- ⁇ -catenin target gene sequences SEQ ID NO:
- HPV target gene sequences are recited in Table 12.
- the sequences in Table 12 are target sequences as they are capable of silencing the HPV E6 oncogene. Table 12
- Table 13 Additional preferable HPV target gene sequences are recited in Table 13.
- the sequences in Table 13 are target sequences as they are capable of silencing the HPV E7 oncogene. Table 13
- Table 14 Additional preferable HPV target gene sequences are recited in Table 14.
- the sequences in Table 14 are target sequences shared by both HPV E6 and E6.
- Table 14 GAGGTATTTGAATTTGCAT 154
- a preferable MDR-I target gene sequence is recited in Table 15.
- the sequence in Table 15 is capable of silencing the MDR-I gene in human.
- a preferable k-Ras target gene sequence is recited in Table 16.
- the sequence in Table 16 is capable of silencing the k-Ras gene in human.
- Table 16 Preferable IL-6R target gene sequence are recited in Table 17.
- the sequences in Table 17 are capable of silencing IL-6R in human.
- Table 18 are capable of silencing the IL-6R gene in mouse. Table 18
- IL-7 target gene sequences are recited in Table 19.
- the sequences in Table 19 are capable of silencing the IL-7 gene in human.
- Table 20 Additional preferable IL-7 target gene sequences are recited in Table 20.
- the sequences in Table 20 are capable of silencing the IL-7 gene in mouse. Table 20
- Table 21 Additional preferable IL-7 target gene sequences are recited in Table 21.
- the sequences in Table 21 are cross species sequences as they are capable of silencing the IL-7 gene in human and mouse. Table 21
- IL-13Ra-l target gene sequences are recited in Table 22.
- the sequences in Table 22 are capable of silencing the IL-13Ra-l gene in human.
- Table 23 Additional preferable IL-13Ra-l target gene sequences are recited in Table 23.
- the sequences in Table 23 are capable of silencing the IL-13Ra-l gene in mouse.
- a preferable IL- 18 target gene sequence is recited in Table 24.
- the sequence in Table 24 is capable of silencing the IL- 18 gene in human.
- Table 25 Additional preferable IL- 18 target gene sequences are recited in Table 25.
- the sequences in Table 25 are capable of silencing the IL- 18 gene in mouse.
- Table 25
- CCL20 target gene sequences are recited in Table 26.
- the sequences in Table 26 are capable of silencing the CCL20 gene in human.
- CCL20 target gene sequences are recited in Table 28.
- the sequences in Table 28 are cross-species target sequences as they are capable of silencing the CCL20 gene in human and mouse.
- CCL20 target gene sequences are recited in Table 29.
- the sequences in Table 29 are capable of silencing the CCL20 gene in human.
- Table 30 Additional preferable CCL20 target gene sequences are recited in Table 30.
- the sequences in Table 30 are capable of silencing the CCL20 gene in mouse. Table 30
- the present invention also provides methods of treating or preventing a disease or disorder in a mammal.
- the methods include regulating the expression of at least one gene in a cell known to cause a disease or disorder by introducing to the cells of the mammal at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs, where the expressed siRNAs interfere with the mRNA of the gene known to cause the disease or disorder of interest.
- BTP bacterial therapeutic particle
- RNAi methods of the invention including BMGS and tkRNAi are used to treat any disease or disorder for which gene expression regulation would be beneficial. This method is effected by silencing or knocking down (decreasing) genes involved with one or more diseases and disorders.
- the gene to be regulated to treat or prevent a disease or disorder of interest can be, but is not limited to, ras, ⁇ -catenin, one or more HPV oncogenes, APC, HER-2, MDR-I, MRP-2, FATP4, SGLUT-I, GLUT-2, GLUT-5, apobec-1, MTP, IL-6, IL-6R, IL-7, IL-12, IL-13, IL-13 Ra-I, IL-18, p38/JNK MAP kinase, p65/NF- ⁇ B, CCL20 (MIP-3 ⁇ ), Claudin-2, Chitinase 3-like 1, apoA-IV, MHC class I and MHC class II.
- the ras is k-Ras.
- the HPV oncogene is E6 or E7.
- the present invention provides methods of treating or preventing cancer or a cell proliferation disorder, viral disease, an inflammatory disease or disorder, a metabolic disease or disorder, an autoimmune disease or disorder, or a disease, disorder or cosmetic concern in the skin or hair in a mammal by regulating the expression of a gene or several genes known to be associated with the onset, propagation or prolongation of the disease or disorder by introducing a bacterium or BTP to the cell.
- the bacterium or BTP contain one or more siRNAs or one or more DNA molecules encoding one or more siRNAs, where the expressed siRNAs interfere with the mRNA of the gene known to cause, propagate or prolong the disease or disorder of interest.
- the viral disease can be, but is not limited to, hepatitis B, hepatitis C, Human Papilloma Virus (HPV) infection or epithelial dysplasia or cancer caused by HPV infection or HPV induced transformation, including cervical cancer, rectal cancer and pharyngeal cancer.
- the inflammatory disease or disorder can be, but is not limited to, inflammatory bowel disease, Crohn's disease, ulcerative colitis, an allergy, rheumatoid arthritis.
- the automimmune disease or disorder can be, but is not limited to, celiac disease.
- the disease, disorder or cosmetic concern can be, but is not limited to, psoriasis, eczema, albinism, balding or gray hair.
- the mammal can be any mammal including, but not limited to, human, bovine, ovine, porcine, feline, canine, goat, equine, or primate.
- the mammal is a human.
- treating and “treatment” as used herein refer to the administration of an agent or formulation (e.g. , bacterium and/or BTP containing an siRNA or a DNA encoding for an siRNA) to a clinically symptomatic individual afflicted with an adverse condition, disorder, or disease, so as to effect a reduction in severity and/or frequency of symptoms, eliminate the symptoms and/or their underlying cause, and/or facilitate improvement or remediation of damage.
- an agent or formulation e.g. , bacterium and/or BTP containing an siRNA or a DNA encoding for an siRNA
- preventing and prevention refer to the administration of an agent or composition to a clinically asymptomatic individual who is susceptible to a particular adverse condition, disorder, or disease, and thus relates to the prevention of the occurrence of symptoms and/or their underlying cause.
- compositions and Modes of Administration hi a preferred embodiment of the invention, the invasive bacteria or BTPs containing the
- RNA molecules, and/or DNA encoding such are introduced into an animal by intravenous, intramuscular, intradermal, intraperitoneally, peroral, intranasal, intraocular, intrarectal, intravaginal, intraosseous, oral, immersion and intraurethral inoculation routes.
- the amount of the invasive bacteria or BTPs of the present invention to be administered to a subject will vary depending on the species of the subject, as well as the disease or condition that is being treated. Generally, the dosage employed will be about 10 3 to 10 11 viable organisms, preferably about 10 5 to 10 9 viable organisms per subject.
- the invasive bacteria or BTPs of the present invention are generally administered along with a pharmaceutically acceptable carrier and/or diluent.
- a pharmaceutically acceptable carrier and/or diluent employed is not critical to the present invention.
- diluents include a phosphate buffered saline, buffer for buffering against gastric acid in the stomach, such as citrate buffer (pH 7.0) containing sucrose, bicarbonate buffer (pH 7.0) alone (Levine et al. J. Clin. Invest., 79:888-902 (1987); and Black et al J. Infect.
- bicarbonate buffer pH 7.0
- ascorbic acid lactose
- lactose lactose
- aspartame Levine et al. Lancet, 11:467-470 (1988)
- carriers include proteins, e.g., as found in skim milk, sugars, e.g., sucrose, or polyvinylpyrrolidone. Typically these carriers would be used at a concentration of about 0.1 -30% (w/v) but preferably at a range of 1-10% (w/v).
- compositions of the invention can be formulated for a variety of types of administration, including systemic and topical or localized administration. Lyophilized forms are also included, so long as the bacteria are invasive upon contact with a target cell or upon administration to the subject. Techniques and formulations generally may be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, Pa.
- compositions e.g., bacteria or BTPs
- injection is preferred, including intramuscular, intravenous, intraperitoneal, and subcutaneous.
- the composition, e.g., bacteria or BTPs, of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution.
- the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents ⁇ e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate).
- binding agents e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose
- fillers e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate
- lubricants e.g., magnesium stearate, talc or silica
- disintegrants e.g., potato star
- Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use.
- Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid).
- the preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.
- compositions for oral administration may be suitably formulated to give controlled release of the active compound.
- compositions for buccal administration may take the form of tablets or lozenges formulated in conventional manner.
- the pharmaceutical compositions for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the composition, e.g. , bacteria, and a suitable powder base such as lactose or starch.
- compositions may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
- the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
- compositions may also be formulated in rectal, intravaginal or intraurethral compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
- Systemic administration can also be by transmucosal or transdermal means.
- penetrants appropriate to the barrier to be permeated are used in the formulation.
- penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives.
- detergents may be used to facilitate permeation.
- Transmucosal administration may be through nasal sprays or using suppositories.
- the bacteria of the invention are formulated into ointments, salves, gels, or creams as generally known in the art, so long as the bacteria are still invasive upon contact with a target cell.
- compositions may, if desired, be presented in a pack or dispenser device and/or a kit that may contain one or more unit dosage forms containing the active ingredient.
- the pack may for example comprise metal or plastic foil, such as a blister pack.
- the pack or dispenser device may be accompanied by instructions for administration.
- the invasive bacteria or BTPs containing the RNA or RNA-encoding DNA to be introduced can be used to infect animal cells that are cultured in vitro, such as cells obtained from a subject. These in vj ⁇ r ⁇ -infected cells can then be introduced into animals, e.g., the subject from which the cells were obtained initially, intravenously, intramuscularly, intradermally, or intraperitoneally, or by any inoculation route that allows the cells to enter the host tissue.
- the dosage of viable organisms administered will be at a multiplicity of infection ranging from about 0.1 to 10 6 , preferably about 10 2 to 10 4 bacteria per cell.
- bacteria can also deliver RNA molecules encoding proteins to cells, e.g., animal cells, from which the proteins can later be harvested or purified. For example, a protein can be produced in a tissue culture cell.
- Example 1 Knockdown of ⁇ -catenin and k-Ras
- siRNA knockdown technology disclosed herein.
- in vitro and in vivo knockdown of beta catenin and k-ras utilizing bacterial delivery is described in PCT Publication No. WO 06/066048, which is incorporated herein by reference in its entirety.
- TRIP described herein can be modified to produce a plasmid which allows targeting of multiple genes simultaneously or multiple sequences within one gene simultaneously.
- TRIP with multiple hairpin expression cassettes to produce shRNA can target different sequences in a given gene, or target multiple genes through a simultaneous bacterial treatment.
- the TRIP plasmid can incorporate multiple (up to ten) cloning sites to express different shRNA constructs ( Figure 1).
- the purpose of such a plasmid will be to allow silencing of various genes through a single therapeutic bacterium which will be empowered by the Multiple-expression cassette-TRIP (mec-TRIP) to synthesize short hairpin RNA against a variety of targets simultaneously.
- These different hairpins can either be expressed competitively at high levels through the use of an identical high level promoter (such as T7 promoter or a different high level bacterial promoter), or they can be expressed at different levels through the use of promoters with different levels of activity, this will depend on the intended use of the plasmid and the desired relative silencing levels of the target gene.
- an identical high level promoter such as T7 promoter or a different high level bacterial promoter
- This mec-TRIP could be useful to treat complex diseases as described herein (e.g. inflammatory diseases, or cancer), through the simultaneous silencing(targeting) of multiple targets as described herein (e.g. multiple oncogenes, such as k-ras and beta-catenin in the case of colon cancer, or HER-2 and MDR-I in breast cancer, or other combinations).
- complex diseases as described herein e.g. inflammatory diseases, or cancer
- multiple targets as described herein e.g. multiple oncogenes, such as k-ras and beta-catenin in the case of colon cancer, or HER-2 and MDR-I in breast cancer, or other combinations.
- the TRIP system (bacteria and plasmid) have been modified to include the ORT (Operator Repressor Titration) system from Cobra Biomanufacturing (Keele, UK). This adaptation helps to maintain the plasmid in suitable strains in the absence of selective antibiotics.
- the bacterial carrier strain has been modified accordingly to allow for the ORT system to function (deletion of the DAP gene and replacement with an ORT-controlled DAP gene expression system).
- the plasmid has been modified to remove the antibiotic selection sequences to support the ORT system.
- Figure 2 shows development examples of bacterial strains. Further strains developed include, but are not limited to, CEQ922 (CEQ919 without aroA deletion), CEQ923 (CEQ920 without aroA deletion), CEQ924 (CEQ921 without aroA deletion).
- mice were treated orally with a single dose of 10 8 SL 7207 and sacrificed at various time points after administration. SL7207 were then stained using the Salmonella specific antibody. 2h after treatment, numerous SL7207 could be seen invading the intestinal epithelial layer (Salmonella stained red), suggesting that oral administration of SL7207 may be a useful tool to deliver payloads to the intestinal and colonic mucosa.
- mice were treated with SL7207 harboring a GFP expression plasmid (pEGFPCl, Invitrogen).
- FIG. 3 shows the efficient invasion and plasmid delivery into the intestinal mucosa by S. typhimurium.
- SL7207 were stained using red fluorescent antibody 6h after oral administration. Intact SL7207 and fragments of SL7207 were seen in epithelial cells as well as underlying cells of the lamina basement (top left/right).
- SL7207 successfully deliver expressed DNA into the intestinal mucosa: intestinal mucosal cells expressing GFP after treatment with SL7207 carrying a eukaryotic expression plasmid for GFP (pEGFP-Cl)(lower left).
- pEGFP-Cl eukaryotic expression plasmid for GFP
- SL7207 could be used for the delivery of RNAi to target genes in the intestinal tract.
- GFP transgenic mice (4 per group) were treated with S. typhimurium harboring a shRNA expression plasmid directed against GFP (SL-siGFP) or a shRNA expression plasmid directed against k-RAS (SL-siRAS). 10 8 c.f.u. was given three times weekly for two weeks by oral gavage. Colonic tissues were subsequently reviewed with fluorescent microscopy (data not shown) and stained analyzed after immunhistochemistry staining for GFP expression using a specific antibody (Living Colors®, Invitrogen).
- FIG. 4 shows that bacteria-mediated RNA interference reduces target gene expression in the gastrointestinal epithelium.
- CEQ503 consists of a combination of an attenuated E.coli strain (CEQ201) with a specially engineered TRIP plasmid (pNJSZ).
- the plasmid confers the abilities required to induce tkRNAi (in this case: invasiveness, escape from the entry vesicle, expression of short hairpin RNA).
- tkRNAi in this case: invasiveness, escape from the entry vesicle, expression of short hairpin RNA.
- Genotype Escherichia coli CEQ201 ⁇ glnV44(AS), LAM, rjbCl, endAl, spoTl, thi-1, hsdR17, fa m ⁇ ),creC510 ⁇ dapA, ArecA].
- Plasmid pKD46 cured by growing cells at 43 0 C
- Plasmid pCP20 cured and kan gene deleted from the chromosome by induction of FLP recombinase treatment at 43 0 C
- This plasmid contains two genes, hly and inv, and the H3 hairpin sequence: ggatccAGGAGTAACAATACAAATGGATTCAAGAGATCCATTTGTATTGTTACTCCTTTgt cgac (SEQ ID NO:380), which includes BamHI and Sail restriction sites.
- PCRs are performed to verify chromosomal deletion of dapA, and minipreps and/or PCR are performed to confirm inv, hly and 341-H3 on the plasmid.
- BTPs or minicells containing a suitable plasmid such as TRIP have been engineered for delivery of tkRNAi. These cells will express invasin or Opa to enable entry into mammalian cells and listeriolysin will allow lysis of phagosome following minicell degradation/ lysis. Additionally, a method for manufacturing minicells has been developed that utilizes a suicide construct for killing intact cells to aid in the purification of minicells. Such suicide plasmids have been described in the literature (Kloos et al., (1994) J. Bacterid. 176, 7352-61; Jain and Mekalanos, (2000) Infect. Immun. 68, 986-989).
- the lambda S and R genes that code for holing and lysozyme are placed under regulation of an inducible promoter on the bacterial chromosome. When induced, they will lyse intact cells but not minicells since minicells lack chromosomes.
- a number of different types of regulators such as lad, araC, lambda cI857 and rhaS-rhaR can be used for development of an inducible suicide gene construct..
- a number of different types of suicide genes including E. coli autolysis genes and antimicrobial small peptides, can be used in a similar scheme.
- Purification is enhanced by treatments or mutations that induce filamentation (see, for example, Ward and Lutkenhaus, (1985) Cell 42, 941-949; Bi and Lutkenhaus, 1992).
- Initial purification involves low speed centrifugation to separate intact cells and retain minicells in the supernatant. This can be followed by density gradient purification or filtration (for example, Shull et al., (1971) J. Bacteriol. 106, 626-633).
- Any cell death-triggering gene also known as a suicide gene, including but not limited to genes encoding antimicrobial proteins, bacteriophage lysins or autolysins can be used in this method for obtaining BTPs from a mixture containing BTPs and bacteria.
- Suicide genes can kill live bacteria by mechanisms that include but are not limited to cell lysis, or by the destruction, degradation or poisoning of cellular components such as chromosomal DNA or filament components. Any inducible promoter may be used in conjunction with this system.
- the suicide genes are integrated within the chromosome, thereby limiting their presence only in intact bacterial cells as BTPs or minicells will not incorporate these genes because they do not harbor chromosomal DNA.
- induction of suicide genes will lyse intact bacterial cells.
- the lambda S and R genes are put under the control of Pi acU v 5 (inducible promoter).
- the leaky basal activity is repressed by a "super-repressor” coded by lacP gene on a P gapA (strong promoter). This cassette is put at the minCD locus.
- Example 7 siRNA Inhibition of Human Papillomavirus (HPV) Ongogenes
- MEM Minimum Essential Medium
- FBS FBS supplemented with antibiotics: 100 U/ml penicillin G, 10 ⁇ g/ml streptomycin (Sigma).
- Bacterial Culture Plasmids were transformed into BL21(DE3) strain (Invitrogen). Bacteria were grown at 37°C in LB Broth containing 100 ⁇ g/ml ampicillin. Bacterial cell density (in CFU/ml) was calculated using OD 6 Oo measurement. For cell infection, overnight cultures were inoculated into fresh medium for another 2-3 h growth until the optical density at 600 ran [OD600] reached 0.6.
- Invasion Assay For bacterial invasion, HeIa cells were plated in 6-well dishes at 200,000 cells/well and allowed to incubate overnight in 2 ml complete growth medium. The bacterial cells were grown to mid-exponential phase with optical density at 600 ran [OD600] 0.6 in LB Broth with Ampicillin, and then centrifiiged at 3,400 rpm for 10 minutes at 4 0 C. Bacterial pellets were resuspended in MEM without serum or the antibiotics and the bacteria were added to the cells at an MOI of 1:1000, 1:500, 1:250, 1:125, or 1:62.5 and allowed to invade the HeIa cells for 2 hours at 37 0 C in 5% CO2.
- siRNA Transfection One day before the transfection, cells were plated in complete growth medium without antibiotics so that the cells will be 30-50% confluent at the time of transfection. Diluted various concentrations of siRNA from a stock of 20 ⁇ M in 175 ⁇ l of Opti-MEM.
- RT-PCR Quantitative real-time reverse transcription PCR (RT-PCR) was performed with the TaqMan RT-PCR master Mix Reagents Kit (Applied Biosystems) using the following primers and a probe set for detection of HPV18E6E7 transcripts:
- Probe 5'-TTGGAACTTACAGAGGTGCCTGCGCO' (219-233 and 416-425) (SEQ ID NO:383) The probe was labeled at the 5' end with a reporter fluorescent dye, FAM and at the 3' end with fluorescent dye quencher TAMRA. GAPDH was used to detect human GAPDH transcripts for the normalization.
- HPVsHRNA sequences 5'-TTGGAACTTACAGAGGTGCCTGCGCO' (219-233 and 416-425) (SEQ ID NO:383) The probe was labeled at the 5' end with a reporter fluorescent dye, FAM and at the 3' end with fluorescent dye quencher TAMRA. GAPDH was used to detect human GAPDH transcripts for the normalization.
- HPVsHRNA sequences 5'-TTGGAACTTACAGAGGTGCCTGCGCO' (219-233 and 416-425) (SEQ ID NO:383) The probe was labeled at the 5' end with a reporter fluorescent dye, FAM and at the 3'
- H2 (ineffective sequence) 5'-ggATCCTCAGAAAAACTTAGACACCTTCAAGAGAGGTGTCTAAGTTTTTCTGTTTgTCgAC (SEQ ID NO: 386) 5'- GTCGACAAACAGAAAAAACTTAGACACCTCTCTTGAAGGTGTCTAAGTTTTTCTGAGGATCC (SEQ ID NO: 387)
- Colony Formation Assay HeIa cells were harvested after bacterial invasion for 2h. The cells in either control treated or HPV shRNA treated cells were washed 3x times with complete MEM and one time with PBS. The cells were then trypsinized and counted. 500 cells from each treatment were added to a single well of a six well plate containing 2 ml of complete growth medium. The cells were allowed to grow for 10 days following which the colonies were fixed with GEIMSA stain.
- MTT Assay HeIa cells were harvested after bacterial invasion for 2h. The cells in either control treated or HPV shRNA treated cells were washed 3x times with complete MEM and one time with PBS. The cells were then trypsinized and counted. 5000 cells from each treatment were added to a single well of a 96 well plate in 100 ⁇ l of complete growth medium in triplicates. The cells were incubated at 37 0 C for 48-72h following which 10 ⁇ l of 0.5 mg/ml MTT was added to each well.
- the plate was further incubated at 37 0 C for 3h, the medium was aspirated off from the wells and after incubation, 100 ⁇ l of MTT solubilization solution [10% Triton X-100 in acidic isoproponal (0.1 N HCl)] was added to each well to stop the reaction. The absorbance was read at 570 nm on the plate reader. Results hi this example, the suppressive effect of a short hairpin RNA directed towards HPV 18 E6 and E7 oncogenes was investigated.
- the short hairpin RNA was delivered by infecting human cervical cancer cells (HeIa) with bacterial strains that produce the short hairpin RNA.
- the shRNA expression cassette contained 19 nucleotide (nt) of the target sequence followed by the loop sequence (TTCAAGAGA) (SEQ ID NO:388) and the reverse complement to the 19nt.
- nt nucleotide
- TTCAAGAGA loop sequence
- oligofectamine reagent in a 6 well format was used. Briefly, HeIa cells were plated at a cell density of about 40% confluence in antibiotic free medium. On the next day, siRNA was added to 6 well plates at varying concentrations of 50, 100, 200 nM. The control siRNA was added at a single concentration of 100 nM.
- the oligofectamine transfection method resulted in a decrease in E6 mRNA in HeIa cells with respect to the control siRNA.
- the siRNA (Hl) showed up to about 40% of reduction in E6 mRNA.
- the knockdown response was not dose dependent.
- HeIa human cervical cancer cells
- Figure 8 and Figure 9 demonstrate that siRNA downregulates HPV E6 expression in HeIa cells.
- Cells were plated in six well plates and allowed to grow to a confluence of 40% (about 40,000 cells).
- Oligofectamine/siRNA transfection complexes were prepared in Opti-MEM serum-free medium by mixing 4 ⁇ l of oligofectamine with siRNAs (final concentration in 185 ⁇ l of medium is 50, 100, 200 nM).
- 48 hours post-transfection cells were harvested and analyzed by real-time RT-PCR for both target and GAPDH mRNA levels. Data were normalized against the GAPDH signal.
- Two different negative control siRNAs were used at a single concentration of 200 nM.
- Panels A - C show real time PCR results following invasion assay of HeIa cells.
- HeIa cells were incubated for 2h with shRNA-expressing BL21(DE3) at different multiplicities of infection (MOI).
- MOI multiplicities of infection
- Figure 11 shows the effects of downregulation of HPV E6 and E7 genes on tumor suppressor pathways and other downstream targets.
- HeIa cells were incubated for 2h with shRNA-expressing BL21(DE3) at different multiplicities of infection (MOI).
- Figures 12 and 13 show a colony formation and MTT assay, respectively.
- HeIa cells were incubated for 2h with shRNA-expressing BL21(DE3) at different multiplicities of infection (MOI).
- 2h post-infection cells were washed trypsinized and counted and an equal number of cells for each MOI was added to a well of a six well plate (For CFA: added 500 cells to each well of a 6 well plate, for MTT added 5000 cells in each well of a 96 well plate).
- For colony formation the cells were allowed to grow for 10 days and stained with Geimsa, MTT assay was analyzed at 72h post plating.
- Figures 14 and 15 show real time PCR results following invasion assay of HeIa cells.
- HeIa cells were incubated for 2h with shRNA-expressing BL21(DE3) at different multiplicities of infection (MOI).
- MOI multiplicities of infection
- Forty-eight hours post-infection cells were harvested and analyzed by real-time RT-PCR for both target and GAPDH mRNA levels. Data were normalized against the GAPDH signal. These data were then further normalized to untreated control cells.
- Figure 16 shows the effects of downregulation of HPV E6 and E7 genes on tumor suppressor pathways and other downstream targets.
- HeIa cells were incubated for 2h with shRNA-expressing BL21 (DE3) at different multiplicities of infection (MOI).
- MOI multiplicities of infection
- Forty-eight hours post-infection cells were harvested and analyzed by western blotting. 50 ⁇ g of protein was loaded in each lane and resolved by gel electrophoresis, transferred to a membrane and probed with antibodies specific for HPV 18 E7, p53, actin, pi 10Rb as indicated.
- Figure 17 shows real time PCR results following invasion assay of HeIa cells with a frozen aliquot of negative sHRNA control and HPV sHRNA in BL21 (DE3). HeIa cells were incubated for 2h with shRNA-expressing BL21(DE3) at different multiplicities of infection (MOI). Forty-eight hours post-infection cells were harvested and analyzed by real-time RT-PCR for both target and GAPDH mRNA levels. Data were normalized against the GAPDH signal. These data were then further normalized to untreated control cells.
- Figure 18 shows the plating efficiency of frozen aliquots of negative sHRNA control and
- HPV sHRNA in BL21 (DE3) The frozen bacteria were thawed and resuspended to a final concentration of 3.38X10 8 cells/ml. Invasion assay was performed with this concentration taking 2 mis of 3.38X10 8 cells/ml as an MOI of 1000.
- Some stock control bacteria or HPV bacteria were serially diluted (1:100) and plated on LB plates to assess for the number and viability of bacteria treated cells at 48h. Gene silencing was analyzed either by quantitative real-time PCR using the ⁇ Ct relative quantitation method or by western blot analysis.
- HPVE6 mRNA levels were normalized to an endogenous control, GAPDH. The final data were further normalized to the RNA from the untreated cells.
- cell lysates were prepared in Cell Lysis Buffer (Cell Signaling Technology) and the protein concentration was determined using a BCA kit from BioRad.
- electrophoresis the protein expression was normalized to Actin loading control.
- Example 8 Knockdown of HPV £6 gene assessed by western blotting with HPV 18 £7 antibody:
- Figure 19 shows the knockdown of HPV E6 gene assessed by western blotting with HPV 18 E7 antibody.
- HeIa cells were incubated for 2h with shRNA-expressing BL21(DE3) at different multiplicities of infection (MOI). Forty-eight hours post-infection cells were harvested and analyzed by western blotting.
- the HPV E6 specific knockdown was compared with a negative sHRNA control. Briefly, 50 ⁇ g of protein was loaded in each lane and resolved by gel electrophoresis, transferred to a membrane and probed with antibodies specific for HPV 18 E7 and actin as indicated.
- Example 9 Inhibition of CCL20 Expression in CMT93 Cells
- T-175 flask of CMT93 cells was trypsinized in lOmls until the cells detached.
- Sequences were ordered from Qiagen as pre-annealed siRNA duplexes. Each well was resuspended in 250ul of siRNA buffer (from Qiagen) to give a stock concentration of 2OuM. The plate was then placed in a water bath at 95C for 5 minutes and then allowed to slowly cool to resuspend the duplexes and break apart aggregates. The suspended duplexes were then used in transfection experiments described in standard protocols. The formulation is per well of a 48 well plate containing 25OuL of media; each screen was performed in biological triplicate so the solution was made for 4 wells; 3 for transfection and 1 extra.
- 0.3uL of the appropriate siRNA (from a 2OuM stock solution) were diluted to 47uL with serum/antibiotic free media and mixed. To this solution was added 3uL of HiPerfect transfection reagent (Qiagen) followed by brief vortexing and incubation at room temperature for 20 minutes. 5OuLs of the complex containing mixture was added to each of 3 wells in a 48 well plate containing CMT93 cells. Transfection was for 24 hours at 37C at which time the media was removed and replaced with 40OuLs of DMEM/10% FCS containing lOOng/mL of LPS for 2 hours. Following stimulation, the cells were washed and RNA isolated for qRT-PCR according the Qiagen Quantitech method (see manufacturer's protocol) for 50 cycles.
- HiPerfect transfection reagent Qiagen
- FIG. 20 shows the knockdown of CCL20 expression with the various siRNA sequences in CMT93 cells.
- the siRNA sequences tested are listed below:
- siRNA antisense 5'->3' NO siRNA antisense 5'->3' NO :
- Example 10 Inhibition of Expression of Claudin-2 in CMT93 cells
- T- 175 flask of CMT93 cells was trypsinized in lOmls until the cells detached.
- Sequences were ordered from Qiagen as pre-annealed siRNA duplexes. Each well was resuspended in 250ul of siRNA buffer (from Qiagen) to give a stock concentration of 2OuM. The plate was then placed in a water bath at 95C for 5 minutes and then allowed to slowly cool to resuspend the duplexes and break apart aggregates. The suspended duplexes were then used in transfection experiments described in standard protocols. The formulation is per well of a 48 well plate containing 25OuL of media; each screen was performed in biological triplicate so the solution was made for 4 wells; 3 for transfection and 1 extra.
- 0.3uL of the appropriate siRNA from a 2OuM stock solution
- 47uL of serum/antibiotic free media was mixed.
- 3uL of HiPerfect transfection reagent Qiagen
- 5OuLs of the complex containing mixture was added to each of 3 wells in a 48 well plate containing CMT93 cells. Transfection was for 24 or 48 hours at 37C at which time the cells were washed and RNA isolated for qRT-PCR according the Qiagen Quantitech method (see manufacturer's protocol) for 50 cycles.
- FIG. 21 shows the knockdown of Claudin-2 expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
- the siRNA sequences tested are listed below:
- T-175 flask of CMT93 cells was trypsinized in lOmls until the cells detached. Trypsin was inactivated by addition of 30mls of DMEM (10% FCS, pen/strep) and the cells thoroughly mixed by pipetting. From this solution, 8mls was transferred into a sterile 50ml tube and 32mLs of DMEM 10% added. Cells were well mixed and 25OuLs added to each well of a 48 well plate and incubated overnight at 37C resulting in adherent cells that were approximately 70% confluent the following morning. The next day, siRNA transfection complexes were created by the following method:
- Sequences were ordered from Qiagen as pre-annealed siRNA duplexes. Each well was resuspended in 250ul of siRNA buffer (from Qiagen) to give a stock concentration of 2OuM. The plate was then placed in a water bath at 95C for 5 minutes and then allowed to slowly cool to resuspend the duplexes and break apart aggregates. The suspended duplexes were then used in transfection experiments described in standard protocols. The formulation is per well of a 48 well plate containing 25OuL of media; each screen was performed in biological triplicate so the solution was made for 4 wells; 3 for transfection and 1 extra.
- Figure 22 shows the knockdown of IL6-RA expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
- the siRNA sequences tested are listed below:
- T- 175 flask of CMT93 cells was trypsinized in lOmls until the cells detached. Trypsin was inactivated by addition of 30mls of DMEM (10% FCS, pen/strep) and the cells thoroughly mixed by pipetting. From this solution, 8mls was transferred into a sterile 50ml tube and 32mLs of DMEM 10% added. Cells were well mixed and 25OuLs added to each well of a 48 well plate and incubated overnight at 37C resulting in adherent cells that were approximately 70% confluent the following morning. The next day, siRNA transfection complexes were created by the following method:
- Sequences were ordered from Qiagen as pre-annealed siRNA duplexes. Each well was resuspended in 250ul of siRNA buffer (from Qiagen) to give a stock concentration of 2OuM. The plate was then placed in a water bath at 95C for 5 minutes and then allowed to slowly cool to resuspend the duplexes and break apart aggregates. The suspended duplexes were then used in transfection experiments described in standard protocols. The formulation is per well of a 48 well plate containing 25OuL of media; each screen was performed in biological triplicate so the solution was made for 4 wells; 3 for transfection and 1 extra.
- Figure 23 shows the knockdown of IL13-RA1 expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
- the siRNA sequences tested are listed below:
- siRNA antisense 5'- 3' NO:
- T-175 flask of CMT93 cells was trypsinized in lOmls until the cells detached. Trypsin was inactivated by addition of 3OmIs of DMEM (10% FCS, pen/strep) and the cells thoroughly mixed by pipetting. From this solution, 8mls was transferred into a sterile 50ml tube and 32mLs of DMEM 10% added. Cells were well mixed and 25OuLs added to each well of a 48 well plate and incubated overnight at 37C resulting in adherent cells that were approximately 70% confluent the following morning. The next day, siRNA transfection complexes were created by the following method:
- Sequences were ordered from Qiagen as pre-annealed siRNA duplexes. Each well was resuspended in 250ul of siRNA buffer (from Qiagen) to give a stock concentration of 2OuM. The plate was then placed in a water bath at 95C for 5 minutes and then allowed to slowly cool to resuspend the duplexes and break apart aggregates. The suspended duplexes were then used in transfection experiments described in standard protocols. The formulation is per well of a 48 well plate containing 25OuL of media; each screen was performed in biological triplicate so the solution was made for 4 wells; 3 for transfection and 1 extra.
- T-175 flask of CMT93 cells was trypsinized in lOmls until the cells detached. Trypsin was inactivated by addition of 30mls of DMEM (10% FCS, pen/strep) and the cells thoroughly mixed by pipetting. From this solution, 8mls was transferred into a sterile 50ml tube and 32mLs of DMEM 10% added. Cells were well mixed and 25OuLs added to each well of a 48 well plate and incubated overnight at 37C resulting in adherent cells that were approximately 70% confluent the following morning. The next day, siRNA transfection complexes were created by the following method:
- Sequences were ordered from Qiagen as pre-annealed siRNA duplexes. Each well was resuspended in 250ul of siRNA buffer (from Qiagen) to give a stock concentration of 2OuM. The plate was then placed in a water bath at 95C for 5 minutes and then allowed to slowly cool to resuspend the duplexes and break apart aggregates. The suspended duplexes were then used in transfection experiments described in standard protocols. The formulation is per well of a 48 well plate containing 25OuL of media; each screen was performed in biological triplicate so the solution was made for 4 wells; 3 for transfection and 1 extra.
- RNAiMAX transfection reagent (Invitrogen) followed by brief vortexing and incubation at room temperature for 20 minutes. 5OuLs of the complex containing mixture was added to each of 3 wells in a 48 well plate containing CMT93 cells. Transfection was for 24 hours at 37C at which time the cells were washed and RNA isolated for qRT-PCR according the Qiagen Quantitech method (see manufacturer's protocol) for 40 cycles.
- Figure 25 shows the knockdown of IL-7 expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
- the siRNA sequences tested are listed below: SEQID SEQ ID NO: 1
- RNAiMAX Lipofectamine RNAiMAX
- LPS lipopolysaccharide
- siRNA antisense 5'- 3' NO:
- G5 GGUUCACCAAGGAGGCAGGtt 525 CCUGCCUCCUUGGUGAACCgg 526 H5 GGAUCAAGUAGGCAAAUAUtt 527 AUAUUUGCCUACUUGAUCCaa 528
- G7 GGCCGGUUCACCAAGGAGGtt 531 CCUCCUUGGUGAACCGGCCtg 532
- CEQ200 has the following genotype: glnV44(AS), LAM ' , rfbCl, endAl, spoTl, thi-1, hsdR17, (r k " m k + ),creC510 ⁇ dapA.
- the MM294 has the following genotype: glnV44(AS), LAM " , rfbCl, endAl, spoTl, thi-1, hsdR17, (r k " m k + ),creC510.
- We purchased the plasmids from CGSC see Datsenko et al, (2000) Proc. Natl. Acad. Sci. USA 97,6640-6645).
- Plasmid pKD46 cured by growing cells at 43 0 C MM294 AdapAi.kan
- CEQ201 has the following genotype: CEQ200 ⁇ glnV44(AS), LAM, rfbCl, endAl, spoTl, thi- 1, hsdRl 7, (r k m k + ),creC510 ⁇ dapA ⁇ recA.
- the MM294 has the following genotype: glnV44(AS), LAM " , rfbCl, endAl, spoTl, thi-1, hsdR17, (r k " m k + ),creC510.
- We purchased the plasmids from CGSC see Datsenko et al., (2000) Proc. Natl. Acad. Sci. USA 97,6640-6645). Derivation of CEQ200
- Plasmid pKD46 cured by growing cells at 43 0 C MM294 AdapA::kanArecA::cat Transformed with plasmid pCP20
- Example 18 Construction of BTPs (CEQ210) by deletion of minC and/or minD genes from MM294
- MM294 (from CGSC) ⁇ Transformation with plasmid pKD46 th a AdapA::kan cassette generated using PCR
- the pMBV40, pMBV43 and pMBV44 plasmids may be used as final or intermediary plasmid in the tkRNA system and may be constructed as follows: pUC19 digested with restriction enzyme
- oligonucleotides have the following names and sequences:
- OHTOPl GACTTCATATACCCAAGCTTGGAAAATTTTTTTTAAAAAAGTCTTGACACTTTATGCTTCCGGCTCGTATAATGG ATCCAGGAGTAACAATACAAATGGA (SEQ ID NO: 553)
- OHTOP2 TTCAAGAGATCCATTTGTATTGTTACTCCTTTTTTTTTTTGTCGACGATCCTTAGCGAAAGCTAAGGATTTTTTT TTTACTCGAGCGGATTACTACATAC (SEQ ID NO: 554)
- OHBOTl GTATGTAGTAATCCGCTCGAGTAAAAAAAATCCTTAGCTTTCGCTAAGGATCGTCGACAAAAAAAAAAAA (SEQ ID NO:555)
- 0HB0T2 AGGAGTAACAATACAAATGGATCTCTTGAATCCATTTGTATTGTTACTCCTGGATCCATT (SEQ ID NO: 556)
- 0HB0T3 ATACGAGCCGGAAGCATAAAGTGTCAAGACTTTTTTAAAAAAAATTTTCCAAGCTTGGGTATATGAAGTC (SEQ ID NO : 557)
- Plasmid DNA from a transformant that had the expected DNA sequence of the insert and restriction map was named pMBV38.
- I pMBV38 was digested with Ndel and blunt end ligated with a ⁇ 6 kb fragment generated by BamHI-Sall digestion of the plasmid pKSII-inv-hly
- Plasmid DNA from a transformant that had insertion of inv and hly genes was named pMBV40.
- I pMBV40 was digested with Bsp ⁇ l and the resultant 7.4 kb
- DNA fragment was ligated with a PCR fragment containing kan gene generated using plasmid pKD4 (purchased from
- Ligation mix was transformed in E. coli and Kanamycin resistant transformants were selected. They were screened restriction mapping. They two different orientation of kan gene.
- the plasmids having clockwise and anticlockwise orientation of open reading frame of kan gene were called pMBV43 and pMBV44, respectively As shown in Figure 27, the pMBV40 (amp selected having H3 hairpin) or pMBV43 and pMBV44 (kan selected having H3 hairpin) plasmids, are followed by the respective sequences.
- pMBV40 amp selected having H3 hairpin
- pMBV43 and pMBV44 kan selected having H3 hairpin
- Plasmid pNJSZ is a 10.4 kb plasmid that confers the abilities required to induce tkRNAi. It contains two genes, inv and My, that allows bacteria to invade mammalian cells and to escape from the entry vacuole. Expression of the short hairpin RNA is different between the original Trip plasmid and pNJSZ. In pNJSZ, expression of shRNA is under the control of a constitutive bacterial promoter which allows for continuous expression. This is different from the original Trip plasmid, which has an ITPG inducible promoter, which controls the expression of the shRNA. Moreover, pNJSZ and the original Trip plasmid contain different antibiotic resistant genes.
- pNJSZ has the kanamycin resistance gene, whereas the original Trip plasmid has the ampicillin resistance gene.
- pNJSZc was constructed from pNJSZ by removing any regions of pNJSZ that were not required for its maintenance or abilities to induce tkRNAi. Step 1 as shown in Figure 28: Removed an extra BamHl site at 9778 by digesting pNJSZ with both Spel (9784) and Xmal (9772), T4 DNA polymerase filled-in these two sites and then allowed the plasmid to self ligate, creating pNJSZ ⁇ BamHl .
- Step 2 as shown in Figure 29: Removed both an extra Sail site at 972 and the fl origin of replication by digesting pNJSZ ⁇ BamHl with BgII (208) and Pmel (982), T4 DNA polymerase filled- in these two sites and allowed the plasmid to self ligate, creating pNJSZc.
- the pNJSZc DNA sequence is as follows:
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Oncology (AREA)
- Virology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Endocrinology (AREA)
- Pulmonology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Methods are described for the delivery of one or more small interfering RNAs (siRNAs) to a eukaryotic cell using a bacterium or BTP. Methods are also described for using this bacterium to regulate gene expression in eukaryotic cells using RNA interference, and methods for treating viral diseases and disorders. The bacterium or BTP includes one or more siRNAs or one or more DNA molecules encoding one or more siRNAs. Vectors are also described for use with the bacteria of the invention for causing RNA interference in eukaryotic cells.
Description
BACTERIA MEDIATED GENE SILENCING
RELATED APPLICATIONS
This application claims priority to, and the benefit of, U.S. Provisional Patent Application No. 60/934,751, filed June 15, 2007 and U.S. Provisional Patent Application No. 61/010,028, filed
January 4, 2008. The contents of these applications are incorporated by reference in their entireties.
BACKGROUND
Gene silencing through RNAi (RNA-interference) by use of short interfering RNA (siRNA) has emerged as a powerful tool for molecular biology and holds the potential to be used for therapeutic gene silencing. Short hairpin RNA (shRNA) transcribed from small DNA plasmids within the target cell has also been shown to mediate stable gene silencing and achieve gene knockdown at levels comparable to those obtained by transfection with chemically synthesized siRNA (T. R. Brummelkamp, R. Bernards, R. Agami, Science 296, 550 (2002), P. J. Paddison, A. A. Caudiy, G. J. Hannon, PNAS 99, 1443 (2002)).
Possible applications of RNAi for therapeutic purposes are extensive and include silencing and knockdown of disease genes such as oncogenes or viral genes. One major obstacle for the therapeutic use of RNAi is the delivery of siRNA to the target cell (Zamore PD, Aronin N. Nature Medicine 9,(3):266-8 (2003)). In fact, delivery has been described as the major hurdle now for RNAi (Phillip Sharp, cited by Nature news feature, VoI 425, 2003, 10-12).
Therefore, new methods are needed for the safe and predictable administration of interfering RNAs to mammals.
SUMMARY OF THE INVENTION The present invention provides at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), including one or more siRNAs or one or more DNA molecules encoding one or more siRNAs. The present invention also provides at least one prokaryotic vector including at least one DNA molecule encoding one or more siRNAs and at least one RNA-polymerase III compatible promoter or at least one prokaryotic promoter, wherein the expressed siRNAs interfere with at least one mRNA of a gene of interest.
The present invention also provides methods of using the various bacterium, BTP and vectors provided in the invention. For example, the present invention provides methods of delivering one or more siRNAs to mammalian cells. The methods include introducing at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs to the mammalian cells.
The present invention also provides methods of regulating gene expression in mammalian cells. The method includes introducing at least one invasive bacterium, or at least one bacterial
therapeutic particle (BTP), containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs to the mammalian cells, where the expressed siRNAs interfere with at least one mRNA of a gene of interest thereby regulating gene expression.
The present invention also provides methods of treating or preventing a viral disease or disorder in a mammal. The methods include regulating the expression of at least one gene in a cell known to cause a viral disease or disorder (e.g., known to increase proliferation, growth or dysplasia) by introducing to the cells of the mammal at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs, where the expressed siRNAs interfere with the mRNA of the gene known to cause a viral disease or disorder.
Preferably, the viral disease or disorder can be, but is not limited to, infection, eptithelial dysplasia and cancer caused by HPV infection
The present invention also provides a composition containing at least one invasive bacterium or BTP and a pharmacetucally acceptable carrier. The present invention also provides a eukaryotic host cell containing at least one invasive bacterium or BTP and a pharmacetucally acceptable carrier. The invasive bacterium or BTPs of the present invention can be non-pathogenic, non-virulent bacterium or therapeutic bacterium
The mammalian cells can be ex vivo, in vivo or in vitro. The mammalian cells can be, but are not limited to, human, bovine, ovine, porcine, feline, buffalo, canine, goat, equine, donkey, deer, avian, bird, chicken, and primate cells. Preferably, the mammalian cells are human cells, hi some preferred embodiments, the mammalian cells can be, but are not limited to, gastrointestinal epithelial cells, macrophages, cervical epithelial cells, rectal epithelial cells and a pharyngeal epithelial cells.
The mammalian cells can be infected with about 103 to 10n viable invasive bacterium or BTPs (or any integer within said ranges). Preferably, the mammalian cells can be infected with about 105 to 109 viable invasive bacterium or BTPs (or any integer within said ranges). The mammalian cells can be infected at a multiplicity of infection ranging from about 0.1 to 106 (or any integer within said ranges). Preferably, the mammalian cells can be infected at a multiplicity of infection ranging from about 102 to 104 (or any integer within said ranges).
The mammal can be, but is not limited to, human, bovine, ovine, porcine, feline, buffalo, canine, goat, equine, donkey, deer, avian, bird, chicken, and primate. Preferably, the mammal is a human.
The one or more DNA molecules encoding the one or more siRNAs can be transcribed within the animal cell or transcribed within the bacterium. Preferably, the one or more siRNAs are transcribed within the animal cell as shRNAs. The one or more DNA molecules encoding the one or more siRNAs can include one or more promoter sequences, enhancer sequences, terminator sequences, invasion factor sequences or lysis regulation sequences. The promoter can be a prokaryotic promoter. Preferably, the prokaryotic
promoter is a T7 promoter, a PgapA promoter, a ParaBAD promoter, a Ptac promoter, a Piacuvs promoter, or a recA promoter.
The expressed siRNAs can direct the multienzyme complex RNA-induced silencing complex of the cell to interact with the mRNA of one or more genes of interest. Preferably, the siRNAs interact with the mRNA of one or more HPV oncogenes. Preferably, the complex can degrade the mRNA. Preferably, the expression of one or more genes of interest is decreased or inhibited. The expression is decreased or inhibited as compared to the expression of the gene prior to administration or treatment with an invasive bacterium or BTP containing one or more siRNA or a DNA encoding for one or more siRNAs. Preferably, the expression of one or more HPV oncogenes is decreased or inhibited.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the specification, the singular forms also include the plural unless the context clearly dictates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference. In the case of conflict, the present specification, including definitions, will control, hi addition, the materials, methods, and examples are illustrative only and are not intended to be limiting. Other features and advantages of the invention will be apparent from the following detailed description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a schematic showing the Transkingdom RNA Interference Plasmid (TRIP) with multiple hairpin express cassettes.
Figure 2 is a schematic showing the TRIP system (bacteria and plasmid) modified with the Operator Repressor Titration (ORT) system.
Figure 3 is a photograph showing cellular staining of the intestinal epithelial layer demonstrating efficient invasion and plasmid delivery by S. typhimurium. Figure 4 is a photograph showing that bacteria-mediated RNA interference reduces target gene expression in the gastrointestinal epithelium.
Figure 5 is a schematic showing pNJSZ plasmid construct.
Figure 6 is a schematic showing the use of lamba S and R genes to kill intact bacteria. Figure 7 is a bar graph showing a reduction in HPV oncogene expression with bacterial delivered siRNA.
Figure 8 is a bar graph showing a reduction in HPV oncogene expression with bacterial delivered siRNA.
Figure 9 is a bar graph showing a reduction in HPV oncogene expression with bacterial delivered siRNA.
Figure 10, Panels A-C, are a series of bar graphs showing real time PCR results following invasion of HeIa cells with various siRNAs. Figure 11 is a photograph of an immunoblot showing the effects of downregulation of HPV
E6 and E7 genes on tumor suppressor pathways and other downstream targets.
Figure 12 is a photograph of a colony forming assay showing infection at different multiplicities of infection (MOI).
Figure 13 is a line graph of a MTT assay showing infection at different multiplicities of infection (MOI).
Figure 14 is a bar graph showing real time PCR results following invasion of HeIa cells with various siRNAs
Figure 15, Panels A-C, are a series of bar graphs showing real time PCR results following invasion of HeIa cells with various siRNAs. Figure 16 is a photograph of an immunoblot showing the effects of downregulation of HPV
E6 and E7 genes on tumor suppressor pathways and other downstream targets.
Figure 17 is a bar graph showing real time PCR results following invasion assay of HeIa cells with a frozen aliquot of negative sHRNA control and HPV sHRNA in BL21.
Figure 18 is a photograph showing the plating efficiency of frozen aliquots of negative sHRNA control and HPV sHRNA in BL21.
Figure 19 is a photograph of an immunoblot showing the knockdown of HPV E6 gene assessed by western blotting with HPV 18 E7 antibody.
Figure 20 is a bar graph showing the knockdown of CCL20 expression with the various siRNA sequences in CMT93 cells. Figure 21 is a bar graph showing the knockdown of Claudin-2 expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
Figure 22 is a bar graph showing the knockdown of IL6-RA expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
Figure 23 is a bar graph showing the knockdown of IL 13 -RAl expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
Figure 24 is a bar graph showing the knockdown of ILl 8 expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
Figure 25 is a bar graph showing the knockdown of IL-7 expression with the various siRNA sequences in CMT93 cells post 24hr transfection. Figure 26 is a bar graph showing the knockdown of CH13L1 expression with the various siRNA sequences in CMT93 cells post 24hr transfection.
Figure 27 is a schematic of the pMBV40 or pMBV43 or pMBV44 plasmids.
Figure 28 is a schematic of the pNJSZ ΔBamHl plasmid.
Figure 29 is a schematic of the pNJSZ pNJSZc plasmid.
Figure 30 is a schematic showing a lysis regulation system in combination with strain-specific nutritional attenuation. Figure 31 is a schematic showing three cassettes in the combination lysis regulation system/nutritional attenuation system.
Figure 32 is a schematic showing a lysis regulation systemin combination with a Tet-on expression system.
DETAILED DESCRIPTION OF THE INVENTION
The invention pertains to compositions and methods of delivering small interfering RNAs (siRNAs) to eukaryotic cells using non-pathogenic or therapeutic strains of bacteria or bacterial therapeutic particles (BTPs). The bacteria or BTPs deliver DNA encoding siRNA, or siRNA itself, to effect RNA interference (RNAi) ) by invading into the eukaryotic host cells. Generally, to trigger RNA interference in a target cell, it is required to introduce siRNA into the cell. The siRNA is either introduced into the target cell directly or by transfection or can be transcribed within the target cell as hairpin-structured dsRNA (shRNA) from specific plasmids with RNA-polymerase III compatible promoters (e.g., U6, Hl) (P. J. Paddison, A. A. Caudiy, G. J. Hannon, PNAS 99, 1443 (2002), T. R. Brummelkamp, R. Bernards, R. Agami, Science 296, 550 (2002)). The interfering RNA of the invention regulates gene expression in eukaryotic cells. It silences or knocks down genes of interest inside target cells (e.g., decreases gene activity). The interfering RNA directs the cell-owned multienzyme-complex RISC (RNA-induced silencing complex) to the mRNA of the gene to be silenced. Interaction of RISC and mRNA results in degradation or sequestration of the mRNA. This leads to effective post-transcriptional silencing of the gene of interest. This method is referred to as Bacteria Mediated Gene Silencing (BMGS). In the case of BMGS through delivery of siRNA expressing DNA plasmids, shRNA or siRNA are produced within the target cell after liberation of the eukaryotic transcription plasmid and trigger the highly specific process of mRNA degradation, which results in silencing of the targeted gene. Additionally, one or more cell-specific eukaryotic promoters may be used that limit the expression of siRNA or shRNA to specific target cells or tissues that are in particular metabolic states. In one embodiment of this method, the cell-specific promoter is albumin and the target cell or tissue is the liver. In another embodiment of this method, the cell-specific promoter is keratin and the specific target cell or tissue is the skin.
The non-virulent bacteria and BTPs of the invention have invasive properties (or are modified to have invasive properties) and may enter a mammalian host cell through various mechanisms. In contrast to uptake of bacteria or BTPs by professional phagocytes, which normally results in the destruction of the bacterium or BTP within a specialized lysosome, invasive bacteria or BTP strains
have the ability to invade non-phagocytic host cells. Naturally occurring examples of such bacteria or BTPs are intracellular pathogens such as Yersinia, Rickettsia, Legionella, Brucella, Mycobacterium, Helicobacter, Coxiella, Chlamydia, Neisseria, Burkolderia, Bordetella, Borrelia, Listeria, Shigella, Salmonella, Staphylococcus, Streptococcus, Porphyromonas, Treponema, and Vibrio, but this property can also be transferred to other bacteria or BTPs such as E. coli, Lactobacillus or
Bifldobacteriae, including probiotics through transfer of invasion-related genes (P. Courvalin, S. Goussard, C. Grillot-Courvalin, C.R.Acad.Sci.Paris 318,1207 (1995)). In other embodiments of the invention, bacteria or BTPs used to deliver interfering RNAs to host cells include Shigella flexneri (D. R. Sizemore, A. A. Branstrom, J. C. Sadoff, Science 270, 299 (1995)), invasive E. coli (P. Courvalin, S. Goussard, C. Grillot-Courvalin, C.R.Acad.Sci.Paris 318,1207 (1995), C. Grillot-Courvalin, S. Goussard, F. Huetz, D. M. Ojcius, P. Courvalin, Nat Biotechnol 16, 862 (1998)), Yersinia enterocolitica (A. Al-Mariri A, A. Tibor, P. Lestrate, P. Mertens, X. De Bolle, J. J. Letesson Infect Immun 70, 1915 (2002)) and Listeria monocytogenes (M. Hense, E. Domann, S. Krusch, P. Wachholz, K. E. Dittmar, M. Rohde, J. Wehland, T. Chakraborty, S. Weiss, Cell Microbiol 3, 599 (2001), S. Pilgrim, J. Stritzker, C. Schoen, A. Kolb-Maurer, G. Geginat, M. J. Loessner, I. Gentschev, W. Goebel, Gene Therapy 10, 2036 (2003)). Any invasive bacterium or BTP is useful for DNA transfer into eukaryotic cells (S. Weiss, T. Chakraborty, Curr Opinion Biotechnol 12, 467 (2001)).
BMGS is performed using the naturally invasive pathogen Salmonella typhimurium. In one aspect of this embodiment, the strains of Salmonella typhimurium include SL 7207 and VNP20009 (S. K. Hoiseth, B. A. D. Stacker, Nature 291, 238 (1981); Pawelek JM, Low KB, Bermudes D. Cancer Res. 57(20): 4537-44 (Oct. 15 1997)). In another embodiment of the invention, BMGS is performed using attenuated E. coli. In another aspect of this embodiment, the CEQ201 strain is engineered to possess cell-invading properties through an invasion plasmid. In one aspect of the invention, this plasmid is a TRIP (Transkingdom RNA interference plasmid) plasmid or pNJSZ. A double "trojan horse" technique is also used with an invasive and auxotrophic bacterium or
BTP carrying a eukaryotic transcription plasmid. This plasmid is, in turn, transcribed by the target cell to form one or more hairpin RNA structures that triggers the intracellular process of RNAi. This method of the invention induces significant gene silencing of a variety of genes. In certain aspects of this embodiment, the genes include a transgene (GFP), a mutated oncogene (k-Ras) and a cancer related gene (β-catenin) in vitro.
Another aspect of BMGS according to this invention is termed Transkingdom RNAi (tkRNAi). hi this aspect of the invention, siRNA is directly produced by the invasive bacteria, or accumulated in the BTPs after production in the bacteria, as opposed to the target cell. A transcription plasmid controlled by a prokaryotic promoter (e.g., T7) is inserted into the carrier bacteria through standard transformation protocols. siRNA is produced within the bacteria and is liberated within the mammalian target cell after bacterial lysis triggered either by auxotrophy or by timed addition of antibiotics.
The RNAi methods of the invention, including BMGS and tkRNAi are used to create transient "knockdown" genetic animal models as opposed to genetically engineered knockout models to discover gene functions. The methods are also used as in vitro transfection tool for research and drug development These methods use bacteria with desirable properties (invasiveness, attenuation, steerability) to perform BMGS and tkRNAi. Invasiveness as well as eukaryotic or prokaryotic transcription of one or several shRNA is conferred to a bacterium or BTP using plasmids (e.g., TRIP) and vectors as described in greater detail herein.
1. Bacterium and/or Bacterial Therapeutic Particles (BTPs)
The present invention provides at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), including one or more siRNAs or one or more DNA molecules encoding one or more siRNAs.
According to the invention, any microorganism that is capable of delivering a molecule, e.g., an RNA molecule or an RNA-encoding DNA molecule, into the cytoplasm of a target cell, such as by traversing the membrane and entering the cytoplasm of a cell, can be used to deliver RNA to such cells. In a preferred embodiment, the microorganism is a prokaryote. In an even more preferred embodiment, the prokaryote is a bacterium or BTP. Also within the scope of the invention are microorganisms other than bacteria that can be used for delivering RNA to a cell. For example, the microorganism can be a fungus, e.g., Cryptococcus neoformans, protozoan, e.g., Trypanosoma cruzi, Toxoplasma gondii, Leishmania donovani, and plasmodia.
In a preferred embodiment, the microorganism is a bacterium or BTP. A preferred invasive bacterium or BTP is capable of delivering at least one molecule, e.g., an RNA or RNA-encoding DNA molecule, to a target cells, such as by entering the cytoplasm of a eukaryotic cell. Preferably, the RNA is siRNA or shRNA and the RNA-encoding DNA molecule encodes for siRNA or shRNA.
BTPs are fragments of bacteria used for therapeutic or preventive purposes. BTPs may include particles known in the art as minicells. Minicells are small cells produced by cell division that is faulty near the pole. They are devoid of nucleoid and, therefore, unable to grow and form colonies (Alder et al., (1967) Proc. Nat. Acad. Sci. U.S.A. 57, 321-326; for reviews see Sullivan and Maddock, (2000) Curr. Biol. 10:R249-R252; Margolin, (2001) Curr. Biol. 11, R395-R398; Howard and Kruse, (2005) J. Cell Biol. 168, 533-536). Minicell formation results due to mutations causing a defect in selection of the site for the septum formation for cell division. Such mutations include null alleles of minC, minD (Davie et al, (1984) J. Bacterid. 158, 1202-1203; de Boer et al., 1988) J. Bacteriol. 170, 2106-2112) and certain alleles of ftsZ (Bi and Lutkenhaus, (1992) J. Bacteriol. 174, 5414-5423). Overexpression fo FtsZ or MinC-MinD proteins has also been reported to cause the formation of minicells (Ward and Lutkenhaus, 1985; de Boer et al., 1988). Although minicells are devoid of
nucleoid, they are capable of transcription and translation (Roozen et al., (1971) J. Bacteriol. 107, 21- 33; Shepherd et al., (2001) J. Bacteriol. 183, 2527-34).
BTPs are distinct from bacteria in that they lack the bacterial genome and, therefore, provide a decreased risk of bacterial proliferation in patients. This is of particular value for immune- compromised patients. Furthermore, the inability of BTPs to proliferate allows for their use in sensitive tissues, e.g., the brain, and other areas of the body traditionally considered inaccessible to traditional siRNA. For example, the intraperitoneal delivery of bacteria can include the risk of adhesions and peritonitis, which is eliminated by utilizing BTPs. However, like the bacteria of this invention, BTPs contain the bacterial cell wall, some bacterial plasma contents and subcellular particles, one or more therapeutic components, e.g., one or more siRNAs, one or more invasion factors, one or more phagosome degradation factors, and one or more factors for targeting specific tissues. The BTPs are produced from bacteria that have produced and accumulated siRNAs inside the bacteria, and then segregate the bacterial fragment (BTP) during cell division. In one embodiment of this invention, BTPs are obtained by fermenting the bacteria, during which the BTPs form abundantly, followed by isolation of the BTPs from live bacteria using differential size filtration, which will retain the bacteria but allow passage and collection of BTPs. In another embodiment of this invention, BTPs are separated from bacteria by centrifugation. In another embodiment of this invention, live bacterial cells are lysed through activation of a death signal. Once isolated, the BTPs can be lyophilized and formulated for use. As used herein, the term "invasive" when referring to a microorganism, e.g. , a bacterium or
BTP, refers to a microorganism that is capable of delivering at least one molecule, e.g., an RNA or RNA-encoding DNA molecule, to a target cell. An invasive microorganism can be a microorganism that is capable of traversing a cell membrane, thereby entering the cytoplasm of said cell, and delivering at least some of its content, e.g., RNA or RNA-encoding DNA, into the target cell. The process of delivery of the at least one molecule into the target cell preferably does not significantly modify the invasion apparatus.
Invasive microorganisms include microorganisms that are naturally capable of delivering at least one molecule to a target cell, such as by traversing the cell membrane, e.g., a eukaryotic cell membrane, and entering the cytoplasm, as well as microorganisms which are not naturally invasive and which have been modified, e.g., genetically modified, to be invasive. In another preferred embodiment, a microorganism that is not naturally invasive can be modified to become invasive by linking the bacterium or BTP to an "invasion factor", also termed "entry factor" or "cytoplasm- targeting factor". As used herein, an "invasion factor" is a factor, e.g., a protein or a group of proteins which, when expressed by a non-invasive bacterium or BTP, render the bacterium or BTP invasive. As used herein, an "invasion factor" is encoded by a "cytoplasm-targeting gene".
In one embodiment of this invention, the microorganism is a naturally invasive bacterium or BTP selected from the group that includes, but is not limited to, Yersinia, Rickettsia, Legionella,
Brucella, Mycobacterium, Helicobacter, Coxiella, Chlamydia, Neisseria, Burkolderia, Bordetella, Borrelia, Listeria, Shigella, Salmonella, Staphylococcus, Streptococcus, Porphyromonas, Treponema, Vibrio, E. coli, and Bifidobacteriae. Optionally, the naturally invasive bacterium or BTP is Yersinia expressing an invasion factor selected from the group including, but not limited to, invasin and YadA {Yersinia enterocolitica plasmid adhesion factor). Optionally, the naturally invasive bacterium or
BTP is Rickettsia expressing the invasion factor RickA (actin polymerization protein). Optionally, the naturally invasive bacterium or BTP is Legionella expressing the invasion factor RaIF (guanine exchange factor). Optionally, the naturally invasive bacterium or BTP is Neisseria expressing an invasion factor selected from the group including, but not limited to, NadA {Neisseria adhesion/invasion factor), OpA and OpC (opacity-associated adhesions). Optionally, the naturally invasive bacterium or BTP is Listeria expressing an invasion factor selected from the group including, but not limited to, InIA (intemalin factor), InIB (intemalin factor), Hpt (hexose phosphate transporter), and ActA (actin polymerization protein). Optionally, the naturally invasive bacterium or BTP is Shigella expressing an invasion factor selected from the group including, but not limited to, the Shigella secreting factors IpaA (invasion plasmid antigen), IpaB, IpaC, IpgD, IpaB-IpaC complex, VirA, and IcsA. Optionally, the naturally invasive bacterium or BTP is Salmonella expressing an invasion factor selected from the group including, but not limited to, Salmonella secreting/exchange factors SipA, SipC, SpiC, SigD, SopB, SopE, SopE2, and SptP. Optionally, the naturally invasive bacterium or BTP is Staphylococcus expressing an invasion factor selected from the group including, but not limited to, the fϊbronectin binding proteins FnBPA and FnBPB. Optionally, the naturally invasive bacterium or BTP is Streptococcus expressing an invasion factor selected from the group including, but not limited to, the fϊbronectin binding proteins ACP, Fba, F2, Sfbl , Sfb2, SOF, and PFBP. Optionally, the naturally invasive bacterium or BTP is Porphyromonas gingivalis expressing the invasion factor FimB (integrin binding protein fϊbriae). In another embodiment of this invention, the microorganism is a bacterium or BTP that is not naturally invasive but has been modified, e.g, genetically modified, to be invasive. Optionally, the bacterium or BTP that is not naturally invasive has been genetically modified to be invasive by expressing an invasion factor selected from the group including, but not limited to, invasin, YadA, RickA, RaIF, NadA, OpA, OpC, InIA, InIB, Hpt, ActA, IpaA, IpaB, IpaC, IpgD, IpaB-IpaC complex, VirA, IcsA, SipA, SipC, SpiC, SigD, SopB, SopE, SopE2, SptP, FnBPA, FnBPB, ACP, Fba, F2, Sfbl, Sfb2, SOF, PFBP, and FimB.
In another embodiment of this invention, the microorganism is a bacterium or BTP that may be naturally invasive but has been modified, e.g., genetically modified, to express one or more additional invasion factors. Optionally, the invasion factor is selected from the group that includes, but is not limited to, invasin, YadA, RickA, RaIF, NadA, OpA, OpC, InIA, InIB, Hpt, ActA, IpaA, IpaB, IpaC, IpgD, IpaB-IpaC complex, VirA, IcsA, SipA, SipC, SpiC, SigD, SopB, SopE, SopE2, SptP, FnBPA, FnBPB, ACP, Fba, F2, Sfbl, Sfb2, SOF, PFBP, and FimB.
Naturally invasive microorganisms, e.g., bacteria or BTPs, may have a certain tropism, i.e., preferred target cells. Alternatively, microorganisms, e.g., bacteria or BTPs can be modified, e.g., genetically, to mimic the tropism of a second microorganism. Optionally, the bacterium or BTP is Streptococcus and the preferred target cells are selected from the group including, but not limited to, pharyngeal epithelial cells, buccal epithelial cells of the tongue, and mucosal epithelial cells.
Optionally, the bacterium or BTP is Porphyromonas and the preferred target cells are selected from the group including, but not limited to, oral epithelial cells. Optionally, the bacterium or BTP is Staphylococcus and the preferred target cells are mucosal epithelial cells. Optionally, the bacterium or BTP is Neisseria and the preferred target cells are selected from the group including, but not limited to, urethral epithelial cells and cervical epithelial cells. Optionally, the bacterium or BTP is E. coli and the preferred target cells are selected from the group, including but not limited to, intestinal epithelial cells, urethral epithelial cells, and the cells of the upper urinary tract. Optionally, the bacterium or BTP is Bordetella and the preferred target cells are respiratory epithelial cells. Optionally, the bacterium or BTP is Vibrio and the preferred target cells are intestinal epithelial cells. Optionally, the bacterium or BTP is Treponema and the preferred target cells are mucosal epithelial cells. Optionally, the bacterium or BTP is Mycoplasma and the preferred target cells are respiratory epithelial cells. Optionally, the bacterium or BTP is Helicobacter and the preferred target cells are the endothelial cells of the stomach. Optionally, the bacterium or BTP is Chlamydia and the preferred target cells are selected from the group including, but not limited to, conjunctival cells and urethral epithelial cells.
In another embodiment of this invention, the microorganism is a bacterium or BTP that has been modified, e.g., genetically modified, to have a certain tropism. Optionally, the preferred target cells are selected from the group including, but not limited to, pharyngeal epithelial cells, buccal epithelial cells of the tongue, mucosal epithelial cells, oral epithelial cells, epithelial cells of the urethra, cervical epithelial cells, intestinal epithelial cells, respiratory epithelial cells, cells of the upper urinary tract, epithelial cells of the stomach, and conjunctival cells. Optionally, the preferred target cells are dysplastic or cancerous epithelial cells. Optionally, the preferred target cells are activated or resting immune cells.
Delivery of at least one molecule into a target cell can be determined according to methods known in the art. For example, the presence of the molecule, by the decrease in expression of an RNA or protein silenced thereby, can be detected by hybridization or PCR methods, or by immunological methods that may include the use of an antibody.
Determining whether a microorganism is sufficiently invasive for use in the invention may include determining whether sufficient siRNA was delivered to host cells, relative to the number of microorganisms contacted with the host cells. If the amount of siRNA is low relative to the number of microorganisms used, it may be desirable to further modify the microorganism to increase its invasive potential.
Bacterial or BTP entry into cells can be measured by various methods. Intracellular bacteria or BTPs survive treatment by aminoglycoside antibiotics, whereas extracellular bacteria are rapidly killed. A quantitative estimate of bacterial or BTP uptake can be achieved by treating cell monolayers with the antibiotic gentamicin to inactivate extracellular bacteria or BTPs, then by removing said antibiotic before liberating the surviving intracellular organisms with gentle detergent and determining viable counts on standard bacteriological medium. Furthermore, bacterial or BTP entry into cells can be directly observed, e.g., by thin-section-transmission electron microscopy of cell layers or by immunofluorescent techniques (Falkow et al. (1992) Annual Rev. Cell Biol. 8:333). Thus, various techniques can be used to determine whether a specific bacterium or BTP is capable of invading a specific type of cell or to confirm bacterial invasion following modification of the bacteria or BTP, such modification of the tropism of the bacteria to mimic that of a second bacterium. Bacteria or BTPs that can be used for delivering RNA according to the method of the invention are preferably non-pathogenic. However, pathogenic bacteria or BTP s can also be used, so long as their pathogenicity has been attenuated, to thereby render the bacteria non-harmful to a subject to which it is administered. As used herein, the term "attenuated bacterium or BTP " refers to a bacterium or BTP that has been modified to significantly reduce or eliminate its harmfulness to a subject. A pathogenic bacterium or BTP can be attenuated by various methods, set forth below. Without wanting to be limited to a specific mechanism of action, the bacterium or BTP delivering the RNA into the eukaryotic cell can enter various compartments of the cell, depending on the type of bacterium or BTP. For example, the bacterium or BTP can be in a vesicle, e.g., a phagocytic vesicle. Once inside the cell, the bacterium or BTP can be destroyed or lysed and its contents delivered to the eukaryotic cell. A bacterium or BTP can also be engineered to express a phagosome degrading protein to allow leakage of RNA from the phagosome, hi one embodiment of this invention, the bacterium or BTP expresses, either naturally or through modification, e.g., genetic modification, a protein that contributes to pore-formation, breakage or degradation of the phagosome. Optionally, the protein is a cholesterol-dependent cytolysin. Optionally, the protein is selected from the group consisting of listeriolysin, ivanolysin, streptolysin, sphingomyelinase, perfringolysin, botulinolysin, leukocidin, anthrax toxin, phospholipase, IpaB (invasion plasmid antigen), IpaH, IcsB (intercellular spread), DOT/Icm (defect in organelle trafficking/intracellular multiplication defective), DOTU (stabilization factor for the DOT/Icm complex), IcmF, and PmrA (multidrug resistance efflux pump). hi some embodiments, the bacterium can stay alive for various times in the eukaryotic cell and may continue to produce RNA. The RNA or RNA-encoding DNA can then be released from the bacterium into the cell by, e.g., leakage, hi certain embodiments of the invention, the bacterium can also replicate in the eukaryotic cell, hi a preferred embodiment, bacterial replication does not kill the host cell. The invention is not limited to delivery of RNA or RNA-encoding DNA by a specific
mechanism and is intended to encompass methods and compositions permitting delivery of RNA or RNA-encoding DNA by a bacterium independently of the mechanism of delivery.
In one embodiment, the bacterium or BTP for use in the present invention is non-pathogenic or non- virulent. In another aspect of this embodiment, the bacterium or BTP is therapeutic. In another aspect of this embodiment, the bacterium or BTP is an attenuated strain or derivative thereof selected from, but not limited to, Yersinia, Rickettsia, Legionella, Brucella, Mycobacterium, Helicobacter, Haemophilus, Coxiella, Chlamydia, Neisseria, Burkolderia, Bordetella, Borrelia, Listeria, Shigella, Salmonella, Staphylococcus, Streptococcus, Porphyromonas, Treponema, Vibrio, E. coli, and Bifidobacteriae. Optionally, the Yersinia strain is an attenuated strain of the Yersinia pseudotuberculosis species. Optionally, the Yersinia strain is an attenuated strain of the Yersinia enterocolitica species. Optionally, the Rickettsia strain is an attenuated strain of the Rickettsia coronii species. Optionally, the Legionella strain is an attenuated strain of the Legionella pneumophilia species. Optionally, the Mycobacterium strain is an attenuated strain of the Mycobacterium tuberculosis species. Optionally, the Mycobacterium strain is an attenuated strain of the Mycobacterium bovis BCG species. Optionally, the Helicobacter strain is an attenuated strain of the Helicobacter pylori species. Optionally, the Coxiella strain is an attenuated strain of Coxiella burnetti. Optionally, the Haemophilus strain is an attenuated strain of the Haemophilus influenza species. Optionally, the Chlamydia strain is an attenuated strain of the Chlamydia trachomatis species. Optionally, the Chlamydia strain is an attenuated strain of the Chlamydia pneumoniae species. Optionally, the Neisseria strain is an attenuated strain of the Neisseria gonorrheae species. Optionally, the Neisseria strain is an attenuated strain of the Neisseria meningitides species. Optionally, the Burkolderia strain is an attenuated strain of the Burkolderia cepacia species. Optionally, the Bordetella strain is an attenuated strain of the Bordetella pertussis species. Optionally, the Borrelia strain is an attenuated strain of the Borrelia hermisii species. Optionally, the Listeria strain is an attenuated strain of the Listeria monocytogenes species. Optionally, the Listeria strain is an attenuated strain of the Listeria ivanovii species. Optionally, the Salmonella strain is an attenuated strain of the Salmonella enterica species. Optionally, the Salmonella strain is an attenuated strain of the Salmonella typhimurium species. Optionally, the Salmonella typhimurium strain is SL 7207 or VNP20009. Optionally, the Staphylococcus strain is an attenuated strain of the Staphylococcus aureus species. Optionally, the Streptococcus strain is an attenuated strain of the Streptococcus pyogenes species. Optionally, the Streptococcus strain is an attenuated strain of the Streptococcus mutans species. Optionally, the Streptococcus strain is an attenuated strain of the Streptococcus salivarius species. Optionally, the Streptococcus strain is an attenuated strain of the Streptococcus pneumonia species. Optionally, the Porphyromonas strain is an attenuated strain of the Porphyromonas gingivalis species. Optionally, the Pseudomonas strain is an attenuated strain of the Pseudomonas aeruginosa species. Optionally, the Treponema strain is an attenuated strain of the
Treponema pallidum species. Optionally, the Vibrio strain is an attenuated strain of the Vibrio cholerae species. Optionally, the E. coli strain is MM294.
Set forth below are examples of bacteria that have been described in the literature as being naturally invasive (section 1.1), as well as bacteria which have been described in the literature as being naturally non-invasive bacteria (section 1.2), as well as bacteria which are naturally nonpathogenic or which are attenuated. Although some bacteria have been described as being noninvasive (section 1.2), these may still be sufficiently invasive for use according to the invention. Whether traditionally described as naturally invasive or non-invasive, any bacterial strain can be modified to modulate, in particular to increase, its invasive characteristics {e.g., as described in section 1.3).
/ .1 Naturally Invasive Bacteria
The particular naturally invasive bacteria employed in the present invention are not critical thereto. Examples of such naturally occurring invasive bacteria include, but are not limited to, Shigella spp., Salmonella spp., Listeria spp., Rickettsia spp., and enteroinvasive Escherichia coli.
The particular Shigella strain employed is not critical to the present invention. Examples of Shigella strains that can be employed in the present invention include Shigella flexneri 2a (ATCC No. 29903), Shigella sonnei (ATCC No. 29930), and Shigella disenteriae (ATCC No. 13313). An attenuated Shigella strain, such as Shigella flexneri 2a 2457T aroA virG mutant CVD 1203 (Noriega et al. supra), Shigella flexneri M90T icsA mutant (Goldberg et al. Infect. Immun., 62:5664-5668 (1994)), Shigella flexneri Y SFLl 14 aroD mutant (Karnell et al. Vacc, 10:167-174 (1992)), and Shigella flexneri aroA aroD mutant (Verma et al. Vacc, 9:6-9 (1991)) are preferably employed in the present invention. Alternatively, new attenuated Shigella spp. strains can be constructed by introducing an attenuating mutation either singularly or in conjunction with one or more additional attenuating mutations.
At least one advantage to Shigella bacteria as delivery vectors is their tropism for lymphoid tissue in the colonic mucosal surface. In addition, the primary site of Shigella replication is believed to be within dendritic cells and macrophages, which are commonly found at the basal lateral surface of M cells in mucosal lymphoid tissues (reviewed by McGhee, J. R. et al. (1994) Reproduction, Fertility, & Development 6:369; Pascual, D. W. et al. (1994) Immunomethods 5 :56). As such,
Shigella vectors may provide a means to target RNA interference or deliver therapeutic molecules to these professional antigen-presenting cells. Another advantage of Shigella vectors is that attenuated Shigella strains deliver nucleic acid reporter genes in vitro and in vivo (Sizemore, D. R. et al. (1995) Science 270:299; Courvalin, P. et al. (1995) Comptes Rendus de 1 Academie des Sciences Serie III- Sciences de Ia Vie-Life Sciences 318:1207; Powell, R. J. et al. (1996) In: Molecular approaches to the control of infectious diseases. F. Brown, E. Norrby, D. Burton and J. Mekalanos, eds. Cold Spring Harbor Laboratory Press, New York. 183; Anderson, R. J. et al. (1997) Abstracts for the 97th General
Meeting of the American Society for Microbiology :E.). On the practical side, the tightly restricted host specificity of Shigella stands to prevent the spread of Shigella vectors into the food chain via intermediate hosts. Furthermore, attenuated strains that are highly attenuated in rodents, primates and volunteers have been developed (Anderson et al. (1997) supra; Li, A. et al. (1992) Vaccine 10:395; Li, A. et al. (1993) Vaccine 11:180; Karnell, A. et al. (1995) Vaccine 13:88; Sansonetti, P. J. and J. Arondel (1989) Vaccine 7:443; Fontaine, A. et al. (1990) Research in Microbiology 141:907; Sansonetti, P. J. et al. (1991) Vaccine 9:416; Noriega, F. R. et al. (1994) Infection & Immunity 62:5168; Noriega, F. R. et al. (1996) Infection & Immunity 64:3055; Noriega, F. R. et al. (1996) Infection & Immunity 64:23; Noriega, F. R. etal. (1996) Infection & Immunity 64:3055; Kotloff, K. L. et al. (1996) Infection & Immunity 64:4542). This latter knowledge will allow the development of well-tolerated Shigella vectors for use in humans.
Attenuating mutations can be introduced into bacterial pathogens using non-specific mutagenesis either chemically, using agents such as N-methyl-N'-nitro-N-nitrosoguanidine, or using recombinant DNA techniques; classic genetic techniques, such as TnIO mutagenesis, P22 -mediated transduction, λ phage mediated crossover, and conjugational transfer; or site-directed mutagenesis using recombinant DNA techniques. Recombinant DNA techniques are preferable since strains constructed by recombinant DNA techniques are far more defined. Examples of such attenuating mutations include, but are not limited to:
(i) auxotrophic mutations, such as aro (Hoiseth et al. Nature, 291 :238-239 (1981)), gua (McFarland et al. Microbiol. Path., 3:129-141 (1987)), nad (Park et al. J. Bact., 170:3725-3730
(1988), thy (Nnalue et al. Infect. Immun., 55:955-962 (1987)), and asd (Curtiss, supra) mutations; (ii) mutations that inactivate global regulatory functions, such as cya (Curtiss et al. Infect. Immun., 55:3035-3043 (1987)), crp (Curtiss et al (1987), supra), phoP/phoQ (Groisman etal. Proc. Natl. Acad. Sci., USA, 86:7077-7081 (1989); and Miller et al. Proc. Natl. Acad. Sci., USA, 86:5054- 5058 (1989)), phopc (Miller et al. J. Bact., 172:2485-2490 (1990)) or ompR (Dorman et al. Infect. Immun., 57:2136-2140 (1989)) mutations;
(iii) mutations that modify the stress response, such as recA (Buchmeier et al. MoI. Micro., 7:933-936 (1993)), htrA (Johnson et al. MoI. Micro., 5:401-407 (1991)), htpR (Neidhardt et al. Biochem. Biophys. Res. Com., 100:894-900 (1981)), hsp (Neidhardt et al. Ann. Rev. Genet., 18:295- 329 (1984)) and groEL (Buchmeier et al. Sci., 248:730-732 (1990)) mutations;
(iv) mutations in specific virulence factors, such as IsyA (Libby et al. Proc. Natl. Acad. Sci., USA, 91 :489-493 (1994)), pag or prg (Miller et al (1990), supra; and Miller et al (1989), supra), iscA or virG (d'Hauteville et al. MoI. Micro., 6:833-841 (1992)), plcA (Mengaud et al. MoI. Microbiol., 5:367-72 (1991); Camilli et al. J. Exp. Med, 173:751-754 (1991)), and act (Brundage et al. Proc. Natl. Acad. Sci., USA, 90:11890-11894 (1993)) mutations;
(v) mutations that affect DNA topology, such as topA (Galan et al. Infect. Immun., 58:1879- 1885 (1990));
(vi) mutations that disrupt or modify the cell cycle, such as min (de Boer et al. Cell, 56:641- 649 (1989)).
(vii) introduction of a gene encoding a suicide system, such as sacB (Recorbet et al. App. Environ. Micro., 59:1361-1366 (1993); Quandt et al. Gene, 127:15-21 (1993)), nuc (Ahrenholtz et al. App. Environ. Micro., 60:3746-3751 (1994)), hok, gef, kil, or phlA (Molin et al. Ann. Rev. Microbiol., 47:139-166 (1993));
(viii) mutations that alter the biogenesis of lipopolysaccharide and/or lipid A, such as rFb (Raetz in Esherishia coli and Salmonella typhimurium, Neidhardt et al., Ed., ASM Press, Washington D.C. pp 1035-1063 (1996)), galE (Hone et al. J. Infect. Dis., 156:164-167 (1987)) and htrB (Raetz, supra), msbB (Reatz, supra)
(ix) introduction of a bacteriophage lysis system, such as lysogens encoded by P22 (Rennell et al. Virol, 143:280-289 (1985)), λ murein transglycosylase (Bienkowska-Szewczyk et al. MoI. Gen. Genet, 184:111-114 (1981)) or S-gene (Reader et al. Virol, 43:623-628 (1971)); and
The attenuating mutations can be either constitutively expressed or under the control of inducible promoters, such as the temperature sensitive heat shock family of promoters (Neidhardt et al. supra), or the anaerobically induced nirB promoter (Harborne et al. MoI. Micro., 6:2805-2813 (1992)) or repressible promoters, such as uapA (Gorfϊnkiel et al. J. Biol. Chem., 268:23376-23381 (1993)) or gcv (Stauffer et al. J. Bact., 176:6159-6164 (1994)).
The particular Listeria strain employed is not critical to the present invention. Examples of Listeria strains that can be employed in the present invention include Listeria monocytogenes (ATCC No. 15313). Attenuated Listeria strains, such as L. monocytogenes actA mutant (Brundage et al. supra) oτL. monocytogenes plcA (Camilli et al. J. Exp. Med., 173:751-754 (1991)) are preferably used in the present invention. Alternatively, new attenuated Listeria strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Salmonella strain employed is not critical to the present invention. Examples of Salmonella strains that can be employed in the present invention include Salmonella typhi (ATCC No. 7251) and S. typhimurium (ATCC No. 13311). Attenuated Salmonella strains are preferably used in the present invention and include S. typhi-aioC-aroD (Hone et al. Vacc. 9:810 (1991) and S. typhimurium-aroA mutant (Mastroeni et al. Micro. Pathol. 13:477 (1992)). Alternatively, new attenuated Salmonella strains can be constructed by introducing one or more attenuating mutations as described for Shigella spp. above.
The particular Rickettsia strain employed is not critical to the present invention. Examples of Rickettsia strains which can be employed in the present invention include Rickettsia Rickettsiae (ATCC Nos. VR149 and VR891), Ricketsia prowaseckii (ATCC No. VR233), Rickettsia tsutsugamuchi (ATCC Nos. VR312, VR150 and VR609), Rickettsia mooseri (ATCC No. VR144), Rickettsia sibirica (ATCC No. VRl 51), and Rochalimaea quitana (ATCC No. VR358). Attenuated
Rickettsia strains are preferably used in the present invention and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular enteroinvasive Escherichia strain employed is not critical to the present invention. Examples of enteroinvasive Escherichia strains which can be employed in the present invention include Escherichia coli strains 4608-58, 1184-68, 53638-C-17, 13-80, and 6-81 (Sansonetti et al. Ann. Microbiol. (Inst. Pasteur), 132A:351-355 (1982)). Attenuated enteroinvasive Escherichia strains are preferably used in the present invention and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
Furthermore, since certain microorganisms other than bacteria can also interact with integrin molecules (which are receptors for certain invasion factors) for cellular uptake, such microorganisms can also be used for introducing RNA into target cells. For example, viruses, e.g., foot-and-mouth disease virus, echovirus, and adenovirus, and eukaryotic pathogens, e.g., Histoplasma capsulatum and Leishmania major interact with integrin molecules.
1.2 Less Invasive Bacteria
Examples of bacteria which can be used in the invention and which have been described in the literature as being non-invasive or at least less invasive than the bacteria listed in the previous section (1.1) include, but are not limited to, Yersinia spp., Escherichia spp., Klebsiella spp., Bordetella spp., Neisseria spp., Aeromonas spp., Franciesella spp., Corynebacterium spp., Citrobacter spp., Chlamydia spp., Hemophilus spp., Brucella spp., Mycobacterium spp., Legionella spp., Rhodococcus spp., Pseudomonas spp., Helicobacter spp., Vibrio spp., Bacillus spp., and Erysipelothrix spp. It may be necessary to modify these bacteria to increase their invasive potential. The particular Yersinia strain employed is not critical to the present invention. Examples of Yersinia strains that can be employed in the present invention include Y. enterocolitica (ATCC No. 9610) or Y. pestis (ATCC No. 19428). Attenuated Yersinia strains, such as Y. enterocolitica Ye03-R2 (al-Hendy et al. Infect. Immun., 60:870-875 (1992)) or Y. enterocolitica aroA (O'Gaora et al. Micro. Path., 9:105-116 (1990)) are preferably used in the present invention. Alternatively, new attenuated Yersinia strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above. The particular Escherichia strain employed is not critical to the present invention. Examples of Escherichia strains that can be employed in the present invention include E. coli Nissle 1917, MM294, H10407 (Elinghorst et al. Infect. Immun., 60:2409-2417 (1992)), and E. coli EFC4, CFT325 and CPZ005 (Donnenberg et al. J. Infect. Dis., 169:831-838 (1994)). Attenuated Escherichia strains, such as the attenuated turkey pathogen E. coli 02 carAB mutant (Kwaga et al. Infect. Immun., 62:3766-3772 (1994)) or CEQ201 are preferably used in the present invention. Alternatively, new attenuated Escherichia strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Klebsiella strain employed is not critical to the present invention. Examples of Klebsiella strains that can be employed in the present invention include K. pneumoniae (ATCC No. 13884). Attenuated Klebsiella strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Bordetella strain employed is not critical to the present invention. Examples of Bordetella strains that can be employed in the present invention include B. bronchiseptica (ATCC No. 19395). Attenuated Bordetella strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Neisseria strain employed is not critical to the present invention. Examples of Neisseria strains that can be employed in the present invention include N. meningitidis (ATCC No. 13077) and N. gonorrhoeae (ATCC No. 19424). Attenuated Neisseria strains, such as N. gonorrhoeae MSIl aro mutant (Chamberlain et al. Micro. Path., 15:51-63 (1993)) are preferably used in the present invention. Alternatively, new attenuated Neisseria strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Aeromonas strain employed is not critical to the present invention. Examples of Aeromonas strains that can be employed in the present invention include A. eucrenophila (ATCC No. 23309). Alternatively, new attenuated Aeromonas strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Frandesella strain employed is not critical to the present invention. Examples of Franciesella strains that can be employed in the present invention include F. tularensis (ATCC No. 15482). Attenuated Franciesella strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Corynebacterium strain employed is not critical to the present invention. Examples of Corynebacterium strains that can be employed in the present invention include C. pseudotuberculosis (ATCC No. 19410). Attenuated Corynebacterium strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Citrobacter strain employed is not critical to the present invention. Examples of Citrobacter strains that can be employed in the present invention include C.freundii (ATCC No. 8090). Attenuated Citrobacter strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Chlamydia strain employed is not critical to the present invention. Examples of Chlamydia strains that can be employed in the present invention include C. pneumoniae (ATCC No.
VRl 310). Attenuated Chlamydia strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Hemophilus strain employed is not critical to the present invention. Examples of Hemophilus strains that can be employed in the present invention include H. sornnus (ATCC No. 43625). Attenuated Hemophilus strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Brucella strain employed is not critical to the present invention. Examples of Brucella strains that can be employed in the present invention include B. abortus (ATCC No. 23448). Attenuated Brucella strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Mycobacterium strain employed is not critical to the present invention. Examples of Mycobacterium strains that can be employed in the present invention include M. intracellular (ATCC No. 13950) and M. tuberculosis (ATCC No. 27294). Attenuated Mycobacterium strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above. The particular Legionella strain employed is not critical to the present invention. Examples of
Legionella strains that can be employed in the present invention include L. pneumophila (ATCC No. 33156). Attenuated Legionella strains, such as a L. pneumophila mip mutant (Ott, FEMS Micro. Rev., 14:161-176 (1994)) are preferably used in the present invention. Alternatively, new attenuated Legionella strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Rhodococcus strain employed is not critical to the present invention. Examples of Rhodococcus strains that can be employed in the present invention include R. equi (ATCC No. 6939). Attenuated Rhodococcus strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Pseudomonas strain employed is not critical to the present invention. Examples of Pseudomonas strains that can be employed in the present invention include P. aeruginosa (ATCC No. 23267). Attenuated Pseudomonas strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Helicobacter strain employed is not critical to the present invention. Examples of Helicobacter strains that can be employed in the present invention include H. mustelae (ATCC No.
43772). Attenuated Helicobacter strains are preferably used in the present invention, and can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Salmonella strain employed is not critical to the present invention. Examples of Salmonella strains that can be employed in the present invention include Salmonella typhi (ATCC No. 7251) and S. typhimurium (ATCC No. 13311). Attenuated Salmonella strains are preferably used in the present invention and include S. typhi aroC aroD (Hone et al. Vacc, 9:810-816 (1991)) and S. typhimurium aroA mutant (Mastroeni etal. Micro. Pathol, 13:477-491 (1992))). Alternatively, new attenuated Salmonella strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Vibrio strain employed is not critical to the present invention. Examples of Vibrio strains that can be employed in the present invention include Vibrio cholerae (ATCC No. 14035) and Vibrio cincinnatiensis (ATCC No. 35912). Attenuated Vibrio strains are preferably used in the present invention and include V. cholerae RSI virulence mutant (Taylor et al. J. Infect. Dis., 170:1518-1523 (1994)) and V. cholerae ctxA, ace, zot, cep mutant (Waldor etal. J. Infect. Dis.,
170:278-283 (1994)). Alternatively, new attenuated Vibrio strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
The particular Bacillus strain employed is not critical to the present invention. Examples of Bacillus strains that can be employed in the present invention include Bacillus subtilis (ATCC No. 6051). Attenuated Bacillus strains are preferably used in the present invention and include B. anthracis mutant pXOl (Welkos et al. Micro. Pathol, 14:381-388 (1993)) and attenuated BCG strains (Stover et al. Nat., 351 :456-460 (1991)). Alternatively, new attenuated Bacillus strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above. The particular Erysipelothrix strain employed is not critical to the present invention.
Examples of Erysipelothrix strains that can be employed in the present invention include Erysipelothrix rhusiopathiae (ATCC No. 19414) and Erysipelothrix tonsillαrum (ATCC No. 43339). Attenuated Erysipelothrix strains are preferably used in the present invention and include E. rhusiopathiae Kg-Ia and Kg-2 (Watarai et al. J. Vet. Med. Sci., 55:595-600 (1993)) and E. rhusiopathiae ORVAC mutant (Markowska-Daniel et al. hit. J. Med. Microb. Virol. Parisit. Infect. Dis., 277:547-553 (1992)). Alternatively, new attenuated Erysipelothrix strains can be constructed by introducing one or more attenuating mutations in groups (i) to (vii) as described for Shigella spp. above.
1.3. Methods for Increasing the Invasive Properties of a Bacterial Strain
Whether organisms have been traditionally described as invasive or non-invasive, these organisms can be engineered to increase their invasive properties, e.g., by mimicking the invasive
properties of Shigella spp., Listeria spp., Rickettsia spp., or enteroinvasive E. coli spp. For example, one or more genes that enable the microorganism to access the cytoplasm of a cell, e.g., a cell in the natural host of said non-invasive bacteria, can be introduced into the microorganism.
Examples of such genes referred to herein as "cytoplasm-targeting genes" include genes encoding the proteins that enable invasion by Shigella or the analogous invasion genes of enteroinvasive Escherichia, or listeriolysin O of Listeria, as such techniques are known to result in rendering a wide array of invasive bacteria capable of invading and entering the cytoplasm of animal cells (Formal etal. Infect. Immun., 46:465 (1984); Bielecke etal. Nature, 345:175-176 (1990); Small et al. In: Microbiology- 1986, pages 121-124, Levine et al. Eds., American Society for Microbiology, Washington, D.C. (1986); Zychlinsky et al. Molec. Micro., 11 :619-627 (1994); Gentschev et al. (1995) Infection & Immunity 63:4202; Isberg, R. R. and S. Falkow (1985) Nature 317:262; and Isberg, R. R. et al. (1987) Cell 50:769). Methods for transferring the above cytoplasm-targeting genes into a bacterial strain are well known in the art. Another preferred gene that can be introduced into bacteria to increase their invasive character encodes the invasin protein from Yersinia pseudotuberculosis, (Leong et al. EMBO J., 9:1979 (1990)). Invasin can also be introduced in combination with listeriolysin, thereby further increasing the invasive character of the bacteria relative to the introduction of either of these genes. The above genes have been described for illustrative purposes; however, it will be obvious to those skilled in the art that any gene or combination of genes, from one or more sources, that participates in the delivery of a molecule, in particular an RNA or RNA-encoding DNA moleecule, from a microorganism into the cytoplasm of a cell, e.g. , an animal cell, will suffice. Thus, such genes are not limited to bacterial genes, and include viral genes, such as influenza virus hemagglutinin HA-2 that promotes endosmolysis (Plank et al. J. Biol. Chem., 269:12918-12924 (1994)).
The above cytoplasm-targeting genes can be obtained by, e.g., PCR amplification from DNA isolated from an invasive bacterium carrying the desired cytoplasm-targeting gene. Primers for PCR can be designed from the nucleotide sequences available in the art, e.g., in the above-listed references and/or in GenBank, which is publicly available on the internet (www.ncbi.nlm.nih.gov/). The PCR primers can be designed to amplify a cytoplasm-targeting gene, a cytoplasm-targeting operon, a cluster of cytoplasm-targeting genes, or a regulon of cytoplasm-targeting genes. The PCR strategy employed will depend on the genetic organization of the cytoplasm-targeting gene or genes in the target invasive bacteria. The PCR primers are designed to contain a sequence that is homologous to DNA sequences at the beginning and end of the target DNA sequence. The cytoplasm-targeting genes can then be introduced into the target bacterial strain, e.g., by using Hfr transfer or plasmid mobilization (Miller, A Short Course in Bacterial Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1992); Bothwell et al. supra; and Ausubel et al. supra), bacteriophage- mediated transduction (de Boer, supra; Miller, supra; and Ausubel et al. supra), chemical transformation (Bothwell et al. supra; Ausubel et al. supra), electroporation (Bothwel et al. supra;
Ausubel et al. supra; and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) and physical transformation techniques (Johnston et al. supra; and Bothwell, supra). The cytoplasm-targeting genes can be incorporated into lysogenic bacteriophage (de Boer et al. Cell, 56:641-649 (1989)), plasmids vectors (Curtiss et al. supra) or spliced into the chromosome (Hone et al. supra) of the target strain.
In addition to genetically engineering bacteria and BTPs to increase their invasive properties, as set forth above, bacteria and can also be modified by linking an invasion factor to the bacteria. Accordingly, in one embodiment, a bacterium is rendered more invasive by coating the bacterium, either covalently or non-covalently, with an invasion factor, e.g., the protein invasin, invasin derivatives, or a fragment thereof sufficient for invasiveness. In fact, it has been shown that noninvasive bacterial cells coated with purified invasin from Yersinia pseudotuberculosis or the carboxyl- terminal 192 amino acids of invasin are able to enter mammalian cells (Leong et al. (1990) EMBO J. 9:1979). Furthermore, latex beads coated with the carboxyl terminal region of invasin are efficiently internalized by mammalian cells, as are strains of Staphylococcus aureus coated with antibody- immobilized invasin (reviewed in Isberg and Tran van Nhieu (1994) Ann. Rev. Genet. 27:395).
Alternatively, a bacterium can also be coated with an antibody, variant thereof, or fragment thereof, which binds specifically to a surface molecule recognized by a bacterial entry factor. For example, it has been shown that bacteria are internalized if they are coated with a monoclonal antibody directed against an integrin molecule, e.g., α5Bl, known to be the surface molecule with which the bacterial invasin protein interacts (Isberg and Tran van Nhieu, supra). Such antibodies can be prepared according to methods known in the art. The antibodies can be tested for efficacy in mediating bacterial invasiveness by, e.g., coating bacteria with the antibody, contacting the bacteria with eukaryotic cells having a surface receptor recognized by the antibody, and monitoring the presence of intracellular bacteria, according to the methods described above. Methods for linking an invasion factor to the surface of a bacterium are known in the art and include cross-linking.
3; Plasmids and Vectors
The present invention also provides at least one vector or plasmid including at least one DNA molecule encoding one or more siRNAs and at least one promoter, wherein the expressed siRNAs interfere with at least one mRNA of a gene of interest. In one preferred embodiment, the present invention provides at least one prokaryotic vector including at least one DNA molecule encoding one or more siRNAs and at least one RNA-polymerase III compatible promoter or at least one prokaryotic promoter, wherein the expressed siRNAs interfere with at least one mRNA of a gene of interest. The TRIP (transkingdom RNA interference plasmid) vectors and plasmids of the present invention include a multiple cloning site, a promoter sequence and a terminator sequence. The TRIP vectors and plasmids also include one or more sequences encoding for an invasion factor to permit the non-invasive bacterium or BTP to enter mammalian cells (e.g., the Inv locus that encodes invasion
that permits the bacterium or BTP to enter β 1 -integrin-positive mammalian cells) (Young et al., J. Cell Biol. 116, 197-207 (1992)) and one or more sequences to permit the genetic material to escape from the entry vesicles (e.g., HIy A gene that encodes listeriolysin O) (Mathew et al., Gene Ther. 10, 1105-1115 (2003) and Grillot-Courvalin et al., Na/. Biotechnol. 16, 862-866 (1998)). TRIP is further described (including a vector/plasmid schematic) in PCT Publication No. WO 06/066048. In preferred embodiments, the TRIP vectors and plasmids will incorporate a hairpin RNA expression cassette encoding short hairpin RNA under the control of an appropriate promoter sequence and terminator sequence.
In the design of these constructs, an algorithm was utilized to take into account some known difficulties with the development of siRNA, namely: ( 1 ) Exclusion of disqualifying properties (SNPs, interferon motifs); (2) Exclusion of the sequence if there was homology in ref seq (19/21, >17 contiguous to any other genes) and (3) Exclusion of the sequence if there were significant miRNA seed type matches.
As described herein, the one or more DNA molecules encoding the one or more siRNAs are transcribed within the eukaryotic target cell or transcribed within the bacterium or BTP.
In embodiments where the DNA is transcribed within the eukaryotic cell, the one or more siRNAs are transcribed within the eukaryotic cells as shRNAs . The eukaryotic cell can be in vivo, in vitro or ex vivo. In one aspect of this embodiment, the one or more DNA molecules encoding the one or more siRNAs contain a eukaryotic promoter. Optionally, the eukaryotic promoter is a RNA- polymerase III promoter. Optionally, the RNA polymerase III promoter is a U6 promoter or an Hl promoter.
In embodiments where the DNA is transcribed within the bacterium or BTP, the one or more DNA molecules contain a prokaryotic promoter. Optionally, the prokaryotic promoter is an E. coli promoter. Preferably, the E. coli promoter can be a T7 promoter, lacUV5 promoter, RNA polymerase promoter, gapA promoter, pAl promoter, lac regulated promoter, araC+ PamBAD promoter, T5 promoter, P120 promoter (Estrem et al, 1998, Proc. Natl. Acad. Sci. USA 95, 9761-9766; Meng et al., 2001, Nucleic Acids Res. 29, 4166-417; De Boer et al., 1983, Proc. NatL Acad. Sci. USA 80, 21-25) or recA promoter.
Preferable, promoter sequences are recited in Table 1. Table 1
RNA polymerase promoter TAATTGATACTTTATGCTTTTT TCTGTATAAT gapA promoter AAGCTTTCAGTCGCGTAATGCT TAGGCACAGGATTGATTTGTCG CAATGATTGACACGATTCCGCT TGACACTGCGTAAGTTTTGTGT TATAATGGATCC pAl promoter AAGCTTAAGGAGAGACAACTTA AAGAGACTTAAAAGATTAATTT AAAATTTATCAAAAAGAGTATT GACTTAAAGTCTAACCTATAGG ATACTTGGATCC lac regulated promoter AAGCTTTGTGTGGAATTGTGAG CGGATAACAATTCCACACATTG ACACTTTATGCTTCCGGCTCGT ATAATGGATCC lac regulated promoter AAGCTTGGAAAATTTTTTTTAA AAAAGTCATGTGTGGAATTGTG AGCGGATAACAATTCCACATAT AATGGATCC araC+ P3nBAD promoter GACTTCATATACCCAAGCTTTA 10 AAAAAAAAATCCTTAGCTTTCG CTAAGGATCTCCGTCAAGCCGT CAATTGTCTGATTCGTTACCAA TTATGACAACTTGACGGCTACA TCATTCACTTTTTCTTCACAAC CGGCACGAAACTCGCTCGGGCT GGCCCCGGTGCATTTTTTAAAT ACTCGCGAGAAATAGAGTTGAT CGTCAAAACCAACATTGCGACC GACGGTGGCGATAGGCATCCGG GTAGTGCTCAAAAGCAGCTTCG CCTGACTAATGCGTTGGTCCTC GCGCCAGCTTAAGACGCTAATC CCTAACTGCTGGCGGAAAAGAT GTGACAGACGCGACGGCGACAA GCAAACATGCTGTGCGACGCTG GCGATATCAAAATTGCTGTCTG CCAGGTGATCGCTGATGTACTG ACAAGCCTCGCGTACCCGATTA TCCATCGGTGGATGGAGCGACT CGTTAATCGCTTCCATGCGCCG CAGTAACAATTGCTCAAGCAGA TTTATCGCCAGCAGCTCCGAAT AGCGCCCTTCCCCTTGCCCGGC GTTAATGATTTGCCCAAACAGG TCGCTGAAATGCGGCTGGTGCG CTTCATCCGGGCGAAAGAAACC CGTATTGGCAAATATTGACGGC CAGTTAAGCCATTCATGCCAGT AGGCGCGCGGACGAAAGTAAAC CCACTGGTGATACCATTCGCGA GCCTCCGGATGACGACCGTAGT GATGAATCTCTCCTGGCGGGAA CAGCAAAATATCACCCGGTCGG CAGACAAATTCTCGTCCCTGAT TTTTCACCACCCCCTGACCGCG AATGGTGAGATTGAGAATATAA CCTTTCATTCCCAGCGGTCGGT CGATAAAAAAATCGAGATAACC GTTGGCCTCAATCGGCGTTAAA CCCGCCACCAGATGGGCGTTAA
In embodiments where the DNA is transcribed within the bacterium or BTP, the E. coli promoter is associated with a terminator. Preferably, the E. coli terminator can be a T7 terminator, lacUV5 terminator, Rho-independent terminator, Rho-dependent terminator, or RNA polymerase terminator.
Preferable, terminator sequences are recited in Table 2.
Table 2
In additional embodiments, the vectors and plasmids of the present invention further include one or more enhancer sequences, selection markers, or lysis regulation system sequences.
In one aspect of the invention, the one or more DNA molecules contain a prokaryotic enhancer. Optionally, the prokaryotic enhancer is a T7 enhancer. Optionally, the T7 enhancer has the sequence GAGACAGG (SEQ ID NO: 42). In another aspect of this embodiment, the one or more DNA molecules contain a prokaryotic terminator.
In another aspect of the, the one or more DNA molecules are associated with one or more selection markers. In one aspect of this embodiment, the selection marker is an amber suppressor containing one or more mutations or an diamino pimelic acid (DAP) containing one or more mutations. Optionally, the dap gene is selected from, but not limited to, dapA and dapE.
Preferable, selection marker sequences are recited in Table 3.
Table 3
Selection Marker Sequence SEQ ID NO: amber suppressor gene AATTCGGGGCTATAGCTCAGCT 20 sequence GGGAGAGCGCTTGCATCTAATG CAAGAGGTCAGCGGTTCGATCC CGCTTAGCTCCACCACTGCA amber suppressor sequence AATTCGCCCGGATAGCTCAGTC 21 GGTAGAGCAGGGGATTCTAAAT CCCCGTGTCCTTGGTTCGATTC CGAGTCCGGGCACTGCA
Rho- lgt with double amber ATGACCAGTAGCTATCTGCATT 22 mutation {lgt am-am allele AGCCGGAGTAGGATCCGGTCAT TTTCTCAATAGGACCCGTGGCG of lgt gene) sequence CTTCACTGGTACGGCCTGATGT ATCTGGTGGGTTTCATTTTTGC AATGTGGCTGGCAACACGACGG GCGAATCGTCCGGGCAGCGGCT GGACCAAAAATGAAGTTGAAAA CTTACTCTATGCGGGCTTCCTC GGCGTCTTCCTCGGGGGACGTA TTGGTTATGTTCTGTTCTACAA TTTCCCGCAGTTTATGGCCGAT CCGCTGTATCTGTTCCGTGTCT GGGACGGCGGCATGTCTTTCCA CGGCGGCCTGATTGGCGTTATC GTGGTGATGATTATCTTCGCCC GCCGTACTAAACGTTCCTTCTT CCAGGTCTCTGATTTTATCGCA CCACTCATTCCGTTTGGTCTTG GTGCCGGGCGTCTGGGCAACTT TATTAACGGTGAATTGTGGGGC CGCGTTGACCCGAACTTCCCGT TTGCCATGCTGTTCCCTGGCTC CCGTACAGAAGATATTTTGCTG CTGCAAACCAACCCGCAGTGGC AATCCATTTTCGACACTTACGG TGTGCTGCCGCGCCACCCATCA CAGCTTTACGAGCTGCTGCTGG AAGGTGTGGTGCTGTTTATTAT CCTCAACCTGTATATTCGTAAA CCACGCCCAATGGGAGCTGTCT CAGGTTTGTTCCTGATTGGTTA CGGCGCGTTTCGCATCATTGTT
GAGTTTTTCCGCCAGCCCGACG CGCAGTTTACCGGTGCCTGGGT GCAGTACATCAGCATGGGGCAA ATTCTTTCCATCCCGATGATTG TCGCGGGTGTGATCATGATGGT CTGGGCATATCGTCGCAGCCCA CAGCAACACGTTTCCTGA murA with double amber ATGGATAAATTTCGTGTTCAGG 23 mutation (murA am-am GGCCAACGAAGCTCCAGGGCGA AGTCACAATTTCCGGCGCTAAA allele of murA gene) AATTAGTAGCTGCCTATCCTTT sequence TTGCCGCACTACTGGCGGAAGA ACCGGTAGAGATCCAGAACGTC CCGAAACTGAAAGACGTCGATA CATCAATGAAGCTGCTAAGCCA GCTGGGTGCGAAAGTAGAACGT AATGGTTCTGTGCATATTGATG CCCGCGACGTTAATGTATTCTG CGCACCTTACGATCTGGTTAAA ACCATGCGTGCTTCTATCTGGG CGCTGGGGCCGCTGGTAGCGCG CTTTGGTCAGGGGCAAGTTTCA CTACCTGGCGGTTGTACGATCG GTGCGCGTCCGGTTGATCTACA CATTTCTGGCCTCGAACAATTA GGCGCGACCATCAAACTGGAAG AAGGTTACGTTAAAGCTTCCGT CGATGGTCGTTTGAAAGGTGCA CATATCGTGATGGATAAAGTCA GCGTTGGCGCAACGGTGACCAT CATGTGTGCTGCAACCCTGGCG GAAGGCACCACGATTATTGAAA ACGCAGCGCGTGAACCGGAAAT CGTCGATACCGCGAACTTCCTG ATTACGCTGGGTGCGAAAATTA GCGGTCAGGGCACCGATCGTAT CGTCATCGAAGGTGTGGAACGT TTAGGCGGCGGTGTCTATCGCG TTCTGCCGGATCGTATCGAAAC CGGTACTTTCCTGGTGGCGGCG GCGATTTCTCGCGGCAAAATTA TCTGCCGTAACGCGCAGCCAGA TACTCTCGACGCCGTGCTGGCG AAACTGCGTGACGCTGGAGCGG ACATCGAAGTCGGCGAAGACTG GATTAGCCTGGATATGCATGGC AAACGTCCGAAGGCTGTTAACG TACGTACCGCGCCGCATCCGGC ATTCCCGACCGATATGCAGGCC CAGTTCACGCTGTTGAACCTGG TGGCAGAAGGGACCGGGTTTAT CACCGAAACGGTCTTTGAAAAC CGCTTTATGCATGTGCCAGAGC TGAGCCGTATGGGCGCGCACGC CGAAATCGAAAGCAATACCGTT ATTTGTCACGGTGTTGAAAAAC TTTCTGGCGCACAGGTTATGGC AACCGATCTGCGTGCATCAGCA AGCCTGGTGCTGGCTGGCTGTA TTGCGGAAGGGACGACGGTGGT TGATCGTATTTATCACATCGAT CGTGGCTACGAACGCATTGAAG
ACAAACTGCGCGCTTTAGGTGC AAATATTGAGCGTGTGAAAGGC GAATAA dapA sequence GCCAGGCGACTGTCTTCAATAT 24 TACAGCCGCAACTACTGACATG ACGGGTGATGGTGTTCACAATT CCAGGGCGATCGGCACCCAACG CAGTGATCACCAGATAATGTTG CGATGACAGTGTCAAACTGGTT ATTCCTTTAAGGGGTGAGTTGT TCTTAAGGAAAGCATAAAAAAA ACATGCATACAACAATCAGAAC GGTTCTGTCTGCTTGCTTTTAA TGCCATACCAAACGTACCATTG AGACACTTGTTTGCACAGAGGA TGGCCCATGTTCACGGGAAGTA TTGTCGCGATTGTTACTCCGAT GGATGAAAAAGGTAATGTCTGT CGGGCTAGCTTGAAAAAACTGA TTGATTATCATGTCGCCAGCGG TACTTCGGCGATCGTTTCTGTT GGCACCACTGGCGAGTCCGCTA CCTTAAATCATGACGAACATGC TGATGTGGTGATGATGACGCTG GATCTGGCTGATGGGCGCATTC CGGTAATTGCCGGGACCGGCGC TAACGCTACTGCGGAAGCCATT AGCCTGACGCAGCGCTTCAATG ACAGTGGTATCGTCGGCTGCCT GACGGTAACCCCTTACTACAAT CGTCCGTCGCAAGAAGGTTTGT ATCAGCATTTCAAAGCCATCGC TGAGCATACTGACCTGCCGCAA ATTCTGTATAATGTGCCGTCCC GTACTGGCTGCGATCTGCTCCC GGAAACGGTGGGCCGTCTGGCG AAAGTAAAAAATATTATCGGAA TCAAAGAGGCAACAGGGAACTT AACGCGTGTAAACCAGATCAAA GAGCTGGTTTCAGATGATTTTG TTCTGCTGAGCGGCGATGATGC GAGCGCGCTGGACTTCATGCAA TTGGGCGGTCATGGGGTTATTT CCGTTACGGCTAACGTCGCAGC GCGTGATATGGCCCAGATGTGC AAACTGGCAGCAGAAGGGCATT TTGCCGAGGCACGCGTTATTAA TCAGCGTCTGATGCCATTACAC AACAAACTATTTGTCGAACCCA ATCCAATCCCGGTGAAATGGGC ATGTAAGGAACTGGGTCTTGTG GCGACCGATACGCTGCGCCTGC CAATGACACCAATCACCGACAG TGGTCGTGAGACGGTCAGAGCG GCGCTTAAGCATGCCGGTTTGC TGTAAAGTTTAGGGAGATTTGA TGGCTTACTCTGTTCAAAAGTC GCGCCTGGCAAAGGTTGCGGGT GTTTCGCTTGTTTTATTACTCG CTGCCTGTAGTTCTGACTCACG CTATAAGCGTCAGGTCAGTGGT GATGAAGCCTACCTGGAAGCG
Optionally, the amber suppressor is associated with a promoter or a terminator. Optionally, the promoter is a lipoprotein promoter. Preferable, promoter sequences are recited in Table 4. Table 4
Optionally, the terminator is an rrnC terminator. Preferable, terminator sequences are recited in Table 5.
Table 5
Bacterial and BTP delivery is more attractive than viral delivery because they are more accessible to genetic manipulation, which allows the production of vector strains specifically tailored to certain applications. In one embodiment of the invention, the methods of the invention are used to create bacteria and BTPs that cause RNAi in a tissue specific manner.
Liberation of the siRNA encoding plasmid or the one or more siRNAs from the intracellular bacteria or BTPs occurs through active mechanisms. One mechanism involves the type III export system in S. typhimuriumm, a specialized multiprotein complex spanning the bacterial or BTP cell membrane whose functions include secretion of virulence factors to the outside of the cell to allow signaling towards the target cell, but which can also be used to deliver antigens into target cells (Rϋssmann H. Int J Med Microbiol, 293:107-12 (2003)), or through bacterial lysis and liberation of bacterial or BTP contents into the cytoplasm. The lysis of intracellular bacteria or BTPs is triggered through various mechanisms, including addition of an intracellularly active antibiotic (tetracycline), naturally through bacterial metabolic attenuation (auxotrophy), or through a lysis regulation system or bacterial suicide system comprising a bacterial regulator, promoter and sensor that is sensitive to the environment, e.g., the pH, magnesium concentration, phosphate concentration, ferric ion concentration, osmolarity, anaerobic conditions, nutritional deficiency and general stress of the target cell or the host phagosome. When the bacteria or BTP lysis regulation system senses one or more of the above environmental conditions, bacterial or BTP lysis is triggered by one or more mechanisms
including but not limited to antimicrobial proteins, bacteriophage lysins and autolysins expressed by the bacteria or BTP, either naturally or through modification, or through pore-forming proteins expressed by the bacteria or BTPs, either naturally or through modification, e.g., genetic modification, which break the phagosomes containing the bacteria or BTPs and liberate the siRNA-encoding plasmid or the one or more siRNAs.
The regulator of the lysis regulation system may be selected from the group that includes but is not limited to OmpR, ArcA, PhoP, PhoB, Fur, RstA, EvgA and RpoS. Preferable, lysis regulator sequences are recited in Table 6.
Table 6
Lysis Regulation System Sequence SEQ ID NO: Regulator Sequence
OmpR regulator ATGCAAGAGAACTACAAGATTC 29 TGGTGGTCGATGACGACATGCG CCTGCGTGCGCTGCTGGAACGT TATCTCACCGAACAAGGCTTCC AGGTTCGAAGCGTCGCTAATGC AGAACAGATGGATCGCCTGCTG ACTCGTGAATCTTTCCATCTTA TGGTACTGGATTTAATGTTACC TGGTGAAGATGGCTTGTCGATT TGCCGACGTCTTCGTAGTCAGA GCAACCCGATGCCGATCATTAT GGTGACGGCGAAAGGGGAAGAA GTGGACCGTATCGTAGGCCTGG AGATTGGCGCTGACGACTACAT TCCAAAACCGTTTAACCCGCGT GAACTGCTGGCCCGTATCCGTG CGGTGCTGCGTCGTCAGGCGAA CGAACTGCCAGGCGCACCGTCA CAGGAAGAGGCGGTAATTGCTT TCGGTAAGTTCAAACTTAACCT CGGTACGCGCGAAATGTTCCGC GAAGACGAGCCGATGCCGCTCA CCAGCGGTGAGTTTGCGGTACT GAAGGCACTGGTCAGCCATCCG CGTGAGCCGCTCTCCCGCGATA AGCTGATGAACCTTGCCCGTGG TCGTGAATATTCCGCAATGGAA CGCTCCATCGACGTGCAGATTT CGCGTCTGCGCCGCATGGTGGA AGAAGATCCAGCGCATCCGCGT TACATTCAGACCGTCTGGGGTC TGGGCTACGTCTTTGTACCGGA CGGCTCTAAAGCATGA
PhoP regulator ATGCGCGTACTGGTTGTTGAAG 30 ACAATGCGTTGTTACGTCACCA CCTTAAAGTTCAGATTCAGGAT GCTGGTCATCAGGTCGATGACG CAGAAGATGCCAAAGAAGCCGA TTATTATCTCAATGAACATATA CCGGATATTGCGATTGTCGATC TCGGATTGCCAGACGAGGACGG TCTGTCACTGATTCGCCGCTGG CGTAGCAACGATGTTTCACTGC CGATTCTGGTATTAACCGCCCG TGAAAGCTGGCAGGACAAAGTC
The promoter of the lysis regulation system may be selected from the group that includes but is not limited to ompF, ompC, fadB, phoPQ, mgtA, mgrB, psiB, phnD, Ptrp, sodA, sodB, sltA, sltB, asr, csgD, emrKY, yhiUV, acrAB, mdfA and tolC. Preferable, lysis regulation system promoter sequences are recited in Table 7. Table 7
The sensor of the lysis regulation system may be selected from the group that includes but is not limited to EnvZ, ArcB, PhoQ, PhoR, RstB and EvgS. Preferable, lysis regulation system sensor sequences are recited in Table 8. Table 8
GCCGCTGACCGAAATTCATCAG GGCGATTTCTCTCCGCTGTTCC GCTATACGCTGGCGATTATGCT ATTGGCGATAGGCGGGGCGTGG CTGTTTATTCGTATCCAGAACC GACCGTTGGTCGATCTCGAACA CGCAGCCTTGCAGGTTGGTAAA GGGATTATTCCGCCGCCGCTGC GTGAGTATGGCGCTTCGGAGGT GCGTTCCGTTACCCGTGCCTTT AACCATATGGCGGCTGGTGTTA AGCAACTGGCGGATGACCGCAC GCTGCTGATGGCGGGGGTAAGT CACGACTTGCGCACGCCGCTGA CGCGTATTCGCCTGGCGACTGA GATGATGAGCGAGCAGGATGGC TATCTGGCAGAATCGATCAATA AAGATATCGAAGAGTGCAACGC CATCATTGAGCAGTTTATCGAC TACCTGCGCACCGGGCAGGAGA TGCCGATGGAAATGGCGGATCT TAATGCAGTACTCGGTGAGGTG ATTGCTGCCGAAAGTGGCTATG AGCGGGAAATTGAAACCGCGCT TTACCCCGGCAGCATTGAAGTG AAAATGCACCCGCTGTCGATCA AACGCGCGGTGGCGAATATGGT GGTCAACGCCGCCCGTTATGGC AATGGCTGGATCAAAGTCAGCA GCGGAACGGAGCCGAATCGCGC CTGGTTCCAGGTGGAAGATGAC GGTCCGGGAATTGCGCCGGAAC AACGTAAGCACCTGTTCCAGCC GTTTGTCCGCGGCGACAGTGCG CGCACCATTAGCGGCACGGGAT TAGGGCTGGCAATTGTGCAGCG TATCGTGGATAACCATAACGGG ATGCTGGAGCTTGGCACCAGCG AGCGGGGCGGGCTTTCCATTCG CGCCTGGCTGCCAGTGCCGGTA ACGCGGGCGCAGGGCACGACAA AAGAAGGGTAA
PhoQ sensor ATGAAAAAATTACTGCGTCTTT 38 TTTTCCCGCTCTCGCTGCGGGT ACGTTTTCTGTTGGCAACGGCA GCGGTAGTACTGGTGCTTTCGC TTGCCTACGGAATGGTCGCGCT GATCGGTTATAGCGTCAGTTTC GATAAAACTACGTTTCGGCTGT TACGTGGCGAGAGCAATCTGTT CTATACCCTTGCGAAGTGGGAA AACAATAAGTTGCATGTCGAGT TACCCGAAAATATCGACAAGCA AAGCCCCACCATGACGCTAATT TATGATGAGAACGGGCAGCTTT TATGGGCGCAACGTGACGTGCC CTGGCTGATGAAGATGATCCAG CCTGACTGGCTGAAATCGAATG GTTTTCATGAAATTGAAGCGGA TGTTAACGATACCAGCCTCTTG CTGAGTGGAGATCATTCGATAC AGCAACAGTTGCAGGAAGTGCG
GGAAGATGATGACGACGCGGAG ATGACCCACTCGGTGGCAGTAA ACGTCTACCCGGCAACATCGCG GATGCCAAAATTAACCATTGTG GTGGTGGATACCATTCCGGTGG AGCTAAAAAGTTCCTATATGGT CTGGAGCTGGTTTATCTATGTG CTCTCAGCCAATCTGCTGTTAG TGATCCCGCTGCTGTGGGTCGC CGCCTGGTGGAGTTTACGCCCC ATCGAAGCCCTGGCAAAAGAAG TCCGCGAACTGGAAGAACATAA CCGCGAATTGCTCAATCCAGCC ACAACGCGAGAACTGACCAGTC TGGTACGAAACCTGAACCGATT GTTAAAAAGTGAACGCGAACGT TACGACAAATACCGTACGACGC TCACCGACCTGACCCATAGTCT GAAAACGCCACTGGCGGTGCTG CAAAGTACGCTGCGTTCTCTGC GTAGTGAAAAGATGAGCGTCAG TGATGCTGAGCCGGTAATGCTG GAGCAAATCAGCCGCATTTCAC AGCAAATTGGCTACTACCTGCA TCGTGCCAGTATGCGCGGCGGG ACATTGCTCAGCCGCGAGCTGC ATCCGGTCGCCCCACTGCTGGA CAATCTCACCTCAGCGCTGAAC AAAGTGTATCAACGCAAAGGGG TCAATATCTCTCTCGATATTTC GCCAGAGATCAGCTTTGTCGGT GAGCAGAACGATTTTGTCGAGG TGATGGGCAACGTGCTGGATAA TGCCTGTAAATATTGCCTCGAG TTTGTCGAAATTTCTGCAAGGC AAACCGACGAGCATCTCTATAT TGTGGTCGAGGATGATGGCCCC GGTATTCCATTAAGCAAGCGAG AGGTCATTTTCGACCGTGGTCA ACGGGTTGATACTTTACGCCCT GGGCAAGGTGTAGGGCTGGCGG TAGCCCGCGAAATCACCGAGCA ATATGAGGGTAAAATCGTCGCC GGAGAGAGCATGCTGGGCGGTG CGCGGATGGAGGTGATTTTTGG TCGCCAGCATTCTGCGCCGAAA GATGAATAA
The lysis regulation system may comprise any combination of one or more of the above regulators, promoters and sensors.
In one example of this embodiment, the lysis regulation system comprises OmpR as the regulator, ompF as the promoter and EnvZ as the sensor and the stimulus is reduced osmolality. In another example of this embodiment, the lysis regulation system comprises OmpR as the regulator, ompC as the promoter and EnvZ as the sensor and the stimulus is reduced osmolality.
In another example of this embodiment, the lysis regulation system comprises the ArcA as the regulator, fad as the promoter and Arc B as the sensor and the stimulus is anaerobic conditions.
In another example of this embodiment, the lysis regulation system comprises PhoP as the regulator, phoPQ as the promoter and PhoQ as the sensor and the stimulus is reduced magnesium concentration. In another example of this embodiment, the lysis regulation system comprises PhoP as the regulator, mgtA as the promoter and PhoQ as the sensor and the stimulus is reduced magnesium concentration. In another example of this embodiment, the lysis regulation system comprises PhoP as the regulator, mgrB as the promoter and PhoQ as the sensor and the stimulus is reduced magnesium concentration.
In another example of this embodiment, the lysis regulation system comprises PhoB as the regulator, psiB as the promoter and PhoR as the sensor and the stimulus is reduced phosphate concentration. In another example of this embodiment, the lysis regulation system comprises PhoB as the regulator, phnD as the promoter and PhoR as the sensor and the stimulus is reduced phosphate concentration.In another example of this embodiment, the lysis regulation system comprises RstA as the regulator, asr as the promoter and RstB as the sensor. In another example of this embodiment, the lysis regulation system comprises RstA ast the regulator, csgD as the promoter and RstB as the sensor.
In another example of this embodiment, the lysis regulation system comprises EvgA as the regulator, emrKY as the promoter and EvgS as the sensor. In another example of this embodiment, the lysis regulation system comprises EvgA as the regulator, yhiUV as the promoter and EvgS as the sensor. In another example of this embodiment, the lysis regulation system comprises EvgA as the regulator, acrAB as the promoter and EvgS as the sensor. In another example of this embodiment, the lysis regulation system comprises EvgA as the regulator, mdfA as the promoter and EvgS as the sensor. In another example of this embodiment, the lysis regulation system comprises EvgA as the regulator, tolC as the promoter and EvgS as the sensor.
In another example of this embodiment, the lysis regulation system comprises Fur as the regulator in combination with a promoter selected from the group comprising sodA, sodB, sltA or sltB.
The antimicrobial protein may be selected from the group that includes but is not limited to α- and β-defensins, protegrins, cathelicidins (e.g., indolicidin and bactenecins), granulysin, lysozyme, lactoferrin, azurocidin, elastase, bactericidal permeability inducing peptide (BPI), adrenomedullin, brevinin, histatins and hepcidin. Additional antimicrobial proteins are disclosed in the following, each of which is incorporated herein by reference in its entirety: Devine, D.A. et al., Current Pharmaceutical Design, 8, 703-714 (2002); Jack R. W., et al., Microbiological Reviews, 59 (2), 171- 200 (June 1995).
Optionally, the antimicrobial protein is an α-defensin, β-defensin, or protegrin. Preferable, antimicrobial protein sequences are recited in Table 9. Table 9
GGTCGCCTGTGCTATTGTAGGC GTAGGTTCTGCGTCTGTGTCGG ACGAGGATGACGGTTGCGACGG CAGGCTTTCCCTCCCCCAATTT TCCCGGGGCCAGGTTTCCGTCC CCCAATTTTTCCGCCTCCACCT TTCCGGCCCGCACCATTCGGTC CACCAAGGTTCCCTGGTAGACG GTGAAGGATTTGCAGGCAACTC ACCCAGAAGGCCTTTCGGTACA TTAAAATCCCAGCAAGGAGACC TAAGCATCTGCTTTGCCCAGGC CCGCATCTGTCAAATAAATTCT TGTGAAACC protegrin-3 protein ATGGAGACCCAGAGAGCCAGCC 48 TGTGCCTGGGGCGCTGGTCACT GTGGCTTCTGCTGCTGGCACTC GTGGTGCCCTCGGCCAGCGCCC AGGCCCTCAGCTACAGGGAGGC CGTGCTTCGTGCTGTGGATCGC CTCAACGAGCAGTCCTCGGAAG CTAATCTCTACCGCCTCCTGGA GCTGGACCAGCCGCCCAAGGCC GACGAGGACCCGGGCACCCCGA AACCTGTGAGCTTCACGGTGAA GGAGACTGTGTGTCCCAGGCCG ACCCGGCAGCCCCCGGAGCTGT GTGACTTCAAGGAGAACGGGCG GGTGAAACAGTGTGTGGGGACA GTCACCCTGGATCAGATCAAGG ACCCGCTCGACATCACCTGCAA TGAGGTTCAAGGTGTCAGGGGA GGTGGCCTGTGCTATTGTAGGC GTAGGTTCTGCGTCTGTGTCGG ACGAGGATGACGGTTGCGACGG CAGGCTTTCCCTCCCCCAATTT TCCCGGGGCCAGGTTTCCGTCC CCCAATTTTTCCGCCTCCACCT TTCCGGCCCGCACCATTCGGTC CACCAAGGTTCCCTGGTAGACG GTGAAGGATTTGCAGGCAACTC ACCCAGAAGGCCTTTCGGTACA TTAAAATCCCAGCAAGGAGACC TAAGCATCTGCTTTGCCCAGGC CCGCATCTGTCAAATAAATTCT TGTGAAACC protegrin-4 protein ATGGAGACCCAGAGAGCCAGCC 49 TGTGCCTGGGGCGCTGGTCACT GTGGCTTCTGCTGCTGGCACTC GTGGTGCCCTCGGCCAGCGCCC AGGCCCTCAGCTACAGGGAGGC CGTGCTTCGTGCTGTGGATCGC CTCAACGAGCAGTCCTCGGAAG CTAATCTCTACCGCCTCCTGGA GCTGGACCAGCCGCCCAAGGCC GACGAGGACCCGGGCACCCCGA AACCTGTGAGCTTCACGGTGAA GGAGACTGTGTGTCCCAGGCCG ACCCGGCAGCCCCCGGAGCTGT GTGACTTCAAGGAGAACGGGCG GGTGAAACAGTGTGTGGGGACA GTCACCCTGGATCAGATCAAGG
The bacteriophase lysin may be selected from the group that includes but is not limited to holins and endolysins or lysins (e.g., lysozyme, amidase and transglycoslate). Additional lysins are disclosed in the following, each of which is incorporated herein by reference in its entirety: Kloos D.- U., et al., Journal of Bacteriology, 176 (23), 7352-7361 (December 1994); Jain V., et al., Infection and Immunity, 68 (2), 986-989 (February 2000); Srividhya K.V., et al., J. Biosci., 32, 979-990 (2007); Young R.V., Microbiological Reviews, 56 (3), 430-481 (September 1992).
The autolysin may be selected from the group that includes but is not limited to peptidoglycan hydrolases, amidases (e.g., N-acetylmuramyl-L-alanine amidases), transglycosylases, endopeptidases and glucosaminidases. Additional autolysins are disclosed in the following, each of which is incorporated herein by reference in its entirety: Heidrich C, et al., Molecular Microbiology, 41 (1), 167-178 (2001); Kitano K., et al., Journal oj Bacteriology, 167 (3), 759-765 (September 1986); Lommatzsch J., et al., Journal of Bacteriology, 179 (17), 5465-5470 (September 1997); Oshida T., et al., PNAS, 92, 285-289 (January 1995); Lenz L.L., et al., PNAS, 100 (21), 12432-12437 (October 14, 2003); Ramadurai L., et al., Journal of Bacteriology, 179 (11), 3625-3631 (June 1997); Kraft A.R., et al., Journal of Bacteriology, 180 (12), 3441-3447 (July 1998); Dijkstra A.J., et al., FEBS Letters, 366, 115-118 (1995); Huard C, et al., Microbiology, 149, 695-705 (2003).
In one aspect of the invention, the control exerted by the lysis regulation system may further be enhanced by bacterial or BTP strain-specific regulation. In one aspect of this embodiment, the strain-specific regulation is attenuation caused by deletion of a nutritional gene. The nutritional gene may be selected from the group that includes but is not limited to dapA, aroA and guaBA. In one example of this embodiment, dapA attenuation results in deficiency in the biosynthesis of lysine and peptidoglycan. In this particular embodiment, transcription of genes including but not limited to lysC may be activated by mechanisms such as transcriptional induction, antitermination and riboswitch. In another example of this embodiment, aroA attenuation results in deficiency in aromatic amino acids and derepression of one or more genes including but not limited to aroF, aroG and aroH by regulators such as TrpR and TyrR. In another example of this embodiment, guaBA attenuation results in derepression of one or more genes that are repressed by PurR.
In addition to the lysis regulation system and strain-specific regulation, the bacteria or BTP may further contain an inducible system that includes but is not limited to a Tet-on expression system to facilitate bacterial or BTP lysis at a time desired by the clinician. Upon administration of tetracycline, which activates the Tet-on promoter, the bacteria or BTP express a protein that triggers lysis of the bacteria or BTP. In one example of this embodiment, the protein expressed under the Tet- on expression system is selected from the group that includes but is not limited to defensins and protegrins.
The present invention also provides a lysis regulation system in combination with strain- specific attenuation (e.g., nutritional attenuation). As shown in Figure 30, a global regulator can sense an extraceullar condition and regulate transcription, starvation for specific nutrient such as an amino acid in vivo, in contrast to laboratory growth in the presence of excess of the nutrient and a positive or negative regulator in response to starvation. In the schematic shown in Figure 31 there can be three cassettes, any of which may be place on either the bacterial chromosome or on a plasmid.
As described, the present invention provides a plasmid containing a lysis regulation system comprising OmpR as the regulator, ompF or ompC as the promoter and protegrin or β-defensin as the antimicrobial protein, in combination with a Tet-on expression system, which provides two levels of control of bacterial lysis. This embodiment is illustrated in Figure 32.
In another aspect of the invention, the DNA insert comprises one or more of the following constructs, each of which contains an HPV target sequence, a hairpin sequence and BamHl and Sail restriction sites to facilitate incorporation into the hairpin RNA expression cassette of the TRIP plasmid as shown in Table 10. Table 10
HPV Target Sequence Construct
BamHI sense ( 19bp) loop anti sense ( 21bp) Sai l
5'-GATCC TAGGTATTTGAATTTGCAT TTCAAGAGA ATGCAAATTCAAATACCTTTT G-3' (SEQ ID NO: 50)
3'-G ATCCATAAACTTAAACGTA AAGTTCTCT TACGTTTAAGTTTATGGAAAA CAGCT-5' (SEQ ID NO: 51)
4. Cell and Gene Targets
The present invention also provides methods of using the various bacterium, BTP and vectors provided in the invention. For example, the present invention provides methods of delivering one or more siRNAs to mammalian cells. The methods include introducing at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs to the mammalian cells.
The present invention also provides methods of regulating gene expression in mammalian cells. The method includes introducing at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs to the mammalian cells, where the expressed siRNAs interfere with at least one mRNA of a gene of interest thereby regulating gene expression.
The invention provides a method for delivering RNA to any type of target cell. As used herein, the term "target cell" refers to a cell that can be invaded by a bacterium, i.e., a cell that has the necessary surface receptor for recognition by the bacterium.
Preferred target cells are eukaryotic cells. Even more preferred target cells are animal cells. "Animal cells" are defined as nucleated, non-chloroplast containing cells derived from or present in multicellular organisms whose taxanomic position lies within the kingdom animalia. The cells may be present in the intact animal, a primary cell culture, explant culture or a transformed cell line. The particular tissue source of the cells is not critical to the present invention.
The recipient animal cells employed in the present invention are not critical thereto and include cells present in or derived from all organisms within the kingdom animalia, such as those of the families mammalia, pisces, avian, reptilia.
Preferred animal cells are mammalian cells, such as humans, bovine, ovine, porcine, feline, canine, goat, equine, and primate cells. The most preferred mammalian cells are human cells. The cells can be in vivo, in vitro or ex vivo. In some embodiments of the invention, the cell is a cervical epithelial cell, a rectal epithelial cell or a pharyngeal epithelial cell, macrophage, gastrointestinal epithelial cell, skin cell, melanocyte, keratinocyte, hair follicle, colon cancer cell, an ovarian cancer cell, a bladder cancer cell, a pharyngeal cancer cell, a rectal cancer cell, a prostate cancer cell, a breast cancer cell, a lung cancer cell, a renal cancer cell, a pancreatic cancer cell, or a hematologic cancer cell such as a lymphoma or leukemia cell. In one aspect of this embodiment, the colon cancer cell is an SW 480 cell. In another aspect of this embodiment, the pancreatic cancer cell is a CAPAN-I cell. m a preferred embodiment, the target cell is in a mucosal surface. Certain enteric pathogens, e.g., E. coli, Shigella, Listeria, and Salmonella, are naturally adapted for this application, as these organisms possess the ability to attach to and invade host mucosal surfaces (Kreig et al. supra). Therefore, in the present invention, such bacteria can deliver RNA molecules or RNA-encoding DNA to cells in the host mucosal compartment.
Although certain types of bacteria may have a certain tropism, i.e., preferred target cells, delivery of RNA or RNA-encoding DNA to a certain type of cell can be achieved by choosing a bacterium which has a tropism for the desired cell type or which is modified such as to be able to invade the desired cell type. Thus, e.g., a bacterium could be genetically engineered to mimic mucosal tissue tropism and invasive properties, as discussed above, to thereby allow said bacteria to invade mucosal tissue, and deliver RNA or RNA-encoding DNA to cells in those sites.
Bacteria can also be targeted to other types of cells. For example, bacteria can be targeted to erythrocytes of humans and primates by modifying bacteria to express on their surface either, or both of, the Plasmodium vivax reticulocyte binding proteins- 1 and -2, which bind specifically to erythrocytes in humans and primates (Galinski et al. Cell, 69:1213-1226 (1992)). In another embodiment, bacteria are modified to have on their surface asialoorosomucoid, which is a ligand for
the asilogycoprotein receptor on hepatocytes (Wu etal. J. Biol. Chem., 263:14621-14624 (1988)). In yet another embodiment, bacteria are coated with insulin-poly-L-lysine, which has been shown to target plasmid uptake to cells with an insulin receptor (Rosenkranz et al. Expt. Cell Res., 199:323-329 (1992)). Also within the scope of the invention are bacteria modified to have on their surface p60 of Listeria monocytogenes, which allows for tropism for hepatocytes (Hess et al. Infect. Immun., 63:2047-2053 (1995)), or a 60 kD surface protein from Trypanosoma cruzi which causes specific binding to the mammalian extra-cellular matrix by binding to heparin, heparin sulfate and collagen (Ortega-Barria ef α/. Cell, 67:411^21 (1991)).
Yet in another embodiment, a cell can be modified to become a target cell of a bacterium for delivery of RNA. Accordingly, a cell can be modified to express a surface antigen that is recognized by a bacterium for its entry into the cell, i.e., a receptor of an invasion factor. The cell can be modified either by introducing into the cell a nucleic acid encoding a receptor of an invasion factor, such that the surface antigen is expressed in the desired conditions. Alternatively, the cell can be coated with a receptor of an invasion factor. Receptors of invasion factors include proteins belonging to the integrin receptor superfamily. A list of the type of integrin receptors recognized by various bacteria and other microorganisms can be found, e.g., in Isberg and Tran Van Nhieu (1994) Ann. Rev. Genet. 27:395. Nucleotide sequences for the integrin subunits can be found, e.g., in GenBank, publicly available on the internet.
As set forth above, yet other target cells include fish, avian, and reptilian cells. Examples of bacteria that are naturally invasive for fish, avian, and reptilian cells are set forth below.
Examples of bacteria that can naturally access the cytoplasm of fish cells include, but are not limited to, Aeromonas salminocida (ATCC No. 33658) and Aeromonas schuberii (ATCC No. 43700). Attenuated bacteria are preferably used in the invention, and include A. salmonicidia vapA (Gustafson et al. J. MoI. Biol., 237:452-463 (1994)) oτA. salmonicidia aromatic-dependent mutant (Vaughan et al. Infect. Immun., 61:2172-2181 (1993)).
Examples of bacteria that can naturally access the cytoplasm of avian cells include, but are not restricted to, Salmonella galinarum (ATCC No. 9184), Salmonella enteriditis (ATCC No. 4931) and Salmonella typhimurium (ATCC No. 6994). Attenuated bacteria are preferred to the invention and include attenuated Salmonella strains such as S. galinarum cya crp mutant (Curtiss et al. (1987) supra) or S. enteritidis aroA aromatic-dependent mutant CVL30 (Cooper et al. Infect. Immun., 62:4739-4746 (1994)).
Examples of bacteria that can naturally access the cytoplasm of reptilian cells include, but are not restricted to, Salmonella typhimurium (ATCC No. 6994). Attenuated bacteria are preferable to the invention and include, attenuated strains such as S. typhimuirum aromatic-dependent mutant (Hormaeche et al. supra).
The invention also provides for delivery of RNA to other eukaryotic cells, e.g., plant cells, so long as there are microorganisms that are capable of invading such cells, either naturally or after
having been modified to become invasive. Examples of microorganisms which can invade plant cells include Agrobacterium tumerfacium, which uses a pilus-like structure which binds to the plant cell via specific receptors, and then through a process that resembles bacterial conjugation, delivers at least some of its content to the plant cell. Set forth below are examples of cell lines to which RNA can be delivered according to the method of this invention.
Examples of human cell lines include but are not limited to ATCC Nos. CCL 62, CCL 159, HTB 151, HTB 22, CCL 2, CRL 1634, CRL 8155, HTB 61, and HTB104.
Examples of bovine cell lines include ATCC Nos. CRL 6021, CRL 1733, CRL 6033, CRL 6023, CCL 44 and CRL 1390.
Examples of ovine cells lines include ATCC Nos. CRL 6540, CRL 6538, CRL 6548 and CRL 6546.
Examples of porcine cell lines include ATCC Nos. CL 184, CRL 6492, and CRL 1746.
Examples of feline cell lines include CRL 6077, CRL 6113, CRL 6140, CRL 6164, CCL 94, CCL 150, CRL 6075 and CRL 6123.
Examples of buffalo cell lines include CCL 40 and CRL 6072.
Examples of canine cells include ATCC Nos. CRL 6213, CCL 34, CRL 6202, CRL 6225, CRL 6215, CRL 6203 and CRL 6575.
Examples of goat derived cell lines include ATCC No. CCL 73 and ATCC No. CRL 6270. Examples of horse derived cell lines include ATCC Nos. CCL 57 and CRL 6583.
Examples of deer cell lines include ATCC Nos. CRL 6193-6196.
Examples of primate derived cell lines include those from chimpanzee's such as ATCC Nos. CRL 6312, CRL 6304, and CRL 1868; monkey cell lines such as ATCC Nos. CRL 1576, CCL 26, and CCL 161; orangautan cell line ATCC No. CRL 1850; and gorilla cell line ATCC No. CRL 1854. The invention also provides methods of regulating the expression of one or more genes.
Preferably, regulating the expression of one or more genes means decreasing or lessening the expression of the gene and/or decreasing or lessening the activity of the gene and its corresponding gene product.
In one embodiment, the expressed siRNAs direct the multienzyme complex RISC (RNA- induced silencing complex) of the cell to interact with the mRNAs to be regulated. This complex degrades or sequesters the mRNA. This causes the expression of the gene to be decreased or inhibited.
In some embodiments, the gene is an animal gene. Preferred animal genes are mammalian genes, such as humans, bovine, ovine, porcine, feline, canine, goat, equine, and primate genes. The most preferred mammalian genes are human cells.
The gene to be regulated can be a viral gene, anti-inflammatory gene, obesity gene or automimmune disease or disorder gene. In some embodiments, more than one gene can be regulated from a single plasmid or vector.
In preferred embodiments, the gene can be, but is not limited to, ras, β-catenin, one or more HPV oncogenes, APC, HER-2, MDR-I, MRP-2, FATP4, SGLUT-I, GLUT-2, GLUT-5, apobec-1, MTP, IL-6, IL-6R, IL-7, IL-12, IL-13, IL-13 Ra-I, IL-18, p38/JNK MAP kinase, p65/NF-κB, CCL20 (MIP-3α), Claudin-2, Chitinase 3-like 1, apoA-IV, MHC class I and MHC class II. In one aspect of this embodiment, the ras is k-Ras. In another aspect of this embodiment, the HPV oncogene is E6 or E7. Preferable β-catenin target gene sequences are recited in Table 11. The sequences in Table
11 are cross-species target sequences as they are capable of silencing the beta-catenin gene (CTNNBl) in human, mouse, rat, dog and monkey. Table 11. β-catenin target gene sequences SEQ ID NO:
AGCCAATGGCTTGGAATGAGA 52
ATCAGCTGGCCTGGTTTGATA 53
CTGTGAACTTGCTCAGGACAA 54
AGCAATCAGCTGGCCTGGTTT 55
CCTCTGTGAACTTGCTCAGGA 56
TTCCGAATGTCTGAGGACAAG 57
CCAATGGCTTGGAATGAGACT 58
GGTGCTGACTATCCAGTTGAT 59
CAATCAGCTGGCCTGGTTTGA 60
CACCCTGGTGCTGACTATCCA 61
CACCACCCTGGTGCTGACTAT 62
TGCTTTATTCTCCCATTGAAA 63
CTGGTGCTGACTATCCAGTTG 64
TCTGTGCTCTTCGTCATCTGA 65
TGCCATCTGTGCTCTTCGTCA 66
TGGTGCTGACTATCCAGTTGA 67
CCTGGTGCTGACTATCCAGTT 68
ACCCTGGTGCTGACTATCCAG 69
GAGCCTGCCATCTGTGCTCTT 70
CTGGTTTGATACTGACCTGTA 71
TGGTTTGATACTGACCTGTAA 72
TCGAGGAGTAACAATACAAAT 73
ACCATGCAGAATACAAATGAT 74
AGGAGTAACAATACAAATGGA 75
GTCGAGGAGTAACAATACAAA 76
TTGTTGTAACCTGCTGTGATA 77
GAGTAATGGTGTAGAACACTA 78
AGTAATGGTGTAGAACACTAA 79
CACACTAACCAAGCTGAGTTT 80
TTTGGTCGAGGAGTAACAATA 81
TACCATTCCATTGTTTGTGCA 82
TAGGGTAAATCAGTAAGAGGT 83
CTAACCAAGCTGAGTTTCCTA 84
TGGTCGAGGAGTAACAATACA 85
CTGGCCTGGTTTGATACTGAC 86
TAACCTCACTTGCAATAATTA 87 ATCCCACTGGCCTCTGATAAA 88 GACCACAAGCAGAGTGCTGAA 89 CACAAGCAGAGTGCTGAAGGT 90 CTAACCTCACTTGCAATAATT 91 AGCTGATATTGATGGACAG 92
Preferable HPV target gene sequences are recited in Table 12. The sequences in Table 12 are target sequences as they are capable of silencing the HPV E6 oncogene. Table 12
Additional preferable HPV target gene sequences are recited in Table 13. The sequences in Table 13 are target sequences as they are capable of silencing the HPV E7 oncogene. Table 13
Additional preferable HPV target gene sequences are recited in Table 14. The sequences in Table 14 are target sequences shared by both HPV E6 and E6. Table 14
GAGGTATTTGAATTTGCAT 154
A preferable MDR-I target gene sequence is recited in Table 15. The sequence in Table 15 is capable of silencing the MDR-I gene in human. Table 15
A preferable k-Ras target gene sequence is recited in Table 16. The sequence in Table 16 is capable of silencing the k-Ras gene in human. Table 16
Preferable IL-6R target gene sequence are recited in Table 17. The sequences in Table 17 are capable of silencing IL-6R in human.
Table 17
Table 18 are capable of silencing the IL-6R gene in mouse. Table 18
Preferable IL-7 target gene sequences are recited in Table 19. The sequences in Table 19 are capable of silencing the IL-7 gene in human. Table 19
Additional preferable IL-7 target gene sequences are recited in Table 20. The sequences in Table 20 are capable of silencing the IL-7 gene in mouse. Table 20
Additional preferable IL-7 target gene sequences are recited in Table 21. The sequences in Table 21 are cross species sequences as they are capable of silencing the IL-7 gene in human and mouse. Table 21
Preferable IL-13Ra-l target gene sequences are recited in Table 22. The sequences in Table 22 are capable of silencing the IL-13Ra-l gene in human. Table 22
Additional preferable IL-13Ra-l target gene sequences are recited in Table 23. The sequences in Table 23 are capable of silencing the IL-13Ra-l gene in mouse. Table 23
A preferable IL- 18 target gene sequence is recited in Table 24. The sequence in Table 24 is capable of silencing the IL- 18 gene in human. Table 24
Additional preferable IL- 18 target gene sequences are recited in Table 25. The sequences in Table 25 are capable of silencing the IL- 18 gene in mouse. Table 25
Preferable CCL20 target gene sequences are recited in Table 26. The sequences in Table 26 are capable of silencing the CCL20 gene in human. Table 26
Additional referable CCL20 target gene sequences are recited in Table 27. The sequences in Table 27 are capable of silencing the CCL20 gene in mouse. Table 27
Additional preferable CCL20 target gene sequences are recited in Table 28. The sequences in Table 28 are cross-species target sequences as they are capable of silencing the CCL20 gene in human and mouse.
Table 28.
Preferable CCL20 target gene sequences are recited in Table 29. The sequences in Table 29 are capable of silencing the CCL20 gene in human. Table 29
Additional preferable CCL20 target gene sequences are recited in Table 30. The sequences in Table 30 are capable of silencing the CCL20 gene in mouse. Table 30
Preferable Chitinase-3 target gene sequences are recited in Table 31. The sequences in Table 31 are capable of silencing the Chitinase-3 gene in human. Table 31
Additional preferable Chitinase-3 target gene sequences are recited in Table 32. The sequences in Table 32 are capable of silencing the Chitinase-3 gene in mouse. Table 32
5; Treatment of Diseases and Disorders
The present invention also provides methods of treating or preventing a disease or disorder in a mammal. The methods include regulating the expression of at least one gene in a cell known to cause a disease or disorder by introducing to the cells of the mammal at least one invasive bacterium, or at least one bacterial therapeutic particle (BTP), containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs, where the expressed siRNAs interfere with the mRNA of the gene known to cause the disease or disorder of interest.
The RNAi methods of the invention, including BMGS and tkRNAi are used to treat any disease or disorder for which gene expression regulation would be beneficial. This method is effected by silencing or knocking down (decreasing) genes involved with one or more diseases and disorders.
The gene to be regulated to treat or prevent a disease or disorder of interest, can be, but is not limited to, ras, β-catenin, one or more HPV oncogenes, APC, HER-2, MDR-I, MRP-2, FATP4, SGLUT-I, GLUT-2, GLUT-5, apobec-1, MTP, IL-6, IL-6R, IL-7, IL-12, IL-13, IL-13 Ra-I, IL-18, p38/JNK MAP kinase, p65/NF-κB, CCL20 (MIP-3α), Claudin-2, Chitinase 3-like 1, apoA-IV, MHC
class I and MHC class II. In one aspect of this embodiment, the ras is k-Ras. In another aspect of this embodiment, the HPV oncogene is E6 or E7.
Preferably, the present invention provides methods of treating or preventing cancer or a cell proliferation disorder, viral disease, an inflammatory disease or disorder, a metabolic disease or disorder, an autoimmune disease or disorder, or a disease, disorder or cosmetic concern in the skin or hair in a mammal by regulating the expression of a gene or several genes known to be associated with the onset, propagation or prolongation of the disease or disorder by introducing a bacterium or BTP to the cell. The bacterium or BTP contain one or more siRNAs or one or more DNA molecules encoding one or more siRNAs, where the expressed siRNAs interfere with the mRNA of the gene known to cause, propagate or prolong the disease or disorder of interest.
In some preferred embodiments, the viral disease can be, but is not limited to, hepatitis B, hepatitis C, Human Papilloma Virus (HPV) infection or epithelial dysplasia or cancer caused by HPV infection or HPV induced transformation, including cervical cancer, rectal cancer and pharyngeal cancer. In some preferred embodiments, the inflammatory disease or disorder can be, but is not limited to, inflammatory bowel disease, Crohn's disease, ulcerative colitis, an allergy, rheumatoid arthritis.
In some preferred embodiments, the automimmune disease or disorder can be, but is not limited to, celiac disease. hi some preferred embodiments, the disease, disorder or cosmetic concern can be, but is not limited to, psoriasis, eczema, albinism, balding or gray hair.
The mammal can be any mammal including, but not limited to, human, bovine, ovine, porcine, feline, canine, goat, equine, or primate. Preferably, the mammal is a human.
The terms "treating" and "treatment" as used herein refer to the administration of an agent or formulation (e.g. , bacterium and/or BTP containing an siRNA or a DNA encoding for an siRNA) to a clinically symptomatic individual afflicted with an adverse condition, disorder, or disease, so as to effect a reduction in severity and/or frequency of symptoms, eliminate the symptoms and/or their underlying cause, and/or facilitate improvement or remediation of damage.
The terms "preventing" and "prevention" refer to the administration of an agent or composition to a clinically asymptomatic individual who is susceptible to a particular adverse condition, disorder, or disease, and thus relates to the prevention of the occurrence of symptoms and/or their underlying cause.
6. Pharmaceutical Compositions and Modes of Administration hi a preferred embodiment of the invention, the invasive bacteria or BTPs containing the
RNA molecules, and/or DNA encoding such, are introduced into an animal by intravenous,
intramuscular, intradermal, intraperitoneally, peroral, intranasal, intraocular, intrarectal, intravaginal, intraosseous, oral, immersion and intraurethral inoculation routes.
The amount of the invasive bacteria or BTPs of the present invention to be administered to a subject will vary depending on the species of the subject, as well as the disease or condition that is being treated. Generally, the dosage employed will be about 103 to 1011 viable organisms, preferably about 105 to 109 viable organisms per subject.
The invasive bacteria or BTPs of the present invention are generally administered along with a pharmaceutically acceptable carrier and/or diluent. The particular pharmaceutically acceptable carrier an/or diluent employed is not critical to the present invention. Examples of diluents include a phosphate buffered saline, buffer for buffering against gastric acid in the stomach, such as citrate buffer (pH 7.0) containing sucrose, bicarbonate buffer (pH 7.0) alone (Levine et al. J. Clin. Invest., 79:888-902 (1987); and Black et al J. Infect. Dis., 155:1260-1265 (1987)), or bicarbonate buffer (pH 7.0) containing ascorbic acid, lactose, and optionally aspartame (Levine et al. Lancet, 11:467-470 (1988)). Examples of carriers include proteins, e.g., as found in skim milk, sugars, e.g., sucrose, or polyvinylpyrrolidone. Typically these carriers would be used at a concentration of about 0.1 -30% (w/v) but preferably at a range of 1-10% (w/v).
Set forth below are other pharmaceutically acceptable carriers or diluents which may be used for delivery specific routes. Any such carrier or diluent can be used for administration of the bacteria of the invention, so long as the bacteria or BTPs are still capable of invading a target cell. In vitro or in vivo tests for invasiveness can be performed to determine appropriate diluents and carriers. The compositions of the invention can be formulated for a variety of types of administration, including systemic and topical or localized administration. Lyophilized forms are also included, so long as the bacteria are invasive upon contact with a target cell or upon administration to the subject. Techniques and formulations generally may be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, Pa. For systemic administration, injection is preferred, including intramuscular, intravenous, intraperitoneal, and subcutaneous. For injection, the composition, e.g., bacteria or BTPs, of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution.
For oral administration, the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents {e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods well known in the art. Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means
with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.
Preparations for oral administration may be suitably formulated to give controlled release of the active compound. For buccal administration the compositions may take the form of tablets or lozenges formulated in conventional manner.
For administration by inhalation, the pharmaceutical compositions for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the composition, e.g. , bacteria, and a suitable powder base such as lactose or starch.
The pharmaceutical compositions may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
The pharmaceutical compositions may also be formulated in rectal, intravaginal or intraurethral compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration may be through nasal sprays or using suppositories. For topical administration, the bacteria of the invention are formulated into ointments, salves, gels, or creams as generally known in the art, so long as the bacteria are still invasive upon contact with a target cell. The compositions may, if desired, be presented in a pack or dispenser device and/or a kit that may contain one or more unit dosage forms containing the active ingredient. The pack may for
example comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration.
The invasive bacteria or BTPs containing the RNA or RNA-encoding DNA to be introduced can be used to infect animal cells that are cultured in vitro, such as cells obtained from a subject. These in vjϊrø-infected cells can then be introduced into animals, e.g., the subject from which the cells were obtained initially, intravenously, intramuscularly, intradermally, or intraperitoneally, or by any inoculation route that allows the cells to enter the host tissue. When delivering RNA to individual cells, the dosage of viable organisms administered will be at a multiplicity of infection ranging from about 0.1 to 106, preferably about 102 to 104 bacteria per cell. hi yet another embodiment of the present invention, bacteria can also deliver RNA molecules encoding proteins to cells, e.g., animal cells, from which the proteins can later be harvested or purified. For example, a protein can be produced in a tissue culture cell.
While the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
The present invention is further illustrated by the following examples that should not be construed as limiting in any way. The contents of all cited references including literature references, issued patents, published patent applications as cited throughout this application are hereby expressly incorporated by reference. The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J.
Gait ed., 1984); Mullis et al. U.S. Pat. No: 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods hi Enzymology (Academic Press, Inc., N. Y.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods hi Enzymology, VoIs. 154 and 155 (Wu et al. eds.), Immunochemical Methods hi Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I- rV (D. M. Weir and C. C. Blackwell, eds., 1986); Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
The following non-limiting examples are merely illustrative of the preferred embodiments of the present invention, and are not to be construed as limiting the invention.
EXAMPLES
Example 1: Knockdown of β-catenin and k-Ras Previous studies have demonstrated the powerful nature of the siRNA knockdown technology disclosed herein. For example, in vitro and in vivo knockdown of beta catenin and k-ras utilizing bacterial delivery is described in PCT Publication No. WO 06/066048, which is incorporated herein by reference in its entirety.
Example 2 : TRIP with Multiple shRNA Expression Cassettes
The TRIP described herein, and described in further detail in PCT Publication No. WO 06/066048, can be modified to produce a plasmid which allows targeting of multiple genes simultaneously or multiple sequences within one gene simultaneously. For example, TRIP with multiple hairpin expression cassettes to produce shRNA can target different sequences in a given gene, or target multiple genes through a simultaneous bacterial treatment.
The TRIP plasmid can incorporate multiple (up to ten) cloning sites to express different shRNA constructs (Figure 1). The purpose of such a plasmid will be to allow silencing of various genes through a single therapeutic bacterium which will be empowered by the Multiple-expression cassette-TRIP (mec-TRIP) to synthesize short hairpin RNA against a variety of targets simultaneously.
These different hairpins can either be expressed competitively at high levels through the use of an identical high level promoter (such as T7 promoter or a different high level bacterial promoter), or they can be expressed at different levels through the use of promoters with different levels of activity, this will depend on the intended use of the plasmid and the desired relative silencing levels of the target gene.
This mec-TRIP could be useful to treat complex diseases as described herein (e.g. inflammatory diseases, or cancer), through the simultaneous silencing(targeting) of multiple targets as described herein (e.g. multiple oncogenes, such as k-ras and beta-catenin in the case of colon cancer, or HER-2 and MDR-I in breast cancer, or other combinations).
Example 3: Operator Repressor Titration System
The TRIP system (bacteria and plasmid) have been modified to include the ORT (Operator Repressor Titration) system from Cobra Biomanufacturing (Keele, UK). This adaptation helps to maintain the plasmid in suitable strains in the absence of selective antibiotics. The bacterial carrier strain has been modified accordingly to allow for the ORT system to function (deletion of the DAP gene and replacement with an ORT-controlled DAP gene expression system). The plasmid has been modified to remove the antibiotic selection sequences to support the ORT system. Further changes
have been introduced to the bacterial genome, including for example, (a) deletion of the aroA gene (in some CEQ strains) to make the bacteria more susceptible to nutrient shortage, particularly in the intracellular compartment where they will die due to lack of nutrients; (b) insertion of T7RNApolymerase gene into the chromosome and or (c) integration of a shRNA expression cassette under T7 promoter into the chromosome.
Figure 2 shows development examples of bacterial strains. Further strains developed include, but are not limited to, CEQ922 (CEQ919 without aroA deletion), CEQ923 (CEQ920 without aroA deletion), CEQ924 (CEQ921 without aroA deletion).
Example 4: Intestinal Tract Gene Delivery
S. typhimurium was investigated to determine if it could be used as a vector for RNAi delivery into the epithelial cells lining the intestinal tract. Mice were treated orally with a single dose of 108 SL 7207 and sacrificed at various time points after administration. SL7207 were then stained using the Salmonella specific antibody. 2h after treatment, numerous SL7207 could be seen invading the intestinal epithelial layer (Salmonella stained red), suggesting that oral administration of SL7207 may be a useful tool to deliver payloads to the intestinal and colonic mucosa. In a follow up experiment, mice were treated with SL7207 harboring a GFP expression plasmid (pEGFPCl, Invitrogen). At 24h after a single treatment, a small percentage (approximately 1%) of cells was clearly found to express GFP. Figure 3 shows the efficient invasion and plasmid delivery into the intestinal mucosa by S. typhimurium. SL7207 were stained using red fluorescent antibody 6h after oral administration. Intact SL7207 and fragments of SL7207 were seen in epithelial cells as well as underlying cells of the lamina propria (top left/right). SL7207 successfully deliver expressed DNA into the intestinal mucosa: intestinal mucosal cells expressing GFP after treatment with SL7207 carrying a eukaryotic expression plasmid for GFP (pEGFP-Cl)(lower left). For fluorescence microscopy, SL7207 were stained with red fluorescent antibody and nuclei were counterstained with Hoechst 37111.
To test whether SL7207 could be used for the delivery of RNAi to target genes in the intestinal tract, GFP transgenic mice (4 per group) were treated with S. typhimurium harboring a shRNA expression plasmid directed against GFP (SL-siGFP) or a shRNA expression plasmid directed against k-RAS (SL-siRAS). 108 c.f.u. was given three times weekly for two weeks by oral gavage. Colonic tissues were subsequently reviewed with fluorescent microscopy (data not shown) and stained analyzed after immunhistochemistry staining for GFP expression using a specific antibody (Living Colors®, Invitrogen). There was a significant reduction in the overall GFP expression level and significant reduction in the number of GFP expressing crypts in the SL-siGFP treated animals compared with the SL-siRAS treated animals (33.9% vs 50%, p<0.05), suggesting that this method could be useful to deliver therapeutic RNAi into the colonic epithelium.
Figure 4 shows that bacteria-mediated RNA interference reduces target gene expression in the gastrointestinal epithelium. After treatment with SL7207 carrying expression plasmids targeting GFP (SL-siGFP, right bottom panel), colon tissues showed lower levels of GFP expression, and fewer colonic crypts were stained positive for GFP compared with animals treated with SL-siRAS (left bottom panel). Slides were stained with GFP-specific antibody.
Example 5: Construction of CEQ503 Bacterial Strain
Derivation and Description of CEQ 503 (Strain CEO201 (pNJSZY)
CEQ503 consists of a combination of an attenuated E.coli strain (CEQ201) with a specially engineered TRIP plasmid (pNJSZ). The plasmid confers the abilities required to induce tkRNAi (in this case: invasiveness, escape from the entry vesicle, expression of short hairpin RNA). Strain Description of CEQ503 (pNJSZ):
1. Genotype: Escherichia coli CEQ201 \glnV44(AS), LAM, rjbCl, endAl, spoTl, thi-1, hsdR17, fa m^),creC510 ΔdapA, ArecA].
2. Derivation of CEQ201
MM294 (Meselson and Yuan, Nature 217, 1110, 1968;
Transformation with plasmid pKD46
Transformation with a ΔrecA::cat cassette generated using PCR with pKD3
MM294 AdapAukan ArecA::cat (pKD46) ,
^ Plasmid pKD46 cured by growing cells at 43 0C
MM294 AdapA::kan ArecA::cat I Transformed with plasmid pCP2θ'
MM294 AdapA::kan ArecAv.cat (pCP20)
Plasmid pCP20 cured and kan gene deleted from the chromosome by induction of FLP recombinase treatment at 43 0C
MM294 AdapA ArecA (CEQ201)
3. Plasmid: pNJSZ, shown schematically in Figure 5, is a 10.4 kb plasmid that confers kanamycin resistance to our bacterial strain (CEQ503). This plasmid contains two genes, hly and inv, and the
H3 hairpin sequence: ggatccAGGAGTAACAATACAAATGGATTCAAGAGATCCATTTGTATTGTTACTCCTTTgt cgac (SEQ ID NO:380), which includes BamHI and Sail restriction sites. To verify the presence of this plasmid, PCRs are performed to verify chromosomal deletion of dapA, and minipreps and/or PCR are performed to confirm inv, hly and 341-H3 on the plasmid.
4. Nutritional Requirements: Althea Media Broth or LB, Miller (Luria-Bertani) broth (Amresco; cat. no.: J106-2KG) and 50 μg/ml of DL-Δ;ε-Diaminopemilic acid (DAP) (SIGMA; cat. no.: D1377- 10G).
5. Growth Conditions: 37 "C
Example 6: BTP Production
BTPs or minicells containing a suitable plasmid such as TRIP have been engineered for delivery of tkRNAi. These cells will express invasin or Opa to enable entry into mammalian cells and listeriolysin will allow lysis of phagosome following minicell degradation/ lysis. Additionally, a method for manufacturing minicells has been developed that utilizes a suicide construct for killing intact cells to aid in the purification of minicells. Such suicide plasmids have been described in the literature (Kloos et al., (1994) J. Bacterid. 176, 7352-61; Jain and Mekalanos, (2000) Infect. Immun. 68, 986-989). Summarily, the lambda S and R genes that code for holing and lysozyme are placed under regulation of an inducible promoter on the bacterial chromosome. When induced, they will lyse intact cells but not minicells since minicells lack chromosomes. A number of different types of regulators such as lad, araC, lambda cI857 and rhaS-rhaR can be used for development of an inducible suicide gene construct.. Similarly, a number of different types of suicide genes, including E. coli autolysis genes and antimicrobial small peptides, can be used in a similar scheme. Purification is enhanced by treatments or mutations that induce filamentation (see, for example, Ward and Lutkenhaus, (1985) Cell 42, 941-949; Bi and Lutkenhaus, 1992). Initial purification involves low speed centrifugation to separate intact cells and retain minicells in the supernatant. This can be followed by density gradient purification or filtration (for example, Shull et al., (1971) J. Bacteriol. 106, 626-633).
Any cell death-triggering gene, also known as a suicide gene, including but not limited to genes encoding antimicrobial proteins, bacteriophage lysins or autolysins can be used in this method for obtaining BTPs from a mixture containing BTPs and bacteria. Suicide genes can kill live bacteria by mechanisms that include but are not limited to cell lysis, or by the destruction, degradation or poisoning of cellular components such as chromosomal DNA or filament components. Any inducible promoter may be used in conjunction with this system. In one embodiment of this invention, the suicide genes are integrated within the chromosome, thereby limiting their presence only in intact
bacterial cells as BTPs or minicells will not incorporate these genes because they do not harbor chromosomal DNA.
As shown in Figure 6, induction of suicide genes will lyse intact bacterial cells. The lambda S and R genes (suicide genes) are put under the control of PiacUv5 (inducible promoter). The leaky basal activity is repressed by a "super-repressor" coded by lacP gene on a PgapA (strong promoter). This cassette is put at the minCD locus.
Example 7: siRNA Inhibition of Human Papillomavirus (HPV) Ongogenes
Experimental Procedures
Cell Culture: HeIa cells were cultured in Minimum Essential Medium (MEM, ATCC No. 30- 2003) with 10% FBS supplemented with antibiotics: 100 U/ml penicillin G, 10 μg/ml streptomycin (Sigma).
Bacterial Culture: Plasmids were transformed into BL21(DE3) strain (Invitrogen). Bacteria were grown at 37°C in LB Broth containing 100 μg/ml ampicillin. Bacterial cell density (in CFU/ml) was calculated using OD6Oo measurement. For cell infection, overnight cultures were inoculated into fresh medium for another 2-3 h growth until the optical density at 600 ran [OD600] reached 0.6.
Invasion Assay: For bacterial invasion, HeIa cells were plated in 6-well dishes at 200,000 cells/well and allowed to incubate overnight in 2 ml complete growth medium. The bacterial cells were grown to mid-exponential phase with optical density at 600 ran [OD600] 0.6 in LB Broth with Ampicillin, and then centrifiiged at 3,400 rpm for 10 minutes at 40C. Bacterial pellets were resuspended in MEM without serum or the antibiotics and the bacteria were added to the cells at an MOI of 1:1000, 1:500, 1:250, 1:125, or 1:62.5 and allowed to invade the HeIa cells for 2 hours at 370C in 5% CO2. The cells were washed 4 times with MEM containing 10% FBS and penicillin- streptomycin (100 IU of penicillin and 100 μg of streptomycin per ml). Cells were incubated in fresh complete medium for further 48 hours at 370C in 5% CO2 and total RNA was then isolated by the Qiagen RNeasy system with on-column DNAse digestion or by TRIZOL extraction method. siRNA Transfection: One day before the transfection, cells were plated in complete growth medium without antibiotics so that the cells will be 30-50% confluent at the time of transfection. Diluted various concentrations of siRNA from a stock of 20μM in 175 μl of Opti-MEM. Mixed 4 μl of Oligofectamine separately in 15 μl of Opti-MEM. Mixed gently and incubated for 5-10 min at room temperature. Combined the diluted siRNA with diluted oligofectamine and incubated for 15-20 min at room temperature. While the complexes were being formed, removed the growth medium from the cells and added 800 μl of medium without serum to each well containing cells. Added the 200 μl of siRNA/oligofectamine complexes to the cells and incubated at 370C for 4h. Added ImI of growth medium containing 3X the normal concentration of serum without removing the transfection mixture. Gene silencing was assayed at 48 h.
RT-PCR: Quantitative real-time reverse transcription PCR (RT-PCR) was performed with the TaqMan RT-PCR master Mix Reagents Kit (Applied Biosystems) using the following primers and a probe set for detection of HPV18E6E7 transcripts:
Forward Primer: S'-CTGATCTGTGCACGGAACTGA-S' (148-168) (SEQ ID NO:381) Reverse Primer: 5'-TGTCTAAGTTTTTCTGCTGGATTCA-3'(439-463) (SEQ ID NO:382)
Probe: 5'-TTGGAACTTACAGAGGTGCCTGCGCO' (219-233 and 416-425) (SEQ ID NO:383) The probe was labeled at the 5' end with a reporter fluorescent dye, FAM and at the 3' end with fluorescent dye quencher TAMRA. GAPDH was used to detect human GAPDH transcripts for the normalization. HPVsHRNA sequences:
Hl (working sequence)
5'- ggATCCTAGGTATTTGAATTTGCATTTCAAGAGAATGCAAATTCAAATACCTTTTgTCgAC (SEQ ID NO: 384) 5'- GTCGACAAAAGGTATTTGAATTTGCATTCTCTTGAAATGCAAATTCAAATACCTAGGATCC (SEQ ID NO: 385)
H2 (ineffective sequence) 5'-ggATCCTCAGAAAAACTTAGACACCTTCAAGAGAGGTGTCTAAGTTTTTCTGTTTgTCgAC (SEQ ID NO: 386) 5'- GTCGACAAACAGAAAAACTTAGACACCTCTCTTGAAGGTGTCTAAGTTTTTCTGAGGATCC (SEQ ID NO: 387)
Western Blot: HeIa cells were lysed using IX Cell lysis Buffer (Cell Signaling Technology, Cat No. 9803). For electrophoresis, 50 μg of total protein in 2X loading buffer was loaded to each well of a 12% SDS-PAGE gel. After transferring the blot was blocked and probed with primary antibody at 2h followed by incubation with HRP-conjugated secondary antibody before detection by ECL. All primary antibodies were used at 1/1000 dilution except HPV18E7 antibody at 1/250. Anti-Human pRb antibody: BD Pharmingen (Cat No. 554136), Sec Ab: HRP-anti Mouse HPV18E7: Santa Cruz (Cat No. sc-1590), Sec Ab:donkey anti-goat IgG-HRP Cat no. sc 2020 p53: Santa Cruz (Cat No. sc-126), Sec Ab: HRP-anti Mouse p21 : Santa Cruz (Cat No. sc-397), Sec Ab: HRP-anti Rabbit c-Myc: Cell Signaling Technology (Cat No. 9402), Sec Ab: HRP-anti Rabbit
Colony Formation Assay: HeIa cells were harvested after bacterial invasion for 2h. The cells in either control treated or HPV shRNA treated cells were washed 3x times with complete MEM and one time with PBS. The cells were then trypsinized and counted. 500 cells from each treatment were added to a single well of a six well plate containing 2 ml of complete growth medium. The cells were allowed to grow for 10 days following which the colonies were fixed with GEIMSA stain.
MTT Assay: HeIa cells were harvested after bacterial invasion for 2h. The cells in either control treated or HPV shRNA treated cells were washed 3x times with complete MEM and one time with PBS. The cells were then trypsinized and counted. 5000 cells from each treatment were added to a single well of a 96 well plate in 100 μl of complete growth medium in triplicates. The cells were incubated at 370C for 48-72h following which 10 μl of 0.5 mg/ml MTT was added to each well. The plate was further incubated at 370C for 3h, the medium was aspirated off from the wells and after
incubation, 100 μl of MTT solubilization solution [10% Triton X-100 in acidic isoproponal (0.1 N HCl)] was added to each well to stop the reaction. The absorbance was read at 570 nm on the plate reader. Results hi this example, the suppressive effect of a short hairpin RNA directed towards HPV 18 E6 and E7 oncogenes was investigated. The short hairpin RNA was delivered by infecting human cervical cancer cells (HeIa) with bacterial strains that produce the short hairpin RNA. The shRNA expression cassette contained 19 nucleotide (nt) of the target sequence followed by the loop sequence (TTCAAGAGA) (SEQ ID NO:388) and the reverse complement to the 19nt. For the 19 nt, two shRNA sequences published in Cancer Gene Therapy (2006) 13, 1023-1032, were used to measure siRNA delivery and gene silencing efficiency, oligofectamine reagent in a 6 well format was used. Briefly, HeIa cells were plated at a cell density of about 40% confluence in antibiotic free medium. On the next day, siRNA was added to 6 well plates at varying concentrations of 50, 100, 200 nM. The control siRNA was added at a single concentration of 100 nM. As shown in Figure 7, the oligofectamine transfection method resulted in a decrease in E6 mRNA in HeIa cells with respect to the control siRNA. The siRNA (Hl) showed up to about 40% of reduction in E6 mRNA. The knockdown response was not dose dependent.
Next, the hairpin of the siRNA (Hl) was cloned into the TRIP vector, hi order to determine if gene silencing could be achieved through the transkingdom system, the shRNA in human cervical cancer cells (HeIa) was tested in an invasion assay. Briefly, HeIa cells were plated in a six-well plate at 2x10s cells/well, allowed to grow overnight and incubated the next day for 2h at different MOIs with bacteria (E.colϊ) engineered to produce the hairpin RNA. The bacteria were washed off with medium containing 10% FBS and Pen Strep four times and the mammalian cells were further incubated for an additional 48h in the complete medium. RNA or protein was isolated from the bacteria.
Figure 8 and Figure 9 demonstrate that siRNA downregulates HPV E6 expression in HeIa cells. Cells were plated in six well plates and allowed to grow to a confluence of 40% (about 40,000 cells). Oligofectamine/siRNA transfection complexes were prepared in Opti-MEM serum-free medium by mixing 4 μl of oligofectamine with siRNAs (final concentration in 185 μl of medium is 50, 100, 200 nM). 48 hours post-transfection cells were harvested and analyzed by real-time RT-PCR for both target and GAPDH mRNA levels. Data were normalized against the GAPDH signal. Two different negative control siRNAs were used at a single concentration of 200 nM.
Figure 10, Panels A - C show real time PCR results following invasion assay of HeIa cells. HeIa cells were incubated for 2h with shRNA-expressing BL21(DE3) at different multiplicities of infection (MOI). Forty-eight hours post-infection the cells were harvested and analyzed by real-time RT-PCR for both target and GAPDH mRNA levels. Data were normalized against the GAPDH signal. These data were then further normalized to untreated control cells.
Figure 11 shows the effects of downregulation of HPV E6 and E7 genes on tumor suppressor pathways and other downstream targets. HeIa cells were incubated for 2h with shRNA-expressing BL21(DE3) at different multiplicities of infection (MOI). Forty-eight hours post-infection cells were harvested and analyzed by western blotting. 50 μg of protein was loaded in each lane and resolved by gel electrophoresis, transferred to a membrane and probed with antibodies specific for HPV 18 E7, p53, actin, pi 10Rb, p21 and c-myc as indicated.
Figures 12 and 13 show a colony formation and MTT assay, respectively. HeIa cells were incubated for 2h with shRNA-expressing BL21(DE3) at different multiplicities of infection (MOI). 2h post-infection cells were washed trypsinized and counted and an equal number of cells for each MOI was added to a well of a six well plate (For CFA: added 500 cells to each well of a 6 well plate, for MTT added 5000 cells in each well of a 96 well plate). For colony formation, the cells were allowed to grow for 10 days and stained with Geimsa, MTT assay was analyzed at 72h post plating.
Figures 14 and 15 show real time PCR results following invasion assay of HeIa cells. HeIa cells were incubated for 2h with shRNA-expressing BL21(DE3) at different multiplicities of infection (MOI). Forty-eight hours post-infection cells were harvested and analyzed by real-time RT-PCR for both target and GAPDH mRNA levels. Data were normalized against the GAPDH signal. These data were then further normalized to untreated control cells.
Figure 16 shows the effects of downregulation of HPV E6 and E7 genes on tumor suppressor pathways and other downstream targets. HeIa cells were incubated for 2h with shRNA-expressing BL21 (DE3) at different multiplicities of infection (MOI). Forty-eight hours post-infection cells were harvested and analyzed by western blotting. 50 μg of protein was loaded in each lane and resolved by gel electrophoresis, transferred to a membrane and probed with antibodies specific for HPV 18 E7, p53, actin, pi 10Rb as indicated.
Figure 17 shows real time PCR results following invasion assay of HeIa cells with a frozen aliquot of negative sHRNA control and HPV sHRNA in BL21 (DE3). HeIa cells were incubated for 2h with shRNA-expressing BL21(DE3) at different multiplicities of infection (MOI). Forty-eight hours post-infection cells were harvested and analyzed by real-time RT-PCR for both target and GAPDH mRNA levels. Data were normalized against the GAPDH signal. These data were then further normalized to untreated control cells. Figure 18 shows the plating efficiency of frozen aliquots of negative sHRNA control and
HPV sHRNA in BL21 (DE3). The frozen bacteria were thawed and resuspended to a final concentration of 3.38X108 cells/ml. Invasion assay was performed with this concentration taking 2 mis of 3.38X108 cells/ml as an MOI of 1000. Some stock control bacteria or HPV bacteria were serially diluted (1:100) and plated on LB plates to assess for the number and viability of bacteria treated cells at 48h. Gene silencing was analyzed either by quantitative real-time PCR using the ΔΔCt relative quantitation method or by western blot analysis. HPVE6 mRNA levels were normalized to an endogenous control, GAPDH. The final data were further normalized to the RNA from the untreated
cells. For Protein analysis, cell lysates were prepared in Cell Lysis Buffer (Cell Signaling Technology) and the protein concentration was determined using a BCA kit from BioRad. For electrophoresis, the protein expression was normalized to Actin loading control.
Example 8: Knockdown of HPV £6 gene assessed by western blotting with HPV 18 £7 antibody:
HeIa cells were incubated for 2h with shRNA-expressing BL21(DE3) (HPVHl construct below) at different multiplicities of infection (MOI). Forty-eight hours post-infection cells were harvested and analyzed by western blotting. The HPV E6 specific knockdown was compared with a negative shRNA control. Briefly, 50 μg of protein was loaded in each lane and resolved by gel electrophoresis, transferred to a membrane and probed with antibodies specific for HPV 18 E7, and actin as indicated. HPVHl
5'-GATCC TAGGTATTTGAATTTGCAT TTCAAGAGA ATGCAAATTCAAATACCTTTT O-3' (SEQ ID NO: 389) 3'-G ATCCATAAACTTAAACGTA AAGTTCTCT TACGTTTAAGTTTATGGAAAA CAGCT-5' (SEQ ID NO:390)
Figure 19 shows the knockdown of HPV E6 gene assessed by western blotting with HPV 18 E7 antibody. HeIa cells were incubated for 2h with shRNA-expressing BL21(DE3) at different multiplicities of infection (MOI). Forty-eight hours post-infection cells were harvested and analyzed by western blotting. The HPV E6 specific knockdown was compared with a negative sHRNA control. Briefly, 50 μg of protein was loaded in each lane and resolved by gel electrophoresis, transferred to a membrane and probed with antibodies specific for HPV 18 E7 and actin as indicated.
Example 9: Inhibition of CCL20 Expression in CMT93 Cells One confluent T-175 flask of CMT93 cells was trypsinized in lOmls until the cells detached.
Trypsin was inactivated by addition of 30mls of DMEM (10% FCS, pen/strep) and the cells thoroughly mixed by pipetting. From this solution, 8mls was transferred into a sterile 50ml tube and 32mLs of DMEM 10% added. Cells were well mixed and 25OuLs added to each well of a 48 well plate and incubated overnight at 37C resulting in adherent cells that were approximately 70% confluent the following morning. The next day, siRNA transfection complexes were created by the following method.
Sequences were ordered from Qiagen as pre-annealed siRNA duplexes. Each well was resuspended in 250ul of siRNA buffer (from Qiagen) to give a stock concentration of 2OuM. The plate was then placed in a water bath at 95C for 5 minutes and then allowed to slowly cool to resuspend the duplexes and break apart aggregates. The suspended duplexes were then used in transfection experiments described in standard protocols. The formulation is per well of a 48 well plate containing 25OuL of media; each screen was performed in biological triplicate so the solution was made for 4 wells; 3 for transfection and 1 extra.
0.3uL of the appropriate siRNA (from a 2OuM stock solution) were diluted to 47uL with serum/antibiotic free media and mixed. To this solution was added 3uL of HiPerfect transfection reagent (Qiagen) followed by brief vortexing and incubation at room temperature for 20 minutes. 5OuLs of the complex containing mixture was added to each of 3 wells in a 48 well plate containing CMT93 cells. Transfection was for 24 hours at 37C at which time the media was removed and replaced with 40OuLs of DMEM/10% FCS containing lOOng/mL of LPS for 2 hours. Following stimulation, the cells were washed and RNA isolated for qRT-PCR according the Qiagen Quantitech method (see manufacturer's protocol) for 50 cycles.
Figure 20 shows the knockdown of CCL20 expression with the various siRNA sequences in CMT93 cells. The siRNA sequences tested are listed below:
SEQ ID SEQ ID
Well siRNA sense 5'->3' NO: siRNA antisense 5'->3' NO :
G1 GCUUGUGACAUUAAUGCUAtt 391 UAGCAUUAAUGUCACAAGCtt 392
H1 AUAAGCUAUUGUAAAGAUAtt 393 UAUCUUUACAAUAGCUUAUtg 394
G2 CAUCUUUCACACGAAGAAAtt 395 UUUCUUCGUGUGAAAGAUGat 396
H2 CUAUUGUAAAGAUAUUUAAtt 397 UUAAAUAUCUUUACAAUAGct 398
G3 GCCUAAGAGUCAAGAAGAUtt 399 AUCUUCUUGACUCUUAGGCtg 4°°
G4 CAGUGGACUUGUCAAUGGAtt 401 UCCAUUGACAAGUCCACUGgg 4°2
G5 GAAGUUGAUUCAUAUUGCAtt 403 UGCAAUAUGAAUCAACUUCat 4°4
G6 GUUGAUUCAUAUUGCAUCAtt 405 UGAUGCAAUAUGAAUCAAC11 4°6
G7 ACAUUAGAGUUAAGUUGUAtt 407 UACAACUUAACUCUAAUGUga 4°8
G8 CAUUAGAGUUAAGUUGUAUtt 409 AUACAACUUAACUCUAAUGtg 41°
G9 UGUUAUUUAUAGAUCUGAAtt 411 UUCAGAUCUAUAAAUAACAta i12
G10 GUUUAGCUAUUUAAUGUUAtt 413 UAACAUUAAAUAGCUAAACat 4 λ4
G11 AGUGGAAGGAUUAAUAUUAtt 415 UAAUAUUAAUCCUUCCACUaa 4 X6
F12 CCAGCACUGAGUACAUCAAtt 417 UUGAUGUACUCAGUGCUGGgt 4 x8
G12 UGUUUAAGGGAAUAGUUUAtt 419 UAAACUAUUCCCUUAAACAta 42°
Example 10: Inhibition of Expression of Claudin-2 in CMT93 cells One confluent T- 175 flask of CMT93 cells was trypsinized in lOmls until the cells detached.
Trypsin was inactivated by addition of 30mls of DMEM (10% FCS, pen/strep) and the cells thoroughly mixed by pipetting. From this solution, 8mls was transferred into a sterile 50ml tube and 32mLs of DMEM 10% added. Cells were well mixed and 25OuL added to each well of a 48 well plate and incubated overnight at 37C resulting in adherent cells that were approximately 70% confluent the following morning. The next day, siRNA transfection complexes were created by the following method:
Sequences were ordered from Qiagen as pre-annealed siRNA duplexes. Each well was resuspended in 250ul of siRNA buffer (from Qiagen) to give a stock concentration of 2OuM. The plate was then placed in a water bath at 95C for 5 minutes and then allowed to slowly cool to resuspend the duplexes and break apart aggregates. The suspended duplexes were then used in
transfection experiments described in standard protocols. The formulation is per well of a 48 well plate containing 25OuL of media; each screen was performed in biological triplicate so the solution was made for 4 wells; 3 for transfection and 1 extra.
0.3uL of the appropriate siRNA (from a 2OuM stock solution) to 47uL of serum/antibiotic free media and mixed. To this solution was added 3uL of HiPerfect transfection reagent (Qiagen) followed by brief vortexing and incubation at room temperature for 20 minutes. 5OuLs of the complex containing mixture was added to each of 3 wells in a 48 well plate containing CMT93 cells. Transfection was for 24 or 48 hours at 37C at which time the cells were washed and RNA isolated for qRT-PCR according the Qiagen Quantitech method (see manufacturer's protocol) for 50 cycles.
Figure 21 shows the knockdown of Claudin-2 expression with the various siRNA sequences in CMT93 cells post 24hr transfection. The siRNA sequences tested are listed below:
SEQID siRNA antisense 5'->3' SEQ ID
Well siRNA sense 5'-»3' NO: NO:
D4 GCUGGGACUAUAUAUAUAAtt 421 UUAUAUAUAUAGUCCCAGCca 422
D5 GGGCAAUUGCUAUAUCUUAtt 423 UAAGAUAUAGCAAUUGCCCtC 424
D6 GCAGCCAAACGACAAGCAAtt 425 UUGCUUGUCGUUUGGCUGCtg 426
D7 AGGGUUUCCUUAAGGACAAtt 427 UUGUCCUUAAGGAAACCCUtg 428
C9 GAAAUGGAUUAGUCAGUAAtt 429 UUACUGACUAAUCCAUUUCtt 43°
D11 GGCUCCGAAGAUACUUCUAtt 431 UAGAAGUAUCUUCGGAGCCtg 432
Example 11: Inhibition of Expression of ILό-Ra in CMT93 Cells
One confluent T-175 flask of CMT93 cells was trypsinized in lOmls until the cells detached. Trypsin was inactivated by addition of 30mls of DMEM (10% FCS, pen/strep) and the cells thoroughly mixed by pipetting. From this solution, 8mls was transferred into a sterile 50ml tube and 32mLs of DMEM 10% added. Cells were well mixed and 25OuLs added to each well of a 48 well plate and incubated overnight at 37C resulting in adherent cells that were approximately 70% confluent the following morning. The next day, siRNA transfection complexes were created by the following method:
Sequences were ordered from Qiagen as pre-annealed siRNA duplexes. Each well was resuspended in 250ul of siRNA buffer (from Qiagen) to give a stock concentration of 2OuM. The plate was then placed in a water bath at 95C for 5 minutes and then allowed to slowly cool to resuspend the duplexes and break apart aggregates. The suspended duplexes were then used in transfection experiments described in standard protocols. The formulation is per well of a 48 well plate containing 25OuL of media; each screen was performed in biological triplicate so the solution was made for 4 wells; 3 for transfection and 1 extra.
0.3uL of the appropriate siRNA (from a 2OuM stock solution) to 47uL of serum/antibiotic free media and mixed. To this solution was added 3uL of HiPerfect transfection reagent (Qiagen)
followed by brief vortexing and incubation at room temperature for 20 minutes. 5OuLs of the complex containing mixture was added to each of 3 wells in a 48 well plate containing CMT93 cells. Transfection was for 24, 48 or 72 hours at 37C at which time the cells were washed and RNA isolated for qRT-PCR according the Qiagen Quantitech method (see manufacturer's protocol) for 40 cycles.
Figure 22 shows the knockdown of IL6-RA expression with the various siRNA sequences in CMT93 cells post 24hr transfection. The siRNA sequences tested are listed below:
SEQID SEQ ID
Well siRNA sense 5'->3' NO: siRNA antisense 5'->3' NO:
E1 CCUGGAGGGUGACAAAGUAtt 433 UACUUUGUCACCCUCCAGGat 434
F1 GGUCUGACAAUACCGUAAAtt 435 UUUACGGUAUUGUCAGACCca 436
F2 GCUGUUUCCUAUAACAGAAtt 437 UUCUGUUAUAGGAAACAGCgg 438
F3 GCUGUGAAAGGGAAAUUUAtt 439 UAAAUUUCCCUUUCACAGCag 440
E4 CCUUGUGGUAUCAGCCAUAtt 441 UAUGGCUGAUACCACAAGGtt 442
E5 GCUUCGAUACCGACCUGUAtt 443 UACAGGUCGGUAUCGAAGCtg 444
E6 CGGCAGGAAUCCUCUGGAAtt 445 UUCCAGAGGAUUCCUGCCGgg 446
E7 CCACGAGGAUCAGUACGAAtt 447 UUCGUACUGAUCCUCGUGGtt 448
E8 CACGAGGAUCAGUACGAAAtt 449 UUUCGUACUGAUCCUCGUGgt 450
E9 GAUCAGUACGAAAGUUCUAtt 451 UAGAACUUUCGUACUGAUCct 452
E10 GUACGAAAGUUCUACAGAAtt 453 UUCUGUAGAACUUUCGUACtg 454
E11 GAAAGUUCUACAGAAGCAAtt 455 UUGCUUCUGUAGAACUUUCgt 456
E12 GGGUCUGACAAUACCGUAAtt 457 UUACGGUAUUGUCAGACCCag 458
Example 12: Inhibition of Expression of IL13-Ral in CMT93 Cells
One confluent T- 175 flask of CMT93 cells was trypsinized in lOmls until the cells detached. Trypsin was inactivated by addition of 30mls of DMEM (10% FCS, pen/strep) and the cells thoroughly mixed by pipetting. From this solution, 8mls was transferred into a sterile 50ml tube and 32mLs of DMEM 10% added. Cells were well mixed and 25OuLs added to each well of a 48 well plate and incubated overnight at 37C resulting in adherent cells that were approximately 70% confluent the following morning. The next day, siRNA transfection complexes were created by the following method:
Sequences were ordered from Qiagen as pre-annealed siRNA duplexes. Each well was resuspended in 250ul of siRNA buffer (from Qiagen) to give a stock concentration of 2OuM. The plate was then placed in a water bath at 95C for 5 minutes and then allowed to slowly cool to resuspend the duplexes and break apart aggregates. The suspended duplexes were then used in transfection experiments described in standard protocols. The formulation is per well of a 48 well plate containing 25OuL of media; each screen was performed in biological triplicate so the solution was made for 4 wells; 3 for transfection and 1 extra. 0.3uL of the appropriate siRNA (from a 2OuM stock solution) to 47uL of serum/antibiotic free media and mixed. To this solution was added 3uL of HiPerfect transfection reagent (Qiagen)
followed by brief vortexing and incubation at room temperature for 20 minutes. 5OuLs of the complex containing mixture was added to each of 3 wells in a 48 well plate containing CMT93 cells. Transfection was for 24 or 72 hours at 37C at which time the cells were washed and RNA isolated for qRT-PCR according the Qiagen Quantitech method (see manufacturer's protocol) for 40 cycles.
Figure 23 shows the knockdown of IL13-RA1 expression with the various siRNA sequences in CMT93 cells post 24hr transfection. The siRNA sequences tested are listed below:
SEQID SEQ ID
Well siRNA sense 5'->3' NO: siRNA antisense 5'-»3' NO:
F1 AGAAGACUCUAAUGAUGUAtt 459 UACAUCAUUAGAGUCUUCUtg 46°
F2 CAGUCAGAGUAAGAGUCAAtt 461 UUGACUCUUACUCUGACUGtg 462
F8 CAGAACAUCUAGCAAACAAtt 463 UUGUUUGCUAGAUGUUCUGtg 464
F9 CUUGUAGGUUCACAUAUUAtt 465 UAAUAUGUGAACCUACAAGtt 466
F10 CAGUGUAGUGCCAAUGAAAtt 467 UUUCAUUGGCACUACACUGag 468
F11 GUAUGACAUCUAUGAGAAAtt 469 UUUCUCAUAGAUGUCAUACtt 470
Example 13: Inhibition of Expression of IL-18 in CMT93 Cells
One confluent T-175 flask of CMT93 cells was trypsinized in lOmls until the cells detached. Trypsin was inactivated by addition of 3OmIs of DMEM (10% FCS, pen/strep) and the cells thoroughly mixed by pipetting. From this solution, 8mls was transferred into a sterile 50ml tube and 32mLs of DMEM 10% added. Cells were well mixed and 25OuLs added to each well of a 48 well plate and incubated overnight at 37C resulting in adherent cells that were approximately 70% confluent the following morning. The next day, siRNA transfection complexes were created by the following method:
Sequences were ordered from Qiagen as pre-annealed siRNA duplexes. Each well was resuspended in 250ul of siRNA buffer (from Qiagen) to give a stock concentration of 2OuM. The plate was then placed in a water bath at 95C for 5 minutes and then allowed to slowly cool to resuspend the duplexes and break apart aggregates. The suspended duplexes were then used in transfection experiments described in standard protocols. The formulation is per well of a 48 well plate containing 25OuL of media; each screen was performed in biological triplicate so the solution was made for 4 wells; 3 for transfection and 1 extra.
0.3uL of the appropriate siRNA (from a 2OuM stock solution) to 47uL of serum/antibiotic free media and mixed. To this solution was added 3uL of Lipofectamine RNAiMAX transfection reagent (Invitrogen) followed by brief vortexing and incubation at room temperature for 20 minutes. 5OuLs of the complex containing mixture was added to each of 3 wells in a 48 well plate containing CMT93 cells. Transfection was for 24 hours at 37C at which time the cells were washed and RNA isolated for qRT-PCR according the Qiagen Quantitech method (see manufacturer's protocol) for 40 cycles.
Figure 24 shows the knockdown of ILl 8 expression with the various siRNA sequences in CMT93 cells post 24hr transfection. The siRNA sequences tested are listed below:
SEQID SEQID
Well siRNA sense 5'->3' NO: siRNA antisense 5'->3' NO:
B2 AGGAAAUGAUGUUUAUUGAtt 471 UCAAUAAACAUCAUUUCCUtg 472
B3 GGCCGACUUCACUGUACAAtt 473 UUGUACAGUGAAGUCGGCCaa 474
B4 GAUGGAGUUUGAAUCUUCAtt 475 UGAAGAUUCAAACUCCAUCtt 476
B5 CAACCGCAGUAAUACGGAAtt 477 UUCCGUAUUACUGCGGUUGta 478
B6 CGAGGCUGCAUGAUUUAUAtt 479 UAUAAAUCAUGCAGCCUCGgg 480
B7 CCUGUAUUUCCAUAACAGAtt 481 UCUGUUAUGGAAAUACAGGcg 482
B8 CAUGUACAAAGACAGUGAAtt 483 UUCACUGUCUUUGUACAUGta 484
B9 CGAGGAUAUGACUGAUAUUtt 485 AAUAUCAGUCAUAUCCUCGaa 486
B10 GGAUAUGACUGAUAUUGAUtt 487 AUCAAUAUCAGUCAUAUCCtc 488
B11 CUAACUUACAUCAAAGUUAtt 489 UAACUUUGAUGUAAGUUAGtg 490
B12 CUCACUAACUUACAUCAAAtt 491 UUUGAUGUAAGUUAGUGAGag 492
Example 14: Inhibition of Expression of IL-7 in CMT93 Cells
One confluent T-175 flask of CMT93 cells was trypsinized in lOmls until the cells detached. Trypsin was inactivated by addition of 30mls of DMEM (10% FCS, pen/strep) and the cells thoroughly mixed by pipetting. From this solution, 8mls was transferred into a sterile 50ml tube and 32mLs of DMEM 10% added. Cells were well mixed and 25OuLs added to each well of a 48 well plate and incubated overnight at 37C resulting in adherent cells that were approximately 70% confluent the following morning. The next day, siRNA transfection complexes were created by the following method:
Sequences were ordered from Qiagen as pre-annealed siRNA duplexes. Each well was resuspended in 250ul of siRNA buffer (from Qiagen) to give a stock concentration of 2OuM. The plate was then placed in a water bath at 95C for 5 minutes and then allowed to slowly cool to resuspend the duplexes and break apart aggregates. The suspended duplexes were then used in transfection experiments described in standard protocols. The formulation is per well of a 48 well plate containing 25OuL of media; each screen was performed in biological triplicate so the solution was made for 4 wells; 3 for transfection and 1 extra. 0.3uL of the appropriate siRNA (from a 2OuM stock solution) to 47uL of serum/antibiotic free media and mixed. To this solution was added 3uL of Lipofectamine RNAiMAX transfection reagent (Invitrogen) followed by brief vortexing and incubation at room temperature for 20 minutes. 5OuLs of the complex containing mixture was added to each of 3 wells in a 48 well plate containing CMT93 cells. Transfection was for 24 hours at 37C at which time the cells were washed and RNA isolated for qRT-PCR according the Qiagen Quantitech method (see manufacturer's protocol) for 40 cycles.
Figure 25 shows the knockdown of IL-7 expression with the various siRNA sequences in CMT93 cells post 24hr transfection. The siRNA sequences tested are listed below:
SEQID SEQ ID
Well siRNA sense 5'-» 3' NO: siRNA antisense 5'->3' NO:
A1 GAUCCUACGGAAGUUAUGGtt 493 CCAUAACUUCCGUAGGAUCcg 494
B1 CCAUGUUCCAUGUUUCUUUtt 495 AAAGAAACAUGGAACAUGGtc 496
A2 CCUCCCGCAGACCAUGUUCtt 497 GAACAUGGUCUGCGGGAGGcg 498
A3 CUCCCGCAGACCAUGUUCCtt 499 GGAACAUGGUCUGCGGGAGgc 5°°
A4 UCCCGCAGACCAUGUUCCAtt 501 UGGAACAUGGUCUGCGGGAgg 502
A5 CCCGCAGACCAUGUUCCAUtt 503 AUGGAACAUGGUCUGCGGGag 5°4
A6 CCGCAGACCAUGUUCCAUGtt 505 CAUGGAACAUGGUCUGCGGga 506
A7 CGCAGACCAUGUUCCAUGUtt 507 ACAUGGAACAUGGUCUGCGgg 508
A10 AGACCAUGUUCCAUGUUUCtt 509 GAAACAUGGAACAUGGUCUgc 510
A12 ACCAUGUUCCAUGUUUCUUtt 511 AAGAAACAUGGAACAUGGUct 5l2
Example 15: Inhibition of Expression of Chitinase3-like-l (CH13L1) Expression in CMT93 Cells
In a 1.7ml microcentrifuge tube, 2.4 μl of 20 μM double-stranded RNA solution (from Qiagen) was diluted into 394 μl Opti-MEM serum-free medium (Invitrogen) containing 1 μl Lipofectamine RNAiMAX (Invitrogen), mixed, and incubated 10 min at room temperature to enable the formation of transfection complexes. 100 μl of this mixture was added to each of three wells of a 24-well tissue culture dish, on top of which CMT-93 cells were plated in a 500 μl volume, resulting in a final volume of 600 μl per well and a final RNA concentration of 20 nM. After 24 h transfection, 0.1 μg/ml lipopolysaccharide (LPS) (Sigma) was added to each well and cells were incubated for a further 24 h to stimulate CHI3L1 production, after which cells were washed in PBS and harvested for RNA extraction. CMT-93 cells were prepared for transfection as follows. 1 confluent T-175 flask of CMT93 cells was trypsinized in lOmls until the cells detached. Trypsin was inactivated by addition of 30mls of DMEM (10% FBS) and the cells thoroughly mixed by pipetting. From this solution, lOmls was transferred into a sterile 50ml tube and 4OmLs of DMEM 10% FBS added. Cells were well mixed and 500 μLs added to each well of a 24-well plate. This concentration of cells resulted in approximately 70% confluency after 24 h of growth. Figure 26 shows the knockdown of CH13L1 expression with the various siRNA sequences in
CMT93 cells post 24hr transfection. The siRNA sequences tested are listed below:
SEQID SEQID
Well siRNA sense 5'->3' NO: siRNA antisense 5'-»3' NO:
G1 CCACAUCAUCUACAGCUUUtt 513 AAAGCUGUAGAUGAUGUGGgt 514
H1 GGUUUGACAGAUACAGCAAtt 515 UUGCUGUAUCUGUCAAACCta 516
G2 UCAUCUACAGCUUUGCCAAtt 517 UUGGCAAAGCUGUAGAUGAtg 518
H2 CCCUGUUAAGGAAUGCAAAtt 519 UUUGCAUUCCUUAACAGGGtt 520
H3 CAAGUAGGCAAAUAUCUUAtt 521 UAAGAUAUUUGCCUACUUGat 522
H4 CAGCUUUGUCAGCAGGAAAtt 523 UUUCCUGCUGACAAAGCUGcg 524
G5 GGUUCACCAAGGAGGCAGGtt 525 CCUGCCUCCUUGGUGAACCgg 526
H5 GGAUCAAGUAGGCAAAUAUtt 527 AUAUUUGCCUACUUGAUCCaa 528
H6 GAGGGACCAUACUAAUUAUtt 529 AUAAUUAGUAUGGUCCCUCaa 53°
G7 GGCCGGUUCACCAAGGAGGtt 531 CCUCCUUGGUGAACCGGCCtg 532
H7 GGACAAGGAGAGUGUCAAAtt 533 UUUGACACUCUCCUUGUCCtc 534
G8 CCGGUUCACCAAGGAGGCAtt 535 UGCCUCCUUGGUGAACCGGcc 536
H8 CGUACAAGCUGGUCUGCUAtt 537 UAGCAGACCAGCUUGUACGca 538
G9 GGAGUUUAAUCUCUUGCAAtt 539 UUGCAAGAGAUUAAACUCCtg 540
H9 CAAGGAACUGAAUGCGGAAtt 541 UUCCGCAUUCAGUUCCUUGat 542
G10 CCCUGAUCAAGGAACUGAAtt 543 UUCAGUUCCUUGAUCAGGGtg 544
H10 CUUGGAUCAAGUAGGCAAAtt 545 UUUGCCUACUUGAUCCAAGtg 546
G11 GGAUUGAGGGACCAUACUAtt 547 UAGUAUGGUCCCUCAAUCCtg 554488
G12 GCAAAUUCUCAGACUCUAAtt 549 UUAGAGUCUGAGAAUUUGCat 550
H12 CCUUCCCUUAGGAACUUAAtt 551 UUAAGUUCCUAAGGGAAGGat 552
Example 16: Construction of CEQ200
CEQ200 has the following genotype: glnV44(AS), LAM', rfbCl, endAl, spoTl, thi-1, hsdR17, (rk " mk +),creC510 ΔdapA. The MM294 has the following genotype: glnV44(AS), LAM", rfbCl, endAl, spoTl, thi-1, hsdR17, (rk "mk +),creC510. We purchased the plasmids from CGSC (see Datsenko et al, (2000) Proc. Natl. Acad. Sci. USA 97,6640-6645).
Derivation of CEQ200
Plasmid pKD46 cured by growing cells at 43 0C MM294 AdapAi.kan
Plasmid pCP20 cured and kan gene was deleted by induction of FLP recombinase treatment at 43 0C
CEQ200
Example 17: Construction of CEQ201
CEQ201 has the following genotype: CEQ200 \glnV44(AS), LAM, rfbCl, endAl, spoTl, thi- 1, hsdRl 7, (rkmk +),creC510 ΔdapA ΔrecA. The MM294 has the following genotype: glnV44(AS), LAM", rfbCl, endAl, spoTl, thi-1, hsdR17, (rk "mk +),creC510. We purchased the plasmids from CGSC (see Datsenko et al., (2000) Proc. Natl. Acad. Sci. USA 97,6640-6645).
Derivation of CEQ200
I Transformation with plasmid pKD46 MM294 (pKD46) Transformation with a AdapA::kan cassette
generated using PCR using pKD4 MM294 AdapA:;kan (pKD46)
Transformation with a ArecA::cat cassette generated using PCR using pKD3 MM294 bJapA::kan ArecA::cat (pKD46)
Plasmid pKD46 cured by growing cells at 43 0C MM294 AdapA::kanArecA::cat Transformed with plasmid pCP20
MM294 AdapA::kan ArecA::cat (pCP20)
PIa ;mid pCP20 cured and kan and cat gene was deleted by induction of FLP recombinase treatment at 43 0C
CEQ201
Example 18: Construction of BTPs (CEQ210) by deletion of minC and/or minD genes from MM294
MM294 (from CGSC) ^Transformation with plasmid pKD46 th a AdapA::kan cassette generated using PCR
MM294 AminCD::kan (pCP20)
Plasmid pCP20 cured and kan gene was deleted by induction of FLP recombinase treatment at 43 0C.
CEQ210
Example 19: Illustration of the pMBV40, pMBV43 and pMBV44 plasmids
The pMBV40, pMBV43 and pMBV44 plasmids may be used as final or intermediary plasmid in the tkRNA system and may be constructed as follows: pUC19 digested with restriction enzyme
/VMII. Resultant ~ 2.4 kb fragment was ligated with a ~ 200 bp DNA fragment generated by annealing 5 oligonucleotides with each other. The oligonucleotides have the following names and sequences:
OHTOPl : GACTTCATATACCCAAGCTTGGAAAATTTTTTTTAAAAAAGTCTTGACACTTTATGCTTCCGGCTCGTATAATGG ATCCAGGAGTAACAATACAAATGGA (SEQ ID NO: 553)
OHTOP2:TTCAAGAGATCCATTTGTATTGTTACTCCTTTTTTTTTTTGTCGACGATCCTTAGCGAAAGCTAAGGATTTTTTT TTTACTCGAGCGGATTACTACATAC (SEQ ID NO: 554) OHBOTl: GTATGTAGTAATCCGCTCGAGTAAAAAAAAAATCCTTAGCTTTCGCTAAGGATCGTCGACAAAAAAAAAA (SEQ ID NO:555)
0HB0T2: AGGAGTAACAATACAAATGGATCTCTTGAATCCATTTGTATTGTTACTCCTGGATCCATT (SEQ ID NO: 556)
0HB0T3 : ATACGAGCCGGAAGCATAAAGTGTCAAGACTTTTTTAAAAAAAATTTTCCAAGCTTGGGTATATGAAGTC (SEQ ID NO : 557)
I
Ligation mix was transformed in E. coli and Ampicillin resistant transformants were selected. Plasmid DNA from a transformant that had the expected DNA sequence of the insert and restriction map was named pMBV38.
I pMBV38 was digested with Ndel and blunt end ligated with a ~ 6 kb fragment generated by BamHI-Sall digestion of the plasmid pKSII-inv-hly
The predicted sequence of pKSII-inv-hly is as follows: CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAA TAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTT GGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGG CCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCT AAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGA AAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAA TGCGCCGCTACAGGGCGCGTCCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCC TCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTT CCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGAGCT CCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGCTGGGCCGTAAGATCGGCATTTAA TCGCGACAATCCTTTTAAAAAAACAGCGCCGCTCAATTAACCTGAGCGGCGTTGTTCTTCTGGACGTTTGCTA CTTATGGGGCGAGTCTAGGATTGCCGGACTCCCATTCGCGCCCCAAATAATCAGCTCATTAAACTGTTCTTAT TGCTATCTGTTATCTGGTTATATTGACAGCGCACAGAGCGGGAACGCCAAGTATGCAGGCCCTGGTTGCAGTG CGCCTGTGTCCATATTCATGGTTTCAAAATCCGTGCTGGTCTTTTTGACCCAATATTCACCAGATTGCCAATC AGAACTATACGCGGTCAAGCTCCCCCACTCGCCCCACAATGTCCCGTCAGGCGCACGCGTTCCGTTGGTTGCA CGTGAGGATTCAAGAACCGCAGACATATCTGAACCTTGGCATTGTCTGCTGGCCTCGAGACTGGATACCAGCG ATCTGCCGCCATCGTATATCCACCGATTTGGGTAGAACCGATAACTCACCGAATAACTTGGGAATTTTTTACT TTTCGCCGTCACAGCCACTTCGCTATAGGTTTGGTAGGTAATCGTCACCTGACCCTGATCGTTAACCGATACA TTGGGTGTGAATGACGACGACCACTCATACTGAGTATTATTAGCAACATCGTTATCCATCTGTAACTGGAATG TGGCGTTTTTAAAGATCGTTTTCGGGAACCCTTTATCCGTAGCGAAATTTTGCCCGTTAACCAGAATACCGGT CAGCGTAGGTACCGGGAATAGGGATATTTTTTTCTGCAATGTACTCAGTATCAGGGTATCAACCTGCGGCGTG
ATTGTGACATCACCGACACTATTCCCAACCACCGTCGCGGTATAGCTATCTGGCTGCTCGGTAATGGGGCTAA TACTCACCGGCACACCGTTTTGAGTAAAACTCAAGCCCTGCATCCCACTGATAAAATGGCCATTCTTATCGAC AGGGACAAAGGATAATGTGGAACTCATCGTGCCATCAGCCAAGATATCCGGTGTGGAGACGGTGAAACTGGAG CGGCCAGCATCTGGAATAGGATCTGCCGTGAAATTAACCGTCACACTCGGCACACTGAACGCAGCCCCATCCA CTTTCACCGTTACTGTTGCTACCCCCAACGTGGTACTGGTCAATGGTGCGCTATAAGTGCCGTCATTGTGATC CGTGATAACGCCCATATTGCCTAAGGTTGTGTCAAAAGCCACATTCGCGCCAGCCTGCGGGTCCCCATAGGTA TCCTTCAACTCCAACGTGATGGTTGAAGCCATTAGACCATCAGCGATGATAGATGTCGGTACCGCAGCCAGAG TGGATTTATCCGCCGCGATAGTACCCTTAACAAAGTGGGTATCAACACTTTGCCGTTGCCCCTCCACTTCTGC TGTGACTACCGTCACGCCATCTGTCGTATTGGTTAATGCAATGCGCGCGACGCCATTTGCATCTGTCTTTTCC
AATCAGCAACGGTGAACTCAACGGTGATTGCAGTTTTCCCATTAGCCGGTGCGCCATCACCAATGACGGCCGC CGTTAATGTCAACTGAGGCTGCTGAACGGTGACGCTCAATGTGAATGAGTTAGATCGGTTTCCTTGGTGATCA ACCGCGAGCGCACTAAGCGAATAAAAGTTGGCTGTCAGGTCGTCCGTTACCCGACTCACTTGTGCTGTGCGTT GGCATCACTCCAGACAATTTCCCTTACAGCAGATGCCCCTTGTACTTGTGCGTTCACCTGATAAACCTGACCC GGCAGGCCGGAGATAGTTGCTGGCGATAATGTCAGTTTAACCACCTGCTGTTTCTGATACTCCAACACGATAT TATTGTTACGATCGACAAGGTTATAGCGGCTCTCCGCCAGTAGACGTGTTCCTGCCACCGCTGAAGGGCTAAG TTGCGACTGAAAACTCTCGCCCAGGCGATAGTTCATTTGGAGGTTCCACTGTGTTTCATGCTTACTGCTTTTC GGTTGCGTTGCAGATTATCTTTACCAAATAAAGCAACACGCTCACCGGTGTATTGCTCATACATCAACTTCCC CCCCAGTTGTGGGAGTGCAGGTAAATAAGCATTCGCGCGCAAATCCCCCCCAGTGGCTGGGCGCTCTTTATAG TCGGAGAAATCACGCGACGAGTGCCATCCATTGAGGCGAAAATACCCATTGGCAGCCAACTGTAAATAATCGG
TTAGCGAAAAATTTTTGTCAAAATTCAGATTAACTTGAGCCGTACCGAATCGATTTAACCACTGTTTGATTTC
GTGCTTATCATCTTATTCACCGCTTCAGTCTCCTGCTCCTTATTGGCGCGATCTATTATTGCAGCATTTCTTT
CTGTATCCGATGCGGAAAAGGGATTGATTGAACTCTCCATTTCATTATTAGGATGGAGATTTTCAAATGCAGA TGAAGAGACAGAATAAGGCTGGACCTGTTGCGGTGCGTTAGCATCATATTTTTCTGAAGCCCCAGCCATGAAC
TAGACATTCCCGCATTCCTTATCAAGAGAAACTCACTGATTGGCTGGAAAACCATCATAATTTAAATGAAATA AAGCATACCTGTCATACGTCAAACTGCATGTGCGTTGGCTGTGCTCAACAACTTGAGTTATTTGAGGTATAAC TCTAATTTAGTAAAGACATTAAGAGGATAGCACTTTTTTAAAAAACCAGACTGGGCAGATTAAAAATATTCAA AATATATAATAAAACAGTCTATACCATACAGCGATAGAATTGATTTATTGTAACTAAGCAGGTGAGAATATCA AAAAAAACAAAAATACAAAATGAACTATTATCATATAAATAATATCAATTAGAATAAGCCCCCTTCATTTGAT GTTGTCAGTTGTCTGCTGCGGTTTTTATTTCTACTTTCAGTCTGAAGTGTTACTCCGCAATATCCGCATTAAT CCTGATGGTTGCCTTGATGACTGCAGGAATTCGATCCCTCCTTTGATTAGTATATTCCTATCTTAAAGTGACT TTTATGTTGAGGCATTAACATTTGTTAACGACGATAAAGGGACAGCAGGACTAGAATAAAGCTATAAAGCAAG CATATAATATTGCGTTTCATCTTTAGAAGCGAATTTCGCCAATATTATAATTATCAAAAGAGAGGGGTGGCAA ACGGTATTTGGCATTATTAGGTTAAAAAATGTAGAAGGAGAGTGAAACCCATGAAAAAAATAATGCTAGTTTT TATTACACTTATATTAGTTAGTCTACCAATTGCGCAACAAACTGAAGCAAAGGATGCATCTGCATTCAATAAA GAAAATTCAATTTCATCCATGGCACCACCAGCATCTCCGCCTGCAAGTCCTAAGACGCCAATCGAAAAGAAAC ACGCGGATGAAATCGATAAGTATATACAAGGATTGGATTACAATAAAAACAATGTATTAGTATACCACGGAGA TGCAGTGACAAATGTGCCGCCAAGAAAAGGTTACAAAGATGGAAATGAATATATTGTTGTGGAGAAAAAGAAG AAATCCATCAATCAAAATAATGCAGACATTCAAGTTGTGAATGCAATTTCGAGCCTAACCTATCCAGGTGCTC TCGTAAAAGCGAATTCGGAATTAGTAGAAAATCAACCAGATGTTCTCCCTGTAAAACGTGATTCATTAACACT CAGCATTGATTTGCCAGGTATGACTAATCAAGACAATAAAATCGTTGTAAAAAATGCCACTAAATCAAACGTT AACAACGCAGTAAATACATTAGTGGAAAGATGGAATGAAAAATATGCTCAAGCTTATCCAAATGTAAGTGCAA AAATTGATTATGATGACGAAATGGCTTACAGTGAATCACAATTAATTGCGAAATTTGGTACAGCATTTAAAGC TGTAAATAATAGCTTGAATGTAAACTTCGGCGCAATCAGTGAAGGGAAAATGCAAGAAGAAGTCATTAGTTTT AAACAAATTTACTATAACGTGAATGTTAATGAACCTACAAGACCTTCCAGATTTTTCGGCAAAGCTGTTACTA AAGAGCAGTTGCAAGCGCTTGGAGTGAATGCAGAAAATCCTCCTGCATATATCTCAAGTGTGGCGTATGGCCG TCAAGTTTATTTGAAATTATCAACTAATTCCCATAGTACTAAAGTAAAAGCTGCTTTTGATGCTGCCGTAAGC GGAAAATCTGTCTCAGGTGATGTAGAACTAACAAATATCATCAAAAATTCTTCCTTCAAAGCCGTAATTTACG GAGGTTCCGCAAAAGATGAAGTTCAAATCATCGACGGCAACCTCGGAGACTTACGCGATATTTTGAAAAAAGG CGCTACTTTTAATCGAGAAACACCAGGAGTTCCCATTGCTTATACAACAAACTTCCTAAAAGACAATGAATTA GCTGTTATTAAAAACAACTCAGAATATATTGAAACAACTTCAAAAGCTTATACAGATGGAAAAATTAACATCG ATCACTCTGGAGGATACGTTGCTCAATTCAACATTTCTTGGGATGAAGTAAATTATGATCCTGAAGGTAACGA AATTGTTCAACATAAAAACTGGAGCGAAAACAATAAAAGCAAGCTAGCTCATTTCACATCGTCCATCTATTTG CCAGGTAACGCGAGAAATATTAATGTTTACGCTAAAGAATGCACTGGTTTAGCTTGGGAATGGTGGAGAACGG
ATATAGTAATAAAGTAGATAATCCAATCGAATAATTGTAAAAGTAATAAAAAATTAAGAATAAAACCGCTTAA CACACACGAAAAAATAAGCTTGTTTTGCACTCTTCGTAAATTATTTTGTGAAGAATGTAGAAACAGGCTTATT TTTTAATTTTTTTAGAAGAATTAACAAATGTAAAAGAATATCTGACTGTTTATCCATATAATATAAGCATATC CCAAAGTTTAAGCCACCTATAGTTTCTACTGCAAAACGTATAATTTAGTTCCCACATATACTAAAAAACGTGT CCTTAACTCTCTCTGTCAGATTAGTTGTAGGTGGCTTAAACTTAGTTTTACGAATTAAAAAGGAGCGGTGAAA
TTCTGTCGGGGAAGAAAAACTTCAAAATAATACACAAGCCAAAAAGACCCCTGCTGATTTAAAAGCTTATCAA GCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGC
CACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGG
GAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCC CCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAG GCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCT TTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCG GAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGT ATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTAT CTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCT
AAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACT TGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAG TTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGAT ACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGA AGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGC CAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGC TTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGC ATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTG AGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGA ACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGAT CCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTG AGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTC TTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTT AGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCAC (SEQ ID NO: 558) i
Ligation mix was transformed in E. coli and Ampicillin resistant transformants were selected. Plasmid DNA from a transformant that had insertion of inv and hly genes was named pMBV40. I pMBV40 was digested with BspΑl and the resultant 7.4 kb
DNA fragment was ligated with a PCR fragment containing kan gene generated using plasmid pKD4 (purchased from
CGSC (see Datsenko et al., (2000) Proc. Natl. Acad. Sci. USA 97,6640-6645) as the template. i
Ligation mix was transformed in E. coli and Kanamycin resistant transformants were selected. They were screened restriction mapping. They two different orientation of kan gene. The plasmids having clockwise and anticlockwise orientation of open reading frame of kan gene were called pMBV43 and pMBV44, respectively
As shown in Figure 27, the pMBV40 (amp selected having H3 hairpin) or pMBV43 and pMBV44 (kan selected having H3 hairpin) plasmids, are followed by the respective sequences. pMBV40
TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAG
CGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATCGACGGTATCGATAAGCTTGATAAGCTTTTAAATCAGC
AGGGGTCTTTTTGGCTTGTGTATTATTTTGAAGTTTTTCTTCCCCGACAGAATCTGCTTTTACCGTCATAGTGAA ATGAGCCTGAAAAGCTATTACCATGATGATACAAATAAGTTTACTTTTCATTTCACCGCTCCTTTTTAATTCGTA
AAACTAAGTTTAAGCCACCTACAACTAATCTGACAGAGAGAGTTAAGGACACGTTTTTTAGTATATGTGGGAACT
CAGATATTCTTTTACATTTGTTAATTCTTCTAAAAAAATTAAAAAATAAGCCTGTTTCTACATTCTTCACAAAAT
AATTTACGAAGAGTGCAAAACAAGCTTATTTTTTCGTGTGTGTTAAGCGGTTTTATTCTTAATTTTTTATTACTT TTACAATTATTCGATTGGATTATCTACTTTATTACTATATTTCGGATAAAGCGTGGTGCCCCAGATGGAGATATT
ATTGTTTTCGCTCCAGTTTTTATGTTGAACAATTTCGTTACCTTCAGGATCATAATTTACTTCATCCCAAGAAAT
GTTGAATTGAGCAACGTATCCTCCAGAGTGATCGATGTTAATTTTTCCATCTGTATAAGCTTTTGAAGTTGTTTC AATATATTCTGAGTTGTTTTTAATAACAGCTAATTCATTGTCTTTTAGGAAGTTTGTTGTATAAGCAATGGGAAC
TTGAACTTCATCTTTTGCGGAACCTCCGTAAATTACGGCTTTGAAGGAAGAATTTTTGATGATATTTGTTAGTTC
AAGCGCTTGCAACTGCTCTTTAGTAACAGCTTTGCCGAAAAATCTGGAAGGTCTTGTAGGTTCATTAACATTCAC GTTATAGTAAATTTGTTTAAAACTAATGACTTCTTCTTGCATTTTCCCTTCACTGATTGCGCCGAAGTTTACATT CAAGCTATTATTTACAGCTTTAAATGCTGTACCAAATTTCGCAATTAATTGTGATTCACTGTAAGCCATTTCGTC ATCATAATCAATTTTTGCACTTACATTTGGATAAGCTTGAGCATATTTTTCATTCCATCTTTCCACTAATGTATT
TTTTACGAGAGCACCTGGATAGGTTAGGCTCGAAATTGCATTCACAACTTGAATGTCTGCATTATTTTGATTGAT GGATTTCTTCTTTTTCTCCACAACAATATATTCATTTCCATCTTTGTAACCTTTTCTTGGCGGCACATTTGTCAC TGCATCTCCGTGGTATACTAATACATTGTTTTTATTGTAATCCAATCCTTGTATATACTTATCGATTTCATCCGC TTTATTGAATGCAGATGCATCCTTTGCTTCAGTTTGTTGCGCAATTGGTAGACTAACTAATATAAGTGTAATAAA AACTAGCATTATTTTTTTCATGGGTTTCACTCTCCTTCTACATTTTTTAACCTAATAATGCCAAATACCGTTTGC
TTTTCCAGCCAATCAGTGAGTTTCTCTTGATAAGGAATGCGGGAATGTCTATGTATTTTAATAAAATAATTTCAT TTAATATTATTTCACGAATAGTTATTTGTATCTTTTTGATATGTGGAATGTTCATGGCTGGGGCTTCAGAAAAAT ATGATGCTAACGCACCGCAACAGGTCCAGCCTTATTCTGTCTCTTCATCTGCATTTGAAAATCTCCATCCTAATA
CTCAAGTTAATCTGAATTTTGACAAAAATTTTTCGCTAAAAGAAAGCTCTCTTGATTGGCTGGCTCCTTGGTATG
ACTCTGCTTCATTCCTCTTTTTTAGTCAGTTAGGTATTCGCAATAAAGACAGCCGCAACACACTTAACCTTGGCG
TCGGGATACGTACATTGGAGAACGGTTGGCTGTACGGACTTAATACTTTTTATGATAATGATTTGACCGGCCACA ACCACCGTATCGGTCTTGGTGCCGAGGCCTGGACCGATTATTTACAGTTGGCTGCCAATGGGTATTTTCGCCTCA
TTGGTAAAGATAATCTGCAACGCAACCCTTATGCCGTGACTGCCGGGATCAATTACACCCCCGTGCCTCTACTCA
CTGTCGGGGTAGATCAGCGTATGGGGAAAAGCAGTAAGCATGAAACACAGTGGAACCTCCAAATGAACTATCGCC TGGGCGAGAGTTTTCAGTCGCAACTTAGCCCTTCAGCGGTGGCAGGAACACGTCTACTGGCGGAGAGCCGCTATA
ATACCTATGGGGACCCGCAGGCTGGCGCGAATGTGGCTTTTGACACAACCTTAGGCAATATGGGCGTTATCACGG
AGAATGGCCATTTTATCAGTGGGATGCAGGGCTTGAGTTTTACTCAAAACGGTGTGCCGGTGAGTATTAGCCCCA
TTGGAAAATTTTTTTTAAAAAAGTCTTGACACTTTATGCTTCCGGCTCGTATAATGGATCCAGGAGTAACAATAC AAATGGATTCAAGAGATCCATTTGTATTGTTACTCCTTTTTTTTTTTGTCGACGATCCTTAGCGAAAGCTAAGGA
TGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGC
TGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCT TCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGC
AATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGG GGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAG
TCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGAT
TATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTG GTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGG ATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAA GGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTT TCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAAT GTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACA TATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCT AAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC (SEQ ID NO: 559)
pMBV43 TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAG
CGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATCGACGGTATCGATAAGCTTGATAAGCTTTTAAATCAGC AGGGGTCTTTTTGGCTTGTGTATTATTTTGAAGTTTTTCTTCCCCGACAGAATCTGCTTTTACCGTCATAGTGAA
ATGAGCCTGAAAAGCTATTACCATGATGATACAAATAAGTTTACTTTTCATTTCACCGCTCCTTTTTAATTCGTA
CAGATATTCTTTTACATTTGTTAATTCTTCTAAAAAAATTAAAAAATAAGCCTGTTTCTACATTCTTCACAAAAT AATTTACGAAGAGTGCAAAACAAGCTTATTTTTTCGTGTGTGTTAAGCGGTTTTATTCTTAATTTTTTATTACTT
TCTATTTTTCACAAGTGGTAAGTTCCGGTCATCAATTACCGTTCTCCACCATTCCCAAGCTAAACCAGTGCATTC TTTAGCGTAAACATTAATATTTCTCGCGTTACCTGGCAAATAGATGGACGATGTGAAATGAGCTAGCTTGCTTTT GTTGAATTGAGCAACGTATCCTCCAGAGTGATCGATGTTAATTTTTCCATCTGTATAAGCTTTTGAAGTTGTTTC AATATATTCTGAGTTGTTTTTAATAACAGCTAATTCATTGTCTTTTAGGAAGTTTGTTGTATAAGCAATGGGAAC
TTGAACTTCATCTTTTGCGGAACCTCCGTAAATTACGGCTTTGAAGGAAGAATTTTTGATGATATTTGTTAGTTC TACATCACCTGAGACAGATTTTCCGCTTACGGCAGCATCAAAAGCAGCTTTTACTTTAGTACTATGGGAATTAGT TGATAATTTCAAATAAACTTGACGGCCATACGCCACACTTGAGATATATGCAGGAGGATTTTCTGCATTCACTCC AAGCGCTTGCAACTGCTCTTTAGTAACAGCTTTGCCGAAAAATCTGGAAGGTCTTGTAGGTTCATTAACATTCAC GTTATAGTAAATTTGTTTAAAACTAATGACTTCTTCTTGCATTTTCCCTTCACTGATTGCGCCGAAGTTTACATT
ATCATAATCAATTTTTGCACTTACATTTGGATAAGCTTGAGCATATTTTTCATTCCATCTTTCCACTAATGTATT TACTGCGTTGTTAACGTTTGATTTAGTGGCATTTTTTACAACGATTTTATTGTCTTGATTAGTCATACCTGGCAA
TTTTACGAGAGCACCTGGATAGGTTAGGCTCGAAATTGCATTCACAACTTGAATGTCTGCATTATTTTGATTGAT
GGATTTCTTCTTTTTCTCCACAACAATATATTCATTTCCATCTTTGTAACCTTTTCTTGGCGGCACATTTGTCAC
TGCATCTCCGTGGTATACTAATACATTGTTTTTATTGTAATCCAATCCTTGTATATACTTATCGATTTCATCCGC GTGTTTCTTTTCGATTGGCGTCTTAGGACTTGCAGGCGGAGATGCTGGTGGTGCCATGGATGAAATTGAATTTTC
AACTAGCATTATTTTTTTCATGGGTTTCACTCTCCTTCTACATTTTTTAACCTAATAATGCCAAATACCGTTTGC CACCCCTCTCTTTTGATAATTATAATATTGGCGAAATTCGCTTCTAAAGATGAAACGCAATATTATATGCTTGCT TTATAGCTTTATTCTAGTCCTGCTGTCCCTTTATCGTCGTTAACAAATGTTAATGCCTCAACATAAAAGTCACTT
ACTATTGCATCTTTAATTAATGGTCAAGGTGATTTCAAATGCTCGTTTGTGGCCAGTTATACCTCAAATAACTCA AGTTGTTGAGCACAGCCAACGCACATGCAGTTTGACGTATGACAGGTATGCTTTATTTCATTTAAATTATGATGG TTTTCCAGCCAATCAGTGAGTTTCTCTTGATAAGGAATGCGGGAATGTCTATGTATTTTAATAAAATAATTTCAT
ATGAAATGGAGAGTTCAATCAATCCCTTTTCCGCATCGGATACAGAAAGAAATGCTGCAATAATAGATCGCGCCA ATAAGGAGCAGGAGACTGAAGCGGTGAATAAGATGATAAGCACCGGGGCCAGGTTAGCTGCATCAGGCAGGGCAT CTGATGTTGCTCACTCAATGGTGGGCGATGCGGTTAATCAAGAAATCAAACAGTGGTTAAATCGATTCGGTACGG CTCAAGTTAATCTGAATTTTGACAAAAATTTTTCGCTAAAAGAAAGCTCTCTTGATTGGCTGGCTCCTTGGTATG ACTCTGCTTCATTCCTCTTTTTTAGTCAGTTAGGTATTCGCAATAAAGACAGCCGCAACACACTTAACCTTGGCG
ACCACCGTATCGGTCTTGGTGCCGAGGCCTGGACCGATTATTTACAGTTGGCTGCCAATGGGTATTTTCGCCTCA ATGGATGGCACTCGTCGCGTGATTTCTCCGACTATAAAGAGCGCCCAGCCACTGGGGGGGATTTGCGCGCGAATG CTTATTTACCTGCACTCCCACAACTGGGGGGGAAGTTGATGTATGAGCAATACACCGGTGAGCGTGTTGCTTTAT CTGTCGGGGTAGATCAGCGTATGGGGAAAAGCAGTAAGCATGAAACACAGTGGAACCTCCAAATGAACTATCGCC
ACCTTGTCGATCGTAACAATAATATCGTGTTGGAGTATCAGAAACAGCAGGTGGTTAAACTGACATTATCGCCAG
CAACTATCTCCGGCCTGCCGGGTCAGGTTTATCAGGTGAACGCACAAGTACAAGGGGCATCTGCTGTAAGGGAAA
TTGTCTGGAGTGATGCCGAACTGATTGCCGCTGGCGGCACATTAACACCACTGAGTACCACACAATTCAACTTGG TTTTACCGCCTTATAAACGCACAGCACAAGTGAGTCGGGTAACGGACGACCTGACAGCCAACTTTTATTCGCTTA
GTTTCACCGTCTCCACACCGGATATCTTGGCTGATGGCACGATGAGTTCCACATTATCCTTTGTCCCTGTCGATA AGAATGGCCATTTTATCAGTGGGATGCAGGGCTTGAGTTTTACTCAAAACGGTGTGCCGGTGAGTATTAGCCCCA
CTGACGGGACATTGTGGGGCGAGTGGGGGAGCTTGACCGCGTATAGTTCTGATTGGCAATCTGGTGAATATTGGG
TTGGAAAATTTTTTTTAAAAAAGTCTTGACACTTTATGCTTCCGGCTCGTATAATGGATCCAGGAGTAACAATAC AAATGGATTCAAGAGATCCATTTGTATTGTTACTCCTTTTTTTTTTTGTCGACGATCCTTAGCGAAAGCTAAGGA
GTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAG
ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACG
CAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACC
CTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTT
CGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGC
CAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAG ATAGGCGTATCACGAGGCCCTTTCGTC (SEQ ID NO: 560) pMBV44 TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAG CGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATG CGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATCGACGGTATCGATAAGCTTGATAAGCTTTTAAATCAGC AGGGGTCTTTTTGGCTTGTGTATTATTTTGAAGTTTTTCTTCCCCGACAGAATCTGCTTTTACCGTCATAGTGAA ATGAGCCTGAAAAGCTATTACCATGATGATACAAATAAGTTTACTTTTCATTTCACCGCTCCTTTTTAATTCGTA
CAGATATTCTTTTACATTTGTTAATTCTTCTAAAAAAATTAAAAAATAAGCCTGTTTCTACATTCTTCACAAAAT
AATTTACGAAGAGTGCAAAACAAGCTTATTTTTTCGTGTGTGTTAAGCGGTTTTATTCTTAATTTTTTATTACTT TTACAATTATTCGATTGGATTATCTACTTTATTACTATATTTCGGATAAAGCGTGGTGCCCCAGATGGAGATATT
GTTGAATTGAGCAACGTATCCTCCAGAGTGATCGATGTTAATTTTTCCATCTGTATAAGCTTTTGAAGTTGTTTC AATATATTCTGAGTTGTTTTTAATAACAGCTAATTCATTGTCTTTTAGGAAGTTTGTTGTATAAGCAATGGGAAC TCCTGGTGTTTCTCGATTAAAAGTAGCGCCTTTTTTCAAAATATCGCGTAAGTCTCCGAGGTTGCCGTCGATGAT TTGAACTTCATCTTTTGCGGAACCTCCGTAAATTACGGCTTTGAAGGAAGAATTTTTGATGATATTTGTTAGTTC
AAGCGCTTGCAACTGCTCTTTAGTAACAGCTTTGCCGAAAAATCTGGAAGGTCTTGTAGGTTCATTAACATTCAC GTTATAGTAAATTTGTTTAAAACTAATGACTTCTTCTTGCATTTTCCCTTCACTGATTGCGCCGAAGTTTACATT CAAGCTATTATTTACAGCTTTAAATGCTGTACCAAATTTCGCAATTAATTGTGATTCACTGTAAGCCATTTCGTC
TACTGCGTTGTTAACGTTTGATTTAGTGGCATTTTTTACAACGATTTTATTGTCTTGATTAGTCATACCTGGCAA
TTTTACGAGAGCACCTGGATAGGTTAGGCTCGAAATTGCATTCACAACTTGAATGTCTGCATTATTTTGATTGAT
GGATTTCTTCTTTTTCTCCACAACAATATATTCATTTCCATCTTTGTAACCTTTTCTTGGCGGCACATTTGTCAC TGCATCTCCGTGGTATACTAATACATTGTTTTTATTGTAATCCAATCCTTGTATATACTTATCGATTTCATCCGC
TTTATTGAATGCAGATGCATCCTTTGCTTCAGTTTGTTGCGCAATTGGTAGACTAACTAATATAAGTGTAATAAA AACTAGCATTATTTTTTTCATGGGTTTCACTCTCCTTCTACATTTTTTAACCTAATAATGCCAAATACCGTTTGC
GCTTAGTTACAATAAATCAATTCTATCGCTGTATGGTATAGACTGTTTTATTATATATTTTGAATATTTTTAATC TGCCCAGTCTGGTTTTTTAAAAAAGTGCTATCCTCTTAATGTCTTTACTAAATTAGAAAACAAGTTTCACTTTCA
AGTTGTTGAGCACAGCCAACGCACATGCAGTTTGACGTATGACAGGTATGCTTTATTTCATTTAAATTATGATGG TTTTCCAGCCAATCAGTGAGTTTCTCTTGATAAGGAATGCGGGAATGTCTATGTATTTTAATAAAATAATTTCAT ATGATGCTAACGCACCGCAACAGGTCCAGCCTTATTCTGTCTCTTCATCTGCATTTGAAAATCTCCATCCTAATA ATGAAATGGAGAGTTCAATCAATCCCTTTTCCGCATCGGATACAGAAAGAAATGCTGCAATAATAGATCGCGCCA ATAAGGAGCAGGAGACTGAAGCGGTGAATAAGATGATAAGCACCGGGGCCAGGTTAGCTGCATCAGGCAGGGCAT CTGATGTTGCTCACTCAATGGTGGGCGATGCGGTTAATCAAGAAATCAAACAGTGGTTAAATCGATTCGGTACGG ACTCTGCTTCATTCCTCTTTTTTAGTCAGTTAGGTATTCGCAATAAAGACAGCCGCAACACACTTAACCTTGGCG TCGGGATACGTACATTGGAGAACGGTTGGCTGTACGGACTTAATACTTTTTATGATAATGATTTGACCGGCCACA ACCACCGTATCGGTCTTGGTGCCGAGGCCTGGACCGATTATTTACAGTTGGCTGCCAATGGGTATTTTCGCCTCA ATGGATGGCACTCGTCGCGTGATTTCTCCGACTATAAAGAGCGCCCAGCCACTGGGGGGGATTTGCGCGCGAATG CTTATTTACCTGCACTCCCACAACTGGGGGGGAAGTTGATGTATGAGCAATACACCGGTGAGCGTGTTGCTTTAT
TGGGCGAGAGTTTTCAGTCGCAACTTAGCCCTTCAGCGGTGGCAGGAACACGTCTACTGGCGGAGAGCCGCTATA ACCTTGTCGATCGTAACAATAATATCGTGTTGGAGTATCAGAAACAGCAGGTGGTTAAACTGACATTATCGCCAG CAACTATCTCCGGCCTGCCGGGTCAGGTTTATCAGGTGAACGCACAAGTACAAGGGGCATCTGCTGTAAGGGAAA TTGTCTGGAGTGATGCCGAACTGATTGCCGCTGGCGGCACATTAACACCACTGAGTACCACACAATTCAACTTGG TTTTACCGCCTTATAAACGCACAGCACAAGTGAGTCGGGTAACGGACGACCTGACAGCCAACTTTTATTCGCTTA GTGCGCTCGCGGTTGATCACCAAGGAAACCGATCTAACTCATTCACATTGAGCGTCACCGTTCAGCAGCCTCAGT TGACATTAACGGCGGCCGTCATTGGTGATGGCGCACCGGCTAATGGGAAAACTGCAATCACCGTTGAGTTCACCG TTGCTGATTTTGAGGGGAAACCCTTAGCCGGGCAGGAGGTGGTGATAACCACCAATAATGGTGCGCTACCGAATA AAATCACGGAAAAGACAGATGCAAATGGCGTCGCGCGCATTGCATTAACCAATACGACAGATGGCGTGACGGTAG TCACAGCAGAAGTGGAGGGGCAACGGCAAAGTGTTGATACCCACTTTGTTAAGGGTACTATCGCGGCGGATAAAT CCACTCTGGCTGCGGTACCGACATCTATCATCGCTGATGGTCTAATGGCTTCAACCATCACGTTGGAGTTGAAGG ATACCTATGGGGACCCGCAGGCTGGCGCGAATGTGGCTTTTGACACAACCTTAGGCAATATGGGCGTTATCACGG ATCACAATGACGGCACTTATAGCGCACCATTGACCAGTACCACGTTGGGGGTAGCAACAGTAACGGTGAAAGTGG ATGGGGCTGCGTTCAGTGTGCCGAGTGTGACGGTTAATTTCACGGCAGATCCTATTCCAGATGCTGGCCGCTCCA GTTTCACCGTCTCCACACCGGATATCTTGGCTGATGGCACGATGAGTTCCACATTATCCTTTGTCCCTGTCGATA AGAATGGCCATTTTATCAGTGGGATGCAGGGCTTGAGTTTTACTCAAAACGGTGTGCCGGTGAGTATTAGCCCCA
TTAACGGGCAAAATTTCGCTACGGATAAAGGGTTCCCGAAAACGATCTTTAAAAACGCCACATTCCAGTTACAGA
ATTCGGTGAGTTATCGGTTCTACCCAAATCGGTGGATATACGATGGCGGCAGATCGCTGGTATCCAGTCTCGAGG
TCAAAAAGACCAGCACGGATTTTGAAACCATGAATATGGACACAGGCGCACTGCAACCAGGGCCTGCATACTTGG CGTTCCCGCTCTGTGCGCTGTCAATATAACCAGATAACAGATAGCAATAAGAACAGTTTAATGAGCTGATTATTT
TTGGAAAATTTTTTTTAAAAAAGTCTTGACACTTTATGCTTCCGGCTCGTATAATGGATCCAGGAGTAACAATAC AAATGGATTCAAGAGATCCATTTGTATTGTTACTCCTTTTTTTTTTTGTCGACGATCCTTAGCGAAAGCTAAGGA TTTTTTTTTTACTCGAGCGGATTACTACATACCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGC GTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAG AGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATC
ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACG
TCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGC AGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGA
GTCGGGCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCATC
GCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCC ATCTTGTTCAATCATGCGAAACGATCCTCATCCTGTCTCTTGATCAGATCTTGATCCCCTGCGCCATCAGATCCT TGGCGGCAAGAAAGCCATCCAGTTTACTTTGCAGGGCTTCCCAACCTTACCAGATCATGACATTAACCTATAAAA ATAGGCGTATCACGAGGCCCTTTCGTC (SEQ ID NO: 561)
Example 23: Construction of pNJSZc Plasmid pNJSZ is a 10.4 kb plasmid that confers the abilities required to induce tkRNAi. It contains two genes, inv and My, that allows bacteria to invade mammalian cells and to escape from the entry vacuole. Expression of the short hairpin RNA is different between the original Trip plasmid and pNJSZ. In pNJSZ, expression of shRNA is under the control of a constitutive bacterial promoter which allows for continuous expression. This is different from the original Trip plasmid, which has an ITPG inducible promoter, which controls the expression of the shRNA. Moreover, pNJSZ and the original Trip plasmid contain different antibiotic resistant genes. pNJSZ has the kanamycin resistance gene, whereas the original Trip plasmid has the ampicillin resistance gene. pNJSZc was constructed from pNJSZ by removing any regions of pNJSZ that were not required for its maintenance or abilities to induce tkRNAi.
Step 1 as shown in Figure 28: Removed an extra BamHl site at 9778 by digesting pNJSZ with both Spel (9784) and Xmal (9772), T4 DNA polymerase filled-in these two sites and then allowed the plasmid to self ligate, creating pNJSZ ΔBamHl .
Step 2 as shown in Figure 29: Removed both an extra Sail site at 972 and the fl origin of replication by digesting pNJSZ ΔBamHl with BgII (208) and Pmel (982), T4 DNA polymerase filled- in these two sites and allowed the plasmid to self ligate, creating pNJSZc.
The pNJSZc DNA sequence is as follows:
TACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCT GTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCAAGATCCCC
TTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACG CCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAGCTTCAAAAGCGCTCTGAAGTTCCTATACTT TCTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATATGGACCATGGCGCGGCATGCAAGCTCGG
TTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGA TAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGG ATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGT TTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATAC TGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCT
AAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGT CGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGC CAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCC TGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAG CGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTA
TTTTGAAGTTTTTCTTCCCCGACAGAATCTGCTTTTACCGTCATAGTGAAATGAGCCTGAAAAGCTATTACCATG ATGATACAAATAAGTTTACTTTTCATTTCACCGCTCCTTTTTAATTCGTAAAACTAAGTTTAAGCCACCTACAAC TAATCTGACAGAGAGAGTTAAGGACACGTTTTTTAGTATATGTGGGAACTAAATTATACGTTTTGCAGTAGAAAC TATAGGTGGCTTAAACTTTGGGATATGCTTATATTATATGGATAAACAGTCAGATATTCTTTTACATTTGTTAAT TCTTCTAAAAAAATTAAAAAATAAGCCTGTTTCTACATTCTTCACAAAATAATTTACGAAGAGTGCAAAACAAGC TTATTTTTTCGTGTGTGTTAAGCGGTTTTATTCTTAATTTTTTATTACTTTTACAATTATTCGATTGGATTATCT ACTTTATTACTATATTTCGGATAAAGCGTGGTGCCCCAGATGGAGATATTTCTATTTTTCACAAGTGGTAAGTTC CGGTCATCAATTACCGTTCTCCACCATTCCCAAGCTAAACCAGTGCATTCTTTAGCGTAAACATTAATATTTCTC GCGTTACCTGGCAAATAGATGGACGATGTGAAATGAGCTAGCTTGCTTTTATTGTTTTCGCTCCAGTTTTTATGT TGAACAATTTCGTTACCTTCAGGATCATAATTTACTTCATCCCAAGAAATGTTGAATTGAGCAACGTATCCTCCA GAGTGATCGATGTTAATTTTTCCATCTGTATAAGCTTTTGAAGTTGTTTCAATATATTCTGAGTTGTTTTTAATA
ACAGCTAATTCATTGTCTTTTAGGAAGTTTGTTGTATAAGCAATGGGAACTCCTGGTGTTTCTCGATTAAAAGTA
ATGACTTCTTCTTGCATTTTCCCTTCACTGATTGCGCCGAAGTTTACATTCAAGCTATTATTTACAGCTTTAAAT
TTTGGATAAGCTTGAGCATATTTTTCATTCCATCTTTCCACTAATGTATTTACTGCGTTGTTAACGTTTGATTTA GTGGCATTTTTTACAACGATTTTATTGTCTTGATTAGTCATACCTGGCAAATCAATGCTGAGTGTTAATGAATCA
CGTTTTACAGGGAGAACATCTGGTTGATTTTCTACTAATTCCGAATTCGCTTTTACGAGAGCACCTGGATAGGTT
ATATGATAATAGTTCATTTTGTATTTTGTTTTTTTGATATTCTCACCTGCTTAGTTACAATAAATCAATTCTATC
GCTGTATGGTATAGACTGTTTTATTATATATTTTGAATATTTTTAATCTGCCCAGTCTGGTTTTTTAAAAAAGTG
CTATCCTCTTAATGTCTTTACTAAATTAGAAAACAAGTTTCACTTTCAACTATTGCATCTTTAATTAATGGTCAA GGTGATTTCAAATGCTCGTTTGTGGCCAGTTATACCTCAAATAACTCAAGTTGTTGAGCACAGCCAACGCACATG
TGATAAGGAATGCGGGAATGTCTATGTATTTTAATAAAATAATTTCATTTAATATTATTTCACGAATAGTTATTT GTATCTTTTTGATATGTGGAATGTTCATGGCTGGGGCTTCAGAAAAATATGATGCTAACGCACCGCAACAGGTCC
CCGACTATAAAGAGCGCCCAGCCACTGGGGGGGATTTGCGCGCGAATGCTTATTTACCTGCACTCCCACAACTGG GGGGGAAGTTGATGTATGAGCAATACACCGGTGAGCGTGTTGCTTTATTTGGTAAAGATAATCTGCAACGCAACC CTTATGCCGTGACTGCCGGGATCAATTACACCCCCGTGCCTCTACTCACTGTCGGGGTAGATCAGCGTATGGGGA
TTTATCAGGTGAACGCACAAGTACAAGGGGCATCTGCTGTAAGGGAAATTGTCTGGAGTGATGCCGAACTGATTG CCGCTGGCGGCACATTAACACCACTGAGTACCACACAATTCAACTTGGTTTTACCGCCTTATAAACGCACAGCAC
CCGGGCAGGAGGTGGTGATAACCACCAATAATGGTGCGCTACCGAATAAAATCACGGAAAAGACAGATGCAAATG GCGTCGCGCGCATTGCATTAACCAATACGACAGATGGCGTGACGGTAGTCACAGCAGAAGTGGAGGGGCAACGGC
TCATCGCTGATGGTCTAATGGCTTCAACCATCACGTTGGAGTTGAAGGATACCTATGGGGACCCGCAGGCTGGCG CGAATGTGGCTTTTGACACAACCTTAGGCAATATGGGCGTTATCACGGATCACAATGACGGCACTTATAGCGCAC CATTGACCAGTACCACGTTGGGGGTAGCAACAGTAACGGTGAAAGTGGATGGGGCTGCGTTCAGTGTGCCGAGTG TGACGGTTAATTTCACGGCAGATCCTATTCCAGATGCTGGCCGCTCCAGTTTCACCGTCTCCACACCGGATATCT TGGCTGATGGCACGATGAGTTCCACATTATCCTTTGTCCCTGTCGATAAGAATGGCCATTTTATCAGTGGGATGC AGGGCTTGAGTTTTACTCAAAACGGTGTGCCGGTGAGTATTAGCCCCATTACCGAGCAGCCAGATAGCTATACCG CGACGGTGGTTGGGAATAGTGTCGGTGATGTCACAATCACGCCGCAGGTTGATACCCTGATACTGAGTACATTGC AGAAAAAAATATCCCTATTCCCGGTACCTACGCTGACCGGTATTCTGGTTAACGGGCAAAATTTCGCTACGGATA AAGGGTTCCCGAAAACGATCTTTAAAAACGCCACATTCCAGTTACAGATGGATAACGATGTTGCTAATAATACTC AGTATGAGTGGTCGTCGTCATTCACACCCAATGTATCGGTTAACGATCAGGGTCAGGTGACGATTACCTACCAAA CCTATAGCGAAGTGGCTGTGACGGCGAAAAGTAAAAAATTCCCAAGTTATTCGGTGAGTTATCGGTTCTACCCAA ATCGGTGGATATACGATGGCGGCAGATCGCTGGTATCCAGTCTCGAGGCCAGCAGACAATGCCAAGGTTCAGATA
GATAATGTTGCGATGACAGTGTCAAACTGGTTATTCCTTCAAGGGGTGAGTTGTTCTTAAGCATGCCGGTTTGCT GTAAAGTTTAGGGAGATTTGATGGCTTACTCTGTTCAAAAGTCGCGCCTGGCAAAGGTTGCGGGTGTTTCGCTTG
TACTCCTTTGTCGACTGGACAGTTCAAGAGACTGTCCATCAATATCAGCTTTGTCACAAACCCCGCCACCGGCGG GGTTTTTTTCTGCTCTAGGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTACA
GCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAA
CAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACC
CGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACC
GTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCG GAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT
TCTTTTACATTTGTTAATTCTTCTAAAAAAATTAAAAAATAAGCCTGTTTCTACATTCTTCACAAAATAATTTAC
GAAGAGTGCAAAACAAGCTTATTTTTTCGTGTGTGTTAAGCGGTTTTATTCTTAATTTTTTATTACTTTTACAAT TATTCGATTGGATTATCTACTTTATTACTATATTTCGGATAAAGCGTGGTGCCCCAGATGGAGATATTTCTATTT
TTCACAAGTGGTAAGTTCCGGTCATCAATTACCGTTCTCCACCATTCCCAAGCTAAACCAGTGCATTCTTTAGCG
TCATCTTTTGCGGAACCTCCGTAAATTACGGCTTTGAAGGAAGAATTTTTGATGATATTTGTTAGTTCTACATCA TTCAAATAAACTTGACGGCCATACGCCACACTTGAGATATATGCAGGAGGATTTTCTGCATTCACTCCAAGCGCT TAAATTTGTTTAAAACTAATGACTTCTTCTTGCATTTTCCCTTCACTGATTGCGCCGAAGTTTACATTCAAGCTA TCAATTTTTGCACTTACATTTGGATAAGCTTGAGCATATTTTTCATTCCATCTTTCCACTAATGTATTTACTGCG
AGAGCACCTGGATAGGTTAGGCTCGAAATTGCATTCACAACTTGAATGTCTGCATTATTTTGATTGATGGATTTC
CCGTGGTATACTAATACATTGTTTTTATTGTAATCCAATCCTTGTATATACTTATCGATTTCATCCGCGTGTTTC TTTTCGATTGGCGTCTTAGGACTTGCAGGCGGAGATGCTGGTGGTGCCATGGATGAAATTGAATTTTCTTTATTG
ATTATTTTTTTCATGGGTTTCACTCTCCTTCTACATTTTTTAACCTAATAATGCCAAATACCGTTTGCCACCCCT TTTATTCTAGTCCTGCTGTCCCTTTATCGTCGTTAACAAATGTTAATGCCTCAACATAAAAGTCACTTTAAGATA
GGAGTAACACTTCAGACTGAAAGTAGAAATAAAAACCGCAGCAGACAACTGACAACATCAAATGAAGGGGGCTTA
TTCTAATTGATATTATTTATATGATAATAGTTCATTTTGTATTTTGTTTTTTTGATATTCTCACCTGCTTAGTTA CAATAAATCAATTCTATCGCTGTATGGTATAGACTGTTTTATTATATATTTTGAATATTTTTAATCTGCCCAGTC
TCTTTAATTAATGGTCAAGGTGATTTCAAATGCTCGTTTGTGGCCAGTTATACCTCAAATAACTCAAGTTGTTGA GCACAGCCAACGCACATGCAGTTTGACGTATGACAGGTATGCTTTATTTCATTTAAATTATGATGGTTTTCCAGC
ACGCACCGCAACAGGTCCAGCCTTATTCTGTCTCTTCATCTGCATTTGAAAATCTCCATCCTAATAATGAAATGG AGAGTTCAATCAATCCCTTTTCCGCATCGGATACAGAAAGAAATGCTGCAATAATAGATCGCGCCAATAAGGAGC
ATCTGAATTTTGACAAAAATTTTTCGCTAAAAGAAAGCTCTCTTGATTGGCTGGCTCCTTGGTATGACTCTGCTT
TCGGTCTTGGTGCCGAGGCCTGGACCGATTATTTACAGTTGGCTGCCAATGGGTATTTTCGCCTCAATGGATGGC ACTCGTCGCGTGATTTCTCCGACTATAAAGAGCGCCCAGCCACTGGGGGGGATTTGCGCGCGAATGCTTATTTAC CTGCACTCCCACAACTGGGGGGGAAGTTGATGTATGAGCAATACACCGGTGAGCGTGTTGCTTTATTTGGTAAAG ATAATCTGCAACGCAACCCTTATGCCGTGACTGCCGGGATCAATTACACCCCCGTGCCTCTACTCACTGTCGGGG TAGATCAGCGTATGGGGAAAAGCAGTAAGCATGAAACACAGTGGAACCTCCAAATGAACTATCGCCTGGGCGAGA GTTTTCAGTCGCAACTTAGCCCTTCAGCGGTGGCAGGAACACGTCTACTGGCGGAGAGCCGCTATAACCTTGTCG CCGGCCTGCCGGGTCAGGTTTATCAGGTGAACGCACAAGTACAAGGGGCATCTGCTGTAAGGGAAATTGTCTGGA GTGATGCCGAACTGATTGCCGCTGGCGGCACATTAACACCACTGAGTACCACACAATTCAACTTGGTTTTACCGC CTTATAAACGCACAGCACAAGTGAGTCGGGTAACGGACGACCTGACAGCCAACTTTTATTCGCTTAGTGCGCTCG
CGGCGGCCGTCATTGGTGATGGCGCACCGGCTAATGGGAAAACTGCAATCACCGTTGAGTTCACCGTTGCTGATT TTGAGGGGAAACCCTTAGCCGGGCAGGAGGTGGTGATAACCACCAATAATGGTGCGCTACCGAATAAAATCACGG
AAAAGACAGATGCAAATGGCGTCGCGCGCATTGCATTAACCAATACGACAGATGGCGTGACGGTAGTCACAGCAG
AAGTGGAGGGGCAACGGCAAAGTGTTGATACCCACTTTGTTAAGGGTACTATCGCGGCGGATAAATCCACTCTGG
CTGCGGTACCGACATCTATCATCGCTGATGGTCTAATGGCTTCAACCATCACGTTGGAGTTGAAGGATACCTATG
GGGACCCGCAGGCTGGCGCGAATGTGGCTTTTGACACAACCTTAGGCAATATGGGCGTTATCACGGATCACAATG ACGGCACTTATAGCGCACCATTGACCAGTACCACGTTGGGGGTAGCAACAGTAACGGTGAAAGTGGATGGGGCTG
CGTTCAGTGTGCCGAGTGTGACGGTTAATTTCACGGCAGATCCTATTCCAGATGCTGGCCGCTCCAGTTTCACCG
TCTCCACACCGGATATCTTGGCTGATGGCACGATGAGTTCCACATTATCCTTTGTCCCTGTCGATAAGAATGGCC
ATTTTATCAGTGGGATGCAGGGCTTGAGTTTTACTCAAAACGGTGTGCCGGTGAGTATTAGCCCCATTACCGAGC
AGCCAGATAGCTATACCGCGACGGTGGTTGGGAATAGTGTCGGTGATGTCACAATCACGCCGCAGGTTGATACCC TGATACTGAGTACATTGCAGAAAAAAATATCCCTATTCCCGGTACCTACGCTGACCGGTATTCTGGTTAACGGGC
AAAATTTCGCTACGGATAAAGGGTTCCCGAAAACGATCTTTAAAAACGCCACATTCCAGTTACAGATGGATAACG
TCTGTGCGCTGTCAATATAACCAGATAACAGATAGCAATAAGAACAGTTTAATGAGCTGATTATTTGGGGCGCGA
TTGCGGGTGTTTCGCTTGTTTTATTACTCGCTGCCTGTAGTTCTGACTCACGCTATAAGCGTCAGGTCAGTGGTG
GAGATCCATTTGTATTGTTACTCCTTTGTCGACTGGACAGTTCAAGAGACTGTCCATCAATATCAGCTTTGTCAC AAACCCCGCCACCGGCGGGGTTTTTTTCTGCTCTAG(SEQ ID NO: 562)
Claims
1. An invasive bacterium comprising one or more siRNAs or one or more DNA molecules encoding one or more siRNAs, wherein the expressed siRNAs interfere with the mRNA of one or more HPV oncogenes.
2. A prokaryotic vector comprising at least one DNA molecule encoding one or more siRNAs and at least one RNA-polymerase III compatible promoter or at least one prokaryotic promoter, wherein the expressed siRNAs interfere with the mRNA of one or more HPV oncogenes.
3. A method of delivering one or more siRNAs to mammalian cells, the method comprising introducing to said mammalian cells at least one invasive bacterium containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs, wherein the expressed siRNAs interfere with the mRNA of one or more HPV oncogenes.
4. A method of regulating gene expression in mammalian cells, the method comprising introducing to said mammalian cells at least one invasive bacterium containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs, wherein the expressed siRNAs interfere with the mRNA of one or more HPV oncogenes.
5. A method of treating or preventing a viral disease or disorder in a mammal, the method comprising regulating the expression of at least one gene in a cell known to increase proliferation, growth or dysplasia, by introducing to the cells of the mammal at least one invasive bacterium containing one or more siRNAs or one or more DNA molecules encoding one or more siRNAs, wherein the expressed siRNAs interfere with the mRNA of one or more HPV oncogenes.
6. The invasive bacterium of claim 1 , wherein said invasive bacterium is a non-pathogenic or non-virulent bacterium.
7. The invasive bacterium of claim 1, wherein said invasive bacterium is a therapeutic bacterium.
8. A composition comprising the invasive bacterium of claim 1 and a pharmaceutically acceptable carrier.
9. A eukaryotic host cell comprising the invasive bacterium of claim 1, and a pharmaceutically acceptable carrier.
10. The method of claims 3 and 4, wherein said mammalian cells are in vivo or in vitro.
11. The method of claims 3 and 4, wherein said mammalian cells are selected from the group consisting of human, bovine, ovine, porcine, feline, buffalo, canine, goat, equine, donkey, deer, avian, bird, chicken, and primate cells.
12. The method of claims 3 to 5, wherein said invasive bacterium is a non-pathogenic or non- virulent bacterium.
13. The method of claims 3 to 5, wherein said invasive bacterium is a therapeutic bacterium.
14. The method of claims 3 to 5, wherein said one or more DNA molecules encoding said one or more siRNAs are transcribed within the mamalian cell.
15. The method of claim 14, wherein said one or more siRNAs are transcribed within the mamalian cell as shRNAs.
16. The method of claims 3 to 5, wherein said one or more DNA molecules encoding said one or more siRNAs are transcribed within the bacterium.
17. The method of claims 3 to 5, wherein said one or more DNA molecules encoding one or more siRNAs comprise a prokaryotic promoter.
18. The method of claim 17, wherein said prokaryotic promoter is selected from the group consisting of a T7 promoter, a PgapA promoter, a Par_BAD promoter, a Ptac promoter, a Piacuvs promoter and a recA promoter.
19. The method of claims 3 to 5, wherein said one or more DNA molecules encoding one or more siRNAs further comprise at least one of enhancer sequence, terminator sequence, invasion factor sequence or lysis regulation sequence.
20. The method of claims 3 and 4, wherein said mammalian cells are infected with about 103 to IO11 viable invasive bacteria.
21. The method of claim 20, wherein said mammalian cells are infected with about 105 to 109 viable invasive bacteria.
22. The method of claims 3 and 4, wherein said mammalian cells are infected at a multiplicity of infection ranging from about 0.1 to 106.
23. The method of claim 22, wherein said mammalian cells are infected at a multiplicity of infection ranging from about 102 to 104.
24. The method of claims 3 to 5, wherein the expressed siRNAs direct the multienzyme complex RNA-induced silencing complex of the cell to interact with the mRNA of one or more HPV oncogenes.
25. The method of claim 24, wherein said complex degrades said mRNA.
26. The method of claims 3 to 5, wherein expression of one or more HPV oncogenes is decreased or inhibited.
27. The method of claim 5, wherein the viral disease or disorder is selected from the group consisting of infection, eptithelial dysplasia and cancer caused by HPV infection.
28. The method of claim 5, wherein said mammal is selected from the group consisting of human, bovine, ovine, porcine, feline, buffalo, canine, goat, equine, donkey, deer, avian, bird, chicken, and primate.
29. The method of claim 5, wherein the mammalian cells are selected from the group consisting of a gastrointestinal epithelial cell, a macrophage, a cervical epithelial cell, a rectal epithelial cell and a pharyngeal epithelial cell.
30. The invasive bacterium of claim 1 , wherein wherein said invasive bacterium contains the pNJSZc plasmid.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP08768475.9A EP2173875B1 (en) | 2007-06-15 | 2008-06-13 | Bacteria mediated gene silencing |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US93475107P | 2007-06-15 | 2007-06-15 | |
US60/934,751 | 2007-06-15 | ||
US1002808P | 2008-01-04 | 2008-01-04 | |
US61/010,028 | 2008-01-04 |
Publications (3)
Publication Number | Publication Date |
---|---|
WO2008156702A2 true WO2008156702A2 (en) | 2008-12-24 |
WO2008156702A9 WO2008156702A9 (en) | 2009-02-12 |
WO2008156702A3 WO2008156702A3 (en) | 2009-04-02 |
Family
ID=40030198
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2008/007384 WO2008156661A2 (en) | 2007-06-15 | 2008-06-13 | BACTERIAL MEDIATED TNF-α GENE SILENCING |
PCT/US2008/007448 WO2008156702A2 (en) | 2007-06-15 | 2008-06-13 | Bacteria mediated gene silencing |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2008/007384 WO2008156661A2 (en) | 2007-06-15 | 2008-06-13 | BACTERIAL MEDIATED TNF-α GENE SILENCING |
Country Status (3)
Country | Link |
---|---|
US (7) | US20100239546A1 (en) |
EP (2) | EP2176412B1 (en) |
WO (2) | WO2008156661A2 (en) |
Cited By (18)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2010057009A1 (en) * | 2008-11-14 | 2010-05-20 | Cequent Pharmaceuticals, Inc. | E. coli mediated gene silencing of beta-catenin |
WO2011108930A1 (en) | 2010-03-04 | 2011-09-09 | Interna Technologies Bv | A MiRNA MOLECULE DEFINED BY ITS SOURCE AND ITS DIAGNOSTIC AND THERAPEUTIC USES IN DISEASES OR CONDITIONS ASSOCIATED WITH EMT |
WO2012005572A1 (en) | 2010-07-06 | 2012-01-12 | Interna Technologies Bv | Mirna and its diagnostic and therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated braf pathway |
EP2474617A1 (en) | 2011-01-11 | 2012-07-11 | InteRNA Technologies BV | Mir for treating neo-angiogenesis |
WO2013095132A1 (en) | 2011-12-22 | 2013-06-27 | Interna Technologies B.V. | Mirna for treating head and neck cancer |
WO2013105022A3 (en) * | 2012-01-09 | 2013-10-31 | Novartis Ag | Rnai agents to treat beta-catenin related diseases |
WO2014072357A1 (en) | 2012-11-06 | 2014-05-15 | Interna Technologies B.V. | Combination for use in treating diseases or conditions associated with melanoma, or treating diseases or conditions associated with activated b-raf pathway |
WO2015042556A1 (en) * | 2013-09-23 | 2015-03-26 | Georgia Tech Research Corporation | Targeting non-coding rna for rna interference |
US9181546B2 (en) | 2004-12-17 | 2015-11-10 | Beth Israel Deaconess Medical Center | Compositions for bacterial mediated gene silencing and methods of using same |
US9486513B1 (en) | 2010-02-09 | 2016-11-08 | David Gordon Bermudes | Immunization and/or treatment of parasites and infectious agents by live bacteria |
AU2013297196B2 (en) * | 2012-08-02 | 2017-01-05 | EnhancedBio Inc. | Composition for treating cancer associated with HPV infection |
US9593339B1 (en) | 2013-02-14 | 2017-03-14 | David Gordon Bermudes | Bacteria carrying bacteriophage and protease inhibitors for the treatment of disorders and methods of treatment |
US9878023B1 (en) | 2010-02-09 | 2018-01-30 | David Gordon Bermudes | Protease inhibitor: protease sensitive expression system composition and methods improving the therapeutic activity and specificity of proteins delivered by bacteria |
WO2019086603A1 (en) | 2017-11-03 | 2019-05-09 | Interna Technologies B.V. | Mirna molecule, equivalent, antagomir, or source thereof for treating and/or diagnosing a condition and/or a disease associated with neuronal deficiency or for neuronal (re)generation |
EP3587579A1 (en) * | 2010-07-06 | 2020-01-01 | Dicerna Pharmaceuticals, Inc. | Methods and compositions for the specific inhibition of beta-catenin by double-stranded rna |
US10857233B1 (en) | 2010-02-09 | 2020-12-08 | David Gordon Bermudes | Protease inhibitor combination with therapeutic proteins including antibodies |
EP3733212A4 (en) * | 2017-12-28 | 2021-08-18 | Industry-University Cooperation Foundation Hanyang University | Pharmaceutical composition for preventing or treating cancer metastasis to lung, containing chi3l1 inhibitor as active ingredient |
US11180535B1 (en) | 2016-12-07 | 2021-11-23 | David Gordon Bermudes | Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria |
Families Citing this family (25)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20080124355A1 (en) | 2006-09-22 | 2008-05-29 | David Gordon Bermudes | Live bacterial vaccines for viral infection prophylaxis or treatment |
US20100087336A1 (en) * | 2007-03-08 | 2010-04-08 | Biotex, Inc. | Functional nucleic acids and methods |
US20090266760A1 (en) * | 2007-03-08 | 2009-10-29 | George William Jackson | Functional nucleic acids for biological sequestration |
US20100239546A1 (en) * | 2007-06-15 | 2010-09-23 | Beth Israel Deaconess Medical Center | Bacterial mediated tnf alpha gene silencing |
US8647642B2 (en) | 2008-09-18 | 2014-02-11 | Aviex Technologies, Llc | Live bacterial vaccines resistant to carbon dioxide (CO2), acidic PH and/or osmolarity for viral infection prophylaxis or treatment |
US8241623B1 (en) | 2009-02-09 | 2012-08-14 | David Bermudes | Protease sensitivity expression system |
WO2010147684A1 (en) * | 2009-06-15 | 2010-12-23 | Thomas Jefferson University | Compositions for and methods of activating guanylyl cyclase c |
US20120009153A1 (en) * | 2009-08-13 | 2012-01-12 | Hongnian Guo | Compositions for bacterial mediated gene silencing and methods of using the same |
JP5649429B2 (en) | 2010-12-14 | 2015-01-07 | パナソニックIpマネジメント株式会社 | Video processing device, camera device, and video processing method |
WO2012149364A1 (en) | 2011-04-28 | 2012-11-01 | Diamond Don J | Tumor associated vaccines and compositions for disrupting tumor-derived immunosuppression for use in combination cancer immunotherapy |
CN105407974A (en) * | 2013-07-03 | 2016-03-16 | 希望之城 | Anticancer combinations |
CN112410275A (en) | 2014-01-23 | 2021-02-26 | 科罗拉多州立大学研究基金会 | E.coli mediated siRNA silencing of influenza |
WO2015116531A1 (en) * | 2014-01-29 | 2015-08-06 | Synphagen Llc. | Therapeutic phages and methods for delivery of nucleic acids for therapeutic uses |
JP6755801B2 (en) | 2014-01-29 | 2020-09-16 | シンファジェン・リミテッド・ライアビリティ・カンパニーSynPhaGen LLC. | Therapeutic phage and methods for nucleic acid delivery for therapeutic use |
US9737592B1 (en) | 2014-02-14 | 2017-08-22 | David Gordon Bermudes | Topical and orally administered protease inhibitors and bacterial vectors for the treatment of disorders and methods of treatment |
US9616114B1 (en) | 2014-09-18 | 2017-04-11 | David Gordon Bermudes | Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity |
AU2017368050A1 (en) | 2016-11-29 | 2019-06-20 | Puretech Lyt, Inc. | Exosomes for delivery of therapeutic agents |
US11129906B1 (en) | 2016-12-07 | 2021-09-28 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
EP3607070A4 (en) * | 2017-04-03 | 2020-12-16 | Sivec Biotechnologies, LLC | A transkingdom platform for therapeutic nucleic acid delivery |
US11701379B2 (en) * | 2018-03-26 | 2023-07-18 | Rhode Island Hospital | In vitro and in vivo intracellular delivery of siRNA via self-assembled nanopieces |
WO2019204780A1 (en) * | 2018-04-19 | 2019-10-24 | The Regents Of The University Of Colorado | Antisense antibiotics and bacterial secretion based delivery system to eliminate drug-resistant bacteria |
US11471497B1 (en) | 2019-03-13 | 2022-10-18 | David Gordon Bermudes | Copper chelation therapeutics |
WO2021030276A2 (en) * | 2019-08-09 | 2021-02-18 | The Regents Of The University Of Colorado A Body Corporate | Systems, methods, and compositions for a facile accelerated specific therapeutic (fast) pipeline |
CN111298101B (en) * | 2020-02-21 | 2023-05-30 | 佛山科学技术学院 | Application of antibacterial peptide PG-1 in inhibiting avian influenza virus |
US10973908B1 (en) | 2020-05-14 | 2021-04-13 | David Gordon Bermudes | Expression of SARS-CoV-2 spike protein receptor binding domain in attenuated salmonella as a vaccine |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006021894A2 (en) * | 2004-08-26 | 2006-03-02 | Engeneic Gene Therapy Pty Limited | Delivering functional nucleic acids to mammalian cells via bacterially derived, intact minicells |
WO2006066048A2 (en) * | 2004-12-17 | 2006-06-22 | Beth Israel Deaconess Medical Center | Compositions for bacterial mediated gene silencing and methods of using same |
WO2008012695A2 (en) * | 2006-06-23 | 2008-01-31 | Engeneic Molecular Delivery Pty Ltd. | Targeted delivery of drugs, therapeutic nucleic acids and functional nucleic acids to mammalian cells via intact killed bacterial cells |
Family Cites Families (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2001519162A (en) * | 1997-10-07 | 2001-10-23 | ユニバーシティ・オブ・メリーランド・バイオテクノロジー・インスティチュート | Method for introducing and expressing RNA in animal cells |
US6046319A (en) * | 1997-10-22 | 2000-04-04 | University Technologies International, Inc. | Antisense oligodeoxynucleotides regulating expression of TNF-α |
GB0029524D0 (en) * | 2000-12-04 | 2001-01-17 | Univ Sheffield | Disease treatment |
US20050227935A1 (en) * | 2001-05-18 | 2005-10-13 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of TNF and TNF receptor gene expression using short interfering nucleic acid (siNA) |
EP1390472A4 (en) | 2001-05-29 | 2004-11-17 | Sirna Therapeutics Inc | Nucleic acid treatment of diseases or conditions related to levels of ras, her2 and hiv |
US7176303B2 (en) * | 2003-11-06 | 2007-02-13 | Isis Pharmaceuticals, Inc. | Modulation of STAT5 expression |
EP1566202A1 (en) * | 2004-02-23 | 2005-08-24 | Sahltech I Göteborg AB | Use of resistin antagonists in the treatment of rheumatoid arthritis |
US20060051789A1 (en) * | 2004-07-01 | 2006-03-09 | Somagenics, Inc. | Methods of preparation of gene-specific oligonucleotide libraries and uses thereof |
WO2008109359A1 (en) * | 2007-03-02 | 2008-09-12 | Mdrna, Inc. | Nucleic acid compounds for inhibiting pdgfr family gene expression and uses thereof |
US20100239546A1 (en) | 2007-06-15 | 2010-09-23 | Beth Israel Deaconess Medical Center | Bacterial mediated tnf alpha gene silencing |
-
2008
- 2008-06-13 US US12/602,883 patent/US20100239546A1/en not_active Abandoned
- 2008-06-13 WO PCT/US2008/007384 patent/WO2008156661A2/en active Application Filing
- 2008-06-13 US US12/157,969 patent/US20080311081A1/en not_active Abandoned
- 2008-06-13 WO PCT/US2008/007448 patent/WO2008156702A2/en active Application Filing
- 2008-06-13 EP EP08768425.4A patent/EP2176412B1/en not_active Not-in-force
- 2008-06-13 EP EP08768475.9A patent/EP2173875B1/en not_active Not-in-force
-
2009
- 2009-12-08 US US12/632,985 patent/US9012213B2/en not_active Expired - Fee Related
-
2013
- 2013-10-26 US US14/064,130 patent/US20150030573A1/en not_active Abandoned
-
2014
- 2014-07-11 US US14/328,900 patent/US20150017138A1/en not_active Abandoned
-
2015
- 2015-03-14 US US14/658,176 patent/US9714426B2/en not_active Expired - Fee Related
-
2017
- 2017-12-09 US US15/836,853 patent/US20180087060A1/en not_active Abandoned
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006021894A2 (en) * | 2004-08-26 | 2006-03-02 | Engeneic Gene Therapy Pty Limited | Delivering functional nucleic acids to mammalian cells via bacterially derived, intact minicells |
WO2006066048A2 (en) * | 2004-12-17 | 2006-06-22 | Beth Israel Deaconess Medical Center | Compositions for bacterial mediated gene silencing and methods of using same |
WO2008012695A2 (en) * | 2006-06-23 | 2008-01-31 | Engeneic Molecular Delivery Pty Ltd. | Targeted delivery of drugs, therapeutic nucleic acids and functional nucleic acids to mammalian cells via intact killed bacterial cells |
Non-Patent Citations (4)
Title |
---|
BUTZ K ET AL: "siRNA targeting of the viral E6 oncogene efficiently kills human papillomavirus-positive cancer cells" ONCOGENE, NATURE PUBLISHING GROUP, GB BASINGSTOKE, HANTS, vol. 22, no. 38, 4 September 2003 (2003-09-04), pages 5938-5945, XP002282768 ISSN: 0950-9232 * |
GU W ET AL: "Inhibition of cervical cancer cell growth in vitro and in vivo with lentiviral-vector delivered short hairpin RNA targeting human papillomavirus E6 and E7 oncogenes" CANCER GENE THERAPY, vol. 13, no. 11, November 2006 (2006-11), pages 1023-1032, XP002506645 ISSN: 0929-1903 * |
KEATES A C ET AL: "Cequent Pharmaceuticals, Inc.: the biological pitcher for RNAi therapeutics" PHARMACOGENOMICS,, vol. 8, no. 7, 1 July 2007 (2007-07-01), pages 867-871, XP009109205 * |
MACRON D: "Cequent reports delay in lead program, but unveils new drug development efforts" RNAI NEWS, vol. 6, no. 19, 8 February 2008 (2008-02-08), XP009109632 & FRUEHAUF J: "Treatment of Gastrointestinal Targets using RNA Interference" ORAL PRESENTATION, 30 April 2008 (2008-04-30), RNAi WORLD CONGRESS; BOSTON, USA; APRIL 30 -MAY 2, 2008 * |
Cited By (33)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9181546B2 (en) | 2004-12-17 | 2015-11-10 | Beth Israel Deaconess Medical Center | Compositions for bacterial mediated gene silencing and methods of using same |
WO2010057009A1 (en) * | 2008-11-14 | 2010-05-20 | Cequent Pharmaceuticals, Inc. | E. coli mediated gene silencing of beta-catenin |
US11219671B1 (en) | 2010-02-09 | 2022-01-11 | David Gordon Bermudes | Protease inhibitor:protease sensitive expression system, composition and methods for improving the therapeutic activity and specificity of proteins delivered by bacteria |
US10954521B1 (en) | 2010-02-09 | 2021-03-23 | David Gordon Bermudes | Immunization and/or treatment of parasites and infectious agents by live bacteria |
US10857233B1 (en) | 2010-02-09 | 2020-12-08 | David Gordon Bermudes | Protease inhibitor combination with therapeutic proteins including antibodies |
US10364435B1 (en) | 2010-02-09 | 2019-07-30 | David Gordon Bermudes | Immunization and/or treatment of parasites and infectious agents by live bacteria |
US9878023B1 (en) | 2010-02-09 | 2018-01-30 | David Gordon Bermudes | Protease inhibitor: protease sensitive expression system composition and methods improving the therapeutic activity and specificity of proteins delivered by bacteria |
US9486513B1 (en) | 2010-02-09 | 2016-11-08 | David Gordon Bermudes | Immunization and/or treatment of parasites and infectious agents by live bacteria |
WO2011108930A1 (en) | 2010-03-04 | 2011-09-09 | Interna Technologies Bv | A MiRNA MOLECULE DEFINED BY ITS SOURCE AND ITS DIAGNOSTIC AND THERAPEUTIC USES IN DISEASES OR CONDITIONS ASSOCIATED WITH EMT |
EP3214174A1 (en) | 2010-03-04 | 2017-09-06 | InteRNA Technologies B.V. | A mirna molecule defined by its source and its diagnostic and therapeutic uses in diseases or conditions associated with emt |
EP3587579A1 (en) * | 2010-07-06 | 2020-01-01 | Dicerna Pharmaceuticals, Inc. | Methods and compositions for the specific inhibition of beta-catenin by double-stranded rna |
WO2012005572A1 (en) | 2010-07-06 | 2012-01-12 | Interna Technologies Bv | Mirna and its diagnostic and therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated braf pathway |
EP3369817A1 (en) | 2010-07-06 | 2018-09-05 | InteRNA Technologies B.V. | Mirna and its diagnostic and therapeutic uses in diseases or conditions associated with melanoma , or in diseases or conditions with activated braf pathway |
US10612023B2 (en) | 2010-07-06 | 2020-04-07 | Dicerna Pharmaceuticals, Inc. | Methods and compositions for the specific inhibition of β-catenin by double-stranded RNA |
EP2474617A1 (en) | 2011-01-11 | 2012-07-11 | InteRNA Technologies BV | Mir for treating neo-angiogenesis |
WO2012096573A1 (en) | 2011-01-11 | 2012-07-19 | Interna Technologies B.V. | Mirna for treating diseases and conditions associated with neo-angiogenesis |
WO2013095132A1 (en) | 2011-12-22 | 2013-06-27 | Interna Technologies B.V. | Mirna for treating head and neck cancer |
CN104302768A (en) * | 2012-01-09 | 2015-01-21 | 诺华股份有限公司 | Rnai agents to treat beta-catenin related diseases |
US10023862B2 (en) | 2012-01-09 | 2018-07-17 | Arrowhead Pharmaceuticals, Inc. | Organic compositions to treat beta-catenin-related diseases |
WO2013105022A3 (en) * | 2012-01-09 | 2013-10-31 | Novartis Ag | Rnai agents to treat beta-catenin related diseases |
AU2013297196B2 (en) * | 2012-08-02 | 2017-01-05 | EnhancedBio Inc. | Composition for treating cancer associated with HPV infection |
US9719093B2 (en) | 2012-08-02 | 2017-08-01 | Abion Inc. | Composition for treating cancer associated with HPV infection |
US10221418B2 (en) | 2012-08-02 | 2019-03-05 | EnhancedBio Inc. | Composition for treating cancer associated with HPV infection |
WO2014072357A1 (en) | 2012-11-06 | 2014-05-15 | Interna Technologies B.V. | Combination for use in treating diseases or conditions associated with melanoma, or treating diseases or conditions associated with activated b-raf pathway |
EP3800256A1 (en) | 2012-11-06 | 2021-04-07 | InteRNA Technologies B.V. | Combination to be used in therapeutic use against diseases or conditions associated with melanoma, or in diseases or conditions associated with activated b-raf pathway |
US10501746B1 (en) | 2013-02-14 | 2019-12-10 | David Gordon Bermudes | Bacteria carrying bacteriophage and protease inhibitors for the treatment of disorders and methods of treatment |
US9593339B1 (en) | 2013-02-14 | 2017-03-14 | David Gordon Bermudes | Bacteria carrying bacteriophage and protease inhibitors for the treatment of disorders and methods of treatment |
US11827890B1 (en) | 2013-02-14 | 2023-11-28 | David Gordon Bermudes | Bacteria carrying bacteriophage and protease inhibitors for the treatment of disorders and methods of treatment |
US10329560B2 (en) | 2013-09-23 | 2019-06-25 | Georgia Tech Research Corporation | Targeting non-coding RNA for RNA interference |
WO2015042556A1 (en) * | 2013-09-23 | 2015-03-26 | Georgia Tech Research Corporation | Targeting non-coding rna for rna interference |
US11180535B1 (en) | 2016-12-07 | 2021-11-23 | David Gordon Bermudes | Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria |
WO2019086603A1 (en) | 2017-11-03 | 2019-05-09 | Interna Technologies B.V. | Mirna molecule, equivalent, antagomir, or source thereof for treating and/or diagnosing a condition and/or a disease associated with neuronal deficiency or for neuronal (re)generation |
EP3733212A4 (en) * | 2017-12-28 | 2021-08-18 | Industry-University Cooperation Foundation Hanyang University | Pharmaceutical composition for preventing or treating cancer metastasis to lung, containing chi3l1 inhibitor as active ingredient |
Also Published As
Publication number | Publication date |
---|---|
WO2008156661A2 (en) | 2008-12-24 |
US20180087060A1 (en) | 2018-03-29 |
EP2176412A2 (en) | 2010-04-21 |
WO2008156661A3 (en) | 2009-03-05 |
US20100239546A1 (en) | 2010-09-23 |
WO2008156702A3 (en) | 2009-04-02 |
EP2173875A2 (en) | 2010-04-14 |
EP2173875B1 (en) | 2017-08-30 |
US20150030573A1 (en) | 2015-01-29 |
WO2008156661A9 (en) | 2009-06-25 |
WO2008156702A9 (en) | 2009-02-12 |
US9714426B2 (en) | 2017-07-25 |
US20150017138A1 (en) | 2015-01-15 |
US20080311081A1 (en) | 2008-12-18 |
US20100092438A1 (en) | 2010-04-15 |
US9012213B2 (en) | 2015-04-21 |
US20150184167A1 (en) | 2015-07-02 |
EP2176412B1 (en) | 2017-09-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9714426B2 (en) | Bacteria mediated gene silencing | |
US20100189691A1 (en) | E. Coli Mediated Gene Silencing of Beta-Catenin | |
US20190085327A1 (en) | Bacteria-Mediated Gene Modulation Via microRNA Machinery | |
AU2005316458B2 (en) | Compositions for bacterial mediated gene silencing and methods of using same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08768475 Country of ref document: EP Kind code of ref document: A2 |
|
NENP | Non-entry into the national phase in: |
Ref country code: DE |
|
REEP | Request for entry into the european phase |
Ref document number: 2008768475 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2008768475 Country of ref document: EP |